Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

Science.gov (United States)

Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

2018-02-01

To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

High efficiency hydrodynamic DNA fragmentation in a bubbling system

NARCIS (Netherlands)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

2017-01-01

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

Science.gov (United States)

Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

2017-01-18

DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

Twisting short dsDNA with applied tension

Science.gov (United States)

Zoli, Marco

2018-02-01

The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

Directory of Open Access Journals (Sweden)

Carol Coughlan

2015-01-01

Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

Science.gov (United States)

Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

2017-09-01

Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

A mechanism of gene amplification driven by small DNA fragments.

Directory of Open Access Journals (Sweden)

Kuntal Mukherjee

Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

Bacterial natural transformation by highly fragmented and damaged DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

2013-01-01

for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

Science.gov (United States)

García-Vilchis, David; Aranda-Anzaldo, Armando

2017-12-01

Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

Science.gov (United States)

Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

2009-10-07

Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

FragIdent--automatic identification and characterisation of cDNA-fragments.

Science.gov (United States)

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

[Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

Science.gov (United States)

Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

2016-01-01

Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

Amplification of deoxyribonucleic acid (DNA) fragment using two ...

African Journals Online (AJOL)

user

2011-04-11

Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

Structural factors involved in the recognition of helix distortions in uv-damaged DNA by model peptides

Energy Technology Data Exchange (ETDEWEB)

Lang, H; Zimmer, C [Akademie der Wissenschaften der DDR, Jena. Forschungszentrum fuer Molekularbiologie und Medizin

1977-02-28

On the basis of our previous and present results concerning conformational changes of DNA after uv-irradiation some conclusions on the structure of DNA double helix in uv-damaged regions were drawn. From the results it appears that local distortions like denaturation or premelting should be excluded. Furthermore it was shown that the thymine dimerization strongly depends on the adjacent nucleic acid bases. By means of a strong binding effect of the oligopeptide netropsin to DNA irradiated at low uv-doses it is concluded that such local distortions in DNA together with a specific sequence-dependent variation of the conformation could act as recognition sites for endonucleases.

Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

1995-01-01

Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

Quantification of DNA fragmentation in processed foods using real-time PCR.

Science.gov (United States)

Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

2017-07-01

DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

BuD, a helix–loop–helix DNA-binding domain for genome modification

Energy Technology Data Exchange (ETDEWEB)

Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

2014-07-01

Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

Binding of HIV-1 gp41-directed neutralizing and non-neutralizing fragment antibody binding domain (Fab and single chain variable fragment (ScFv antibodies to the ectodomain of gp41 in the pre-hairpin and six-helix bundle conformations.

Directory of Open Access Journals (Sweden)

John M Louis

Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.

DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

International Nuclear Information System (INIS)

Kosaka, T.; Kuwabara, M.; Koide, F.

1992-01-01

Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

Science.gov (United States)

Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

2013-04-01

An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

Science.gov (United States)

De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

2015-03-01

Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

Science.gov (United States)

Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

2003-08-15

DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

International Nuclear Information System (INIS)

Lau How Mooi

1998-01-01

Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

FragIdent – Automatic identification and characterisation of cDNA-fragments

Directory of Open Access Journals (Sweden)

Goehler Heike

2009-03-01

Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

Science.gov (United States)

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

Science.gov (United States)

Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

2015-10-29

Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

Real-time Tracking of DNA Fragment Separation by Smartphone.

Science.gov (United States)

Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

2017-06-01

Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

The C-Terminal RpoN Domain of sigma54 Forms an unpredictedHelix-Turn-Helix Motif Similar to domains of sigma70

Energy Technology Data Exchange (ETDEWEB)

Doucleff, Michaeleen; Malak, Lawrence T.; Pelton, Jeffrey G.; Wemmer, David E.

2005-11-01

The ''{delta}'' subunit of prokaryotic RNA-polymerase allows gene-specific transcription initiation. Two {sigma} families have been identified, {sigma}{sup 70} and {sigma}{sup 54}, which use distinct mechanisms to initiate transcription and share no detectable sequence homology. Although the {sigma}{sup 70}-type factors have been well characterized structurally by x-ray crystallography, no high-resolution structural information is available for the {sigma}{sup 54}-type factors. Here we present the NMR derived structure of the C-terminal domain of {sigma}{sup 54} from Aquifex aeolicus. This domain (Thr323 to Gly389), which contains the highly conserved RpoN box sequence, consists of a poorly structured N-terminal tail followed by a three-helix bundle, which is surprisingly similar to domains of the {sigma}{sup 70}-type proteins. Residues of the RpoN box, which have previously been shown to be critical for DNA binding, form the second helix of an unpredicted helix-turn-helix motif. This structure's homology with other DNA binding proteins, combined with previous biochemical data, suggest how the C-terminal domain of {sigma}{sup 54} binds to DNA.

Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

Science.gov (United States)

2005-10-01

1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

Directory of Open Access Journals (Sweden)

Barbara Dariš

2018-02-01

Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

1994-08-01

The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean

Directory of Open Access Journals (Sweden)

Karen A. Hudson

2015-01-01

Full Text Available The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281 of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop.

PROTEOLYTIC REMOVAL OF THE CARBOXYL TERMINUS OF THE T4 GENE 32 HELIX-DESTABILIZING PROTEIN ALTERS THE T4 IN VITRO REPLICATION COMPLEX

Energy Technology Data Exchange (ETDEWEB)

Burke, R.L.; Alberts, B.M.; Hosoda, J.

1980-07-01

The proteolytic removal of about 60 amino acids from the COOH terminus of the bacteriophage T4 helix-destabilizing protein (gene 32 protein) produces 32*I, a 27,000-dalton fragment which still binds tightly and cooperatively to single-stranded DNA. The substitution of 32*I protein for intact 32 protein in the seven-protein T4 replication complex results in dramatic changes in some of the reactions catalyzed by this in vitro DNA replication system, while leaving others largely unperturbed. (1) Like intact 32 protein, the 32*I protein promotes DNA synthesis by the DNA polymerase when the T4 polymerase accessory proteins (gene 44/62 and 45 proteins) are also present. The host helix-destabilizing protein (Escherichia coli ssb protein) cannot replace the 32*I protein for this synthesis. (2) Unlike intact 32 protein, 32*I protein strongly inhibits DNA synthesis catalyzed by the T4 DNA polymerase alone on a primed single-stranded DNA template. (3) Unlike intact 32 protein, the 32*I protein strongly inhibits RNA primer synthesis catalyzed by the T4 gene 41 and 61 proteins and also reduces the efficiency of RNA primer utilization. As a result, de novo DNA chain starts are blocked completely in the complete T4 replication system, and no lagging strand DNA synthesis occurs. (4) The 32*I protein does not bind to either the T4 DNA polymerase or to the T4 gene 61 protein in the absence of DNA; these associations (detected with intact 32 protein) would therefore appear to be essential for the normal control of 32 protein activity, and to account at least in part for observations 2 and 3, above. We propose that the COOH-terminal domain of intact 32 protein functions to guide its interactions with the T4 DNA polymerase and the T4 gene 61 RNA-priming protein. When this domain is removed, as in 32*I protein, the helix destabilization induced by the protein is controlled inadequately, so that polymerizing enzymes tend to be displaced from the growing 3{prime}-OH end of a

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

Energy Technology Data Exchange (ETDEWEB)

Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

2000-06-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

International Nuclear Information System (INIS)

Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

2000-01-01

We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

Fragmentation of sperm DNA using the TUNEL method.

Science.gov (United States)

Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

2014-11-01

To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

Science.gov (United States)

Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

1985-12-05

The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

Science.gov (United States)

Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

2013-10-01

Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

International Nuclear Information System (INIS)

Jones, J.L.; Bulford, B.B.

1990-07-01

The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

Science.gov (United States)

Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

2015-07-01

Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

Directory of Open Access Journals (Sweden)

Gosalvez Jaime

2009-04-01

Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

Science.gov (United States)

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

DEFF Research Database (Denmark)

Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

1995-01-01

Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

Science.gov (United States)

Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

2005-01-01

AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

International Nuclear Information System (INIS)

Evenson, Donald P.; Wixon, Regina

2005-01-01

Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

International Nuclear Information System (INIS)

Tang, M.; Lee, C.S.; Doisy, R.; Ross, L.; Needham-VanDevanter, D.R.; Hurley, L.H.

1988-01-01

The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure

Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

Science.gov (United States)

van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

2006-01-01

We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

Science.gov (United States)

Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

2006-12-01

The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

DEFF Research Database (Denmark)

Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

2013-01-01

It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

(PCR) for direct cloning of blunt-end DNA fragments

African Journals Online (AJOL)

Administrator

2011-09-19

Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

Nucleic acid helices: I. Structure of M1 RNA from E. coli as determined bypsoralen crosslinking. II. Thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing 3. 0 M tetramethylammonium chloride

Energy Technology Data Exchange (ETDEWEB)

Lipson, S.E.

1987-01-01

This work includes two different investigations examining nucleic acid helices. The first study discusses secondary and tertiary interactions in the RNA moiety of ribonuclease P from Escherichia coli. The second study discusses the thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing tetramethylammonium chloride. The RNA moiety of ribonuclease P from Escherichia coli (M1 RNA) has been photoreacted with 4{prime}-hydroxymethyl-4,5{prime}8-trimethylpsoralen and long wave UV light (320-380 nm) in a buffer in which the M1 RNA alone acts as a true catalyst of tRNA processing. Limited specific digestion followed by two dimensional gel electrophoresis yields fragments crosslinked by HMT. The positions of the crosslinks have been determined to within {plus minus}15 nucleotides by photoreversal of the isolated crosslinked fragments and enzymatic sequencing of the resulting RNA. Further assignments of the exact locations of the crosslinks have been made on the known photoreactivity of the psoralen with different bases.

Nucleic acid helices: I. Structure of M1 RNA from E. coli as determined bypsoralen crosslinking. II. Thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing 3.0 M tetramethylammonium chloride

International Nuclear Information System (INIS)

Lipson, S.E.

1987-01-01

This work includes two different investigations examining nucleic acid helices. The first study discusses secondary and tertiary interactions in the RNA moiety of ribonuclease P from Escherichia coli. The second study discusses the thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing tetramethylammonium chloride. The RNA moiety of ribonuclease P from Escherichia coli (M1 RNA) has been photoreacted with 4'-hydroxymethyl-4,5'8-trimethylpsoralen and long wave UV light (320-380 nm) in a buffer in which the M1 RNA alone acts as a true catalyst of tRNA processing. Limited specific digestion followed by two dimensional gel electrophoresis yields fragments crosslinked by HMT. The positions of the crosslinks have been determined to within ±15 nucleotides by photoreversal of the isolated crosslinked fragments and enzymatic sequencing of the resulting RNA. Further assignments of the exact locations of the crosslinks have been made on the known photoreactivity of the psoralen with different bases

Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

Science.gov (United States)

Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

2018-04-12

Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Crystallization and preliminary electron diffraction study to 3. 7 A of DNA helix-destabilizing protein gp32*I

Energy Technology Data Exchange (ETDEWEB)

Chiu, W; Hosoda, J

1978-01-01

A two-dimensionally large and thin crystal has been obtained from gp32*I, a proteolytically digested product of a DNA helix-destabilizing protein coded by gene 32 in bacteriophage T4. High-resolution electron diffraction patterns (approx. 3.7 A) are recorded from both unstained and stained protein crystals embedded in glucose. The crystal is of orthorhombic space group with a = 62.9 A and b = 47.3 A.

Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

International Nuclear Information System (INIS)

Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

1990-01-01

A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

International Nuclear Information System (INIS)

Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

2006-01-01

Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

Energy Technology Data Exchange (ETDEWEB)

Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

2014-06-01

The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

Ionization and fragmentation of DNA-RNA bases: a density functional theory study

International Nuclear Information System (INIS)

Sadr-Arani, Leila

2014-01-01

Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

A smallest 6 kda metalloprotease, mini-matrilysin, in living world: a revolutionary conserved zinc-dependent proteolytic domain- helix-loop-helix catalytic zinc binding domain (ZBD

Directory of Open Access Journals (Sweden)

Yu Wei-Hsuan

2012-05-01

Full Text Available Abstract Background The Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family. The metzincin super family share a catalytic domain consisting of a twisted five-stranded β sheet and three long α helices (A, B and C. The catalytic zinc is at the bottom of the cleft and is ligated by three His residues in the consensus sequence motif, HEXXHXXGXXH, which is located in helix B and part of the adjacent Met turn region. An interesting question is - what is the minimum portion of the enzyme that still possesses catalytic and inhibitor recognition?” Methods We have expressed a 60-residue truncated form of matrilysin which retains only the helix B-Met turn-helix C region and deletes helix A and the five-stranded β sheet which form the upper portion of the active cleft. This is only 1/4 of the full catalytic domain. The E. coli derived 6 kDa MMP-7 ZBD fragments were purified and refolded. The proteolytic activities were analyzed by Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay and CM-transferrin zymography analysis. SC44463, BB94 and Phosphoramidon were computationally docked into the 3day structure of the human MMP7 ZBD and TAD and thermolysin using the docking program GOLD. Results This minimal 6 kDa matrilysin has been refolded and shown to have proteolytic activity in the Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay. Triton X-100 and heparin are important factors in the refolding environment for this mini-enzyme matrilysin. This minienzyme has the proteolytic activity towards peptide substrate, but the hexamer and octamer of the mini MMP-7 complex demonstrates the CM-transferrin proteolytic activities in zymographic analysis. Peptide digestion is inhibited by SC44463, specific MMP7 inhibitors, but not phosphorimadon. Interestingly, the mini MMP-7 can be processed by autolysis and producing ~ 6�

The basic helix-loop-helix region of the transcriptional repressor hairy and enhancer of split 1 is preorganized to bind DNA

NARCIS (Netherlands)

Popovic, Matija; Wienk, Hans; Coglievina, Maristella; Boelens, Rolf; Pongor, Sándor; Pintar, Alessandro

2014-01-01

Hairy and enhancer of split 1, one of the main downstream effectors in Notch signaling, is a transcriptional repressor of the basic helix-loop-helix (bHLH) family. Using nuclear magnetic resonance methods, we have determined the structure and dynamics of a recombinant protein, H1H, which includes an

Core nucleosomes by digestion of reconstructed histone-DNA complexes

Energy Technology Data Exchange (ETDEWEB)

Bryan, P N; Wright, E B; Olins, D E

1979-04-01

Reconstructed complexes of the inner histones (H2A, H2B, H3, H4) and a variety of DNAs were digested with micrococcal nuclease to yield very homogeneous populations of core nucleosomes (..nu../sub 1/). Nucleosomes containing Micrococcus luteus DNA (72% G+C); chicken DNA (43% G+C), Clostridium perfringens DNA (29% G+C); or poly(dA-dT).poly(dA-dT) have been examined by circular dichroism, thermal denaturation, electron microscopy, and DNAse I digestion. Circular dichroism spectra of all particles show a typically suppressed ellipticity at 260 to 280 nm and a prominent ..cap alpha..-helix signal at 222 nm. All particles show biphasic melting except ..nu../sub 1/(dA-dT), which show three prominent melting transitions at ionic strength less than or equal to 1 mM. DNAse I digestion of ..nu../sub 1/ (dA-dT) produces a ladder of DNA fragments differing in length by one base residue. ..nu../sub 1/ (dA-dT) contain 146 base pairs of DNA and exhibit an average DNA helix pitch of 10.4 to 10.5 bases per turn. There appear to be two regions of different DNA pitch within ..nu../sub 1/ (dA-dT). It is suggested that the two regions of DNA pitch might correspond to the two regions of the melting profiles.

Antimicrobial Effects of Helix D-derived Peptides of Human Antithrombin III*

Science.gov (United States)

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K. V.; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-01-01

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix d-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. PMID:25202017

Structural and functional aspects of winged-helix domains at the core of transcription initiation complexes.

Science.gov (United States)

Teichmann, Martin; Dumay-Odelot, Hélène; Fribourg, Sébastien

2012-01-01

The winged helix (WH) domain is found in core components of transcription systems in eukaryotes and prokaryotes. It represents a sub-class of the helix-turn-helix motif. The WH domain participates in establishing protein-DNA and protein-protein-interactions. Here, we discuss possible explanations for the enrichment of this motif in transcription systems.

Sequence-influenced interactions of oligoacridines with DNA detected by retarded gel electrophorectic migrations

International Nuclear Information System (INIS)

Nielsen, P.E.; Zhen, W.; Henriksen, U.; Buchardt, O.

1988-01-01

The authors have found that di-, tri-, tetra-, and hexa-9-acridinylamines are so efficiently associated with DNA during electrophoresis in polyacrylamide or agarose gels that they retard its migration. The retardation is roughly proportional to the reagent to base pair ratio, and the magnitude of the retardation indicates that a combined charge neutralization/helix extension mechanism is mainly responsible for the effect. Furthermore, DNA sequence dependent differences are observed. Thus, the pUC 19 restriction fragments (HaeIII or AluI), which in the native state comigrate upon gel electrophoretic analysis, could be separated in the presence of a diacridine, and specific DNA fragments responded differently to different diacridines. These results suggest that the effect also is due to a contribution from the DNA conformation and that the DNA conformation dynamics are influenced differently upon binding of different diacridines. They foresee three applications of this observation: (1) in analytical gel electrophoretic separation of otherwise comigrating DNA molecules, (2) in studies of polyintercalator-DNA interaction, and (3) in measurements of polyintercalator-induced DNA unwinding

Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

NARCIS (Netherlands)

Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

2010-01-01

Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

International Nuclear Information System (INIS)

D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

1988-01-01

cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

2015-01-01

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

International Nuclear Information System (INIS)

Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

1979-01-01

Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

Structure and DNA-binding of meiosis-specific protein Hop2

Science.gov (United States)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Antimicrobial effects of helix D-derived peptides of human antithrombin III.

Science.gov (United States)

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K V; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-10-24

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix D-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

Science.gov (United States)

Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

2015-05-15

During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

Science.gov (United States)

Qian, Yong; Wang, Chunyan; Gao, Fenglei

2015-01-15

A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

Science.gov (United States)

Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

2018-03-23

To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

Science.gov (United States)

Fraser, L; Strzezek, J

2007-07-15

In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

Crystallographic study of one turn of G/C-rich B-DNA.

Science.gov (United States)

Heinemann, U; Alings, C

1989-11-20

The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.

Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

Energy Technology Data Exchange (ETDEWEB)

Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

2001-09-15

We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

Science.gov (United States)

Holley, W. R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

International Nuclear Information System (INIS)

Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

1986-01-01

The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

Teaching helix and problems connected with helix using GeoGebra

Science.gov (United States)

Bímová, Daniela

2017-12-01

The contribution presents the dynamic applets created in GeoGebra that show the origin and main properties of a helix and it also presents some constructive problems connected with the helix. There are created the step by step algorithms of some constructions in the chosen applets. Three-dimensional applets include illustrative helix samples and spatial animations that help students better see problems concerning the helix spatially. There is mentioned the website in the contribution on which there is situated GeoGebra book dedicated to the topic "Helix" and containing the mentioned applets. The created applets and materials of the GeoGebra book "Helix" help in teaching and studying the course Constructive Geometry determined for the students of the Faculty of Mechanical Engineering of the Technical University of Liberec.

Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

Science.gov (United States)

Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

2013-09-24

Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

DEFF Research Database (Denmark)

Peng, Xu; Brügger, Kim; Shen, Biao

2003-01-01

terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...

Polarizability of Six-Helix Bundle and Triangle DNA Origami and Their Escape Characteristics from a Dielectrophoretic Trap.

Science.gov (United States)

Gan, Lin; Camacho-Alanis, Fernanda; Ros, Alexandra

2015-12-15

DNA nanoassemblies, such as DNA origamis, hold promise in biosensing, drug delivery, nanoelectronic circuits, and biological computing, which require suitable methods for migration and precision positioning. Insulator-based dielectrophoresis (iDEP) has been demonstrated as a powerful migration and trapping tool for μm- and nm-sized colloids as well as DNA origamis. However, little is known about the polarizability of origami species, which is responsible for their dielectrophoretic migration. Here, we report the experimentally determined polarizabilities of the six-helix bundle origami (6HxB) and triangle origami by measuring the migration times through a potential landscape exhibiting dielectrophoretic barriers. The resulting migration times correlate to the depth of the dielectrophoretic potential barrier and the escape characteristics of the origami according to an adapted Kramer's rate model, allowing their polarizabilities to be determined. We found that the 6HxB polarizability is larger than that of the triangle origami, which correlates with the variations in charge density of both origamis. Further, we discuss the orientation of both origami species in the dielectrophoretic trap and discuss the influence of diffusion during the escape process. Our study provides detailed insight into the factors contributing to the migration through dielectrophoretic potential landscapes, which can be exploited for applications with DNA and other nanoassemblies based on dielectrophoresis.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

Science.gov (United States)

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

International Nuclear Information System (INIS)

Yakura, Kimitaka; Tanifuji, Shigeyuki.

