hela 5s rna: Topics by WorldWideScience.org

Sample records for hela 5s rna

Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

International Nuclear Information System (INIS)

Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

1985-01-01

The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules
MicroRNA-433 negatively regulates the expression of thymidylate synthase (TYMS) responsible for 5-fluorouracil sensitivity in HeLa cells

International Nuclear Information System (INIS)

Gotanda, Keisuke; Hirota, Takeshi; Matsumoto, Nozomi; Ieiri, Ichiro

2013-01-01

Thymidylate synthase (TYMS) is an important folate-dependent enzyme in DNA synthesis and an important target for cancer chemotherapy. High TYMS expression levels in tumors are generally associated with resistance to 5-fluorouracil (5-FU). The cause of the variability in TYMS expression is still not fully understood, however, only a small proportion of the TYMS expression can be explained by TYMS genetic polymorphisms. The purpose of this study is to identify novel microRNAs (miRNAs) which regulate the expression of TYMS and to determine whether miRNAs binding to the 3′-untranslated region (UTR) of TYMS mRNA affect the proliferation of HeLa cells treated with 5-FU. An in silico search was performed to find potential binding sites of miRNAs in TYMS mRNA. The efficacy of predicted miRNAs at the 3′-UTR of TYMS mRNA was evaluated using a dual-luciferase reporter assay. TYMS mRNA and protein expression in HeLa cells was quantified with real-time RT-PCR and Western blotting, respectively. The effects of miR-433 on cell proliferative activity were determined by WST-8 assay. The overexpression of miR-433 was associated with significantly decreased reporter activity in the plasmid containing the 3′-UTR of TYMS mRNA (P < 0.01). The levels of TYMS mRNA and protein in HeLa cells were significantly decreased by the overexpression of miR-433 (P < 0.05). Furthermore, miR-433 increased inhibition of cell proliferation in HeLa cells treated with 5-FU at over 2.0 μM. The results indicate that miR-433 post-transcriptionally regulates the expression of TYMS mRNA and protein, and increases sensitivity to 5-FU in HeLa cells. This is the first report showing that a miRNA regulating TYMS expression has a significant impact on sensitivity to 5-FU treatment
tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.

Directory of Open Access Journals (Sweden)

Mayumi Okamoto

2014-09-01

Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.
Full-length single-cell RNA-seq applied to a viral human cancer: applications to HPV expression and splicing analysis in HeLa S3 cells.

Science.gov (United States)

Wu, Liang; Zhang, Xiaolong; Zhao, Zhikun; Wang, Ling; Li, Bo; Li, Guibo; Dean, Michael; Yu, Qichao; Wang, Yanhui; Lin, Xinxin; Rao, Weijian; Mei, Zhanlong; Li, Yang; Jiang, Runze; Yang, Huan; Li, Fuqiang; Xie, Guoyun; Xu, Liqin; Wu, Kui; Zhang, Jie; Chen, Jianghao; Wang, Ting; Kristiansen, Karsten; Zhang, Xiuqing; Li, Yingrui; Yang, Huanming; Wang, Jian; Hou, Yong; Xu, Xun

2015-01-01

Viral infection causes multiple forms of human cancer, and HPV infection is the primary factor in cervical carcinomas. Recent single-cell RNA-seq studies highlight the tumor heterogeneity present in most cancers, but virally induced tumors have not been studied. HeLa is a well characterized HPV+ cervical cancer cell line. We developed a new high throughput platform to prepare single-cell RNA on a nanoliter scale based on a customized microwell chip. Using this method, we successfully amplified full-length transcripts of 669 single HeLa S3 cells and 40 of them were randomly selected to perform single-cell RNA sequencing. Based on these data, we obtained a comprehensive understanding of the heterogeneity of HeLa S3 cells in gene expression, alternative splicing and fusions. Furthermore, we identified a high diversity of HPV-18 expression and splicing at the single-cell level. By co-expression analysis we identified 283 E6, E7 co-regulated genes, including CDC25, PCNA, PLK4, BUB1B and IRF1 known to interact with HPV viral proteins. Our results reveal the heterogeneity of a virus-infected cell line. It not only provides a transcriptome characterization of HeLa S3 cells at the single cell level, but is a demonstration of the power of single cell RNA-seq analysis of virally infected cells and cancers.
Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells

International Nuclear Information System (INIS)

Takeda, N.; Kuhn, R.J.; Yang, C.F.; Takegami, T.; Wimmer, E.

1986-01-01

An in vitro poliovirus RNA-synthesizing system derived from a crude membrance fraction of infected HeLa cells was used to analyze the mechanism of initiation of poliovirus plus-strand RNA synthesis. This system contains an activity that synthesizes the nucleotidyl proteins VPg-pU and VPg-pUpU. These molecules represent the 5'-terminal structure of nascent RNA molecules and of virion RNA. The membranous replication complex is also capable of synthesizing mucleotidyl proteins containing nine or more of the poliovirus 5'-proximal nucleotides as assayed by the formation of the RNase T 1 -resistant oligonucleotide VPg-pUUAAAACAGp or by fingerprint analysis of the in vitro-synthesized 32 P-RNA. Incubation of preformed VPg-pUpU with unlabeled nucleoside triphosphates resulted in the formation of VPg-pUUAAAACAGp. This reaction, which appeared to be an elongation of VPg-pUpU, was stimulated by the addition of a soluble fraction (S-10) obtained from uninfected HeLa cells. Preformed VPg-pU could be chased into VPg-pUpU in the presence of UTP. The data are consistent with a model that VPg-pU can function as a primer for poliovirus plus-strand RNA synthesis in the membranous replication complex and that the elongation reaction may be stimulated by a host cellular factor
Methylation of nucleolar RNA in HeLa cells studied by autoradiography

International Nuclear Information System (INIS)

Cervera, J.; Martinez, A.; Renau-Piqueras, J.

1984-01-01

Methylation of nucleolar RNA was studied by autoradiography in HeLa cells using L-[methyl- 3 H]methionine and S-adenosyl-L-[methyl- 3 H]methionine as radioactive precursors. Pulse-labeling experiments show that nucleolar RNA methylation occurs on the newly synthesized RNA at the nucleolar fibrillar RNP component and mostly on the fibrillar ring of fibrillar centers, where pre-rRNA is being synthesized. Pulse-chase experiments show a shift of silver grains from the nucleolar fibrillar RNP component to the nucleolar granular component first and then to the cytoplasm. Labeling of nucleolar RNA via specific methylation permits the study of intranucleolar processing of pre-rRNA and confirms the sequence of labeling of the two nucleolar RNP components observed with radioactive uridine
Potential proteins targeted by let-7f-5p in HeLa cells.

Science.gov (United States)

Wang, Yu; Chen, Xiujuan; Zhang, Yi; Song, Jiandong

2017-07-24

MicroRNAs are a class of small, endogenous, non-coding RNAs mediating posttranscriptional gene silencing. The current authors hypothesized that let-7f-5p is likely involved in cell invasion and proliferation by regulating the expression of target genes. The current study combined let-7f-5p with iTRAQ to assess its effect on gene expression in HeLa cells. Results indicated that 164 proteins were expressed at different levels in HeLa cells overexpressing let-7f-5p and negative controls and that 172 proteins were expressed at different levels in let-7f-5p-silenced HeLa cells and negative controls. Results indicated that let-7f-5p may suppress insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) in HeLa cells.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

Directory of Open Access Journals (Sweden)

Giuseppe Fiume

2016-11-01

Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

Science.gov (United States)

Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

2016-11-07

The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.
Chaperoning 5S RNA assembly.

Science.gov (United States)

Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

2015-07-01

In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
5S rRNA and ribosome.

Science.gov (United States)

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

International Nuclear Information System (INIS)

Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

1982-01-01

The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)
Effects of growth state and 3H labeling level on RNA turnover in WI-38 fibroblasts and HeLa cells

International Nuclear Information System (INIS)

Sameshima, M.; Schlessinger, D.

1981-01-01

The rate of turnover of prelabeled RNA in WI-38 human diploid fibroblasts varied with the level of 3 H incorporated, the cell density of cultures, and the arrest of growth by senescence. The half-life of RNA in sparse cultures of growing WI-38 diploid fibroblasts depended on the level of [ 3 H]uridine incorporated; extrapolated to zero levels of incorporation, the half-life was 15 to 20 days. At any level of incorporated [ 3 H]uridine, however, RNA half-life decreased to 4 to 5 days in superconfluent cultures as the culture growth slowed. A similar shortening of half-life was observed when growth was stopped by 3 H irradiation or clonal senescence. However, the rate of turnover was not simply dependent on whether cells were growing; for example, turnover did not increase when growth was arrested by incubating cells in conditioned medium. HeLa and L cells also showed an RNA half-life of about 14 to 20 days with an increase in turnover rate of crowded cultures. However, this increase occurred at higher cell densities than with the diploid fibroblasts. Also, the growth rate and rate of RNA turnover of HeLa and L cells were much less affected by incorporated 3 H. The differential responses to confluence and 3 H label can explain the higher turnover rate of RNA in normal human fibroblasts compared to SV40-transformed cells [S.A. Liebhaber, S. Wolf, and D. Schlessinger, Cell 13, 121-127 (1978)
Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

Science.gov (United States)

Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

2011-01-01

Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Developmental regulation of Xenopus 5S RNA genes

International Nuclear Information System (INIS)

Wormington, W.M.; Schlissel, M.; Brown, D.D.

1983-01-01

In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
Modulation of intracellular calcium homeostasis by trimethyltin chloride in human tumour cells: Neuroblastoma SY5Y and cervix adenocarcinoma HeLa S3

International Nuclear Information System (INIS)

Florea, Ana-Maria; Splettstoesser, Frank; Dopp, Elke; Rettenmeier, Albert W.; Buesselberg, Dietrich

2005-01-01

Physiological modifications of intracellular Ca 2+ ([Ca 2+ ] i ) levels trigger and/or regulate a diversity of cellular activities (e.g. neurotransmitter release, synaptic plasticity, muscular contraction, cell proliferation), while calcium overloads could result in cytotoxicity. Previously, we have shown that trimethyltin chloride (Me 3 SnCl; TMT) modulates calcium homeostasis in cervix adenocarcinoma (HeLa S3) cells [Florea, A.-M., Dopp, E., Buesselberg, D., 2005. TMT induces elevated calcium transients in HeLa cells: types and levels of response. Cell Calcium 37, 252-258]. Here we compare [Ca 2+ ] i -changes induced by trimethyltin chloride in neuroblastoma SY5Y and HeLa S3 cells using calcium-sensitive dyes (fluo-4/AM (fluo-4) and rhod-2/AM (rhod-2)) and laser scanning microscopy (LSM). TMT-induced calcium elevations in neuroblastoma SY5Y as well as in HeLa S3 cells. [Ca 2+ ] i rose to a sustained plateau or to transient spikes. Overall, the detected averaged increase of the maximum calcium elevation were: 0.5 μM ∼125.6%; 5 μM ∼130.1%; 500 μM ∼145% in HeLa S3 cells and 0.5 μM ∼133.3%; 5 μM ∼136.1%; 500 μM ∼147.1% in neuroblastoma SY5Y cells. The calcium rise derived from internal stores did not significantly depend on the presence of calcium in the external solution: ∼109% (no calcium added) versus ∼117% (2 mM calcium; 5 μM TMT) in HeLa cells. This difference was similar in neuroblastoma SY5Y cells, were ∼127% versus ∼136% increase (5 μM TMT) were measured. Staining of calcium stores with rhod-2 showed a TMT-induced [Ca 2+ ] i -decrease in the stores followed by an increase of the calcium concentration in the nuclei of the two cell lines tested. Our results suggest that toxic effects in human tumour cells after exposure to trimethyltin compounds might be due to an elevation of [Ca 2+ ] i
The invasion of tobacco mosaic virus RNA induces endoplasmic reticulum stress-related autophagy in HeLa cells

Science.gov (United States)

Li, Li; Wang, Li; Xiao, Ruijing; Zhu, Guoguo; Li, Yan; Liu, Changxuan; Yang, Ru; Tang, Zhiqing; Li, Jie; Huang, Wei; Chen, Lang; Zheng, Xiaoling; He, Yuling; Tan, Jinquan

2011-01-01

The ability of human cells to defend against viruses originating from distant species has long been ignored. Owing to the pressure of natural evolution and human exploration, some of these viruses may be able to invade human beings. If their ‘fresh’ host had no defences, the viruses could cause a serious pandemic, as seen with HIV, SARS (severe acute respiratory syndrome) and avian influenza virus that originated from chimpanzees, the common palm civet and birds, respectively. It is unknown whether the human immune system could tolerate invasion with a plant virus. To model such an alien virus invasion, we chose TMV (tobacco mosaic virus) and used human epithelial carcinoma cells (HeLa cells) as its ‘fresh’ host. We established a reliable system for transfecting TMV-RNA into HeLa cells and found that TMV-RNA triggered autophagy in HeLa cells as shown by the appearance of autophagic vacuoles, the conversion of LC3-I (light chain protein 3-I) to LC3-II, the up-regulated expression of Beclin1 and the accumulation of TMV protein on autophagosomal membranes. We observed suspected TMV virions in HeLa cells by TEM (transmission electron microscopy). Furthermore, we found that TMV-RNA was translated into CP (coat protein) in the ER (endoplasmic reticulum) and that TMV-positive RNA translocated from the cytoplasm to the nucleolus. Finally, we detected greatly increased expression of GRP78 (78 kDa glucose-regulated protein), a typical marker of ERS (ER stress) and found that the formation of autophagosomes was closely related to the expanded ER membrane. Taken together, our data indicate that HeLa cells used ERS and ERS-related autophagy to defend against TMV-RNA. PMID:21729006
Increased 5S rRNA oxidation in Alzheimer's disease.

Science.gov (United States)

Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

2012-01-01

It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Eukaryotic 5S rRNA biogenesis

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

Directory of Open Access Journals (Sweden)

Stefanie Gerstberger

2017-10-01

Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

Identification of CELF1 RNA targets by CLIP-seq in human HeLa cells

Directory of Open Access Journals (Sweden)

Olivier Le Tonquèze

2016-06-01

Full Text Available The specific interactions between RNA-binding proteins and their target RNAs are an essential level to control gene expression. By combining ultra-violet cross-linking and immunoprecipitation (CLIP and massive SoliD sequencing we identified the RNAs bound by the RNA-binding protein CELF1, in human HeLa cells. The CELF1 binding sites deduced from the sequence data allow characterizing specific features of CELF1-RNA association. We present therefore the first map of CELF1 binding sites in human cells.
Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

Science.gov (United States)

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
5S ribosomal RNA database Y2K.

Science.gov (United States)

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Evolution of primary and secondary structures in 5S and 5.8S rRNA

International Nuclear Information System (INIS)

Curtiss, W.C.

1986-01-01

The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented
5S rRNA-derived and tRNA-derived SINEs in fruit bats.

Science.gov (United States)

Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

2009-05-01

Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.
IER5 gene's mRNA expression after irradiation

International Nuclear Information System (INIS)

Ding Kuke; Shen Jingjing; Xu Lili; Li Yanling; Zhou Ping; Ma Binrong; Zhao Zengqiang; Sui Jianli; Zhou Pingkun

2008-01-01

Objective: To explore the effect of irradiation on IER5 gene expression. Methods: Two kinds of cells (AHH-1 and HeLa) and the BALB/c-nu mice inoculated with tumor cells were exposed to 60 Co γ- rays and analyzed by real-time PCR. The above-mentioned irradiated objects were firstly divided into groups by different doses and post-radiation time, then mRNA were extracted and reverse-transcripted to DNA before real-time PCR test. Results: Under the same condition, AHH-1 was more sensitive to radiation than HeLa. The dose level corresponding to the expression peak of AHH-1 was less than that of HeLa. For AHH-1 cells, the response to 2 Gy irradiation was earlier than that to 10 Gy. But there was not remarkable difference for HeLa response between 2 and 10 Gy, and the top transcriptional levels for both cells nearly simultaneously appeared at 2 h after irradiation. In addition, the IER5 gene of human liver tumor was more sensitive than that of lung cancer and brain tumor. Conclusions: IER5 might be a candidate biomarker of radiation injury, and had the potential value in radiation-therapy for liver tumor. (authors)
Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

Science.gov (United States)

Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

2009-02-01

Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.
[RNA interference of HERC4 inhibits proliferation, apoptosis and migration of cervical cancer Hela cells].

Science.gov (United States)

Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo

2016-02-20

To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (PHela cells, increased the apoptosis rate (PHela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.
[Baicalein promotes the apoptosis of HeLa cells by inhibiting ERK1/2 expression].

Science.gov (United States)

Wang, Yongzhou; Xia, Jiyi; Tang, Xiaoping; Tang, Li; Mao, Xiguang; Zhang, Yujiao; Yu, Xiaolan

2016-11-01

Objective To investigate the effects of baicalein and U0126 treatment on the apoptosis of human cervical carcinoma HeLa cells and the potential mechanism. Methods HeLa cells were subjected to (1, 2, 5, 10, 20, 50, 100, 200, 300) μmol/L baicalein or (1, 2, 5, 10, 20, 30) μmol/L U0126 treatment for 24 hours. The optimal concentrations of baicalein and U0126 for HeLa inhibition was determined by a cell counting Kit-8 assay. HeLa cells were then treated with these inhibitory concentrations for 24 hours separately or in combination. The cell cycle and the degree of apoptosis were analyzed by flow cytometry. The cell apoptosis index was evaluated by the TUNEL assay. The expressions of extracellular signal-regulated kinase 1/2 (ERK1/2), Bax, and Bcl-2 at the mRNA and protein levels were examined by real-time PCR and Western blotting, respectively. Results Optimal inhibitory concentrations of baicalein and U0126 for HeLa cells were 200 μmol/L and 10 μmol/L, respectively. Compared with the control group, baicalein treatment increased the growth rate of cells in the G0/G1 phase but decreased the S phase. Combination treatment of 200 μmol/L baicalein and 10 μmol/L U0126 for 24 hours further reduced the S phase growth rate. Treatment with 10 μmol/L U0126 or 200 μmol/L baicalein for 24 hours induced cell apoptosis, and the combination treatment induced more apoptosis. Treatment by baicalein alone or in combination with U0126 for 24 hours significantly decreased ERK1/2 and Bcl-2 mRNA expressions, and upregulated Bax mRNA expression. It also downregulated ERK1/2 phosphorylation and Bcl-2 protein expression, while increasing Bax protein expression. Conclusion Both baicalein and U012 appear to inhibit proliferation, induce apoptosis, and increase the growth rate in the G0/G1 phase but reduce the S phase of HeLa cells. This effect is enhanced when they are used synergistically.
Systems biology approach to transplant tolerance: proof of concept experiments using RNA interference (RNAi) to knock down hub genes in Jurkat and HeLa cells in vitro.

Science.gov (United States)

Lwin, Wint Wah; Park, Ken; Wauson, Matthew; Gao, Qin; Finn, Patricia W; Perkins, David; Khanna, Ajai

2012-07-01

Systems biology is gaining importance in studying complex systems such as the functional interconnections of human genes [1]. To investigate the molecular interactions involved in T cell immune responses, we used databases of physical gene-gene interactions to constructed molecular interaction networks (interconnections) with R language algorithms. This helped to identify highly interconnected "hub" genes AT(1)P5C1, IL6ST, PRKCZ, MYC, FOS, JUN, and MAPK1. We hypothesized that suppression of these hub genes in the gene network would result in significant phenotypic effects on T cells and examined this in vitro. The molecular interaction networks were then analyzed and visualized with Cytoscape. Jurkat and HeLa cells were transfected with siRNA for the selected hub genes. Cell proliferation was measured using ATP luminescence and BrdU labeling, which were measured 36, 72, and 96 h after activation. Following T cell stimulation, we found a significant decrease in ATP production (P cells. However, HeLa cells showed a significant (P cell proliferation when the genes MAPK1, IL6ST, ATP5C1, JUN, and FOS were knocked down. In both Jurkat and HeLa cells, targeted gene knockdown using siRNA showed decreased cell proliferation and ATP production in both Jurkat and HeLa cells. However, Jurkat T cells and HELA cells use different hub genes to regulate activation responses. This experiment provides proof of principle of applying siRNA knockdown of T cell hub genes to evaluate their proliferative capacity and ATP production. This novel concept outlines a systems biology approach to identify hub genes for targeted therapeutics. Published by Elsevier Inc.
Increased expression of cyclin B1 mRNA coincides with diminished G2-phase arrest in irradiated HeLa cells treated with staurosporine or caffeine

International Nuclear Information System (INIS)

Bernhard, E.J.; Maity, A.; McKenna, W.G.; Muschel, R.J.

1994-01-01

The irradiation of cells results in delayed progression through the G 2 phase of the cell cycle. Treatment of irradiated HeLa cells with caffeine greatly reduces the G 2 -phase delay, while caffeine does not alter progression of cells through the cell cycle in unirradiated cells. In this report we demonstrate that treatment of HeLa cells with the kinase inhibitor staurosporine, but not with the inhibitor H7, also results in a reduction of the G 2 -phase arrest after irradiation. Cell cycle progression in unirradiated cells is unaffected by 4.4 nM (2ng/ml) staurosporine, which releases the radiation-induced G 2 -phase arrest. In HeLa cells, the G 2 -phase delay after irradiation in S phase is accompanied by decreased expression of cyclin B1 mRNA. Coincident with the reduction in G 2 -phase delay, we observed an increase in cyclin B1 mRNA accumulation in irradiated, staurosporine-treated cells compared to cells treated with irradiation alone. Caffeine treatment of irradiated HeLa cells also resulted in an elevation in the levels of cyclin B1 message. These results support the hypothesis that diminished cyclin B1 mRNA levels influence G 2 -phase arrest to some degree. The findings that both staurosporine and caffeine treatments reverse the depression in cyclin B1 expression suggest that these two compounds may act on a common pathway of cell cycle control in response to radiation injury. 33 refs., 6 figs
Time of action of 4.5 S RNA in Escherichia coli translation

DEFF Research Database (Denmark)

Brown, S

1989-01-01

A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

International Nuclear Information System (INIS)

Terao, K.; Uchiumi, T.; Ogata, K.

1980-01-01

After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)
Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

OpenAIRE

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
Involvement of S6K1 in mitochondria function and structure in HeLa cells.

Science.gov (United States)

Park, Jisoo; Tran, Quangdon; Mun, Kisun; Masuda, Kouhei; Kwon, So Hee; Kim, Seon-Hwan; Kim, Dong-Hoon; Thomas, George; Park, Jongsun

2016-12-01

The major biological function of mitochondria is to generate cellular energy through oxidative phosphorylation. Apart from cellular respiration, mitochondria also play a key role in signaling processes, including aging and cancer metabolism. It has been shown that S6K1-knockout mice are resistant to obesity due to enhanced beta-oxidation, with an increased number of large mitochondria. Therefore, in this report, the possible involvement of S6K1 in regulating mitochondria dynamics and function has been investigated in stable lenti-shS6K1-HeLa cells. Interestingly, S6K1-stably depleted HeLa cells showed phenotypical changes in mitochondria morphology. This observation was further confirmed by detailed image analysis of mitochondria shape. Corresponding molecular changes were also observed in these cells, such as the induction of mitochondrial fission proteins (Drp1 and Fis1). Oxygen consumption is elevated in S6K1-depeleted HeLa cells and FL5.12 cells. In addition, S6K1 depletion leads to enhancement of ATP production in cytoplasm and mitochondria. However, the relative ratio of mitochondrial ATP to cytoplasmic ATP is actually decreased in lenti-shS6K1-HeLa cells compared to control cells. Lastly, induction of mitophagy was found in lenti-shS6K1-HeLa cells with corresponding changes of mitochondria shape on electron microscope analysis. Taken together, our results indicate that S6K1 is involved in the regulation of mitochondria morphology and function in HeLa cells. This study will provide novel insights into S6K1 function in mitochondria-mediated cellular signaling. Copyright © 2016 Elsevier Inc. All rights reserved.
Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

International Nuclear Information System (INIS)

Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

1999-01-01

The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)
Increased expression of cyclin B1 mRNA coincides with diminished G{sub 2}-phase arrest in irradiated HeLa cells treated with staurosporine or caffeine

Energy Technology Data Exchange (ETDEWEB)

Bernhard, E.J.; Maity, A.; McKenna, W.G.; Muschel, R.J. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)

1994-12-01

The irradiation of cells results in delayed progression through the G{sub 2} phase of the cell cycle. Treatment of irradiated HeLa cells with caffeine greatly reduces the G{sub 2}-phase delay, while caffeine does not alter progression of cells through the cell cycle in unirradiated cells. In this report we demonstrate that treatment of HeLa cells with the kinase inhibitor staurosporine, but not with the inhibitor H7, also results in a reduction of the G{sub 2}-phase arrest after irradiation. Cell cycle progression in unirradiated cells is unaffected by 4.4 nM (2ng/ml) staurosporine, which releases the radiation-induced G{sub 2}-phase arrest. In HeLa cells, the G{sub 2}-phase delay after irradiation in S phase is accompanied by decreased expression of cyclin B1 mRNA. Coincident with the reduction in G{sub 2}-phase delay, we observed an increase in cyclin B1 mRNA accumulation in irradiated, staurosporine-treated cells compared to cells treated with irradiation alone. Caffeine treatment of irradiated HeLa cells also resulted in an elevation in the levels of cyclin B1 message. These results support the hypothesis that diminished cyclin B1 mRNA levels influence G{sub 2}-phase arrest to some degree. The findings that both staurosporine and caffeine treatments reverse the depression in cyclin B1 expression suggest that these two compounds may act on a common pathway of cell cycle control in response to radiation injury. 33 refs., 6 figs.
Exportin-5 mediates nuclear export of SRP RNA in vertebrates.

Science.gov (United States)

Takeiwa, Toshihiko; Taniguchi, Ichiro; Ohno, Mutsuhito

2015-04-01

The signal recognition particle is a ribonucleoprotein complex that is essential for the translocation of nascent proteins into the endoplasmic reticulum. It has been shown that the RNA component (SRP RNA) is exported from the nucleus by CRM1 in the budding yeast. However, how SRP RNA is exported in higher species has been elusive. Here, we show that SRP RNA does not use the CRM1 pathway in Xenopus oocytes. Instead, SRP RNA uses the same export pathway as pre-miRNA and tRNA as showed by cross-competition experiments. Consistently, the recombinant Exportin-5 protein specifically stimulated export of SRP RNA as well as of pre-miRNA and tRNA, whereas an antibody raised against Exportin-5 specifically inhibited export of the same RNA species. Moreover, biotinylated SRP RNA can pull down Exportin-5 but not CRM1 from HeLa cell nuclear extracts in a RanGTP-dependent manner. These results, taken together, strongly suggest that the principal export receptor for SRP RNA in vertebrates is Exportin-5 unlike in the budding yeast. © 2015 The Authors. Genes to Cells published by Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
[S100A7 promotes the metastasis and epithelial-mesenchymal transition on HeLa and CaSki cells].

Science.gov (United States)

Tian, T; Hua, Z; Wang, L Z; Wang, X Y; Chen, H Y; Liu, Z H; Cui, Z M

2018-02-25

Objective: To elucidate the impact of over-expression of S100A7 on migration, invasion, proliferation, cell cycle, and epithelial-mesenchymal transition (EMT) in human cervical cancer HeLa and CaSki cells. Methods: (1) Immunohistochemistry of SP was used to examine the expression of S100A7 in 40 cases of squamous cervical cancer tissues and 20 cases of normal cervical tissues. (2) The vectors of pLVX-IRES-Neo-S100A7 and pLVX-IRES-Neo were used to transfect human cervical cancer HeLa and CaSki cells, and the positive clones were screened and identified. Next, transwell migration assay, cell counting kit-8 (CCK-8) assay and fluorescence activating cell sorter (FACS) were used to detect the effect of S100A7-overexpression on the migration, invasion, proliferation and cell cycle of cervical cancer cells. Furthermore, western blot was performed to observe the expression of epithelial marker (E-cadherin) and mesenchymal markers (N-cadherin, vimentin, and fibronectin) of EMT. Results: (1) S100A7 expression was significantly higher in cervical squamous cancer tissues (median 91.6) than that in normal cervical tissues (median 52.1; Z=- 2.948, P= 0.003) . (2) Stable S100A7-overexpressed cells were established using lentiviral-mediated gene delivery in HeLa and CaSki cells. S100A7 was detected by real-time quantitative reverse transcription PCR, S100A7 mRNA of S100A7-overexpressed cells were 119±3 and 177±16, increased significantly compared with control groups of median ( Pcells, the number of S100A7-overexpressed HeLa and CaSki cells that passed the transwell membrane assay were increased significanatly (572±51 vs 337±25, PHeLa and CaSki cells that passed the transwell membrane were respectively 441±15 and 110±14, elevated significantly compared with control cells (156±21 and 59±7; Pcell cycle progression of HeLa and CaSki cells ( P> 0.05) . Expression of E-cadherin was dramatically decreased, while N-cadherin, vimentin, and fibronectin increased in S100A7
Changes in distribution of cell cycle phases and DNA content in HeLa S3 cell after irradiation

International Nuclear Information System (INIS)

Wang Shunbao

1992-01-01

The effects of irradiation and hyperthermia on the distribution in various phases and DNA content of HeLa S 3 cells were analyzed by flow cytometry and an image analysis instrument. A marked increase in DNA content from 6.718 to 9.614(AU) in HeLa S 3 cells after 6 Gy irradiation was seen to correspond with the changes in the distribution of various phases in G 2 + M, from 22% to 52%. Meanwhile, the surviving fraction of HeLa S 3 cells after 6 Gy irradiation was less than 1%. However, after heating at 44 deg C for 10 min, the amount of cells in G 2 + M increased from 22.5% to 52.5% and the surviving fraction after hyperthermia was less than 2.65%. The changes in distribution of various phases after Ir-192 irradiation were similar to those seen after X-ray irradiation. The delay of G 2 + M phase after treatment with 8 Gy plus heating at 44 deg C for 7 min in HeLa S 3 cells was similar to that seen in the case of treatment with 8 Gy alone. As the surviving fraction accompanying the G 2 + M delay after irradiation plus heat treatment was very low, we suggest that the changes of distribution in various phases of HeLa S 3 cells after treatment might be used as a rapid indicator of serious injury

Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

DEFF Research Database (Denmark)

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....
Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

Science.gov (United States)

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

Science.gov (United States)

Drouin, Guy; Tsang, Corey

2012-06-01

Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
An Archaea 5S rRNA analog is stably expressed in Escherichia coli

Science.gov (United States)

Yang, Y.; Fox, G. E.

1996-01-01

Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
Effects of DCK knockdown on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells.

Science.gov (United States)

Shang, Q-Y; Wu, C-S; Gao, H-R

2017-09-01

The present study explored the effect that deoxycytidine kinase (DCK) knockdown had on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells. Human cervical cancer HeLa cells that had received no prior treatment were selected from the HeLa group. The HeLa-negative control (NC) group consisted of cells that had undergone an empty vector treatment, and finally the HeLa-short hairpin RNA (shRNA) group included cells that were treated by means of shRNA-DCK expression. DCK expressions were evaluated by quantitative real-time polymerase chain reaction in addition to western blotting assays. Cell proliferation was estimated using the Cell Counting Kit-8 (CCK-8) assay and cell cycle progression. Cell apoptosis was determined by flow cytometry. BALB/c nude mice (n=24) were selected to establish transplanted tumor models, with gross tumor volume measured every 3 days. The results in vitro were as follows: compared with the HeLa group, the HeLa-shRNA group exhibited downregulation of DCK expression and inhibition of cell proliferation at 48, 72 and 96 h. Additionally, more cells in the HeLa-shRNA group were arrested in G0/G1 stage and less in S and G2/M stages, as well as in promotion of cell apoptosis. In vivo results are as follows: when comparing the HeLa and HeLa-NC groups, the gross tumor volume of the transplanted tumor in nude mice in the HeLa-shRNA group was found to have decreased in 13, 16, 19 and 22 days. Based on these findings, our study suggests that DCK knockdown facilitates apoptosis while inhibiting proliferation and tumorigenicity in vivo of cervical cancer HeLa cells.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Toxicity of cadmium sulfide (CdS) nanoparticles against Escherichia coli and HeLa cells

International Nuclear Information System (INIS)

Hossain, Sk Tofajjen; Mukherjee, Samir Kumar

2013-01-01

Highlights: • Toxic effect of CdS NPs on the growth and cell division in E. coli was studied. • CdS NPs affected cell surface topology and cell division. • Downregulation of both FtsZ and FtsQ was observed due to NPs exposure. • CdS NPs affected HeLa cell morphology with fragmented nuclei. • All such effects might be due to elevated oxidative stress. -- Abstract: The present study endeavours to assess the toxic effect of synthesized CdS nanoparticles (NPs) on Escherichia coli and HeLa cells. The CdS NPs were characterized by DLS, XRD, TEM and AFM studies and the average size of NPs was revealed as ∼3 nm. On CdS NPs exposure bacterial cells changed morphological features to filamentous form and damage of the cell surface was found by AFM study. The expression of two conserved cell division components namely ftsZ and ftsQ in E. coli was decreased both at transcriptional and translational levels upon CdS NPs exposure. CdS NPs inhibited proper cell septum formation without affecting the nucleoid segregation. Viability of HeLa cells declined with increasing concentration of CdS NPs and the IC 50 value was found to be 4 μg/mL. NPs treated HeLa cells showed changed morphology with condensed and fragmented nuclei. Increased level of reactive oxygen species (ROS) was found both in E. coli and HeLa cells on CdS NPs exposure. The inverse correlation between declined cell viabilities and elevated ROS level suggested that oxidative stress seems to be the key event by which NPs induce toxicity both in E. coli and HeLa cells
Involvement of the 5'-leader sequence in coupling the stability of a human H3 histone mRNA with DNA replication

International Nuclear Information System (INIS)

Morris, T.; Marashi, F.; Weber, L.; Hickey, E.; Greenspan, D.; Bonner, J.; Stein, J.; Stein, G.

1986-01-01

Two lines of evidence derived from fusion gene constructs indicate that sequences residing in the 5'-nontranslated region of a cell cycle-dependent human H3 histone mRNA are involved in the selective destabilization that occurs when DNA synthesis is terminated. The experimental approach was to construct chimeric genes in which fragments of the mRNA coding regions of the H3 histone gene were fused with fragments of genes not expressed in a cell cycle-dependent manner. After transfection in HeLa S3 cells with the recombinant plasmids, levels of fusion mRNAs were determined by S1 nuclease analysis prior to and following DNA synthesis inhibition. When the first 20 nucleotides of an H3 histone mRNA leader were replaced with 89 nucleotides of the leader from a Drosophila heat-shock (hsp70) mRNA, the fusion transcript remained stable during inhibition of DNA synthesis, in contrast to the rapid destabilization of the endogenous histone mRNA in these cells. In a reciprocal experiment, a histone-globin fusion gene was constructed that produced a transcript with the initial 20 nucleotides of the H3 histone mRNA substituted for the human β-globin mRNA leader. In HeLa cells treated with inhibitors of DNA synthesis and/or protein synthesis, cellular levels of this histone-globin fusion mRNA appeared to be regulated in a manner similar to endogenous histone mRNA levels. These results suggest that the first 20 nucleotides of the leader are sufficient to couple histone mRNA stability with DNA replication
Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

International Nuclear Information System (INIS)

Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

1987-01-01

A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed
Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

DEFF Research Database (Denmark)

Ostergaard, P; Phan, H; Johansen, L B

1998-01-01

The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....
Chromosomal loop/nuclear matrix organization of transcriptionally active and inactive RNA polymerases in HeLa nuclei.

Science.gov (United States)

Roberge, M; Dahmus, M E; Bradbury, E M

1988-06-05

The relative distribution of transcriptionally active and inactive RNA polymerases I and II between the nuclear matrix/scaffold and chromosomal loops of HeLa cells was determined. Total RNA polymerase was assessed by immunoblotting and transcribing RNA polymerase by a photoaffinity labeling technique in isolated nuclei. Nuclear matrix/scaffold was isolated by three methods using high-salt, intermediate-salt or low-salt extraction. The distribution of RNA polymerases I and II were very similar within each of the methods, but considerable differences in distributions were found between the different preparation methods. Either intermediate-salt or high-salt treatment of DNase I-digested nuclei showed significant association of RNA polymerases with the nuclear matrix. However, intermediate-salt followed by high-salt treatment released all transcribing and non-transcribing RNA polymerases. Nuclear scaffolds isolated with lithium diiodosalicylate (low-salt) contained very little of the RNA polymerases. This treatment, however, caused the dissociation of RNA polymerase II transcription complexes. These results show unambiguously that RNA polymerases, both in their active and inactive forms, are not nuclear matrix proteins. The data support models in which the transcriptional machinery moves around DNA loops during transcription.
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

Science.gov (United States)

Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Genetic selection and DNA sequences of 4.5S RNA homologs

DEFF Research Database (Denmark)

Brown, S; Thon, G; Tolentino, E

1989-01-01

A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

Science.gov (United States)

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-02-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

International Nuclear Information System (INIS)

Pelczar, P.; Fiett, J.; Bartnik, E.

1994-01-01

We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig
Quantitative Proteomics Analysis Reveals Novel Insights into Mechanisms of Action of Long Noncoding RNA Hox Transcript Antisense Intergenic RNA (HOTAIR) in HeLa Cells*

Science.gov (United States)

Zheng, Peng; Xiong, Qian; Wu, Ying; Chen, Ying; Chen, Zhuo; Fleming, Joy; Gao, Ding; Bi, Lijun; Ge, Feng

2015-01-01

Long noncoding RNAs (lncRNAs), which have emerged in recent years as a new and crucial layer of gene regulators, regulate various biological processes such as carcinogenesis and metastasis. HOTAIR (Hox transcript antisense intergenic RNA), a lncRNA overexpressed in most human cancers, has been shown to be an oncogenic lncRNA. Here, we explored the role of HOTAIR in HeLa cells and searched for proteins regulated by HOTAIR. To understand the mechanism of action of HOTAIR from a systems perspective, we employed a quantitative proteomic strategy to systematically identify potential targets of HOTAIR. The expression of 170 proteins was significantly dys-regulated after inhibition of HOTAIR, implying that they could be potential targets of HOTAIR. Analysis of this data at the systems level revealed major changes in proteins involved in diverse cellular components, including the cytoskeleton and the respiratory chain. Further functional studies on vimentin (VIM), a key protein involved in the cytoskeleton, revealed that HOTAIR exerts its effects on migration and invasion of HeLa cells, at least in part, through the regulation of VIM expression. Inhibition of HOTAIR leads to mitochondrial dysfunction and ultrastructural alterations, suggesting a novel role of HOTAIR in maintaining mitochondrial function in cancer cells. Our results provide novel insights into the mechanisms underlying the function of HOTAIR in cancer cells. We expect that the methods used in this study will become an integral part of functional studies of lncRNAs. PMID:25762744
Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

International Nuclear Information System (INIS)

Hirose, Yutaka; Harada, Fumio

2008-01-01

4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus
Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

Directory of Open Access Journals (Sweden)

Stern David B

2010-09-01

Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.
Radiosensitization of nitroindazole derivatives on HeLa cells

International Nuclear Information System (INIS)

Wang Hao; Shi Peiji; Zhou Xiaoliang; Wang Yan; Tang Weisheng

2010-01-01

Objective: To investigate the cytotoxicity and radiosensitization of 5-nitroindazole-3-formyliminodiacetic acid on HeLa cells. Methods: HeLa cells in exponential growth phase were incubated in culture media with different doses and the survival rate was determined by MTT assay. The survival rate of cells receiving radiation combined with different doses of medicine was compared with that of the control.Results: The cytotoxicity of S-nitroindazole-3-formyliminodiacetic acid on HeLa cells was very low. The drug had hypoxia radiosensitizing effect on HeLa cells. At doses of 0, 6, 12, 24, 48 and 96 μg/ml under hypoxia, the survival rate were 0.91 , 0.87, 0.84, 0.81, 0.76 and 0.60, respectively. At the dosage of 48 and 96 μg/ml, the survival rate were 0.85 and 0.73 under oxygenous). Conclusions: 5-Nitroindazole-3-formyliminodiacetic acid has low cytotoxicity and rediosensitizing effect on HeLa cells. (authors)

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

Science.gov (United States)

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
A critical role for noncoding 5S rRNA in regulating Mdmx stability.

Science.gov (United States)

Li, Muyang; Gu, Wei

2011-09-16

Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.
Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

Science.gov (United States)

Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

2018-04-06

Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.
CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

Science.gov (United States)

Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

2017-09-01

The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

International Nuclear Information System (INIS)

Schubert, I.; Baeumlein, H.; Wobus, U.

1978-01-01

In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)
Interferon-β induced microRNA-129-5p down-regulates HPV-18 E6 and E7 viral gene expression by targeting SP1 in cervical cancer cells.

Directory of Open Access Journals (Sweden)

Jiarong Zhang

Full Text Available Infection by human papillomavirus (HPV can cause cervical intraepithelial neoplasia (CIN and cancer. Down-regulation of E6 and E7 expression may be responsible for the positive clinical outcomes observed with IFN treatment, but the molecular basis has not been well determined. As miRNAs play an important role in HPV induced cervical carcinogenesis, we hypothesize that IFN-β can regulate the expressions of specific miRNAs in cervical cancer cells, and that these miRNAs can mediate E6 and E7 expression, thus modulate their oncogenic potential. In this study, we found that miR-129-5p to be a candidate IFN-β inducible miRNA. MiR-129-5p levels gradually decrease with the development of cervical intraepithelial lesions. Manipulation of miR-129-5p expression in Hela cells modulates HPV-18 E6 and E7 viral gene expression. Exogenous miR-129-5p inhibits cell proliferation in Hela cells, promotes apoptosis and blocks cell cycle progression in Hela cells. SP1 is a direct target of miR-129-5p in Hela cells. This study is the first report of a cellular miRNA with anti-HPV activity and provides new insights into regulatory mechanisms between the HPV and the IFN system in host cells at the miRNA level.
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

Science.gov (United States)

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

NARCIS (Netherlands)

Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

2012-01-01

Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

Science.gov (United States)

Ciganda, Martin; Williams, Noreen

2012-01-01

P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Common 5S rRNA variants are likely to be accepted in many sequence contexts

Science.gov (United States)

Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

2003-01-01

Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Unravelling the potential of a new uracil phosphoribosyltransferase (UPRT) from Arabidopsis thaliana in sensitizing HeLa cells towards 5-fluorouracil.

Science.gov (United States)

Narayanan, Sharmila; Sanpui, Pallab; Sahoo, Lingaraj; Ghosh, Siddhartha Sankar

2016-10-01

In silico studies with uracil phosphoribosyltransferase from Arabidopsis thaliana (AtUPRT) revealed its lower binding energies for uracil and 5-fluorouracil (5-FU) as compared to those of bacterial UPRT indicating the prospective of AtUPRT in gene therapy implications. Hence, AtUPRT was cloned and stably expressed in cervical cancer cells (HeLa) to investigate the effect of prodrug 5-FU on these transfected cancer cells. The treatment of AtUPRT-expressing HeLa (HeLa-UPP) cells with 5-FU for 72h resulted in significant decrease in cell viability. Moreover, 5-FU was observed to induce apoptosis and perturb mitochondrial membrane potential in HeLa-UPP cells. While cell cycle analysis revealed significant S-phase arrest as a result of 5-FU treatment in HeLa-UPP cells, quantitative gene expression analysis demonstrated simultaneous upregulation of important cell cycle related genes, cyclin D1 and p21. The survival fractions of non-transfected, vector-transfected and AtUPRT-transfected HeLa cells, following 5-FU treatment, were calculated to be 0.425, 0.366 and 0.227, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

International Nuclear Information System (INIS)

Nuc, K.; Nuc, P.; Pawelkiewicz, J.

1993-01-01

We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A; Wagner, R

1979-01-01

An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....
Ectopic overexpression of LAPTM5 results in lysosomal targeting and induces Mcl-1 down-regulation, Bak activation, and mitochondria-dependent apoptosis in human HeLa cells.

Directory of Open Access Journals (Sweden)

Do Youn Jun

Full Text Available Human lysosomal-associated protein multispanning membrane 5 (LAPTM5 was identified by an ordered differential display-polymerase chain reaction (ODD-PCR as an up-regulated cDNA fragment during 12-O-tetradecanoylphorbol 13-acetate (TPA-induced differentiation of U937 cells into monocytes/macrophages. After TPA-treatment, the levels of LAPTM5 mRNA and protein increased and reached a maximum at 18-36 h. In healthy human tissues, LAPTM5 mRNA was expressed at high levels in hematopoietic cells and tissues, at low levels in the lung and fetal liver, and was not detected in other non-hematopoietic tissues. LAPTM5 mRNA was detected in immature malignant cells of myeloid lineage, such as K562, HL-60, U937, and THP-1 cells, and in unstimulated peripheral T cells, but was absent or barely detectable in lymphoid malignant or non-hematopoietic malignant cells. The LAPTM5 level in HL-60 cells increased more significantly during TPA-induced monocyte/macrophage differentiation than during DMSO-induced granulocyte differentiation. Ectopic expression of GFP-LAPTM5 or LAPTM5 in HeLa cells exhibited the localization of LAPTM5 to the lysosome. In HeLa cells overexpressing LAPTM5, the Mcl-1 and Bid levels declined markedly and apoptosis was induced via Bak activation, Δψm loss, activation of caspase-9, -8 and -3, and PARP degradation without accompanying necrosis. However, these LAPTM5-induced apoptotic events except for the decline of Bid level were completely abrogated by concomitant overexpression of Mcl-1. The pan-caspase inhibitor (z-VAD-fmk could suppress the LAPTM5-induced apoptotic sub-G1 peak by ~40% but failed to block the induced Δψm loss, whereas the broad-range inhibitor of cathepsins (Cathepsin Inhibitor I could suppress the LAPTM5-induced apoptotic sub-G1 peak and Δψm loss, by ~22% and ~23%, respectively, suggesting that the LAPTM5-mediated Δψm loss was exerted at least in part in a cathepsin-dependent manner. Together, these results
Ectopic overexpression of LAPTM5 results in lysosomal targeting and induces Mcl-1 down-regulation, Bak activation, and mitochondria-dependent apoptosis in human HeLa cells

Science.gov (United States)

Jun, Do Youn; Kim, Hyejin; Jang, Won Young; Lee, Ji Young; Fukui, Kiyoshi; Kim, Young Ho

2017-01-01

Human lysosomal-associated protein multispanning membrane 5 (LAPTM5) was identified by an ordered differential display-polymerase chain reaction (ODD-PCR) as an up-regulated cDNA fragment during 12-O-tetradecanoylphorbol 13-acetate (TPA)-induced differentiation of U937 cells into monocytes/macrophages. After TPA-treatment, the levels of LAPTM5 mRNA and protein increased and reached a maximum at 18–36 h. In healthy human tissues, LAPTM5 mRNA was expressed at high levels in hematopoietic cells and tissues, at low levels in the lung and fetal liver, and was not detected in other non-hematopoietic tissues. LAPTM5 mRNA was detected in immature malignant cells of myeloid lineage, such as K562, HL-60, U937, and THP-1 cells, and in unstimulated peripheral T cells, but was absent or barely detectable in lymphoid malignant or non-hematopoietic malignant cells. The LAPTM5 level in HL-60 cells increased more significantly during TPA-induced monocyte/macrophage differentiation than during DMSO-induced granulocyte differentiation. Ectopic expression of GFP-LAPTM5 or LAPTM5 in HeLa cells exhibited the localization of LAPTM5 to the lysosome. In HeLa cells overexpressing LAPTM5, the Mcl-1 and Bid levels declined markedly and apoptosis was induced via Bak activation, Δψm loss, activation of caspase-9, -8 and -3, and PARP degradation without accompanying necrosis. However, these LAPTM5-induced apoptotic events except for the decline of Bid level were completely abrogated by concomitant overexpression of Mcl-1. The pan-caspase inhibitor (z-VAD-fmk) could suppress the LAPTM5-induced apoptotic sub-G1 peak by ~40% but failed to block the induced Δψm loss, whereas the broad-range inhibitor of cathepsins (Cathepsin Inhibitor I) could suppress the LAPTM5-induced apoptotic sub-G1 peak and Δψm loss, by ~22% and ~23%, respectively, suggesting that the LAPTM5-mediated Δψm loss was exerted at least in part in a cathepsin-dependent manner. Together, these results demonstrate that
Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

Science.gov (United States)

Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

2017-04-01

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Matrix Metallopeptidase 14 Plays an Important Role in Regulating Tumorigenic Gene Expression and Invasion Ability of HeLa Cells.