1983-01-01

EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

Science.gov (United States)

Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

1976-09-01

Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Science.gov (United States)

Birla, Bhagyashree S; Chou, Hui-Hsien

2015-01-01

Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

Directory of Open Access Journals (Sweden)

Bhagyashree S Birla

Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

Science.gov (United States)

Wehrmann, A; Eggeling, L; Sahm, H

1994-12-01

In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

Nature of defects produced on thymine fragment by gamma irradiation of DNA

International Nuclear Information System (INIS)

Teoule, R.; Bonicel, A.

1975-01-01

A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

Hydrogen-deuterium exchange studies of the rat thyroid transcription factor 1 homeodomain

International Nuclear Information System (INIS)

Esposito, Gennaro; Fogolari, Federico; Damante, Giuseppe; Formisano, Silvestro; Tell, Gianluca; Leonardi, Antonio; Di Lauro, Roberto; Viglino, Paolo

1997-01-01

The 1 H NMR solution structure of the rat thyroid transcription factor 1 homeodomain (TTF-1 HD) showed that the molecule folds like classical homeodomains. The C-terminal extension of helix III (fragment 51-59) appeared to adopt a helical geometry, albeit not as rigid as the preceding portion, but the hydrogen-deuterium exchange of backboneamides and the NOE data provided evidence of a discontinuity between the two moieties of helix III at the highly conserved fragmentAsn 51 -His 52 -Arg 53 .Analysis of quantitative measurements of isotope exchange rates allows one to recognize the general occurrence, in that region of HD motifs, of opposite effects to helix III stability. Asparagine, histidine and arginine residues occur most frequently at the beginning and end of protein helices.In TTF-1 HD a local fluctuation is observed in the fragment 51-53 which either kinks or tightens the α-helix. A search through the protein structure database reveals that the three most common variants of HD fragments 51-53 are often involved in helices and, frequently, in helix initiation or termination. For homeodomains in general, the nature of the fragment 51-53 may be related to the conformational dynamics of their DNA-recognition helix (helix III). Besides the specific results on fragment 51-53, the complete isotope exchange analysis of TTF-1 HD data shows that the partially solvent-exposed recognition helix is stabilized by hydrophobic interactions, like most of the structured regions of the molecule. Hydrophobic stabilization of the contacting regions meets the requirements of a DNA-interaction mechanism which, as shown with other DNA-protein complexes, should entail negative heat capacity variations due to changes in solvent exposure of the nonpolar protein surface

A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

Directory of Open Access Journals (Sweden)

Manesh Kumar Panner Selvam

2018-03-01

Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

NARCIS (Netherlands)

ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

International Nuclear Information System (INIS)

Jackson, Christopher B.; Gallati, Sabina; Schaller, André

2012-01-01

Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

Energy Technology Data Exchange (ETDEWEB)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

International Nuclear Information System (INIS)

Villano, C.M.; White, L.A.

2006-01-01

The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

Directory of Open Access Journals (Sweden)

Beiyu Liu

2009-09-01

Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

Directory of Open Access Journals (Sweden)

Agustín García-Peiró

2014-01-01

Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

Science.gov (United States)

Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

2009-11-01

Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

Science.gov (United States)

Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

1991-01-01

Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

The type II collagen fragments Helix-II and CTX-II reveal different enzymatic pathways of human cartilage collagen degradation

DEFF Research Database (Denmark)

Charni-Ben Tabassi, N; Desmarais, S; Jensen, Anne-Christine Bay

2008-01-01

human recombinant cathepsins (Cats) and matrix-metalloproteases (MMPs). Next, we analyzed the spontaneous release of Helix-II and CTX-II from cartilage sections of patients with knee OA who were immediately deep frozen after joint replacement to preserve endogenous enzyme activity until assay. Cartilage....... Cat D was unable to digest intact cartilage. MMPs-1, -3, -7, -9, and -13 efficiently released CTX-II, but only small amount of Helix-II. Neither CTX-II nor Helix-II alone was able to reflect accurately the collagenolytic activity of Cats and MMPs as reflected by the release of hydroxyproline. In OA...

Application of TensorFlow to recognition of visualized results of fragment molecular orbital (FMO) calculations

OpenAIRE

Saitou, Sona; Iijima, Jun; Fujimoto, Mayu; Mochizuki, Yuji; Okuwaki, Koji; Doi, Hideo; Komeiji, Yuto

2018-01-01

We have applied Google's TensorFlow deep learning toolkit to recognize the visualized results of the fragment molecular orbital (FMO) calculations. Typical protein structures of alpha-helix and beta-sheet provide some characteristic patterns in the two-dimensional map of inter-fragment interaction energy termed as IFIE-map (Kurisaki et al., Biophys. Chem. 130 (2007) 1). A thousand of IFIE-map images with labels depending on the existences of alpha-helix and beta-sheet were prepared by employi...

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

Science.gov (United States)

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

International Nuclear Information System (INIS)

Hahn, P.J.; Giddings, L.; Lane, M.J.

1989-01-01

Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

NMR assignments for the amino-terminal residues of trp repressor and their role in DNA binding

International Nuclear Information System (INIS)

Arrowsmith, C.H.; Carey, J.; Treat-Clemons, L.; Jardetzky, O.

1989-01-01

The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile arms. Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

International Nuclear Information System (INIS)

Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

2012-01-01

Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

Energy Technology Data Exchange (ETDEWEB)

Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2012-04-20

Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

International Nuclear Information System (INIS)

Wei Kang; Liu Xueying; Zhu Xuefen

1984-01-01

The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

Science.gov (United States)

Boyko, Alex; Kovalchuk, Igor

2010-01-01

Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

Structural studies of polypeptides: Mechanism of immunoglobin catalysis and helix propagation in hybrid sequence, disulfide containing peptides

Energy Technology Data Exchange (ETDEWEB)

Storrs, Richard Wood [Univ. of California, Berkeley, CA (United States)

1992-08-01

Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by ³¹P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal of cis, syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 Å of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an α-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.

Structural studies of polypeptides: Mechanism of immunoglobin catalysis and helix propagation in hybrid sequence, disulfide containing peptides

Energy Technology Data Exchange (ETDEWEB)

Storrs, R.W.

1992-08-01

Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by [sup 31]P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal of cis, syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 [Angstrom] of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an [alpha]-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.

Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

International Nuclear Information System (INIS)

Zhu Shoupeng; Xiao Dong; Han Xiaofeng

1997-01-01

The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

Science.gov (United States)

Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

1996-01-01

For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

Directory of Open Access Journals (Sweden)

Jiabing Ji

Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

International Nuclear Information System (INIS)

Sage, E.; Moustacchi, E.

1987-01-01

The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

Influence of mobile DNA-protein-DNA bridges on DNA configurations: Coarse-grained Monte-Carlo simulations

NARCIS (Netherlands)

Vries, de R.

2011-01-01

A large literature exists on modeling the influence of sequence-specific DNA-binding proteins on the shape of the DNA double helix in terms of one or a few fixed constraints. This approach is inadequate for the many proteins that bind DNA sequence independently, and that are present in very large

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Triple Helix going abroad?

DEFF Research Database (Denmark)

Sørensen, Olav Jull; Hu, Yimei

2014-01-01

The aim of the article is to explore to what extent the Tripple helix is being internationalized. Each of the helixes have their own internationalization rationale but the article show by small example that the helix itself is being internationalized and integrated with the host country tripple h...

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

Science.gov (United States)

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

Science.gov (United States)

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

Directory of Open Access Journals (Sweden)

S. Yu. Borovets

2017-01-01

Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Directory of Open Access Journals (Sweden)

Jorge A. Bertolotto

2016-06-01

Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

Science.gov (United States)

Bertolotto, Jorge A.; Umazano, Juan P.

2016-06-01

In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

Science.gov (United States)

de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

2015-03-01

Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

Nuclear receptor ligand-binding domains: reduction of helix H12 dynamics to favour crystallization

Energy Technology Data Exchange (ETDEWEB)

Nahoum, Virginie; Lipski, Alexandra; Quillard, Fabien; Guichou, Jean-François [INSERM, U554, 34090 Montpellier (France); Université de Montpellier, CNRS, UMR5048, Centre de Biochimie Structurale (CBS), 34090 Montpellier (France); Boublik, Yvan [CNRS, UMR5237, Centre de Recherche de Biochimie Macromoléculaire (CRBM), 34293 Montpellier (France); Pérez, Efrèn [Universidade de Vigo, Departamento de Quimica Organica, Facultad de Química, 36310 Vigo (Spain); Germain, Pierre [Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), BP 10142, 67404 Illkirch CEDEX (France); Lera, Angel R. de [Universidade de Vigo, Departamento de Quimica Organica, Facultad de Química, 36310 Vigo (Spain); Bourguet, William, E-mail: bourguet@cbs.cnrs.fr [INSERM, U554, 34090 Montpellier (France); Université de Montpellier, CNRS, UMR5048, Centre de Biochimie Structurale (CBS), 34090 Montpellier (France)

2008-07-01

Attempts have been made to crystallize the ligand-binding domain of the human retinoid X receptor in complex with a variety of newly synthesized ligands. An inverse correlation was observed between the ‘crystallizability’ and the structural dynamics of the various receptor–ligand complexes. Crystallization trials of the human retinoid X receptor α ligand-binding domain (RXRα LBD) in complex with various ligands have been carried out. Using fluorescence anisotropy, it has been found that when compared with agonists these small-molecule effectors enhance the dynamics of the RXRα LBD C-terminal helix H12. In some cases, the mobility of this helix could be dramatically reduced by the addition of a 13-residue co-activator fragment (CoA). In keeping with these observations, crystals have been obtained of the corresponding ternary RXRα LBD–ligand–CoA complexes. In contrast, attempts to crystallize complexes with a highly mobile H12 remained unsuccessful. These experimental observations substantiate the previously recognized role of co-regulator fragments in facilitating the crystallization of nuclear receptor LBDs.

Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

Science.gov (United States)

Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

2016-06-20

Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

Directory of Open Access Journals (Sweden)

George Anifandis

2018-05-01

Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

Science.gov (United States)

Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

2017-12-01

In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

A 3D-DNA Molecule Made of PlayMais

Science.gov (United States)

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Effect of superoxide dismutase supplementation on sperm DNA fragmentation

Directory of Open Access Journals (Sweden)

Luciano Negri

2017-10-01

Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

International Nuclear Information System (INIS)

Al-Gubory, Kais H.

2005-01-01

The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

Directory of Open Access Journals (Sweden)

Leclerc Xavier

2009-04-01

Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

International Nuclear Information System (INIS)

Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

1987-01-01

The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

International Nuclear Information System (INIS)

Holley, W.R.; Chatterjee, A.

1996-01-01

We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

DNA-Destabilizing Agents as an Alternative Approach for Targeting DNA: Mechanisms of Action and Cellular Consequences

Directory of Open Access Journals (Sweden)

Gaëlle Lenglet

2010-01-01

Full Text Available DNA targeting drugs represent a large proportion of the actual anticancer drug pharmacopeia, both in terms of drug brands and prescription volumes. Small DNA-interacting molecules share the ability of certain proteins to change the DNA helix's overall organization and geometrical orientation via tilt, roll, twist, slip, and flip effects. In this ocean of DNA-interacting compounds, most stabilize both DNA strands and very few display helix-destabilizing properties. These types of DNA-destabilizing effect are observed with certain mono- or bis-intercalators and DNA alkylating agents (some of which have been or are being developed as cancer drugs. The formation of locally destabilized DNA portions could interfere with protein/DNA recognition and potentially affect several crucial cellular processes, such as DNA repair, replication, and transcription. The present paper describes the molecular basis of DNA destabilization, the cellular impact on protein recognition, and DNA repair processes and the latter's relationships with antitumour efficacy.

DNA Packaging by λ-Like Bacteriophages: Mutations Broadening the Packaging Specificity of Terminase, the λ-Packaging Enzyme

OpenAIRE

Feiss, Michael; Reynolds, Erin; Schrock, Morgan; Sippy, Jean

2010-01-01

The DNA-packaging specificities of phages λ and 21 depend on the specific DNA interactions of the small terminase subunits, which have support helix-turn-recognition helix-wing DNA-binding motifs. λ-Terminase with the recognition helix of 21 preferentially packages 21 DNA. This chimeric terminase's ability to package λDNA is reduced ∼20-fold. Phage λ with the chimeric terminase is unable to form plaques, but pseudorevertants are readily obtained. Some pseudorevertants have trans-acting suppre...

[Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

Science.gov (United States)

Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

2016-09-01

Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

Science.gov (United States)

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

[Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

Science.gov (United States)

Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

2009-02-01

To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

[Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

Science.gov (United States)

Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

2015-08-01

In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

Breathing, bubbling, and bending: DNA flexibility from multimicrosecond simulations

Science.gov (United States)

Zeida, Ari; Machado, Matías Rodrigo; Dans, Pablo Daniel; Pantano, Sergio

2012-08-01

Bending of the seemingly stiff DNA double helix is a fundamental physical process for any living organism. Specialized proteins recognize DNA inducing and stabilizing sharp curvatures of the double helix. However, experimental evidence suggests a high protein-independent flexibility of DNA. On the basis of coarse-grained simulations, we propose that DNA experiences thermally induced kinks associated with the spontaneous formation of internal bubbles. Comparison of the protein-induced DNA curvature calculated from the Protein Data Bank with that sampled by our simulations suggests that thermally induced distortions can account for ˜80% of the DNA curvature present in experimentally solved structures.

Breathing, bubbling, and bending: DNA flexibility from multimicrosecond simulations.

Science.gov (United States)

Zeida, Ari; Machado, Matías Rodrigo; Dans, Pablo Daniel; Pantano, Sergio

2012-08-01

Bending of the seemingly stiff DNA double helix is a fundamental physical process for any living organism. Specialized proteins recognize DNA inducing and stabilizing sharp curvatures of the double helix. However, experimental evidence suggests a high protein-independent flexibility of DNA. On the basis of coarse-grained simulations, we propose that DNA experiences thermally induced kinks associated with the spontaneous formation of internal bubbles. Comparison of the protein-induced DNA curvature calculated from the Protein Data Bank with that sampled by our simulations suggests that thermally induced distortions can account for ~80% of the DNA curvature present in experimentally solved structures.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

Science.gov (United States)

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

Helix-coil transition of a four-way DNA junction observed by multiple fluorescence parameters.

Science.gov (United States)

Vámosi, György; Clegg, Robert M

2008-10-16

The thermal denaturation of immobile four-way DNA ("Holliday-") junctions with 17 base pair arms was studied via fluorescence spectroscopic measurements. Two arms of the molecule were labeled at the 5'-end with fluorescein and tetramethylrhodamine, respectively. Melting was monitored by the fluorescence intensity of the dyes, the fluorescence anisotropy of tetramethylrhodamine, and Forster resonance energy transfer (FRET) between fluorescein and rhodamine. To fit the thermal denaturation curves of the four-way junctions, two basic thermodynamic models were tested: (1) all-or-none transitions assuming a molecularity of one, two, or four and (2) a statistical "zipper" model. The all-or-none models correspond to reaction mechanisms assuming that the cooperative melting unit (that is, the structure changing from complete helix to complete coil) consists of (1) one arm, (2) two neighboring arms (which have one continuous strand common to the two arms), or (3) all four arms. In each case, the melting of the cooperative unit takes place in a single step. The tetramolecular reaction model (four-arm melting) yielded unrealistically low van't Hoff enthalpy and entropy values, whereas the monomolecular model (one-arm melting) resulted in a poor fit to the experimental data. The all-or-none bimolecular (two neighboring arm model) fit gave intermediate standard enthalpy change (Delta H) values between those expected for the melting of a duplex with a total length between the helix lengths of one and two arms (17 and 34 base pairs). Simulations according to the zipper model fit the experimental curves best when the length of the simulated duplex was assumed to be 34 base pairs, the length of a single strand. This suggests that the most important parameter determining the melting behavior of the molecule is the end-to-end distance of the strands (34 bases) rather than the length of the individual arms (17 base pairs) and that the equilibrium concentration of partially denatured

DNA nanotechnology: a future perspective

Science.gov (United States)

2013-01-01

In addition to its genetic function, DNA is one of the most distinct and smart self-assembling nanomaterials. DNA nanotechnology exploits the predictable self-assembly of DNA oligonucleotides to design and assemble innovative and highly discrete nanostructures. Highly ordered DNA motifs are capable of providing an ultra-fine framework for the next generation of nanofabrications. The majority of these applications are based upon the complementarity of DNA base pairing: adenine with thymine, and guanine with cytosine. DNA provides an intelligent route for the creation of nanoarchitectures with programmable and predictable patterns. DNA strands twist along one helix for a number of bases before switching to the other helix by passing through a crossover junction. The association of two crossovers keeps the helices parallel and holds them tightly together, allowing the assembly of bigger structures. Because of the DNA molecule's unique and novel characteristics, it can easily be applied in a vast variety of multidisciplinary research areas like biomedicine, computer science, nano/optoelectronics, and bionanotechnology. PMID:23497147

Assembly of Liposomes Controlled by Triple Helix Formation

DEFF Research Database (Denmark)

Vogel, Stefan; Jakobsen, Ulla

2013-01-01

Attachment of DNA to the surface of different solid nanoparticles (e.g. gold- and silica nanoparticles) is well established and a number of DNA-modified solid nanoparticle systems have been applied to thermal denaturation analysis of oligonucleotides. We report herein the non-covalent immobilizat...... analysis (NTA) and dynamic light scattering (DLS) show independently from ultraviolet spectroscopy experiments the formation of liposome aggregates.......-covalent immobilization of oligonucleotides on the surface of soft nanoparticles (e.g. liposomes) and the subsequent controlled assembly by DNA triple helix formation. The non-covalent approach avoids tedious surface chemistry and necessary purification procedures and can simplify and extend the available methodology...... sequences (G or C-rich) to explore the applicability of the method for different triple helical assembly modes. We demonstrate advantages and limitations of the approach and proof the reversible and reproducible formation of liposome aggregates during thermal denaturation cycles. Nanoparticle tracking...

Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

Directory of Open Access Journals (Sweden)

Cheuk-Chun Szeto

Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

Genome-wide identification and analysis of basic helix-loop-helix domains in dog, Canis lupus familiaris.

Science.gov (United States)

Wang, Xu-Hua; Wang, Yong; Liu, A-Ke; Liu, Xiao-Ting; Zhou, Yang; Yao, Qin; Chen, Ke-Ping

2015-04-01

The basic helix-loop-helix (bHLH) domain is a highly conserved amino acid motif that defines a group of DNA-binding transcription factors. bHLH proteins play essential regulatory roles in a variety of biological processes in animal, plant, and fungus. The domestic dog, Canis lupus familiaris, is a good model organism for genetic, physiological, and behavioral studies. In this study, we identified 115 putative bHLH genes in the dog genome. Based on a phylogenetic analysis, 51, 26, 14, 4, 12, and 4 dog bHLH genes were assigned to six separate groups (A-F); four bHLH genes were categorized as ''orphans''. Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with positional conservation, other conserved domains flanking the bHLH motif, and highly conserved intron/exon patterns in other vertebrates. Our analytical results confirmed the GenBank annotations of 89 dog bHLH proteins and provided information that could be used to update the annotations of the remaining 26 dog bHLH proteins. These data will provide good references for further studies on the structures and regulatory functions of bHLH proteins in the growth and development of dogs, which may help in understanding the mechanisms that underlie the physical and behavioral differences between dogs and wolves.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

International Nuclear Information System (INIS)

Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

2010-01-01

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

Energy Technology Data Exchange (ETDEWEB)

Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

2010-01-05

Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

One Peptide Reveals the Two Faces of α-Helix Unfolding-Folding Dynamics.

Science.gov (United States)

Jesus, Catarina S H; Cruz, Pedro F; Arnaut, Luis G; Brito, Rui M M; Serpa, Carlos

2018-04-12

The understanding of fast folding dynamics of single α-helices comes mostly from studies on rationally designed peptides displaying sequences with high helical propensity. The folding/unfolding dynamics and energetics of α-helix conformations in naturally occurring peptides remains largely unexplored. Here we report the study of a protein fragment analogue of the C-peptide from bovine pancreatic ribonuclease-A, RN80, a 13-amino acid residue peptide that adopts a highly populated helical conformation in aqueous solution. 1 H NMR and CD structural studies of RN80 showed that α-helix formation displays a pH-dependent bell-shaped curve, with a maximum near pH 5, and a large decrease in helical content in alkaline pH. The main forces stabilizing this short α-helix were identified as a salt bridge formed between Glu-2 and Arg-10 and the cation-π interaction involving Tyr-8 and His-12. Thus, deprotonation of Glu-2 or protonation of His-12 are essential for the RN80 α-helix stability. In the present study, RN80 folding and unfolding were triggered by laser-induced pH jumps and detected by time-resolved photoacoustic calorimetry (PAC). The photoacid proton release, amino acid residue protonation, and unfolding/folding events occur at different time scales and were clearly distinguished using time-resolved PAC. The partial unfolding of the RN80 α-helix, due to protonation of Glu-2 and consequent breaking of the stabilizing salt bridge between Glu-2 and Arg-10, is characterized by a concentration-independent volume expansion in the sub-microsecond time range (0.8 mL mol -1 , 369 ns). This small volume expansion reports the cost of peptide backbone rehydration upon disruption of a solvent-exposed salt bridge, as well as backbone intrinsic expansion. On the other hand, RN80 α-helix folding triggered by His-12 protonation and subsequent formation of a cation-π interaction leads to a microsecond volume contraction (-6.0 mL mol -1 , ∼1.7 μs). The essential role of two

Multiple helix ecosystems for sustainable competitiveness

CERN Document Server

Ferreira, João; Farinha, Luís; Fernandes, Nuno

2016-01-01

This book discusses the main issues, challenges, opportunities, and trends involving the interactions between academia, industry, government and society. Specifically, it aims to explore how these interactions enhance the ways in which companies deliver products and services in order to achieve sustainable competitiveness in the marketplace. Sustainable competitiveness has been widely discussed by academics and practitioners, considering the importance of protecting the environment while sustaining the economic goals of organizations. The Quintuple Helix innovation model is a framework for facilitating knowledge, innovation and sustainable competitive advantage. It embeds the Triple and the Quadruple Helix models by adding a fifth helix, the “natural environment.” The Triple Helix model focuses on the university-industry-government triad, while the Quadruple adds civil society (the media- and culture-driven public) as a fourth helix. The Quintuple Helix model facilitates research, public policy, and pract...

DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

International Nuclear Information System (INIS)

Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

1998-01-01

The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

DNA hydration studied by neutron fiber diffraction

Energy Technology Data Exchange (ETDEWEB)

Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J. [Keele Univ. (United Kingdom)] [and others

1994-12-31

The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix.

DNA hydration studied by neutron fiber diffraction

International Nuclear Information System (INIS)

Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J.

1994-01-01

The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix

Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

Science.gov (United States)

Bille, Todd W; Cromartie, Carter; Farr, Matthew

2009-09-01

This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

Force-Induced Unravelling of DNA Origami.

Science.gov (United States)

Engel, Megan C; Smith, David M; Jobst, Markus A; Sajfutdinow, Martin; Liedl, Tim; Romano, Flavio; Rovigatti, Lorenzo; Louis, Ard A; Doye, Jonathan P K

2018-05-31

The mechanical properties of DNA nanostructures are of widespread interest as applications that exploit their stability under constant or intermittent external forces become increasingly common. We explore the force response of DNA origami in comprehensive detail by combining AFM single molecule force spectroscopy experiments with simulations using oxDNA, a coarse-grained model of DNA at the nucleotide level, to study the unravelling of an iconic origami system: the Rothemund tile. We contrast the force-induced melting of the tile with simulations of an origami 10-helix bundle. Finally, we simulate a recently-proposed origami biosensor, whose function takes advantage of origami behaviour under tension. We observe characteristic stick-slip unfolding dynamics in our force-extension curves for both the Rothemund tile and the helix bundle and reasonable agreement with experimentally observed rupture forces for these systems. Our results highlight the effect of design on force response: we observe regular, modular unfolding for the Rothemund tile that contrasts with strain-softening of the 10-helix bundle which leads to catastropic failure under monotonically increasing force. Further, unravelling occurs straightforwardly from the scaffold ends inwards for the Rothemund tile, while the helix bundle unfolds more nonlinearly. The detailed visualization of the yielding events provided by simulation allows preferred pathways through the complex unfolding free-energy landscape to be mapped, as a key factor in determining relative barrier heights is the extensional release per base pair broken. We shed light on two important questions: how stable DNA nanostructures are under external forces; and what design principles can be applied to enhance stability.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

Directory of Open Access Journals (Sweden)

Kotoka Masuyama

Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

NARCIS (Netherlands)

Wienk, H.L.J.; Slootweg, J.C.; Speerstra, S.; Kaptein, R.; Boelens, R.; Folkers, G.E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL

The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

Science.gov (United States)

Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

2018-01-01

The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

Generating structured light with phase helix and intensity helix using reflection-enhanced plasmonic metasurface at 2 μm

Science.gov (United States)

Zhao, Yifan; Du, Jing; Zhang, Jinrun; Shen, Li; Wang, Jian

2018-04-01

Mid-infrared (2-20 μm) light has been attracting great attention in many areas of science and technology. Beyond the extended wavelength range from visible and near-infrared to mid-infrared, shaping spatial structures may add opportunities to grooming applications of mid-infrared photonics. Here, we design and fabricate a reflection-enhanced plasmonic metasurface and demonstrate efficient generation of structured light with the phase helix and intensity helix at 2 μm. This work includes two distinct aspects. First, structured light (phase helix, intensity helix) generation at 2 μm, which is far beyond the ability of conventional spatial light modulators, is enabled by the metasurface with sub-wavelength engineered structures. Second, the self-referenced intensity helix against environmental noise is generated without using a spatially separated light. The demonstrations may open up advanced perspectives to structured light applications at 2 μm, such as phase helix for communications and non-communications (imaging, sensing) and intensity helix for enhanced microscopy and advanced metrology.

DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

DEFF Research Database (Denmark)

Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

2012-01-01

Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

Energy Technology Data Exchange (ETDEWEB)

Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

2012-07-29

Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

Human Genome Research: Decoding DNA

Science.gov (United States)

dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

Science.gov (United States)

Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

2012-03-13

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Science.gov (United States)

Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

2012-01-01

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

Science.gov (United States)

M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

1994-01-01

A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

Directory of Open Access Journals (Sweden)

Olga Makarova

Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

International Nuclear Information System (INIS)

Mendel, D.; Dervan, P.B.

1987-01-01

Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

NMR studies of abasic sites in DNA duplexes: Deoxyadenosine stacks into the helix opposite acyclic lesions

International Nuclear Information System (INIS)

Kalnik, M.W.; Chang, Chienneng; Johnson, F.; Grollman, A.P.; Patel, D.J.

1989-01-01

Proton and phosphorus NMR studies are reported for two complementary nonanucleotide duplexes containing acyclic abasic sites. The first duplex, d(C-A-T-G-A-G-T-A-C)·d(G-T-A-C-P-C-A-T-G), contains an acyclic propanyl moiety, P, located opposite a deoxyadenosine at the center of the helix (designated AP P 9-mer duplex). The second duplex, d(C-A-T-G-A-G-T-A-C-)·d(G-T-A-C-E-C-A-T-G), contains a similarly located acyclic ethanyl moiety, E (designated AP E 9-mer duplex). The ethanyl moiety is one carbon shorter than the natural carbon-phosphodiester backbone of a single nucleotide unit of DNA. The majority of the exchangeable and nonexchangeable base and sugar protons in both the AP P 9-mer and AP E 9-mer duplexes, including those at the abasic site, have been assigned by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H 2 O and D 2 O solution between -5 and 5 degree C. These spectroscopic observations establish that A5 inserts into the helix opposite the abasic site (P14 and El14) and stacks between the flanking G4·C15 and G6·C13 Watson-Crick base pairs in both the AP P 9-mer and AP E 9-mer duplexes. Proton NMR parameters for the Ap P 9-mer and AP E 9-mer duplexes are similar to those reported previously. These proton NMR experiments demonstrate that the structures at abasic sites are very similar whether the five-membered ring is open or closed or whether the phosphodiester backbone is shortened by one carbon atom. Phosphorus spectra of the AP P 9-mer and AP E 9-mer duplexes (5 degree C) indicate that the backbone conformation is similarly perturbed at three phosphodiester backbone torsion angles

Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

Science.gov (United States)

Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

2001-01-01

Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

Science.gov (United States)

Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

2017-01-01

Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

Origin and Diversification of Basic-Helix-Loop-Helix Proteins in Plants

OpenAIRE

Pires, Nuno; Dolan, Liam

2009-01-01

Basic helix-loop-helix (bHLH) proteins are a class of transcription factors found throughout eukaryotic organisms. Classification of the complete sets of bHLH proteins in the sequenced genomes of Arabidopsis thaliana and Oryza sativa (rice) has defined the diversity of these proteins among flowering plants. However, the evolutionary relationships of different plant bHLH groups and the diversity of bHLH proteins in more ancestral groups of plants are currently unknown. In this study, we use wh...

Recognition and Binding of a Helix-Loop-Helix Peptide to Carbonic Anhydrase Occurs via Partly Folded Intermediate Structures

Science.gov (United States)

Lignell, Martin; Becker, Hans-Christian

2010-01-01

Abstract We have studied the association of a helix-loop-helix peptide scaffold carrying a benzenesulfonamide ligand to carbonic anhydrase using steady-state and time-resolved fluorescence spectroscopy. The helix-loop-helix peptide, developed for biosensing applications, is labeled with the fluorescent probe dansyl, which serves as a polarity-sensitive reporter of the binding event. Using maximum entropy analysis of the fluorescence lifetime of dansyl at 1:1 stoichiometry reveals three characteristic fluorescence lifetime groups, interpreted as differently interacting peptide/protein structures. We characterize these peptide/protein complexes as mostly bound but unfolded, bound and partly folded, and strongly bound and folded. Furthermore, analysis of the fluorescence anisotropy decay resulted in three different dansyl rotational correlation times, namely 0.18, 1.2, and 23 ns. Using the amplitudes of these times, we can correlate the lifetime groups with the corresponding fluorescence anisotropy component. The 23-ns rotational correlation time, which appears with the same amplitude as a 17-ns fluorescence lifetime, shows that the dansyl fluorophore follows the rotational diffusion of carbonic anhydrase when it is a part of the folded peptide/protein complex. A partly folded and partly hydrated interfacial structure is manifested in an 8-ns dansyl fluorescence lifetime and a 1.2-ns rotational correlation time. This structure, we believe, is similar to a molten-globule-like interfacial structure, which allows segmental movement and has a higher degree of solvent exposure of dansyl. Indirect excitation of dansyl on the helix-loop-helix peptide through Förster energy transfer from one or several tryptophans in the carbonic anhydrase shows that the helix-loop-helix scaffold binds to a tryptophan-rich domain of the carbonic anhydrase. We conclude that binding of the peptide to carbonic anhydrase involves a transition from a disordered to an ordered structure of the

A large-scale association study for nanoparticle C60 uncovers mechanisms of nanotoxicity disrupting the native conformations of DNA/RNA.

Science.gov (United States)

Xu, Xue; Wang, Xia; Li, Yan; Wang, Yonghua; Yang, Ling

2012-09-01

Nano-scale particles have attracted a lot of attention for its potential use in medical studies, in particular for the diagnostic and therapeutic purposes. However, the toxicity and other side effects caused by the undesired interaction between nanoparticles and DNA/RNA are not clear. To address this problem, a model to evaluate the general rules governing how nanoparticles interact with DNA/RNA is demanded. Here by, use of an examination of 2254 native nucleotides with molecular dynamics simulation and thermodynamic analysis, we demonstrate how the DNA/RNA native structures are disrupted by the fullerene (C60) in a physiological condition. The nanoparticle was found to bind with the minor grooves of double-stranded DNA and trigger unwinding and disrupting of the DNA helix, which indicates C60 can potentially inhibit the DNA replication and induce potential side effects. In contrast to that of DNA, C60 only binds to the major grooves of RNA helix, which stabilizes the RNA structure or transforms the configuration from stretch to curl. This finding sheds new light on how C60 inhibits reverse transcription as HIV replicates. In addition, the binding of C60 stabilizes the structures of RNA riboswitch, indicating that C60 might regulate the gene expression. The binding energies of C60 with different genomic fragments varies in the range of -56 to -10 kcal mol(-1), which further verifies the role of nanoparticle in DNA/RNA damage. Our findings reveal a general mode by which C60 causes DNA/RNA damage or other toxic effects at a systematic level, suggesting it should be cautious to handle these nanomaterials in various medical applications.

Chirality-specific lift forces of helix under shear flows: Helix perpendicular to shear plane.

Science.gov (United States)

Zhang, Qi-Yi

2017-02-01

Chiral objects in shear flow experience a chirality-specific lift force. Shear flows past helices in a low Reynolds number regime were studied using slender-body theory. The chirality-specific lift forces in the vorticity direction experienced by helices are dominated by a set of helix geometry parameters: helix radius, pitch length, number of turns, and helix phase angle. Its analytical formula is given. The chirality-specific forces are the physical reasons for the chiral separation of helices in shear flow. Our results are well supported by the latest experimental observations. © 2016 Wiley Periodicals, Inc.

Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

Science.gov (United States)

Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

2018-02-01

Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

Science.gov (United States)

Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

2009-09-01

We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

Conformational changes in DNA caused by DNA-ase I, gamma and ultraviolet radiation as revealed by differential pulse polarography

International Nuclear Information System (INIS)

Vorlickova, M.

1979-01-01

The height, potential and half width of differential pulse-polarographic peaks of DNA were investigated in dependence on degradation by DNA-ase I and gamma and UV radiation. It was found that in all cases studied growth of peak II (reflecting conformational changes in the DNA double helix) was limited, and only after it reached a certain height further degradation induced the appearance of peak III of single-stranded DNA. This course is explained as reflecting the limited extent of conformational changes in the framework of the double helix, which probably follows from a limited number of sites that can undergo certain types of conformational changes. The character of the conformational changes is dependent on the chemical nature of the damage. (author)

Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

Science.gov (United States)

Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

2017-05-11

Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Net (ERP/SAP2) one of the Ras-inducible TCFs, has a novel inhibitory domain with resemblance to the helix-loop-helix motif.

Science.gov (United States)

Maira, S M; Wurtz, J M; Wasylyk, B

1996-11-01

The three ternary complex factors (TCFs), Net (ERP/ SAP-2), ELK-1 and SAP-1, are highly related ets oncogene family members that participate in the response of the cell to Ras and growth signals. Understanding the different roles of these factors will provide insights into how the signals result in coordinate regulation of the cell. We show that Net inhibits transcription under basal conditions, in which SAP-1a is inactive and ELK-1 stimulates. Repression is mediated by the NID, the Net Inhibitory Domain of about 50 amino acids, which autoregulates the Net protein and also inhibits when it is isolated in a heterologous fusion protein. Net is particularly sensitive to Ras activation. Ras activates Net through the C-domain, which is conserved between the three TCFs, and the NID is an efficient inhibitor of Ras activation. The NID, as well as more C-terminal sequences, inhibit DNA binding. Net is more refractory to DNA binding than the other TCFs, possibly due to the presence of multiple inhibitory elements. The NID may adopt a helix-loop-helix (HLH) structure, as evidenced by homology to other HLH motifs, structure predictions, model building and mutagenesis of critical residues. The sequence resemblance with myogenic factors suggested that Net may form complexes with the same partners. Indeed, we found that Net can interact in vivo with the basic HLH factor, E47. We propose that Net is regulated at the level of its latent DNA-binding activity by protein interactions and/or phosphorylation. Net may form complexes with HLH proteins as well as SRF on specific promotor sequences. The identification of the novel inhibitory domain provides a new inroad into exploring the different roles of the ternary complex factors in growth control and transformation.

DNA Charge Transport: From Chemical Principles to the Cell

Science.gov (United States)

Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

2016-01-01

The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

Science.gov (United States)

Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

1997-01-01

Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis

Helix-Hopes on Finite Hyperfields

Directory of Open Access Journals (Sweden)

Thomas Vougiouklis

2016-12-01

Full Text Available Hyperstructure theory can overcome restrictions which ordinary algebraic structures have. A hyperproduct on non-square ordinary matrices can be defined by using the so called helix-hyperoperations. We study the helix-hyperstructures on the representations using ordinary fields. The related theory can be faced by defining the hyperproduct on the set of non square matrices. The main tools of the Hyperstructure Theory are the fundamental relations which connect the largest class of hyperstructures, the Hv-structures, with the corresponding classical ones. We focus on finite dimensional helix-hyperstructures and on small Hv-fields, as well.

Studies of interaction between two alkaloids and double helix DNA

International Nuclear Information System (INIS)

Sun, Yantao; Peng, Tingting; Zhao, Lei; Jiang, Dayu; Cui, Yuncheng

2014-01-01

This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K A ) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level

Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

Science.gov (United States)

Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

2017-10-01

A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide γ-phosphate derivative

Science.gov (United States)

Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.

2011-01-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative.

Science.gov (United States)

Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H

2011-03-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

Gibberellin-regulated gene in the basal region of rice leaf sheath encodes basic helix-loop-helix transcription factor.

Science.gov (United States)

Komatsu, Setsuko; Takasaki, Hironori

2009-07-01

Genes regulated by gibberellin (GA) during leaf sheath elongation in rice seedlings were identified using the transcriptome approach. mRNA from the basal regions of leaf sheaths treated with GA3 was analyzed by high-coverage gene expression profiling. 33,004 peaks were detected, and 30 transcripts showed significant changes in the presence of GA3. Among these, basic helix-loop-helix transcription factor (AK073385) was significantly upregulated. Quantitative PCR analysis confirmed that expression of AK073385 was controlled by GA3 in a time- and dose-dependent manner. Basic helix-loop-helix transcription factor (AK073385) is therefore involved in the regulation of gene expression by GA3.

Crystal structure of an Okazaki fragment at 2-A resolution

Science.gov (United States)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

Science.gov (United States)

Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

2016-01-01

DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

Directory of Open Access Journals (Sweden)

Sara Sadeghi

2016-01-01

Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

Structure of a DNA glycosylase that unhooks interstrand cross-links

Energy Technology Data Exchange (ETDEWEB)

Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.; Eichman, Brandt F. (Vanderbilt)

2017-04-10

DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protects its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.

Double-helix stellarator

International Nuclear Information System (INIS)

Moroz, P.E.

1997-09-01

A new stellarator configuration, the Double-Helix Stellarator (DHS), is introduced. This novel configuration features a double-helix center post as the only helical element of the stellarator coil system. The DHS configuration has many unique characteristics. One of them is the extreme low plasma aspect ratio, A ∼ 1--1.2. Other advantages include a high enclosed volume, appreciable rotational transform, and a possibility of extreme-high-β MHD equilibria. Moreover, the DHS features improved transport characteristics caused by the absence of the magnetic field ripple on the outboard of the torus. Compactness, simplicity and modularity of the coil system add to the DHS advantages for fusion applications

The Modular Construction of DNA Double Helix

Indian Academy of Sciences (India)

discovery, DNA structure has been able to disseminate knowl- edge of key ... band a. This procedure would place segment a, overlapping with d. Glue securely a ... Because of alignment problems, unless great care is taken, the modules do ...

Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

International Nuclear Information System (INIS)

Vejko, N.N.; Spitkovskij, D.M.

2000-01-01

The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

Micromechanics of base pair unzipping in the DNA duplex

International Nuclear Information System (INIS)

Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

2012-01-01

All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

Science.gov (United States)

Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

2014-04-01

Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

Science.gov (United States)

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

Science.gov (United States)

Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

2000-01-01

DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

Directory of Open Access Journals (Sweden)

Yuming Lu

Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Discrete instability in the DNA double helix

International Nuclear Information System (INIS)

Tabi, Conrad Bertrand; Mohamadou, Alidou; Kofane, Timoleon Crepin

2009-06-01

Modulational instability (MI) is explored in the framework of the base-rotor model of DNA dynamics. We show in fact that, the helicoidal coupling introduced in the spin model of DNA reduces the system to a modified discrete sine-Gordon (sG) equation. The MI criterion is thus modified and displays interesting features because of the helicoidal coupling. This is confirmed in the numerical analysis where a critical value of the helicoidal coupling constant is derived. In the simulations, we have found that a train of pulses are generated when the lattice is subjected to MI, in agreement with analytical results obtained in a modified discrete sG equation. Also, the competitive effects of the harmonic longitudinal and helicoidal constants on the dynamics of the system are notably pointed out. In the same way, it is shown that MI can lead to energy localization which is high for some values of the helicoidal coupling constant. (author)

DNA packing in chromatine, a manifestation of the Bonnet transformation.