Science.gov (United States)

Zhang, Ying-Hui; Wang, Juan-Juan; Li, Min; Zheng, Han-Xi; Xu, Lan; Chen, You-Guo

2016-03-01

The objectives of this study were to investigate the functional effect of matrix metallopeptidase 14 (MMP14) on cell invasion in cervical cancer cells (HeLa line) and to study the underlying molecular mechanisms. Expression vector of short hairpin RNA targeting MMP14 was treated in HeLa cells, and then, transfection efficiency was verified by a florescence microscope. Transwell assay was used to investigate cell invasion ability in HeLa cells. Quantitative polymerase chain reaction and Western blotting analysis were used to detect the expression of MMP14 and relative factors in messenger RNA and protein levels, respectively. Matrix metallopeptidase 14 short hairpin RNA expression vector transfection obviously decreased MMP14 expression in messenger RNA and protein levels. Down-regulation of MMP14 suppressed invasion ability of HeLa cells and reduced transforming growth factor β1 and vascular endothelial growth factor B expressions. Furthermore, MMP14 knockdown decreased bone sialoprotein and enhanced forkhead box protein L2 expression in both RNA and protein levels. Matrix metallopeptidase 14 plays an important role in regulating invasion of HeLa cells. Matrix metallopeptidase 14 knockdown contributes to attenuating the malignant phenotype of cervical cancer cell.
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

Science.gov (United States)

Ahuja, Richa; Kumar, Vijay

2017-07-01

RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
Observations on the expression of human papillomavirus major capsid protein in HeLa cells.

Science.gov (United States)

Xiao, Chang-Yi; Fu, Bing-Bing; Li, Zhi-Ying; Mushtaq, Gohar; Kamal, Mohammad Amjad; Li, Jia-Hua; Tang, Gui-Cheng; Xiao, Shuo-Shuang

2015-01-01

The goal of this study was to identify the nature of the inclusion bodies that have been found in HeLa cells (cervical cancer immortal cell line) by electron microscope and to determine whether the major capsid protein (L1) of human papillomavirus (HPV) can be expressed in HPV-positive uterine cervix cancer cells. HPV L1 protein expression in HeLa cells was detected with anti-HPV L1 multivalent mice monoclonal antibody and rabbit polyclonal anti-HPV L1 antibody by ELISA, light microscope immunohistochemistry, electron microscope immunocytochemistry and Western blotting assays. Reverse transcriptional PCR (RT-PCR) was performed to detect the transcription of L1 mRNA in HeLa cells. The immortalized human keratinocyte HeCat was used as the negative control. HPV L1 proteins reacted positively in the lysate of HeLa cells by ELISA assays. HRP labeled light microscope immunohistochemistry assay showed that there was a strong HPV L1 positive reaction in HeLa cells. Under the electron microscope, irregular shaped inclusion bodies, assembled by many small and uniform granules, had been observed in the cytoplasm of some HeLa cells. These granules could be labeled by the colloidal gold carried by HPV L1 antibody. The Western blotting assay showed that there was a L1 reaction strap at 80-85 kDa in the HeLa cell lysates, hence demonstrating the existence of HPV18 L1 in HeLa cells. RT-PCR assay showed that the L1 mRNA was transcribed in HeLa cells. The inclusion bodies found in the cytoplasm of HeLa cells are composed of HPV18 L1 protein. Since HeLa cell line is a type of cervical cancer cells, this implies that HeLa cells have the ability to express HPV L1 proteins.

Paclitaxel-resistant HeLa cells have up-regulated levels of reactive oxygen species and increased expression of taxol resistance gene 1.

Science.gov (United States)

Bi, Wenxiang; Wang, Yuxia; Sun, Gaoying; Zhang, Xiaojin; Wei, Yongqing; Li, Lu; Wang, Xiaoyuan

2014-07-01

This study is to establish a paclitaxel (PTX)-resistant human cervical carcinoma HeLa cell line (HeLa/PTX) and to investigate its redox characteristics and the expression of taxol resistance gene 1 (Txr1). HeLa cells were treated with PTX and effects of PTX on cell proliferation were detected through cell counting and the MTT assay. Levels of cellular reactive oxygen species (ROS), reduced glutathione (GSH), and oxidized glutathione (GSSG) as well as the ratio of GSH to GSSG were measured by the 2,7-difluorescein diacetate (DCFH-DA) method and the 5,5'dithiobis(2-nitrobenzoic acid) (DTNB) method. Activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) were determined by the nitrite formation method, the molybdate colorimetric method, and the DTNB colorimetric method, respectively. The level of Txr1 mRNA was determined by real-time PCR. Compared with the regular HeLa cells, HeLa/PTX cells were larger in size and had more cytoplasmic granules. The population doubling time for HeLa/PTX cells was 1.32 times of that of HeLa cells (PHeLa/PTX cells showed stronger resistance to PTX than HeLa cells with a resistance index of 122.69. HeLa/PTX cells had higher levels of ROS (PHeLa cells. HeLa/PTX cells, with higher levels of ROS and Txr1 mRNA expression, are more resistant to PTX than HeLa cells.
Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

Science.gov (United States)

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

Science.gov (United States)

Tan, Cheng; Li, Wenfei; Wang, Wei

2013-12-19

Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.
[The Effect of TALENs-mediated Downregulation Expression of Nanog on Malignant Behavior of Cervical Cancer HeLa Cells].

Science.gov (United States)

Yu, Ai-qing; Li, Cheng-lin; Yang, Yi; Yan, Shi-rong

2016-01-01

To study the effect of downregulation expression of Nanog on malignant behavior of cervical cancer HeLa cells. Gene editing tool TALENs was employed to induce downregulation expression of Nanog, and Nanog mutation was evaluated by sequencing. RT-PCR and Western blot was used to detect the mRNA and protein expression level, respectively. Colony-formation assay, Transwell invasion assay, and chemotherapy sensibility assay was carried out to assess the capacity of colony-formation, invasion, and chemoresistance, respectively. TALENs successfully induced Nanog mutation and downregulated Nanog expression. Nanog mRNA and protein expression of Nanog-mutated monoclonal HeLa cells downregulated 3 times compared to thoses of wild-type HeLa cells (P HeLa cells were observed when compared to those of wild-type HeLa cells (P HeLa cells. Importantly, downregulation or silencing of Nanog is promising to be a novel strategy for the treatment of cervical carcinoma.
Dose-rate effects on the cell cycle and survival of S3 HeLa and V79 cells

International Nuclear Information System (INIS)

Mitchell, J.B.; Bedford, J.S.; Bailey, S.M.

1979-01-01

The effects of continuous irradiation at different dose rates on the cell cycle and on cell survival were studied using synchronized S3 HeLa and V79 cells. The minimum dose rate necessary to stop cell division was found to be approximately 23 rad/hr for HeLa cells and 270 rad/hr for V79 cells. For dose rates that stop cell division, cells progress through G 1 and S, with a small delay in the S phase, and are blocked in G 2 . Appreciable mitotic accumulation was observed for HeLa cells at dose rates which stopped cell division. By comparison, much less mitotic accumulation was observed for V79 cells over a range of dose rates from 37 to 270 rad/hr. Minimum mitotic delays for a variety of dose rates were determined for both cell lines. S3 HeLa cells are much more sensitive in this respect than V79 cells; however, it appeared that for higher dose rates the minimum mitotic delay in HeLa cells asymptotically approached a value of about 35 hr. In addition to the qualitative differences observed for the two cell lines in regard to mitotic accumulation, HeLa cells accumulated for prolonged periods in the presence of colcemid while V79 cells were blocked for only a few hours, HeLa cells show a dramatic effect of redistribution of cells into sensitive phases of the cell cycle during exposure, which was reflected in the survival curves at low dose rate. More cell killing per unit dose was observed at 37 than at 74 rad/hr
The 4.5 S RNA gene of Escherichia coli is essential for cell growth

DEFF Research Database (Denmark)

Brown, S; Fournier, M J

1984-01-01

The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

Science.gov (United States)

Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

2016-01-01

Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

Science.gov (United States)

Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

2015-04-07

During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

Science.gov (United States)

Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

2015-03-11

A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Construction of cell model of silenced Ku80 and the radiobiology change of HeLa cell

International Nuclear Information System (INIS)

Zhuang Liang; Yu Shiying; Huang Xiaoyuan; Xiong Huihua; Xiong Hua; Li Xiaolan; Leng Yan

2007-01-01

Objective: To construct the cell model of Ku80 with expression inhibited by siRNA and to explore the role of Ku80 in radiobiology. Methods: Ku80-siRNA expression plasmids were constructed and HeLa cells were transfected with these plasmids by lipofectamine. Western blotting was used to measure the expression of Ku80. After irradiation with 6 MV X ray, cells were collected and analyzed by flow cytometry for apoptosis and cell cycle at 24, 48 and 72 h; The radiobiology parameters of four cell lines were acquired by clone formation array. Results: Three stable transfected cell clones were obtained, and the inhibition rates of Ku80 protein expression of two positive clones were 89.3% and 96.4%; The apoptosis rates of HeLa cells Ku80 inhibited were higher than control cells at 48 and 72 after X ray irradiation (P 0.05). HeLa cells of silenced Ku80 had lower SF 2 and D 0 than control cells, and their SER (sensitization enhancement ratio) based on D 10 were 1.315 and 1.365, respectively. Conclusions: The HeLa cell models with Ku80 expression suppressed were successfully established; the inhibition of Ku80 by siRNA could enhance the radiosensitivity of HeLa cells. (authors)
Detecção da citotoxicidade de materiais biocompatíveis nas linhagens celulares MRC-5, HeLa e RC-IAL MRC-5, HeLa and RC-IAL cell lines sensitivity for detection of cytotoxicity of biocompatible materials

Directory of Open Access Journals (Sweden)

Aurea S. Cruz

1992-04-01

Full Text Available A sensibilidade de uma linhagem celular diplóide e duas heteroplóides, para a detecção de citotoxicidade através do método de difusão em camada de ágar sobre culturas celulares, foi avaliada experimentalmente com solução de ácido ascórbico em diferentes concentrações e, na prática, frente a 562 amostras de 21 diferentes materiais industriais enviados para análise na Seção de Culturas Celulares do Instituto Adolfo Lutz. A linhagem celular heteroplóide designada RC-IAL apresentou, em relação às linhagens MRC-5 e HeLa, maior sensibilidade porque revelou a presença de efeito citotóxico nas menores concentrações utilizadas (10 e 25 ug/ml do ácido ascórbico e apresentou maior diâmetro do halo citotóxico em 15 amostras e igual diâmetro em 16 das 43 amostras (7,6% que resultaram positivas. Nas 43 amostras positivas, a linhagem MRC-5 não revelou citotoxicidade em 3 amostras de espuma e 1 de resina acrílica. O polivinilcloreto (PVC e o polietileno, raramente revelaram positividade, enquanto plástico, algodão e resinas acrílicas revelaram citotoxicidade ao redor de 5%. Em vista dos resultados é discutida a proposta da utilização da linhagem RC-IAL e HeLa para a continuidade das futuras análises solicitadas ao Instituto Adolfo LutzThe sensitivity of diploid and heteroploid cell lines for detection of cytotoxicity using the agar diffusion method on cell culture, was tested with ascorbic acid solution of different concentrations. A total of 562 samples of 21 various materials were tested. The heteroploid cell line, RC-IAL, showed in relation to the MRC-5 and HeLa cell lines, greater sensitivity because it showed the presence of cytotoxic effect with the lowest concentration used (10 and 25ug/ml of ascorbic acid and showed greater diameter of cytotoxic halo in 15 samples and equal diameter in 16 of the 43 positive samples (7.6%. Out of 43 positive samples, the MRC-5 line did not show cytotoxicity in 3 sponge samples and
A phthalide derivative isolated from endophytic fungi Pestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells

International Nuclear Information System (INIS)

Chen, C.; Yang, R.L.

2013-01-01

MP [4-(3′,3′-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniae isolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27 KIP1 protein and p21 CIP1 mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21 CIP1 , p16 INK4a and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation of p73, JunB, FKHR, and Bim. The results indicate that MP may be a potential treatment for cervical cancer
A phthalide derivative isolated from endophytic fungi Pestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Chen, C. [College of Life Science, Hebei University, Baoding (China); Yang, R.L. [Key Laboratory of Microbial Diversity Research and Application of Hebei Province, Baoding, China, Key Laboratory of Microbial Diversity Research and Application of Hebei Province, Baoding (China)

2013-07-30

MP [4-(3′,3′-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniae isolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27{sup KIP1} protein and p21{sup CIP1} mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21{sup CIP1}, p16{sup INK4a} and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation of p73, JunB, FKHR, and Bim. The results indicate that MP may be a potential treatment for cervical cancer.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

International Nuclear Information System (INIS)

Zhang, H.; Wang, J.C.; Liu, L.F.

1988-01-01

Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
The Genomic and Transcriptomic Landscape of a HeLa Cell Line

Science.gov (United States)

Landry, Jonathan J. M.; Pyl, Paul Theodor; Rausch, Tobias; Zichner, Thomas; Tekkedil, Manu M.; Stütz, Adrian M.; Jauch, Anna; Aiyar, Raeka S.; Pau, Gregoire; Delhomme, Nicolas; Gagneur, Julien; Korbel, Jan O.; Huber, Wolfgang; Steinmetz, Lars M.

2013-01-01

HeLa is the most widely used model cell line for studying human cellular and molecular biology. To date, no genomic reference for this cell line has been released, and experiments have relied on the human reference genome. Effective design and interpretation of molecular genetic studies performed using HeLa cells require accurate genomic information. Here we present a detailed genomic and transcriptomic characterization of a HeLa cell line. We performed DNA and RNA sequencing of a HeLa Kyoto cell line and analyzed its mutational portfolio and gene expression profile. Segmentation of the genome according to copy number revealed a remarkably high level of aneuploidy and numerous large structural variants at unprecedented resolution. Some of the extensive genomic rearrangements are indicative of catastrophic chromosome shattering, known as chromothripsis. Our analysis of the HeLa gene expression profile revealed that several pathways, including cell cycle and DNA repair, exhibit significantly different expression patterns from those in normal human tissues. Our results provide the first detailed account of genomic variants in the HeLa genome, yielding insight into their impact on gene expression and cellular function as well as their origins. This study underscores the importance of accounting for the strikingly aberrant characteristics of HeLa cells when designing and interpreting experiments, and has implications for the use of HeLa as a model of human biology. PMID:23550136
Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

Science.gov (United States)

Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

2012-07-01

Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

Science.gov (United States)

Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

2018-01-01

The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.
Mitochondria-targeted superoxide dismutase (SOD2) regulates radiation resistance and radiation stress response in HeLa cells

International Nuclear Information System (INIS)

Hosoki, Ayaka; Yonekura, Shin-Ichiro; Zhao, Qing-Li

2012-01-01

Reactive oxygen species (ROS) act as a mediator of ionizing radiation-induced cellular damage. Previous studies have indicated that MnSOD (SOD2) plays a critical role in protection against ionizing radiation in mammalian cells. In this study, we constructed two types of stable HeLa cell lines overexpressing SOD2, HeLa S3/SOD2 and T-REx HeLa/SOD2, to elucidate the mechanisms underlying the protection against radiation by SOD2. SOD2 overexpression in mitochondria enhanced the survival of HeLa S3 and T-REx HeLa cells following γ-irradiation. The levels of γH2AX significantly decreased in HeLa S3/SOD2 and T-REx HeLa/SOD2 cells compared with those in the control cells. MitoSox TM Red assays showed that both lines of SOD2-expressing cells showed suppression of the superoxide generation in mitochondria. Furthermore, flow cytometry with a fluorescent probe (2',7'-dichlorofluorescein) revealed that the cellular levels of ROS increased in HeLa S3 cells during post-irradiation incubation, but the increase was markedly attenuated in HeLa S3/SOD2 cells. DNA microarray analysis revealed that, of 47,000 probe sets analyzed, 117 and 166 probes showed more than 2-fold changes after 5.5 Gy of γ-irradiation in control and HeLa S3/SOD2 cells, respectively. Pathway analysis revealed different expression profiles in irradiated control cells and irradiated SOD2-overexpressing cells. These results indicate that SOD2 protects HeLa cells against cellular effects of γ-rays through suppressing oxidative stress in irradiated cells caused by ROS generated in the mitochondria and through regulating the expression of genes which play a critical role in protection against ionizing radiation. (author)

Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

NARCIS (Netherlands)

Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,
Effect of inhibition of intermediate-conductance-Ca2+-activated K+ channels on HeLa cell proliferation

Directory of Open Access Journals (Sweden)

Ping Zhan

2018-01-01

Conclusion: CLT and blocking of IKCal gene expression effectively inhibits HeLa cell proliferation; therefore, the use of a blocking agent and RNAi both effectively downregulated the mRNA expression of IKCal, which in turn mediated the proliferation of HeLa cells, producing an antitumor effect.
5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

Science.gov (United States)

Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

2018-04-30

The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.
Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro

Directory of Open Access Journals (Sweden)

Wimmer Eckard

2005-11-01

Full Text Available Abstract Poliovirus protein 3CDpro possesses both proteinase and RNA binding activities, which are located in the 3Cpro domain of the protein. The RNA polymerase (3Dpol domain of 3CDpro modulates these activities of the protein. We have recently shown that the level of 3CDpro in HeLa cell-free in vitro translation-RNA replication reactions is suboptimal for efficient virus production. However, the addition of either 3CDpro mRNA or of purified 3CDpro protein to in vitro reactions, programmed with viral RNA, results in a 100-fold increase in virus yield. Mutational analyses of 3CDpro indicated that RNA binding by the 3Cpro domain and the integrity of interface I in the 3Dpol domain of the protein are both required for function. The aim of these studies was to determine the exact step or steps at which 3CDpro enhances virus yield and to determine the mechanism by which this occurs. Our results suggest that the addition of extra 3CDpro to in vitro translation RNA-replication reactions results in a mild enhancement of both minus and plus strand RNA synthesis. By examining the viral particles formed in the in vitro reactions on sucrose gradients we determined that 3CDpro has only a slight stimulating effect on the synthesis of capsid precursors but it strikingly enhances the maturation of virus particles. Both the stimulation of RNA synthesis and the maturation of the virus particles are dependent on the presence of an intact RNA binding site within the 3Cpro domain of 3CDpro. In addition, the integrity of interface I in the 3Dpol domain of 3CDpro is required for efficient production of mature virus. Surprisingly, plus strand RNA synthesis and virus production in in vitro reactions, programmed with full-length transcript RNA, are not enhanced by the addition of extra 3CDpro. Our results indicate that the stimulation of RNA synthesis and virus maturation by 3CDpro in vitro is dependent on the presence of a VPg-linked RNA template.
Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO

International Nuclear Information System (INIS)

Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico

2010-01-01

Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.
The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

International Nuclear Information System (INIS)

Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

2015-01-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype
The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

Energy Technology Data Exchange (ETDEWEB)

Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

2015-05-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.
Pro-inflammatory Cytokines Are Involved in Fluoride-Induced Cytotoxic Potential in HeLa Cells.

Science.gov (United States)

Wang, Hong-Wei; Zhou, Bian-Hua; Cao, Jian-Wen; Zhao, Jing; Zhao, Wen-Peng; Tan, Pan-Pan

2017-01-01

This study was designed to investigate the pro-inflammatory cytokines and their involvement in the cytotoxic potential of fluoride (F) in HeLa cells. HeLa cells were cultured with varying F concentrations (1-50 mg/L) for 48 h, and treatment effects were analyzed. The viability of HeLa cells was determined with a colorimetric method. The concentrations of IL-1β, IL-2, IL-6, and TNF-a in culture supernatant were measured through enzyme linked immunosorbent assay (ELISA). The mRNA expression levels of IL-1β, IL-2, IL-6 and TNF-a were subjected to transcript analysis and quantified through reverse transcription real-time PCR. Results showed that 10, 20 and 50 mg/L F significantly decreased the viability of HeLa cells incubated for 24 and 48 h. With their cytotoxic effect, the concentrations of IL-1β, IL-2, IL-6, and TNF-a decreased significantly in response to F, especially at 20 and 50 mg/L for 48 h. The mRNA expression levels of IL-1β, IL-2, IL-6, and TNF-a were downregulated at 50 mg/L F for 48 h. Therefore, F inhibited HeLa cell growth; as such, F could be used to alleviate the inhibition of pro-inflammatory cytokine expression.
5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

Science.gov (United States)

Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

2012-07-17

In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.
Correlation between slowly repairable double-strand breaks and thermal radiosensitization in the human HeLa S3 cell line

NARCIS (Netherlands)

Kampinga, HH; Hiemstra, YS; Konings, AWT; Dikomey, E

The effect of heat on double-strand breaks (dsb) repair was compared with thermal radiosensitization using HeLa S3 cells. Cells were exposed to a combined treatment of X-irradiation followed by heat (44 degrees C, 0.5 h) separated by time intervals up to 8h. DNA dsb were measured by PFGE and
Imaging of RNA in situ hybridization by atomic force microscopy

NARCIS (Netherlands)

Kalle, W.H.J.; Macville, M.V.E.; van de Corput, M.P.C.; de Grooth, B.G.; Tanke, H.J.; Raap, A.K.

In this study we investigated the possibility of imaging internal cellular molecules after cytochemical detection with atomic force microscopy (AFM). To this end, rat 9G and HeLa cells were hybridized with haptenized probes for 28S ribosomal RNA, human elongation factor mRNA and cytomegalovirus
Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

International Nuclear Information System (INIS)

Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

1986-01-01

The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical
SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

Science.gov (United States)

Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

2016-03-01

Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

Science.gov (United States)

Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

1978-01-01

The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.
Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

Science.gov (United States)

Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

2017-03-01

Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in
Knock-down of NDRG2 sensitizes cervical cancer Hela cells to cisplatin through suppressing Bcl-2 expression

International Nuclear Information System (INIS)

Liu, Junye; Guo, Guozhen; Yang, Le; Zhang, Jian; Zhang, Jing; Chen, Yongbin; Li, Kangchu; Li, Yurong; Li, Yan; Yao, Libo

2012-01-01

NDRG2, a member of N-Myc downstream regulated gene family, plays some roles in cellular stress, cell differentiation and tumor suppression. We have found that NDRG2 expression in cervical cancer Hela cells increases significantly upon stimulation with cisplatin, the most popular chemotherapeutic agent currently used for the treatment of advanced cervical cancer. This interesting phenomenon drove us to evaluate the role of NDRG2 in chemosensitivity of Hela cells. In the present study, RNA interference was employed to down-regulate NDRG2 expression in Hela cells. RT-PCR and Western blot were used to detect expression of NDRG2, Bcl-2 and Bax in cancer cells. Real-time PCR was applied to detect miR-15b and miR-16 expression levels. Drug sensitivity was determined with MTT assay. Cell cloning efficiency was evaluated by Colony-forming assay. Apoptotic cells were detected with annexin V staining and flow cytometry. In vitro drug sensitivity assay revealed that suppression of NDRG2 could sensitize Hela cells to cisplatin. Down-regulation of NDRG2 didn’t influence the colony-forming ability but promoted cisplatin-induced apoptosis of Hela cells. Inhibition of NDRG2 in Hela cells was accompanied by decreased Bcl-2 protein level. However, Bcl-2 mRNA level was not changed in Hela cells with down-regulation of NDRG2. Further study indicated that miR-15b and miR-16, two microRNAs targetting Bcl-2, were significantly up-regulated in NDRG2-suppressed Hela cells. These data suggested that down-regulation of NDRG2 could enhance sensitivity of Hela cells to cisplatin through inhibiting Bcl-2 protein expression, which might be mediated by up-regulating miR-15b and miR-16
Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

Science.gov (United States)

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Depletion of cellular poly (A) binding protein prevents protein synthesis and leads to apoptosis in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Thangima Zannat, Mst.; Bhattacharjee, Rumpa B. [Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G2W1 (Canada); Bag, Jnanankur, E-mail: jbag@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G2W1 (Canada)

2011-05-13

Highlights: {yields} Depletion of cellular PABP level arrests mRNA translation in HeLa cells. {yields} PABP knock down leads to apoptotic cell death. {yields} PABP depletion does not affect transcription. {yields} PABP depletion does not lead to nuclear accumulation of mRNA. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) is important in mRNA translation and stability. In yeast, depletion of PABP leads to translation arrest. Similarly, the PABP gene in Drosophila is important for proper development. It is however uncertain, whether mammalian PABP is essential for mRNA translation. Here we showed the effect of PABP depletion on mRNA metabolism in HeLa cells by using a small interfering RNA. Our results suggest that depletion of PABP prevents protein synthesis and consequently leads to cell death through apoptosis. Interestingly, no detectable effect of PABP depletion on transcription, transport and stability of mRNA was observed.
Depletion of cellular poly (A) binding protein prevents protein synthesis and leads to apoptosis in HeLa cells

International Nuclear Information System (INIS)

Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

2011-01-01

Highlights: → Depletion of cellular PABP level arrests mRNA translation in HeLa cells. → PABP knock down leads to apoptotic cell death. → PABP depletion does not affect transcription. → PABP depletion does not lead to nuclear accumulation of mRNA. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) is important in mRNA translation and stability. In yeast, depletion of PABP leads to translation arrest. Similarly, the PABP gene in Drosophila is important for proper development. It is however uncertain, whether mammalian PABP is essential for mRNA translation. Here we showed the effect of PABP depletion on mRNA metabolism in HeLa cells by using a small interfering RNA. Our results suggest that depletion of PABP prevents protein synthesis and consequently leads to cell death through apoptosis. Interestingly, no detectable effect of PABP depletion on transcription, transport and stability of mRNA was observed.
Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

Science.gov (United States)

Garcia, S; Kovařík, A

2013-07-01

In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

DNA damage in synchronized hela cells irradiated with ultraviolet

International Nuclear Information System (INIS)

Downes, C.S.; Collins, A.R.S.; Johnson, R.T.

1979-01-01

The lethal effect of uv radiation on HeLa cells is least in mitosis and greatest in late G 1 -early S. Photochemical damage to HeLa DNA, as measured by thymine-containing dimer formation and by alkaline sucrose sedimentation, also increases from mitosis towards early S phase. Computer simulations of uv absorption by an idealized HeLa cell at different stages of the cell cycle indicate that changes in damage could be due solely to changes in chromatin geometry. But survival is not exclusively a function of damage
Four years of HELAS

Science.gov (United States)

Roth, M.; Lühe, O. v. d.; Aerts, C.; Christensen-Dalsgaard, J.; Corbard, T.; Daszyńska-Daszkiewicz, J.; Di Mauro, M. P.; Gizon, L.; Jiménez-Reyes, S.; Monteiro, M. J. P. F. G.; Pallé, P. L.; Thompson, M. J.

2010-12-01

The European Coordination Action on HELio- and ASteroseismology (HELAS) has completed its fourth and final year of initial funding by the European Commission. Set up as a network which combines solar and stellar physics communities in the important and vigorously evolving field of seismology, HELAS has been able to coordinate the efforts of European astronomers with remarkable success. Four large international conferences including the HELAS-IV conference on Lanzarote as well as many workshops were organized with a substantial contribution from HELAS. About a dozen workshops, addressing specialized questions in global and local helioseismology and asteroseismology were entirely organized by HELAS. Data analysis tools to prepare the European communities for the upcoming influx of data from new missions have been prepared, tested and demonstrated. Lecture notes and outreach material have been assembled and prepared for general access. As a result, HELAS has an important impact on the scientific output of the astrophysics seismology communities and significantly increased the visibility of European research in this field. This paper summarizes the activities and accomplishments of HELAS.
5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Investigation of role of aspartame on apoptosis process in HeLa cells

Directory of Open Access Journals (Sweden)

Muthuraman Pandurangan

2016-07-01

Full Text Available Aspartame is an artificial sweetener used as an alternate for sugar in several foods and beverages. The study reports that consumption of aspartame containing product could lead to cancer. However, the effect of aspartame on apoptosis process in cancer is not yet understood clearly. HeLa cells were exposed to different concentrations (0.01–0.05 mg/ml of aspartame for 48 h. Cytotoxicity of aspartame on cancer cells was determined by SRB assay. The result indicates no significant changes on cell viability. Aspartame suppresses apoptosis process in cancer cells by down-regulation of mRNA expression of tumor suppressor gene p53, and pro-apoptotic gene bax. It up-regulates anti-apoptotic gene bcl-2 mRNA expression. In addition, Ki 67 and PCNA mRNA, and protein expressions were determined. Taking all these together, we conclude that aspartame may be a potent substance to slow-down the apoptosis process in HeLa cells. Further works are ongoing to understand the biochemical and molecular mechanism of aspartame in cancer cells.
Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

DEFF Research Database (Denmark)

Christiansen, J; Douthwaite, S R; Christensen, A

1985-01-01

Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...
DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

Directory of Open Access Journals (Sweden)

Willson Richard C

2010-12-01

Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use
Primary and secondary structure of U8 small nuclear RNA

International Nuclear Information System (INIS)

Reddy, R.; Henning, D.; Busch, H.

1985-01-01

U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus. In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively
Nanosecond pulsed electric fields induce poly(ADP-ribose) formation and non-apoptotic cell death in HeLa S3 cells

Energy Technology Data Exchange (ETDEWEB)

Morotomi-Yano, Keiko; Akiyama, Hidenori [Institute of Pulsed Power Science, Kumamoto University, Kumamoto 860-8555 (Japan); Yano, Ken-ichi, E-mail: yanoken@kumamoto-u.ac.jp [Priority Organization for Innovation and Excellence, Kumamoto University, Kumamoto 860-8555 (Japan)

2013-08-30

Highlights: •Nanosecond pulsed electric field (nsPEF) is a new and unique means for life sciences. •Apoptosis was induced by nsPEF exposure in Jurkat cells. •No signs of apoptosis were detected in HeLa S3 cells exposed to nsPEFs. •Formation of poly(ADP-ribose) was induced in nsPEF-exposed HeLa S3 cells. •Two distinct modes of cell death were activated by nsPEF in a cell-dependent manner. -- Abstract: Nanosecond pulsed electric fields (nsPEFs) have recently gained attention as effective cancer therapy owing to their potency for cell death induction. Previous studies have shown that apoptosis is a predominant mode of nsPEF-induced cell death in several cell lines, such as Jurkat cells. In this study, we analyzed molecular mechanisms for cell death induced by nsPEFs. When nsPEFs were applied to Jurkat cells, apoptosis was readily induced. Next, we used HeLa S3 cells and analyzed apoptotic events. Contrary to our expectation, nsPEF-exposed HeLa S3 cells exhibited no molecular signs of apoptosis execution. Instead, nsPEFs induced the formation of poly(ADP-ribose) (PAR), a hallmark of necrosis. PAR formation occurred concurrently with a decrease in cell viability, supporting implications of nsPEF-induced PAR formation for cell death. Necrotic PAR formation is known to be catalyzed by poly(ADP-ribose) polymerase-1 (PARP-1), and PARP-1 in apoptotic cells is inactivated by caspase-mediated proteolysis. Consistently, we observed intact and cleaved forms of PARP-1 in nsPEF-exposed and UV-irradiated cells, respectively. Taken together, nsPEFs induce two distinct modes of cell death in a cell type-specific manner, and HeLa S3 cells show PAR-associated non-apoptotic cell death in response to nsPEFs.
Nanosecond pulsed electric fields induce poly(ADP-ribose) formation and non-apoptotic cell death in HeLa S3 cells

International Nuclear Information System (INIS)

Morotomi-Yano, Keiko; Akiyama, Hidenori; Yano, Ken-ichi

2013-01-01

Highlights: •Nanosecond pulsed electric field (nsPEF) is a new and unique means for life sciences. •Apoptosis was induced by nsPEF exposure in Jurkat cells. •No signs of apoptosis were detected in HeLa S3 cells exposed to nsPEFs. •Formation of poly(ADP-ribose) was induced in nsPEF-exposed HeLa S3 cells. •Two distinct modes of cell death were activated by nsPEF in a cell-dependent manner. -- Abstract: Nanosecond pulsed electric fields (nsPEFs) have recently gained attention as effective cancer therapy owing to their potency for cell death induction. Previous studies have shown that apoptosis is a predominant mode of nsPEF-induced cell death in several cell lines, such as Jurkat cells. In this study, we analyzed molecular mechanisms for cell death induced by nsPEFs. When nsPEFs were applied to Jurkat cells, apoptosis was readily induced. Next, we used HeLa S3 cells and analyzed apoptotic events. Contrary to our expectation, nsPEF-exposed HeLa S3 cells exhibited no molecular signs of apoptosis execution. Instead, nsPEFs induced the formation of poly(ADP-ribose) (PAR), a hallmark of necrosis. PAR formation occurred concurrently with a decrease in cell viability, supporting implications of nsPEF-induced PAR formation for cell death. Necrotic PAR formation is known to be catalyzed by poly(ADP-ribose) polymerase-1 (PARP-1), and PARP-1 in apoptotic cells is inactivated by caspase-mediated proteolysis. Consistently, we observed intact and cleaved forms of PARP-1 in nsPEF-exposed and UV-irradiated cells, respectively. Taken together, nsPEFs induce two distinct modes of cell death in a cell type-specific manner, and HeLa S3 cells show PAR-associated non-apoptotic cell death in response to nsPEFs
Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

DEFF Research Database (Denmark)

Brown, S

1987-01-01

A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....
Effect of guinea pig or monkey colonic mucus on Shigella aggregation and invasion of HeLa cells by Shigella flexneri 1b and 2a.

OpenAIRE

Dinari, G; Hale, T L; Washington, O; Formal, S B

1986-01-01

The effects of guinea pig and rhesus monkey colonic mucus preparations on Shigella aggregation and invasion of HeLa cell monolayers by Shigella flexneri serotype 1b, 2a, and 5 strains were investigated. Guinea pig mucus caused agglutination of S. flexneri serotype 1b but not of S. flexneri serotype 2a or 5. Guinea pig mucus also inhibited HeLa cell invasion by S. flexneri serotypes 1b and 2a. Monkey mucus neither agglutinated any Shigella strain nor inhibited HeLa cell invasion.
[Cloning of human CD45 gene and its expression in Hela cells].

Science.gov (United States)

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

Directory of Open Access Journals (Sweden)

Giulio Donati

2013-07-01

Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

Science.gov (United States)

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
CYB5D2 requires heme-binding to regulate HeLa cell growth and confer survival from chemotherapeutic agents.

Directory of Open Access Journals (Sweden)

Anthony Bruce

Full Text Available The cytochrome b5 domain containing 2 (CYB5D2; Neuferricin protein has been reported to bind heme, however, the critical residues responsible for heme-binding are undefined. Furthermore, the relationship between heme-binding and CYB5D2-mediated intracellular functions remains unknown. Previous studies examining heme-binding in two cytochrome b5 heme-binding domain-containing proteins, damage-associated protein 1 (Dap1; Saccharomyces cerevisiae and human progesterone receptor membrane component 1 (PGRMC1, have revealed that conserved tyrosine (Y 73, Y79, aspartic acid (D 86, and Y127 residues present in human CYB5D2 may be involved in heme-binding. CYB5D2 binds to type b heme, however, only the substitution of glycine (G at D86 (D86G within its cytochrome b5 heme-binding (cyt-b5 domain abolished its heme-binding ability. Both CYB5D2 and CYB5D2(D86G localize to the endoplasmic reticulum. Ectopic CYB5D2 expression inhibited cell proliferation and anchorage-independent colony growth of HeLa cells. Conversely, CYB5D2 knockdown and ectopic CYB5D2(D86G expression increased cell proliferation and colony growth. As PGRMC1 has been reported to regulate the expression and activities of cytochrome P450 proteins (CYPs, we examined the role of CYB5D2 in regulating the activities of CYPs involved in sterol synthesis (CYP51A1 and drug metabolism (CYP3A4. CYB5D2 co-localizes with cytochrome P450 reductase (CYPOR, while CYB5D2 knockdown reduced lanosterol demethylase (CYP51A1 levels and rendered HeLa cells sensitive to mevalonate. Additionally, knockdown of CYB5D2 reduced CYP3A4 activity. Lastly, CYB5D2 expression conferred HeLa cell survival from chemotherapeutic agents (paclitaxel, cisplatin and doxorubicin, with its ability to promote survival being dependent on its heme-binding ability. Taken together, this study provides evidence that heme-binding is critical for CYB5D2 in regulating HeLa cell growth and survival, with endogenous CYB5D2 being required to
Evaluation of 5.8S rRNA to identify Penaeus semisulcatus and its subspecies, Penaeus semisulcatus persicus (Penaeidae and some Decapoda species

Directory of Open Access Journals (Sweden)

Zahra Noroozi

2015-10-01

Full Text Available The green tiger prawn, Penaeus semisulcatus is one of the most important members of the family Penaeidae in the Persian Gulf. Based on the morphological characteristics, two groups, including P. semisulcatus and its subspecies viz. P. s. persicus are recognized. This study was conducted to investigate the genetic distance between P. semisulcatus and P. s. persicus by analyzing partial sequence of 5.8S rRNA. Another objective of this study is to evaluate the ability of 5.8S rRNA to identify the species of Decapoda. The results indicated that the 5.8S rRNA gene of both P. semisulcatus and P. s. persicus were exactly identical, and sequence variation was not observed. The results also indicated that 5.8S rRNA sequences between species of the same genus of analysed species of Decapoda are conserved, and no genetic distance was observed in species level. The low evolutionary rate and efficient conservation of the 5.8S rRNA can be attributed to its role in the translation process.
Rev1, Rev3, or Rev7 siRNA Abolishes Ultraviolet Light-Induced Translesion Replication in HeLa Cells: A Comprehensive Study Using Alkaline Sucrose Density Gradient Sedimentation

Directory of Open Access Journals (Sweden)

Jun Takezawa

2010-01-01

Full Text Available When a replicative DNA polymerase stalls upon encountering a lesion on the template strand, it is relieved by other low-processivity polymerase(s, which insert nucleotide(s opposite the lesion, extend by a few nucleotides, and dissociate from the 3′-OH. The replicative polymerase then resumes DNA synthesis. This process, termed translesion replication (TLS or replicative bypass, may involve at least five different polymerases in mammals, although the participating polymerases and their roles have not been entirely characterized. Using siRNAs originally designed and an alkaline sucrose density gradient sedimentation technique, we verified the involvement of several polymerases in ultraviolet (UV light-induced TLS in HeLa cells. First, siRNAs to Rev3 or Rev7 largely abolished UV-TLS, suggesting that these 2 gene products, which comprise Polζ, play a main role in mutagenic TLS. Second, Rev1-targeted siRNA also abrogated UV-TLS, indicating that Rev1 is also indispensable to mutagenic TLS. Third, Polη-targeted siRNA also prevented TLS to a greater extent than our expectations. Forth, although siRNA to Polι had no detectable effect, that to Polκ delayed UV-TLS. To our knowledge, this is the first study reporting apparent evidence for the participation of Polκ in UV-TLS.
YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

DEFF Research Database (Denmark)

Andersen, Niels Møller; Douthwaite, Stephen

2006-01-01

generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...
Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

Science.gov (United States)

Curtiss, W C; Vournakis, J N

1984-01-01

Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

[Astragalus polysaccharide may increase sensitivity of cervical cancer HeLa cells to cisplatin by regulating cell autophagy].

Science.gov (United States)

Zhai, Qiu-Li; Hu, Xiang-Dan; Xiao, Jing; Yu, Dong-Qing

2018-02-01

This study aimed to investigate the possible sensitivity of Astragalus polysaccharides, in order to improve the chemosensitivity of cervical cancer HeLa cells to cisplatin by regulating the cell autophagy, and explore its possible mechanism. In this study, HeLa cells were divided into control group, cisplatin group, Astragalus polysaccharide group, and Astragalus polysaccharide combined with cisplatin group. MTT assay was used to detect the proliferation of cervical cancer HeLa cells. Flow cytometry was used to detect the apoptosis and cycle of HeLa cells in each experimental group. RT-PCR was used to detect the mRNA expression of autophagy-related proteins beclin1, LC3Ⅱ and p62. The expression levels of autophagy-related proteins beclin1, LC3Ⅱ, LC3Ⅰ and p62 were detected by WB method. MTT results showed that compared with the control group, the proliferation of HeLa cells was significantly inhibited in each administration group( P HeLa cells was significantly increased( P HeLa cells to cisplatin by regulating the cell autophagy. Its possible mechanism of action is correlated with the up-regulation of autophagy-related proteins beclin1, the promote the conversion from LC3Ⅰ to LC3Ⅱ, the down-regulation of labeled protein p62, and the enhancement of HeLa cell autophagic activity, thereby increasing the sensitivity of HeLa cells to cisplatin chemotherapy. Copyright© by the Chinese Pharmaceutical Association.
Co-encapsulation of chrysophsin-1 and epirubicin in PEGylated liposomes circumvents multidrug resistance in HeLa cells.

Science.gov (United States)

Lo, Yu-Li; Tu, Wei-Chen

2015-12-05

Chrysophsin-1, an amphipathic alpha-helical antimicrobial peptide, is isolated from the gills of the red sea bream and possesses different structure and mechanism(s) in comparison with traditional multidrug resistance (MDR) modulators. For the purpose of reducing off-target normal cell toxicity, it is rational to incorporate chrysophsin-1 and epirubicin in a PEGylated liposomal formulation. In the present study, we report a multifunctional liposomes with epirubicin as an antineoplastic agent and an apoptosis inducer, as well as chrysophsin-1 as a MDR transporter inhibitor and an apoptosis modulator in human cervical cancer HeLa cells. Co-incubation of HeLa cells with PEGylated liposomal formulation of epirubicin and chrysophsin-1 resulted in a significant increase in the cytotoxicity of epirubicin. The liposomal formulations of epirubicin and/or chrysophsin-1 were shown to considerably improve the intracellular H2O2 and O2(-) levels of HeLa cells. Furthermore, these treatments were found to extensively reduce mRNA expression levels of MDR1, MRP1, and MRP2. The addition of chrysophsin-1 in liposomes was demonstrated to substantially enhance the intracellular accumulation of epirubicin in HeLa cells. Moreover, the PEGylated liposomes of epirubicin and chrysophsin-1 were also found to significantly increase the mRNA expressions of p53, Bax, and Bcl-2. The ratio of Bax to Bcl-2 was noticeably amplified in the presence of these formulations. Apoptosis induction was also validated by chromatin condensation, a reduction in mitochondrial membrane potential, the increased sub-G1 phase of cell cycle, and more populations of apoptosis using annexin V/PI assay. These formulations were verified to increase the activity and mRNA expression levels of caspase-9 and caspases-3. Collectively, our findings provide the first evidence that cotreatment with free or liposomal chrysophsin-1 and epirubicin leads to cell death in human cervical cancer cells through the ROS
Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

Science.gov (United States)

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion
Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

Science.gov (United States)

Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

2014-04-01

Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

Science.gov (United States)

Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

2012-01-01

5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.
An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

International Nuclear Information System (INIS)

Timmins, P.A.; Langowski, J.; Brown, R.S.

1988-01-01

The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA
Organization and transient expression of the gene for human U11 snRNA

Science.gov (United States)

Clemens, Suter-Crazzolara; Walter, Keller

1991-01-01

The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214
The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

Science.gov (United States)

Branciamore, Sergio; Di Giulio, Massimo

2012-04-01

The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.
Analysis of RNA binding by the dengue virus NS5 RNA capping enzyme.

Directory of Open Access Journals (Sweden)

Brittney R Henderson

Full Text Available Flaviviruses are small, capped positive sense RNA viruses that replicate in the cytoplasm of infected cells. Dengue virus and other related flaviviruses have evolved RNA capping enzymes to form the viral RNA cap structure that protects the viral genome and directs efficient viral polyprotein translation. The N-terminal domain of NS5 possesses the methyltransferase and guanylyltransferase activities necessary for forming mature RNA cap structures. The mechanism for flavivirus guanylyltransferase activity is currently unknown, and how the capping enzyme binds its diphosphorylated RNA substrate is important for deciphering how the flavivirus guanylyltransferase functions. In this report we examine how flavivirus NS5 N-terminal capping enzymes bind to the 5' end of the viral RNA using a fluorescence polarization-based RNA binding assay. We observed that the K(D for RNA binding is approximately 200 nM Dengue, Yellow Fever, and West Nile virus capping enzymes. Removal of one or both of the 5' phosphates reduces binding affinity, indicating that the terminal phosphates contribute significantly to binding. RNA binding affinity is negatively affected by the presence of GTP or ATP and positively affected by S-adensyl methoninine (SAM. Structural superpositioning of the dengue virus capping enzyme with the Vaccinia virus VP39 protein bound to RNA suggests how the flavivirus capping enzyme may bind RNA, and mutagenesis analysis of residues in the putative RNA binding site demonstrate that several basic residues are critical for RNA binding. Several mutants show differential binding to 5' di-, mono-, and un-phosphorylated RNAs. The mode of RNA binding appears similar to that found with other methyltransferase enzymes, and a discussion of diphosphorylated RNA binding is presented.
Effects of 3-AB on PARP expression of Hela cells and apoptosis and cell cycle progression of Hela cells after X-rays irradiation

International Nuclear Information System (INIS)

Du Xiang; Zhao Hongguang; Guo Wei; Gong Shouliang; Wang Wen

2007-01-01

Objective: To study the changes of apoptosis and cell cycle progression of Hela cells after the poly (ADP- ribose) polymerase (PARP) was inhibited by its inhibitor 3-aminobenzamid (3-AB) and the mechanisms of PARP interaction with Hela cells damaged by irradiation. Methods: Hela cell line was used. Flow cytometry (FCM) was used to examine the PARP expression of control and 3 AB groups at 0, 2, 4, 8, 12 h alter administration with 5 mmol·L -1 3-AB. The percentage of apoptotic cells and cell cycle progression ol control, irradiation, 3-AB plus irradiation groups were measured with FCM at 2, 8, 12, 24 h after exposure to 2 Gy irradiation following administration with 5 mmol·L -1 3-AB. Results: The percentage of Hela cells with positive expression of PARP protein decreased after administration with 3-AB and there was significant difference between 3-AB plus irradiation group and control group (P 2 cells in the 3-AB plus irradiation group were lower than those in the irradiation group (P 2 arrest induced by irradiation. (authors)
A systems biology analysis of the changes in gene expression via silencing of HPV-18 E1 expression in HeLa cells.