Science.gov (United States)

Blum, Z; Lidin, S

1988-08-01

The packing of DNA is described using the formalism of differential geometry. Winding of the DNA double helix around the histone 2-5 octamer forming a nucleosome and the condensation of the so-formed bead-on-a-string chromatine aided by histone 1 is interpreted as two consecutive isometric, i.e. Bonnet, transformations. The DNA double helix can be approximated to a helicoid which can be transformed isometrically to a catenoid, an approximation of the nucleosome. Owing to the organization of the histone octamer the extended chromatine takes a helicoidal shape allowing a second Bonnet transformation to consummate the condensation into a chromatine fibre.

Gly184 of the Escherichia coli cAMP receptor protein provides optimal context for both DNA binding and RNA polymerase interaction.

Science.gov (United States)

Hicks, Matt N; Gunasekara, Sanjiva; Serate, Jose; Park, Jin; Mosharaf, Pegah; Zhou, Yue; Lee, Jin-Won; Youn, Hwan

2017-10-01

The Escherichia coli cAMP receptor protein (CRP) utilizes the helix-turn-helix motif for DNA binding. The CRP's recognition helix, termed F-helix, includes a stretch of six amino acids (Arg180, Glu181, Thr182, Val183, Gly184, and Arg185) for direct DNA contacts. Arg180, Glu181 and Arg185 are known as important residues for DNA binding and specificity, but little has been studied for the other residues. Here we show that Gly184 is another F-helix residue critical for the transcriptional activation function of CRP. First, glycine was repeatedly selected at CRP position 184 for its unique ability to provide wild type-level transcriptional activation activity. To dissect the glycine requirement, wild type CRP and mutants G184A, G184F, G184S, and G184Y were purified and their in vitro DNA-binding activity was measured. G184A and G184F displayed reduced DNA binding, which may explain their low transcriptional activation activity. However, G184S and G184Y displayed apparently normal DNA affinity. Therefore, an additional factor is needed to account for the diminished transcriptional activation function in G184S and G184Y, and the best explanation is perturbations in their interaction with RNA polymerase. The fact that glycine is the smallest amino acid could not fully warrant its suitability, as shown in this study. We hypothesize that Gly184 fulfills the dual functions of DNA binding and RNA polymerase interaction by conferring conformational flexibility to the F-helix.

Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

Science.gov (United States)

Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

2017-09-01

In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

49. Brazilian congress on genetics. DNA double helix. Abstracts

International Nuclear Information System (INIS)

2003-01-01

Use of radioisotopes and ionizing radiations in genetics is presented. Several aspects related to men, animals, plants and microorganisms are reported highlighting biological radiation effects, evolution, mutagenesis and genetic engineering. Genetic mapping, gene mutations, genetic diversity, DNA hybridization, DNA sequencing, plant cultivation and plant grow are studied as well

Scar-less multi-part DNA assembly design automation

Science.gov (United States)

Hillson, Nathan J.

2016-06-07

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

Effect of temperature on DNA double helix: An insight from ...

Indian Academy of Sciences (India)

The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often ...

A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

Science.gov (United States)

Santangelo, G M; Tornow, J

1997-12-01

As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

Science.gov (United States)

Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

2018-01-01

Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

The generalized model of polypeptide chain describing the helix-coil transition in biopolymers

International Nuclear Information System (INIS)

Mamasakhlisov, E.S.; Badasyan, A.V.; Tsarukyan, A.V.; Grigoryan, A.V.; Morozov, V.F.

2005-07-01

In this paper we summarize some results of our theoretical investigations of helix-coil transition both in single-strand (polypeptides) and two-strand (polynucleotides) macromolecules. The Hamiltonian of the Generalized Model of Polypeptide Chain (GMPC) is introduced to describe the system in which the conformations are correlated over some dimensional range Δ (it equals 3 for polypeptide, because one H-bond fixes three pairs of rotation, for double strand DNA it equals to one chain rigidity because of impossibility of loop formation on the scale less than Δ). The Hamiltonian does not contain any parameter designed especially for helix-coil transition and uses pure molecular microscopic parameters (the energy of hydrogen bond formation, reduced partition function of repeated unit, the number of repeated units fixed by one hydrogen bond, the energies of interaction between the repeated units and the solvent molecules). To calculate averages we evaluate the partition function using the transfer-matrix approach. The GMPC allowed to describe the influence of a number of factors, affecting the transition, basing on a unified microscopic approach. Thus we obtained, that solvents change transition temperature and interval in different ways, depending on type of solvent and on energy of solvent- macromolecule interaction; stacking on the background of H-bonding increases stability and decreases cooperativity of melting. For heterogeneous DNA we could analytically derive well known formulae for transition temperature and interval. In the framework of GMPC we calculate and show the difference of two order parameters of helix-coil transition - the helicity degree, and the average fraction of repeated units in helical conformation. Given article has the aim to review the results obtained during twenty years in the context of GMPC. (author)

NMR studies of bent DNA using {sup 13}C-enriched samples

Energy Technology Data Exchange (ETDEWEB)

Zimmer, D.P.; Crothers, D.M. [Yale Univ., New Haven, CT (United States)

1994-12-01

Bending of the DNA double helix can be brought about by introducing runs of adenines (A-tracts) in phase with the helical repeat of the DNA. The requirements for bending of DNA by A-tracts are that the length of the A-tract be greater than 3 base pairs and that the A-tracts must be in phase with the helical repeat (every 10 or 11 bp). Other factors, such as the number of adenines in the run, flanking sequences, and whether the A-tracts are phased with respect to the 5{prime}A or the 3{prime}A, have effects upon the degree of bending as assayed by electrophoretic mobility on native polyacrylamide gels. There are a number of models for bending A-tract DNA. The junction-bending model postulates that the structure of A-tracts is similar to the fiber diffraction structure of poly A, in which there is a significant degree of base pair tilt with respect to the helix axis. In this model, bending occurs at the junction between the A-tract and the B-form helix to allow favorable stacking interactions to occur. The bend of the helix could arise as a result of some other perturbation of B-form DNA by A-tracts, such as propeller twist; bending also could be due to a combination of factors. Our goal is to find the structural features of A-tracts responsible for bending of the helix by performing NMR on oligonucleotides containing A-tracts to obtain higher resolution structural data. One of the problems encountered in NMR structure determination of nucleic acids and other macromolecules is the assignment of resonances to nuclei. This procedure can be greatly facilitated through the use of {sup 13}C-enriched nucleic acid samples. We are developing a technique for the enzymatic synthesis of labeled DNA for NMR. The technique we are developing is similar to RNA labeling techniques already in use. The technique involves growth of methylotrophic bacteria on {sup 13}CH{sub 3}OH.

The swimming of a perfect deforming helix

Science.gov (United States)

Koens, Lyndon; Zhang, Hang; Mourran, Ahmed; Lauga, Eric

2017-11-01

Many bacteria rotate helical flagellar filaments in order to swim. When at rest or rotated counter-clockwise these flagella are left handed helices but they undergo polymorphic transformations to right-handed helices when the motor is reversed. These helical deformations themselves can generate motion, with for example Rhodobacter sphaeroides using the polymorphic transformation of the flagellum to generate rotation, or Spiroplasma propagating a change of helix handedness across its body's length to generate forward motion. Recent experiments reported on an artificial helical microswimmer generating motion without a propagating change in handedness. Made of a temperature sensitive gel, these swimmers moved by changing the dimensions of the helix in a non-reciprocal way. Inspired by these results and helix's ubiquitous presence in the bacterial world, we investigate how a deforming helix moves within a viscous fluid. Maintaining a single handedness along its entire length, we discuss how a perfect deforming helix can create a non-reciprocal swimming stroke, identify its principle directions of motion, and calculate the swimming kinematics asymptotically.

Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

Science.gov (United States)

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

2012-01-01

Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

International Nuclear Information System (INIS)

Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

1986-01-01

A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

Science.gov (United States)

Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

2010-08-01

In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

Science.gov (United States)

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

Science.gov (United States)

Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

2015-08-18

The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

Designing cooperatively folded abiotic uni- and multimolecular helix bundles

Science.gov (United States)

de, Soumen; Chi, Bo; Granier, Thierry; Qi, Ting; Maurizot, Victor; Huc, Ivan

2018-01-01

Abiotic foldamers, that is foldamers that have backbones chemically remote from peptidic and nucleotidic skeletons, may give access to shapes and functions different to those of peptides and nucleotides. However, design methodologies towards abiotic tertiary and quaternary structures are yet to be developed. Here we report rationally designed interactional patterns to guide the folding and assembly of abiotic helix bundles. Computational design facilitated the introduction of hydrogen-bonding functionalities at defined locations on the aromatic amide backbones that promote cooperative folding into helix-turn-helix motifs in organic solvents. The hydrogen-bond-directed aggregation of helices not linked by a turn unit produced several thermodynamically and kinetically stable homochiral dimeric and trimeric bundles with structures that are distinct from the designed helix-turn-helix. Relative helix orientation within the bundles may be changed from parallel to tilted on subtle solvent variations. Altogether, these results prefigure the richness and uniqueness of abiotic tertiary structure behaviour.

The N-terminal domain of the repressor of Staphylococcus aureus phage Φ11 possesses an unusual dimerization ability and DNA binding affinity.

Directory of Open Access Journals (Sweden)

Anindya Biswas

Full Text Available Bacteriophage Φ11 uses Staphylococcus aureus as its host and, like lambdoid phages, harbors three homologous operators in between its two divergently oriented repressor genes. None of the repressors of Φ11, however, showed binding to all three operators, even at high concentrations. To understand why the DNA binding mechanism of Φ11 repressors does not match that of lambdoid phage repressors, we studied the N-terminal domain of the Φ11 lysogenic repressor, as it harbors a putative helix-turn-helix motif. Our data revealed that the secondary and tertiary structures of the N-terminal domain were different from those of the full-length repressor. Nonetheless, the N-terminal domain was able to dimerize and bind to the operators similar to the intact repressor. In addition, the operator base specificity, binding stoichiometry, and binding mechanism of this domain were nearly identical to those of the whole repressor. The binding affinities of the repressor and its N-terminal domain were reduced to a similar extent when the temperature was increased to 42°C. Both proteins also adequately dislodged a RNA polymerase from a Φ11 DNA fragment carrying two operators and a promoter. Unlike the intact repressor, the binding of the N-terminal domain to two adjacent operator sites was not cooperative in nature. Taken together, we suggest that the dimerization and DNA binding abilities of the N-terminal domain of the Φ11 repressor are distinct from those of the DNA binding domains of other phage repressors.

Effect of temperature on DNA double helix: An insight from ...

Indian Academy of Sciences (India)

2012-06-25

Jun 25, 2012 ... We have carried out detailed MD simulations of DNA double ..... Wireframe representation of B-DNA crystal structures with PDB identifier (a) 1EHV, ..... nucleic acid structures, PhD thesis, University of Calcutta, Kolkata.

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

Science.gov (United States)

Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

2017-04-26

We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

A look at the effect of sequence complexity on pressure destabilisation of DNA polymers.

Science.gov (United States)

Rayan, Gamal; Macgregor, Robert B

2015-04-01

Our previous studies on the helix-coil transition of double-stranded DNA polymers have demonstrated that molar volume change (ΔV) accompanying the thermally-induced transition can be positive or negative depending on the experimental conditions, that the pressure-induced transition is more cooperative than the heat-induced transition [Rayan and Macgregor, J Phys Chem B2005, 109, 15558-15565], and that the pressure-induced transition does not occur in the absence of water [Rayan and Macgregor, Biophys Chem, 2009, 144, 62-66]. Additionally, we have shown that ΔV values obtained by pressure-dependent techniques differ from those obtained by ambient pressure techniques such as PPC [Rayan et al. J Phys Chem B2009, 113, 1738-1742] thus shedding light on the effects of pressure on DNA polymers. Herein, we examine the effect of sequence complexity, and hence cooperativity on pressure destabilisation of DNA polymers. Working with Clostridium perfringes DNA under conditions such that the estimated ΔV of the helix-coil transition corresponds to -1.78 mL/mol (base pair) at atmospheric pressure, we do not observe the pressure-induced helix-coil transition of this DNA polymer, whereas synthetic copolymers poly[d(A-T)] and poly[d(I-C)] undergo cooperative pressure-induced transitions at similar ΔV values. We hypothesise that the reason for the lack of pressure-induced helix-coil transition of C. perfringens DNA under these experimental conditions lies in its sequence complexity. Copyright © 2015 Elsevier B.V. All rights reserved.

Structural changes of ultraviolet-irradiated DNA derived from hydrodynamic measurements

International Nuclear Information System (INIS)

Triebel, H.; Reinert, K.E.; Baeer, H.; Lang, H.

1979-01-01

The paper reports on sedimentation and viscosity measurements performed on ultraviolet-irradiated DNA from T7 phage and calf thymus. From the hydrodynamic data the relative changes in the mean molecular weight, radius of gyration, and effective Kuhn statistical segment length were calculated. The results show that ultraviolet irradiation (254 nm) leads to a significant decrease of the effective statistical segment length of DNA which may be due to small local helix kinks (produced by the generation of photodimers) and a local increase of chain flexibility. Alterations in the overall DNA conformation may be observed even at low fluence where the mean molecular weight almost stays constant. The locally distorted helix regions possibly may serve as recognition sites in the first step of excision repair. (Auth.)

Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

Science.gov (United States)

Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

2015-09-01

To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

Identification of helix capping and {beta}-turn motifs from NMR chemical shifts

Energy Technology Data Exchange (ETDEWEB)

Shen Yang; Bax, Ad, E-mail: bax@nih.gov [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

2012-03-15

We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and {sup 13}C{sup {beta}} chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of {beta}-turns: I, II, I Prime , II Prime and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and {beta}-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7-0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.

Identification of helix capping and β-turn motifs from NMR chemical shifts

International Nuclear Information System (INIS)

Shen Yang; Bax, Ad

2012-01-01

We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and 13 C β chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of β-turns: I, II, I′, II′ and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and β-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7–0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.

Fragman: an R package for fragment analysis.

Science.gov (United States)

Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

2016-04-21

Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

OpenAIRE

C. Selva Kumar

2011-01-01

Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol＋1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

Science.gov (United States)

Creager, Angela N H; Morgan, Gregory J

2008-06-01

Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

An effective approach for identification of in vivo protein-DNA binding sites from paired-end ChIP-Seq data

Directory of Open Access Journals (Sweden)

Wilson Zoe A

2010-02-01

Full Text Available Abstract Background ChIP-Seq, which combines chromatin immunoprecipitation (ChIP with high-throughput massively parallel sequencing, is increasingly being used for identification of protein-DNA interactions in vivo in the genome. However, to maximize the effectiveness of data analysis of such sequences requires the development of new algorithms that are able to accurately predict DNA-protein binding sites. Results Here, we present SIPeS (Site Identification from Paired-end Sequencing, a novel algorithm for precise identification of binding sites from short reads generated by paired-end solexa ChIP-Seq technology. In this paper we used ChIP-Seq data from the Arabidopsis basic helix-loop-helix transcription factor ABORTED MICROSPORES (AMS, which is expressed within the anther during pollen development, the results show that SIPeS has better resolution for binding site identification compared to two existing ChIP-Seq peak detection algorithms, Cisgenome and MACS. Conclusions When compared to Cisgenome and MACS, SIPeS shows better resolution for binding site discovery. Moreover, SIPeS is designed to calculate the mappable genome length accurately with the fragment length based on the paired-end reads. Dynamic baselines are also employed to effectively discriminate closely adjacent binding sites, for effective binding sites discovery, which is of particular value when working with high-density genomes.

Helix probe areas for the utilization of geothermal power. A practical example; Helix-Sondenfelder zur Nutzung von Erdwaerme. Ein Praxisbeispiel

Energy Technology Data Exchange (ETDEWEB)

Kuebert, Markus; Walker-Hertkorn, Simone [tewag Technologie - Erdwaermeanlagen - Umweltschutz GmbH, Starzach (Germany); Tietz, Jan [REHAU AG und Co., Erlangen-Eltersdorf (Germany); Riepold, Markus; Gloeckl, Andreas [MR Tiefbau GmbH, Brunnen (Germany)

2013-02-01

Thanks to their spiral shape so-called helix probes with a tube length of 40 meter have a height of only three meter: A lot of heat exchange area in a small space. Thus, helix probes are an ideal solution for the utilization of geothermal energy at places at which one cannot drill deeply due to geothermal reasons. Under this aspect, the contribution under consideration reports on the planning of a helix probe area being sustainably adapted to the user requirements for the new construction of a production facility.

Fragmentation of chromatin with 125I radioactive disintegrations

International Nuclear Information System (INIS)

Turner, G.N.; Nobis, P.; Dewey, W.C.

1976-01-01

The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

2016-09-02

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

International Nuclear Information System (INIS)

Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

2016-01-01

Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

Molecular mechanics of DNA bricks: in situ structure, mechanical properties and ionic conductivity

International Nuclear Information System (INIS)

Slone, Scott Michael; Li, Chen-Yu; Aksimentiev, Aleksei; Yoo, Jejoong

2016-01-01

The DNA bricks method exploits self-assembly of short DNA fragments to produce custom three-dimensional objects with subnanometer precision. In contrast to DNA origami, the DNA brick method permits a variety of different structures to be realized using the same library of DNA strands. As a consequence of their design, however, assembled DNA brick structures have fewer interhelical connections in comparison to equivalent DNA origami structures. Although the overall shape of the DNA brick objects has been characterized and found to conform to the features of the target designs, the microscopic properties of DNA brick objects remain yet to be determined. Here, we use the all-atom molecular dynamics method to directly compare the structure, mechanical properties and ionic conductivity of DNA brick and DNA origami structures different only by internal connectivity of their consistituent DNA strands. In comparison to equivalent DNA origami structures, the DNA brick structures are found to be less rigid and less dense and have a larger cross-section area normal to the DNA helix direction. At the microscopic level, the junction in the DNA brick structures are found to be right-handed, similar to the structure of individual Holliday junctions (HJ) in solution, which contrasts with the left-handed structure of HJ in DNA origami. Subject to external electric field, a DNA brick plate is more leaky to ions than an equivalent DNA origami plate because of its lower density and larger cross-section area. Overall, our results indicate that the structures produced by the DNA brick method are fairly similar in their overall appearance to those created by the DNA origami method but are more compliant when subject to external forces, which likely is a consequence of their single crossover design. (paper)

Conflict RNA modification, host-parasite co-evolution, and the origins of DNA and DNA-binding proteins1.

Science.gov (United States)

McLaughlin, Paul J; Keegan, Liam P

2014-08-01

Nearly 150 different enzymatically modified forms of the four canonical residues in RNA have been identified. For instance, enzymes of the ADAR (adenosine deaminase acting on RNA) family convert adenosine residues into inosine in cellular dsRNAs. Recent findings show that DNA endonuclease V enzymes have undergone an evolutionary transition from cleaving 3' to deoxyinosine in DNA and ssDNA to cleaving 3' to inosine in dsRNA and ssRNA in humans. Recent work on dsRNA-binding domains of ADARs and other proteins also shows that a degree of sequence specificity is achieved by direct readout in the minor groove. However, the level of sequence specificity observed is much less than that of DNA major groove-binding helix-turn-helix proteins. We suggest that the evolution of DNA-binding proteins following the RNA to DNA genome transition represents the major advantage that DNA genomes have over RNA genomes. We propose that a hypothetical RNA modification, a RRAR (ribose reductase acting on genomic dsRNA) produced the first stretches of DNA in RNA genomes. We discuss why this is the most satisfactory explanation for the origin of DNA. The evolution of this RNA modification and later steps to DNA genomes are likely to have been driven by cellular genome co-evolution with viruses and intragenomic parasites. RNA modifications continue to be involved in host-virus conflicts; in vertebrates, edited cellular dsRNAs with inosine-uracil base pairs appear to be recognized as self RNA and to suppress activation of innate immune sensors that detect viral dsRNA.

Genotoxicity of Nicotiana tabacum leaves on Helix aspersa.