Science.gov (United States)

Castillo, Andres; Wang, Lu; Koriyama, Chihaya; Eizuru, Yoshito; Jordan, King; Akiba, Suminori

2014-10-01

Previous studies have reported the detection of a truncated E1 mRNA generated from HPV-18 in HeLa cells. Although it is unclear whether a truncated E1 protein could function as a replicative helicase for viral replication, it would still retain binding sites for potential interactions with different host cell proteins. Furthermore, in this study, we found evidence in support of expression of full-length HPV-18 E1 mRNA in HeLa cells. To determine whether interactions between E1 and cellular proteins play an important role in cellular processes other than viral replication, genome-wide expression profiles of HPV-18 positive HeLa cells were compared before and after the siRNA knockdown of E1 expression. Differential expression and gene set enrichment analysis uncovered four functionally related sets of genes implicated in host defence mechanisms against viral infection. These included the toll-like receptor, interferon and apoptosis pathways, along with the antiviral interferon-stimulated gene set. In addition, we found that the transcriptional coactivator E1A-binding protein p300 (EP300) was downregulated, which is interesting given that EP300 is thought to be required for the transcription of HPV-18 genes in HeLa cells. The observed changes in gene expression produced via the silencing of HPV-18 E1 expression in HeLa cells indicate that in addition to its well-known role in viral replication, the E1 protein may also play an important role in mitigating the host's ability to defend against viral infection.
Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

Science.gov (United States)

Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

2010-08-16

In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy
Juglans mandshurica Maxim extracts exhibit antitumor activity on HeLa cells in vitro.

Science.gov (United States)

Xin, Nian; Hasan, Murtaza; Li, Wei; Li, Yan

2014-04-01

The present study examined the potential application of Juglans mandshurica Maxim extracts (HT) for cancer therapy by assessing their anti‑proliferative activity, reduction of telomerase activity, induction of apoptosis and cell cycle arrest in S phase in HeLa cells. From the perspective of using HT as a herbal medicine, photomicroscopy and florescent microscopy techniques were utilized to characterize the effect of the extracts on telomerase activity and cell morphology. Flow cytometry was employed to study apoptosis and cell cycle of HeLa cells, and DNA laddering was performed. The results showed that HT inhibited cell proliferation and telomerase activity, induced apoptosis and caused S phase arrest of HeLa cells in vitro. HT inhibited HeLa cell proliferation significantly, and the highest inhibition rate was 83.7%. A trap‑silver staining assay showed that HT was capable of markedly decreasing telomerase activity of HeLa cells and this inhibition was enhanced in a time‑ and dose‑dependent manner. Results of a Hoechst 33258 staining assay showed that HeLa cells treated by HT induced cell death. Through DNA agarose gel electrophoresis, DNA ladders of HeLa cells treated with HT were observed, indicating apoptosis. In conclusion, the present study demonstrated that HT exhibited anti‑tumor effects comprising the inhibition of growth and telomerase activity as well as apoptosis and cell cycle arrest in HeLa cells.
Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
Radioprotective effect of calorie restriction in Hela cells and SD rats

International Nuclear Information System (INIS)

Yang Yang; Chong Yu; Jiao Yang; Xu Jiaying; Fan Saijun

2012-01-01

Objective: To explore the effect of low calorie metabolism on the survival of HeLa cells exposed to X-rays, and the influence of starvation on the antioxidative factors in the blood of rats after irradiation. Methods: MTT method was used to evaluate the impact of different concentration glucose on the proliferation of HeLa cells. Colony formation assay was employed to detect the influence of glucose (1, 5, 10 and 25 mmol/L) on radiosensitivity of HeLa cells. Flow cytometry assay was used to analyze distribution of cell cycle and apoptosis. 60 male SD rats were randomly divided into 6 groups with 10 rats each. Rats in every two groups were fed ad libitum, fasted for 24 h and fasted for 48 h, respectively. Rats in one group of each approach were respectively exposed to whole-body X-rays at 11 Gy. At 2 h after irradiation,all of rats were sacrificed and their venous blood was collected. Elisa kits were used to detect superoxide dismutase (SOD) and total antioxidant capacity (T-AOC). Results: An increased viability was observed in HeLa cells treated with the glucose at low concentration (<25 mmol/L), while HeLa cell growth was inhibited by glucose at doses of >25 mmol/L. Relevant to cells treated with 1 mmoL/L glucose, SERs (sensitive enhancement ratio) in cells exposed to 5, 10 and 25 mmol/L glucose were 1.07, 1.10 and 1.23,respectively. A reduction of G 2 /M and S arrests and apoptosis caused by 6 Gy X-ray irradiation were observed [(49.68 ±1.88)% and (35.54±1.45)% at G 2 /M phase, (16.88 ±1.22)% and (10.23 ±1.65)% at S phase, t=10.42, 5.61, P<0.05] and in the cells treated with 1 mmol/L glucose compared with cells treated with 25 mmol/L glucose [(25.50 ± 0.95)% and (7.56 ± 1.07)%, t=21.72, P<0.05].Without irradiation, calorie restriction exhibited a negligible influence on SOD and T-AOC in rats. However, after 11 Gy irradiation, compared with rats fed ad libitum, the levels of SOD and T-AOC were significantly increased in rats with calorie restriction (t=40
Adenovirus DNA replication in vitro is stimulated by RNA from uninfected HeLa cells

NARCIS (Netherlands)

Vliet, P.C. van der; Dam, D. van; Kwant, M.M.

1984-01-01

Adenovirus DNA replication was studied in a partially reconstituted system consisting of purified viral proteins (DNA-binding protein, precursor terminal protein and Ad DNA polymerase) and a nuclear extract from uninfected HeLa cells. Optimal DNA replication required the presence of a heat-stable,
A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

Science.gov (United States)

Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

2017-11-06

Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.
[miR-143 inhibits cell proliferation through targeted regulating the expression of K-ras gene in HeLa cells].

Science.gov (United States)

Qin, H X; Cui, H K; Pan, Y; Hu, R L; Zhu, L H; Wang, S J

2016-12-23

Objective: To explore the effect of microRNA miR-143 on the proliferation of cervical cancer HeLa cells through targeted regulating the expression of K-ras gene. Methods: The luciferase report carrier containing wild type 3'-UTR of K-ras gene (K-ras-wt) or mutated 3'-UTR of the K-ras (K-ras-mut) were co-transfected with iR-143 mimic into the HeLa cells respectively, and the targeting effect of miR-143 in the transfectants was verified by the dual luciferase report system. HeLa cells were also transfected with miR-143 mimic (miR-143 mimic group), mimic control (negative control group), and miR-143 mimic plus K-ras gene (miR-143 mimic+ K-ras group), respectively. The expression of miR-143 in the transfected HeLa cells was detected by real-time PCR (RT-PCR), and the expression of K-ras protein was detected by Western blot. The cell proliferation activity of each group was examined by MTT assay. In addition, human cervical cancer tissue samples ( n =5) and cervical intraepithelial neoplasia tissue samples ( n =5) were also examined for the expression of miR-143 and K-ras protein by RT-PCR and Western blot, respectively. Results: The luciferase report assay showed that co-transfection with miR-143 mimic decreased the luciferase activity of the K-ras-wt significantly, but did not inhibit the luciferase activity of the K-ras-mut. The expression of miR-143 in the HeLa cells transfected with miR-143 mimic was significantly higher than that in the HeLa cells transfected with the mimic control (3.31±0.45 vs 0.97±0.22, P cell proliferative activity of the miR-143 mimic group was significantly lower than that of the negative control group ( P cell proliferative activity of the miR-143 mimic+ K-ras group was also significantly lower than the control group ( P HeLa cells through targeted regulating the expression of K-ras gene. In human cervical cancer tissues of a small sample set, the expression of miR-143 is downregulated, and the expression of K-ras is upregulated.
[Effect of NOR1 gene knockdown on the biological behavior of HeLa cells].

Science.gov (United States)

Tan, Yixin; Li, Wenjuan; Yi, Mei; Wang, Wei; Zheng, Pan; Zhang, Haijing; Xiang, Bo; Li, Guiyuan

2014-08-01

To explore the effect of the oxidored nitro domain containing protein 1 (NOR1) gene knockdown on the biological behavior of HeLa cells in cervical carcinoma. The recombinant plasmids pSUPER-shNOR1-1, pSUPER-shNOR1-2 and pSUPERscramble, which targeted to NOR1 gene, were constructed by pSUPER.neo+GFP vector, transfected into HeLa cells respectively using Lipofectamine 2000 reagent, and followed by G418 selection. The expression level of NOR1 mRNA and protein were determined by RT-PCR and Western blotting, respectively. Methyl thiazolyl tetrazolium (MTT) assay was performed to determine the growth curve of cell viability. The stable transfectants were treated with H₂O₂ and cell apoptosis was determined by Hoechst 33258 staining and terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) assay. The expression levels of Bcl-2, cleaved caspase 9 and poly ADP-ribose polymerase (PARP) were measured by Western blot. NOR1- knockdown HeLa cells were successfully constructed by transfection of pSUPER-shNOR1-1 or pSUPER-shNOR1-2 plasmids into HeLa cells. MTT assay showed that the silence of endogenous NOR1 in HeLa cells could lead to the increase in cell viability and proliferation, and the inhibition of H₂O₂-induced apoptosis compared with the negative control. Western blot showed that the expression level of active caspase 9 and cleaved PARP was inhibited in NOR1-knockdown cells when they were treated with H₂O₂ while the expression level of Bcl-2 protein increased. Silence of endogenous NOR1 facilitates the cell viability and growth of HeLa cells, and attenuates HeLa cells apoptosis induced by H₂O₂, which might be mediated by up-regulation of Bcl-2 level and down-regulation of the cleaved caspase 9 cascade.
The reducibility of heLa cell viability by Sargassum polycystum extracts

Science.gov (United States)

Firdaus, M.; Setijawati, D.; Islam, I.; Nursyam, H.; Kartikaningsih, H.; Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

2018-04-01

Cervical cancer is the second largest cause of death-related cancer in women. The efficacy of cancer drugs is still low. Bioactive of brown seaweed has been studied by in vitro and in vivo as anticancer. The aim of this study was to evaluate the cytotoxicity of Sargassum polycystum extracts on HeLa cell, to recognize bioactive on extract and estimate the interaction between the bioactive and target protein. S. polycystum was found from Talango Island waters and HeLa cell was obtained from Indonesian Science Institute. Sample was extracted by ethanol, ethyl acetate and hexane, concentrated and finally, extracts were assayed on HeLa cell. The viability of this cell was quantified on ELISA-Reader. The bioactive compounds of the extract were elucidated by GC-MS. The interaction between bioactive and target protein was evaluated by using in silico method. The result showed that the lowest viability of HeLa cell on n-hexane extracts treatment. The n-hexane extract of this seaweed contained benzenepropanoic acid. This compound reduced HeLa cell viability by reducing of thrombin concentration. In conclusion, the benzene propanoic acid of S. polycystum was the cytotoxic agent and it is potential agent for anti-cervical cancer.

Cell-type-specific genome editing with a microRNA-responsive CRISPR-Cas9 switch.

Science.gov (United States)

Hirosawa, Moe; Fujita, Yoshihiko; Parr, Callum J C; Hayashi, Karin; Kashida, Shunnichi; Hotta, Akitsu; Woltjen, Knut; Saito, Hirohide

2017-07-27

The CRISPR-Cas9 system is a powerful genome-editing tool useful in a variety of biotechnology and biomedical applications. Here we developed a synthetic RNA-based, microRNA (miRNA)-responsive CRISPR-Cas9 system (miR-Cas9 switch) in which the genome editing activity of Cas9 can be modulated through endogenous miRNA signatures in mammalian cells. We created miR-Cas9 switches by using a miRNA-complementary sequence in the 5΄-UTR of mRNA encoding Streptococcus pyogenes Cas9. The miR-21-Cas9 or miR-302-Cas9 switches selectively and efficiently responded to miR-21-5p in HeLa cells or miR-302a-5p in human induced pluripotent stem cells, and post-transcriptionally attenuated the Cas9 activity only in the target cells. Moreover, the miR-Cas9 switches could differentially control the genome editing by sensing endogenous miRNA activities within a heterogeneous cell population. Our miR-Cas9 switch system provides a promising framework for cell-type selective genome editing and cell engineering based on intracellular miRNA information. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

Energy Technology Data Exchange (ETDEWEB)

Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

1976-01-01

An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.
Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

Science.gov (United States)

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
Isolation of parafluorophenylalanine-resistant mutants from HeLa cell cultures

International Nuclear Information System (INIS)

Yim, L.K.; Stuart, W.D.

1983-01-01

This report describes a method to isolate temperature-conditional phenylalanine transport mutants from the transformed human cell line HeLa. Using ultraviolet light as a mutagenic agent and DL-parafluorophenylalanine (PFPA), a poisonous analogue of L-phenylalanine, as a selective agent, mutagenized cells were selected for survival in the presence of PFPA at a temperature of 39 degrees C. Survivors of the mutagenesis and selection procedures were removed from the culture dishes by trypsin and cloned at a temperature of 35 degrees C. Seven of these lines isolated demonstrated continued resistance to PFPA at 39 degrees C. These lines were tested for uptake of L-phenylalanine at an external concentration of 100 microM and for continued resistance to PFPA at two concentrations. Cells were tested at 35 and at 39 degrees C. The data were compared to those obtained for the parental HeLa cell line under identical conditions. The seven mutant cell lines demonstrated varying resistances to PFPA and varying levels of accumulation of L-phenylalanine when tested at 35 and 39 degrees C. Three mutant lines were additionally tested for L-phenylalanine tRNA charging levels and for transport of L-arginine. The lines had parental cell levels of tRNA charging and L-arginine transport which suggest that the induced genetic defect affects a specific L-phenylalanine transport system
Nanosecond pulsed electric fields induce poly(ADP-ribose) formation and non-apoptotic cell death in HeLa S3 cells.

Science.gov (United States)

Morotomi-Yano, Keiko; Akiyama, Hidenori; Yano, Ken-ichi

2013-08-30

Nanosecond pulsed electric fields (nsPEFs) have recently gained attention as effective cancer therapy owing to their potency for cell death induction. Previous studies have shown that apoptosis is a predominant mode of nsPEF-induced cell death in several cell lines, such as Jurkat cells. In this study, we analyzed molecular mechanisms for cell death induced by nsPEFs. When nsPEFs were applied to Jurkat cells, apoptosis was readily induced. Next, we used HeLa S3 cells and analyzed apoptotic events. Contrary to our expectation, nsPEF-exposed HeLa S3 cells exhibited no molecular signs of apoptosis execution. Instead, nsPEFs induced the formation of poly(ADP-ribose) (PAR), a hallmark of necrosis. PAR formation occurred concurrently with a decrease in cell viability, supporting implications of nsPEF-induced PAR formation for cell death. Necrotic PAR formation is known to be catalyzed by poly(ADP-ribose) polymerase-1 (PARP-1), and PARP-1 in apoptotic cells is inactivated by caspase-mediated proteolysis. Consistently, we observed intact and cleaved forms of PARP-1 in nsPEF-exposed and UV-irradiated cells, respectively. Taken together, nsPEFs induce two distinct modes of cell death in a cell type-specific manner, and HeLa S3 cells show PAR-associated non-apoptotic cell death in response to nsPEFs. Copyright © 2013 Elsevier Inc. All rights reserved.
The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

Science.gov (United States)

Leontis, N B; Westhof, E

1998-09-01

A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings
Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

Science.gov (United States)

Burlibașa, Liliana; Suciu, Ilinca

2015-12-01

Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.
Cloning of smac gene and its overexpression effects on radiosensitivity of HeLa cells to γ-rays

International Nuclear Information System (INIS)

Zhao Baofeng; Tian Mei; Lei Hongwei; Su Xu

2006-01-01

Objective: To clone smac gene and construct eukaryocytic expression vector pcDNA3.1/ smac. The smac gene was transfected into HeLa cells to explore the effects of over-expression of extrinsic smac gene on radiosensitivity to γ-rays of HeLa cells. Methods: The full-length smac gene was amplified from total RNA of HeLa cells by RTPCR. The RTPCR product was ligated with the vector pcDNA3.1 and sequenced. The correct pcDNA3.1/smac was transfected into HeLa cells. The expression of smac gene was tested by RTPCR and Western blot. The cellular growth inhibition rates were evaluated by MTT 48 horns after irradiation with different doses of γ-rays. Results: Recombinant eukaryocytic expression vector pcDNA3.1/smac was successfully constructed. RTPCR and Western blot results indicated that the expression of smac gene of HeLa/smac cells was significantly enhanced compared with the expression of smac gene of HeLa/pcDNA3.1 and HeLa cells. 48 hours after different doses of γ-ray irradiation was significantly higher in pcDNA3.1/smac transfected HeLa/smac cells than those of non-transfected HeLa cells or pcDNA3.1 transfected HeLa/pcDNA3.1 cells, inhabitation rates were 38.85%, 17.64% and 20.32%, respectively. Conclusions: smac gene was successfully cloned. Extrinsic smac gene over-expression could significantly enhance radiosensitivity to γ-ray of HeLa cells, which would herald a new approach to improve radiosensitivity of cervical cancer. (authors)
A single methyltransferase YefA (RlmCD) catalyses both m5U747 and m5U1939 modifications in Bacillus subtilis 23S rRNA

DEFF Research Database (Denmark)

Desmolaize, Benoit; Fabret, Céline; Brégeon, Damien

2011-01-01

Escherichia coli possesses three paralogues. These comprise the methyltransferases TrmA that targets U54 in tRNAs, RlmC that modifies U747 in 23S rRNA and RlmD that is specific for U1939 in 23S rRNA. The tRNAs and rRNAs of the Gram-positive bacterium Bacillus subtilis have the same three m(5)U modifications....... However, as previously shown, the m(5)U54 modification in B. subtilis tRNAs is catalysed in a fundamentally different manner by the folate-dependent enzyme TrmFO, which is unrelated to the E. coli TrmA. Here, we show that methylation of U747 and U1939 in B. subtilis rRNA is catalysed by a single enzyme...
Effect of 5-fluorodeoxyuridine on DNA replication in ultraviolet-irradiated HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Brozmanova, J.; Masek, F.; Synzynys, B.I.; Saenko, A.S.

1985-11-05

In HeLa cells precultivated for 6 hours with 5-fluorodeoxyuridine (FUdR) and for 18 hours in FUdR-free medium, DNA synthesis was much more resistant to UV irradiation than that of untreated cells. DNA synthesized in FUdR-pretreated and UV irradiated cells represents a semiconservative DNA replication and shows more rapid shift of the pulse-labelled chased DNA to high molecular weight. This DNA synthesis is not induced by synchronization of the cell cycle. It is assumed that either the changes of chromatine structure, or an enhanced level of some enzymes might be involved in the replication of the damaged template. (author).
FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

Science.gov (United States)

Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

2016-02-01

Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.
Dynamic behavior of histone H1 microinjected into HeLa cells

International Nuclear Information System (INIS)

Wu, L.H.; Kuehl, L.; Rechsteiner, M.

1986-01-01

Histone H1 was purified from bovine thymus and radiolabeled with tritium by reductive methylation or with 125 I using chloramine-T. Red blood cell-mediated microinjection was then used to introduce the labeled H1 molecules into HeLa cells synchronized in S phase. The injected H1 molecules rapidly entered HeLa nuclei, and a number of tests indicate that their association with chromatin was equivalent to that of endogenous histone H1. The injected molecules copurified with HeLa cell nucleosomes, exhibited a half-life of ∼100h, and were hyperphosphorylated at mitosis. When injected HeLa cells were fused with mouse 3T3 fibroblasts < 10% of the labeled H1 molecules migrated to mouse nuclei during the next 48 h. Despite their slow rate of migration between nuclei, the injected H1 molecules were evenly distributed on mouse and human genomes soon after mitosis of HeLa-3T3 heterokaryons. These results suggest that although most histone H1 molecules are stably associated with interphase chromatin, they undergo extensive redistribution after mitosis
Effect of hyperthermia and radiation on the cell cycle progression of HeLa cells

International Nuclear Information System (INIS)

Kubota, Nobuo

1982-01-01

The effect of hyperthermia and irradiation on cytokinetics was studied using exponentially growing HeLa cells. To determine the effect of heat and/or radiation on the cell cycle progression, the changes in the DNA distribution of the cell population after time intervals after treatment were studied. The cellular DNA content of the cell population was measured by flow cytometry. The results obtained were as follows: 1. Compared with the control, the cellular DNA content distribution of HeLa cells treated with 43 0 C for 20 min and 60 min showed cell accumulation in S and G 2 M phases 8 hours after treatment. 2. Hyperthermic treatment at 45 0 C for 20 min caused cells to accumulate in S phase in the first 4 hours and G 2 M phase after 8 to 14.5 hours, whereas heat treatment at 45 0 C for 60 min caused cells to accumulate in G 2 M phase after 24 hours. 3. Irradiation of exponentially growing cells induced a block in the progress from G 2 M to G 1 phase. 4. Dose survival curves of HeLa cells with and without postirradiation thermal treatment (43 0 C, 60 min) showed significant enhancement of radiosensitivity by hyperthermia. 5. The sequential treatment, i.e. 5 Gy irradiation followed immediately by heat treatment at 43 0 C for 60 min, caused more cells to accumulate in G 2 M phase after 24 and 48 hours, as compared with 5 Gy irradiation alone. (author)
MCPIP1 contributes to the toxicity of proteasome inhibitor MG-132 in HeLa cells by the inhibition of NF-κB.

Science.gov (United States)

Skalniak, Lukasz; Dziendziel, Monika; Jura, Jolanta

2014-10-01

Recently, we have shown that the treatment of cells with proteasome inhibitor MG-132 results in the induction of expression of monocyte chemotactic protein-1 induced protein 1 (MCPIP1). MCPIP1 is a ribonuclease, responsible for the degradation of transcripts encoding certain pro-inflammatory cytokines. The protein is also known as an inhibitor of NF-κB transcription factor. Thanks to its molecular properties, MCPIP1 is considered as a regulator of inflammation, differentiation, and survival. Using siRNA technology, we show here that MCPIP1 expression contributes to the toxic properties of MG-132 in HeLa cells. The inhibition of proteasome by MG-132 and epoxomicin markedly increased MCPIP1 expression. While MG-132 induces HeLa cell death, down-regulation of MCPIP1 expression by siRNA partially protects HeLa cells from MG-132 toxicity and restores Nuclear factor-κB (NF-κB) activity, inhibited by MG-132 treatment. Inversely, overexpression of MCPIP1 decreased constitutive activity of NF-κB and limited the survival of HeLa cells, as we have shown in the previous study. Interestingly, although MG-132 decreased the expression of IκBα and increased p65 phosphorylation, the inhibition of constitutive NF-κB activity was observed in MG-132-treated cells. Since the elevated constitutive activity of NF-κB is one of the mechanisms providing increased survival of cancer cells, including HeLa cells, we propose that death-promoting properties of MCPIP1 in MG-132-treated HeLa cells may, at least partially, derive from the negative effect on the constitutive NF-κB activity.
MicroRNA hsa-miR-29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1.

Science.gov (United States)

Kollinerová, S; Dostál, Z; Modrianský, M

2017-04-01

Etoposide is commonly used as a monotherapy or in combination with other drugs for cancer treatments. In order to increase the drug efficacy, ceaseless search for novel combinations of drugs and supporting molecules is under way. MiRNAs are natural candidates for facilitating drug effect in various cell types. We used several systems to evaluate the effect of miR-29 family on etoposide toxicity in HeLa cells. We show that miR-29b significantly increases etoposide toxicity in HeLa cells. Because Mcl-1 protein has been recognized as a miR-29 family target, we evaluated downregulation of Mcl-1 protein splicing variant expression induced by miR-29 precursors and confirmed a key role of Mcl-1 protein in enhancing etoposide toxicity. Despite downregulation of Mcl-1 by all three miR-29 family members, only miR-29b significantly enhanced etoposide toxicity. We hypothesized that this difference may be linked to the change in Mcl-1L/Mcl-1S ratio induced by miR-29b. We hypothesized that the change could be due to miR-29b nuclear shuttling. Using specifically modified miR-29b sequences with enhanced cytosolic and nuclear localization we show that there is a difference, albeit statistically non-significant. In conclusion, we show that miR-29b has the synergistic effect with etoposide treatment in the HeLa cells and that this effect is linked to Mcl-1 protein expression and nuclear shuttling of miR-29b. Copyright © 2017 Elsevier Ltd. All rights reserved.
Relationship between RNA polymerase II and efficiency of vaccinia virus replication

International Nuclear Information System (INIS)

Wilton, S.; Dales, S.

1989-01-01

It is clear from previous studies that host transcriptase or RNA polymerase II (pol II) has a role in poxvirus replication. To elucidate the participation of this enzyme further, in this study the authors examined several parameters related to pol II during the cycle of vaccinia virus infection in L-strain fibroblasts, HeLa cells, and L 6 H 9 rat myoblasts. Nucleocytoplasmic transposition of pol II into virus factories and virions was assessed by immunofluorescence and immunoblotting by using anti-pol II immunoglobulin G. RNA polymerase activities were compared in nuclear extracts containing cured enzyme preparations. Rates of translation into cellular or viral polypeptides were ascertained by labeling with [ 35 S]methionine. In L and HeLa cells, which produced vaccinia virus more abundantly, the rate of RNA polymerase and translation in controls and following infection were higher than in myoblasts. The data on synthesis and virus formation could be correlated with observations on transmigration of pol II, which was more efficient and complete in L and HeLa cells. The stimulus for pol II to leave the nucleus required the expression of both early and late viral functions. On the basis of current and past information, the authors suggest that mobilization of pol II depends on the efficiency of vaccinia virus replication and furthermore that control over vaccinia virus production by the host is related to the content or availability (or both) of pol II in different cell types
Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

International Nuclear Information System (INIS)

Oesterberg, R.; Garrett, A.

1977-01-01

The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de
Spontaneous and radiation induced cell death in HeLa S3 human carcinoma

International Nuclear Information System (INIS)

Zaric, B.; Milosavljevic, B.; Radojcic, M.

2001-01-01

Radiation biologists have classified radiation-induced cell death based on cell proliferative capacity to either mitotic or interphase death. Cytologists have revealed two morphologically and biochemically diverse forms of cell death, apoptosis and necrosis. While the knowledge of the former is already well exploited by radiologists, cell susceptibility to apoptosis and necrosis is still under investigation. We studied characteristics of spontaneous cell death, and dose dependence and time course of radiation-induced cell death of human uterine cervix epitheloid carcinoma HeLaS 3 in culture. Cells were irradiated with 2-40 Gy of γ-rays. The effect on growth, viability, morphology and genomic DNA structure were followed 24-72 h after irradiation. Cell viability was evaluated by trypan-blue exclusion assay and cell morphology by in situ DNA staining with propidium iodide. Cell genomic DNA fragmentation pattern was determined by electrophoresis on 2% agarose gels. At all cell densities 25-35% cells were PI positive and their DNA was fragmented to a high molecular size (≥20 kbp), but the internucleosomal ladder was not observed. A significant decrease in viability to 33% was observed 72 h post 40 Gy irradiation. It corresponded to 55% of PI positive cells. A smear of smaller DNA fragments (0.1-1 kbp), 24 h after 10-20 Gy irradiation was considered as proof that the dominant form of radiation-induced cell death was necrosis. It was concluded that the dominant form of radiation-induced cell death in HeLaS 3 population was necrosis and the radiation dose which caused 50% of cell death after 72 h (termed ND 50 ) was between 30-40 Gy. (author)
Glucose capped silver nanoparticles induce cell cycle arrest in HeLa cells.

Science.gov (United States)

Panzarini, Elisa; Mariano, Stefania; Vergallo, Cristian; Carata, Elisabetta; Fimia, Gian Maria; Mura, Francesco; Rossi, Marco; Vergaro, Viviana; Ciccarella, Giuseppe; Corazzari, Marco; Dini, Luciana

2017-06-01

This study aims to determine the interaction (uptake and biological effects on cell viability and cell cycle progression) of glucose capped silver nanoparticles (AgNPs-G) on human epithelioid cervix carcinoma (HeLa) cells, in relation to amount, 2×10 3 or 2×10 4 NPs/cell, and exposure time, up to 48h. The spherical and well dispersed AgNPs (30±5nm) were obtained by using glucose as reducing agent in a green synthesis method that ensures to stabilize AgNPs avoiding cytotoxic soluble silver ions Ag + release. HeLa cells take up abundantly and rapidly AgNPs-G resulting toxic to cells in amount and incubation time dependent manner. HeLa cells were arrested at S and G2/M phases of the cell cycle and subG1 population increased when incubated with 2×10 4 AgNPs-G/cell. Mitotic index decreased accordingly. The dissolution experiments demonstrated that the observed effects were due only to AgNPs-G since glucose capping prevents Ag + release. The AgNPs-G influence on HeLa cells viability and cell cycle progression suggest that AgNPs-G, alone or in combination with chemotherapeutics, may be exploited for the development of novel antiproliferative treatment in cancer therapy. However, the possible influence of the cell cycle on cellular uptake of AgNPs-G and the mechanism of AgNPs entry in cells need further investigation. Copyright © 2017 Elsevier B.V. All rights reserved.
Analysis of the factors in determining radiosensitivity in mammalian cells by using radio-sensitive and -resistant clones isolated from HeLa S3 cells in vitro

International Nuclear Information System (INIS)

Nikaido, Osamu; Horikawa, Masakatsu

1976-01-01

The factors in determining radiosensitivity of cultured mammalian cells were analysed by using two clones each having different radiosensitivities. The radiosensitive clones were isolated from HeLa S3 cells by the N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-treatment, X-irradiation (200 R) and 5-bromodeoxyuridine (BUdR)-visible light method. On the other hand, the radioresistant clone was isolated by single X-irradiation (2000 R) from MNNG-treated HeLa S3 cell population. The radiosensitivities expressed in D sub(o) and D sub(q) values were 110 and 140 R in radiosensitive SM-1a clone and 180 and 230 R in radioresistant RM-1b clone respectively. The biological and biochemical characteristics of both clones such as the distribution of chromosome numbers, formation and rejoining of single strand breaks in DNA caused by X-irradiation, non-protein sulfhydryl (NPSH) and apparent total sulfhydryl (APSH) contents were measured. Among the characteristics analysed, different contents of NPSH in the cell were well correlated to their daiosensitivities among the original HeLa S3 cells, SM-1a and RM-1b clone. Additionally, it was found that the radioresistant L.P3 Co-3 cells isolated by Tsuboi et al. from the original mouse L.P3 cells by means of serial irradiation with 60 Co γ-rays have more abundant NPSH than the original L.P3 cells. From these results, it can be concluded that the amount of NPSH play the main role in determining radiosensitivity in cultured mammalian cells. (auth.)

Agonist/antagonist interactions with cloned human 5-HT(1A) receptors: Variations in intrinsic activity studied in transfected HeLa cells

NARCIS (Netherlands)

Boddeke, H.W.G.M.; Fargin, A.; Raymond, J.R.; Schoeffter, P.; Hoyer, D.

1992-01-01

The characteristics of 5-HT(1A)-recognition sites and receptor-mediated release of intracellular calcium were established in two transfected HeLa cell lines (HA 6 and HA 7) expressing different levels of human 5-HT(1A) receptors (about 3000 and 500 fmol/mg protein, Fargin et al. 1989; 1991; Raymond
The critical role of quercetin in autophagy and apoptosis in HeLa cells.

Science.gov (United States)

Wang, Yijun; Zhang, Wei; Lv, Qiongying; Zhang, Juan; Zhu, Dingjun

2016-01-01

In recent years, the effects of quercetin on autophagy and apoptosis of cancer cells have been widely reported, while effects on HeLa cells are still unclear. Here, HeLa cells were subjected to quercetin treatment, and then proliferation, apoptosis, and autophagy were evaluated using MTT, flow cytometry, and MDC staining, respectively. The LC3-I/II, Beclin 1, active caspase-3, and S6K1 phosphorylation were detected using Western blot assay. The ultrastructure of HeLa was observed via transmission electron microscope (TEM). Our findings showed that quercetin can dose-dependently inhibit the growth of HeLa cells. The MDC fluorescence was enhanced with increased concentration of quercetin and hit a plateau at 50 μmol/l. Western blot assay revealed that LC3-I/II ratio, Beclin 1, and active caspase-3 protein were enforced in a dose-dependent method. However, the phosphorylation of S6K1 gradually decreased, concomitant with an increase of autophagy. In addition, TEM revealed that the number of autophagic vacuoles was peaked at 50 μmol/l of quercetin. Besides, interference of autophagy with 3-MA led to proliferation inhibition and increased apoptosis in HeLa cells, accompanied by the decreased LC3-I/II conversion and the increased active caspase-3. In conclusion, quercetin can inhibit HeLa cell proliferation and induce protective autophagy at low concentrations; thus, 3-MA plus quercetin would suppress autophagy and effectively increased apoptosis.
Nuclear proteome analysis of cisplatin-treated HeLa cells

International Nuclear Information System (INIS)

Wu Wei; Yan Chunlan; Gan Tieer; Chen Zhanghui; Lu Xianghong; Duerksen-Hughes, Penelope J.; Zhu Xinqiang; Yang Jun

2010-01-01

Cisplatin has been widely accepted as one of the most efficient anticancer drugs for decades. However, the mechanisms for the cytotoxic effects of cisplatin are still not fully understood. Cisplatin primarily targets DNA, resulting in the formation of DNA double strand breaks and eventually causing cell death. In this study, we applied two-dimensional electrophoresis coupled with LC-MS/MS to analyze the nuclear proteome of HeLa cells treated with cisplatin, in an effort to uncover new mechanistic clues regarding the cellular response to cisplatin. A total of 19 proteins were successfully identified, and these proteins are involved in a variety of basal metabolic and biological processes in cells, including biosynthesis, cell cycle, glycolysis and apoptosis. Six were related to the regulation of mRNA splicing, and we therefore asked whether the Fas gene might undergo alternative splicing following cisplatin treatment. This proved to be the case, as the splicing forms of Fas were modified in cisplatin-treated HeLa cells. This work provides novel information, from the perspective of the nuclear response, for understanding the cytotoxicity caused by cisplatin-induced DNA damage.
Low concentrations of doxycycline attenuates FasL-induced apoptosis in HeLa cells.

Science.gov (United States)

Yoon, Jung Mi; Koppula, Sushruta; Huh, Se Jong; Hur, Sun Jin; Kim, Chan Gil

2015-07-24

Doxycycline (DC) has been shown to possess non-antibiotic properties including Fas/Fas Ligand (FasL)-mediated apoptosis against several tumor types in the concentration range of 10-40 µg/mL. However, the effect of DC in apoptotic signaling at much low concentrations was not studied. The present study investigated the attenuation effect of low dose of DC on FasL-induced apoptosis in HeLa cell by the methods of MTT assay, fluorescence microscopy, DNA fragmentation, flow cytometry analysis, and western blotting. In the present findings we showed that low concentration of DC (HeLa cells. FasL treatment to HeLa cells resulted in a concentration-dependent induction of cell death, and treatment with low concentrations of DC (0.1-2 µg/mL) significantly (p cell death as measured by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Further, the FasL-induced apoptotic features in HeLa cells, such as morphological changes, DNA fragmentation and cell cycle arrest was also inhibited by DC (0.5 µg/mL). Tetracycline and minocycline also showed similar anti-apoptotic effects but were not significant when compared to DC, tested at same concentrations. Further, DC (0.01-16 µg/mL) did not influence the hydrogen peroxide- or cisplatin-induced intrinsic apoptotic pathway in HeLa cells. Protein analysis using Western blotting confirmed that FasL-induced cleavage/activation of caspase-8 and caspase-3, were inhibited by DC treatment at low concentration (0.5 µg/mL). Considering the overall data, we report for the first time that DC exhibited anti-apoptotic effects at low concentrations in HeLa cells by inhibition of caspase activation via FasL-induced extrinsic pathway.
Anti-proliferative effect of RCE-4 from Reineckia carnea on human cervical cancer HeLa cells by inhibiting the PI3K/Akt/mTOR signaling pathway and NF-κB activation.

Science.gov (United States)

Bai, Caihong; Yang, Xiaojiao; Zou, Kun; He, Haibo; Wang, Junzhi; Qin, Huilin; Yu, Xiaoqin; Liu, Chengxiong; Zheng, Juyan; Cheng, Fan; Chen, Jianfeng

2016-06-01

Cervical cancer is the second leading cause of cancer deaths in women worldwide. In recent years, the studies find that inflammation is a critical component of tumor progression, and the ideal therapeutic methods should be aimed at the inflammation reaction triggers. (1β,3β,5β,25S)-spirostan-1,3-diol1-[α-L-rhamnopyranosyl-(1 → 2)-β-D-xylopyranoside] (RCE-4) was the main active composition of Reineckia carnea (Andr.) Kunth. It significantly induced apoptosis in cervical cancer Caski cells through the mitochondrial pathway in our previous studies; however, its underlying mechanism remains poorly understood. This study aimed to further evaluate the effect of RCE-4 on human cervical cancer HeLa cells. Based on this observation, we investigated the anti-cervical cancer effect of RCE-4 by modulating phosphatidylinositol 3-kinase/protein kinase-B/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathway, nuclear factor-kappa B (NF-κB) activation, and inflammation-related key factors in HeLa cells. The results indicated that the HeLa cell was the most sensitive with an IC50 of 7.01 μM; RCE-4 significantly promoted the release of cellular lactate dehydrogenase (LDH); increased DNA fragmentation and apoptosis; reduced PI3K, Akt, mTOR, and NF-κBp65 phosphorylation levels; increased the Bax and cleaved poly (ADP-ribose) polymerase (PARP) protein levels; suppressed Bcl-2 protein expression; elevated the Bax/Bcl-2 expression ratio; and decreased the interleukin-1 beta (IL-1β) and interleukin-6 (IL-6) mRNA expressions in HeLa cells in a concentration-dependent manner. These findings suggest that RCE-4 exerted beneficially anti-cervical cancer effect on HeLa cells, mainly inhibiting PI3K/Akt/mTOR signaling pathway phosphorylation and NF-κB activation, promoting HeLa cell apoptosis. Graphical abstract Anti-tumor effect of RCE-4 on HeLa cells.
Growth regulation of HeLa cells by 1060 nm photons

International Nuclear Information System (INIS)

Torghele, K. F.

1993-12-01

Living organisms are open systems dominated by electromagnetic interaction. An essential feature of a living system is its cybernetic process which imply their capability of adaptation and sensitivity to internal and external fluctuations. The experimental results show that coherent and incoherent light of 1060 nm wavelength influences the metabolic processes and consequently the proliferation of cancer cell cultures (HeLa). Light induced regulation of HeLa cell growth depends on the cell density, the state of the cell culture and the amount of light irradiation. Best proliferation inhibiting effects can be obtained by application of 200 J/m 2 on HeLa cells in Lag-Phase and a typical cell density of 5.10 4 cells/cm 2 . Proceeding on the singlet oxygen hypothesis (KLIMA, H. et al.; 1990), it is shown mathematically that the dynamical behaviour of the NADH model is influenced by 1060 nm photons. Both, the experimental and the numerical results support our hypothesis: 1060 nm photons regulate the proliferation of HeLa cells. (author)
Isolation and characterization of the heterogeneous nuclear RNA-ribonucleoprotein complex

International Nuclear Information System (INIS)

Choi, Y.D.

1985-01-01

Exposure of cells to UV light of sufficient intensity brings about crosslinking of RNA to proteins which are in direct contact with it in vivo. The major [ 35 S]methionine-labeled proteins which become crosslinked to poly(A) + hnRNA in HeLa cells are of 120K, 68K, 53K, 43K, 41K, 38K, and 36K (K = kilodaltons). By immunizing mice with UV crosslinked complexes two monoclonal antibodies (2B12 and 4F4) against the C proteins (41K and 43K) and one (3G6) against the 120K protein of the hnRNP complex were obtained. Immunofluorescence microscopy demonstrates that the C proteins and 120K are segregated to the nucleus and are not associated with nucleoli or chromatin. The two C proteins are highly related to each other antigenically. Monoclonal antibody 4F4 identifies the C proteins of the hnRNP complex in widely divergent species from human to lizard. The C proteins are phosphorylated and are in contact with hnRNA in vivo. The hnRNP complex was isolated from vertebrate cell nuclei by immunoprecipitation with these monoclonal antibodies. This complex contains proteins and hnRNA of up to ∼10 kb. The major steady state labeled [ 35 S]methionine labeled proteins of the isolated complex from HeLa cells are of 34K, 36K, 36K (A1 and A2), 37K, 38K (B1 and B2), 41K, 43K (C1 and C2) and doublets at 68K and at 120K. These proteins are organized into a 30S particle. Large hnRNP complexes are composed of multiples of 30S particles which are connected by highly nuclease sensitive stretches of hnRNA. It it concluded that the hnRNP structure is an integral component of the mRNA formation pathway in the eukaryotic cell
Pengaruh Variasi Jumlah Tembakan Nanosecond Pulsed Electric Fields (Nspefs Terhadap Ekspresi Gen Socs3 pada Sel Kanker Serviks Hela S3

Directory of Open Access Journals (Sweden)

Martina Kurnia Rohmah

2017-12-01

Abstract Nanosecond Pulsed Electric Fields (NsPEFs is bioelectric that was developed by electroporation technology. NsPEFs use high intensity in short time exposure (1 – 300 nanosecond. NsPEFs have biological effect and was developed in cancer therapy. In cervical cancer, viral protein of HPV depresses some tumor suppressors like Socs3 gene. This research aims to investigate the effect of short variation in Socs3 gene expression. HeLa S3 cells were cultured in α-MEM with FBS 10%. NsPEFs as much as 20 kV/cm and 80 nano seconds was exposure over HeLa S3 cell in 4 mm cuvette. Wave of NsPEFs was detected by high voltage probe in oscilloscope. NsPEFs was exposure at 0 (control, 5, 10, 20, 30, 40, 50, and 60 shots. Socs3 gene expression was analyzed using real time PCR and RT-PCR. Quantitative data was analyzed by Kolmogorov-Smirnov, Anova, and HSD Tuker (p<0.05. This research show that NsPEFs is significantly increase Socs3 gene expression (p=0.000. The optimal shot 20 and 30 shots increase Socs3 gene expression subsequently = 2.779 and = 3.105 times. This expression decrease in higher than 30 shots of NsPEFs exposure. Keywords: NsPEFs, shot, expression, Socs3
Studies on radioresistance with HeLa cells

International Nuclear Information System (INIS)

Koiwai, Soichiro; Muta, Nobuyoshi

1980-01-01

In our previous experiments (15, 16), HeLa cells were successively irradiated with 1 kR of X-rays. After receiving 3, 5, 8, 11, 14, and 17 kR the iradiated HeLa cells showed progressively increasing radioresistance. In the present paper, the results of studies on the variation of the extrapolation number (n), mean lethal dose (D sub(o)), and quasi-threshold dose (D sub(q)) of survival curves for these radioresistant HeLa strains were reported. The values of n of the original and radioresistant strains were all found between 2 and 3, and a change of the n values with an increase in the total dose received by the cell strains was not noticed. On the other hand, the values of D sub(o) of the radioresistant strains progressively increased from 105 R in the original line to 148 R in the 17 kR strain with increasing doses of pre-irradiation. Similarly, the values of D sub(q) had a tendency to increase in the radioresistant strains. Repair of sublethal damage with the original and radioresistant strains was studied and the properties of the radioresistant strains were discussed. (author)
[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

Science.gov (United States)

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.
Novel compounds TAD-1822-7-F2 and F5 inhibited HeLa cells growth through the JAK/Stat signaling pathway.

Science.gov (United States)

Yang, Tianfeng; Shi, Xianpeng; Kang, Yuan; Zhu, Man; Fan, Mengying; Zhang, Dongdong; Zhang, Yanmin

2018-07-01

Cervical carcinoma remains the second most common malignancy with a high mortality rate among women worldwide. TAD-1822-7-F2 (F2) and TAD-1822-7-F5 (F5) are novel compounds synthesized on the chemical structure of taspine derivatives, and show an effective suppression for HeLa cells. Our study aims to confirm the potential targets of F2 and F5, and investigate the underlying mechanism of the inhibitory effect on HeLa cells. In this study, Real Time Cell Analysis and crystal violet staining assay were conducted to investigate the effect of F2 and F5 on HeLa cells proliferation. And the analytical methods of surface plasmon resonance and quartz crystal microbalance were established and employed to study the interaction between F2 and F5 and potential target protein JAK2, suggesting that both compounds have strong interaction with the JAK2 protein. Western blot analysis, immunofluorescence staining study and PCR was conducted to investigate the molecules of JAK/Stat signaling pathway. Interestingly, F2 and F5 showed diverse regulation for signaling molecules because of their different chemical structure. F2 increased the expression of JAK2 and downregulated the level of P-JAK1 and P-JAK2, and decreased P-Stat3 (Ser727). While F5 could increase the expression of JAK2 and naturally decrease the phosphorylation of JAK1 and Tyk2, and decreased the expression of P-Stat6. Moreover, F2 and F5 showed the same downregulation on the P-Stat3 (Tyr705). Therefore, F2 and F5 could target the JAK2 protein and prevent the phosphorylation of JAKs to suppress the phosphorylation of the downstream effector Stats, which suggested that F2 and F5 have great potential to be the inhibitors of the JAK/Stat signaling pathway. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
High oxygen partial pressure increases photodynamic effect on HeLa cell lines in the presence of chloraluminium phthalocyanine.

Science.gov (United States)

Bajgar, Robert; Kolarova, Hana; Bolek, Lukas; Binder, Svatopluk; Pizova, Klara; Hanakova, Adela

2014-08-01

Photodynamic therapy (PDT) is linked with oxidative damage of biomolecules causing significant impairment of essential cellular functions that lead to cell death. It is the reason why photodynamic therapy has found application in treatment of different oncological, cardiovascular, skin and eye diseases. Efficacy of PDT depends on combined action of three components; sensitizer, light and oxygen. In the present study, we examined whether higher partial pressure of oxygen increases lethality in HeLa cell lines exposed to light in the presence of chloraluminium phthalocyanine disulfonate (ClAlPcS2). ClAlPcS2- sensitized HeLa cells incubated under different oxygen conditions were exposed to PDT. Production of singlet oxygen ((1)O2) and other forms of reactive oxygen species (ROS) as well as changes in mitochondrial membrane potential were determined by appropriately sensitive fluorescence probes. The effect of PDT on HeLa cell viability under different oxygen conditions was quantified using the standard methylthiazol tetrazolium (MTT) test. At the highest oxygen concentration of 28 ± 2 mg/l HeLa cells were significantly more sensitive to light-activated ClAlPcS2 (EC50=0.29 ± 0.05 μM) in comparison to cells incubated at lower oxygen concentrations of 8 ± 0.5 and 0.5 ± 0.1 mg/l, where the half maximal effective concentration was 0.42 ± 0.06 μM and 0.94 ± 0.14 μM, respectively. Moreover, we found that the higher presence of oxygen is accompanied with higher production of singlet oxygen, a higher rate of type II photodynamic reactions, and a significant drop in the mitochondrial membrane potential. These results demonstrate that the photodynamic effect in cervical cancer cells utilizing ClAlPcS2 significantly depends on oxygen level. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

Directory of Open Access Journals (Sweden)

Mateus Mondin

2007-01-01

Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.
Combined treatment of ionizing radiation with genistein on cervical cancer HeLa cells

International Nuclear Information System (INIS)

Zhang Bei; Liu Jiayin; Han Suping; Pan Jinshun; Yin Xiaoxing; Wang Bing; Hu Gang

2006-01-01

The anticancer agent genistein inhibits cell growth of tumor cell lines from various malignancies. In our study, we investigated the effectiveness of combined treatment of ionizing radiation (IR) with genistein on cervical HeLa cells and its possible mechanism. It was found that the inhibitory rate in cells with combined treatment was significantly higher than that of the cells treated with IR or genistein alone. After treatments of IR (4 Gy) combined with genistein (40 μmol/L), the apoptotic index of the cells was significantly increased and the cells were arrested in the G2/M phase. Survivin mRNA expression increased after IR (4 Gy), while it significantly decreased after combined treatment. These findings indicated that genistein enhanced the radiosensitivity of cervical cancer HeLa cells, and the mechanisms for this action might include increase of apoptosis, decrease of survivin expression, and prolongation of cell cycle arrest. (author)
Subnanomolar antisense activity of phosphonate-peptide nucleic acid (PNA) conjugates delivered by cationic lipids to HeLa cells

DEFF Research Database (Denmark)

Shiraishi, Takehiko; Hamzavi, Ramin; Nielsen, Peter E

2008-01-01

oligomer. This modification of the PNA does not interfere with the nucleic acid target binding affinity based on thermal stability of the PNA/RNA duplexes. When delivered to cultured HeLa pLuc705 cells by Lipofectamine, the PNAs showed dose-dependent nuclear antisense activity in the nanomolar range...
Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B-Treated Cervical Cancer HeLa Cells.

Science.gov (United States)

Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

2017-09-01

Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H 2 O 2 -induced cell death is via neutralization of reactive oxygen species.
Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Radiation response of Hela cells at the stationary phase of growth

International Nuclear Information System (INIS)

Semenyak, O.Yu.; Kalendo, G.S.; Serebryakov, N.G.

1988-01-01

The early stages of a repopulation process of HeLa cells under the effect of irradiation 5 Gy dose and an influence of a preliminary 0.1 Gy dose irradiation at that process were investigated. As it was shown the fraction of cell with a great proliferation potential appeared in one day after lethal 5 Gy dose irradiation of the resting HeLa cells. If the other irradiation regime was used: 0.1 Gy dose plus 4.9 dose in 3 min after the first action, the part of cells with a great proliferation potential became considerably less
Rapid increase of inositol 1,4,5-trisphosphate in the HeLa cells after hypergravity exposure

Science.gov (United States)

Kumei, Yasuhiro; Whitson, Peggy A.; Cintron, Nitza M.; Sato, Atsushige

1990-01-01

The IP3 level in HeLa cells has been elevated through the application in hypergravity in a time-dependent manner. The data obtained for the hydrolytic products of PIP2, IP3, and DG are noted to modulate c-myc gene expression. It is also established that the cAMP accumulation by the IBMX in hypergravity-exposed cells was suppressed relative to the control. In light of IP3 increase and cAMP decrease results, a single GTP-binding protein may play a role in the hypergravity signal transduction of HeLa cells by stimulating PLC while inhibiting adenylate cyclase.
The Antiproliferative Effect of Cyclodipeptides from Pseudomonas aeruginosa PAO1 on HeLa Cells Involves Inhibition of Phosphorylation of Akt and S6k Kinases.

Science.gov (United States)

Hernández-Padilla, Laura; Vázquez-Rivera, Dolores; Sánchez-Briones, Luis A; Díaz-Pérez, Alma L; Moreno-Rodríguez, José; Moreno-Eutimio, Mario A; Meza-Carmen, Victor; Cruz, Homero Reyes-De la; Campos-García, Jesús

2017-06-20

Pseudomonas aeruginosa PAO1, a potential pathogen of plants and animals, produces the cyclodipeptides cyclo(l-Pro-l-Tyr), cyclo(l-Pro-l-Phe), and cyclo(l-Pro-l-Val) (PAO1-CDPs), whose effects have been implicated in inhibition of human tumor cell line proliferation. Our purpose was to investigate in depth in the mechanisms of HeLa cell proliferation inhibition by the PAO1-CDPs. The results indicate that PAO1-CDPs, both purified individually and in mixtures, inhibited HeLa cell proliferation by arresting the cell cycle at the G0-G1 transition. The crude PAO1-CDPs mixture promoted cell death in HeLa cells in a dose-dependent manner, showing efficacy similar to that of isolated PAO1-CDPs (LD 50 of 60-250 µM) and inducing apoptosis with EC 50 between 0.6 and 3.0 µM. Moreover, PAO1-CDPs showed a higher proapoptotic activity (~10³-10⁵ fold) than their synthetic analogs did. Subsequently, the PAO1-CDPs affected mitochondrial membrane potential and induced apoptosis by caspase-9-dependent pathway. The mechanism of inhibition of cells proliferation in HeLa cells involves inhibition of phosphorylation of both Akt-S473 and S6k-T389 protein kinases, showing a cyclic behavior of their expression and phosphorylation in a time and concentration-dependent fashion. Taken together our findings indicate that PI3K-Akt-mTOR-S6k signaling pathway blockage is involved in the antiproliferative effect of the PAO1-CDPs.

Low concentrations of doxycycline attenuates FasL-induced apoptosis in HeLa cells

Directory of Open Access Journals (Sweden)

Jung Mi Yoon

2015-01-01

Full Text Available BACKGROUND: Doxycycline (DC has been shown to possess non-antibiotic properties including Fas/Fas Ligand (FasL-mediated apoptosis against several tumor types in the concentration range of 10-40 μg/mL. However, the effect of DC in apoptotic signaling at much low concentrations was not studied. METHODS: The present study investigated the attenuation effect of low dose of DC on FasL-induced apoptosis in HeLa cell by the methods of MTT assay, fluorescence microscopy, DNA fragmentation, flow cytometry analysis, and western blotting. RESULTS AND CONCLUSION: In the present findings we showed that low concentration of DC (<2.0 μg/mL exhibited protective effects against FasL-induced apoptosis in HeLa cells. FasL treatment to HeLa cells resulted in a concentration-dependent induction of cell death, and treatment with low concentrations of DC (0.1-2 μg/mL significantly (p < 0.001 attenuated the FasL-induced cell death as measured by 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazo-lium bromide (MTT assay. Further, the FasL-induced apoptotic features in HeLa cells, such as morphological changes, DNA fragmentation and cell cycle arrest was also inhibited by DC (0.5 μg/mL. Tetracycline and minocycline also showed similar anti-apoptotic effects but were not significant when compared to DC, tested at same concentrations. Further, DC (0.01-16 μg/mL did not influence the hydrogen peroxide- or cisplatin-induced intrinsic apoptotic pathway in HeLa cells. Protein analysis using Western blotting confirmed that FasL-induced cleavage/activation of cas-pase-8 and caspase-3, were inhibited by DC treatment at low concentration (0.5 μg/mL. Considering the overall data, we report for the first time that DC exhibited anti-apoptotic effects at low concentrations in HeLa cells by inhibition of caspase activation via FasL-induced extrinsic pathway.
Fractionation of HeLa cell nuclear extracts reveals minor small nuclear ribonucleoprotein particles

International Nuclear Information System (INIS)

Kroemer, A.

1987-01-01

Upon chromatographic fractionation of HeLa cell nuclear extracts, small RNAs of 145 and 66/65 nucleotides, respectively, were detected that are distinct from the abundant small RNAs present in the extract. These RNAs are precipitated by antibodies directed against the trimethylguanosine cap structure, characteristic for small nuclear RNAs (snRNAs) of the U type. The RNAs of 145 and 66/65 nucleotides appear to be associated with at least one of the proteins common to the major small nuclear ribonucleoprotein particles U1 to U6, since they are specifically bound by anti-Sm antibodies. These criteria characterize the RNAs that are 145 and 66/65 nucleotides in length as U-type snRNAs. Upon gel filtration, the RNAs are found within particles of molecular weights ≅ 150,000 and 115,000 respectively. The RNA of 145 nucleotides represents a different minor snRNA, designated U11, whereas the RNA of 66/65 nucleotides may correspond to either mammalian U7 or U10 RNA
Structures of a putative RNA 5-methyluridine methyltransferase, Thermus thermophilus TTHA1280, and its complex with S-adenosyl-l-homocysteine

International Nuclear Information System (INIS)

Pioszak, Augen A.; Murayama, Kazutaka; Nakagawa, Noriko; Ebihara, Akio; Kuramitsu, Seiki; Shirouzu, Mikako; Yokoyama, Shigeyuki

2005-01-01

Three structures of a putative RNA 5-methyluridine methyltransferase from T. thermophilus, including its complex with S-adenosyl-l-homocysteine, are presented. The structures reveal the mode of cofactor binding, architecture of the putative active site, and the presence of a deep cleft adjacent to the active site that may bind RNA. The Thermus thermophilus hypothetical protein TTHA1280 belongs to a family of predicted S-adenosyl-l-methionine (AdoMet) dependent RNA methyltransferases (MTases) present in many bacterial and archaeal species. Inspection of amino-acid sequence motifs common to class I Rossmann-fold-like MTases suggested a specific role as an RNA 5-methyluridine MTase. Selenomethionine (SeMet) labelled and native versions of the protein were expressed, purified and crystallized. Two crystal forms of the SeMet-labelled apoprotein were obtained: SeMet-ApoI and SeMet-ApoII. Cocrystallization of the native protein with S-adenosyl-l-homocysteine (AdoHcy) yielded a third crystal form, Native-AdoHcy. The SeMet-ApoI structure was solved by the multiple anomalous dispersion method and refined at 2.55 Å resolution. The SeMet-ApoII and Native-AdoHcy structures were solved by molecular replacement and refined at 1.80 and 2.60 Å, respectively. TTHA1280 formed a homodimer in the crystals and in solution. Each subunit folds into a three-domain structure composed of a small N-terminal PUA domain, a central α/β-domain and a C-terminal Rossmann-fold-like MTase domain. The three domains form an overall clamp-like shape, with the putative active site facing a deep cleft. The architecture of the active site is consistent with specific recognition of uridine and catalysis of methyl transfer to the 5-carbon position. The cleft is suitable in size and charge distribution for binding single-stranded RNA.
Dose-rate effects in plateau-phase cultures of S3 HeLa and V79 cells

International Nuclear Information System (INIS)

Mitchell, J.B.; Bedford, J.S.; Bailey, S.M.

1979-01-01

Dose-rate effects on cell survival were studied for log-, fed plateau-, and unfed plateau-phase cultures of V79 and S3 HeLa cells. For log-phase cultures, repair, cell-cycle redistribution, and cell division during exposure can contribute to the overall dose-rate effect, but their relative contributions are difficult to determine. With plateau-phase cultures, the cell-cycle times are greatly lengthened, for those cells that are in cycle. Hence, the contribution to the overall dose-rate effect of cell-cycle redistribution and cell division during the exposure could be minimized using plateau-phase cultures. With respect to the acute dose-survival curves, there was a clear loss in effectiveness when the dose rate was lowered to 154 rad/hr for both fed and unfed plateau-phase HeLa and V79 cells. There was no further reduction in effectiveness per unit dose, however, when the dose rate was reduced to 55 rad/hr. Since there was virtually no cell division or cell-cycle redistribution, it may be that a limit to the repair-dependent dose-rate effect at 37 0 C has been reached at a dose rate of 154 rad/hr
Characterization of the association of radiolabeled bleomycin A2 with HeLa cells

International Nuclear Information System (INIS)

Roy, S.N.; Horwitz, S.B.

1984-01-01

The association of [ 3 H]bleomycin A2 and Cu(II):[ 3 H]bleomycin A2 with HeLa cells has been characterized. Under the conditions of our experiments, approximately 0.1% of the total drug in the medium associates with HeLa cells. Both forms of the drug bind to HeLa cells in a specific and saturable manner, with a Km of 20 microM and a Vmax of 2.5 pmol/min/10(6) cells. Scatchard analysis of the specific binding data demonstrates a single set of high-affinity binding sites. Cytotoxic activities of both forms of the drug are similar, with a 50% lethal dose of 0.5 microM at 48 hr. The specific binding in HeLa cells of either the labeled metal-free drug or its copper complex is reversible by a 100-fold excess of either unlabeled drug. Interaction of the drug with cells is temperature sensitive but is unaffected by metabolic poisons, suggesting that this process is not energy dependent. Isolation of DNA from HeLa cells incubated with the drug indicates that 1 mol of either [ 3 H]bleomycin A2 or Cu(II):[ 3 H]bleomycin A2 binds per 10(8) nucleotides. Further studies with the radiolabeled drug are required to define precisely the mechanisms involved in bleomycin uptake and compartmentalization within the cell
Ascorbyl Stearate Promotes Apoptosis Through Intrinsic Mitochondrial Pathway in HeLa Cancer Cells.

Science.gov (United States)

Mane, Shirish D; Thoh, Maikho; Sharma, Deepak; Sandur, Santosh K; Naidu, K Akhilender

2016-12-01

Ascorbic acid is proposed to have antitumor potential against certain cancer types but has the limitation of requiring high doses for treating cancer. Ascorbyl stearate (ASC-S) is a fatty acid ester derivative of ascorbic acid with comparable potent apoptotic activity. The present study was aimed at understanding the pathway involved in apoptotic activity of ASC-S in cervical cancer cells. The effect of ASC-S on reactive oxygen species (ROS), and mitochondrial membrane potential (MMP) was studied in HeLa cells. Furthermore, the dose-dependent effect of ASC-S on release of cytochrome c, pro-caspase-9, caspase-3, BH3 interacting-domain death agonist (BID), truncated BH3 interacting-domain death agonist (t-BID), FAS ligand (FASL) and transcription factors nuclear factor-kappa B (NF-ĸB), nuclear factor of activated T-cells (NFAT) and activator protein-1 (AP1) were studied in HeLa cells. Treatment of HeLa cells with ASC-S significantly increased the MMP. The modulation of MMP resulted in cleavage of BID, expression of FAS, cleavage of pro-caspase-9 and release of cytochrome c into cytosol. In addition, ASC-S treatment resulted in deregulation of transcription factors NF-ĸB, NFAT and AP1, which play an important role in the development of inflammation and cancer. Our data, for the first time, suggest that ASC-S has an apoptotic effect against HeLa cells by inducing change in mitochondrial membrane permeability, cytochrome c release and subsequent activation of caspase-3 and NF-ĸB. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Dataset on the effects of CYB5D2 on the distribution of HeLa cervical cancer cell cycle

Directory of Open Access Journals (Sweden)

Yanyun Xie

2016-03-01

Full Text Available We have recently reported that CYB5D2 plays a role in suppression of cervical cancer tumorigenesis, “CYB5D2 displays tumor suppression activities towards cervical cancer” [1]. We provide the accompany data here describing the effects of CYB5D2 overexpression and addition of recombinant CYB5D2 on HeLa cell cycle distribution. Furthermore, we will present the conditions used to specifically determine CYB5D2 expression in primary cervical and cervical cancer tissues using immunohistochemistry (IHC and the patient cohort involved in assessing the CYB5D2 protein levels in primary cervical and cervical cancer tissues.
Expression proteomics of UPF1 knockdown in HeLa cells reveals autoregulation of hnRNP A2/B1 mediated by alternative splicing resulting in nonsense-mediated mRNA decay

Directory of Open Access Journals (Sweden)

Zavolan Mihaela

2010-10-01

Full Text Available Abstract Background In addition to acting as an RNA quality control pathway, nonsense-mediated mRNA decay (NMD plays roles in regulating normal gene expression. In particular, the extent to which alternative splicing is coupled to NMD and the roles of NMD in regulating uORF containing transcripts have been a matter of debate. Results In order to achieve a greater understanding of NMD regulated gene expression we used 2D-DiGE proteomics technology to examine the changes in protein expression induced in HeLa cells by UPF1 knockdown. QPCR based validation of the corresponding mRNAs, in response to both UPF1 knockdown and cycloheximide treatment, identified 17 bona fide NMD targets. Most of these were associated with bioinformatically predicted NMD activating features, predominantly upstream open reading frames (uORFs. Strikingly, however, the majority of transcripts up-regulated by UPF1 knockdown were either insensitive to, or even down-regulated by, cycloheximide treatment. Furthermore, the mRNA abundance of several down-regulated proteins failed to change upon UPF1 knockdown, indicating that UPF1's role in regulating mRNA and protein abundance is more complex than previously appreciated. Among the bona fide NMD targets, we identified a highly conserved AS-NMD event within the 3' UTR of the HNRNPA2B1 gene. Overexpression of GFP tagged hnRNP A2 resulted in a decrease in endogenous hnRNP A2 and B1 mRNA with a concurrent increase in the NMD sensitive isoforms. Conclusions Despite the large number of changes in protein expression upon UPF1 knockdown, a relatively small fraction of them can be directly attributed to the action of NMD on the corresponding mRNA. From amongst these we have identified a conserved AS-NMD event within HNRNPA2B1 that appears to mediate autoregulation of HNRNPA2B1 expression levels.
Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

Science.gov (United States)

Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

2014-10-17

RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.
Effect of endoplasmic reticulum stress on the response of HeLa cells to carbon ion radiation

International Nuclear Information System (INIS)

Xia Jiefang; Wang Zhuanzi; Wei Wei; Dang Bingrong; Li Wenjian

2015-01-01

To investigate the effect of endoplasmic reticulum stress on HeLa cells to "1"2C"6"+ ion irradiation, HeLa cells were pretreated with 2.5 mmol/L dithiothreitol and irradiated by "1"2C"6"+ ions with different doses. The results showed that, compared with IR alone, dithiothreitol combined with carbon ion irradiation caused HeLa cell survival decreased, and the apoptosis increased. Moreover, dithiothreitol and carbon ion radiation combination treatment led to a significant increase of G_2/M phase, and autophagy was activated obviously in combination treatment group. The results imply that continuous endoplasmic reticulum stress can change the response of HeLa cells to "1"2C"6"+ irradiation, and dithiothreitol may affect HeLa cells through the autophagy cell death pathway. (authors)
Efficacy of Proliferation of HeLa Cells under Three Different Low-Intensity Red Lasers Irradiation

Directory of Open Access Journals (Sweden)

H. Q. Yang

2012-01-01

Full Text Available This study was intended to compare the efficacy of proliferation of HeLa cells under three different low-intensity laser irradiation (LIL, that is, 633 nm, 658 nm, and 785 nm. The time-dependent responses of proliferation of HeLa cells after the red laser irradiation and the influence of fetal bovine serum (FBS at 1%, 2%, 5%, or 10% on the proliferation of cells were also investigated. The results indicated that the proliferation of HeLa cells in 10% FBS was in proliferation-specific homeostasis (PSH so that it was not modulated with LIL; the proliferation in FBS at 1%, 2%, or 5% was far from PSH so that it may be wavelength dependently modulated with LIL, and the maximum proliferation promotion was conducted with LIL at 633 nm amongst the three different LIL. It was concluded the wavelength-dependent photobiomodulation of LIL on proliferation of HeLa cells may be homeostatic.
RNA Processing Factor 5 is required for efficient 5' cleavage at a processing site conserved in RNAs of three different mitochondrial genes in Arabidopsis thaliana.

Science.gov (United States)

Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan

2013-05-01

The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

Science.gov (United States)

Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

2016-01-01

Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B–Treated Cervical Cancer HeLa Cells

Science.gov (United States)

Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

2016-01-01

Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H2O2–induced cell death is via neutralization of reactive oxygen species. PMID:27458249
Transcriptome-wide mapping of 5-methylcytidine RNA modifications in bacteria, archaea, and yeast reveals m5C within archaeal mRNAs.

Directory of Open Access Journals (Sweden)

Sarit Edelheit

2013-06-01

Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.
Leukemia-associated gene MLAA-34 reduces arsenic trioxide-induced apoptosis in HeLa cells via activation of the Wnt/β-catenin signaling pathway.

Science.gov (United States)

Zhang, Pengyu; Zhao, Xuan; Zhang, Wenjuan; He, Aili; Lei, Bo; Zhang, Wanggang; Chen, Yinxia

2017-01-01

Our laboratory previously used the SEREX method in U937 cells and identified a novel leukemia-associated gene MLAA-34, a novel splice variant of CAB39L associated with acute monocytic leukemia, that exhibited anti-apoptotic activities in U937 cells. Whether MLAA-34 has an anti-apoptotic role in other tumor cells has not yet been reported. We explored whether MLAA-34 exhibited anti-apoptotic effects in HeLa cervical cancer cells and the possible mechanism of action. We generated a HeLa cell line stably expressing MLAA-34 and found that MLAA-34 overexpression had no effect on the growth, apoptosis and cell cycle of HeLa cells. However, upon treatment with arsenic trioxide (ATO) to induce apoptosis, the cell viability and colony formation ability of ATO-treated MLAA-34 stable HeLa cells were significantly higher than that of ATO-treated controls, and the apoptosis rate and proportion of G2/M cells also decreased. We found that ATO treatment of HeLa cells resulted in significant decreases in the expression of β-catenin mRNA and protein and the downstream target factors c-Myc, cyclin B1, and cyclin D1 in the Wnt signaling pathway. Notably, ATO-treated MLAA-34 stable HeLa cells showed a significant reduction in the ATO-mediated downregulation of these factors. In addition, MLAA-34 overexpression significantly increased the expression of nuclear β-catenin protein in ATO-treated cells compared with HeLa cells treated only with ATO. Thus, here we have found that the Wnt/β-catenin signaling pathway is involved in ATO-induced apoptosis in HeLa cells. MLAA-34 reduces ATO-induced apoptosis and G2/M arrest, and the anti-apoptotic effect may be achieved by activating the Wnt/β-catenin signaling pathway in HeLa cells.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

Science.gov (United States)

Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

2012-08-17

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

Science.gov (United States)

Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

2016-12-01

In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.
Effects of Smac gene over-expression on radiotherapeutic sensitivity of cervical cancer cell line HeLa

International Nuclear Information System (INIS)

Zheng Liduan; Wang Liang; Tong Qiangsong; Fei Shihong; Xiong Yufang; Wu Gang

2005-01-01

Objective: To study the effects of extrinsic Smac gene transfection and its over-expression on radiotherapeutic sensitivity of cervical cancer cells, in order to explore a novel strategy for ameliorating radiotherapy of cervical cancer. Methods: After Smac gene was transferred into cells of cervical cancer cell line HeLa, the subclone cells were obtained by persistent G 418 selection. Cellular Smac gene expression was determined by RT-PCR and Western blot. After treatment with X-ray irradiation, cellular growth activity in vitro was investigated by MTT colorimetry. Cellular apoptosis and its rate were determined by electron microscopy, Annexin V-FITC and propidium iodide staining flow cytometry. Cellular Caspase-3 protein expression and its activity were assayed by Western blot and colorimetry. Results: RT-PCR and Western blot demonstrated that Smac mRNA and protein levels of HeLa/Smac cells, the selected subclone cells of cervical cancer cell line, were significantly higher than those of HeLa cells (P<0.01). After treated with 8 Gy X-ray irradiation, growth activity of HeLa/Smac cells reduced by 10.19%(P<0.01), as compared with that of HeLa cells. Partial HeLa/Smac cancer cells presented characteristic morphological changes of apoptosis under electron microscope, with an apoptosis rate of 16.4%, which was significantly higher than that of HeLa cells(6.2%, P<0.01). Compared with HeLa cells, Caspase-3 expression level in HeLa/Smac was improved significantly (P<0.01), while its activity was 3.42 times as much as that of HeLa cells (P<0.01). Conclusion: Stable transfection of extrinsic Smac gene and its over-expression in cervical cancer cell line could significantly enhance cellular caspase-3 expression and activity, ameliorate apoptosis-inducing effects of radiation on cancer cells, which would be a novel strategy to improve radiotherapeutic effects for cervical cancer. (authors)
Effect of estrogens on bacterial adherence to HeLa cells.

OpenAIRE

Sugarman, B; Epps, L R

1982-01-01

Incubating confluent cell culture HeLa cells for 18 h with increasing concentrations of estrogens progressively enhanced the subsequent attachment of a variety of radiolabeled bacteria to the HeLa cells. This effect was not caused by other hormones and was not produced by 1-h incubations of HeLa cells or bacteria with hormones. Estrogens did not similarly affect two other receptor cell lines studied. The addition of metabolic inhibitors showed that this effect of estrogens on HeLa cells was e...

Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

International Nuclear Information System (INIS)

Gewirth, D.T.; Moore, P.B.

1987-01-01

The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR
Establishment of HeLa cell mutants deficient in sphingolipid-related genes using TALENs.

Directory of Open Access Journals (Sweden)

Toshiyuki Yamaji

Full Text Available Sphingolipids are essential components in eukaryotes and have various cellular functions. Recent developments in genome-editing technologies have facilitated gene disruption in various organisms and cell lines. We here show the disruption of various sphingolipid metabolic genes in human cervical carcinoma HeLa cells by using transcription activator-like effector nucleases (TALENs. A TALEN pair targeting the human CERT gene (alternative name COL4A3BP encoding a ceramide transport protein induced a loss-of-function phenotype in more than 60% of HeLa cells even though the cell line has a pseudo-triploid karyotype. We have isolated several loss-of-function mutant clones for CERT, UGCG (encoding glucosylceramide synthase, and B4GalT5 (encoding the major lactosylceramide synthase, and also a CERT/UGCG double-deficient clone. Characterization of these clones supported previous proposals that CERT primarily contributes to the synthesis of SM but not GlcCer, and that B4GalT5 is the major LacCer synthase. These newly established sphingolipid-deficient HeLa cell mutants together with our previously established stable transfectants provide a 'sphingolipid-modified HeLa cell panel,' which will be useful to elucidate the functions of various sphingolipid species against essentially the same genomic background.
The Structure of the RNA m5C Methyltransferase YebU from Escherichia coli Reveals a C-terminal RNA-recruiting PUA Domain

DEFF Research Database (Denmark)

Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A

2006-01-01

potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...
I prokaryota si chrání svoji RNA – nové typy 5'-RNA čepiček

Czech Academy of Sciences Publication Activity Database

Cahová, Hana

2017-01-01

Roč. 111, č. 7 (2017), s. 414-423 ISSN 0009-2770 R&D Projects: GA ČR(CZ) GJ16-16358Y Institutional support: RVO:61388963 Keywords : 5'-RNA cap * NAD-RNA * RNA chemical modification Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 0.387, year: 2016 http://www.chemicke-listy.cz/docs/full/2017_07_414-423.pdf
Sensitization of human carcinoma cells to alkylating agents by small interfering RNA suppression of 3-alkyladenine-DNA glycosylase.

Science.gov (United States)

Paik, Johanna; Duncan, Tod; Lindahl, Tomas; Sedgwick, Barbara

2005-11-15

One of the major cytotoxic lesions generated by alkylating agents is DNA 3-alkyladenine, which can be excised by 3-alkyladenine DNA glycosylase (AAG). Inhibition of AAG may therefore result in increased cellular sensitivity to chemotherapeutic alkylating agents. To investigate this possibility, we have examined the role of AAG in protecting human tumor cells against such agents. Plasmids that express small interfering RNAs targeted to two different regions of AAG mRNA were transfected into HeLa cervical carcinoma cells and A2780-SCA ovarian carcinoma cells. Stable derivatives of both cell types with low AAG protein levels were sensitized to alkylating agents. Two HeLa cell lines with AAG protein levels reduced by at least 80% to 90% displayed a 5- to 10-fold increase in sensitivity to methyl methanesulfonate, N-methyl-N-nitrosourea, and the chemotherapeutic drugs temozolomide and 1,3-bis(2-chloroethyl)-1-nitrosourea. These cells showed no increase in sensitivity to UV light or ionizing radiation. After treatment with methyl methanesulfonate, AAG knockdown HeLa cells were delayed in S phase but accumulated in G2-M. Our data support the hypothesis that ablation of AAG activity in human tumor cells may provide a useful strategy to enhance the efficacy of current chemotherapeutic regimens that include alkylating agents.
Catalytic mechanism and inhibition of tRNA (Uracil-5-)methyltransferase: evidence for covalent catalysis

International Nuclear Information System (INIS)

Santi, D.V.; Hardy, L.W.

1987-01-01

tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes
Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

Directory of Open Access Journals (Sweden)

Garcia Sònia

2012-06-01

Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.
Determination of sRNA expressions by RNA-seq in Yersinia pestis grown in vitro and during infection.

Directory of Open Access Journals (Sweden)

Yanfeng Yan

Full Text Available BACKGROUND: Small non-coding RNAs (sRNAs facilitate host-microbe interactions. They have a central function in the post-transcriptional regulation during pathogenic lifestyles. Hfq, an RNA-binding protein that many sRNAs act in conjunction with, is required for Y. pestis pathogenesis. However, information on how Yersinia pestis modulates the expression of sRNAs during infection is largely unknown. METHODOLOGY AND PRINCIPAL FINDINGS: We used RNA-seq technology to identify the sRNA candidates expressed from Y. pestis grown in vitro and in the infected lungs of mice. A total of 104 sRNAs were found, including 26 previously annotated sRNAs, by searching against the Rfam database with 78 novel sRNA candidates. Approximately 89% (93/104 of these sRNAs from Y. pestis are shared with its ancestor Y. pseudotuberculosis. Ninety-seven percent of these sRNAs (101/104 are shared among more than 80 sequenced genomes of 135 Y. pestis strains. These 78 novel sRNAs include 62 intergenic and 16 antisense sRNAs. Fourteen sRNAs were selected for verification by independent Northern blot analysis. Results showed that nine selected sRNA transcripts were Hfq-dependent. Interestingly, three novel sRNAs were identified as new members of the transcription factor CRP regulon. Semi-quantitative analysis revealed that Y. pestis from the infected lungs induced the expressions of six sRNAs including RyhB1, RyhB2, CyaR/RyeE, 6S RNA, RybB and sR039 and repressed the expressions of four sRNAs, including CsrB, CsrC, 4.5S RNA and sR027. CONCLUSIONS AND SIGNIFICANCE: This study is the first attempt to subject RNA from Y. pestis-infected samples to direct high-throughput sequencing. Many novel sRNAs were identified and the expression patterns of relevant sRNAs in Y. pestis during in vitro growth and in vivo infection were revealed. The annotated sRNAs accounted for the most abundant sRNAs either expressed in bacteria grown in vitro or differentially expressed in the infected lungs
Apoptotic effects of bovine apo-lactoferrin on HeLa tumor cells.

Science.gov (United States)

Luzi, Carla; Brisdelli, Fabrizia; Iorio, Roberto; Bozzi, Argante; Carnicelli, Veronica; Di Giulio, Antonio; Lizzi, Anna Rita

2017-01-01

Lactoferrin (Lf), a cationic iron-binding glycoprotein of 80 kDa present in body secretions, is known as a compound with marked antimicrobial activity. In the present study, the apoptotic effect of iron-free bovine lactoferrin (apo-bLf) on human epithelial cancer (HeLa) cells was examined in association with reactive oxygen species and glutathione (GSH) levels. Apoptotic effect of iron-free bovine lactoferrin inhibited the growth of HeLa cells after 48 hours of treatment while the diferric-bLf was ineffective in the concentration range tested (from 1 to 12.5 μM). Western blot analysis showed that key apoptotic regulators including Bax, Bcl-2, Sirt1, Mcl-1, and PARP-1 were modulated by 1.25 μM of apo-bLf. In the same cell line, apo-bLf induced apoptosis together with poly (ADP-ribose) polymerase cleavage, caspase activation, and a significant drop of NAD + . In addition, apo-bLf-treated HeLa cells showed a marked increase of reactive oxygen species level and a significant GSH depletion. On the whole, apo-bLf triggered apoptosis of HeLa cells upon oxygen radicals burst and GSH decrease. Copyright © 2017 John Wiley & Sons, Ltd.
Cytotoxic and apoptotic activities of black widow spiderling extract against HeLa cells.

Science.gov (United States)

Peng, Xiaozhen; Dai, Zhipan; Lei, Qian; Liang, Long; Yan, Shuai; Wang, Xianchun

2017-06-01

Black widow spiders contain toxic components not only in the venom glands but also in other parts of the spider body, including the legs and abdomen. Additionally, both the eggs and newborn spiderlings of the black widow spider contain venom. It is important to investigate their potential effects on cancer cells. In the present study, the effects of newborn black widow spiderling extract on human HeLa cells were evaluated in vitro . When applied at different concentrations, the total extract decreased HeLa cell viability in a dose-dependent manner, with an IC 50 value of 158 µg/ml. Flow cytometry indicated that treatment of HeLa cells with the total extract of the spiderlings induced apoptosis in HeLa cells in a dose-dependent manner and led to cell cycle arrest in the S-phase. Additionally, application of the total extract at different concentrations increased apoptosis-related caspase 3 activity in a dose-dependent manner. HeLa cells treated with the total extract appeared to be morphologically changed, exhibiting membrane blebbing, nuclear fragmentation and condensation of chromatin. Further separation and activity screening demonstrated that the cytotoxic and apoptotic activities of the total extract were attributable mainly to its high molecular mass proteins, one of which was purified and characterized to determine its anti-tumor activities on HeLa cells. The results of the present study therefore have expanded understanding regarding the effect of spider toxins on cancer cells and suggested that components of black widow spiderlings may be developed as a promising novel agent to treat cancer.
Study of radiation sensitization of artesunate on human HeLa cells of cervical cancer

International Nuclear Information System (INIS)

Ji Rong; Cao Jianping; Chen Xialin; Zhu Wei; Jiang Qing; Pan Chunyan; Zhou Yuanyuan; Feng Yang; Peng Xiaomei; Liu Yang; Fan Saijun

2010-01-01

Objective: To investigate the radiosensitizing effects of artesunate on human HeLa cells of cervical cancer in vitro. Methods: Hela cells irradiated with 60 Co γ-rays. The dose rate was 0.635 Gy/min and the radiation dose was 0, 1, 2, 4, 6 Gy, respectively. The anti-proliferation activities of artesunate on HeLa cells were evaluated with MTT assay, to determine the most appropriate drug concentration. The effect of radiosensitivity was observed by using clonogenic assay. The single-hit multi-target model was used to plot the HeLa cell's dose-survival curve, to calculate mean lethal dose, quasi-threshold dose and sensitization enhancement rate, and to evaluate its radiosensitization effect. The apoptosis was analyzed with flow cytometry (FCM) to further test the radiation sensitization of artesunate on HeLa cells. Results: The inhibition of artesunate on HeLa cells increased with concentration. In radiation group, the cell cloning efficiency were 91.67%, 82.02%, 58.06%, 25.01%, respectively, and in artesunate (2.0 μmol/L) + radiation group, the cell cloning efficiency were 74.93%, 60.53%, 22.38%, 5.05%. In radiation group and artesunate (2.0 μmol/L) + radiation group, the mean lethal dose (D 0 ) was 2.95 and 2.07 Gy, respectively, while the qusai-threshold dose (D q ) were 2.01 and 1.24 Gy, respectively, and SER was 1.43. Compared with 2 and 6 Gy radiation group, the apoptosis rate of drug + radiation group increased from 12.26%, 40.08% to 22.71%, 59.92. Conclusions: The inhibiting effect of artesunate on HeLa cells is concentration-dependent. Artesunate has radiosensitizing effect on HeLa cells in vitro. (authors)
CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.

Science.gov (United States)

Busi, Florent; Cresteil, Thierry

2005-09-01

The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.
Suppressive effect on HeLa cells proliferation by phenothiazine derivatives alone and combining with ionizing radiation

International Nuclear Information System (INIS)

Yan Yuqian; Wang Lin; Sui Jianli; Bai Bei; Zhou Pingkun; Yan Yuqiu; Sun Weijian

2006-01-01

Objective: To examine the antiproliferative effects of phenothiazine derivatives (PTZDs) alone on HeLa cells and in combination with ionizing radiation. Methods: MTT and colony-forming method were used to evaluate the proliferation activity and cellular radiosensitivity of HeLa cells. Results: We compared the antiproliferative effects of six phenothiazine derivatives, and found that the derivatives α-chloro-N-dimethylamine phenothiazine (PTZD2), α-triflumethyl-N-α(dimethylamine ethyl) phenothiazine (PTZD3) and α-chloro-N-(dimethylamine ethyl) phenothiazine (PTZD5) showed a significant antiproliferative effect at concentration of 10 μmol/L. HeLa cells proliferation was completely suppressed when treated with PTZDs of 40-50 μmol/L. PTZD2/PTZD3 and cobalt-60 gamma-irradiation showed synergistic suppressive effect on proliferation of HeLa cells. The enhancement ratios of 10 μmol/L PTZD3 combination with 2 Gy and 4 Gy irradiations were 3.5 and 1.8, respectively. The maximum synergistic suppressive effect was observed when cells administered with PTZD3 at 18 h before being irradiated. Conclusion: Phenothiazine derivatives show antiproliferations on HeLa cells, and differ in degrees. The synergistic anticancer effect could be obtained by combining phenothiazine derivatives with radiotherapy. (authors)
Diversity of 23S rRNA genes within individual prokaryotic genomes.

Directory of Open Access Journals (Sweden)

Anna Pei

Full Text Available BACKGROUND: The concept of ribosomal constraints on rRNA genes is deduced primarily based on the comparison of consensus rRNA sequences between closely related species, but recent advances in whole-genome sequencing allow evaluation of this concept within organisms with multiple rRNA operons. METHODOLOGY/PRINCIPAL FINDINGS: Using the 23S rRNA gene as an example, we analyzed the diversity among individual rRNA genes within a genome. Of 184 prokaryotic species containing multiple 23S rRNA genes, diversity was observed in 113 (61.4% genomes (mean 0.40%, range 0.01%-4.04%. Significant (1.17%-4.04% intragenomic variation was found in 8 species. In 5 of the 8 species, the diversity in the primary structure had only minimal effect on the secondary structure (stem versus loop transition. In the remaining 3 species, the diversity significantly altered local secondary structure, but the alteration appears minimized through complex rearrangement. Intervening sequences (IVS, ranging between 9 and 1471 nt in size, were found in 7 species. IVS in Deinococcus radiodurans and Nostoc sp. encode transposases. T. tengcongensis was the only species in which intragenomic diversity >3% was observed among 4 paralogous 23S rRNA genes. CONCLUSIONS/SIGNIFICANCE: These findings indicate tight ribosomal constraints on individual 23S rRNA genes within a genome. Although classification using primary 23S rRNA sequences could be erroneous, significant diversity among paralogous 23S rRNA genes was observed only once in the 184 species analyzed, indicating little overall impact on the mainstream of 23S rRNA gene-based prokaryotic taxonomy.
pEgr-sTRAIL transfer in combination with 60Co γ ray irradiation to induce the apoptosis on HeLa cells and activation of Caspase-3

International Nuclear Information System (INIS)

Tian Mei; Guo Zhiying; Zhao Baofeng; Ruan Jianlei; Su Xu

2009-01-01

In order to approach the radiosensitivity of TRAIL expression controlled by Egr-1 promotor, the recombinant vector pEgr-sTRAIL was tranfected into HeLa cells, the early apoptosis and Caspase-3 activity were detected after different doses of 60 Co γ-ray irradiation. The results showed that pEgr-sTRAIL transfected in combination with γ-ray irradiation could significantly induce the apoptosis of HeLa cells in a dose-dependent manner. The higher activity of Capase-3 was also found in pEgr-sTRAIL irradiated group by using western blotting and spectrophotometry. Our result demonstrated that the activity of Caspase-3, as the apoptosis executor, play an important role in TRAIL-induced apoptosis and the enhanced TRAIL-induced apoptosis in transfected cells after irradiation can be controlled by radio-sensitive promoter Egr-1. (authors)
Cell-type-specific genome editing with a microRNA-responsive CRISPR–Cas9 switch

Science.gov (United States)

Hirosawa, Moe; Fujita, Yoshihiko; Parr, Callum J. C.; Hayashi, Karin; Kashida, Shunnichi; Hotta, Akitsu; Woltjen, Knut

2017-01-01

Abstract The CRISPR–Cas9 system is a powerful genome-editing tool useful in a variety of biotechnology and biomedical applications. Here we developed a synthetic RNA-based, microRNA (miRNA)-responsive CRISPR–Cas9 system (miR-Cas9 switch) in which the genome editing activity of Cas9 can be modulated through endogenous miRNA signatures in mammalian cells. We created miR-Cas9 switches by using a miRNA-complementary sequence in the 5΄-UTR of mRNA encoding Streptococcus pyogenes Cas9. The miR-21-Cas9 or miR-302-Cas9 switches selectively and efficiently responded to miR-21-5p in HeLa cells or miR-302a-5p in human induced pluripotent stem cells, and post-transcriptionally attenuated the Cas9 activity only in the target cells. Moreover, the miR-Cas9 switches could differentially control the genome editing by sensing endogenous miRNA activities within a heterogeneous cell population. Our miR-Cas9 switch system provides a promising framework for cell-type selective genome editing and cell engineering based on intracellular miRNA information. PMID:28525578
The Role of Exportin-5 in MicroRNA Biogenesis and Cancer

Directory of Open Access Journals (Sweden)

Ke Wu

2018-04-01

Full Text Available MicroRNAs (miRNAs are conserved small non-coding RNAs that play an important role in the regulation of gene expression and participate in a variety of biological processes. The biogenesis of miRNAs is tightly controlled at multiple steps, such as transcription of miRNA genes, processing by Drosha and Dicer, and transportation of precursor miRNAs (pre-miRNAs from the nucleus to the cytoplasm by exportin-5 (XPO5. Given the critical role of nuclear export of pre-miRNAs in miRNA biogenesis, any alterations of XPO5, resulting from either genetic mutation, epigenetic change, abnormal expression level or posttranslational modification, could affect miRNA expression and thus have profound effects on tumorigenesis. Importantly, XPO5 phosphorylation by ERK kinase and its cis/trans isomerization by the prolyl isomerase Pin1 impair XPO5′s nucleo-to-cytoplasmic transport ability of pre-miRNAs, leading to downregulation of mature miRNAs in hepatocellular carcinoma. In this review, we focus on how XPO5 transports pre-miRNAs in the cells and summarize the dysregulation of XPO5 in human tumors. Keywords: Exportin-5, MicroRNA, Biogenesis, Dysregulation, Cancer
Regulation of human histone gene expression: transcriptional and posttranscriptional control in the coupling of histone messenger RNA stability with DNA replication

International Nuclear Information System (INIS)

Baumbach, L.L.; Stein, G.S.; Stein, J.L.

1987-01-01

The extent to which transcriptional and posttranscriptional regulation contributes to the coupling of histone gene expression and DNA replication was examined during the cell cycle in synchronized HeLa S3 cells. Rates of transcription were determined in vitro in isolated nuclei. A 3-5-fold increase in cell cycle dependent histone gene transcription was observed in early S phase, prior to the peak of DNA synthesis. This result is consistent with a previous determination of histone mRNA synthesis in intact cells. The transcription of these genes did not change appreciably after inhibition of DNA replication by hydroxyurea treatment, although Northern blot analysis indicated that cellular levels of histone mRNA decreased rapidly in the presence of the drug. Total cellular levels of histone mRNA closely parallel the rate of DNA synthesis as a function of cell cycle progression, reaching a maximal 20-fold increase as compared with non S phase levels. This DNA synthesis dependent accumulation of histone mRNA occurs predominantly in the cytoplasm and appears to be mediated primarily by control of histone mRNA stability. Changes in nuclear histone mRNA levels were less pronounced. These combined observations suggest that both transcriptional regulation and posttranscriptional regulation contribute toward control of the cell cycle dependent accumulation of histone mRNA during S phase, while the stability of histone mRNA throughout S phase and the selective turnover of histone mRNAs, either at the natural termination of S phase or following inhibition of DNA synthesis, are posttranscriptionally regulated
[Effects of selenium compounds on proliferation, migration and adhesion of HeLa cells].

Science.gov (United States)

Sun, Licui; Lu, Jiaxi; Wang, Qin; Liu, Yiqun; Han, Feng; Yang, Yanhua; Zhang, Hongkun; Huang, Zhenwu

2015-03-01

To explore the effects of methylseleninic acid (MeSeA), selenomethionine (SeMet) and methylselenocysteine (MeSeCys) on proliferation, migration and adhesion of HeLa cells. HeLa cells were cultured and treated with MeSeA, SeMet and MeSeCys for 12 - 72 h respectively. MTT assay, healing assay and in vitro cell Matrigel adhesion assay were used to detect the proliferation, migration and adhesion of HeLa cells. Compared to the control group, the proliferation of HeLa cells was remarkably inhibited by MeSeA (P HeLa cells in MeSeA group was inhibited by 34% (P HeLa cells with inhibitions of 18% and 13% was in SeMet group in 4 h and 8 h. The inhibitions of HeLa cell migration in MeSeCys group was 28% (P HeLa cells in the MeSeA group, the SeMet group as well as the MeSeCys group were inhibited by 36% (P HeLa cell were effectively inhibited by MeSeA, while the adhesive function of HeLa cell was remarkably inhibited by MeSeCys.
Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

Science.gov (United States)

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-05-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Enhanced lethal effect of combined ACNU with x-ray on cultured HeLaS3 cells

International Nuclear Information System (INIS)

Kanazawa, Haruyuki; Miyamoto, Tadaaki

1983-01-01

The combined effects of ACNU and X-irradiation on cultured HeLaS 3 cells were investigated. Pretreatment with either ACNU or X-ray induced a substantial reduction in shoulder width the D 0 value of the dose-response curve for the other agent, given later was unchanged. ACNU did not inhibit the recovery of sublethal damage (SLD) induced by X-ray when this treatment preceded the spilit-dose experiment. Our results indicate that some cell damage induced by each agent is transmissible to the progeny of the surviving cells and that the interaction of ACNU and X-irradiation was lethal to the cells. (author)
Preparation and characterization of high-specific activity radiolabeled 50 S measles virus RNA

International Nuclear Information System (INIS)

Spruance, S.L.; Ashton, B.N.; Smith, C.B.

1980-01-01

A method is described to radiolabeled measles virus RNA for hybridization studies. Tritiated nucleosides were added to the media of measles virus infected Vero cells and negative-strand (genome) RNA with a specific activity of 6X10 5 c.p.m./μg was purified from viral nucleocapsids. 50 S RNA was the sole RNA present in nucleocapsids and self-annealed to 50% due to the presence of 25% 50 S plus-strands (anti-genomes). (Auth.)
Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....
HTP Nutraceutical Screening for Histone Deacetylase Inhibitors and Effects of HDACis on Tumor-suppressing miRNAs by Trichostatin A and Grapeseed (Vitis vinifera) in HeLa cells.