Science.gov (United States)

da Silva, Fernanda R; Erdtmann, Bernardo; Dalpiaz, Tiago; Nunes, Emilene; Ferraz, Alexandre; Martins, Tales L C; Dias, Johny F; da Rosa, Darlan P; Porawskie, Marilene; Bona, Silvia; da Silva, Juliana

2013-07-01

Tobacco farmers are routinely exposed to complex mixtures of inorganic and organic chemicals present in tobacco leaves. In this study, we examined the genotoxicity of tobacco leaves in the snail Helix aspersa as a measure of the risk to human health. DNA damage was evaluated using the micronucleus test and the Comet assay and the concentration of cytochrome P450 enzymes was estimated. Two groups of snails were studied: one fed on tobacco leaves and one fed on lettuce (Lactuca sativa L) leaves (control group). All of the snails received leaves (tobacco and lettuce leaves were the only food provided) and water ad libitum. Hemolymph cells were collected after 0, 24, 48 and 72 h. The Comet assay and micronucleus test showed that exposure to tobacco leaves for different periods of time caused significant DNA damage. Inhibition of cytochrome P450 enzymes occurred only in the tobacco group. Chemical analysis indicated the presence of the alkaloid nicotine, coumarins, saponins, flavonoids and various metals. These results show that tobacco leaves are genotoxic in H. aspersa and inhibit cytochrome P450 activity, probably through the action of the complex chemical mixture present in the plant.

Genotoxicity of Nicotiana tabacum leaves on Helix aspersa

Directory of Open Access Journals (Sweden)

Fernanda R. da Silva

2013-01-01

Full Text Available Tobacco farmers are routinely exposed to complex mixtures of inorganic and organic chemicals present in tobacco leaves. In this study, we examined the genotoxicity of tobacco leaves in the snail Helix aspersa as a measure of the risk to human health. DNA damage was evaluated using the micronucleus test and the Comet assay and the concentration of cytochrome P450 enzymes was estimated. Two groups of snails were studied: one fed on tobacco leaves and one fed on lettuce (Lactuca sativa L leaves (control group. All of the snails received leaves (tobacco and lettuce leaves were the only food provided and water ad libitum. Hemolymph cells were collected after 0, 24, 48 and 72 h. The Comet assay and micronucleus test showed that exposure to tobacco leaves for different periods of time caused significant DNA damage. Inhibition of cytochrome P450 enzymes occurred only in the tobacco group. Chemical analysis indicated the presence of the alkaloid nicotine, coumarins, saponins, flavonoids and various metals. These results show that tobacco leaves are genotoxic in H. aspersa and inhibit cytochrome P450 activity, probably through the action of the complex chemical mixture present in the plant.

Polymer fragmentation in extensional flow

Energy Technology Data Exchange (ETDEWEB)

Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

2001-06-01

In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

Directory of Open Access Journals (Sweden)

Yuqian Luo

2016-11-01

Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

Antibody recognition of Z-DNA

International Nuclear Information System (INIS)

Lafer, E.M.; Moeller, A.; Valle, R.P.C.; Nordheim, V.A.; Rich, A.; Stollar, B.D.; Massachusetts Inst. of Tech., Cambridge)

1983-01-01

To measure serological reactions under physiological ionic strength, we prepared a brominated (Bl) poly(dG-dC).poly(dG-dC), which forms a stable Z helix in solutions of low salt concentration. Mice and rabbits were immunized with this polymer complexed with the basic protein methylated bovine serum albumin (MBSA), and it was discovered that the Z-DNA helix is a strong immunogen. Various antibody populations were purified from the rabbit serum by quantitative immunoprecipitation. Spleen cells from the mice were used for the preparation of hybridoma cell lines secreting monoclonal antibodies. Anti-Z-DNA antibodies were also raised by immunizing animals with poly(dG-dm 5 C).poly(dG-dm 5 C) under conditions where it was reported to be in the left-handed Z conformation as well as unmodified poly(dG-dC).poly(dG-dC) that was in the right-handed B conformation: both were complexed with MBSA. Z-DNA reactive antibodies were found in both murine and human SLE. A Z-DNA-specific as well as a dDNA and Z-DNA cross-reactive antibody population were distinguished by affinity chromatography of the SLE sera. The specificities of the various anti-Z-DNA antibody populations were measured by direct-binding and competitive radioimmunoassays, using synthetic polymers of defined structure under various ionic strengths. These studies allow us to map the possible antigenic sites for these antibodies, which serve as a model for DNA-protein recognition. The findings also established the usefulness of the antibodies as biochemical probes for Z-DNA. 29 references, 6 figures, 1 table

A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

Energy Technology Data Exchange (ETDEWEB)

Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

1994-09-15

In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

Energy Technology Data Exchange (ETDEWEB)

Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

2012-06-01

Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation

Directory of Open Access Journals (Sweden)

Andrés Miguel-Arribas

2017-11-01

Full Text Available Bacterial conjugation is the process by which a conjugative element (CE is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer (oriT, where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis. We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1LS20 and aux2LS20, and which we show are essential for conjugation. Both Aux1LS20 and Aux2LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1LS20 and Aux2LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriTLS20, although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1LS20 and/or Aux2LS20 are located upstream of almost 400 relaxase genes of the RelLS20 family (MOBL of relaxases. Thus, Aux1LS20 and Aux2LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

The Bacillus subtilis Conjugative Plasmid pLS20 Encodes Two Ribbon-Helix-Helix Type Auxiliary Relaxosome Proteins That Are Essential for Conjugation.

Science.gov (United States)

Miguel-Arribas, Andrés; Hao, Jian-An; Luque-Ortega, Juan R; Ramachandran, Gayetri; Val-Calvo, Jorge; Gago-Córdoba, César; González-Álvarez, Daniel; Abia, David; Alfonso, Carlos; Wu, Ling J; Meijer, Wilfried J J

2017-01-01

Bacterial conjugation is the process by which a conjugative element (CE) is transferred horizontally from a donor to a recipient cell via a connecting pore. One of the first steps in the conjugation process is the formation of a nucleoprotein complex at the origin of transfer ( oriT ), where one of the components of the nucleoprotein complex, the relaxase, introduces a site- and strand specific nick to initiate the transfer of a single DNA strand into the recipient cell. In most cases, the nucleoprotein complex involves, besides the relaxase, one or more additional proteins, named auxiliary proteins, which are encoded by the CE and/or the host. The conjugative plasmid pLS20 replicates in the Gram-positive Firmicute bacterium Bacillus subtilis . We have recently identified the relaxase gene and the oriT of pLS20, which are separated by a region of almost 1 kb. Here we show that this region contains two auxiliary genes that we name aux1 LS20 and aux2 LS20 , and which we show are essential for conjugation. Both Aux1 LS20 and Aux2 LS20 are predicted to contain a Ribbon-Helix-Helix DNA binding motif near their N-terminus. Analyses of the purified proteins show that Aux1 LS20 and Aux2 LS20 form tetramers and hexamers in solution, respectively, and that they both bind preferentially to oriT LS20 , although with different characteristics and specificities. In silico analyses revealed that genes encoding homologs of Aux1 LS20 and/or Aux2 LS20 are located upstream of almost 400 relaxase genes of the Rel LS20 family (MOB L ) of relaxases. Thus, Aux1 LS20 and Aux2 LS20 of pLS20 constitute the founding member of the first two families of auxiliary proteins described for CEs of Gram-positive origin.

DNA topology and transcription

Science.gov (United States)

Kouzine, Fedor; Levens, David; Baranello, Laura

2014-01-01

Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions. PMID:24755522

Interactions between the mixotrophic dinoflagellate Takayama helix and common heterotrophic protists.

Science.gov (United States)

Ok, Jin Hee; Jeong, Hae Jin; Lim, An Suk; Lee, Kyung Ha

2017-09-01

The phototrophic dinoflagellate Takayama helix that is known to be harmful to abalone larvae has recently been revealed to be mixotrophic. Although mixotrophy elevates the growth rate of T. helix by 79%-185%, its absolute growth rate is still as low as 0.3d -1 . Thus, if the mortality rate of T. helix due to predation is high, this dinoflagellate may not easily prevail. To investigate potential effective protistan grazers on T. helix, feeding by diverse heterotrophic dinoflagellates such as engulfment-feeding Oxyrrhis marina, Gyrodinium dominans, Gyrodinium moestrupii, Polykrikos kofoidii, and Noctiluca scintillans, peduncle-feeding Aduncodinium glandula, Gyrodiniellum shiwhaense, Luciella masanensis, and Pfiesteria piscicida, pallium-feeding Oblea rotunda and Protoperidinium pellucidum, and the naked ciliates Pelagostrobilidium sp. (ca. 40μm in cell length) and Strombidinopsis sp. (ca. 150μm in cell length) on T. helix was explored. Among the tested heterotrophic protists, O. marina, G. dominans, G. moestrupii, A. glandula, L. masanensis, P. kofoidii, P. piscicida, and Strombidinopsis sp. were able to feed on T. helix. The growth rates of all these predators except Strombidinopsis sp. with T. helix prey were lower than those without the prey. The growth rate of Strombidinopsis sp. on T. helix was almost zero although the growth rate of Strombidinopsis sp. with T. helix prey was higher than those without the prey. Moreover, T. helix fed on O. marina and P. pellucidum and lysed the cells of P. kofoidii and G. shiwhaense. With increasing the concentrations of T. helix, the growth rates of O. marina and P. kofoidii decreased, but those of G. dominans and L. masanensis largely did not change. Therefore, reciprocal predation, lysis, no feeding, and the low ingestion rates of the common protists preying on T. helix may result in a low mortality rate due to predation, thereby compensating for this species' low growth rate. Copyright © 2017 Elsevier B.V. All rights

Comparative Study on the Adaptation and Growth Dynamics of the Helix pomatia and Helix aspersa Muller Terrestrial Snails Under Different Feeding Regimes

Directory of Open Access Journals (Sweden)

Adrian Toader-Williams

2010-05-01

Full Text Available We used Helix pomatia and Helix aspersa species and measure their growth as the snails were approaching the hibernation season. Helix pomatia 2yo shown a decrease in weight while being raised in enclosed parcels of 4sqm the younger Helix pomatia 1yo as well as Helix aspersa Muller demonstrated the ability to adapt relatively fast to the same conditions. We established 5 experimental lots in a Helix pomatia farm, GPS coordinates N46.606040 E23.599950. Control lot contained Taraxacum officinales, Sonchus oleraceus, Equisetum arvense and Atriplex hortensis, wild flora found within the farm. The other lots contained the same plants as the control lot plus different combinations of imported plants from other areals. The H. pomatia 2yo weight decreased in the control lot by a mean of -3.86% while H. aspersa 1yo marked an increase of +16.89% in the same lot during the same period. The lot containing lupinus polyphyllus delivered snails with weight gain of +24.66% for H. pomatia 2yo and an increase of only +1.98% for H. aspersa 1yo. As a contrast, H. pomatia 2yo gained only +7.72% while H. aspersa 1yo gained +28.89%, in the lot containing Lavanda officinalis, Foeniculum vulgare and Hyssopus officinalis among the other plants.

Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

Directory of Open Access Journals (Sweden)

D. Vaamonde

2014-12-01

Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

DEFF Research Database (Denmark)

Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

2002-01-01

, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

Francis Crick, DNA, and the Central Dogma

Science.gov (United States)

Olby, Robert

1970-01-01

This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

Government and Governance of Regional Triple Helix Interactions

Science.gov (United States)

Danson, Mike; Todeva, Emanuela

2016-01-01

This conceptual paper contributes to the discussion of the role of regional government and regional Triple Helix constellations driving economic development and growth within regional boundaries. The impact of regionalism and subsidiarity on regional Triple Helix constellations, and the questions of governmentality, governance and institutional…

A basic helix-loop-helix transcription factor, PhFBH4, regulates flower senescence by modulating ethylene biosynthesis pathway in petunia

Science.gov (United States)

The basic helix-loop-helix (bHLH) transcription factors (TFs) play important roles in regulating multiple biological processes in plants. However, there are few reports about the function of bHLHs in flower senescence. In this study, a bHLH TF, PhFBH4, was found to be dramatically upregulated during...

Synchronization of DNA array replication kinetics

Science.gov (United States)

Manturov, Alexey O.; Grigoryev, Anton V.

2016-04-01

In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

Double helix vortex breakdown in a turbulent swirling annular jet flow

Science.gov (United States)

Vanierschot, M.; Percin, M.; van Oudheusden, B. W.

2018-03-01

In this paper, we report on the structure and dynamics of double helix vortex breakdown in a turbulent annular swirling jet. Double helix breakdown has been reported previously for the laminar flow regime, but this structure has rarely been observed in turbulent flow. The flow field is investigated experimentally by means of time-resolved tomographic particle image velocimetry. Notwithstanding the axisymmetric nature of the time-averaged flow, analysis of the instantaneous three-dimensional (3D) vortical structures shows the existence of a vortex core along the central axis which breaks up into a double helix downstream. The winding sense of this double helix is opposite to the swirl direction (m =-2 ) and it is wrapped around a central vortex breakdown bubble. This structure is quite different from double helix breakdown found in laminar flows where the helix is formed in the wake of the bubble and not upstream. The double helix precesses around the central axis of the jet with a precessing frequency corresponding to a Strouhal number of 0.27.

An α-Helix-Mimicking 12,13-Helix: Designed α/β/γ-Foldamers as Selective Inhibitors of Protein-Protein Interactions.

Science.gov (United States)

Grison, Claire M; Miles, Jennifer A; Robin, Sylvie; Wilson, Andrew J; Aitken, David J

2016-09-05

A major current challenge in bioorganic chemistry is the identification of effective mimics of protein secondary structures that act as inhibitors of protein-protein interactions (PPIs). In this work, trans-2-aminocyclobutanecarboxylic acid (tACBC) was used as the key β-amino acid component in the design of α/β/γ-peptides to structurally mimic a native α-helix. Suitably functionalized α/β/γ-peptides assume an α-helix-mimicking 12,13-helix conformation in solution, exhibit enhanced proteolytic stability in comparison to the wild-type α-peptide parent sequence from which they are derived, and act as selective inhibitors of the p53/hDM2 interaction. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

IFITM3 requires an amphipathic helix for antiviral activity.

Science.gov (United States)

Chesarino, Nicholas M; Compton, Alex A; McMichael, Temet M; Kenney, Adam D; Zhang, Lizhi; Soewarna, Victoria; Davis, Matthew; Schwartz, Olivier; Yount, Jacob S

2017-10-01

Interferon-induced transmembrane protein 3 (IFITM3) is a cellular factor that blocks virus fusion with cell membranes. IFITM3 has been suggested to alter membrane curvature and fluidity, though its exact mechanism of action is unclear. Using a bioinformatic approach, we predict IFITM3 secondary structures and identify a highly conserved, short amphipathic helix within a hydrophobic region of IFITM3 previously thought to be a transmembrane domain. Consistent with the known ability of amphipathic helices to alter membrane properties, we show that this helix and its amphipathicity are required for the IFITM3-dependent inhibition of influenza virus, Zika virus, vesicular stomatitis virus, Ebola virus, and human immunodeficiency virus infections. The homologous amphipathic helix within IFITM1 is also required for the inhibition of infection, indicating that IFITM proteins possess a conserved mechanism of antiviral action. We further demonstrate that the amphipathic helix of IFITM3 is required to block influenza virus hemagglutinin-mediated membrane fusion. Overall, our results provide evidence that IFITM proteins utilize an amphipathic helix for inhibiting virus fusion. © 2017 The Authors.

An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

Science.gov (United States)

Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

2017-04-15

Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

Effect of Hedera helix on lung histopathology in chronic asthma.

Science.gov (United States)

Hocaoglu, Arzu Babayigit; Karaman, Ozkan; Erge, Duygu Olmez; Erbil, Guven; Yilmaz, Osman; Kivcak, Bijen; Bagriyanik, H Alper; Uzuner, Nevin

2012-12-01

Hedera helix is widely used to treat bronchial asthma for many years. However, effects of this herb on lung histopathology is still far from clear. We aimed to determine the effect of oral administration of Hedera helix on lung histopathology in a murine model of chronic asthma.BALB/c mice were divided into four groups; I (Placebo), II (Hedera helix), III (Dexamethasone) and IV (Control). All mice except controls were sensitized and challenged with ovalbumin. Then, mice in group I received saline, group II 100 mg/kg Hedera helix and group III 1 mg/kg dexamethasone via orogastic gavage once daily for one week. Airway histopathology was evaluated by using light and electron microscopy in all groups.Goblet cell numbers and thicknesses of basement membrane were found significantly lower in group II, but there was no statistically significant difference in terms of number of mast cells, thicknesses of epithelium and subepithelial smooth muscle layers between group I and II. When Hedera helix and dexamethasone groups were compared with each other, thickness of epithelium, subepithelial muscle layers, number of mast cells and goblet cells of group III were significantly ameliorated when compared with the group II. Although Hedera helix administration reduced only goblet cell counts and the thicknesses of basement membrane in the asthmatic airways, dexamethasone ameliorated all histopathologic parameters except thickness of basement membrane better than Hedera helix.

ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

DEFF Research Database (Denmark)

Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

2008-01-01

A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

The effect of polyamines on the photochemical reactivity of DNA

International Nuclear Information System (INIS)

Ben-Hur, E.; Hebrew Univ., Jerusalem

1975-01-01

The effects of diaminopentane (cadaverine), diaminoethane and the polyamine, spermine, on the photoreactions of 4,5', 8-trimethylpsoralen with DNA were studied. Near ultraviolet (UV) light (360 nm) irradiation of psoralen with DNA results in the formation of psoralen monoadducts with pyrimidine bases and DNA interstrand crosslinks. The polyamines studied reduced the rate of both photoreactions to the same extent by a factor of 1.5-2.0. The magnitude of the effect increased with polyamine concentration. Effectiveness was in the order spermine > cadaverine > diaminoethane. This is also the same order for stabilization of the DNA double-helix. Under conditions of higher DNA stability (higher ionic strength), higher polyamine concentrations were required to obtain an effect which was smaller than at low ionic strength. It is concluded that the photoreactions of psoralen with pyrimidines in DNA require some distortion of the double-helix. This distortion is made more difficult in the presence of stabilizing agents like polyamines and therefore the rate of the reaction is reduced. If crosslinking of DNA by psoralen is a two-step reaction then it must be concluded that the second step does not require further distortion. Consistently with the above, polyamines also reduced the UV-induced dimerization of thymine in DNA, although to a lesser extent. (author)

Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

OpenAIRE

Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

2014-01-01

Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

Dimerization of the docking/adaptor protein HEF1 via a carboxy-terminal helix-loop-helix domain.

Science.gov (United States)

Law, S F; Zhang, Y Z; Fashena, S J; Toby, G; Estojak, J; Golemis, E A

1999-10-10

HEF1, p130(Cas), and Efs define a family of multidomain docking proteins which plays a central coordinating role for tyrosine-kinase-based signaling related to cell adhesion. HEF1 function has been specifically implicated in signaling pathways important for cell adhesion and differentiation in lymphoid and epithelial cells. While the SH3 domains and SH2-binding site domains (substrate domains) of HEF1 family proteins are well characterized and binding partners known, to date the highly conserved carboxy-terminal domains of the three proteins have lacked functional definition. In this study, we have determined that the carboxy-terminal domain of HEF1 contains a divergent helix-loop-helix (HLH) motif. This motif mediates HEF1 homodimerization and HEF1 heterodimerization with a recognition specificity similar to that of the transcriptional regulatory HLH proteins Id2, E12, and E47. We had previously demonstrated that the HEF1 carboxy-terminus expressed as a separate domain in yeast reprograms cell division patterns, inducing constitutive pseudohyphal growth. Here we show that pseudohyphal induction by HEF1 requires an intact HLH, further supporting the idea that this motif has an effector activity for HEF1, and implying that HEF1 pseudohyphal activity derives in part from interactions with yeast helix-loop-helix proteins. These combined results provide initial insight into the mode of function of the HEF1 carboxy-terminal domain and suggest that the HEF1 protein may interact with cellular proteins which control differentiation. Copyright 1999 Academic Press.

Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

Science.gov (United States)

Treulen, F; Uribe, P; Boguen, R; Villegas, J V

2016-02-01

Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

Basic Tilted Helix Bundle – A new protein fold in human FKBP25/FKBP3 and HectD1

International Nuclear Information System (INIS)

Helander, Sara; Montecchio, Meri; Lemak, Alexander; Farès, Christophe; Almlöf, Jonas; Li, Yanjun; Yee, Adelinda; Arrowsmith, Cheryl H.; Dhe-Paganon, Sirano; Sunnerhagen, Maria

2014-01-01

Highlights: • We describe the structure of a novel fold in FKBP25 and HectD. • The new fold is named the Basic Tilted Helix Bundle (BTHB) domain. • A conserved basic surface patch is presented, suggesting a functional role. - Abstract: In this paper, we describe the structure of a N-terminal domain motif in nuclear-localized FKBP25 1–73 , a member of the FKBP family, together with the structure of a sequence-related subdomain of the E3 ubiquitin ligase HectD1 that we show belongs to the same fold. This motif adopts a compact 5-helix bundle which we name the Basic Tilted Helix Bundle (BTHB) domain. A positively charged surface patch, structurally centered around the tilted helix H4, is present in both FKBP25 and HectD1 and is conserved in both proteins, suggesting a conserved functional role. We provide detailed comparative analysis of the structures of the two proteins and their sequence similarities, and analysis of the interaction of the proposed FKBP25 binding protein YY1. We suggest that the basic motif in BTHB is involved in the observed DNA binding of FKBP25, and that the function of this domain can be affected by regulatory YY1 binding and/or interactions with adjacent domains

Basic Tilted Helix Bundle – A new protein fold in human FKBP25/FKBP3 and HectD1

Energy Technology Data Exchange (ETDEWEB)

Helander, Sara; Montecchio, Meri [Department of Physics, Chemistry and Biology, Division of Chemistry, Linköping University, SE-58183 Linköping (Sweden); Lemak, Alexander [Princess Margaret Cancer Centre and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M5G 1L7 (Canada); Northeast Structural Genomics Consortium, Toronto, Ontario (Canada); Farès, Christophe [Princess Margaret Cancer Centre and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M5G 1L7 (Canada); Almlöf, Jonas [Department of Physics, Chemistry and Biology, Division of Chemistry, Linköping University, SE-58183 Linköping (Sweden); Li, Yanjun [Structural Genomics Consortium, University of Toronto, 101 College St, Toronto, Ontario M5G 1L7 (Canada); Yee, Adelinda [Princess Margaret Cancer Centre and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M5G 1L7 (Canada); Northeast Structural Genomics Consortium, Toronto, Ontario (Canada); Arrowsmith, Cheryl H. [Princess Margaret Cancer Centre and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M5G 1L7 (Canada); Northeast Structural Genomics Consortium, Toronto, Ontario (Canada); Structural Genomics Consortium, University of Toronto, 101 College St, Toronto, Ontario M5G 1L7 (Canada); Dhe-Paganon, Sirano [Structural Genomics Consortium, University of Toronto, 101 College St, Toronto, Ontario M5G 1L7 (Canada); Sunnerhagen, Maria, E-mail: maria.sunnerhagen@liu.se [Department of Physics, Chemistry and Biology, Division of Chemistry, Linköping University, SE-58183 Linköping (Sweden)

2014-04-25

Highlights: • We describe the structure of a novel fold in FKBP25 and HectD. • The new fold is named the Basic Tilted Helix Bundle (BTHB) domain. • A conserved basic surface patch is presented, suggesting a functional role. - Abstract: In this paper, we describe the structure of a N-terminal domain motif in nuclear-localized FKBP25{sub 1–73}, a member of the FKBP family, together with the structure of a sequence-related subdomain of the E3 ubiquitin ligase HectD1 that we show belongs to the same fold. This motif adopts a compact 5-helix bundle which we name the Basic Tilted Helix Bundle (BTHB) domain. A positively charged surface patch, structurally centered around the tilted helix H4, is present in both FKBP25 and HectD1 and is conserved in both proteins, suggesting a conserved functional role. We provide detailed comparative analysis of the structures of the two proteins and their sequence similarities, and analysis of the interaction of the proposed FKBP25 binding protein YY1. We suggest that the basic motif in BTHB is involved in the observed DNA binding of FKBP25, and that the function of this domain can be affected by regulatory YY1 binding and/or interactions with adjacent domains.

Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

International Nuclear Information System (INIS)

Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

2013-01-01

Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

Science.gov (United States)

Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

2011-07-15

presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

DEFF Research Database (Denmark)

Stronati, A; Manicardi, G C; Cecati, M

2006-01-01

Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

Science.gov (United States)

Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

2008-04-01

The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

Science.gov (United States)

Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

2013-12-31

A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

Structural modeling and DNA binding autoinhibition analysis of Ergp55, a critical transcription factor in prostate cancer.

Directory of Open Access Journals (Sweden)

Shanti P Gangwar

Full Text Available BACKGROUND: The Ergp55 protein belongs to Ets family of transcription factor. The Ets proteins are highly conserved in their DNA binding domain and involved in various development processes and regulation of cancer metabolism. To study the structure and DNA binding autoinhibition mechanism of Ergp55 protein, we have produced full length and smaller polypeptides of Ergp55 protein in E. coli and characterized using various biophysical techniques. RESULTS: The Ergp55 polypeptides contain large amount of α-helix and random coil structures as measured by circular dichorism spectroscopy. The full length Ergp55 forms a flexible and elongated molecule as revealed by molecular modeling, dynamics simulation and structural prediction algorithms. The binding analyses of Ergp55 polypeptides with target DNA sequences of E74 and cfos promoters indicate that longer fragments of Ergp55 (beyond the Ets domain showed the evidence of auto-inhibition. This study also revealed the parts of Ergp55 protein that mediate auto-inhibition. SIGNIFICANCE: The current study will aid in designing the compounds that stabilize the inhibited form of Ergp55 and inhibit its binding to promoter DNA. It will contribute in the development of drugs targeting Ergp55 for the prostate cancer treatment.

How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

Science.gov (United States)

Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

2014-01-01

The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

Mode conversions by a discontinuous junction of two helix loaded waveguides

International Nuclear Information System (INIS)

Choe, J.Y.; Ahn, S.; Ganquly, A.K.; Uhm, H.S.

1983-01-01

For various reasons, it is desirable to vary the primary propagating mode from one section of the waveguide to another. We choose the base structure to be the sheath helix loaded waveguide. Specifically, we join two physically different helix loaded waveguides axisymmetrically, thereby providing the required discontinuities at the junction (Z = 0). The helix loaded waveguide is more advantageous to the simple waveguide in that the helix mode that exists uniquely in the helix waveguide in addition to the usual fast wave hybrid modes, is without cutoff and thus behaves like a transmission line. In order to obtain the mode conversion rates, we expand the waves in the both sides of the junction with its own eigenmodes including the evanescent modes, and by matching fields at the junction (Z = 0) obtain the matrix equation for the coefficients for the eigenmodes in both sides. By choosing the propagating incident wave (Z = 0) the resulting outgoing waves in the other end (Z > 0) will be computed from the matrix equation. A computer program is devised to solve the suitably truncated matrix equation, and the numerical examples for the mode conversion rates with the parameter variations will be presented. The relevant physical parameters to yield discontinuities at the junction are the radii of the outer conductor and the helix wire and the pitch angle of the helix. Special emphases are on the conversion rates from the helix mode (Z 0) for the application to the tapered gyrotron amplifier

Conformational Analysis of DNA Repair Intermediates by Time-Resolved Fluorescence Spectroscopy

OpenAIRE

Lin, Su; Horning, David P.; Szostak, Jack W.; Chaput, John C.

2009-01-01

DNA repair enzymes are essential for maintaining the integrity of the DNA sequence. Unfortunately, very little is known about how these enzymes recognize damaged regions along the helix. Structural analysis of cellular repair enzymes bound to DNA reveals that these enzymes are able to recognize DNA in a variety of conformations. However, the prevalence of these deformations in the absence of enzymes remains unclear, as small populations of DNA conformations are often difficult to detect by NM...

DNA minor groove electrostatic potential: influence of sequence-specific transitions of the torsion angle gamma and deoxyribose conformations.

Science.gov (United States)

Zhitnikova, M Y; Shestopalova, A V

2017-11-01

The structural adjustments of the sugar-phosphate DNA backbone (switching of the γ angle (O5'-C5'-C4'-C3') from canonical to alternative conformations and/or C2'-endo → C3'-endo transition of deoxyribose) lead to the sequence-specific changes in accessible surface area of both polar and non-polar atoms of the grooves and the polar/hydrophobic profile of the latter ones. The distribution of the minor groove electrostatic potential is likely to be changing as a result of such conformational rearrangements in sugar-phosphate DNA backbone. Our analysis of the crystal structures of the short free DNA fragments and calculation of their electrostatic potentials allowed us to determine: (1) the number of classical and alternative γ angle conformations in the free B-DNA; (2) changes in the minor groove electrostatic potential, depending on the conformation of the sugar-phosphate DNA backbone; (3) the effect of the DNA sequence on the minor groove electrostatic potential. We have demonstrated that the structural adjustments of the DNA double helix (the conformations of the sugar-phosphate backbone and the minor groove dimensions) induce changes in the distribution of the minor groove electrostatic potential and are sequence-specific. Therefore, these features of the minor groove sizes and distribution of minor groove electrostatic potential can be used as a signal for recognition of the target DNA sequence by protein in the implementation of the indirect readout mechanism.

Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

DEFF Research Database (Denmark)

Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

1988-01-01

Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

Electronic transport in methylated fragments of DNA

Energy Technology Data Exchange (ETDEWEB)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Electronic transport in methylated fragments of DNA

International Nuclear Information System (INIS)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

2015-01-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

Correlation of bistranded clustered abasic DNA lesion processing with structural and dynamic DNA helix distortion

Science.gov (United States)

Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dehez, François; Georgakilas, Alexandros G.; Monari, Antonio; Dumont, Elise

2016-01-01

Clustered apurinic/apyrimidinic (AP; abasic) DNA lesions produced by ionizing radiation are by far more cytotoxic than isolated AP lesion entities. The structure and dynamics of a series of seven 23-bp oligonucleotides featuring simple bistranded clustered damage sites, comprising of two AP sites, zero, one, three or five bases 3′ or 5′ apart from each other, were investigated through 400 ns explicit solvent molecular dynamics simulations. They provide representative structures of synthetically engineered multiply damage sites-containing oligonucleotides whose repair was investigated experimentally (Nucl. Acids Res. 2004, 32:5609-5620; Nucl. Acids Res. 2002, 30: 2800–2808). The inspection of extrahelical positioning of the AP sites, bulge and non Watson–Crick hydrogen bonding corroborates the experimental measurements of repair efficiencies by bacterial or human AP endonucleases Nfo and APE1, respectively. This study provides unprecedented knowledge into the structure and dynamics of clustered abasic DNA lesions, notably rationalizing the non-symmetry with respect to 3′ to 5′ position. In addition, it provides strong mechanistic insights and basis for future studies on the effects of clustered DNA damage on the recognition and processing of these lesions by bacterial or human DNA repair enzymes specialized in the processing of such lesions. PMID:27587587

Mechanical unfolding reveals stable 3-helix intermediates in talin and α-catenin.

Directory of Open Access Journals (Sweden)

Vasyl V Mykuliak

2018-04-01

Full Text Available Mechanical stability is a key feature in the regulation of structural scaffolding proteins and their functions. Despite the abundance of α-helical structures among the human proteome and their undisputed importance in health and disease, the fundamental principles of their behavior under mechanical load are poorly understood. Talin and α-catenin are two key molecules in focal adhesions and adherens junctions, respectively. In this study, we used a combination of atomistic steered molecular dynamics (SMD simulations, polyprotein engineering, and single-molecule atomic force microscopy (smAFM to investigate unfolding of these proteins. SMD simulations revealed that talin rod α-helix bundles as well as α-catenin α-helix domains unfold through stable 3-helix intermediates. While the 5-helix bundles were found to be mechanically stable, a second stable conformation corresponding to the 3-helix state was revealed. Mechanically weaker 4-helix bundles easily unfolded into a stable 3-helix conformation. The results of smAFM experiments were in agreement with the findings of the computational simulations. The disulfide clamp mutants, designed to protect the stable state, support the 3-helix intermediate model in both experimental and computational setups. As a result, multiple discrete unfolding intermediate states in the talin and α-catenin unfolding pathway were discovered. Better understanding of the mechanical unfolding mechanism of α-helix proteins is a key step towards comprehensive models describing the mechanoregulation of proteins.

Emerging critical roles of Fe-S clusters in DNA replication and repair

Science.gov (United States)

Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

2015-01-01

Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

International Nuclear Information System (INIS)

Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

2011-01-01

Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

Science.gov (United States)

Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

2013-01-01

A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

Hydroxyproline Ring Pucker Causes Frustration of Helix Parameters in the Collagen Triple Helix

Science.gov (United States)

Ying Chow, W.; Bihan, Dominique; Forman, Chris J.; Slatter, David A.; Reid, David G.; Wales, David J.; Farndale, Richard W.; Duer, Melinda J.

2015-07-01

Collagens, the most abundant proteins in mammals, are defined by their triple-helical structures and distinctive Gly-Xaa-Yaa repeating sequence, where Xaa is often proline and Yaa, hydroxyproline (Hyp/O). It is known that hydroxyproline in the Yaa position stabilises the triple helix, and that lack of proline hydroxylation in vivo leads to dysfunctional collagen extracellular matrix assembly, due to a range of factors such as a change in hydration properties. In addition, we note that in model peptides, when Yaa is unmodified proline, the Xaa proline has a strong propensity to adopt an endo ring conformation, whilst when Yaa is hydroxyproline, the Xaa proline adopts a range of endo and exo conformations. Here we use a combination of solid-state NMR spectroscopy and potential energy landscape modelling of synthetic triple-helical collagen peptides to understand this effect. We show that hydroxylation of the Yaa proline causes the Xaa proline ring conformation to become metastable, which in turn confers flexibility on the triple helix.

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

RAPD analysis of alfalfa DNA mutation via N+ implantation

International Nuclear Information System (INIS)

Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

2003-01-01

Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

Science.gov (United States)

Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

2007-05-02

An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

Nature of the Charged-Group Effect on the Stability of the C-Peptide Helix

Science.gov (United States)

Shoemaker, Kevin R.; Kim, Peter S.; Brems, David N.; Marqusee, Susan; York, Eunice J.; Chaiken, Irwin M.; Stewart, John M.; Baldwin, Robert L.

1985-04-01

The residues responsible for the pH-dependent stability of the helix formed by the isolated C-peptide (residues 1-13 of ribonuclease A) have been identified by chemical synthesis of analogues and measurement of their helix-forming properties. Each of the residues ionizing between pH 2 and pH 8 has been replaced separately by an uncharged residue. Protonation of Glu-2- is responsible for the sharp decrease in helix stability between pH 5 and pH 2, and deprotonation of His-12+ causes a similar decrease between pH 5 and pH 8. Glu-9- is not needed for helix stability. The results cannot be explained by the Zimm-Bragg model and host-guest data for α -helix formation, which predict that the stability of the C-peptide helix should increase when Glu-2- is protonated or when His-12+ is deprotonated. Moreover, histidine+ is a strong helix-breaker in host-guest studies. In proteins, acidic and basic residues tend to occur at opposite ends of α -helices: acidic residues occur preferentially near the NH2-terminal end and basic residues near the COOH-terminal end. A possible explanation, based on a helix dipole model, has been given [Blagdon, D. E. & Goodman, M. (1975) Biopolymers 14, 241-245]. Our results are consistent with the helix dipole model and they support the suggestion that the distribution of charged residues in protein helices reflects the helix-stabilizing propensity of those residues. Because Glu-9 is not needed for helix stability, a possible Glu-9-\\cdots His-12+ salt bridge does not contribute significantly to helix stability. The role of a possible Glu-2-\\cdots Arg-10+ salt bridge has not yet been evaluated. A charged-group effect on α -helix stability in water has also been observed in a different peptide system [Ihara, S., Ooi, T. & Takahashi, S. (1982) Biopolymers 21, 131-145]: block copolymers containing (Ala)20 and (Glu)20 show partial helix formation at low temperatures, pH 7.5, where the glutamic acid residues are ionized. (Glu)20(Ala)20Phe forms a

Rapid purification of circular DNA by triplex-mediated affinity capture

Science.gov (United States)

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

Science.gov (United States)

Arora, Shagun; Tandon, Simran

2015-01-01

In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

DNA repair deficiency in neurodegeneration

DEFF Research Database (Denmark)

Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

2011-01-01

Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive...... neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative...... base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby...

Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

Directory of Open Access Journals (Sweden)

A. Yu. Popova

2015-01-01

Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

"Special Issue": Regional Dimensions of the Triple Helix Model

Science.gov (United States)

Todeva, Emanuela; Danson, Mike

2016-01-01

This paper introduces the rationale for the special issue and its contributions, which bridge the literature on regional development and the Triple Helix model. The concept of the Triple Helix at the sub-national, and specifically regional, level is established and examined, with special regard to regional economic development founded on…

Enantiospecific kinking of DNA by a partially intercalating metal complex

KAUST Repository

Reymer, Anna; Nordé n, Bengt

2012-01-01

Opposite enantiomers of [Ru(phenanthroline) 3] 2+ affect the persistence length of DNA differently, a long speculated effect of helix kinking. Our molecular dynamics simulations confirm a substantial change of duplex secondary structure produced

Early models of DNA damage formation

International Nuclear Information System (INIS)

Śmiałek, Małgorzata A

2012-01-01

Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.

Genome instabilities arising from ribonucleotides in DNA.

Science.gov (United States)

Klein, Hannah L

2017-08-01

Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

Application of DNA fingerprints for cell-line individualization.

OpenAIRE

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-01-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

DNA conformational analysis in solution by uranyl mediated photocleavage

DEFF Research Database (Denmark)

Nielsen, Peter E.; Møllegaard, N E; Jeppesen, C

1990-01-01

Uranyl mediated photocleavage of double stranded DNA is proposed as a general probing for DNA helix conformation in terms of minor groove width/electronegative potential. Specifically, it is found that A/T-tracts known to constitute strong distamycin binding sites are preferentially photocleaved ......, uranyl photocleavage of the internal control region (ICR) of the 5S-RNA gene yields a cleavage modulation pattern fully compatible with that obtained by DNase I which also--in a more complex way--senses DNA minor groove width....

Enantiospecific kinking of DNA by a partially intercalating metal complex

KAUST Repository

Reymer, Anna

2012-01-01

Opposite enantiomers of [Ru(phenanthroline) 3] 2+ affect the persistence length of DNA differently, a long speculated effect of helix kinking. Our molecular dynamics simulations confirm a substantial change of duplex secondary structure produced by wedge-intercalation of one but not the other enantiomer. This effect is exploited by several classes of DNA operative proteins. © The Royal Society of Chemistry 2012.

The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

Science.gov (United States)

Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

1998-10-01

The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

Science.gov (United States)

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

Binding of the antitumor drug nogalamycin and its derivatives to DNA: Structural comparison

International Nuclear Information System (INIS)

Gao, Yi-Gui; Liaw, Yen-Chywan; Robinson, H.; Wang, A. H.-J.

1990-01-01

The three-dimensional molecular structures of the complexes between a novel antitumor drug nogalamycin and its derivative U-58872 with a modified DNA hexamer d[m 5 CGT(pS)Am 5 CG] have been determined at 1.7- and 1.8-angstrom resolution, respectively, by X-ray diffraction analyses. Both structures (in space group P6 1 ) have been refined with constrained refinement procedure to final R factors of 0.208 (3386 reflections) and 0.196 (2143 reflections). In both complexes, two nogalamycins bind to the DNA hexamer double helix in a 2:1 ratio with the elongated aglycon chromophore intercalated between the CpG steps at both ends of the helix. The aglycon chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. Most of the sugars remain in the C2'-endo pucker family, except three deoxycytidine residues (terminal C1, C7, and internal C5). All nucleotides are in the anti conformation. Specific hydrogen bonds are found in the complex between the drug and guanine-cytosine bases in both grooves of the helix. One hydroxyl group of the aminoglucose donates a hydrogen bond to the N7 of guanine, while the other receives a hydrogen bond from the N4 amino group of cytosine. The orientation of these two hydrogen bonds suggests that nogalamycin prefers a GC base pair with its aglycon chromophore intercalating at the 5'-side of a guanine (between NpG), or at the 3'-side of a cytosine (between CpN) with the sugars pointing toward the GC base pair. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through, suggesting that nogalamycin prefers GC sequences embedded in a stretch of AT sequences

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

Science.gov (United States)

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki

Directory of Open Access Journals (Sweden)

Silvia W. Lestari

2015-12-01

Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD   Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on

Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

International Nuclear Information System (INIS)

Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

1982-01-01

The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

The carboxy-terminal αN helix of the archaeal XerA tyrosine recombinase is a molecular switch to control site-specific recombination.