Science.gov (United States)

Mazzio, Elizabeth A; Soliman, Karam F A

2017-01-02

), with several miRNAs overlapping in the upward direction by both GSE and TSA (e.g. hsa-miR-23b-5p, hsa-miR-27b-5p, hsa-miR-1180-3p, hsa-miR-6880-5p and hsa-mir-943). Using DIANA miRNA online tools, it was determined that GSE and TSA simultaneously cause overexpression of similar miRNAs predicted to destroy the following influential oncogenes: NFkB, NRAS, KRAS, HRAS, MYC, TGFBR1, E2F1, E2F2, BCL21, CDKN1A, CDK6, HIF1a, and VEGFA. The data from this study show that plant- based HDACis are relatively rare, and can elicit a similar pattern to TSA in up-regulating miRNAs involved with tumor suppression of HeLa cervical carcinoma. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Photokinetic and ultrastructural studies on porphyrin photosensitization of HeLa cells

International Nuclear Information System (INIS)

Milanesi, Carla; Sorgato, Fiorella; Jori, Giulio

1989-01-01

Liposome-bound haematoporphyrin or haematoporphyrin dimethylester, as well as haematoporphyrin dissolved in phosphate-buffered saline, were added to HeLa cell monolayers at a dose of 1 μg of porphyrin per 10 5 cells. After 2 min or 20 min incubation liposome-bound porphyrins were accumulated by cells in an about two-fold larger amount than the water-dissolved haematoporphyrin. This caused a more efficient photosensitization of HeLa cells by liposome-delivered porphyrins upon illumination with 366 nm light. Ultrastructural studies of HeLa cells, which had been incubated in a physiological medium for 24 h after the end of irradiation, showed that liposomal porphyrins induce an early and extensive endocytoplasmic damage, leading to mitochondrial swelling and vesiculation; changes of permeability of the cytoplasmic membrane are also evident, especially in the case of haematoporphyrin dimethylester. On the other hand, water-dissolved haematoporphyrin predominantly photosensitizes damage of the plasma membrane. The different pattern of cell photodamage probably reflects a different subcellular distribution of the photosensitizing drugs. (author)
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

Science.gov (United States)

Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

2013-11-01

Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Deficit in DNA content relative to histones in X-irradiated HeLa cells

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.; Neubort, S.

1976-01-01

The DNA and histone content of HeLa S-3 cell cultures was measured by direct mass assays 21 hours after 1000 rad of X-irradiation, when the cells were arrested in G2 phase. The nuclear DNA content of such cultures was found to be deficient (73 per cent of control values). In contrast, the synthesis of nuclear histones persisted, and the total histone content was close to 100 per cent of control values. When synchronously-growing cultures were irradiated in mid-S phase and examined 3.5 hours later in G2 phase, both DNA and histone content were equal to control values. (author)
Synergistic effect of fisetin combined with sorafenib in human cervical cancer HeLa cells through activation of death receptor-5 mediated caspase-8/caspase-3 and the mitochondria-dependent apoptotic pathway.

Science.gov (United States)

Lin, Ming-Te; Lin, Chia-Liang; Lin, Tzu-Yu; Cheng, Chun-Wen; Yang, Shun-Fa; Lin, Chu-Liang; Wu, Chih-Chien; Hsieh, Yi-Hsien; Tsai, Jen-Pi

2016-05-01

Combining antitumor agents with bioactive compounds is a potential strategy for improving the effect of chemotherapy on cancer cells. The goal of this study was to elucidate the antitumor effect of the flavonoid, fisetin, combined with the multikinase inhibitor, sorafenib, against human cervical cancer cells in vitro and in vivo. The combination of fisetin and sorafenib synergistically induced apoptosis in HeLa cells, which is accompanied by a marked increase in loss of mitochondrial membrane potential. Apoptosis induction was achieved by caspase-3 and caspase-8 activation which increased the ratio of Bax/Bcl-2 and caused the subsequent cleavage of PARP level while disrupting the mitochondrial membrane potential in HeLa cells. Decreased Bax/Bcl-2 ratio level and mitochondrial membrane potential were also observed in siDR5-treated HeLa cells. In addition, in vivo studies revealed that the combined fisetin and sorafenib treatment was clearly superior to sorafenib treatment alone using a HeLa xenograft model. Our study showed that the combination of fisetin and sorafenib exerted better synergistic effects in vitro and in vivo than either agent used alone against human cervical cancer, and this synergism was based on apoptotic potential through a mitochondrial- and DR5-dependent caspase-8/caspase-3 signaling pathway. This combined fisetin and sorafenib treatment represents a novel therapeutic strategy for further clinical developments in advanced cervical cancer.
Prader-Willi region non-protein coding RNA 1 suppressed gastric cancer growth as a competing endogenous RNA of microRNA-425-5p.

Science.gov (United States)

Chen, Zihao; Ju, Hongping; Yu, Shan; Zhao, Ting; Jing, Xiaojie; Li, Ping; Jia, Jing; Li, Nan; Tan, Bibo; Li, Yong

2018-03-13

Gastric cancer (GC) is one of a major global health problem especially in Asia. Nowadays, long non-coding RNA has gained significantly attention in the current research climate such as carcinogenesis. This research desired to explore the mechanism of Prader-Willi region non-protein coding RNA 1 (PWRN1) on regulating GC process. Differentially expressed lncRNAs in GC tissues were screened out through microarray analysis. The RNA and protein expression level was detected by qRT-PCR and western blot. Cell proliferation, apoptosis rate, metastasis abilities were respectively determined by CCK8, flow cytometry, wound healing and transwell assay. The luciferase reporter system was used to verify the targeting relationships between PWRN1, miR-425-5p and PTEN RIP assay was performed to prove whether PWRN1 acted as a competitive endogenous RNA (ceRNA) of miR-425-5p. Tumor xenograft model and immunohistochemistry were developed to study the influence of PWRN1 on tumor growth in vivo Microarray analysis determined that PWRN1 was different expressed between GC tissues and adjacent tissues. QRT-PCR revealed PWRN1 low expression in GC tissues and cells. PWRN1 up-regulated could reduce proliferation and metastasis and increased apoptosis in GC cells, while miR-425-5p had reverse effects. The RIP assay indicated that PWRN1 may target an oncogene miR-425-5p. The tumor xenograft assay found that up-regulated PWRN1 suppressed the tumor growth. The bioinformatic analysis, luciferase assay and western blot indicated that PWRN1 affected PTEN/Akt/MDM2/p53 axis via suppressing miR-425-5p. Our findings suggested that PWRN1 functioned as a ceRNA targeting to miR-425-5p and suppressed GC development via p53 signaling pathway. ©2018 The Author(s).
Curcumin targeting the thioredoxin system elevates oxidative stress in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Cai, Wenqing; Zhang, Baoxin; Duan, Dongzhu [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou, Gansu 730000 (China); Wu, Jincai [College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000 (China); Fang, Jianguo, E-mail: fangjg@lzu.edu.cn [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou, Gansu 730000 (China); College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000 (China)

2012-08-01

The thioredoxin system, composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH, is ubiquitous in all cells and involved in many redox-dependent signaling pathways. Curcumin, a naturally occurring pigment that gives a specific yellow color in curry food, is consumed in normal diet up to 100 mg per day. This molecule has also been used in traditional medicine for the treatment of a variety of diseases. Curcumin has numerous biological functions, and many of these functions are related to induction of oxidative stress. However, how curcumin elicits oxidative stress in cells is unclear. Our previous work has demonstrated the way by which curcumin interacts with recombinant TrxR1 and alters the antioxidant enzyme into a reactive oxygen species (ROS) generator in vitro. Herein we reported that curcumin can target the cytosolic/nuclear thioredoxin system to eventually elevate oxidative stress in HeLa cells. Curcumin-modified TrxR1 dose-dependently and quantitatively transfers electrons from NADPH to oxygen with the production of ROS. Also, curcumin can drastically down-regulate Trx1 protein level as well as its enzyme activity in HeLa cells, which in turn remarkably decreases intracellular free thiols, shifting the intracellular redox balance to a more oxidative state, and subsequently induces DNA oxidative damage. Furthermore, curcumin-pretreated HeLa cells are more sensitive to oxidative stress. Knockdown of TrxR1 sensitizes HeLa cells to curcumin cytotoxicity, highlighting the physiological significance of targeting TrxR1 by curcumin. Taken together, our data disclose a previously unrecognized prooxidant mechanism of curcumin in cells, and provide a deep insight in understanding how curcumin works in vivo. -- Highlights: ► Curcumin induces oxidative stress by targeting the thioredoxin system. ► Curcumin-modified TrxR quantitatively oxidizes NADPH to generate ROS. ► Knockdown of TrxR1 augments curcumin's cytotoxicity in HeLa cells. �
HeLa DNA damage response induced by 12C6+ ions

International Nuclear Information System (INIS)

Chen Jidong; Li Ning; Zhang Hong; Wu Zhenhua

2009-01-01

The aim of this study is to explore the DNA damage response of HeLa irradiated by 12 C 6+ beam and the mechanism of the p53 activation change in this response.In our present study, double strands break(DSB)of HeLa cells irradiated with 12 C 6+ beam were detected through neutral single cell gel electrophoresis, and AO/EB staining was used to detect the apoptosis of irradiated HeLa in 24h irradiation. Moreover, HeLa was pre-treated with caffeine (ATM and ATR inhibiting) or wormannin with certain concentrations (20 μmol/L, ATM and DNA-PK inhibiting) and irradiated with 1Gy of 12 C 6+ beam,and the expression of p53 was detected with Western blot analysis. The results show that DSB of HeLa caused by 12 C 6+ beam increases with absorbed doses and decreases with the time after irradiation. The apoptosis percentage of irradiated HeLa increases with absorbed doses. It has been found that the p53 expression increases after irradiation, but has not significant increment with caffeine or wortmannin pre-treatment in cells.It can be deduced that the p53 activation is ATM-dependent, but not ATR and DNA-PK-dependent in HeLa DNA damage response induced by 12 C 6+ beam. (authors)
Combined antitumor activity of the nitroreductase/CB1954 suicide gene system and γ-rays in HeLa cells in vitro

Science.gov (United States)

Teng, Geling; Ju, Yuanrong; Yang, Yepeng; Hua, Hu; Chi, Jingyu; Mu, Xiuan

2016-01-01

Escherichia coli nitroreductase (NTR) may convert the prodrug CB1954 (5-(aziridin-1-yl)-2,4-dinitrobenzamide) into a bifunctional alkylating agent, which may lead to DNA crosslinks and the apoptosis of cancer cells. NTR/CB1954 has been demonstrated to be an effective gene therapy in cancer cells. The present study examined whether the NTR/CB1954 suicide gene system had cytotoxic effects on HeLa cells and may improve the radiosensitivity of HeLa cells to γ-rays. It was observed that the NTR/CB1954 suicide gene system exerted marked cytotoxic effects on HeLa cells. The combined therapeutic effects of NTR/CB1954 and γ-rays on HeLa cells demonstrated a synergistic effect. CB1954 at concentrations of 12.5 and 25 µmol/l increased the sensitization enhancement ratio of HeLa cells to 1.54 and 1.66, respectively. Therefore, when compared with monotherapy, the combined therapy of NTR/CB1954 and γ-rays may increase the apoptotic rate and enhance the radiosensitivity of HeLa cells. The combined therapy of γ-ray radiation and the NTR/CB1954 suicide gene system may be a novel and potent therapeutic method for the treatment of cervical carcinoma. PMID:27840931
Demethoxycurcumin Suppresses Migration and Invasion of Human Cervical Cancer HeLa Cells via Inhibition of NF-κB Pathways.

Science.gov (United States)

Lin, Chin-Chung; Kuo, Chao-Lin; Huang, Yi-Ping; Chen, Cheng-Yen; Hsu, Ming-Jie; Chu, Yung Lin; Chueh, Fu-Shin; Chung, Jing-Gung

2018-05-01

Demethoxycurcumin (DMC), one of the curcuminoids present in turmeric, has been shown to induce cell death in many human cancer cell lines, however, there has not been any investigation on whether DMC inhibits metastatic activity in human cervical cancer cells in vitro. In the present study, DMC at 2.5-15 μM decreased cell number, thus, we used IC 20 (7.5 μM) for further investigation of its anti-metastatic activity in human cervical cancer HeLa cells. The wound healing, migration, invasion, zymography, and western blotting assays were used to investigate the effects of DMC on HeLa cells. The wound healing assay was used to show that DMC suppressed cell movement of HeLa cells. Furthermore, the trans-well chamber assay was used to show that DMC suppressed HeLa cell migration and invasion. Gelatin zymography assay did not show any significant effects of DMC on the gelatinolytic activity (MMP-2 and -9) in conditioned media of HeLa cells treated by DMC. Western blotting showed that DMC significantly reduced protein levels of GRB2, MMP-2, ERK1/2, N-cadherin and Ras but increased the levels of E-cadherin and NF-κB in HeLa cells. Confocal laser microscopy indicated that DMC increased NF-κB in HeLa cells confirming the results from Western blotting. DMC may be used as a novel anti-metastatic agent for the treatment of human cervical cancer in the future. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

OpenAIRE

1986-01-01

We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...
PASSPORT-seq: A Novel High-Throughput Bioassay to Functionally Test Polymorphisms in Micro-RNA Target Sites

Directory of Open Access Journals (Sweden)

Joseph Ipe

2018-06-01

Full Text Available Next-generation sequencing (NGS studies have identified large numbers of genetic variants that are predicted to alter miRNA–mRNA interactions. We developed a novel high-throughput bioassay, PASSPORT-seq, that can functionally test in parallel 100s of these variants in miRNA binding sites (mirSNPs. The results are highly reproducible across both technical and biological replicates. The utility of the bioassay was demonstrated by testing 100 mirSNPs in HEK293, HepG2, and HeLa cells. The results of several of the variants were validated in all three cell lines using traditional individual luciferase assays. Fifty-five mirSNPs were functional in at least one of three cell lines (FDR ≤ 0.05; 11, 36, and 27 of them were functional in HEK293, HepG2, and HeLa cells, respectively. Only four of the variants were functional in all three cell lines, which demonstrates the cell-type specific effects of mirSNPs and the importance of testing the mirSNPs in multiple cell lines. Using PASSPORT-seq, we functionally tested 111 variants in the 3′ UTR of 17 pharmacogenes that are predicted to alter miRNA regulation. Thirty-three of the variants tested were functional in at least one cell line.
A novel RNA binding surface of the TAM domain of TIP5/BAZ2A mediates epigenetic regulation of rRNA genes.

Science.gov (United States)

Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael

2015-05-26

The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yeast CUP1 protects HeLa cells against copper-induced stress

Energy Technology Data Exchange (ETDEWEB)

Xie, X.X. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China); College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou (China); Ma, Y.F.; Wang, Q.S.; Chen, Z.L.; Liao, R.R.; Pan, Y.C. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China)

2015-06-12

As an essential trace element, copper can be toxic in mammalian cells when present in excess. Metallothioneins (MTs) are small, cysteine-rich proteins that avidly bind copper and thus play an important role in detoxification. YeastCUP1 is a member of the MT gene family. The aim of this study was to determine whether yeast CUP1 could bind copper effectively and protect cells against copper stress. In this study,CUP1 expression was determined by quantitative real-time PCR, and copper content was detected by inductively coupled plasma mass spectrometry. Production of intracellular reactive oxygen species (ROS) was evaluated using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) assay. Cellular viability was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, and the cell cycle distribution of CUP1 was analyzed by fluorescence-activated cell sorting. The data indicated that overexpression of yeast CUP1 in HeLa cells played a protective role against copper-induced stress, leading to increased cellular viability (P<0.05) and decreased ROS production (P<0.05). It was also observed that overexpression of yeast CUP1 reduced the percentage of G1 cells and increased the percentage of S cells, which suggested that it contributed to cell viability. We found that overexpression of yeast CUP1 protected HeLa cells against copper stress. These results offer useful data to elucidate the mechanism of the MT gene on copper metabolism in mammalian cells.
Total Alkaloids of Sophora alopecuroides Inhibit Growth and Induce Apoptosis in Human Cervical Tumor HeLa Cells In vitro.

Science.gov (United States)

Li, Jian-Guang; Yang, Xiao-Yi; Huang, Wei

2016-05-01

Uygur females of Xinjiang have the higher incidence of cervical tumor in the country. Alkaloids are the major active ingredients in Sophora alopecuroides, and its antitumor effect was recognized by the medical profession. Xinjiang is the main site of S. alopecuroides production in China so these plants are abundant in the region. Studies on the antitumor properties of total alkaloids of S. alopecuroides (TASA) can take full use of the traditional folk medicine in antitumor unique utility. To explore the effects of TASA on proliferation and apoptosis of human cervical tumor HeLa cells in vitro. TASA was extracted, purified, and each monomer component was analyzed by high-performance liquid chromatography. The effect of TASA at different concentrations on the survival of HeLa cells was determined after 24 h using the Cell Counting Kit-8. In addition, cells were photographed using an inverted microscope to document morphological changes. The effect of TASA on apoptotic rate of HeLa cells was assessed by flow cytometry. Monomers of TASA were found to be sophoridine, matrine, and sophocarpine. On treatment with 8.75 mg/ml of TASA, more than 50% of HeLa cells died, and cell death rate increased further with longer incubation. The apoptotic rates of HeLa cells in the experimental groups were 16.0% and 33.3% at concentrations of 6.25 mg/ml and 12.50 mg/ml, respectively. TASA can induce apoptosis in cervical tumor HeLa cells, and it has obvious inhibitory effects on cell growth. Total alkaloids of Sophora alopecuroides (TASA) exhibits anti-human cervical tumor propertiesMonomer component of TASA was analyzed by high-performance liquid chromatography, and its main effect component are sophoridine, matrine, and sophocarpineTASA inhibits growth and induces apoptosis in HeLa cells. Abbreviations used: TASA: Total alkaloids of S. alopecuroides, CCK-8: Cell Counting Kit-8, FBS: Fetal bovine serum, PBS: Phosphate buffered saline, DMEM: Dulbecco's modified Eagle medium.
Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

Czech Academy of Sciences Publication Activity Database

Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

2003-01-01

Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003
Rad51C deficiency destabilizes XRCC3, impairs recombination and radiosensitizes S/G2-phase cells

Energy Technology Data Exchange (ETDEWEB)

Lio, Yi-Ching; Schild, David; Brenneman, Mark A.; Redpath, J. Leslie; Chen, David J.

2004-05-01

The highly conserved Rad51 protein plays an essential role in repairing DNA damage through homologous recombination. In vertebrates, five Rad51 paralogs (Rad51B, Rad51C, Rad51D, XRCC2, XRCC3) are expressed in mitotically growing cells, and are thought to play mediating roles in homologous recombination, though their precise functions remain unclear. Here we report the use of RNA interference to deplete expression of Rad51C protein in human HT1080 and HeLa cells. In HT1080 cells, depletion of Rad51C by small interfering RNA caused a significant reduction of frequency in homologous recombination. The level of XRCC3 protein was also sharply reduced in Rad51C-depleted HeLa cells, suggesting that XRCC3 is dependent for its stability upon heterodimerization with Rad51C. In addition, Rad51C-depleted HeLa cells showed hypersensitivity to the DNA cross-linking agent mitomycin C, and moderately increased sensitivity to ionizing radiation. Importantly, the radiosensitivity of Rad51C-deficient HeLa cells was evident in S and G{sub 2}/M phases of the cell cycle but not in G{sub 1} phase. Together, these results provide direct cellular evidence for the importance of human Rad51C in homologous recombinational repair.

Hesperidin inhibits HeLa cell proliferation through apoptosis mediated by endoplasmic reticulum stress pathways and cell cycle arrest

International Nuclear Information System (INIS)

Wang, Yaoxian; Yu, Hui; Zhang, Jin; Gao, Jing; Ge, Xin; Lou, Ge

2015-01-01

Hesperidin (30, 5, 9-dihydroxy-40-methoxy-7-orutinosyl flavanone) is a flavanone that is found mainly in citrus fruits and has been shown to have some anti-neoplastic effects. The aim of the present study was to investigate the effect of hesperidin on apoptosis in human cervical cancer HeLa cells and to identify the mechanism involved. Cells were treated with hesperidin (0, 20, 40, 60, 80, and 100 μM) for 24, 48, or 72 h and relative cell viability was assessed using the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. Hesperidin inhibited the proliferation of HeLa cells in a concentration- and time-dependent manner. Hesperidin-induced apoptosis in HeLa cells was characterized by increased nuclear condensation and DNA fragmentation. Furthermore, increased levels of GADD153/CHOP and GRP78 indicated hesperidin-induced apoptosis in HeLa cells involved a caspase-dependent pathway, presumably downstream of the endoplasmic reticulum stress pathway. Both of these proteins are hallmarks of endoplasmic reticulum stress. Hesperidin also promoted the formation of reactive oxygen species, mobilization of intracellular Ca 2+ , loss of mitochondrial membrane potential (ΔΨm), increased release of cytochrome c and apoptosis-inducing factor from mitochondria, and promoted capase-3 activation. It also arrested HeLa cells in the G0/G1 phase in the cell cycle by downregulating the expression of cyclinD1, cyclinE1, and cyclin-dependent kinase 2 at the protein level. The effect of hesperidin was also verified on the human colon cancer cell HT-29 cells. We concluded that hesperidin inhibited HeLa cell proliferation through apoptosis involving endoplasmic reticulum stress pathways and cell cycle arrest
Discovery of HeLa Cell Contamination in HES Cells: Call for Cell Line Authentication in Reproductive Biology Research.

Science.gov (United States)

Kniss, Douglas A; Summerfield, Taryn L

2014-08-01

Continuous cell lines are used frequently in reproductive biology research to study problems in early pregnancy events and parturition. It has been recognized for 50 years that many mammalian cell lines contain inter- or intraspecies contaminations with other cells. However, most investigators do not routinely test their culture systems for cross-contamination. The most frequent contributor to cross-contamination of cell lines is the HeLa cell isolated from an aggressive cervical adenocarcinoma. We report on the discovery of HeLa cell contamination of the human endometrial epithelial cell line HES isolated in our laboratory. Short tandem repeat analysis of 9 unique genetic loci demonstrated molecular identity between HES and HeLa cells. In addition, we verified that WISH cells, isolated originally from human amnion epithelium, were also contaminated with HeLa cells. Inasmuch as our laboratory did not culture HeLa cells at the time of HES cell derivations, the source of contamination was the WISH cell line. These data highlight the need for continued diligence in authenticating cell lines used in reproductive biology research. © The Author(s) 2014.
Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

Science.gov (United States)

Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

2010-02-01

Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.
Combined antitumor activity of the nitroreductase/CB1954 suicide gene system and γ-rays in HeLa cells in vitro.

Science.gov (United States)

Teng, Geling; Ju, Yuanrong; Yang, Yepeng; Hua, Hu; Chi, Jingyu; Mu, Xiuan

2016-12-01

Escherichia coli nitroreductase (NTR) may convert the prodrug CB1954 (5-(aziridin-1-yl)-2,4-dinitrobenzamide) into a bifunctional alkylating agent, which may lead to DNA crosslinks and the apoptosis of cancer cells. NTR/CB1954 has been demonstrated to be an effective gene therapy in cancer cells. The present study examined whether the NTR/CB1954 suicide gene system had cytotoxic effects on HeLa cells and may improve the radiosensitivity of HeLa cells to γ‑rays. It was observed that the NTR/CB1954 suicide gene system exerted marked cytotoxic effects on HeLa cells. The combined therapeutic effects of NTR/CB1954 and γ‑rays on HeLa cells demonstrated a synergistic effect. CB1954 at concentrations of 12.5 and 25 µmol/l increased the sensitization enhancement ratio of HeLa cells to 1.54 and 1.66, respectively. Therefore, when compared with monotherapy, the combined therapy of NTR/CB1954 and γ‑rays may increase the apoptotic rate and enhance the radiosensitivity of HeLa cells. The combined therapy of γ‑ray radiation and the NTR/CB1954 suicide gene system may be a novel and potent therapeutic method for the treatment of cervical carcinoma.
Covalent Chemical 5'-Functionalization of RNA with Diazo Reagents.

Science.gov (United States)

Gampe, Christian M; Hollis-Symynkywicz, Micah; Zécri, Frédéric

2016-08-22

Functionalization of RNA at the 5'-terminus is important for analytical and therapeutic purposes. Currently, these RNAs are synthesized de novo starting with a chemically functionalized 5'-nucleotide, which is incorporated into RNA using chemical synthesis or biochemical techniques. Methods for direct chemical modification of native RNA would provide an attractive alternative but are currently underexplored. Herein, we report that diazo compounds can be used to selectively alkylate the 5'-phosphate of ribo(oligo)nucleotides to give RNA labelled through a native phosphate ester bond. We applied this method to functionalize oligonucleotides with biotin and an orthosteric inhibitor of the eukaryotic initiation factor 4E (eIF4E), an enzyme involved in mRNA recognition. The modified RNA binds to eIF4E, demonstrating the utility of this labelling technique to modulate biological activity of RNA. This method complements existing techniques and may be used to chemically introduce a broad range of functional handles at the 5'-end of RNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Quantification of Functionalised Gold Nanoparticle-Targeted Knockdown of Gene Expression in HeLa Cells

Science.gov (United States)

Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.

2014-01-01

Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959
SKI2 mediates degradation of RISC 5'-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis.

Science.gov (United States)

Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

2015-12-15

Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
From HeLa cell division to infectious diarrhoea

International Nuclear Information System (INIS)

Stephen, J.; Osborne, M.P.; Spencer, A.J.; Warley, A.

1990-01-01

Hela S3 cells were grown in suspension both randomly and, synchronously using hydroxyurea which blocks cells at the G1/S interface. Cryosections were prepared, freeze-dried and analyzed by X-ray microanalysis. As cells moved into S and through M phases [Na] and [Cl] increased; both returned to normal levels upon re-entering G1 phase. The Na/K ratio was 1:1 in G1 phase. Infection of HeLa S3 cells in G1 phase with vaccinia virus resulted in no change in intracellular [Na]. Infection of neonatal mice with murine rotavirus was localized to villus tip enterocytes and gave rise to diarrhoea which was maximal at 72h post-infection (p.i.). Diarrhoea was preceded by ischemia of villi (18-42h p.i.) and villus shortening (maximal at 42h p.i.), and was also coincident with a dramatic regrowth of villi. At 48h p.i. a proliferative zone of electron lucent cells was observed in villus base regions. Cryosections of infected gut, taken before, during, and after infection, together with corresponding age-matched controls, were freeze-dried and analysed by X-ray microanalysis. At 48h p.i. electron lucent villus base cells were shown to be more hydrated, and, to contain higher levels of both Na and Cl and lower levels of P, S, K and Mg than corresponding control cells. These studies increase confidence in the use of X-ray microanalysis in studying biological systems, provide some insight into the process of cell division, and constitute the basis of a new concept of diarrhoeal secretion.27 references
From HeLa cell division to infectious diarrhoea

Energy Technology Data Exchange (ETDEWEB)

Stephen, J.; Osborne, M.P.; Spencer, A.J.; Warley, A. (Univ. of Birmingham (England))

1990-09-01

Hela S3 cells were grown in suspension both randomly and, synchronously using hydroxyurea which blocks cells at the G1/S interface. Cryosections were prepared, freeze-dried and analyzed by X-ray microanalysis. As cells moved into S and through M phases (Na) and (Cl) increased; both returned to normal levels upon re-entering G1 phase. The Na/K ratio was 1:1 in G1 phase. Infection of HeLa S3 cells in G1 phase with vaccinia virus resulted in no change in intracellular (Na). Infection of neonatal mice with murine rotavirus was localized to villus tip enterocytes and gave rise to diarrhoea which was maximal at 72h post-infection (p.i.). Diarrhoea was preceded by ischemia of villi (18-42h p.i.) and villus shortening (maximal at 42h p.i.), and was also coincident with a dramatic regrowth of villi. At 48h p.i. a proliferative zone of electron lucent cells was observed in villus base regions. Cryosections of infected gut, taken before, during, and after infection, together with corresponding age-matched controls, were freeze-dried and analysed by X-ray microanalysis. At 48h p.i. electron lucent villus base cells were shown to be more hydrated, and, to contain higher levels of both Na and Cl and lower levels of P, S, K and Mg than corresponding control cells. These studies increase confidence in the use of X-ray microanalysis in studying biological systems, provide some insight into the process of cell division, and constitute the basis of a new concept of diarrhoeal secretion.27 references.
[Characterizing Beijing's Airborne Bacterial Communities in PM2.5 and PM1 Samples During Haze Pollution Episodes Using 16S rRNA Gene Analysis Method].

Science.gov (United States)

Wang, Bu-ying; Lang, Ji-dong; Zhang, Li-na; Fang, Jian-huo; Cao, Chen; Hao, Ji-ming; Zhu, Ting; Tian, Geng; Jiang, Jing-kun

2015-08-01

During 8th-14th Jan., 2013, severe particulate matter (PM) pollution episodes happened in Beijing. These air pollution events lead to high risks for public health. In addition to various PM chemical compositions, biological components in the air may also impose threaten. Little is known about airborne microbial community in such severe air pollution conditions. PM2.5 and PM10 samples were collected during that 7-day pollution period. The 16S rRNA gene V3 amplification and the MiSeq sequencing were performed for analyzing these samples. It is found that there is no significant difference at phylum level for PM2.5 bacterial communities during that 7-day pollution period both at phylum and at genus level. At genus level, Arthrobacter and Frankia are the major airborne microbes presented in Beijing winter.samples. At genus level, there are 39 common genera (combined by first 50 genera bacterial of the two analysis) between the 16S rRNA gene analysis and those are found by Metagenomic analysis on the same PM samples. Frankia and Paracoccus are relatively more abundant in 16S rRNA gene data, while Kocuria and Geodermatophilus are relatively more abundant in Meta-data. PM10 bacterial communities are similar to those of PM2.5 with some noticeable differences, i.e., at phylum level, more Firmicutes and less Actinobacteria present in PM10 samples than in PM2.5 samples, while at genus level, more Clostridium presents in PM10 samples. The findings in Beijing were compared with three 16S rRNA gene studies in other countries. Although the sampling locations and times are different from each other, compositions of bacterial community are similar for those sampled at the ground atmosphere. Airborne microbial communities near the ground surface are different from those sampled in the upper troposphere.
The flavoprotein Mcap0476 (RlmFO) catalyzes m5U1939 modification in Mycoplasma capricolum 23S rRNA

DEFF Research Database (Denmark)

Lartigue, Carole; Lebaudy, Anne; Blanchard, Alain

2014-01-01

Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl g...... specifically modifies m5U1939 in 23S rRNA, a conserved methylation catalyzed by AdoMet-dependent enzymes in all other characterized bacteria. The Mcap0476 methyltransferase (renamed RlmFO) represents the first folate-dependent flavoprotein seen to modify ribosomal RNA.......Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl...... group donor. One noteworthy exception is seen in some bacteria, where the conserved tRNA methylation at m5U54 is added by the enzyme TrmFO using flavin adenine dinucleotide together with N5,N10-methylenetetrahydrofolate as the one-carbon donor. The minimalist bacterium Mycoplasma capricolum possesses...
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

Science.gov (United States)

Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

2008-07-01

The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Evolution of green plants as deduced from 5S rRNA sequences.

Science.gov (United States)

Hori, H; Lim, B L; Osawa, S

1985-02-01

We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.
Effect of Quercetin on radio-sensitivity of HeLa cells

International Nuclear Information System (INIS)

Wu Xiaofen; Hong Chengjiao; Guo Wenxiu; Pan Yanling; Zhang Baoguo

2011-01-01

In order to investigate the mechanism of Quercetin on radio-sensitivity of human Uterine Cervix Cancer HeLa cells, HeLa cells were cultured in different concentrations of Quercetin and different doses of irradiation. The clonogenic assay was used to observe the cell survival rate. The repair of DNA double-strand breaks and effect of Quercetin combination of radiation on the cell cycle were detected by flow cytometry. The results show that the radio-sensitivity of Quercetin on HeLa cells was obvious and the unrepaired DSBs after irradiation increased, but did not decrease G2/M cell cycle arrest. From this it can be inferred that the effect on HeLa cell radio-sensitivity may be related to the inhibition of the repair of DNA double-strand breaks induced by Quercetin, but it dose not reveal a significant relation with the cell cycle and G2/M arrest. (authors)
Protein kinase C β inhibits autophagy and sensitizes cervical cancer Hela cells to cisplatin.

Science.gov (United States)

Li, Na; Zhang, Wei

2017-04-28

Recently, autophagy has been indicated to play an essential role in various biological events, such as the response of cervical cancer cells to chemotherapy. However, the exact signalling mechanism that regulates autophagy during chemotherapy remains unclear. In the present study, we investigated the regulation by cisplatin on protein kinase C β (PKC β), on B-cell lymphoma 2 (Bcl-2) and on apoptosis in cervical cancer Hela cells. And then we examined the regulation by cisplatin on autophagy and the role of autophagy on the chemotherapy in Hela cells. In addition, the regulation of the PKC β on the autophagy was also investigated. Our results indicated that cisplatin promoted PKC β in Hela cells. The PKC β inhibitor reduced the cisplatin-induced apoptosis, whereas increased the cisplatin-induced autophagy in Hela cells. On the other side, the PKC β overexpression aggravated the cisplatin-induced apoptosis, whereas down-regulated the cisplatin-induced autophagy. Taken together, our study firstly recognized the involvement of PKC β in the cytotoxicity of cisplatin via inhibiting autophagy in cervical cancer cells. We propose that PKC β would sensitize cervical cancer cells to chemotherapy via reducing the chemotherapy induced autophagy in cancer cells. © 2017 The Author(s).
3-(3-Hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a novel combretastatin A-4 analog, induces G2/M arrest and apoptosis by disrupting tubulin polymerization in human cervical HeLa cells and fibrosarcoma HT-1080 cells.

Science.gov (United States)

Zuo, Daiying; Guo, Dandan; Jiang, Xuewei; Guan, Qi; Qi, Huan; Xu, Jingwen; Li, Zengqiang; Yang, Fushan; Zhang, Weige; Wu, Yingliang

2015-02-05

Microtubule is a popular target for anticancer drugs. In this study, we describe the effect 3-(3-hydroxy-4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)-1,2,5-selenadiazole (G-1103), a newly synthesized analog of combretastatin A-4 (CA-4), showing a strong time- and dose-dependent anti-proliferative effect on human cervical cancer HeLa cells and human fibrosarcoma HT-1080 cells. We demonstrated that the growth inhibitory effects of G-1103 in HeLa and HT-1080 cells were associated with microtubule depolymerization and proved that G-1103 acted as microtubule destabilizing agent. Furthermore, cell cycle analysis revealed that G-1103 treatment resulted in cell cycle arrest at the G2/M phase in a time-dependent manner with subsequent apoptosis induction. Western blot analysis revealed that down-regulation of cdc25c and up-regulation of cyclin B1 was related with G2/M arrest in HeLa and HT-1080 cells treatment with G-1103. In addition, G-1103 induced HeLa cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8 expression, which indicated that G-1103 induced HeLa cell apoptosis was mainly associated with death receptor pathway. However, G-1103 induced HT-1080 cell apoptosis by up-regulating cleaved caspase-3, Fas, cleaved caspase-8, Bax and cleaved caspase-9 expression and down-regulating anti-apoptotic protein Bcl-2 expression, which indicated that G-1103 induced HT-1080 cell apoptosis was associated with both mitochondrial and death receptor pathway. Taken together, all the data demonstrated that G-1103 exhibited its antitumor activity through disrupting the microtubule assembly, causing cell cycle arrest and consequently inducing apoptosis in HeLa and HT-1080 cells. Therefore, the novel compound G-1103 is a promising microtubule inhibitor that has great potentials for therapeutic treatment of various malignancies. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Drosha regulates gene expression independently of RNA cleavage function

DEFF Research Database (Denmark)

Gromak, Natalia; Dienstbier, Martin; Macias, Sara

2013-01-01

Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....
Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

Science.gov (United States)

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981
N-methylation of the heterogeneous nuclear ribonucleoproteins in HeLa cells

International Nuclear Information System (INIS)

Rieker, J.P.

1984-01-01

Several of the core proteins on the 40S heterogeneous nuclear ribonucleoprotein particles (hnRNP) from HeLa cells contain N/sup G/,N/sup G/-dimethyl-L-arginine (uDMA). 3-deazaadenosine (c 3 Ado), an inhibitor of and substrate for s-adenosyl-L-homocysteine hydrolase, has been used to study the methylation patterns of the individual polypeptides. Trimethyllysine and uDMA formation in total cellular protein were inhibited in the presence of the drug while other methylated basic amino acids were unaffected. This inhibition was reversed within 60 min after removal of the drug from the medium. Monolayer HeLa cultures were incubated with [methyl- 3 H]-L-methoinine for 12 hours in the presence of 50 uM c 3 Ado. Purified particles were obtained by centrifugation of nuclear extracts on sucrose density gradients. The core proteins were isolated by two-dimensional gel electrophoresis, acid hydrolyzed and analyzed for radioactivity incorporated into methionine and methylated basic amino acids. The ratio of radioactivity incorporated into uDMA relative to that into methionine for the two major particle proteins with molecular weights of 31,000 (A 1 ) and 43,000 (A 2 ) was about 2.0 and 0.2 in control cultures. In the presence of c 3 Ado, these ratios were depressed 60 to 80%. Results of pulse-chase experiments suggested that A 1 and A 2 are metabolically stable proteins (t/sub 0.5/ > 75 hr), whether or not the proteins were undermethylated. Monomethyl-L-arginine may be a precursor in the formation of u-DMA
Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene

Directory of Open Access Journals (Sweden)

, Widanarni

2015-05-01

Full Text Available ABSTRACT This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using HaeIII (5’-GG↓CC and HhaI (5’-GCG↓C restriction enzymes resulting an ARDRA pattern which was further used as the binary data for the construction of phylogenetics tree that was used to estimate the group of bacteria. The result with HaeIII cut restriction enzyme from biofloc-associated bacteria gave 11 ARDRA patterns, while with the restriction enzyme HhaI gave eight ARDRA patterns. Phylogenetics of bacterial populations from biofloc-based cultivation system water consisted of at least 13 different bacterial species. Result of sequencing from two gene sample 16S-rRNA were identified as Microbacterium foliorumand and Pseudomonas putida. Keywords: bacterial diversity, ARDRA, biofloc, phylogeny ABSTRAK Penelitian ini bertujuan untuk menganalisis keragaman genetika bakteri bioflok menggunakan metode polymerase chain reaction (PCR 16S-rRNA dengan teknik ARDRA. Sebanyak 38 isolat bakteri dominan yang diperoleh diamplifikasi gen 16S-rRNAnya dengan PCR, kemudian dipotong dengan enzim restriksi HaeIII (5’-GG↓CC dan HhaI (5’-GCG↓C. Pola ARDRA ini dijadikan data biner sebagai input untuk konstruksi pohon filogenetika yang dapat digunakan untuk memerkirakan jenis bakteri yang ada. Gen 16S-rRNA hasil PCR setelah dipotong dengan enzim restriksi HaeIII didapatkan 11 pola ARDRA, sedangkan dengan enzim restriksi HhaI menghasilkan delapan pola ARDRA. Berdasarkan pohon filogenetika, diketahui populasi bakteri pada air sistem budidaya bioflok sedikitnya terdiri atas 13 jenis bakteri. Berdasarkan sekuensing dari dua sampel gen 16S-rRNA teridentifikasi jenis bakteri Microbacterium

Effect of quercetin on radiosensitivity of human uterine cervix cancer HeLa cells

International Nuclear Information System (INIS)

Liang Xiaofang; Hong Chengjiao; Zhang Baoguo

2009-01-01

In order to investigate the effects of Quercetin on radiosensitivity of human Uterine Cervix Cancer HeLa cells, MTT assay and clonogenic assay were performed to evaluate the cytotoxicity of Quercetin on the cells. Clonogenic assay was used to observe its effects on the radiosensitivity of the cells. MTT result shows that the inhibition of Quercetin on the cells is in the dose-dependent and time-dependent. And the clonogenic assay result shows that the effect of Quercetin on HeLa cells can be divided into two parts, one for the inhibition of HeLa cells and another for the induction of HeLa cell death. The other clonogenic assay result also shows Quercetin can decrease clonogenic survival rate of HeLa cells exposed to X rays. The study shows Quercetin might enhance the radiosensitivity of the HeLa cell line. And it may provide a useful evaluation to combination of ionizing radiation and Quercetin for cancer patients. (authors)
Autophagy Facilitates Salmonella Replication in HeLa Cells

Science.gov (United States)

Yu, Hong B.; Croxen, Matthew A.; Marchiando, Amanda M.; Ferreira, Rosana B. R.; Cadwell, Ken; Foster, Leonard J.; Finlay, B. Brett

2014-01-01

ABSTRACT Autophagy is a process whereby a double-membrane structure (autophagosome) engulfs unnecessary cytosolic proteins, organelles, and invading pathogens and delivers them to the lysosome for degradation. We examined the fate of cytosolic Salmonella targeted by autophagy and found that autophagy-targeted Salmonella present in the cytosol of HeLa cells correlates with intracellular bacterial replication. Real-time analyses revealed that a subset of cytosolic Salmonella extensively associates with autophagy components p62 and/or LC3 and replicates quickly, whereas intravacuolar Salmonella shows no or very limited association with p62 or LC3 and replicates much more slowly. Replication of cytosolic Salmonella in HeLa cells is significantly decreased when autophagy components are depleted. Eventually, hyperreplication of cytosolic Salmonella potentiates cell detachment, facilitating the dissemination of Salmonella to neighboring cells. We propose that Salmonella benefits from autophagy for its cytosolic replication in HeLa cells. PMID:24618251
Radiation sensitization by dihydroartemisinin on human HeLa cells of cervical cancer

International Nuclear Information System (INIS)

Chen Xialin; Cao Jianping; Ji Rong; Zhu Wei; Liu Yang; Gong Xiaomei; Tang Yan; Pan Chunyan; Fan Saijun

2009-01-01

Objective: To investigate the radiosensitizing effects of dihydroartemisinin (DHA) on human HeLa cells of cervical cancer irradiated by X rays. Methods: Cell growth kinetics was determined using MTF assay. Cell survival was analyzed by elonogenic assay. The change of cell cycle and apeptosis was measured by flow cytometry. Results: Dihydroartemisinin inhibited the growth of HeLa cells of human cervical cancer and showed a dose-dependent and time-dependent manner. Dihydroartemisinin (20 μmol/L) showed the radiosensitizing effects on HeLa cells, and the sensitizing enhancement ratio (SER) was 1.47. Dihydroartemisinin abrogated radiation-induced G 2 arrest of the tested HeLa cells, the G 2 ratio of medicine + radiation group dechned from 73.58% to 48.31%. Dihydroartemisinin enhanced the apoptosis of HeLa cells by X-irradiation, the apoptosis rates of medicine + radiation group significantly increased from 29.46%, 48.04%, 70.21% to 45.79%, 66.36% and 79.58%, respectively for 2, 4 and 6 Gy. Conclusions: Dihydroartemisinin could increase the radiosensitivity of HeLa cells of human cervical cancer. Abrogation of radiation-induced C 2 arrest could be part of the mechanism. (authors)
Anticancer effects of brominated indole alkaloid Eudistomin H from marine ascidian Eudistoma viride against cervical cancer cells (HeLa).

Science.gov (United States)

Rajesh, Rajaian Pushpabai; Annappan, Murugan

2015-01-01

Marine invertebrates called ascidians are prolific producers of bioactive substances. The ascidian Eudistoma viride, distributed along the Southeast coast of India, was investigated for its in vitro cytotoxic activity against human cervical carcinoma (HeLa) cells by the MTT assay. The crude methanolic extract of E. viride, with an IC50 of 53 μg/ml, was dose-dependently cytotoxic. It was more potent at 100 μg/ml than cyclohexamide (1 μg/ml), reducing cell viability to 9.2%. Among nine fractions separated by chromatography, ECF-8 exhibited prominent cytoxic activity at 10 μg/ml. The HPLC fraction EHF-21 of ECF-8 was remarkably dose- and time-dependently cytotoxic, with 39.8% viable cells at 1 μg/ml compared to 51% in cyclohexamide-treated cells at the same concentration; the IC50 was 0.49 μg/ml. Hoechst staining of HeLa cells treated with EHF-21 at 0.5 μg/ml revealed apoptotic events such an cell shrinkage, membrane blebbing, chromatin condensation and formation of apoptotic bodies. Cell size and granularity study showed changes in light scatter, indicating the characteristic feature of cells dying by apoptosis. The cell-cycle analysis of HeLa cells treated with fraction EHF-21 at 1 μg/ml showed the marked arrest of cells in G0/G1, S and G2/M phases and an increase in the sub G0/G1 population indicated an increase in the apoptotic cell population. The statistical analysis of the sub-G1 region showed a dose-dependent induction of apoptosis. DNA fragmentation was also observed in HeLa cells treated with EHF-21. The active EHF-21 fraction, a brominated indole alkaloid Eudistomin H, led to apoptotic death of HeLa cells. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Identification of miRNA targets with stable isotope labeling by amino acids in cell culture

DEFF Research Database (Denmark)

Vinther, Jeppe; Hedegaard, Mads Marquardt; Gardner, Paul Phillip

2006-01-01

miRNAs are small noncoding RNAs that regulate gene expression. We have used stable isotope labeling by amino acids in cell culture (SILAC) to investigate the effect of miRNA-1 on the HeLa cell proteome. Expression of 12 out of 504 investigated proteins was repressed by miRNA-1 transfection...
Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

Science.gov (United States)

Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

2015-12-21

5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast

International Nuclear Information System (INIS)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio

2012-01-01

Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

Science.gov (United States)

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

Science.gov (United States)

Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

2009-07-01

RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.
Anti-apoptotic effects of pan-caspase inhibitor (Z-VAD), SOD or catalase on antimycin A-induced HeLa cell death.

Science.gov (United States)

Han, Yong Hwan; Kim, Suhn Hee; Kim, Sung Zoo; Park, Woo Hyun

2009-01-01

Antimycin A (AMA) is an inhibitor of the electron transport chain in mitochondria. In this study, we investigated the anti-apoptotic effects of pan-caspase inhibitor (Z-VAD), superoxide dismutase (SOD) or catalase on AMA-induced HeLa cell death in relation to the cell cycle. Treatment with Z-VAD, SOD or catalase rescued some HeLa cells from AMA-induced apoptosis, but did not prevent the growth inhibition of HeLa cells by AMA. DNA flow cytometric analysis indicated that treatment with AMA significantly induced an S-phase arrest of the cell cycle at 72 h. Interestingly, Z-VAD, SOD and catalase intensified S-phase arrest in AMA-treated cells. In conclusion, treatment with Z-VAD, SOD or catalase decreased apoptotic levels in AMA-treated cells, which was associated with the enhancement of the S-phase arrest of the cell cycle in these cells.
Label-free electrochemiluminescence biosensor for ultrasensitive detection of telomerase activity in HeLa cells based on extension reaction and intercalation of Ru(phen)3 (2.).

Science.gov (United States)

Lin, Yue; Yang, Linlin; Yue, Guiyin; Chen, Lifen; Qiu, Bin; Guo, Longhua; Lin, Zhenyu; Chen, Guonan

2016-10-01

Telomerase is one of the most common markers of human malignant tumors, such as uterine, stomach, esophageal, breast, colorectal, laryngeal squamous cell, thyroid, bladder, and so on. It is necessary to develop some sensitive but convenient detection methods for telomerase activity determination. In this study, a label-free and ultrasensitive electrochemiluminescence (ECL) biosensor has been fabricated to detect the activity of telomerase extracted from HeLa cells. Thiolated telomerase substrate (TS) primer was immobilized on the gold electrode surface through gold-sulfur (Au-S) interaction and then elongated by telomerase specifically. Then, it was hybridized with complementary DNA to form double-stranded DNA (dsDNA) fragments on the electrode surface, and Ru(phen)3 (2+) has been intercalated into the dsDNA grooves to act as the ECL probe. The enhanced ECL intensity has a linear relationship with the number of HeLa cells in the range of 5∼5000 and with a detection limit of 2 HeLa cells. The proposed ECL biosensor has high specificity to telomerase in the presence of common interferents. The relative standard deviations (RSDs) were HeLa cells. The proposed method provides a convenient approach for telomerase-related cancer screening or diagnosis.
Theoretical studies on sRNA-mediated regulation in bacteria

Science.gov (United States)

Chang, Xiao-Xue; Xu, Liu-Fang; Shi, Hua-Lin

2015-12-01

Small RNA(sRNA)-mediated post-transcriptional regulation differs from protein-mediated regulation. Through base-pairing, sRNA can regulate the target mRNA in a catalytic or stoichiometric manner. Some theoretical models were built for comparison of the protein-mediated and sRNA-mediated modes in the steady-state behaviors and noise properties. Many experiments demonstrated that a single sRNA can regulate several mRNAs, which causes crosstalk between the targets. Here, we focus on some models in which two target mRNAs are silenced by the same sRNA to discuss their crosstalk features. Additionally, the sequence-function relationship of sRNA and its role in the kinetic process of base-pairing have been highlighted in model building. Project supported by the National Basic Research Program of China (Grant No. 2013CB834100), the National Natural Science Foundation of China (Grant Nos. 11121403 and 11274320), the Open Project Program of State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, China (Grant No. Y4KF171CJ1), the National Natural Science Foundation for Young Scholar of China (Grant No. 11304115), and the China Postdoctoral Science Foundation (Grant No. 2013M541282).
Host-pathogen interactions in bovine mammary epithelial cells and HeLa cells by Staphylococcus aureus isolated from subclinical bovine mastitis.

Science.gov (United States)

Castilho, Ivana G; Dantas, Stéfani Thais Alves; Langoni, Hélio; Araújo, João P; Fernandes, Ary; Alvarenga, Fernanda C L; Maia, Leandro; Cagnini, Didier Q; Rall, Vera L M

2017-08-01

Staphylococcus aureus is a common pathogen that causes subclinical bovine mastitis due to several virulence factors. In this study, we analyzed S. aureus isolates collected from the milk of cows with subclinical mastitis that had 8 possible combinations of bap, icaA, and icaD genes, to determine their capacity to produce biofilm on biotic (bovine primary mammary epithelial cells and HeLa cells) and abiotic (polystyrene microplates) surfaces, and their ability to adhere to and invade these cells. We also characterized isolates for microbial surface components recognizing adhesive matrix molecules (MSCRAMM) and agr genes, and for their susceptibility to cefquinome sulfate in the presence of biofilm. All isolates adhered to and invaded both cell types, but invasion indexes were higher in bovine primary mammary epithelial cells. Using tryptic soy broth + 1% glucose on abiotic surfaces, 5 out of 8 isolates were biofilm producers, but only the bap + icaA + icaD + isolate was positive in Dulbecco's Modified Eagle's medium. The production of biofilm on biotic surfaces occurred only with this isolate and only on HeLa cells, because the invasion index for bovine primary mammary epithelial cells was too high, making it impossible to use these cells in this assay. Of the 5 biofilm producers in tryptic soy broth + 1% glucose, 4 presented with the bap/fnbA/clfA/clfB/eno/fib/ebpS combination, and all were protected from cefquinome sulfate. We found no predominance of any agr group. The high invasive potential of S. aureus made it impossible to observe biofilm in bovine primary mammary epithelial cells, and we concluded that cells with lower invasion rates, such as HeLa cells, were more appropriate for this assay. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

Science.gov (United States)

Goldfarb, Katherine C; Cech, Thomas R

2017-01-01

MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.
Radiation sensitization by CAPE on human HeLa cells of cervical cancer

International Nuclear Information System (INIS)

Wang Xiaoqiang; Cao Jianping; Fan Saijun; Zun Wei; Huang Xiaofei; Liu Yang; Chen Xialin; Gong Xiaomei; Peng Xiaomei; Zeng Jing

2009-01-01

Objective: To study the radiosensitizing effect of caffic acid phenethyl ester (CAPE) on human cervical cancer HeLa cells. Methods: MTT assay was used to measure the relation between the inhibition effect and CAPE concentrations by CAPE with different concentrations on HeLa cells for 24 hours. HeLa cells were divided into the control and experimental groups, both of which were given 0, 2, 4, 6 and 8 Gy of 60Co γ-irradiation, respectively. The cell clones were counted. Meanwhile HeLa cells were divided into the control, CAPE, irradiation and combination groups. Flow cytometric analysis was adopted to detect the changes of cell cycle distribution induced by CAPE. Results: The inhibition rate of CAPE acting on Hela cells increased with concentrations (F=126. 49 ∼ 3654.88, P 0 ) (1.45 and 1.82 Gy) and the quasi-threshold dose (D q ) (1.89 and 3.21 Gy) of HeLa cells in experimental group decreased comparing with control group, SER was 1.26. Compared with the sole irradiation group, cells in G 2 /M phase of the CAPE group and the sole irradiation group increased (P 2 /M arrest and may be related to the inhibition of the sub-lethal damage repair. (authors)
Quercetin suppresses HeLa cells by blocking PI3K/Akt pathway.

Science.gov (United States)

Xiang, Tao; Fang, Yong; Wang, Shi-Xuan

2014-10-01

To explore the effect of quercetin on the proliferation and apoptosis of HeLa cells, HeLa cells were incubated with quercetin at different concentrations. Cell viability was evaluated by MTT assay, cell apoptosis was detected by Annexin-V/PI double labeled cytometry and DNA ladder assay. Cell cycle was flow cytometrically determined and the morphological changes of the cells were observed under a fluorescence microscope after Hoechst 33258 staining and the apoptosis-related proteins in the HeLa cells were assessed by Western blotting. The results showed that quercetin significantly inhibited the growth of HeLa cells and induced obvious apoptosis in vitro in a time- and dose-dependent manner. Moreover, quercetin induced apoptosis of HeLa cells in cell cycle-dependent manner because quercetin could induce arrest of HeLa cells at G0/G1 phase. Quercetin treatment down-regulated the expression of the PI3K and p-Akt. In addition, quercetin could down-regulate expression of bcl-2, up-regulate Bax, but exerted no effect on the overall expression of Akt. We are led to conclude that quercetin induces apoptosis via PI3k/Akt pathways, and quercetin has potential to be used as an anti-tumor agent against human cervix cancer.
Photodynamic Effect of Ni Nanotubes on an HeLa Cell Line.

Directory of Open Access Journals (Sweden)

Muhammad Hammad Aziz

Full Text Available Nickel nanomaterials are promising in the biomedical field, especially in cancer diagnostics and targeted therapy, due to their distinctive chemical and physical properties. In this experiment, the toxicity of nickel nanotubes (Ni NTs were tested in an in vitro cervical cancer model (HeLa cell line to optimize the parameters of photodynamic therapy (PDT for their greatest effectiveness. Ni NTs were synthesized by electrodeposition. Morphological analysis and magnetic behavior were examined using a Scanning electron microscope (SEM, an energy dispersive X-ray analysis (EDAX and a vibrating sample magnetometer (VSM analysis. Phototoxic and cytotoxic effects of nanomaterials were studied using the Ni NTs alone as well as in conjugation with aminolevulinic acid (5-ALA; this was performed both in the dark and under laser exposure. Toxic effects on the HeLa cell model were evaluated by a neutral red assay (NRA and by detection of intracellular reactive oxygen species (ROS production. Furthermore, 10-200 nM of Ni NTs was prepared in solution form and applied to HeLa cells in 96-well plates. Maximum toxicity of Ni NTs complexed with 5-ALA was observed at 100 J/cm2 and 200 nM. Up to 65-68% loss in cell viability was observed. Statistical analysis was performed on the experimental results to confirm the worth and clarity of results, with p-values = 0.003 and 0.000, respectively. Current results pave the way for a more rational strategy to overcome the problem of drug bioavailability in nanoparticulate targeted cancer therapy, which plays a dynamic role in clinical practice.
Photodynamic Effect of Ni Nanotubes on an HeLa Cell Line

Science.gov (United States)

Hammad Aziz, Muhammad; Fakhar-e-Alam, M.; Fatima, Mahvish; Shaheen, Fozia; Iqbal, Seemab; Atif, M.; Talha, Muhammad; Mansoor Ali, Syed; Afzal, Muhammad; Majid, Abdul; Shelih Al.Harbi, Thamir; Ismail, Muhammad; Wang, Zhiming M.; AlSalhi, M. S.; Alahmed, Z. A.

2016-01-01

Nickel nanomaterials are promising in the biomedical field, especially in cancer diagnostics and targeted therapy, due to their distinctive chemical and physical properties. In this experiment, the toxicity of nickel nanotubes (Ni NTs) were tested in an in vitro cervical cancer model (HeLa cell line) to optimize the parameters of photodynamic therapy (PDT) for their greatest effectiveness. Ni NTs were synthesized by electrodeposition. Morphological analysis and magnetic behavior were examined using a Scanning electron microscope (SEM), an energy dispersive X-ray analysis (EDAX) and a vibrating sample magnetometer (VSM) analysis. Phototoxic and cytotoxic effects of nanomaterials were studied using the Ni NTs alone as well as in conjugation with aminolevulinic acid (5-ALA); this was performed both in the dark and under laser exposure. Toxic effects on the HeLa cell model were evaluated by a neutral red assay (NRA) and by detection of intracellular reactive oxygen species (ROS) production. Furthermore, 10–200 nM of Ni NTs was prepared in solution form and applied to HeLa cells in 96-well plates. Maximum toxicity of Ni NTs complexed with 5-ALA was observed at 100 J/cm2 and 200 nM. Up to 65–68% loss in cell viability was observed. Statistical analysis was performed on the experimental results to confirm the worth and clarity of results, with p-values = 0.003 and 0.000, respectively. Current results pave the way for a more rational strategy to overcome the problem of drug bioavailability in nanoparticulate targeted cancer therapy, which plays a dynamic role in clinical practice. PMID:26990435
HELAS: local helioseismology data website

International Nuclear Information System (INIS)

Schunker, Hannah; Gizon, Laurent; Roth, Markus

2008-01-01

The Local Helioseismology Network Activity is part of the European Helio-and Asteroseismology Network (HELAS). One aspect of the network activity is to collate multipurpose data sets and make them available to the community for local helioseismic analysis. The first stage of the project is underway whereby high quality and useful data sets have been selected and acquired. The HELAS Local Helioseismology Network Activity website at http://www.mps.mpg.de/projects/seismo/NA4/ provides this data ready to download. Furthermore, the data is supplemented with relevant documentation necessary for further analysis, including details about the data reduction process that has already been applied. The data primarily consists of Doppler velocity observations but also includes observations of the line-of-sight magnetic field, vector magnetic field measurements, intensity and travel time maps. The website will be continuously updated with data thereby providing convenient access to comprehensive data sets appropriate for use in local helioseismology.
The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

Science.gov (United States)

Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

2017-09-25

Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

Intracellular Delivery of siRNA by Polycationic Superparamagnetic Nanoparticles

Directory of Open Access Journals (Sweden)

Betzaida Castillo

2012-01-01

Full Text Available The siRNA transfection efficiency of nanoparticles (NPs, composed of a superparamagnetic iron oxide core modified with polycationic polymers (poly(hexamethylene biguanide or branched polyethyleneimine, were studied in CHO-K1 and HeLa cell lines. Both NPs demonstrated to be good siRNA transfection vehicles, but unmodified branched polyethyleneimine (25 kD was superior on both cell lines. However, application of an external magnetic field during transfection (magnetofection increased the efficiency of the superparamagnetic NPs. Furthermore, our results reveal that these NPs are less toxic towards CHO-K1 cell lines than the unmodified polycationic-branched polyethyleneimine (PEI. In general, the external magnetic field did not alter the cell’s viability nor it disrupted the cell membranes, except for the poly(hexamethylene biguanide-modified NP, where it was observed that in CHO-K1 cells application of the external magnetic field promoted membrane damage. This paper presents new polycationic superparamagnetic NPs as promising transfection vehicles for siRNA and demonstrates the advantages of magnetofection.
HeLa cell variants that differ in sensitivity to monofunctional alkylating agents, with independence of cytotoxic and mutagenic responses

Science.gov (United States)

Baker, R. M.; Voorhis, W. C. Van; Spencer, L. A.

1979-01-01

Different strains of the established human cell line HeLa differ substantially in sensitivity to ethyl methanesulfonate (EtMes). The EtMes doses effective for either cytotoxicity or mutation induction in a line of HeLa S3 cells are about 1/10th those required in the CCL2 HeLa line of the American Type Culture Collection. By plating the sensitive HeLa S3 line in the presence of highly cytotoxic doses of EtMes, we obtained a clone (designated A6) that displays about 7-fold greater resistance to EtMes toxicity. This A6 isolate is also cross resistant to other simple monofunctional alkylating agents—exhibiting about 4-fold increased resistance to methyl methanesulfonate and 10- to 15-fold increased resistance to N-methyl-N′-nitro-N-nitrosoguanidine but is similar to the S3 parent in sensitivity to mitomycin C, UV radiation, and γ-rays. In contrast to the results for cytotoxicity, the A6 variant and the S3 parent showed the same high susceptibility to EtMes induction of ouabain-resistant mutations. This is direct biological evidence that different alkylation lesions are normally responsible for mutagenic and cytotoxic effects. The S3 and A6 cell lines may differ in DNA repair capability specific to certain potentially lethal alkylation products. The comparative sensitivity of the A6 cells to alkylation mutagenesis may also prove useful in cell genetic studies by facilitating the generation of multiple mutants for recessive alleles and permitting exceptionally sensitive detection of specific mutagenic effects. PMID:291942
γ-Tocotrienol Inhibits Proliferation and Induces Apoptosis via the Mitochondrial Pathway in Human Cervical Cancer HeLa Cells

Directory of Open Access Journals (Sweden)

Weili Xu

2017-08-01

Full Text Available γ-Tocotrienol, a kind of isoprenoid phytochemical, has antitumor activity. However, there is limited evidence that it has an effect on cervical cancer. In this study, the capacity to inhibit proliferation and induce apoptosis in human cervical cancer HeLa cells and the mechanism underlying these effects were examined. The results indicated that a γ-tocotrienol concentration over 30 μM inhibited the growth of HeLa cells with a 50% inhibitory concentration (IC50 of 46.90 ± 3.50 μM at 24 h, and significantly down-regulated the expression of proliferative cell nuclear antigen (PCNA and Ki-67. DNA flow cytometric analysis indicated that γ-tocotrienol arrested the cell cycle at G0/G1 phase and reduced the S phase in HeLa cells. γ-tocotrienol induced apoptosis of HeLa cells in a time- and dose-dependent manner. γ-tocotrienol-induced apoptosis in HeLa cells was accompanied by down-regulation of Bcl-2, up-regulation of Bax, release of cytochrome from mitochondria, activation of caspase-9 and caspase-3, and subsequent poly (ADP-ribose polymerase (PARP cleavage. These results suggested that γ-tocotrienol could significantly inhibit cell proliferation through G0/G1 cell cycle arrest, and induce apoptosis via the mitochondrial apoptotic pathway in human cervical cancer HeLa cells. Thus, our findings revealed that γ-tocotrienol may be considered as a potential agent for cervical cancer therapy.
γ-Tocotrienol Inhibits Proliferation and Induces Apoptosis Via the Mitochondrial Pathway in Human Cervical Cancer HeLa Cells.

Science.gov (United States)

Xu, Weili; Mi, Yaqing; He, Pan; He, Shenghua; Niu, Lingling

2017-08-04

γ-Tocotrienol, a kind of isoprenoid phytochemical, has antitumor activity. However, there is limited evidence that it has an effect on cervical cancer. In this study, the capacity to inhibit proliferation and induce apoptosis in human cervical cancer HeLa cells and the mechanism underlying these effects were examined. The results indicated that a γ-tocotrienol concentration over 30 μM inhibited the growth of HeLa cells with a 50% inhibitory concentration (IC 50 ) of 46.90 ± 3.50 μM at 24 h, and significantly down-regulated the expression of proliferative cell nuclear antigen (PCNA) and Ki-67. DNA flow cytometric analysis indicated that γ-tocotrienol arrested the cell cycle at G0/G1 phase and reduced the S phase in HeLa cells. γ-tocotrienol induced apoptosis of HeLa cells in a time- and dose-dependent manner. γ-tocotrienol-induced apoptosis in HeLa cells was accompanied by down-regulation of Bcl-2, up-regulation of Bax, release of cytochrome from mitochondria, activation of caspase-9 and caspase-3, and subsequent poly (ADP-ribose) polymerase (PARP) cleavage. These results suggested that γ-tocotrienol could significantly inhibit cell proliferation through G0/G1 cell cycle arrest, and induce apoptosis via the mitochondrial apoptotic pathway in human cervical cancer HeLa cells. Thus, our findings revealed that γ-tocotrienol may be considered as a potential agent for cervical cancer therapy.
Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

International Nuclear Information System (INIS)

Gorelic, L.; Parker, D.

1978-01-01

The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage
PMA synergistically enhances apicularen A-induced cytotoxicity by disrupting microtubule networks in HeLa cells

International Nuclear Information System (INIS)

Seo, Kang-Sik; Hwang, Byung-Doo; Kim, Jong-Seok; Park, Ji-Hoon; Song, Kyoung-Sub; Yun, Eun-Jin; Park, Jong-Il; Kweon, Gi Ryang; Yoon, Wan-Hee; Lim, Kyu

2014-01-01

Combination therapy is key to improving cancer treatment efficacy. Phorbol 12-myristate 13-acetate (PMA), a well-known PKC activator, increases the cytotoxicity of several anticancer drugs. Apicularen A induces cytotoxicity in tumor cells through disrupting microtubule networks by tubulin down-regulation. In this study, we examined whether PMA increases apicularen A-induced cytotoxicity in HeLa cells. Cell viability was examined by thiazolyl blue tetrazolium (MTT) assays. To investigate apoptotic potential of apicularen A, DNA fragmentation assays were performed followed by extracting genomic DNA, and caspase-3 activity assays were performed by fluorescence assays using fluorogenic substrate. The cell cycle distribution induced by combination with PMA and apicularen A was examined by flow cytometry after staining with propidium iodide (PI). The expression levels of target proteins were measured by Western blotting analysis using specific antibodies, and α-tubulin mRNA levels were assessed by reverse transcription polymerase chain reaction (RT-PCR). To examine the effect of combination of PMA and apicularen A on the microtubule architecture, α-tubulin protein and nuclei were visualized by immunofluorescence staining using an anti-α-tubulin antibody and PI, respectively. We found that apicularen A induced caspase-dependent apoptosis in HeLa cells. PMA synergistically increased cytotoxicity and apoptotic sub-G 1 population induced by apicularen A. These effects were completely blocked by the PKC inhibitors Ro31-8220 and Go6983, while caspase inhibition by Z-VAD-fmk did not prevent cytotoxicity. RNA interference using siRNA against PKCα, but not PKCβ and PKCγ, inhibited cytotoxicity induced by combination PMA and apicularen A. PMA increased the apicularen A-induced disruption of microtubule networks by further decreasing α- and β-tubulin protein levels in a PKC-dependent manner. These results suggest that the synergy between PMA and apicularen A is involved by
5'-Phospho-RNA Acceptor Specificity of GDP Polyribonucleotidyltransferase of Vesicular Stomatitis Virus in mRNA Capping.

Science.gov (United States)

Ogino, Minako; Ogino, Tomoaki

2017-03-15

The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5'-phospho-RNA (pRNA) from 5'-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5'-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m 7 G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m 7 GpppA (cap 0), respectively. Furthermore, either the 2'- or 3'-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5'-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups of GDP as
Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast

Energy Technology Data Exchange (ETDEWEB)

Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)

2012-02-03

Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

Directory of Open Access Journals (Sweden)

Kazuho Nishimura

2015-03-01

Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
RNA-dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand.

Science.gov (United States)

Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko

2010-05-01

The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.
ADP-ribosylation of nonhistone proteins from metaphase and interphase HeLa cells: factors responsible for differences

International Nuclear Information System (INIS)

Adolph, K.W.

1986-01-01

A striking reduction was previously detected for HeLa metaphase chromosomes, compared to interphase nuclei, in the number of modified nonhistone species. Several factors which could contribute to this cell cycle change in ADP-ribosylation have therefore been examined. In these experiments, mitotic or interphase cells were incubated with [ 32 P]NAD, chromosomes and nuclei were prepared, and the proteins were resolved by polyacrylamide gel electrophoresis. The level of incorporation of 32 P label was found to be substantially influenced by chromosome expansion, DNA nicking, disruption of chromosomes or nuclei, and the growth activity of cells. The level of ADP-ribosylation was not greatly affected by the presence of inhibitors of RNA, DNA, and protein synthesis. NAD concentration influenced the extent of labelling but not the pattern of labeled species. A similar change in the pattern from interphase to mitosis was observed for whole cells as well as for isolated chromosomes and nuclei. The procedure used to arrest cells in mitosis was not artifactually responsible for the results. The difference in metaphase and interphase ADP-ribosylation is not confined to HeLa cells, since comparable patterns were found for chromosomes and nuclei from Novikoff rat hepatoma cells
[Antiapoptotic Effect of the Leukemia Associated Gene MLAA-34 in HeLa Cells].

Science.gov (United States)

Zhang, Peng-Yu; Zhao, Xuan; Zhang, Wen-Juan; Zhang, Wang-Gang; Chen, Yin-Xia

2016-04-01

To study the antiapoptotic effect of leukemia-associated gene MLAA-34 in HeLa cells. The MLAA-34 recombinant lentiviral expression vector was constructed, and the stably transfected HeLa cell line with high expression of MLAA-34 was set up; As(2)O(3) was used to induce apoptosis; the MTT assay, colony formation test and flow cytometry were used to detect the ability of cell proliferation, colong formation, apoptosis and cell cycle changes respectively. After treatment with As(2)O(3), the survival rate of HeLa cells with MLAA-34 overexpression was significantly higher than that of the control cells, and the colony formation ability of MLAA-34 significantly increased, and the high expression of MLAA-34 gene significantly decreased the apoptosis rate of HeLa cells, and decreased the proportion of G(2)/M phase cells. The leukemia-associated gene MLAA-34 has been comfirmed to show antiapoptotic effect in HeLa cells which are induced by As(2)O(3).
3′-Terminal Sequence in Poliovirus Negative-Strand Templates Is the Primary cis-Acting Element Required for VPgpUpU-Primed Positive-Strand Initiation

OpenAIRE

Sharma, Nidhi; O'Donnell, Brian J.; Flanegan, James B.

2005-01-01

The 5′ cloverleaf in poliovirus RNA has a direct role in regulating the stability, translation, and replication of viral RNA. In this study, we investigated the role of stem a in the 5′ cloverleaf in regulating the stability and replication of poliovirus RNA in HeLa S10 translation-replication reactions. Our results showed that disrupting the duplex structure of stem a destabilized viral RNA and inhibited efficient negative-strand synthesis. Surprisingly, the duplex structure of stem a was no...
Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

Science.gov (United States)

Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

2014-12-16

5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
The novel HSV-1 US5-1 RNA is transcribed off a domain encoding US 5, US 4, US 3, US 2 and α22

Directory of Open Access Journals (Sweden)

Roizman Bernard

2010-05-01

Full Text Available Abstract Background The genome of herpes simplex virus 1 encodes at least 84 transcripts from which proteins are translated and several additional RNAs whose status as mRNAs is unknown. These RNAs include latency-associated transcript, OriS1 and OriS2 RNAs and in case of α4 null mutant additional transcript that spans the junction between L and S component of the HSV-1 genome. Current data do not suggest that a peptide is translated from these RNAs. Results We describe here a novel RNA designated US5-1 that spans 4.5 kb of the unique-short (US region. The RNA initiates in US5 and terminates in the α22 open reading frame. It is expressed antisense to US5, US4, US3 and ICP22 mRNAs. This transcript is expressed with γ2 kinetics and has a half-life of 80 minutes. Conclusion These results identify a novel transcript encoded within HSV-1 genome. Since no major hypothetical open-reading frames are present in this transcript it is feasible that this RNA exerts its function as a non-coding RNA.
A class of DNA-binding peptides from wheat bud causes growth inhibition, G2 cell cycle arrest and apoptosis induction in HeLa cells

Directory of Open Access Journals (Sweden)

Elgjo Kjell

2009-07-01

Full Text Available Abstract Background Deproteinized DNA from eukaryotic and prokaryotic cells still contains a low-molecular weight peptidic fraction which can be dissociated by alkalinization of the medium. This fraction inhibits RNA transcription and tumor cell growth. Removal from DNA of normal cells causes amplification of DNA template activity. This effect is lower or absent in several cancer cell lines. Likewise, the amount of active peptides in cancer cell DNA extracts is lower than in DNA preparation of the corresponding normal cells. Such evidence, and their ubiquitous presence, suggests that they are a regulatory, conserved factor involved in the control of normal cell growth and gene expression. Results We report that peptides extracted from wheat bud chromatin induce growth inhibition, G2 arrest and caspase-dependent apoptosis in HeLa cells. The growth rate is decreased in cells treated during the S phase only and it is accompanied by DNA damage and DNA synthesis inhibition. In G2 cells, this treatment induces inactivation of the CDK1-cyclin B1 complex and an increase of active chk1 kinase expression. Conclusion The data indicate that the chromatin peptidic pool inhibits HeLa cell growth by causing defective DNA replication which, in turn, arrests cell cycle progression to mitosis via G2 checkpoint pathway activation.
The effects of ascorbic acid on diphtheria toxin and intoxicated hela cells

International Nuclear Information System (INIS)

Clark, C.E.; Smith, T.J.

1976-01-01

Ascorbic acid (vitamin C) prevented diphtheria toxin from inhibiting the incorporation of [U- 14 C]-alanine into trichloroacetic acid precipitable material in HeLa cells. Ascorbic acid did not exhibit an effect on the adenosine diphosphate-ribosylation of amino acyl transferase 2 nor did it separate fragment A from fragment B in ''nicked'' toxin. A non-specific reducing agent, para-methylaminophenol sulfate, exhibited an effect of HeLa cells very similar to the results of ascorbic acid. Citric acid, a tricarboxylic acid, had no effect on HeLa cells. (auth.)
Treatment of HeLa cells with Giloe (Tinospora cordifolia meirs) increases the radiosensitivity by increasing DNA damage

International Nuclear Information System (INIS)

Varma, Hari Krishna; Jagetia, Ganesh Chandra; Nayak, Vijayashree

2014-01-01

Radiotherapy is an important treatment modality and screening of phytoceuticals may enhance the clinical outcome of radiotherapy, therefore radiosensitizing activity of various guduchi (Tinospora cordifolia) extracts was studied in HeLa cells. Chromosomal aberrations were scored in HeLa cells treated with 10 μg/ml of aqueous, methanol, or methylene chloride guduchi extracts or doxorubicin before exposure to 0, 0.5, 1, 2 or 3 Gy of γ-radiation at 12, 24, 36 or 48 h post-irradiation. Irradiation of HeLa cells caused a dose dependent rise in the chromatid breaks, chromosome breaks, dicentric, centric rings, acentric fragments and total aberrations at all post-irradiation times and the dose response was linear quadratic for all types of aberrations scored. Chromatid breaks increased up to 12 h post-irradiation and declined steadily up to 48 h post-irradiation, whereas chromosome breaks, dicentric, acentric fragments and total aberrations elevated up to 24 h post-irradiation and declined thereafter. However, centric rings continued to rise steadily up to 48 h post-irradiation. Treatment of HeLa cells with aqueous, methanol or methylene chloride guduchi extract or doxorubicin before irradiation significantly enhanced various types of chromosomal aberrations and a maximum rise in the chromosome aberrations was observed in the HeLa cells treated with methylene chloride extract before irradiation when compared to other groups. Various guduchi extracts enhanced the effect of radiation in HeLa cells by increasing the molecular damage to cellular genome and their effect was similar to or even greater than doxorubicin (positive control) pretreatment, depending on the type of guduchi extract used. (author)
Anticancer effects of the engineered stem cells transduced with therapeutic genes via a selective tumor tropism caused by vascular endothelial growth factor toward HeLa cervical cancer cells.

Science.gov (United States)

Kim, Hye-Sun; Yi, Bo-Rim; Hwang, Kyung-A; Kim, Seung U; Choi, Kyung-Chul

2013-10-01

The aim of the present study was to investigate the therapeutic efficacy of genetically engineered stem cells (GESTECs) expressing bacterial cytosine deaminase (CD) and/or human interferon-beta (IFN-β) gene against HeLa cervical cancer and the migration factors of the GESTECs toward the cancer cells. Anticancer effect of GESTECs was examined in a co-culture with HeLa cells using MTT assay to measure cell viability. A transwell migration assay was performed so as to assess the migration capability of the stem cells to cervical cancer cells. Next, several chemoattractant ligands and their receptors related to a selective migration of the stem cells toward HeLa cells were determined by real-time PCR. The cell viability of HeLa cells was decreased in response to 5-fluorocytosine (5-FC), a prodrug, indicating that 5-fluorouracil (5-FU), a toxic metabolite, was converted from 5-FC by CD gene and it caused the cell death in a co-culture system. When IFN-β was additionally expressed with CD gene by these GESTECs, the anticancer activity was significantly increased. In the migration assay, the GESTECs selectively migrated to HeLa cervical cancer cells. As results of real-time PCR, chemoattractant ligands such as MCP-1, SCF, and VEGF were expressed in HeLa cells, and several receptors such as uPAR, VEGFR2, and c-kit were produced by the GESTECs. These GESTECs transduced with CD gene and IFN-β may provide a potential of a novel gene therapy for anticervical cancer treatments via their selective tumor tropism derived from VEGF and VEGFR2 expressions between HeLa cells and the GESTECs.
Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

OpenAIRE

Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

2001-01-01

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic ...

Mifepristone sensitizing cisplatin for cervical adenocarcinoma HeLa cell sensitivity to chemotherapy and its mechanism.

Science.gov (United States)

Li, Caihong; Ye, Hong

2013-01-01

The study was designed to investigate proliferation inhibition for cervical adenocarcinoma HeLa cell treated with cisplatin combined with mifepristone and access its possible mechanism. HeLa cell was processed by different concentrations of mifepristone, cisplatin, and their combination respectively. Cell's proliferation inhibition rate and induction apoptosis ability were detected by MTT assay, FCM; the expression of P53, survivin and HPV E6 protein were measured by Western Blot. The results showed that cisplatin inhibits proliferation of HeLa cells in different concentrations (p 0.05). Mifepristone at low concentrations (cisplatin can significantly enhance the inhibitory effect of cisplatin on HeLa cell line. Flow cytometry showed that mifepristone at low concentrations (cisplatin can induce apparent apoptosis of HeLa cell line in concentration dependent manner. Western blotting demonstrated that the expression of P53 protein increased and the expression of HPV E6 survivin protein decreased in HeLa cells treated with MIF at low concentrations (cisplatin. Mifepristone at low concentrations (cisplatin to HeLa cells. The strengthening effect of growth inhibition and chemosensitivity to cisplatin of mifepristone are associated with down-regulating HPV E6 survivin protein and upregulating p53 protein.
Intrinsic resistance to aminoglycosides in Enterococcus faecium is conferred by the 16S rRNA m5C1404-specific methyltransferase EfmM

DEFF Research Database (Denmark)

Galimand, Marc; Schmitt, Emmanuelle; Panvert, Michel

2011-01-01

methyltransferase, as well as by the previously characterized aac(6')-Ii that encodes a 6'-N-aminoglycoside acetyltransferase. Inactivation of efmM in E. faecium increases susceptibility to the aminoglycosides kanamycin and tobramycin, and, conversely, expression of a recombinant version of efmM in Escherichia coli...... confers resistance to these drugs. The EfmM protein shows significant sequence similarity to E. coli RsmF (previously called YebU), which is a 5-methylcytidine (m(5)C) methyltransferase modifying 16S rRNA nucleotide C1407. The target for EfmM is shown by mass spectrometry to be a neighboring 16S r...
Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

Science.gov (United States)

Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

2010-04-01

Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
Development of DNA affinity techniques for the functional characterization of purified RNA polymerase II transcription factors

International Nuclear Information System (INIS)

Garfinkel, S.; Thompson, J.A.; Cohen, R.B.; Brendler, T.; Safer, B.

1987-01-01

Affinity adsorption, precipitation, and partitioning techniques have been developed to purify and characterize RNA Pol II transcription components from whole cell extracts (WCE) (HeLa) and nuclear extracts (K562). The titration of these extracts with multicopy constructs of the Ad2 MLP but not pUC8, inhibits transcriptional activity. DNA-binding factors precipitated by this technique are greatly enriched by centrifugation. Using this approach, factors binding to the upstream promoter sequence (UPS) of the Ad2 MLP have been rapidly isolated by Mono Q, Mono S, and DNA affinity chromatography. By U.V. crosslinking to nucleotides containing specific 32 P-phosphodiester bonds within the recognition sequence, this factor is identified as a M/sub r/ = 45,000 polypeptide. To generate an assay system for the functional evaluation of single transcription components, a similar approach using synthetic oligonucleotide sequences spanning single promoter binding sites has been developed. The addition of a synthetic 63-mer containing the UPS element of the Ad2 MLP to HeLa WCE inhibited transcription by 60%. The addition of partially purified UPS binding protein, but not RNA Pol II, restored transcriptional activity. The addition of synthetic oligonucleotides containing other regulatory sequences not present in the Ad2 MLP was without effect
On enhancing drugs effect on radiosensitivity of HeLa cells by inhibiting P13K/Akt signal transduction

International Nuclear Information System (INIS)

Xia Shu; Yu Shiying

2006-01-01

Objective: To explore the mechanism of PI3K/Akt in radiosensitization of docetaxel and cisplatin by inhibiting PI3K/Akt pathway in HeLa cells. Methods: To detect the 50% inhibition concentration (IC 50 ) of cisplatin and docetaxel in Hela cells by mono-nuclear cell direct cytotoxicity assay (MTT) in vitro. Using the IC 20 of cisplatin and docetaxel in Hela cell or in association with LY294002 for 24 h, then, the cells were irradiated by X-ray with 2,3,4,6,8 Gy. The cell survival fraction was computed by clone formation. Cell survival curve was fitted by multitarget one-hit model, and D q , D 0 , SF 2 , sensitizing enhancing ratio(SER) was calculated. The expression of pAkt and total Akt by western blot were detected. Apoptosis was detected by flow cytometry. Results: 1. Docetaxel and cisplatin improved the phosphorylation of Akt by irradiation obviously. 2. The SER of docetaxel + LY294002 + irradiation group (1.92) was higher than that of docetaxel + irradiation group(1.41). The SER of cisplatin + LY294002 + irradiation group(1.71) was higher than the cisplatin + irradiation group (1.37). 3. Apoptosis rate of docetaxel + LY294002 + irradiation and cisplatin + LY294002 + irradiation groups(12.5%, 10.2%) were higher than those of docetaxel + irradiation and cisplatin + irradiation groups(6.1%, 5.1%). Conclusions: PI3K/Akt signal transduction activation may be as an important reason of radiosensitization reduction of docetaxel and cisplatin in the HeLa cells. Our results show that inhibiting PI3K/Akt can improve the radiosensitization of docetaxel and cisplatin in the HeLa cells. (authors)
Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

Science.gov (United States)

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Kaempferia parviflora Extract Exhibits Anti-cancer Activity against HeLa Cervical Cancer Cells.

Science.gov (United States)

Potikanond, Saranyapin; Sookkhee, Siriwoot; Na Takuathung, Mingkwan; Mungkornasawakul, Pitchaya; Wikan, Nitwara; Smith, Duncan R; Nimlamool, Wutigri

2017-01-01

Kaempferia parviflora (KP) has been traditionally used as a folk remedy to treat several diseases including cancer, and several studies have reported cytotoxic activities of extracts of KP against a number of different cancer cell lines. However, many aspects of the molecular mechanism of action of KP remain unclear. In particular, the ability of KP to regulate cancer cell growth and survival signaling is still largely unexplored. The current study aimed to investigate the effects of KP on cell viability, cell migration, cell invasion, cell apoptosis, and on signaling pathways related to growth and survival of cervical cancer cells, HeLa. We discovered that KP reduced HeLa cell viability in a concentration-dependent manner. The potent cytotoxicity of KP against HeLa cells was associated with a dose-dependent induction of apoptotic cell death as determined by flow cytometry and observation of nuclear fragmentation. Moreover, KP-induced cell apoptosis was likely to be mediated through the intrinsic apoptosis pathway since caspase 9 and caspase 7, but not BID, were shown to be activated after KP exposure. Based on the observation that KP induced apoptosis in HeLa cell, we further investigated the effects of KP at non-cytotoxic concentrations on suppressing signal transduction pathways relevant to cell growth and survival. We found that KP suppressed the MAPK and PI3K/AKT signaling pathways in cells activated with EGF, as observed by a significant decrease in phosphorylation of ERK1/2, Elk1, PI3K, and AKT. The data suggest that KP interferes with the growth and survival of HeLa cells. Consistent with the inhibitory effect on EGF-stimulated signaling, KP potently suppressed the migration of HeLa cells. Concomitantly, KP was demonstrated to markedly inhibit HeLa cell invasion. The ability of KP in suppressing the migration and invasion of HeLa cells was associated with the suppression of matrix metalloproteinase-2 production. These data strongly suggest that KP may slow
Inactivated Tianjin strain, a novel genotype of Sendai virus, induces apoptosis in HeLa, NCI-H446 and Hep3B cells.

Science.gov (United States)

Chen, Jun; Han, Han; Wang, Bin; Shi, Liying

2016-07-01

The Sendai virus strain Tianjin is a novel genotype of the Sendai virus. In previous studies, ultraviolet-inactivated Sendai virus strain Tianjin (UV-Tianjin) demonstrated antitumor effects on human breast cancer cells. The aim of the present study was to investigate the in vitro antitumor effects of UV-Tianjin on the human cervical carcinoma HeLa, human small cell lung cancer NCI-H446 and human hepatocellular carcinoma Hep 3B cell lines, and the possible underlying mechanisms of these antitumor effects. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay revealed that UV-Tianjin treatment inhibited the proliferation of HeLa, NCI-H446 and Hep 3B cells in a dose- and time-dependent manner. Hoechst and Annexin V-fluorescein isothiocyanate/propidium iodide double staining indicated that UV-Tianjin induced dose-dependent apoptosis in all three cell lines with the most significant effect observed in the HeLa cell line. In the HeLa cell line, UV-Tianjin-induced apoptosis was further confirmed by the disruption of the mitochondria membrane potential and the activation of caspases, as demonstrated by fluorescent cationic dye and colorimetric assays, respectively. In addition, western blot analysis revealed that UV-Tianjin treatment resulted in significant upregulation of cytochrome c , apoptosis protease activating factor-1, Fas, Fas ligand and Fas-associated protein with death domain, and activated caspase-9, -8 and -3 in HeLa cells. Based on these results, it is hypothesized that UV-Tianjin exhibits anticancer activity in HeLa, NCI-H446 and Hep 3B cell lines via the induction of apoptosis. In conclusion, the results of the present study indicate that in the HeLa cell line, intrinsic and extrinsic apoptotic pathways may be involved in UV-Tianjin-induced apoptosis.
5′-Phospho-RNA Acceptor Specificity of GDP Polyribonucleotidyltransferase of Vesicular Stomatitis Virus in mRNA Capping

Science.gov (United States)

Ogino, Minako

2017-01-01

ABSTRACT The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5′-phospho-RNA (pRNA) from 5′-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5′-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m7G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m7GpppA (cap 0), respectively. Furthermore, either the 2′- or 3′-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5′-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups
The novel sRNA s015 improves nisin yield by increasing acid tolerance of Lactococcus lactis F44.

Science.gov (United States)

Qi, Jiakun; Caiyin, Qinggele; Wu, Hao; Tian, Kairen; Wang, Binbin; Li, Yanni; Qiao, Jianjun

2017-08-01

Nisin, a polycyclic antibacterial peptide produced by Lactococcus lactis, is stable at low pH. Improving the acid tolerance of L. lactis could thus enhance nisin yield. Small non-coding RNAs (sRNAs) play essential roles in acid tolerance by regulating their target mRNAs at the post-transcriptional level. In this study, a novel sRNA, s015, was identified in L. lactis F44 via the use of RNA sequencing, qRT-PCR analysis, and Northern blotting. s015 improved the acid tolerance of L. lactis and boosted nisin yield at low pH. In silico predictions enabled us to construct a library of possible s015 target mRNAs. Statistical analysis and validation suggested that s015 contains a highly conserved region (5'-GAAAAAAAC-3') that likely encompasses the regulatory core of the sRNA. atpG, busAB, cysD, ilvB, tcsR, ung, yudD, and ywdA were verified as direct targets of s015, and the interactions between s015 and its target genes were elucidated. This work provided new insight into the adaptation mechanism of L. lactis under acid stress.
Multiple isoelectric forms of poliovirus RNA-dependent RNA polymerase: Evidence for phosphorylation

International Nuclear Information System (INIS)

Ransone, L.J.; Dasgupta, A.

1989-01-01

Poliovirus-specific RNA-dependent RNA polymerase (3Dpol) was purified to apparent homogeneity. A single polypeptide of an apparent molecular weight of 63,000 catalyzes the synthesis of dimeric and monomeric RNA products in response to the poliovirion RNA template. Analysis of purified 3Dpol by two-dimensional electrophoresis showed multiple forms of 3Dpol, suggesting posttranslational modification of the protein in virus-infected cells. The two major forms of 3Dpol appear to have approximate pI values of 7.1 and 7.4. Incubation of purified 3Dpol with calf intestinal phosphatase resulted in almost complete disappearance of the pI 7.1 form and a concomitant increase in the intensity of the pI 7.4 form of 3Dpol. Addition of 32P-labeled Pi during infection of HeLa cells with poliovirus resulted in specific labeling of 3Dpol and 3CD, a viral protein which contains the entire 3Dpol sequence. Both 3Dpol and 3CD appear to be phosphorylated at serine residues. Ribosomal salt washes prepared from both mock- and poliovirus-infected cells contain phosphatases capable of dephosphorylating quantitatively the phosphorylated form (pI 7.1) of 3Dpol
5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

Science.gov (United States)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.
[Essential oil from Artemisia lavandulaefolia induces apoptosis and necrosis of HeLa cells].