Science.gov (United States)

Serre, Marie-Claude; El Arnaout, Toufic; Brooks, Mark A; Durand, Dominique; Lisboa, Johnny; Lazar, Noureddine; Raynal, Bertrand; van Tilbeurgh, Herman; Quevillon-Cheruel, Sophie

2013-01-01

Tyrosine recombinases are conserved in the three kingdoms of life. Here we present the first crystal structure of a full-length archaeal tyrosine recombinase, XerA from Pyrococcus abyssi, at 3.0 Å resolution. In the absence of DNA substrate XerA crystallizes as a dimer where each monomer displays a tertiary structure similar to that of DNA-bound Tyr-recombinases. Active sites are assembled in the absence of dif except for the catalytic Tyr, which is extruded and located equidistant from each active site within the dimer. Using XerA active site mutants we demonstrate that XerA follows the classical cis-cleavage reaction, suggesting rearrangements of the C-terminal domain upon DNA binding. Surprisingly, XerA C-terminal αN helices dock in cis in a groove that, in bacterial tyrosine recombinases, accommodates in trans αN helices of neighbour monomers in the Holliday junction intermediates. Deletion of the XerA C-terminal αN helix does not impair cleavage of suicide substrates but prevents recombination catalysis. We propose that the enzymatic cycle of XerA involves the switch of the αN helix from cis to trans packing, leading to (i) repositioning of the catalytic Tyr in the active site in cis and (ii) dimer stabilisation via αN contacts in trans between monomers.

The carboxy-terminal αN helix of the archaeal XerA tyrosine recombinase is a molecular switch to control site-specific recombination.

Directory of Open Access Journals (Sweden)

Marie-Claude Serre

Full Text Available Tyrosine recombinases are conserved in the three kingdoms of life. Here we present the first crystal structure of a full-length archaeal tyrosine recombinase, XerA from Pyrococcus abyssi, at 3.0 Å resolution. In the absence of DNA substrate XerA crystallizes as a dimer where each monomer displays a tertiary structure similar to that of DNA-bound Tyr-recombinases. Active sites are assembled in the absence of dif except for the catalytic Tyr, which is extruded and located equidistant from each active site within the dimer. Using XerA active site mutants we demonstrate that XerA follows the classical cis-cleavage reaction, suggesting rearrangements of the C-terminal domain upon DNA binding. Surprisingly, XerA C-terminal αN helices dock in cis in a groove that, in bacterial tyrosine recombinases, accommodates in trans αN helices of neighbour monomers in the Holliday junction intermediates. Deletion of the XerA C-terminal αN helix does not impair cleavage of suicide substrates but prevents recombination catalysis. We propose that the enzymatic cycle of XerA involves the switch of the αN helix from cis to trans packing, leading to (i repositioning of the catalytic Tyr in the active site in cis and (ii dimer stabilisation via αN contacts in trans between monomers.

Extraction of ultrashort DNA molecules from herbarium specimens.

Science.gov (United States)

Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

2017-02-01

DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

Identification of basic/helix-loop-helix transcription factors reveals candidate genes involved in anthocyanin biosynthesis from the strawberry white-flesh mutant

OpenAIRE

Zhao, Fengli; Li, Gang; Hu, Panpan; Zhao, Xia; Li, Liangjie; Wei, Wei; Feng, Jiayue; Zhou, Houcheng

2018-01-01

As the second largest transcription factor family in plant, the basic helix-loop-helix (bHLH) transcription factor family, characterized by the conserved bHLH domain, plays a central regulatory role in many biological process. However, the bHLH transcription factor family of strawberry has not been systematically identified, especially for the anthocyanin biosynthesis. Here, we identified a total of 113 bHLH transcription factors and described their chromosomal distribution and bioinformatics...

The third helix of the murine Hoxc8 homeodomain facilitates protein transduction in mammalian cells

International Nuclear Information System (INIS)

Kong, Kyoung-Ah; Gadi, Jogeswar; Park, Hyoung Woo; Bok, Jinwoong; Kim, Myoung Hee

2008-01-01

Previously, we have demonstrated that purified Hoxc8 homeoprotein has the ability to penetrate the cellular membrane and can be transduced efficiently into COS-7 cells. Moreover, the Hoxc8 protein is able to form a complex with DNA molecules in vitro and helps the DNA be delivered intracellularly, serving as a gene delivery vehicle. Here, we further analyzed the membrane transduction activity of Hoxc8 protein and provide the evidence that the 16 amino acid (a.a.191-206, 2.23 kDa) third helix of murine Hoxc8 protein is an efficient protein transduction domain (PTD). When the 16 amino acid peptide was fused at the carboxyl terminal of enhanced green fluorescence protein (EGFP), the fusion proteins were transduced efficiently into the primary pig fetal fibroblast cells. The transduction efficiency increased in a concentration-dependent manner up to 1 μM, and appeared to plateau above a concentration of 1 μM. When tandem multimers of PTD, EGFP-PTD(2), EGFP-PTD(3), EGFP-PTD(4), and EGFP-PTD(5), were analyzed at 500 nM of concentration, the penetrating efficiency increased in a dose-dependent manner. As the number of PTDs increased, the EGFP signal also increased, although the signal maintained plateau after EGFP-PTD(3). These results indicate that the 16 amino acid third helix is the key element responsible for the membrane transduction activity of Hoxc8 proteins, and further suggest that the small peptide could serve as a therapeutic delivery vehicle for large cargo proteins

TOWARDS UNDERSTANDING OF HELIX B BASED CONFORMATIONAL DISEASES IN SERPIN

Directory of Open Access Journals (Sweden)

Mohamad Aman Jairajpuri

2012-12-01

Full Text Available Serine protease inhibitors (serpins are a unique family of protease inhibitors that are prone to polymer formation due to their metastable nature and a complex inhibition mechanism that involves large scale conformational change. Helix B is in the shutter region near the strand 2A and strand 3A of �-sheet A, where reactive centre loop inserts during the serpin inhibition mechanism. Helix B region in serpins is a mutation hotspot for naturally occurring variants that result in pathological conditions due to polymerization. Helix B residues are completely buried in the native state and loop inserted latent state but not in the inhibitory loop inserted cleaved conformation. Native to cleaved transition during inhibition forms a large cavity in the shutter region, which invariably is the largest cavity in most serpins in native state. In a recent paper we had for the first time hypothesized that exposure of helix B at the N-terminal end is important for smooth insertion of the reactive center loop during serpin inhibition mechanism. It is therefore possible that natural variant that induces conformational deformation of helix B probably alter the cavity size which increases the rate of loop-sheet interaction between the monomers resulting in increased polymerization.

DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

Directory of Open Access Journals (Sweden)

José Gregorio Martínez

Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

Science.gov (United States)

Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

2007-08-01

The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

Science.gov (United States)

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Visualization of DNA in highly processed botanical materials.

Science.gov (United States)

Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

2018-04-15

DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

Science.gov (United States)

Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

2016-12-01

The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

Nucleic acid helix structure determination from NMR proton chemical shifts

Energy Technology Data Exchange (ETDEWEB)

Werf, Ramon M. van der; Tessari, Marco; Wijmenga, Sybren S., E-mail: S.Wijmenga@science.ru.nl [Radboud University Nijmegen, Department of Biophysical Chemistry, Institute of Molecules and Materials (Netherlands)

2013-06-15

We present a method for de novo derivation of the three-dimensional helix structure of nucleic acids using non-exchangeable proton chemical shifts as sole source of experimental restraints. The method is called chemical shift de novo structure derivation protocol employing singular value decomposition (CHEOPS) and uses iterative singular value decomposition to optimize the structure in helix parameter space. The correct performance of CHEOPS and its range of application are established via an extensive set of structure derivations using either simulated or experimental chemical shifts as input. The simulated input data are used to assess in a defined manner the effect of errors or limitations in the input data on the derived structures. We find that the RNA helix parameters can be determined with high accuracy. We finally demonstrate via three deposited RNA structures that experimental proton chemical shifts suffice to derive RNA helix structures with high precision and accuracy. CHEOPS provides, subject to further development, new directions for high-resolution NMR structure determination of nucleic acids.

The helical structure of DNA facilitates binding

International Nuclear Information System (INIS)

Berg, Otto G; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

2016-01-01

The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction–diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general. (paper)

Triple helical DNA in a duplex context and base pair opening

Science.gov (United States)

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Bone fragments a body can make

Energy Technology Data Exchange (ETDEWEB)

Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

1991-05-01

Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

International Nuclear Information System (INIS)

Hentosh, P.; Henner, W.D.; Reynolds, R.J.

1985-01-01

DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

Genome-wide identification of basic helix-loop-helix and NF-1 motifs underlying GR binding sites in male rat hippocampus

DEFF Research Database (Denmark)

Pooley, John R.; Flynn, Ben P.; Grøntved, Lars

2017-01-01

linked to structural and organizational roles, an absence of major tethering partners for GRs, and little or no evidence for binding at negative glucocorticoid response elements. A basic helix-loop-helix motif closely resembling a NeuroD1 or Olig2 binding site was found underlying a subset of GR binding......Glucocorticoids regulate hippocampal function in part by modulating gene expression through the glucocorticoid receptor (GR). GR binding is highly cell type specific, directed to accessible chromatin regions established during tissue differentiation. Distinct classes of GR binding sites...

NMR studies of abasic sites in DNA duplexes: deoxyadenosine stacks into the helix opposite the cyclic analog of 2-deoxyribose

International Nuclear Information System (INIS)

Kalnik, M.W.; Chang, C.N.; Grollman, A.P.; Patel, D.J.

1988-01-01

Proton and phosphorus NMR studies are reported for the complementary d(C-A-T-G-A-G-T-A-C) x d(G-T-A-C-F-C-A-T-G) nonanucleotide duplex (designated AP/sub F/ 9-mer duplex) which contains a stable abasic site analog, F, in the center of the helix. This oligodeoxynucleotide contains a modified tetrahydrofuran moiety, isosteric with 2-deoxyribofuranose, which serves as a structural analog of a natural apurinic/apyrimidinic site. Exchangeable and nonexchangeable base and sugar protons, including those located at the abasic site, have been assigned in the complementary AP/sub F/ 9-mer duplex by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H 2 O and D 2 O solution at low temperature (0 0 C). These studies indicate that A5 inserts into the helix opposite the abasic site F14 and stacks with flanking G4 x C15 and G6 x C13 Watson-Crick base pairs. Base-sugar proton NOE connectivities were measured through G4-A5-G6 on the unmodified strand and between the base protons of C15 and the sugar protons of the 5'-flanking residue F14 on the modified strand. These studies establish that all glycosidic torsion angles are anti and that the helix is right-handed at and adjacent to the abasic site in the AP/sub F/ 9-mer duplex. Two of the 16 phosphodiester groups exhibit phosphorus resonances outside the normal spectral dispersion indicative of altered torsion angles at two of the phosphate groups in the backbone of the AP/sub F/ 9-mer duplex

Modeling photoionization of aqueous DNA and its components.

Science.gov (United States)

Pluhařová, Eva; Slavíček, Petr; Jungwirth, Pavel

2015-05-19

Radiation damage to DNA is usually considered in terms of UVA and UVB radiation. These ultraviolet rays, which are part of the solar spectrum, can indeed cause chemical lesions in DNA, triggered by photoexcitation particularly in the UVB range. Damage can, however, be also caused by higher energy radiation, which can ionize directly the DNA or its immediate surroundings, leading to indirect damage. Thanks to absorption in the atmosphere, the intensity of such ionizing radiation is negligible in the solar spectrum at the surface of Earth. Nevertheless, such an ionizing scenario can become dangerously plausible for astronauts or flight personnel, as well as for persons present at nuclear power plant accidents. On the beneficial side, ionizing radiation is employed as means for destroying the DNA of cancer cells during radiation therapy. Quantitative information about ionization of DNA and its components is important not only for DNA radiation damage, but also for understanding redox properties of DNA in redox sensing or labeling, as well as charge migration along the double helix in nanoelectronics applications. Until recently, the vast majority of experimental and computational data on DNA ionization was pertinent to its components in the gas phase, which is far from its native aqueous environment. The situation has, however, changed for the better due to the advent of photoelectron spectroscopy in liquid microjets and its most recent application to photoionization of aqueous nucleosides, nucleotides, and larger DNA fragments. Here, we present a consistent and efficient computational methodology, which allows to accurately evaluate ionization energies and model photoelectron spectra of aqueous DNA and its individual components. After careful benchmarking, the method based on density functional theory and its time-dependent variant with properly chosen hybrid functionals and polarizable continuum solvent model provides ionization energies with accuracy of 0.2-0.3 e

Regional Dimensions of the Triple Helix Model: Setting the Context

Science.gov (United States)

Todeva, Emanuela; Danson, Mike

2016-01-01

This paper introduces the rationale for the special issue and its contributions, which bridge the literature on regional development and the Triple Helix model. The concept of the Triple Helix at the sub-national, and specifically regional, level is established and examined, with special regard to regional economic development founded on…

A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

Directory of Open Access Journals (Sweden)

Erwan Quéméré

Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

NARCIS (Netherlands)

Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

1991-01-01

Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

International Nuclear Information System (INIS)

Ermolaeva, N.V.; Vodolazskaya, N.A.

1978-01-01

It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

Science.gov (United States)

Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

2009-01-01

The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

FMRFamide receptors of Helix aspersa

International Nuclear Information System (INIS)

Payza, K.

1988-01-01

A receptor binding assay and an isolated heart bioassay were used to identify and characterize the FMRFamide receptors in Helix. In the heart bioassay, FMRFamide increased myocardial contraction force. A potent FMRFamide analog, desaminoTyr-Phe-norLeu-arg-Phe-amide (daYFnLRFamide), was used as a radioiodinated receptor ligand. The high affinity binding of 125 I-daYFnLRFamide at 0 degree C to Helix brain membranes was reversible, saturable, pH-dependent and specific, with a K D of 13-14 nM. A lower affinity (245 nM) site was also observed. Radioligand binding sites were also identified in the heart, male reproductive organs and digestive organs. The structure-activity relations (SAR) of cardiostimulation correlated with the specificity of 125 I-daYFnLRFamide binding to brain and heart receptors. The SAR were similar to those of other molluscan FMRFamide bioassays, except that they showed a marked preference for some analogs with blocked amino-terminals

Elevated temperature triggers human respiratory syncytial virus F protein six-helix bundle formation

International Nuclear Information System (INIS)

Yunus, Abdul S.; Jackson, Trent P.; Crisafi, Katherine; Burimski, Irina; Kilgore, Nicole R.; Zoumplis, Dorian; Allaway, Graham P.; Wild, Carl T.; Salzwedel, Karl

2010-01-01

Human respiratory syncytial virus (RSV) is a major cause of severe lower respiratory tract infection in infants, immunocompromised patients, and the elderly. The RSV fusion (F) protein mediates fusion of the viral envelope with the target cell membrane during virus entry and is a primary target for antiviral drug and vaccine development. The F protein contains two heptad repeat regions, HR1 and HR2. Peptides corresponding to these regions form a six-helix bundle structure that is thought to play a critical role in membrane fusion. However, characterization of six-helix bundle formation in native RSV F protein has been hindered by the fact that a trigger for F protein conformational change has yet to be identified. Here we demonstrate that RSV F protein on the surface of infected cells undergoes a conformational change following exposure to elevated temperature, resulting in the formation of the six-helix bundle structure. We first generated and characterized six-helix bundle-specific antibodies raised against recombinant peptides modeling the RSV F protein six-helix bundle structure. We then used these antibodies as probes to monitor RSV F protein six-helix bundle formation in response to a diverse array of potential triggers of conformational changes. We found that exposure of 'membrane-anchored' RSV F protein to elevated temperature (45-55 deg. C) was sufficient to trigger six-helix bundle formation. Antibody binding to the six-helix bundle conformation was detected by both flow cytometry and cell-surface immunoprecipitation of the RSV F protein. None of the other treatments, including interaction with a number of potential receptors, resulted in significant binding by six-helix bundle-specific antibodies. We conclude that native, untriggered RSV F protein exists in a metastable state that can be converted in vitro to the more stable, fusogenic six-helix bundle conformation by an increase in thermal energy. These findings help to better define the mechanism of

ATP-dependent partitioning of the DNA template into supercoiled domains by Escherichia coli UvrAB

International Nuclear Information System (INIS)

Koo, Hyeon-Sook; Liu, L.F.; Claassen, L.; Grossman, L.

1991-01-01

The helicase action of the Escherichia coli UvrAB complex on a covalently closed circular DNA template was monitored using bacterial DNA topoisomerase I, which specifically removes negative supercoils. In the presence of E. coli DNA topoisomerase I and ATP, the UvrAB complex gradually introduced positive supercoils into the input relaxed plasmid DNA template. Positive supercoils were not produced when E. coli DNA topoisomerase I was replaced by eukaryotic DNA topoisomerase I or when both E. coli and eukaryotic DNA topoisomerases I were added simultaneously. These results suggest that like other DNA helix-tracking processes, the ATP-dependent action of the UvrAM complex on duplex DNA simultaneously generates both positive and negative supercoils, which are not constrained by protein binding but are torsionally strained. The supercoiling activity of UvrAB on UV-damaged DNA was also studied using UV-damaged plasmid DNA and a mutant UvrA protein that lacks the 40 C-terminal amino acids and is defective in preferential binding to UV-damaged DNA. UvrAB was found to preferentially supercoil the UV-damaged DNA template, whereas the mutant protein supercoiled UV-damaged and undamaged DNA with equal efficiency. The authors results therefore suggest that the DNA helix-tracking activity of UvrAB may be involved in searching and/or prepriming the damaged DNA for UvrC incision. A possible role of supercoiled domains in the incision process is discussed

Crosslinked Aspartic Acids as Helix-Nucleating Templates.

Science.gov (United States)

Zhao, Hui; Liu, Qi-Song; Geng, Hao; Tian, Yuan; Cheng, Min; Jiang, Yan-Hong; Xie, Ming-Sheng; Niu, Xiao-Gang; Jiang, Fan; Zhang, Ya-Ou; Lao, Yuan-Zhi; Wu, Yun-Dong; Xu, Nai-Han; Li, Zi-Gang

2016-09-19

Described is a facile helix-nucleating template based on a tethered aspartic acid at the N-terminus [terminal aspartic acid (TD)]. The nucleating effect of the template is subtly influenced by the substituent at the end of the side-chain-end tether as indicated by circular dichroism, nuclear magnetic resonance, and molecular dynamics simulations. Unlike most nucleating strategies, the N-terminal amine is preserved, thus enabling further modification. Peptidomimetic estrogen receptor modulators (PERMs) constructed using this strategy show improved therapeutic properties. The current strategy can be regarded as a good complement to existing helix-stabilizing methods. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA based radiological dosimetry technology

International Nuclear Information System (INIS)

Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

2008-01-01

Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

On the helix equation

Directory of Open Access Journals (Sweden)

Taouil Hajer

2012-08-01

Full Text Available This paper is devoted to the helices processes, i.e. the solutions H : ℝ × Ω → ℝd, (t, ω ↦ H(t, ω of the helix equation egin{eqnarray} H(0,o=0; quad H(s+t,o= H(s,Phi(t,o +H(t,oonumber end{eqnarray} H ( 0 ,ω = 0 ;   H ( s + t,ω = H ( s, Φ ( t,ω + H ( t,ω where Φ : ℝ × Ω → Ω, (t, ω ↦ Φ(t, ω is a dynamical system on a measurable space (Ω, ℱ. More precisely, we investigate dominated solutions and non differentiable solutions of the helix equation. For the last case, the Wiener helix plays a fundamental role. Moreover, some relations with the cocycle equation defined by Φ, are investigated. Ce papier est consacré aux hélices, c’est-à-dire les solutions H : ℝ × Ω → ℝd, (t, ω ↦ H(t, ω de l’équation fonctionnelle egin{eqnarray} H(0,o=0; quad H(s+t,o= H(s,Phi(t,o +H(t,o onumber end{eqnarray} H ( 0 ,ω = 0 ;   H ( s + t,ω = H ( s, Φ ( t,ω + H ( t,ω où Φ : ℝ × Ω → Ω, (t, ω ↦ Φ(t, ω est un système dynamique défini sur un espace mesurable (Ω, ℱ. Plus présisément, nous déterminons d’abord les hélices dominées puis nous caractérisons les hélices non différentiables. Dans ce dernier cas, l’hélice de Wiener joue un rôle important. Nous précisons aussi quelques relations des hélices avec les cocycles définis par Φ.