Science.gov (United States)

Zhang, Lu-min; Lv, Xue-wei; Shao, Lin-xiang; Ma, Yan-fang; Cheng, Wen-zhao; Gao, Hai-tao

2013-12-01

To investigate the effects of Artemisia lavandulaefolia essential oil on apoptosis and necrosis of HeLa cells. Cell viability was assayed using MTT method. The morphological and structure alterations in HeLa cells were observed by microscopy. Furthermore, cell apoptosis was measured by DNA Ladder and flow cytometry. DNA damage was measured by comet assay, and the protein expression was examined by Western blot analysis. MTT assay displayed essential oil from Artemisia lavandulaefolia could inhibit the proliferation of HeLa cells in a dose-dependent manner. After treated with essential oil of Artemisia lavadulaefolia for 24 h, HeLa cells in 100 and 200 microg/mL experiment groups exhibited the typical morphology changes of undergoing apoptosis, such as cell shrinkage and nucleus chromatin condensed. However, the cells in the 400 microg/mL group showed the necrotic morphology changes including cytomembrane rupture and cytoplasm spillover. In addition, DNA Ladder could be demonstrated by DNA electrophoresis in each experiment group. Apoptosis peak was also evident in flow cytometry in each experiment group. After treating the HeLa cells with essential oil of Artemisia lavadulaefolia for 6 h, comet tail was detected by comet assay. Moreover, western blotting analysis showed that caspase-3 was activated and the cleavage of PARP was inactivated. Essential oil from Artemisia lavadulaefolia can inhibit the proliferation of HeLa cells in vitro. Low concentration of essential oil from Artemisia lavadulaefolia can induce apoptosis, whereas high concentration of the compounds result in necrosis of HeLa cells. And,the mechanism may be related to the caspase-3-mediated-PARP apoptotic signal pathway.
In Vitro Ultramorphological Assessment of Apoptosis Induced by Zerumbone on (HeLa

Directory of Open Access Journals (Sweden)

Siddig Ibrahim Abdel Wahab

2009-01-01

Full Text Available Zerumbone (ZER, a potential anticancer compound, isolated from the fresh rhizomes of Zingiber zerumbet. In this investigation, the cytotoxic properties of ZER were evaluated, on cancer cells of human cervix (HeLa, breast and ovary, and normal cells of Chinese Hamster ovary, using MTT assay. Apoptogenic effects of ZER on HeLa were studied using fluorescence microscopy (AO/PI double staining, scanning and transmission electron microscopy (SEM and TEM, and colorimetric assay of the apoptosis promoter enzyme, caspase-3. The results of MTT assay showed that ZER has less effect on normal cells compared to cancer cells. The lowest IC50 of ZER was observed on HeLa cells. Cytological observations showed nuclear and chromatin condensation, cell shrinkage, multinucleation, abnormalities of mitochondrial cristae, membrane blebbing, holes, cytoplasmic extrusions and formation of apoptotic bodies as confirmed collectively by double staining of AO/PI, SEM and TEM. Statistical analysis (two-tailed t-test of differential counting of 200 cells under fluorescence microscope revealed significant difference in apoptotic cells populations between treated and untreated HeLa cells. In addition, ZER has increased the cellular level of caspase-3 on the treated HeLa cells. It could be concluded that ZER was able to produce distinctive morphological features of cell death that corresponds to apoptosis.
3'-5' RNA degradation pathways in human cells

DEFF Research Database (Denmark)

Lubas, Michal Szymon

RNA synthesis and degradation are key steps in the regulation of gene expression in all living organisms. During the course of his PhD studies, Michal Lubas centred his research on the nuclear and cytoplasmic RNA turnover of both noncoding and coding RNAs in human cells. His proteomic studies...... revealed the interaction network of the main 3'-5' RNA degradation machinery – the RNA exosome complex. One of the key findings was the identification and characterisation of the Nuclear Exosome Targeting (NEXT) complex, important for nuclear functions of the exosome. Michal Lubas also studied the role...
Cytotoxic effect and radiation enhancement of artemisinin in uterine cervical carcinoma cell line HeLa

International Nuclear Information System (INIS)

Gong Xiaomei; Zhou Daoan; Cao Jianping; Fan Saijun; Zhu Wei

2010-01-01

Objective: To investigate cytotoxic and radiosensitizing effect of Artemisinin on cervical carcinoma cell line HeLa. Methods: In order to measure the optimized effective time, cytotoxic effect of Artemisinin on HeLa cell line was investigated with MTT assay. The radiosensitization effect of different doses and different treatment duration of Artemisinin on HeLa cell line were evaluated by MTT test, the SER is 1.17 and radiosensitizing effect was measured with multi-target single hit model through SER of HeLa cell. Cell cycles in different groups were calculated by flow cytometry. Results: The 50% inhibition concentration of Artemisinin interacted with HeLa cells for 24 h is 600.19 nmol/ml, and for 48 h is 160.71 nmol/ml. The HeLa cells'surival ratio is 93.51%, 91.87%, and 87.28% after adding Atemisinin of 110.69 nmol/ml and 1 Gy radiation exposure. There are three groups: the chemotherapy only group, the radiotherapy only group and the combination group. The result of the cell cycles showed that cells in G 2 /M period decreased in the combination group. Conclusion: Artemisinin has radiosensitization effect on cervical carcinoma HeLa cells, whichshows dose and time dependent. Artemisinin can inhibit the G 2 /M block by ionizing radiation. (authors)
Condurango (Gonolobus condurango Extract Activates Fas Receptor and Depolarizes Mitochondrial Membrane Potential to Induce ROS-dependent Apoptosis in Cancer Cells in vitro CE-treatment on HeLa: a ROS-dependent mechanism

Directory of Open Access Journals (Sweden)

Kausik Bishayee

2015-09-01

Full Text Available Objectives: Condurango (Gonolobus condurango extract is used by complementary and alternative medicine (CAM practitioners as a traditional medicine, including homeopathy, mainly for the treatment of syphilis. Condurango bark extract is also known to reduce tumor volume, but the underlying molecular mechanisms still remain unclear. Methods: Using a cervical cancer cell line (HeLa as our model, the molecular events behind condurango extract’s (CE’s anticancer effect were investigated by using flow cytometry, immunoblotting and reverse transcriptase-polymerase chain reaction (RT-PCR. Other included cell types were prostate cancer cells (PC3, transformed liver cells (WRL-68, and peripheral blood mononuclear cells (PBMCs. Results: Condurango extract (CE was found to be cytotoxic against target cells, and this was significantly deactivated in the presence of N-acetyl cysteine (NAC, a scavenger of reactive oxygen species (ROS, suggesting that its action could be mediated through ROS generation. CE caused an increase in the HeLa cell population containing deoxyribonucleic acid (DNA damage at the G zero/Growth 1 (G0/G1 stage. Further, CE increased the tumor necrosis factor alpha (TNF-α and the fas receptor (FasR levels both at the ribonucleic acid (RNA and the protein levels, indicating that CE might have a cytotoxic mechanism of action. CE also triggered a sharp decrease in the expression of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB both at the RNA and the protein levels, a possible route to attenuation of B-cell lymphoma 2 (Bcl-2, and caused an opening of the mitochondrial membrane’s permeability transition (MPT pores, thus enhancing caspase activities. Conclusion: Overall, our results suggest possible pathways for CE mediated cytotoxicity in model cancer cells.
Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

DEFF Research Database (Denmark)

Issinger, O G; Beier, H

1978-01-01

Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....
A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

Directory of Open Access Journals (Sweden)

Finn Grey

2010-06-01

Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.
Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

Science.gov (United States)

Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

2016-03-01

The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

Czech Academy of Sciences Publication Activity Database

Garcia, S.; Kovařík, Aleš

2013-01-01

Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013
Sipi soup inhibits cancer‑associated fibroblast activation and the inflammatory process by downregulating long non‑coding RNA HIPK1‑AS.

Science.gov (United States)

Zhou, Bingxiu; Yu, Yuanyuan; Yu, Lixia; Que, Binfu; Qiu, Rui

2018-06-06

Sipi soup (SPS), the aqueous extract derived from the root bark of Sophora japonical L, Salix babylonica L., Morus alba L., as well as Amygdalus davidiana (Carr.) C. de Vos, is a traditional Chinese medicine frequently used to prevent and treat infection and inflammation. However, the role of SPS in cancer‑associated fibroblasts (CAFs) require further investigation. In the present study, the effects of SPS on fibroblast inactivation and the underlying mechanism were investigated. Reverse transcription‑quantitative polymerase chain reaction was used to analyze the mRNA expression levels of fibroblast activation protein (FAP), interleukin (IL)‑6, α‑smooth muscle actin (α‑SMA) and programmed cell death 4 (PDCD4). Flow cytometry was used to evaluate cell apoptosis. Immunofluorescence was used to determine the number of activated fibroblasts. The present study reported that SPS treatment did not affect the proliferative apoptotic potential of fibroblasts. Treatment with HeLa cell culture medium (CM) induced a significant increase in the expression levels of FAP, IL‑6 and α‑SMA, but reduced the expression of PDCD4. SPS reversed the effects of HeLa CM on the expression of these genes. Analysis with a long non‑coding (lnc)RNA array of numerous differentially expressed lncRNAs revealed that the expression levels of the lncRNA homeodomain‑interacting protein kinase 1 antisense RNA (HIPK1‑AS) were increased in cervicitis tissues and cervical squamous cell carcinoma tissues compared with in normal cervical tissues. HIPK1‑AS expression levels were upregulated in response to HeLa CM, but were decreased under SPS treatment. The downregulation of HIPK1‑AS expression via short hairpin RNA abolished the effects of HeLa CM on the expression of inflammation‑associated genes. The findings of the present study suggested that SPS may prevent the progression of cervical cancer by inhibiting the activation of CAF and the inflammatory process by reducing HIPK1�
Effect of doxorubicin on cell survival and micronuclei formation in HeLa cells exposed to different doses of gamma-radiation

International Nuclear Information System (INIS)

Jagetia, G.C.; Nayak, V.

2000-01-01

Purpose: The present study was undertaken to obtain an insight into the combined effects of doxorubicin with radiation on the cell survival and micronuclei induction in HeLa cells. Material and Methods: HeLa S3 cells were allowed to grow till they reached plateau phase, inoculated with 10 μg/ml doxorubicin hydrochloride and then exposed to 0, 0.5, 1, 2 and 3 Gy γ-radiation. Clonogenicity of cell was measured using the colony forming assay, micronuclei formation using the micronucleus assay. Results: The treatment of HeLa cells with doxorubicin (adriamycin) for 2 hours before exposure to different doses of γ-radiation resulted in a significant and dose-dependent decline in the cell survival and cell proliferation when compared to the PBS+irradiation group. Conversely, the frequency of micronuclei increased in a dose-related manner in both the PBS+irradiation and doxorubicin+irradiation groups. The pretreatment of HeLa cells with doxorubicin before irradiation to various doses of γ-rays resulted in a significant elevation in the frequency of micronuclei when compared with the concurrent PBS+irradiation group. The dose-response relationship for both PBS+irradiation and doxorubicin+irradiation groups was linear. The correlation between cell survival and micronuclei induction was also determined for PBS or doxorubicin+irradiation group, where the clonogenicity of cells declined with the increase in micronuclei formation. The correlation between cell survical and micronuclei induction was linear quadratic for both PBS+irradiation and doxorubicin+irradiation groups. Conclusion: From our study it can be concluded that combination treatment with doxorubicin and radiation increased the genotoxic effect of the either treatment given alone. (orig.) [de
Phosphorylation of NS5A Serine-235 is essential to hepatitis C virus RNA replication and normal replication compartment formation

Energy Technology Data Exchange (ETDEWEB)

Eyre, Nicholas S., E-mail: nicholas.eyre@adelaide.edu.au [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia); Hampton-Smith, Rachel J.; Aloia, Amanda L. [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia); Eddes, James S. [Adelaide Proteomics Centre, School of Biological Sciences, University of Adelaide, Adelaide (Australia); Simpson, Kaylene J. [Victorian Centre for Functional Genomics, Peter MacCallum Cancer Centre, East Melbourne (Australia); The Sir Peter MacCallum Department of Oncology, University of Melbourne, Parkville (Australia); Hoffmann, Peter [Adelaide Proteomics Centre, School of Biological Sciences, University of Adelaide, Adelaide (Australia); Institute for Photonics and Advanced Sensing (IPAS), University of Adelaide, Adelaide (Australia); Beard, Michael R. [School of Biological Sciences and Research Centre for Infectious Diseases, University of Adelaide, Adelaide (Australia); Centre for Cancer Biology, SA Pathology, Adelaide (Australia)

2016-04-15

Hepatitis C virus (HCV) NS5A protein is essential for HCV RNA replication and virus assembly. Here we report the identification of NS5A phosphorylation sites Ser-222, Ser-235 and Thr-348 during an infectious HCV replication cycle and demonstrate that Ser-235 phosphorylation is essential for HCV RNA replication. Confocal microscopy revealed that both phosphoablatant (S235A) and phosphomimetic (S235D) mutants redistribute NS5A to large juxta-nuclear foci that display altered colocalization with known replication complex components. Using electron microscopy (EM) we found that S235D alters virus-induced membrane rearrangements while EM using ‘APEX2’-tagged viruses demonstrated S235D-mediated enrichment of NS5A in irregular membranous foci. Finally, using a customized siRNA screen of candidate NS5A kinases and subsequent analysis using a phospho-specific antibody, we show that phosphatidylinositol-4 kinase III alpha (PI4KIIIα) is important for Ser-235 phosphorylation. We conclude that Ser-235 phosphorylation of NS5A is essential for HCV RNA replication and normal replication complex formation and is regulated by PI4KIIIα. - Highlights: • NS5A residues Ser-222, Ser-235 and Thr-348 are phosphorylated during HCV infection. • Phosphorylation of Ser-235 is essential to HCV RNA replication. • Mutation of Ser-235 alters replication compartment localization and morphology. • Phosphatidylinositol-4 kinase III alpha is important for Ser-235 phosphorylation.
Protolichesterinic acid enhances doxorubicin-induced apoptosis in HeLa cells in vitro.

Science.gov (United States)

Brisdelli, Fabrizia; Perilli, Mariagrazia; Sellitri, Doriana; Bellio, Pierangelo; Bozzi, Argante; Amicosante, Gianfranco; Nicoletti, Marcello; Piovano, Marisa; Celenza, Giuseppe

2016-08-01

The aim of this study was to investigate the effect of protolichesterinic acid, a lichen secondary metabolite, on anti-proliferative activity of doxorubicin in three human cancer cell lines, HeLa, SH-SY5Y and K562 cells. The data obtained from MTT assays, performed on cells treated with protolichesterinic acid and doxorubicin alone and in combination, were analysed by the median-effect method as proposed by Chou and Talalay and the Bliss independence model. Apoptosis rate was evaluated by fluorescence microscopy, caspase-3, 8 and 9 activities were detected by spectrofluorimetric analysis and protein expression of Bim, Bid, Bax and Mcl-2 was analysed by Western blotting. The interaction of protolichesterinic acid with thioesterase domain of human fatty acid synthase (hFAS) was investigated by a molecular docking study. The in vitro activity of doxorubicin against HeLa cancer cell line, but not against SH-SY5Y and K562 cells, was synergically increased by protolichesterinic acid. The increased cytotoxicity caused by protolichesterinic acid in HeLa cells was due to a pro-apoptotic effect and was associated to caspase-3, 8 and 9 activation. The simultaneous treatment for 24h with protolichesterinic acid plus doxorubicin caused an increase of Bim protein expression and the appearance of cleaved form of Bid protein. The molecular modelling analysis showed that protolichesterinic acid seemed to behave as a competitive inhibitor of hFAS. These results suggest that protolichesterinic acid could be envisaged as an useful tool against certain types of tumor cells in combination with anticancer drugs. Copyright © 2016 Elsevier Inc. All rights reserved.
Je-Chun-Jun induced apoptosis of human cervical carcinoma HeLa cells

Institute of Scientific and Technical Information of China (English)

Han-jung CHAE; Kyung-mi PARK; Geun-youn LEE; Gi-seup JEONG; Hyung-rae PARK; Hyung-min KIM; Soo-wan CHAE; Shim-keun YOO; Hyung-ryong KIM

2004-01-01

AIM: To study the mechanism of Je-Chun-Jun (JCJ)-inducing the apoptosis of the human cervical carcinoma,HeLa cells. METHODS: The cell viability was assessed using MTT assay. The optical density was measured at 570 nm. The caspase activity was measured using 50 mmol/L of fluorogenic substrate, AC-DEVD-AMC (caspase3), AC-VEID-AMC (caspase-8) or AC-LEHD-AFC (caspase-9). To confirm the expression of proteins, Western blotting was performed. To detect the characteristic of apoptosis chromatin condensation, HeLa cells were stained with Hoechst 33258 in the presence of JCJ. For the cell cycle analysis, HeLa cells were incubated with Propidium iodide (PI) solution. Fluorescence intensity of cell cycle was measured using flow cytometry system. RESULTS:The loss of viability occurred following the exposure of 10 g/L JCJ. Cells treated with 10 g/L JCJ for 3 d exhibited the apoptotic morphology (brightly blue-fluorescent condensed nuclei by Hoechst 33258-staining) and the reduction of cell volume. Cells incubated with JCJ for 48 h were arrested at the G1 phase of cell cycle and their G1 checkpoint related gene products such as cyclin D1 were transiently decreased. We showed that JCJ induced the p38 MAPK activation in HeLa cells. The p38 MAPK inhibitor, SB203580 protected Hela cells from the JCJ-induced death as well as intervened the JCJ-induced accumulation of cells at the G1 phase. In contrast, MEK1 (-ERK upstream) inhibitor, PD98059 had no effect on HeLa cells. CONCLUSION: JCJ induced cell cycle arrest and apoptosis of HeLa cells through p38 MAPK pathway.
The RNA 5 of Prunus necrotic ringspot virus is a biologically inactive copy of the 3'-UTR of the genomic RNA 3.

Science.gov (United States)

Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T

2001-01-01

In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.
Overexpression of microRNA-132 enhances the radiosensitivity of cervical cancer cells by down-regulating Bmi-1.

Science.gov (United States)

Liu, Gui-Feng; Zhang, Shu-Hua; Li, Xue-Feng; Cao, Li-Yan; Fu, Zhan-Zhao; Yu, Shao-Nan

2017-10-06

We examined the effects of microRNA-132 (miR-132) on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A cervical cancer (CC) cells and 104 CC patients. MiR-132 expression was decreased and Bmi-1 expression was increased in tumor tissues compared to adjacent normal tissues and in radiotherapy-resistant patients compared to radiotherapy-sensitive patients. MiR-132 expression and Bmi-1 mRNA expression were also negatively correlated in tumor tissues. HeLa, SiHa, and C33A cells were divided into blank, miR-132 negative control (NC), miR-132 inhibitor, miR-132 mimics, siBmi-1, and miR-132 inhibitor + siBmi-1 groups, after which expression of miR-132 and Bmi-1, and the interaction between them and cell survival, proliferation, and apoptosis were examined. Bmi-1 was confirmed as a target of miRNA-132. Survival was higher and apoptosis lower in the miR-132 inhibitor group than the blank group after various doses of radiation. By contrast, survival was lower and apoptosis higher in the miRNA-132 mimics and siBmi-1 groups than in the blank group. Moreover, miR-132 expression increased and Bmi-1 mRNA expression decreased in each group at radiation doses of 6 and 8 Gy. Finally, co-administration of radiotherapy and exogenous miR-132 inhibited the growth of HeLa cell transplant-induced tumors in nude mice more effectively than radiotherapy alone. These results suggest overexpression of miR-132 enhances the radiosensitivity of CC cells by down-regulating Bmi-1 and that miR-132 may be a useful new target for the treatment of CC.
Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

DEFF Research Database (Denmark)

Dam, M; Douthwaite, S; Tenson, T

1996-01-01

Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...
Effects of TGF-β1 on the Proliferation and Apoptosis of Human Cervical Cancer Hela Cells In Vitro.

Science.gov (United States)

Tao, Ming-Zhu; Gao, Xia; Zhou, Tie-Jun; Guo, Qing-Xi; Zhang, Qiang; Yang, Cheng-Wan

2015-12-01

To investigate the effects of TGF-β1 on the proliferation and apoptosis of cervical cancer Hela cells in vitro. Human cervical cancer Hela cells were cultured in vitro and divided into the experimental and control groups. In the experimental groups, Hela cells were stimulated with different concentrations of TGF-β1 (0.01, 0.1, 1, and 10 ng/mL), while Hela cells cultured in serum-free medium without TGF-β1 were used as controls. The CCK8 method was adopted to detect the effect of TGF-β1 on Hela cell proliferation, and flow cytometry was used to determine cell apoptosis 72 h after TGF-β1 treatment. Compared with the control group, the CCK-8 tests showed that different concentrations of TGF-β1 had no obvious effect on Hela cell proliferation 24 h after treatment (P > 0.05). However, upon 48 or 72 h of treatment, TGF-β1 significantly inhibited the proliferation of Hela cells in a time- and dose-dependent manner (P Hela cells in a dose-dependent manner after 72 h of treatment (P Hela cells in vitro.
γ-irradiation induces radioresistant DNA synthesis in HeLa cells

International Nuclear Information System (INIS)

Synzynys, B.I.; Aminev, A.G.; Konstantinova, S.A.; Saenko, A.S.

1987-01-01

Cells of suspension HeLa culture at the logarithmic phase of growth were exposed to 60 Co-γ-rays (5 Gy), incubated in the nutritious medium, and in 4 h subjected to repeated irradiation: the dose-response function and the dynamics of DNA synthesis inhibition were determined. It was shown that DNA synthesis was inhibited to a lesser extent after preirradiation, in other words, DNA synthesis was radioresistant. A correlation between this synthesis and reproductive cell death is discussed
Extracellular ATP elevates cytoplasmatic free Ca2+ in HeLa cells by the interaction with a 5'-nucleotide receptor

NARCIS (Netherlands)

Smit, M J; Leurs, R; Bloemers, S M; Tertoolen, L G; Bast, A; De Laat, S W; Timmerman, H

1993-01-01

In the present study we have characterized the effects of ATP and several other nucleotides on the intracellular Ca2+ levels of HeLa cells. Using fura-2 microscopy fluorescence measurements, the ATP-mediated increase in intracellular Ca2+ was shown to consist of a rapid rise which decreased after a
Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
IL-8 is upregulated in cervical cancer tissues and is associated with the proliferation and migration of HeLa cervical cancer cells.

Science.gov (United States)

Jia, Linlin; Li, Fengying; Shao, Mingliang; Zhang, Wei; Zhang, Chunbin; Zhao, Xiaolian; Luan, Haiyan; Qi, Yaling; Zhang, Pengxia; Liang, Lichun; Jia, Xiuyue; Zhang, Kun; Lu, Yan; Yang, Zhe; Zhu, Xiulin; Zhang, Qi; Du, Jiwei; Wang, Weiqun

2018-01-01

Interleukin-8 (IL-8) serves an important function in chronic inflammation and cancer development; however, the underlying molecular mechanism(s) of IL-8 in uterine cervical cancer remains unclear. The present study investigated whether IL-8 and its receptors [IL-8 receptor (IL-8R)A and IL-8RB] contributed to the proliferative and migratory abilities of HeLa cervical cancer cells, and also investigated the potential underlying molecular mechanisms. Results demonstrated that IL-8 and its receptors were detected in HeLa cells, and levels of IL-8RA were significantly increased compared with those of IL-8RB. Furthermore, the level of IL-8 in cervical cancer tissues was significantly increased compared with that in normal uterine cervical tissues, and migratory and proliferative efficiencies of HeLa cells treated with exogenous IL-8 were increased, compared with untreated HeLa cells. In addition, exogenous IL-8 was able to downregulate endocytic adaptor protein (NUMB), and upregulate IL-8RA, IL-8RB and extracellular signal-regulated protein kinases (ERKs) expression levels in HeLa cells. Results suggest that IL-8 and its receptors were associated with the tumorigenesis of uterine cervical cancer, and exogenous IL-8 promotes the carcinogenic potential of HeLa cells by increasing the expression levels of IL-8RA, IL-8RB and ERK, and decreasing the expression level of NUMB.
Carbon nanotube-polyamidoamine dendrimer hybrid-modified electrodes for highly sensitive electrochemical detection of microRNA24.

Science.gov (United States)

Li, Fengye; Peng, Jing; Zheng, Qiong; Guo, Xiang; Tang, Hao; Yao, Shouzhuo

2015-01-01

A simple and ultrasensitive microRNA (miRNA) electrochemical biosensor employing multiwalled carbon nanotube (MWCNT)-polyamidoamine (PAMAM) dendrimer and methylene blue (MB) redox indicator is reported in this work. The assay utilizes a glass carbon (GC) electrode modified with MWCNT-PAMAM, on which the oligonucleotide capture probes are immobilized. The electrochemical detection of miRNAs is completed by measuring the reduction signal change of MB before and after the probe hybridization with target miRNA (miRNA24 is used as a model case). The MWCNT-PAMAM/GC electrode shows greatly enhanced signal to MB reduction in contrast to bare GC electrode. The functionalization of MWCNT with PAMAM maintains the electrochemical property of MWCNT to MB reduction but minimizes the undesired adsorption of MB on the MWCNT surface. The effect of experimental variables on the miRNA detection is investigated and optimized. A detection limit of 0.5 fM and a linear peak current density-concentration relationship up to 100 nM are obtained following 60 min hybridization. The proposed assay is successfully used to detect miRNA24 in total RNA sample extracted from HeLa cells.
Altered ganglioside GD3 in HeLa cells might influence the cytotoxic abilities of NK cells

OpenAIRE

Lee, Wen-Chi; Lee, Wen-Ling; Shyong, Wen-Yuann; Yang, Lin-Wei; Ko, Min-Chun; Yeh, Chang-Ching; Edmond Hsieh, Shie-Liang; Wang, Peng-Hui

2012-01-01

Objective: Previously, we found that altered sialidases in HeLa cells in a natural killer-HeLa (NK-HeLa) coculture system contributed to the decreased cytotoxic ability of NK cells. However, changes that occur in the glycosylation of the HeLa cells in the NK-HeLa coculture system remain unknown. Materials and Methods: An NK-HeLa coculture system was used to examine the changes that occur in the gangliosides of HeLa cells. Results: GD3 expression in HeLa cells was significantly increased...
Photodynamic effects induced by meso-tris(pentafluorophenyl)corrole and its cyclodextrin conjugates on cytoskeletal components of HeLa cells.

Science.gov (United States)

Barata, Joana F B; Zamarrón, Alicia; Neves, M Graça P M S; Faustino, M Amparo F; Tomé, Augusto C; Cavaleiro, José A S; Röder, Beate; Juarranz, Ángeles; Sanz-Rodríguez, Francisco

2015-03-06

The aim of this work was to synthesize new corrole β-cyclodextrin conjugates βCD1 (with one β-cyclodextrin moiety) and βCD2 (with two β-cyclodextrin moieties) from 5,10,15-tris(pentafluorophenyl)corrole (TPFC) and to test in vitro the efficacy of these compounds towards tumoral HeLa cells. No dark cytotoxicity was observed for TPFC and βCD1 at the concentration used for PDT cell treatment, even during long incubation periods (24 h). Fluorescence microscopy showed that TPFC and βCD1 accumulate in HeLa cells at lysosomes and in the Golgi apparatus, respectively. The cell survival after the PDT treatment with visible light was dependent on light exposure level and compound concentration. βCD1 was able to penetrate efficiently in the cytoplasm of the HeLa cells. In particular, we have analyzed the photodynamic effect of the corrole derivatives on the microtubules of HeLa cells and the morphological alterations on the mitotic spindle. TPFC and βCD1 caused photocytotoxicity in tumoral HeLa cells and induced a rapid metaphase blockage of cells that also showed clearly altered configurations of the mitotic spindle. The results showed that TPFC has the highest photosensitizing efficiency on tumoral cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria

Czech Academy of Sciences Publication Activity Database

Hnilicová, Jarmila; Jirát-Matějčková, Jitka; Šiková, Michaela; Pospíšil, Jiří; Halada, Petr; Pánek, Josef; Krásný, Libor

2014-01-01

Roč. 42, č. 18 (2014), s. 11763-11776 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GBP305/12/G034; GA ČR GP13-27150P Grant - others:Magistrát hl. m. P.(CZ) CZ.2.16/3.1.00/24023 Institutional support: RVO:61388971 Keywords : ESCHERICHIA-COLI * 6S RNA * NONCODING RNA Subject RIV: EE - Microbiology, Virology Impact factor: 9.112, year: 2014
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

OpenAIRE

Kirpekar, F; Douthwaite, S; Roepstorff, P

2000-01-01

We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...
RNA/DNA Hybrid Interactome Identifies DXH9 as a Molecular Player in Transcriptional Termination and R-Loop-Associated DNA Damage.

Science.gov (United States)

Cristini, Agnese; Groh, Matthias; Kristiansen, Maiken S; Gromak, Natalia

2018-05-08

R-loops comprise an RNA/DNA hybrid and displaced single-stranded DNA. They play important biological roles and are implicated in pathology. Even so, proteins recognizing these structures are largely undefined. Using affinity purification with the S9.6 antibody coupled to mass spectrometry, we defined the RNA/DNA hybrid interactome in HeLa cells. This consists of known R-loop-associated factors SRSF1, FACT, and Top1, and yet uncharacterized interactors, including helicases, RNA processing, DNA repair, and chromatin factors. We validate specific examples of these interactors and characterize their involvement in R-loop biology. A top candidate DHX9 helicase promotes R-loop suppression and transcriptional termination. DHX9 interacts with PARP1, and both proteins prevent R-loop-associated DNA damage. DHX9 and other interactome helicases are overexpressed in cancer, linking R-loop-mediated DNA damage and disease. Our RNA/DNA hybrid interactome provides a powerful resource to study R-loop biology in health and disease. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

The DEAD-Box RNA Helicase DDX3 Interacts with m6A RNA Demethylase ALKBH5

Directory of Open Access Journals (Sweden)

Abdullah Shah

2017-01-01

Full Text Available DDX3 is a member of the family of DEAD-box RNA helicases. DDX3 is a multifaceted helicase and plays essential roles in key biological processes such as cell cycle, stress response, apoptosis, and RNA metabolism. In this study, we found that DDX3 interacted with ALKBH5, an m6A RNA demethylase. The ATP domain of DDX3 and DSBH domain of ALKBH5 were indispensable to their interaction with each other. Furthermore, DDX3 could modulate the demethylation of mRNAs. We also showed that DDX3 regulated the methylation status of microRNAs and there was an interaction between DDX3 and AGO2. The dynamics of m6A RNA modification is still a field demanding further investigation, and here, we add a link by showing that RNA demethylation can be regulated by proteins such as DDX3.
Phosphofructokinase-P Modulates P44/42 MAPK Levels in HeLa Cells.

Science.gov (United States)

Cardim Pires, Thyago Rubens; Albanese, Jamille Mansur; Schwab, Michael; Marette, André; Carvalho, Renato Sampaio; Sola-Penna, Mauro; Zancan, Patricia

2017-05-01

It is known that interfering with glycolysis leads to profound modification of cancer cell proliferation. However, energy production is not the major reason for this correlation. Here, using HeLa cells as a model for cancer, we demonstrate that phosphofructokinase-P (PFK-P), which is overexpressed in diverse types of cancer including HeLa cells, modulates expression of P44/42 mitogen-activated protein kinase (MAPK). Silencing of PFK-P did not alter HeLa cell viability or energy production, including the glycolytic rate. On the other hand, silencing of PFK-P induced the downregulation of p44/42 MAPK, augmenting the sensitivity of HeLa cells to different drugs. Conversely, overexpression of PFK-P promotes the upregulation of p44/42 MAPK, making the cells more resistant to the drugs. These results indicate that overexpression of PFK-P by cancer cells is related to activation of survival pathways via upregulation of MAPK and suggest PFK-P as a promising target for cancer therapy. J. Cell. Biochem. 118: 1216-1226, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

Directory of Open Access Journals (Sweden)

Yao Hailan

2012-08-01

Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.
Auranofin induces apoptosis and necrosis in HeLa cells via oxidative stress and glutathione depletion.

Science.gov (United States)

You, Bo Ra; Shin, Hye Rim; Han, Bo Ram; Kim, Suhn Hee; Park, Woo Hyun

2015-02-01

Auranofin (Au), an inhibitor of thioredoxin reductase, is a known anti‑cancer drug. In the present study, the anti‑growth effect of Au on HeLa cervical cancer cells was examined in association with levels of reactive oxygen species (ROS) and glutathione (GSH). Au inhibited the growth of HeLa cells with an IC50 of ~2 µM at 24 h. This agent induced apoptosis and necrosis, accompanied by the cleavage of poly (ADP‑ribose) polymerase and loss of mitochondrial membrane potential. The pan‑caspase inhibitor, benzyloxycarbonyl‑Val‑Ala‑Asp‑fluoromethylketone, prevented apoptotic cell death and each of the assessed caspase inhibitors inhibited necrotic cell death induced by Au. With respect to the levels of ROS and GSH, Au increased intracellular O2•- in the HeLa cells and induced GSH depletion. The pan‑caspase inhibitor reduced the levels of O2•- and GSH depletion in Au‑treated HeLa cells. The antioxidant, N‑acetyl cysteine, not only attenuated apoptosis and necrosis in the Au‑treated HeLa cells, but also decreased the levels of O2•- and GSH depletion in the cells. By contrast, L‑buthionine sulfoximine, a GSH synthesis inhibitor, intensified cell death O2•- and GSH depletion in the Au‑treated HeLa cells. In conclusion, Au induced apoptosis and necrosis in HeLa cells via the induction of oxidative stress and the depletion of GSH.
MDA5 Detects the Double-Stranded RNA Replicative Form in Picornavirus-Infected Cells

Directory of Open Access Journals (Sweden)

Qian Feng

2012-11-01

Full Text Available RIG-I and MDA5 are cytosolic RNA sensors that play a critical role in innate antiviral responses. Major advances have been made in identifying RIG-I ligands, but our knowledge of the ligands for MDA5 remains restricted to data from transfection experiments mostly using poly(I:C, a synthetic dsRNA mimic. Here, we dissected the IFN-α/β-stimulatory activity of different viral RNA species produced during picornavirus infection, both by RNA transfection and in infected cells in which specific steps of viral RNA replication were inhibited. Our results show that the incoming genomic plus-strand RNA does not activate MDA5, but minus-strand RNA synthesis and production of the 7.5 kbp replicative form trigger a strong IFN-α/β response. IFN-α/β production does not rely on plus-strand RNA synthesis and thus generation of the partially double-stranded replicative intermediate. This study reports MDA5 activation by a natural RNA ligand under physiological conditions.
Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends

Science.gov (United States)

2016-08-24

either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise C...in which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and
sRNAnalyzer-a flexible and customizable small RNA sequencing data analysis pipeline.

Science.gov (United States)

Wu, Xiaogang; Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J; Wang, Kai

2017-12-01

Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline-sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

International Nuclear Information System (INIS)

Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

1977-01-01

The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes
26 S proteasomes function as stable entities

DEFF Research Database (Denmark)

Hendil, Klavs B; Hartmann-Petersen, Rasmus; Tanaka, Keiji

2002-01-01

, shuttles between a free state and the 26-S proteasome, bringing substrate to the complex. However, S5a was not found in the free state in HeLa cells. Besides, all subunits in PA700, including S5a, exchanged at similar low rates. It therefore seems that 26-S proteasomes function as stable entities during...
Human SUV3 helicase regulates growth rate of the HeLa cells and can localize in the nucleoli.

Science.gov (United States)

Szewczyk, Maciej; Fedoryszak-Kuśka, Natalia; Tkaczuk, Katarzyna; Dobrucki, Jurek; Waligórska, Agnieszka; Stępień, Piotr P

2017-01-01

The human SUV3 helicase (SUV3, hSUV3, SUPV3L1) is a DNA/RNA unwinding enzyme belonging to the class of DexH-box helicases. It localizes predominantly in the mitochondria, where it forms an RNA-degrading complex called mitochondrial degradosome with exonuclease PNP (polynucleotide phosphorylase). Association of this complex with the polyA polymerase can modulate mitochondrial polyA tails. Silencing of the SUV3 gene was shown to inhibit the cell cycle and to induce apoptosis in human cell lines. However, since small amounts of the SUV3 helicase were found in the cell nuclei, it was not clear whether the observed phenotypes of SUV3 depletion were of mitochondrial or nuclear origin. In order to answer this question we have designed gene constructs able to inhibit the SUV3 activity exclusively in the cell nuclei. The results indicate that the observed growth rate impairment upon SUV3 depletion is due to its nuclear function(s). Unexpectedly, overexpression of the nuclear-targeted wild-type copies of the SUV3 gene resulted in a higher growth rate. In addition, we demonstrate that the SUV3 helicase can be found in the HeLa cell nucleoli, but it is not detectable in the DNA-repair foci. Our results indicate that the nucleolar-associated human SUV3 protein is an important factor in regulation of the cell cycle.
[miR-25 promotes cell proliferation by targeting RECK in human cervical carcinoma HeLa cells].

Science.gov (United States)

Qiu, Gang; Fang, Baoshuan; Xin, Guohong; Wei, Qiang; Yuan, Xiaoye; Wu, Dayong

2015-01-01

To investigate the effect of miR-25 on the proliferation of human cervical carcinoma HeLa cells and its association with reversion-inducing cysteine-rich protein with Kazal motifs (RECK). The recombinant plasmids of pcDNATM6.2-GW-pre-miR-25, pmirGLO-RECK-WT, pmirGLO-RECK-MT and anti-miR-25 were constructed, and their transfection efficiencies into HeLa cells were identified by real-time quantitative PCR (qRT-PCR). The potential proliferation-stimulating function of miR-25 was analyzed by MTT assay in HeLa cells. Furthermore, the target effect of miR-25 on the RECK was determined by dual-luciferase reporter assay system, qRT-PCR and Western blotting. Sequence analysis demonstrated that the recombinant plasmids of pcDNATM6.2-GW-pre-miR-25 and pmirGLO-RECK-WT, pmirGLO-RECK-MT were successfully constructed, and qRT-PCR revealed that the transfection efficiencies of pre-miR-25 and anti-miR-25 were desirable in HeLa cells. MTT assay showed that miR-25 over-expression promoted the proliferation of HeLa cells. In addition, the luciferase activity was significantly reduced in HeLa cells cotransfected with pre-miR-25 and RECK-WT. The qRT-PCR and Western blotting indicated that the expression level of RECK was up-regulated in HeLa cells transfected with anti-miR-25 at the transcriptional and posttranscriptional levels. miR-25 could promote cell proliferation by targeting RECK in HeLa cells.
Distribution of protein and RNA in the 30S ribosomal subunit

International Nuclear Information System (INIS)

Ramakrishnan, V.

1986-01-01

In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms
Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A

1981-01-01

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....
ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

OpenAIRE

Douet , Julien

2008-01-01

In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...
Radiation-induced thymine base damage and its excision repair in active and inactive chromatin of HeLa cells

International Nuclear Information System (INIS)

Patil, M.S.; Locher, S.E.; Hariharan, P.V.

1985-01-01

The extent of production and excision repair of 5,6-dihydroxydihydrothymine type base (t') damage was determined in transcriptionally active and inactive chromatin of HeLa cells after exposure to 6.8 MeV electrons. It was observed that not only the yield but also rate of repair of t' products was greater in the active chromatin compared to the inactive chromatin of HeLa cells. The results strongly indicate that the conformation of chromatin is an important factor in determining the sensitivity to radiation damage and accessibility to enzymes required for repair of such damage. (author)
Immuno-detection of OCTN1 (SLC22A4) in HeLa cells and characterization of transport function.

Science.gov (United States)

Pochini, Lorena; Scalise, Mariafrancesca; Indiveri, Cesare

2015-11-01

OCTN1 was immuno-detected in the cervical cancer cell HeLa, in which the complete pattern of acetylcholine metabolizing enzymes is expressed. Comparison of immuno-staining intensity of HeLa OCTN1 with the purified recombinant human OCTN1 allowed measuring the specific OCTN1 concentration in the HeLa cell extract and, hence calculating the HeLa OCTN1 specific transport activity that was about 10 nmol×min(-1)×mg protein(-1), measured as uptake of [(3)H]acetylcholine in proteoliposomes reconstituted with HeLa extract. This value was very similar to the specific activity of the recombinant protein. Acetylcholine transport was suppressed by incubation of the protein or proteoliposomes with the anti-OCTN1 antibody and was strongly inhibited by PLP and MTSEA, known inhibitors of OCTN1. The absence of ATP in the internal side of proteoliposomes strongly impaired transport function of both the HeLa and, as expected, the recombinant OCTN1. HeLa OCTN1 was inhibited by spermine, NaCl (Na(+)), TEA, γ-butyrobetaine, choline, acetylcarnitine and ipratropium but not by neostigmine. Besides acetylcholine, choline was taken up by HeLa OCTN1 proteoliposomes. The transporter catalyzed also acetylcholine and choline efflux which, differently from uptake, was not inhibited by MTSEA. Time course of [(3)H]acetylcholine uptake in intact HeLa cells was measured. As in proteoliposomes, acetylcholine transport in intact cells was inhibited by TEA and NaCl. Efflux of [(3)H]acetylcholine occurred in intact cells, as well. The experimental data concur in demonstrating a role of OCTN1 in transporting acetylcholine and choline in HeLa cells. Copyright © 2015 Elsevier B.V. All rights reserved.
HCV RNA traffic and association with NS5A in living cells

Energy Technology Data Exchange (ETDEWEB)

Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia); Betz-Stablein, Brigit; Luciani, Fabio [Systems Immunology, School of Medical Sciences, University of New South Wales, Sydney, NSW (Australia); Chopra, Abha [Institute for Immunology and infectious diseases (IIID), Murdoch University, Perth, WA (Australia); Beard, Michael R., E-mail: michael.beard@adelaide.edu.au [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia)

2016-06-15

The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.
HCV RNA traffic and association with NS5A in living cells

International Nuclear Information System (INIS)

Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie; Betz-Stablein, Brigit; Luciani, Fabio; Chopra, Abha; Beard, Michael R.

2016-01-01

The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.
Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells

Energy Technology Data Exchange (ETDEWEB)

Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H

1988-10-25

DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.

Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

Science.gov (United States)

Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

2018-04-14

To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .
Loss of a putative tumor suppressor locus after gamma-ray-induced neoplastic transformation of HeLa x Skin fibroblast human cell hybrids

International Nuclear Information System (INIS)

Mendonca, M.S.; Redpath, J.L.; Fasching, C.L.

1995-01-01

The nontumorigenic HeLa x skin fibroblast hybrid cell line, CGL1, can be induced to re-express HeLa tumor-associated cell surface antigen, p75-IAP (intestinal alkaline phosphatase), with resulting neoplastic transformation, by exposure to γ radiation. This has allowed the human hybrid system to be developed into a quantitative in vitro model for radiation-induced neoplastic transformation of human cells. Recently, several γ-ray-induced IAP-expression mutants (GIMs) of the nontumorigenic HeLa x skin fibroblast hybrid CGL1 were isolated and all were tumorigenic when injected subcutaneously into nude mice. Control cell lines which were negative for p75-IAP (CONs) were also isolated from irradiated populations, and none were found to be tumorigenic. We have now begun to investigate the molecular basis of radiation-induced neoplastic transformation in this system by studying the potential genetic linkage between p75/IAP expression, tumorigenicity and damage to a putative tumor suppressor locus on fibroblast chromosome 11. Previous analysis of rare spontaneous segregants has indicated that this locus is involved in the regulation of tumorigenicity and in the expression of the HeLa tumor-associated cell surface marker intestinal alkaline phosphatase (p75-IAP) in this system. Therefore, analysis by restriction fragment length polymorphism and chromosome painting have been performed for chromosome 11, and for chromosome 13 as a control, for the p75/IAP-positive GIM and p75/IAP-negative CON cell lines. We report that in five of eight of the GIMs large-scale damage to the fibroblast chromosome 11's is evident (four GIMs have lost one complete copy of a fibroblast chromosome 11 heavily damaged). None of the CONs, however (0/5), have lost a complete copy of either fibroblast chromosome 11. No large-scale damage to the control chromosome 13's was detected in the GIMs or CONs. 49 refs., 3 figs., 2 tabs
Curcumin targeting the thioredoxin system elevates oxidative stress in HeLa cells

International Nuclear Information System (INIS)

Cai, Wenqing; Zhang, Baoxin; Duan, Dongzhu; Wu, Jincai; Fang, Jianguo

2012-01-01

The thioredoxin system, composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH, is ubiquitous in all cells and involved in many redox-dependent signaling pathways. Curcumin, a naturally occurring pigment that gives a specific yellow color in curry food, is consumed in normal diet up to 100 mg per day. This molecule has also been used in traditional medicine for the treatment of a variety of diseases. Curcumin has numerous biological functions, and many of these functions are related to induction of oxidative stress. However, how curcumin elicits oxidative stress in cells is unclear. Our previous work has demonstrated the way by which curcumin interacts with recombinant TrxR1 and alters the antioxidant enzyme into a reactive oxygen species (ROS) generator in vitro. Herein we reported that curcumin can target the cytosolic/nuclear thioredoxin system to eventually elevate oxidative stress in HeLa cells. Curcumin-modified TrxR1 dose-dependently and quantitatively transfers electrons from NADPH to oxygen with the production of ROS. Also, curcumin can drastically down-regulate Trx1 protein level as well as its enzyme activity in HeLa cells, which in turn remarkably decreases intracellular free thiols, shifting the intracellular redox balance to a more oxidative state, and subsequently induces DNA oxidative damage. Furthermore, curcumin-pretreated HeLa cells are more sensitive to oxidative stress. Knockdown of TrxR1 sensitizes HeLa cells to curcumin cytotoxicity, highlighting the physiological significance of targeting TrxR1 by curcumin. Taken together, our data disclose a previously unrecognized prooxidant mechanism of curcumin in cells, and provide a deep insight in understanding how curcumin works in vivo. -- Highlights: ► Curcumin induces oxidative stress by targeting the thioredoxin system. ► Curcumin-modified TrxR quantitatively oxidizes NADPH to generate ROS. ► Knockdown of TrxR1 augments curcumin's cytotoxicity in HeLa cells. ► Curcumin
sRNAnalyzer—a flexible and customizable small RNA sequencing data analysis pipeline

Science.gov (United States)

Kim, Taek-Kyun; Baxter, David; Scherler, Kelsey; Gordon, Aaron; Fong, Olivia; Etheridge, Alton; Galas, David J.

2017-01-01

Abstract Although many tools have been developed to analyze small RNA sequencing (sRNA-Seq) data, it remains challenging to accurately analyze the small RNA population, mainly due to multiple sequence ID assignment caused by short read length. Additional issues in small RNA analysis include low consistency of microRNA (miRNA) measurement results across different platforms, miRNA mapping associated with miRNA sequence variation (isomiR) and RNA editing, and the origin of those unmapped reads after screening against all endogenous reference sequence databases. To address these issues, we built a comprehensive and customizable sRNA-Seq data analysis pipeline—sRNAnalyzer, which enables: (i) comprehensive miRNA profiling strategies to better handle isomiRs and summarization based on each nucleotide position to detect potential SNPs in miRNAs, (ii) different sequence mapping result assignment approaches to simulate results from microarray/qRT-PCR platforms and a local probabilistic model to assign mapping results to the most-likely IDs, (iii) comprehensive ribosomal RNA filtering for accurate mapping of exogenous RNAs and summarization based on taxonomy annotation. We evaluated our pipeline on both artificial samples (including synthetic miRNA and Escherichia coli cultures) and biological samples (human tissue and plasma). sRNAnalyzer is implemented in Perl and available at: http://srnanalyzer.systemsbiology.net/. PMID:29069500
GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

Directory of Open Access Journals (Sweden)

Steffen C. Lott

2018-04-01

Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.
Construction and characterization of poliovirus subgenomic replicons

International Nuclear Information System (INIS)

Kaplan, G.; Racaniello, V.R.

1988-01-01

Poliovirus RNAs containing in-frame deletions within the capsid-coding region were produced by in vitro transcription of altered poliovirus type 1 cDNA by using bacteriophage T7 RNA polymerase. Three RNAs were transcribed that contained deletions of 2,317 nucleotides (bases 747 to 3,064), 1,781 nucleotides (bases 1,175 to 2,956), and 1,295 nucleotides (bases 1,175 to 2,470). All three subgenomic RNAs replicated after transfection into HeLa cells, demonstrating that sequences encoding the capsid polypeptides are not essential for viral RNA replication in vivo. Viral RNA containing the largest deletion (R1) replicated approximately three times better than full-length RNA produced in vitro. Northern blot (RNA blot) hybridization analysis of total cellular RNA from HeLa cells at different times after transfection with R1 demonstrated the presence of increasing amounts of the expected 5.1-kilobase subgenomic RNA. Analysis by immunoprecipitation of [ 35 S-labeled] viral proteins induced after transfection of R1 RNA into HeLa cells revealed the presence of proteins 2A pro , 2C, and 3D pol and its precursors, suggesting that the polyprotein cleavages are similar to those occurring in virus-infected cells. These internally and terminally deleted RNAs inhibited the replication of subgenomic replicons R1, R2, and R3 and caused a reduction in plaque size when cotransfected with P1/Mahoney or P2/Lansing viral RNA, suggesting that individual cells had received both RNAs
Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
Radiosensitizing effect of artesunate on nude mice transplanted with HeLa cells of cervical cancer

International Nuclear Information System (INIS)

Zhou Yuanyuan; Feng Yang; Zhang Xuguang; Zhu Wei; Ni Qianying; Geng Chong; Chen Guanglie; Luo Judong; Fan Saijun; Cao Jianping

2011-01-01

Objective: To investigate the radiosensitization of artesunate on nude mouse transplanted with HeLa cells,and to explore its possible mechanisms. Methods: HeLa cells were inoculated into the nude mice to establish tumor model. Mice were randomly divided into 4 groups as blank control,artesunate group, radiation group and artesunate + radiation group when average volume of tumor were about 5 mm × 5 mm× 5 mm. During the term of treatment, the volume of tumors were measured every 2 days. After 14 days treatment, the mice were killed and tumor tissues were harvested for flow cytometry to detect the alteration of cell cycle. Meanwhile, the pathological change of the tumor tissue was observed with HE staining method, and the change of expression of cycle regulatory protein Cyclin B1, Cdc2 and Wee1 were detected by Western blot. Results: The growth of tumor was significantly inhibited by artesunate combined with radiation and its inhibition rate was 72.34%. Flow cytometry results showed that the percent of cells in G 1 phase increased and G 2 phase decreased in the artesunate + radiation group compared with those in irradiation group (t=4.41, 4.12, P<0.05). The expression level of Cyclin B1 was obviously increased while that of Wee1 decreased in the artesunate + radiation compared with irradiation group. There was no difference in the expression of Cdc2 among the four groups. Conclusions: Artesunate can dramatically increase the radiosensitivity of transplanted tumor of HeLa cells. The possible mechanism might be related to the decreasing G 2 phase by regulating the expression of Cyclin B1 and Wee1. (authors)
A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

Science.gov (United States)

Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

2016-06-01

The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia.
Polydatin inhibits cell proliferation and induces apoptosis in laryngeal cancer and HeLa cells via suppression of the PDGF/AKT signaling pathway.