Genome-wide identification and analysis of the chicken basic helix-loop-helix factors.

Science.gov (United States)

Liu, Wu-Yi; Zhao, Chun-Jiang

2010-01-01

Members of the basic helix-loop-helix (bHLH) family of transcription factors play important roles in a wide range of developmental processes. In this study, we conducted a genome-wide survey using the chicken (Gallus gallus) genomic database, and identified 104 bHLH sequences belonging to 42 gene families in an effort to characterize the chicken bHLH transcription factor family. Phylogenetic analyses revealed that chicken has 50, 21, 15, 4, 8, and 3 bHLH members in groups A, B, C, D, E, and F, respectively, while three members belonging to none of these groups were classified as ''orphans". A comparison between chicken and human bHLH repertoires suggested that both organisms have a number of lineage-specific bHLH members in the proteomes. Chromosome distribution patterns and phylogenetic analyses strongly suggest that the bHLH members should have arisen through gene duplication at an early date. Gene Ontology (GO) enrichment statistics showed 51 top GO annotations of biological processes counted in the frequency. The present study deepens our understanding of the chicken bHLH transcription factor family and provides much useful information for further studies using chicken as a model system.

DNA polymerase beta participates in mitochondrial DNA repair

DEFF Research Database (Denmark)

Sykora, P; Kanno, S; Akbari, M

2017-01-01

We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

A genome-wide survey on basic helix-loop-helix transcription factors in giant panda.

Directory of Open Access Journals (Sweden)

Chunwang Dang

Full Text Available The giant panda (Ailuropoda melanoleuca is a critically endangered mammalian species. Studies on functions of regulatory proteins involved in developmental processes would facilitate understanding of specific behavior in giant panda. The basic helix-loop-helix (bHLH proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including fruit fly, zebrafish, mouse and human. Our present study identified 107 bHLH family members being encoded in giant panda genome. Phylogenetic analyses revealed that they belong to 44 bHLH families with 46, 25, 15, 4, 11 and 3 members in group A, B, C, D, E and F, respectively, while the remaining 3 members were assigned into "orphan". Compared to mouse, the giant panda does not encode seven bHLH proteins namely Beta3a, Mesp2, Sclerax, S-Myc, Hes5 (or Hes6, EBF4 and Orphan 1. These results provide useful background information for future studies on structure and function of bHLH proteins in the regulation of giant panda development.

Telomere Restriction Fragment (TRF) Analysis.

Science.gov (United States)

Mender, Ilgen; Shay, Jerry W

2015-11-20

While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

Structure of the Cpf1 endonuclease R-loop complex after target DNA cleavage

DEFF Research Database (Denmark)

Stella, Stefano; Alcón, Pablo; Montoya, Guillermo

2017-01-01

involved in DNA unwinding to form a CRISPR RNA (crRNA)-DNA hybrid and a displaced DNA strand. The protospacer adjacent motif (PAM) is recognized by the PAM-interacting domain. The loop-lysine helix-loop motif in this domain contains three conserved lysine residues that are inserted in a dentate manner...... and the crRNA-DNA hybrid, avoiding DNA re-annealing. Mutations in key residues reveal a mechanism linking the PAM and DNA nuclease sites. Analysis of the Cpf1 structures proposes a singular working model of RNA-guided DNA cleavage, suggesting new avenues for redesign of Cpf1....

On the identification techniques for ionizing radiation structure breaks in the DNA molecule

International Nuclear Information System (INIS)

Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

2012-01-01

In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

DNA Mapping Made Simple: An Intellectual Activity about the Genetic Modification of Organisms

Science.gov (United States)

Marques, Miguel; Arrabaca, Joao; Chagas, Isabel

2004-01-01

Since the discovery of the DNA double helix (in 1953 by Watson and Crick), technologies have been developed that allow scientists to manipulate the genome of bacteria to produce human hormones, as well as the genome of crop plants to achieve high yield and enhanced flavor. The universality of the genetic code has allowed DNA isolated from a…

Organizing product innovation: hierarchy, market or triple-helix networks?

Science.gov (United States)

Fitjar, Rune Dahl; Gjelsvik, Martin; Rodríguez-Pose, Andrés

This paper assesses the extent to which the organization of the innovation effort in firms, as well as the geographical scale at which this effort is pursued, affects the capacity to benefit from product innovations. Three alternative modes of organization are studied: hierarchy, market and triple-helix-type networks. Furthermore, we consider triple-helix networks at three geographical scales: local, national and international. These relationships are tested on a random sample of 763 firms located in five urban regions of Norway which reported having introduced new products or services during the preceding 3 years. The analysis shows that firms exploiting internal hierarchy or triple-helix networks with a wide range of partners managed to derive a significantly higher share of their income from new products, compared to those that mainly relied on outsourcing within the market. In addition, the analysis shows that the geographical scale of cooperation in networks, as well as the type of partner used, matters for the capacity of firms to benefit from product innovation. In particular, firms that collaborate in international triple-helix-type networks involving suppliers, customers and R&D institutions extract a higher share of their income from product innovations, regardless of whether they organize the processes internally or through the network.

[Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

Science.gov (United States)

Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

2015-08-01

To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

Crystal structure of the C-terminal domain of the RAP74 subunit of human transcription factor IIF

Energy Technology Data Exchange (ETDEWEB)

Kamada, Katsuhiko; De Angelis, Jacqueline; Roeder, Robert G.; Burley, Stephen K. (Rockefeller)

2012-12-13

The x-ray structure of a C-terminal fragment of the RAP74 subunit of human transcription factor (TF) IIF has been determined at 1.02-{angstrom} resolution. The {alpha}/{beta} structure is strikingly similar to the globular domain of linker histone H5 and the DNA-binding domain of hepatocyte nuclear factor 3{gamma} (HNF-3{gamma}), making it a winged-helix protein. The surface electrostatic properties of this compact domain differ significantly from those of bona fide winged-helix transcription factors (HNF-3{gamma} and RFX1) and from the winged-helix domains found within the RAP30 subunit of TFIIF and the {beta} subunit of TFIIE. RAP74 has been shown to interact with the TFIIF-associated C-terminal domain phosphatase FCP1, and a putative phosphatase binding site has been identified within the RAP74 winged-helix domain.

Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

Directory of Open Access Journals (Sweden)

Nguyen-Hieu Tung

2012-09-01

Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

Sequence analysis of mitochondrial DNA hypervariable region III of ...

African Journals Online (AJOL)

The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

Science.gov (United States)

Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

2018-03-12

Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

KAUST Repository

Sun, Lu

2014-10-16

© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film

Twist-stretch profiles of DNA chains

Science.gov (United States)

Zoli, Marco

2017-06-01

Helical molecules change their twist number under the effect of a mechanical load. We study the twist-stretch relation for a set of short DNA molecules modeled by a mesoscopic Hamiltonian. Finite temperature path integral techniques are applied to generate a large ensemble of possible configurations for the base pairs of the sequence. The model also accounts for the bending and twisting fluctuations between adjacent base pairs along the molecules stack. Simulating a broad range of twisting conformation, we compute the helix structural parameters by averaging over the ensemble of base pairs configurations. The method selects, for any applied force, the average twist angle which minimizes the molecule’s free energy. It is found that the chains generally over-twist under an applied stretching and the over-twisting is physically associated to the contraction of the average helix diameter, i.e. to the damping of the base pair fluctuations. Instead, assuming that the maximum amplitude of the bending fluctuations may decrease against the external load, the DNA molecule first over-twists for weak applied forces and then untwists above a characteristic force value. Our results are discussed in relation to available experimental information albeit for kilo-base long molecules.

Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

Science.gov (United States)

Wood, S; Starr, T V; Shukin, R J

1986-01-01

We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

Mycobacterium smegmatis PafBC is involved in regulation of DNA damage response.

Science.gov (United States)

Fudrini Olivencia, Begonia; Müller, Andreas U; Roschitzki, Bernd; Burger, Sibylle; Weber-Ban, Eilika; Imkamp, Frank

2017-10-25

Two genes, pafB and pafC, are organized in an operon with the Pup-ligase gene pafA, which is part of the Pup-proteasome system (PPS) present in mycobacteria and other actinobacteria. The PPS is crucial for Mycobacterium tuberculosis resistance towards reactive nitrogen intermediates (RNI). However, pafB and pafC apparently play only a minor role in RNI resistance. To characterize their function, we generated a pafBC deletion in Mycobacterium smegmatis (Msm). Proteome analysis of the mutant strain revealed decreased cellular levels of various proteins involved in DNA damage repair, including recombinase A (RecA). In agreement with this finding, Msm ΔpafBC displayed increased sensitivity to DNA damaging agents. In mycobacteria two pathways regulate DNA repair genes: the LexA/RecA-dependent SOS response and a predominant pathway that controls gene expression via a LexA/RecA-independent promoter, termed P1. PafB and PafC feature winged helix-turn-helix DNA binding motifs and we demonstrate that together they form a stable heterodimer in vitro, implying a function as a heterodimeric transcriptional regulator. Indeed, P1-driven transcription of recA was decreased in Msm ΔpafBC under standard conditions and induction of recA expression upon DNA damage was strongly impaired. Taken together, our data indicate an important regulatory function of PafBC in the mycobacterial DNA damage response.

Homology of yeast photoreactivating gene fragment with human genomic digests

International Nuclear Information System (INIS)

Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

1984-01-01

Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

Double helix vortex breakdown in a turbulent swirling annular jet flow

NARCIS (Netherlands)

Vanierschot, M.; Perçin, M.; van Oudheusden, B.W.

2018-01-01

In this paper, we report on the structure and dynamics of double helix vortex breakdown in a turbulent annular swirling jet. Double helix breakdown has been reported previously for the laminar flow regime, but this structure has rarely been observed in turbulent flow. The flow field is

Un-repairable DNA damage in cell due to irradiation

International Nuclear Information System (INIS)

Yoshii, Giichi

1992-01-01

Radiation-induced cell reproductive deactivation is caused by damage to DNA. In a cell, cellular DNA radical reacts with diffusion controlled rate and generates DNA peroxide radical. The chemical repair of DNA radical with hydrogen donation by thiol competes with the reaction of oxygen with same radicals in the DNA molecules. From the point reaction rates, the prolongation of radical life time is not as great as expected from the reduction in the glutathione content of the cell. This indicates that further reducting compounds (protein bound thiol) are present in the cell. The residual radicals are altered to strand breaks, base damages and so on. The effective lesions for a number of endpoints is un-repaired double strand break, which has been discovered in a cluster. This event gives risk to high LET radiation or to a track end of X-rays. For X- or electron irradiations the strand breaks are frequently induced by the interactions between sublesions on two strands in DNA. A single strand break followed by radical action may be unstable excited state, because of remaining sugar radical action and of having negative charged phosphates, in which strands breaks will be rejoined in a short time to stable state. On the same time, a break in the double helix will be immediately produced if two breaks are on either or approximately opposite locations. The formation of a double strand break in the helix depends on the ion strength of the cell. The potassium ions are largely released from polyanionic strand during irradiation, which results in the induction of denatured region. Double strand break with the denatured region seems to be un-repairable DNA damage. (author)

Effects of Replication and Transcription on DNA Structure-Related Genetic Instability.

Science.gov (United States)

Wang, Guliang; Vasquez, Karen M

2017-01-05

Many repetitive sequences in the human genome can adopt conformations that differ from the canonical B-DNA double helix (i.e., non-B DNA), and can impact important biological processes such as DNA replication, transcription, recombination, telomere maintenance, viral integration, transposome activation, DNA damage and repair. Thus, non-B DNA-forming sequences have been implicated in genetic instability and disease development. In this article, we discuss the interactions of non-B DNA with the replication and/or transcription machinery, particularly in disease states (e.g., tumors) that can lead to an abnormal cellular environment, and how such interactions may alter DNA replication and transcription, leading to potential conflicts at non-B DNA regions, and eventually result in genetic stability and human disease.

The birth and development of the DNA theory of inheritance: sixty years since the discovery of the structure of DNA.

Science.gov (United States)

Portin, Petter

2014-04-01

The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.

Unraveling the Role of the C-terminal Helix Turn Helix of the Coat-binding Domain of Bacteriophage P22 Scaffolding Protein*

Science.gov (United States)

Padilla-Meier, G. Pauline; Gilcrease, Eddie B.; Weigele, Peter R.; Cortines, Juliana R.; Siegel, Molly; Leavitt, Justin C.; Teschke, Carolyn M.; Casjens, Sherwood R.

2012-01-01

Many viruses encode scaffolding and coat proteins that co-assemble to form procapsids, which are transient precursor structures leading to progeny virions. In bacteriophage P22, the association of scaffolding and coat proteins is mediated mainly by ionic interactions. The coat protein-binding domain of scaffolding protein is a helix turn helix structure near the C terminus with a high number of charged surface residues. Residues Arg-293 and Lys-296 are particularly important for coat protein binding. The two helices contact each other through hydrophobic side chains. In this study, substitution of the residues of the interface between the helices, and the residues in the β-turn, by aspartic acid was used examine the importance of the conformation of the domain in coat binding. These replacements strongly affected the ability of the scaffolding protein to interact with coat protein. The severity of the defect in the association of scaffolding protein to coat protein was dependent on location, with substitutions at residues in the turn and helix 2 causing the most significant effects. Substituting aspartic acid for hydrophobic interface residues dramatically perturbs the stability of the structure, but similar substitutions in the turn had much less effect on the integrity of this domain, as determined by circular dichroism. We propose that the binding of scaffolding protein to coat protein is dependent on angle of the β-turn and the orientation of the charged surface on helix 2. Surprisingly, formation of the highly complex procapsid structure depends on a relatively simple interaction. PMID:22879595

Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

Directory of Open Access Journals (Sweden)

Olufunmilola Ibironke

2012-01-01

Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

Genome-Wide Identification and Analysis of the Chicken Basic Helix-Loop-Helix Factors

Directory of Open Access Journals (Sweden)

Wu-yi Liu

2010-01-01

Full Text Available Members of the basic helix-loop-helix (bHLH family of transcription factors play important roles in a wide range of developmental processes. In this study, we conducted a genome-wide survey using the chicken (Gallus gallus genomic database, and identified 104 bHLH sequences belonging to 42 gene families in an effort to characterize the chicken bHLH transcription factor family. Phylogenetic analyses revealed that chicken has 50, 21, 15, 4, 8, and 3 bHLH members in groups A, B, C, D, E, and F, respectively, while three members belonging to none of these groups were classified as ‘‘orphans’’. A comparison between chicken and human bHLH repertoires suggested that both organisms have a number of lineage-specific bHLH members in the proteomes. Chromosome distribution patterns and phylogenetic analyses strongly suggest that the bHLH members should have arisen through gene duplication at an early date. Gene Ontology (GO enrichment statistics showed 51 top GO annotations of biological processes counted in the frequency. The present study deepens our understanding of the chicken bHLH transcription factor family and provides much useful information for further studies using chicken as a model system.

Field-induced Gap and Quantized Charge Pumping in Nano-helix

Energy Technology Data Exchange (ETDEWEB)

Qi, Xiao-Liang; /Stanford U., Phys. Dept. /Tsinghua U., Beijing; Zhang, Shou-Cheng; /Stanford U., Phys. Dept.

2010-02-15

We propose several novel physical phenomena based on nano-scale helical wires. Applying a static electric field transverse to the helical wire induces a metal to insulator transition, with the band gap determined by the applied voltage. Similar idea can be applied to 'geometrically' constructing one-dimensional systems with arbitrary external potential. With a quadrupolar electrode configuration, the electric field could rotate in the transverse plane, leading to a quantized dc charge current proportional to the frequency of the rotation. Such a device could be used as a new standard for the high precession measurement of the electric current. The inverse effect implies that passing an electric current through a helical wire in the presence of a transverse static electric field can lead to a mechanical rotation of the helix. This effect can be used to construct nano-scale electro-mechanical motors. Finally, our methodology also enables new ways of controlling and measuring the electronic properties of helical biological molecules such as the DNA.

Portrait of a discovery. Watson, Crick, and the double helix.

Science.gov (United States)

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

Investigation of DNA double strand breaks induced by α particle and 7Li ions

International Nuclear Information System (INIS)

Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

2006-01-01

α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

Comparison on the interaction of Al3+/nano-Al13 with calf thymus DNA /salmon sperm DNA

Science.gov (United States)

Ma, Fei; Ma, Yue; Du, Changwen; Yang, Xiaodi; Shen, Renfang

2015-11-01

The conformation change, binding mode and binding site between Al3+/nano-Al13 and calf thymus DNA/salmon sperm DNA were investigated by UV-vis absorption, FTIR spectra, Raman spectroscopy and CD spectra, as well as melting curves measurement. The UV-vis spectra and circular dichroism spectra results suggested that the phosphate group structure was changed when Al3+ interacted with DNA, while the double-helix was distorted when nano-Al13 interacted with DNA. The FTIR and Raman spectroscopy revealed that the binding sites were Al3+ … PO2, Al3+ … N7/guanine PO2 … Al13 … N7-C8/guanine with calf thymus DNA, and Al3+ … N3-O2/cytosine, Al3+ … N7-C8/guanine, PO2 … Al13 … N7-C8/guanine, PO2 … Al13 … N1/adenine with salmon sperm DNA, respectively. The electrostatic binding was existed between Al3+ and DNA, and the electrostatic binding and complexing were found between nano-Al13 and DNA.

Exploring encapsulation mechanism of DNA and mononucleotides in sol-gel derived silica.

Science.gov (United States)

Kapusuz, Derya; Durucan, Caner

2017-07-01

The encapsulation mechanism of DNA in sol-gel derived silica has been explored in order to elucidate the effect of DNA conformation on encapsulation and to identify the nature of chemical/physical interaction of DNA with silica during and after sol-gel transition. In this respect, double stranded DNA and dAMP (2'-deoxyadenosine 5'-monophosphate) were encapsulated in silica using an alkoxide-based sol-gel route. Biomolecule-encapsulating gels have been characterized using UV-Vis, 29 Si NMR, FTIR spectroscopy and gas adsorption (BET) to investigate chemical interactions of biomolecules with the porous silica network and to examine the extent of sol-gel reactions upon encapsulation. Ethidium bromide intercalation and leach out tests showed that helix conformation of DNA was preserved after encapsulation. For both biomolecules, high water-to-alkoxide ratio promoted water-producing condensation and prevented alcoholic denaturation. NMR and FTIR analyses confirmed high hydraulic reactivity (water adsorption) for more silanol groups-containing DNA and dAMP encapsulated gels than plain silica gel. No chemical binding/interaction occurred between biomolecules and silica network. DNA and dAMP encapsulated silica gelled faster than plain silica due to basic nature of DNA or dAMP containing buffer solutions. DNA was not released from silica gels to aqueous environment up to 9 days. The chemical association between DNA/dAMP and silica host was through phosphate groups and molecular water attached to silanols, acting as a barrier around biomolecules. The helix morphology was found not to be essential for such interaction. BET analyses showed that interconnected, inkbottle-shaped mesoporous silica network was condensed around DNA and dAMP molecules.

Transcription initiation complex structures elucidate DNA opening.

Science.gov (United States)

Plaschka, C; Hantsche, M; Dienemann, C; Burzinski, C; Plitzko, J; Cramer, P

2016-05-19

Transcription of eukaryotic protein-coding genes begins with assembly of the RNA polymerase (Pol) II initiation complex and promoter DNA opening. Here we report cryo-electron microscopy (cryo-EM) structures of yeast initiation complexes containing closed and open DNA at resolutions of 8.8 Å and 3.6 Å, respectively. DNA is positioned and retained over the Pol II cleft by a network of interactions between the TATA-box-binding protein TBP and transcription factors TFIIA, TFIIB, TFIIE, and TFIIF. DNA opening occurs around the tip of the Pol II clamp and the TFIIE 'extended winged helix' domain, and can occur in the absence of TFIIH. Loading of the DNA template strand into the active centre may be facilitated by movements of obstructing protein elements triggered by allosteric binding of the TFIIE 'E-ribbon' domain. The results suggest a unified model for transcription initiation with a key event, the trapping of open promoter DNA by extended protein-protein and protein-DNA contacts.

Phosphorylation inhibits DNA-binding of alternatively spliced aryl hydrocarbon receptor nuclear translocator

International Nuclear Information System (INIS)