Science.gov (United States)

Li, Haixia; Shi, Baoyuan; Li, Yanyun; Yin, Fengfang

2017-07-01

Polydatin (PD), a stilbene compound extracted from Polygonum cuspidatum, is suggested to possess anti-cancer activities, including inhibition of cell proliferation, cell cycle arrest, and induction of apoptosis. The platelet-derived growth factor (PDGF)/AKT signaling pathway plays complex roles in tumor suppression. However, the effect of PD on the PDGF/AKT signaling pathway in laryngeal cancer and HeLa cells has not been explored. MTT assay and flow cytometry showed that PD inhibited cell proliferation and induced apoptosis in Hep-2 and AMC-HN-8 cells. Western blot analysis indicated that PD inhibited the expression levels of PDGF-B and phosphorylated AKT (p-AKT) in both cells. Treatment of PDGF-B siRNA or PDGFR inhibitor found that after the PDGF signaling was inactivated, p-AKT expression was significantly decreased in Hep-2 cells. Tumor xenograft experiment in nude mice indicated PD significantly inhibited the growth of Hep-2 cells in vivo. In conclusion, PD inhibited cell proliferation and induced apoptosis in laryngeal cancer and HeLa cells via inactivation of the PDGF/AKT signaling pathway. © 2017 Wiley Periodicals, Inc.
Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
How conserved are the conserved 16S-rRNA regions?

Directory of Open Access Journals (Sweden)

Marcel Martinez-Porchas

2017-02-01

Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.
The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

International Nuclear Information System (INIS)

Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

1989-01-01

The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig
Looking for inhibitors of the dengue virus NS5 RNA-dependent RNA-polymerase using a molecular docking approach

Directory of Open Access Journals (Sweden)

Galiano V

2016-10-01

Full Text Available Vicente Galiano,1 Pablo Garcia-Valtanen,2 Vicente Micol,3,4 José Antonio Encinar3 1Physics and Computer Architecture Department, Miguel Hernández University (UMH, Elche, Spain; 2Experimental Therapeutics Laboratory, Hanson and Sansom Institute for Health Research, School of Pharmacy and Medical Science, University of South Australia, Adelaide, Australia; 3Molecular and Cell Biology Institute, Miguel Hernández University (UMH, Elche, Spain; 4CIBER: CB12/03/30038, Physiopathology of the Obesity and Nutrition, CIBERobn, Instituto de Salud Carlos III, Palma de Mallorca, Spain Abstract: The dengue virus (DENV nonstructural protein 5 (NS5 contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <-10.5 kcal/mol were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo. Keywords: virtual screening, molecular
MicroRNA-124 slows down the progression of Huntington′s disease by promoting neurogenesis in the striatum

Directory of Open Access Journals (Sweden)

Tian Liu

2015-01-01

Full Text Available MicroRNA-124 contributes to neurogenesis through regulating its targets, but its expression both in the brain of Huntington′s disease mouse models and patients is decreased. However, the effects of microRNA-124 on the progression of Huntington′s disease have not been reported. Results from this study showed that microRNA-124 increased the latency to fall for each R6/2 Huntington′s disease transgenic mouse in the rotarod test. 5-Bromo-2′-deoxyuridine (BrdU staining of the striatum shows an increase in neurogenesis. In addition, brain-derived neurotrophic factor and peroxisome proliferator-activated receptor gamma coactivator 1-alpha protein levels in the striatum were increased and SRY-related HMG box transcription factor 9 protein level was decreased. These findings suggest that microRNA-124 slows down the progression of Huntington′s disease possibly through its important role in neuronal differentiation and survival.
Characterization of S-Phase Specific BRCA1-Containing Complex

National Research Council Canada - National Science Library

You, Fanglei

2003-01-01

...), was observed in HeLa and in 293 cells. Hydroxyurea treatment of cells results in the reduction of BRCA1 content in the RNA polymerase II holoenzyme complex with a complementary increase in the HUIC...
Characterization of S-Phase Specific BRCA1-Containing Complex

National Research Council Canada - National Science Library

Chiba, Natsuko

2002-01-01

...), was observed in HeLa and in 293 cells. Hydroxyurea treatment of cells results in the reduction of BRCA1 content in the RNA polymerase II holoenzyme complex with a complementary increase in the HUIC...
Dissociation of histone and DNA synthesis in x-irradiated HeLa cells

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.

1971-01-01

Although histone synthesis and DNA synthesis are normally very well coordinated in HeLa cells, their histone synthesis proved relatively resistant to inhibition by ionizing radiation. During the first 24 h after 1,000 R the rate of cellular DNA synthesis progressively fell to small fractions of control values while histone synthesis with much less relative reduction. Acrylamide gel electropherograms of the acid soluble nuclear histones synthesized by irradiated HeLa cells were qualitatively normal
Effects of DNA polymerase inhibitors on replicative and repair DNA synthesis in ultraviolet-irradiated HeLa cells

International Nuclear Information System (INIS)

Morita, T.; Nakamura, H.; Tsutsui, Y.; Nishiyama, Y.; Yoshida, S.

1982-01-01

Aphidicolin specifically inhibits eukaryotic DNA polymerase α, while 2',3'-dideoxythymidine 5'-triphosphate (d 2 TTP) inhibits DNA polymerase ν and ν but not α. 1-ν-D-Arabinofuranosylcytosine 5'-triphosphate (araCTP) inhibits both DNA polymerase α and ν although to a different extent. Here we measured the effects of these inhibitors on repair DNA synthesis of U.V.-irradiated HeLa cells by two different methods. Firstly, aphidicolin, 1-ν-D-arabinofuranosylcytosine (araC, a precursor of araCTP) and 2',3'-dideoxythimidine (d 2 Thd, a precursor of d 2 TTP) were added directly to the culture medium. In this case, aphidicolin and araC strongly inhibited replicative DNA synthesis of HeLa cells, and they also inhibited repair synthesis after U.V.-irradiation but to a much lesser extent. In contrast, high concentrations of d 2 Thd inhibited repair DNA synthesis to a higher extent than replicative DNA synthesis. Secondly, the active form of inhibitor, d 2 TTP, was microinjected directly into cytoplasm or nuclei or U.V.-irradiated HeLa cells. Microinjection of d 2 TTP effectively inhibited repair synthesis. The microinjection of d 2 TTP, into either cytoplasm or nucleus, strongly inhibited replicative synthesis. These results might indicate that multiple DNA polymerases are involved in repair synthesis as well as in replicative synthesis
Nuclear Export of Pre-Ribosomal Subunits Requires Dbp5, but Not as an RNA-Helicase as for mRNA Export.

Science.gov (United States)

Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike

2016-01-01

The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.

PAI-1 mRNA expression and plasma level in rheumatoid arthritis: relationship with 4G/5G PAI-1 polymorphism.

Science.gov (United States)

Muñoz-Valle, José Francisco; Ruiz-Quezada, Sandra Luz; Oregón-Romero, Edith; Navarro-Hernández, Rosa Elena; Castañeda-Saucedo, Eduardo; De la Cruz-Mosso, Ulises; Illades-Aguiar, Berenice; Leyva-Vázquez, Marco Antonio; Castro-Alarcón, Natividad; Parra-Rojas, Isela

2012-12-01

Rheumatoid arthritis (RA) is a chronic inflammatory disease affecting the synovial membrane, cartilage and bone. PAI-1 is a key regulator of the fibrinolytic system through which plasminogen is converted to plasmin. The plasmin activates the matrix metalloproteinase system, which is closely related with the joint damage and bone destruction in RA. The aim of this study was to investigate the relationship between 4G/5G PAI-1 polymorphism with mRNA expression and PAI-1 plasma protein levels in RA patients. 113 RA patients and 123 healthy subjects (HS) were included in the study. The 4G/5G PAI-1 polymorphism was determined by polymerase chain reaction-restriction fragment length polymorphism method; the PAI-1 mRNA expression was determined by real-time PCR; and the soluble PAI-1 (sPAI-1) levels were quantified using an ELISA kit. No significant differences in the genotype and allele frequencies of 4G/5G PAI-1 polymorphism were found between RA patients and HS. However, the 5G/5G genotype was the most frequent in both studied groups: RA (42%) and HS (44%). PAI-1 mRNA expression was slightly increased (0.67 fold) in RA patients with respect to HS (P = 0.0001). In addition, in RA patients, the 4G/4G genotype carriers showed increased PAI-1 mRNA expression (3.82 fold) versus 4G/5G and 5G/5G genotypes (P = 0.0001), whereas the sPAI-1 plasma levels did not show significant differences. Our results indicate that the 4G/5G PAI-1 polymorphism is not a marker of susceptibility in the Western Mexico. However, the 4G/4G genotype is associated with high PAI-1 mRNA expression but not with the sPAI-1 levels in RA patients.
Pravastatin and simvastatin inhibit the adhesion, replication and proliferation of Toxoplasma gondii (RH strain) in HeLa cells.

Science.gov (United States)

Sanfelice, Raquel Arruda; da Silva, Suelen Santos; Bosqui, Larissa Rodrigues; Miranda-Sapla, Milena Menegazzo; Barbosa, Bellisa Freitas; Silva, Rafaela José; Ferro, Eloísa A Vieira; Panagio, Luciano Aparecido; Navarro, Italmar Teodorico; Bordignon, Juliano; Conchon-Costa, Ivete; Pavanelli, Wander Rogerio; Almeida, Ricardo Sergio; Costa, Idessania Nazareth

2017-03-01

The conventional treatment for toxoplasmosis with pyrimethamine and sulfadiazine shows toxic effects to the host, and it is therefore necessary to search for new drugs. Some studies suggest the use of statins, which inhibit cholesterol synthesis in humans and also the initial processes of isoprenoid biosynthesis in the parasite. Thus, the objective of this study was to evaluate the activity of the statins pravastatin and simvastatin in HeLa cells infected in vitro with the RH strain of T. gondii. HeLa cells (1×10 5 ) were infected with T. gondii tachyzoites (5×10 5 ) following two different treatment protocols. In the first protocol, T. gondii tachyzoites were pretreated with pravastatin (50 and 100μg/mL) and simvastatin (1.56 and 3.125μg/mL) for 30min prior to infection. In the second, HeLa cells were first infected (5×10 5 ) with tachyzoites and subsequently treated with pravastatin and simvastatin for 24h at the concentrations noted above. Initially, we evaluated the cytotoxicity of drugs by the MTT assay, number of tachyzoites adhered to cells, number of infected cells, and viability of tachyzoites by trypan blue exclusion. The supernatant of the cell cultures was collected post-treatment for determination of the pattern of Th1/Th2/Th17 cytokines by cytometric bead array. There was no cytotoxicity to HeLa cells with 50 and 100μg/mL pravastatin and 1.56 and 3.125μg/mL simvastatin. There was no change in the viability of tachyzoites that received pretreatment. Regarding the pre- and post-treatment of the cells with pravastatin and simvastatin alone, there was a reduction in adhesion, invasion and proliferation of cells to T. gondii. As for the production of cytokines, we found that IL-6 and IL-17 were significantly reduced in cells infected with T. gondii and treated with pravastatin and simvastatin, when compared to control. Based on these results, we can infer that pravastatin and simvastatin alone possess antiproliferative effects on tachyzoites forms
Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

Science.gov (United States)

Wu, H; Zhang, J; Shi, H

2016-01-01

Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.
Icotinib hydrochloride enhances chemo- and radiosensitivity by inhibiting EGFR signaling and attenuating RAD51 expression and function in Hela S3 cells

Directory of Open Access Journals (Sweden)

Wang X

2018-03-01

Full Text Available Xuanxuan Wang, Yanjun Gu, Hai Liu, Liming Shi, Xiaonan Sun Department of Radiation Oncology, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University, Hangzhou, China Background: Radiotherapy and cisplatin-based chemotherapy are currently considered as standard treatments employed for advanced cervical cancer (CC. However, patients with local recurrence or distant metastasis continue to have poor outcomes. EGFR overexpression correlated with chemo/radioresistance, and disease failure has been well proved in the previous studies. Hence, the aim of this study was to explore the therapeutic efficacy and underlying mechanism of the sensitization to radiation or cisplatin of icotinib hydrochloride (IH, a high-selective EGFR tyrosine kinase inhibitor (TKI, in the Hela S3 human CC cell line.Methods: Cell proliferation was measured with cell counting kit-8 (CCK-8 assay. Flow cytometry analysis was performed to examine cell cycle distribution and apoptosis. The phosphorylation of EGFR and its downstream signaling molecules were measured by Western blot analysis. γ-H2AX foci and RAD51 foci in the cellular nucleus were visualized using immunofluoresence staining. Expression levels of RAD51 in the whole cells and subceullar fractions were detected to demonstrate the impact of IH on DNA repair. Results: IH can significantly inhibit cell proliferation, redistribute cell cycle, enhance apoptosis and impair DNA damage response of Hela S3 cells following radiation or cisplatin treatment through suppressing the activation of the EGFR signaling pathway and attenuating the expression and function of homologous recombination (HR protein RAD51.Conclusion: This study suggests that IH is a potential sensitizer in radiotherapy and cisplatin-based chemotherapy for CC and RAD51 may serve as a prognosis biomarker for this combination treatment. Keywords: icotinib hydrochloride, cervical cancer, EGFR, radiotherapy, chemotherapy
Cytotoxic effects of Pinus eldarica essential oil and extracts on HeLa and MCF-7 cell lines.

Science.gov (United States)

Sarvmeili, Najmeh; Jafarian-Dehkordi, Abbas; Zolfaghari, Behzad

2016-12-01

Several attempts have so far been made in the search of new anticancer agents of plant origin. Some studies have reported that different species of Pine genus possess cytotoxic activities against various cancer cell lines. In the present study, we evaluated the cytotoxic effects of Pinus eldarica bark and leaf extracts or leaf essential oil on HeLa and MCF-7 tumor cell lines. Hydroalcoholic and phenolic extracts and the essential oil of plant were prepared. Total phenolic contents of the extracts were measured using Folin-Ciocalteu reagent. Essential oil components were determined by gas chromatography-mass spectroscopy (GC-MS). Cytotoxic activity of the extracts and essential oil against HeLa and MCF-7 tumor cell lines were assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. The polyphenolic content of hydroalcoholic and phenolic extracts of the bark and hydroalcoholic extract of the leaf were 48.31%, 47.2%, and 8.47%, respectively. According to the GC-MS analysis, the major components of the leaf oil of P. eldarica were: β -caryophyllene (14.8%), germacrene D (12.9%), α-terpinenyl acetate (8.15%), α -pinene (5.7%), and -α humulene (5.9%). Bark extracts and leaf essential oil of P. eldarica significantly reduced the viability of both HeLa and MCF-7 cells in a concentration dependent manner. However, leaf extract showed less inhibitory effects against both cell lines. The essential oil of P. eldarica was more cytotoxic than its hydroalcoholic and phenolic extracts. The terpenes and phenolic compounds were probably responsible for cytotoxicity of P. eldarica . Therefore, P. eldarica might have a good potential for active anticancer agents.
In vitro studies on radiosensitization effect of glucose capped gold nanoparticles in photon and ion irradiation of HeLa cells

International Nuclear Information System (INIS)

Kaur, Harminder; Pujari, Geetanjali; Semwal, Manoj K.; Sarma, Asitikantha; Avasthi, Devesh Kumar

2013-01-01

Highlights: ► Glucose capped gold nanoparticles (Glu-AuNPs) are synthesized for internalization in HeLa cells (cervical cancer cells). ► Internalization of Glu-AuNPs in HeLa cells is confirmed by cross section TEM of cells. ► Irradiation (by C ion or γ-rays) of HeLa cells with internalized Glu-AuNPs results in enhanced radiosensitization. ► There is about 30% reduction in radiation dose for 90% cell killing of HeLa cells, when internalized by Glu-AuNPs. ► The enhanced radiosensitization due to Glu-AuNPs is of interest for researchers in nanobiotechnology and radiation biology. -- Abstract: Noble metal nanoparticles are of great interest due to their potential applications in diagnostics and therapeutics. In the present work, we synthesized glucose capped gold nanoparticle (Glu-AuNP) for internalization in the HeLa cell line (human cervix cancer cells). The capping of glucose on Au nanoparticle was confirmed by Raman spectroscopy. The Glu-AuNP did not show any toxicity to the HeLa cell. The γ-radiation and carbon ion irradiation of HeLa cell with and without Glu-AuNP were performed to evaluate radiosensitization effects. The study revealed a significant reduction in radiation dose for killing the HeLa cells with internalized Glu-AuNPs as compared to the HeLa cells without Glu-AuNP. The Glu-AuNP treatment resulted in enhancement of radiation effect as evident from increase in relative biological effectiveness (RBE) values for carbon ion irradiated HeLa cells
Biological response of HeLa cells to gold nanoparticles coated with organic molecules.

Science.gov (United States)

Cardoso Avila, P E; Rangel Mendoza, A; Pichardo Molina, J L; Flores Villavicencio, L L; Castruita Dominguez, J P; Chilakapati, M K; Sabanero Lopez, M

2017-08-01

In this work, gold nanospheres functionalized with low weight organic molecules (4-aminothiphenol and cysteamine) were synthesized in a one-step method for their in vitro cytotoxic evaluation on HeLa cells. To enhance the biocompatibility of the cysteamine-capped GNPs, BSA was used due to its broad PH stability and high binding affinity to gold nanoparticles. Besides, the widely reported silica coated gold nanorods were tested here to contrast their toxic response against our nanoparticles coated with organic molecules. Our results shown, the viability measured at 1.9×10 -5 M did not show significant differences against negative controls for all the samples; however, the metabolic activity of HeLa cells dropped when they were exposed to silica gold nanorods in the range of concentrations from 2.9×10 -7 M to 3.0×10 -4 M, while in the cases of gold nanospheres, we found that only at concentrations below 1.9×10 -5 M metabolic activity was normal. Our preliminary results did not indicate any perceivable harmful toxicity to cell membrane, cytoskeleton or nucleus due to our nanospheres at 1.9×10 -5 M. Additional test should be conducted in order to ensure a safe use of them for biological applications, and to determine the extent of possible damage. Copyright © 2017 Elsevier Ltd. All rights reserved.
[Production effect comparison of SEPP and GPx between HepG2 and Hela cells with different selenocompounds].

Science.gov (United States)

Wang, Qin; Gao, Lina; Han, Feng; Lu, Jiaxi; Liu, Yiqun; Sun, Licui; Huang, Zhenwu

2016-03-01

To compare the effect of several selenocompounds on the productions of SEPP and GPx in HepG2 and Hela cells. The cultured HepG2 and Hela cells were divided into the control, Na2SeO3, SeMet and MeSeCys groups. After adding the selected selenocompounds (with the respective concentration 0.01 and 0.1 μmol/L), the experimental groups were then incubated for 48 h and 72 h. Finally, the cell culture supernatants and homogenates were collected for the SEPP and GPx concentrations detection by a double-antibody sandwich enyme-linked immuno-sorbent-assay (ELISA). The SEPP and GPx concentrations in Hela cells treated with 0.1 μmol/L SeMet and MeSeCys were significantly higher than that in the control group (P cell treated with 0.1 μmol/L selenocompounds were significantly higher than that in Hela cells (P cells are more beneficial to the production of selenoproteins than Hela cells.
Effect of secondary compounds in forages on rumen micro-organisms quantified by 16S and 18S rRNA

International Nuclear Information System (INIS)

Wina, E.; Muetzel, S.; Hoffman, E.; Becker, K.; Makkar, H.P.S.

2005-01-01

A gas syringe method was used to evaluate the effect of secondary compounds from plant materials on in vitro fermentation products and microbial biomass. The experiment used Pennisetum purpureum, Morinda citrifolia fruit, Nothopanax scutellarium leaves, Sesbania sesban LS (low saponins type), Sesbania sesban HS (high saponins type) and Sapindus rarak fruit as substrates. The incubation was conducted with and without polyethylene glycol 6000 (PEG) addition for 24 hours. Gas production and short-chain fatty acids (SCFA) were analysed. Prokaryotic and eukaryotic concentrations were measured by quantifying 16S and 18S rRNA. The percentage increase in gas production due to PEG was very small (<5%) for all plant materials, which indicated that the biological effect of tannin in these plant materials is limited. TLC analysis revealed that all materials contained saponin, but only S. rarak, followed by S. sesban, contained a high diversity of saponins. S. sesban gave the highest (234 ml/g) while S. rarak gave the lowest gas production (115 ml/g). S. rarak gave the lowest SCFA production (3.57 mmole/g) and also the lowest ratio of acetate to propionate (1.76), indicating a change in pattern of SCFA production. Total elimination of eukaryotic concentration was evident from the absence of the 18S rRNA band when S. rarak and S. sesban were used as sole substrates. S. rarak also reduced the prokaryotic concentration. To use S. rarak as a defaunating agent without affecting prokaryotes, a crude saponin extract was prepared from S. rarak for further experiment. Different concentrations of crude saponins in a methanol extract of S. rarak fruit dissolved in rumen buffer were added to a substrate consisting of elephant grass and wheat bran (7:3 w/w). Microbial biomass yield was quantified by gravimetry and using rRNA as a marker. Addition of crude saponin extract from S. rarak to a high-roughage diet increased microbial biomass (MB) yield to 1.07 and 1.14 times MB yield of the
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
Inhibition of EGFR nuclear shuttling decreases irradiation resistance in HeLa cells.

Science.gov (United States)

Wei, Hong; Zhu, Zijie; Lu, Longtao

2017-01-01

Cervical cancer is a leading cause of mortality in women worldwide. The resistance to irradiation at the advanced stage is the main reason for the poor prognosis and high mortality. This work aims to elucidate the molecular mechanism underlying the radio-resistance. In this study, we determined the pEGFR-T654 and pDNA-PK-T2609 expression level changes in irradiated HeLa cells treated with T654 peptide, a nuclear localization signal (NLS) inhibitor, to inhibit EGFR nuclear transport. Cell viability, cell cycle and migratory capacity were analyzed. Xenograft animal model was used to evaluate the effect of EGFR nuclear transport inhibition on the tumor growth in vivo. The enhanced translocation of nuclear EGFR in the irradiated HeLa cells correlated with the increasing level of pEGFR-T654 and pDNA-PK-T2609. Inhibition of EGFR nuclear translocation by NLS peptide inhibitor attenuated DNA damage repair in the irradiated HeLa cells, decreased cell viability and promoted cell death through arrest at G0 phase. NLS peptide inhibitor impaired the migratory capacity of irradiated HeLa cells, and negatively affected tumorigenesis in xenograft mice. This work puts forward a potential molecular mechanism of the irradiation resistance in cervical cancer cells, providing a promising direction towards an efficient therapy of cervical cancer.
Human UBL5 protein interacts with coilin and meets the Cajal bodies

International Nuclear Information System (INIS)

Švéda, Martin; Častorálová, Markéta; Lipov, Jan; Ruml, Tomáš; Knejzlík, Zdeněk

2013-01-01

Highlights: •Localization of the UBL5 protein in Hela cells was determined by fluorescence microscopy and biochemical fractionation. •Colocalization of UBL5 with Cajal bodies was observed. •Interaction of UBL5 with coilin was proven by pull-down. -- Abstract: UBL5 protein, a structural homologue of ubiquitin, was shown to be involved in pre-mRNA splicing and transcription regulation in yeast and Caenorhabditis elegans, respectively. However, role of the UBL5 human orthologue is still elusive. In our study, we observed that endogenous human UBL5 that was localized in the nucleus, partially associates with Cajal bodies (CBs), nuclear domains where spliceosomal components are assembled. Simultaneous expression of exogenous UBL5 and coilin resulted in their nuclear colocalization in HeLa cells. The ability of UBL5 to interact with coilin was proved by GST pull-down assay using coilin that was either in vitro translated or extracted from HEK293T cells. Further, our results showed that the UBL5–coilin interaction was not influenced by coilin phosphorylation. These results suggest that UBL5 could be targeted to CBs via its interaction with coilin. Relation between human UBL5 protein and CBs is in the agreement with current observations about yeast orthologue Hub1 playing important role in alternative splicing
Human UBL5 protein interacts with coilin and meets the Cajal bodies

Energy Technology Data Exchange (ETDEWEB)

Švéda, Martin; Častorálová, Markéta; Lipov, Jan; Ruml, Tomáš; Knejzlík, Zdeněk, E-mail: knejzliz@vscht.cz

2013-06-28

Highlights: •Localization of the UBL5 protein in Hela cells was determined by fluorescence microscopy and biochemical fractionation. •Colocalization of UBL5 with Cajal bodies was observed. •Interaction of UBL5 with coilin was proven by pull-down. -- Abstract: UBL5 protein, a structural homologue of ubiquitin, was shown to be involved in pre-mRNA splicing and transcription regulation in yeast and Caenorhabditis elegans, respectively. However, role of the UBL5 human orthologue is still elusive. In our study, we observed that endogenous human UBL5 that was localized in the nucleus, partially associates with Cajal bodies (CBs), nuclear domains where spliceosomal components are assembled. Simultaneous expression of exogenous UBL5 and coilin resulted in their nuclear colocalization in HeLa cells. The ability of UBL5 to interact with coilin was proved by GST pull-down assay using coilin that was either in vitro translated or extracted from HEK293T cells. Further, our results showed that the UBL5–coilin interaction was not influenced by coilin phosphorylation. These results suggest that UBL5 could be targeted to CBs via its interaction with coilin. Relation between human UBL5 protein and CBs is in the agreement with current observations about yeast orthologue Hub1 playing important role in alternative splicing.
Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

Directory of Open Access Journals (Sweden)

Seyed Bagher Mosavi-Azam

2008-10-01

Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25Ã‚ÂºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.
Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

Science.gov (United States)

Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

2008-10-31

A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.
Beet Necrotic Yellow Vein Virus Noncoding RNA Production Depends on a 5′→3′ Xrn Exoribonuclease Activity

Directory of Open Access Journals (Sweden)

Alyssa Flobinus

2018-03-01

Full Text Available The RNA3 species of the beet necrotic yellow vein virus (BNYVV, a multipartite positive-stranded RNA phytovirus, contains the ‘core’ nucleotide sequence required for its systemic movement in Beta macrocarpa. Within this ‘core’ sequence resides a conserved “coremin” motif of 20 nucleotides that is absolutely essential for long-distance movement. RNA3 undergoes processing steps to yield a noncoding RNA3 (ncRNA3 possessing “coremin” at its 5′ end, a mandatory element for ncRNA3 accumulation. Expression of wild-type (wt or mutated RNA3 in Saccharomyces cerevisiae allows for the accumulation of ncRNA3 species. Screening of S. cerevisiae ribonuclease mutants identified the 5′-to-3′ exoribonuclease Xrn1 as a key enzyme in RNA3 processing that was recapitulated both in vitro and in insect cell extracts. Xrn1 stalled on ncRNA3-containing RNA substrates in these decay assays in a similar fashion as the flavivirus Xrn1-resistant structure (sfRNA. Substitution of the BNYVV-RNA3 ‘core’ sequence by the sfRNA sequence led to the accumulation of an ncRNA species in yeast in vitro but not in planta and no viral long distance occurred. Interestingly, XRN4 knockdown reduced BNYVV RNA accumulation suggesting a dual role for the ribonuclease in the viral cycle.
The RNA-binding protein HOS5 and serine/arginine-rich proteins RS40 and RS41 participate in miRNA biogenesis in Arabidopsis

KAUST Repository

Chen, Tao

2015-07-30

MicroRNAs are a class of small regulatory RNAs that are generated from primary miRNA (pri-miRNA) transcripts with a stem-loop structure. Accuracy of the processing of pri-miRNA into mature miRNA in plants can be enhanced by SERRATE (SE) and HYPONASTIC LEAVES 1 (HYL1). HYL1 activity is regulated by the FIERY2 (FRY2)/RNA polymerase II C-terminal domain phosphatase-like 1 (CPL1). Here, we discover that HIGH OSMOTIC STRESS GENE EXPRESSION 5 (HOS5) and two serine/arginine-rich splicing factors RS40 and RS41, previously shown to be involved in pre-mRNA splicing, affect the biogenesis of a subset of miRNA. These proteins are required for correct miRNA strand selection and the maintenance of miRNA levels. FRY2 dephosphorylates HOS5 whose phosphorylation status affects its subnuclear localization. HOS5 and the RS proteins bind both intronless and intron-containing pri-miRNAs. Importantly, all of these splicing-related factors directly interact with both HYL1 and SE in nuclear splicing speckles. Our results indicate that these splicing factors are directly involved in the biogenesis of a group of miRNA.
Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

Science.gov (United States)

Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

2015-10-08

Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.
High throughput 16S rRNA gene amplicon sequencing

DEFF Research Database (Denmark)

Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
The influence of pH on the excision of UV-photoproducts from HeLa cells

International Nuclear Information System (INIS)

Masek, F.; Hochmann, J.; Duraj, J.

1977-01-01

Excision of pyrimidine dimers with pH decreasing in UV irradiated HeLa cells can be depressed. This depression is independent of the UV dose within the investigated range. The excision capacity of the HeLa repair system from absolute amount of excised dimers is shown. (author)

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

Science.gov (United States)

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

Science.gov (United States)

Spirin, Alexander S

2009-11-17

A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Mycobacterium smegmatis HelY Is an RNA-Activated ATPase/dATPase and 3'-to-5' Helicase That Unwinds 3'-Tailed RNA Duplexes and RNA:DNA Hybrids.

Science.gov (United States)

Uson, Maria Loressa; Ordonez, Heather; Shuman, Stewart

2015-10-01

Mycobacteria have a large and distinctive ensemble of DNA helicases that function in DNA replication, repair, and recombination. Little is known about the roster of RNA helicases in mycobacteria or their roles in RNA transactions. The 912-amino-acid Mycobacterium smegmatis HelY (MSMEG_3885) protein is a bacterial homolog of the Mtr4 and Ski2 helicases that regulate RNA 3' processing and turnover by the eukaryal exosome. Here we characterize HelY as an RNA-stimulated ATPase/dATPase and an ATP/dATP-dependent 3'-to-5' helicase. HelY requires a 3' single-strand RNA tail (a loading RNA strand) to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The findings that HelY ATPase is unresponsive to a DNA polynucleotide cofactor and that HelY is unable to unwind a 3'-tailed duplex in which the loading strand is DNA distinguish HelY from other mycobacterial nucleoside triphosphatases/helicases characterized previously. The biochemical properties of HelY, which resemble those of Mtr4/Ski2, hint at a role for HelY in mycobacterial RNA catabolism. RNA helicases play crucial roles in transcription, RNA processing, and translation by virtue of their ability to alter RNA secondary structure or remodel RNA-protein interactions. In eukarya, the RNA helicases Mtr4 and Ski2 regulate RNA 3' resection by the exosome. Mycobacterium smegmatis HelY, a bacterial homolog of Mtr4/Ski2, is characterized here as a unidirectional helicase, powered by RNA-dependent ATP/dATP hydrolysis, that tracks 3' to 5' along a loading RNA strand to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The biochemical properties of HelY suggest a role in bacterial RNA transactions. HelY homologs are present in pathogenic mycobacteria (e.g., M. tuberculosis and M. leprae) and are widely prevalent in Actinobacteria and Cyanobacteria but occur sporadically elsewhere in the bacterial domain. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Mobility of tethering factor EEA1 on endosomes is decreased upon stimulation of EGF receptor endocytosis in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Kosheverova, Vera V., E-mail: kosheverova_vera@incras.ru [Institute of Cytology of RAS, 4, Tikhoretsky Ave, St. Petersburg, 194064 (Russian Federation); Kamentseva, Rimma S., E-mail: rkamentseva@yandex.ru [Institute of Cytology of RAS, 4, Tikhoretsky Ave, St. Petersburg, 194064 (Russian Federation); St. Petersburg State University, 7-9, Universitetskaya nab, St. Petersburg, 199034 (Russian Federation); Gonchar, Ilya V., E-mail: ample@mail.ru [Institute of Cytology of RAS, 4, Tikhoretsky Ave, St. Petersburg, 194064 (Russian Federation); Kharchenko, Marianna V., E-mail: mariannakharchenko@gmail.com [Institute of Cytology of RAS, 4, Tikhoretsky Ave, St. Petersburg, 194064 (Russian Federation); Kornilova, Elena S., E-mail: lenkor@mail.cytspb.rssi.ru [Institute of Cytology of RAS, 4, Tikhoretsky Ave, St. Petersburg, 194064 (Russian Federation); St. Petersburg State University, 7-9, Universitetskaya nab, St. Petersburg, 199034 (Russian Federation); Department of Medical Physics, Peter the Great St. Petersburg Polytechnic University, 29, Polytechnicheskaya, St.Petersburg, 195251 (Russian Federation)

2016-04-22

Tethering factor EEA1, mediating homotypic fusion of early endosomes, was shown to be localized in membrane-bound state both in serum-deprived and stimulated for EGF receptor endocytosis cells. However, it is not known whether dynamics behavior of EEA1 is affected by EGF stimulation. We investigated EEA1 cytosol-to-membrane exchange rate in interphase HeLa cells by FRAP analysis. The data obtained fitted two-states binding model, with the bulk of membrane-associated EEA1 protein represented by the mobile fraction both in serum-starved and EGF-stimulated cells. Fast recovery state had similar half-times in the two cases: about 1.6 s and 2.8 s, respectively. However, the recovery half-time of slowly cycled EEA1 fraction significantly increased in EGF-stimulated comparing to serum-starved cells (from 21 to 99 s). We suppose that the retardation of EEA1 fluorescence recovery upon EGF-stimulation may be due to the increase of activated Rab5 on endosomal membranes, the growth of the number of tethering events between EEA1-positive vesicles and their clustering. - Highlights: • EEA1 mobility was compared in serum-starved and EGF-stimulated interphase HeLa cells. • FRAP analysis revealed fast and slow components of EEA1 recovery in both cases. • Stimulation of EGFR endocytosis did not affect fast EEA1 turnover. • EGF stimulation significantly increased half-time of slowly exchanged EEA1 fraction.
Mobility of tethering factor EEA1 on endosomes is decreased upon stimulation of EGF receptor endocytosis in HeLa cells

International Nuclear Information System (INIS)

Kosheverova, Vera V.; Kamentseva, Rimma S.; Gonchar, Ilya V.; Kharchenko, Marianna V.; Kornilova, Elena S.

2016-01-01

Tethering factor EEA1, mediating homotypic fusion of early endosomes, was shown to be localized in membrane-bound state both in serum-deprived and stimulated for EGF receptor endocytosis cells. However, it is not known whether dynamics behavior of EEA1 is affected by EGF stimulation. We investigated EEA1 cytosol-to-membrane exchange rate in interphase HeLa cells by FRAP analysis. The data obtained fitted two-states binding model, with the bulk of membrane-associated EEA1 protein represented by the mobile fraction both in serum-starved and EGF-stimulated cells. Fast recovery state had similar half-times in the two cases: about 1.6 s and 2.8 s, respectively. However, the recovery half-time of slowly cycled EEA1 fraction significantly increased in EGF-stimulated comparing to serum-starved cells (from 21 to 99 s). We suppose that the retardation of EEA1 fluorescence recovery upon EGF-stimulation may be due to the increase of activated Rab5 on endosomal membranes, the growth of the number of tethering events between EEA1-positive vesicles and their clustering. - Highlights: • EEA1 mobility was compared in serum-starved and EGF-stimulated interphase HeLa cells. • FRAP analysis revealed fast and slow components of EEA1 recovery in both cases. • Stimulation of EGFR endocytosis did not affect fast EEA1 turnover. • EGF stimulation significantly increased half-time of slowly exchanged EEA1 fraction.
LyGDI expression in HeLa cells increased its sensitivity to radiation-induced apoptosis

International Nuclear Information System (INIS)

Zhou Xinwen; Xu Yaxiang

2006-01-01

Objective: In order to confirm whether LyGDI has apoptotic signal transduction function and can increase the apoptotic rate of radiation-induced cell death, the lyGDI and mutant D19lyGDI gene, which constructed with the pCDNA3. 1 His A, were transfected into no-endogenous lyGDI HeLa cells. Methods Transient expressions of lyGDI and D19lyGDI in HeLa cells were analyzed by Western blot using anti-mono antibody of LyGDI and Xpress tag. Cell apoptosis was assayed with Annexin V-FITC apoptosis kit. To select stable clone, the transferred HeLa cells had been maintained in G418 medium for 3 weeks, then a cell line, which stably expressed LyGDI and mutant D19lyGDI, was selected. The selected cell line was irradiated with 12 Gy 60 Co y-rays. Caspase-3 activity of the cells was determined by Western blot and cell viability by clone-forming assay after 48 hours post-irradiation culture. Results: Western blot and Annexin V-FITC apoptotic analysis revealed that lyGDI and D19lyGDI transient expressions in HeLa cells induced apoptosis; Caspase-3 activity measurement and clone-forming assay showed that lyGDI increased sensitivity to radiation-induced cell apoptosis. Conclusions: lyGDI performs function in apoptosis signal transduction, its expression in HeLa cells can increase the sensitivity to radiation-induced cell apoptosis. (authors)
An RNA-binding protein, Qki5, regulates embryonic neural stem cells through pre-mRNA processing in cell adhesion signaling.

Science.gov (United States)

Hayakawa-Yano, Yoshika; Suyama, Satoshi; Nogami, Masahiro; Yugami, Masato; Koya, Ikuko; Furukawa, Takako; Zhou, Li; Abe, Manabu; Sakimura, Kenji; Takebayashi, Hirohide; Nakanishi, Atsushi; Okano, Hideyuki; Yano, Masato

2017-09-15

Cell type-specific transcriptomes are enabled by the action of multiple regulators, which are frequently expressed within restricted tissue regions. In the present study, we identify one such regulator, Quaking 5 (Qki5), as an RNA-binding protein (RNABP) that is expressed in early embryonic neural stem cells and subsequently down-regulated during neurogenesis. mRNA sequencing analysis in neural stem cell culture indicates that Qki proteins play supporting roles in the neural stem cell transcriptome and various forms of mRNA processing that may result from regionally restricted expression and subcellular localization. Also, our in utero electroporation gain-of-function study suggests that the nuclear-type Qki isoform Qki5 supports the neural stem cell state. We next performed in vivo transcriptome-wide protein-RNA interaction mapping to search for direct targets of Qki5 and elucidate how Qki5 regulates neural stem cell function. Combined with our transcriptome analysis, this mapping analysis yielded a bona fide map of Qki5-RNA interaction at single-nucleotide resolution, the identification of 892 Qki5 direct target genes, and an accurate Qki5-dependent alternative splicing rule in the developing brain. Last, our target gene list provides the first compelling evidence that Qki5 is associated with specific biological events; namely, cell-cell adhesion. This prediction was confirmed by histological analysis of mice in which Qki proteins were genetically ablated, which revealed disruption of the apical surface of the lateral wall in the developing brain. These data collectively indicate that Qki5 regulates communication between neural stem cells by mediating numerous RNA processing events and suggest new links between splicing regulation and neural stem cell states. © 2017 Hayakawa-Yano et al.; Published by Cold Spring Harbor Laboratory Press.
Human cytosolic thymidine kinase: purification and physical characterization of the enzyme from HeLa cells

International Nuclear Information System (INIS)

Sherley, J.L.; Kelly, T.J.

1988-01-01

The mammalian cytosolic thymidine kinase is one of a number of enzymes involved in DNA replication whose activities increase dramatically during S phase of the cell cycle. As a first step in defining the mechanisms that control the S phase induction of thymidine kinase activity, the authors have purified the human enzyme from HeLa cells and raised a specific immune serum against the purified protein. The enzyme was isolated from cells arrested in S phase by treatment with methotrexate and purified to near homogeneity by ion-exchange and affinity chromatography. Stabilization of the purified enzyme was achieved by the addition of digitonin. An electrophoretic R/sub m/ of 0.2 in nondenaturing gels characterizes the purified enzyme activity as cytosolic thymidine kinase. The enzyme has a Stoke's radius of 40 A determined by gel filtration and a sedimentation coefficient of 5.5 S determined by glycerol gradient sedimentation. Based on these hydrodynamic values, a native molecular weight of 96,000 was calculated for the purified enzyme. When electrophoresed in denaturing sodium dodecyl sulfate-polyacrylamide gels under reducing conditions, the most purified enzyme fraction was found to contain one predominant polypeptide of M/sub r/ = 24,000. Several lines of evidence indicate that this polypeptide is responsible for thymidine kinase enzymatic activity
[Structural organization of 5S ribosomal DNA of Rosa rugosa].

Science.gov (United States)

Tynkevych, Iu O; Volkov, R A

2014-01-01

In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
FILOGENETIK POPULASI UDANG JERBUNG (Fenneropenaeus merguiensis de Man DI INDONESIA BERDASARKAN SEKUENS 16S-rRNA DNA MITOKONDRIA

Directory of Open Access Journals (Sweden)

Eni Kusrini

2016-11-01

Full Text Available Penelitian ini dilakukan untuk mengetahui hubungan kekerabatan stok udang jerbung Indonesia sebagai informasi dasar bagi program pemuliaan. Udang jerbung uji berasal dari Pantai Bengkulu, Selat Sunda (Banten, Pantai Cilacap (Jawa Tengah, Selat Lombok (NTB, dan Pontianak (Kalimantan Barat. Amplifikasi PCR dan sekuensing daerah 16S-rRNA DNA mitokondria dilakukan menggunakan primer 5’-CGCCTGTTTAAC-AAAAACAT-3’ dan 5’-CCGGTCTGAACTCAGATCATGT-3’. Hasil analisis homologi susunan nukleotida 16S-rRNA DNA mitokondria menunjukkan bahwa udang jerbung yang digunakan dalam penelitian merupakan Fenneropenaeus merguiensis. Hasil analisis kekerabatan menunjukkan bahwa 5 populasi udang jerbung uji dapat dibagi menjadi 2 kelompok besar, yaitu kelompok Kalimantan Barat dan kelompok Bengkulu-Banten-Jawa Tengah-NTB. Populasi udang jerbung Kalimantan dan Bengkulu masing-masing memiliki sekuens spesifik, yaitu ACTGACT dan C-GAC di terminal 5. Sekuens tersebut mungkin dapat digunakan sebagai penanda dalam program pemuliaan udang jerbung Indonesia. The experiment was conducted to understand the family relationship of banana prawn in Indonesia and to provide basic information for breeding program. Prawns were obtained from Bengkulu Coast, Sunda Strait (Banten, Cilacap Coast (Central Java, Lombok Strait (West Nusa Tenggara, Pontianak Coast (West Kalimantan. PCR amplification and sequencing of 16S-rRNA mitochondrial DNA region were performed using 5’-CGCCTGTTTAAC-AAAAACAT-3’ and 5’-CCGGTCTGAACTCAGATCATGT-3’. Analysis of homology sequences of 16S-rRNA mtDNA showed that banana prawn used in this study was Fenneropenaeus merguiensis. Result of family relationship analysis indicated that five populations of banana prawn can be divided into two groups, i.e. West Kalimantan and Bengkulu-Banten-Central Java-NTB groups. Banana prawns from West Kalimantan and Bengkulu have specific sequences at 5’ terminal, ACTGACT and C-GAC, respectively. Those sequences can
Nicotinamide induces mitochondrial-mediated apoptosis through oxidative stress in human cervical cancer HeLa cells.

Science.gov (United States)

Feng, Yi; Wang, Yonghua; Jiang, Chengrui; Fang, Zishui; Zhang, Zhiqiang; Lin, Xiaoying; Sun, Liwei; Jiang, Weiying

2017-07-15

Nicotinamide participates in energy metabolism and influences cellular redox status and modulates multiple pathways related with both cellular survival and death. Recent studies have shown that it induced proliferation inhibition and apoptosis in many cancer cells. However, little is known about the effects of nicotinamide on human cervical cancer cells. We aimed to evaluate the effects of the indicated concentrations nicotinamide on cell proliferation, apoptosis and redox-related parameters in HeLa cells and investigated the apoptotic mechanism. After the treatment of the indicated concentrations nicotinamide, HeLa cell proliferation was evaluated by the CCK-8 assay and the production of ROS (reactive oxygen species) was measured using 2',7'-Dichlorofluorescin diacetate. The apoptotic effect was confirmed by observing the cellular and nuclear morphologies with fluorescence microscope and apoptotic rate of HeLa cell apoptosis was measured by flow cytometry using Annexin-V method. Moreover, we examined the mitochondrial membrane potential by JC-1 method and measured the expression of apoptosis related genes using qRT-PCR and immunoblotting. Nicotinamide restrained the HeLa cell proliferation and significantly increased the accumulation of ROS and depletion of GSH at relatively high concentrations. Furthermore, nicotinamide promoted HeLa cell apoptosis via the intrinsic mitochondrial apoptotic pathway. Our study revealed that nicotinamide induced the apoptosis through oxidative stress and intrinsic mitochondrial apoptotic pathways in HeLa cell. The results emerge that nicotinamide may be an inexpensive, safe and promising therapeutic agent or a neoadjuvant chemotherapy for cervical cancer patients, as well useful to find new drugs for cervical cancer therapy. Copyright © 2017 Elsevier Inc. All rights reserved.
Synergistic combination of fluoro chalcone and doxorubicin on HeLa cervical cancer cells by inducing apoptosis

Science.gov (United States)

Arianingrum, Retno; Arty, Indyah Sulistyo; Atun, Sri

2017-03-01

Doxorubicin (Dox), a primary chemotherapeutic agent used for cancer treatment is known to have various side effect included multidrug resistance (MDR) phenomenon. Combination chemotherapy is one of some approaches to reduce Dox side effect. Chalcones have been reported to reduce the proliferation of many cancer cells. The research were conducted to investigate the cytotoxic activity and apoptosis induction of a chalcone derivate which is containing fluoro substituent [1 - (4" - fluorophenyl) -3 - (4' - hydroxy - 3' - methoxyphenyl) - 2 - propene - 1 -on] (FHM) and its combination with Dox on HeLa cells line. The observation of the cytotoxic activity was conducted using MTT [3 - (4, 5 - dimethyl thiazol - 2 - y1) - 2.5 - diphenyltetrazolium bromide] assay. Apoptosis induction was determined by flow cytometric. The changes of cell morphology were observed using phase contrast microscopy. The combination index (CI) was used to determine the effect of the combination. The study showed that FHM inhibited the HeLa cell growth with IC50 of 34 μM, while the IC50 of Dox was 1 μM. The combination had a higher inhibitory effect on cell growth compare to the single treatment of FHM and Dox. All of the combination doses under IC50 of FHM and Dox gave synergistic (CI: - 0.7) up to strong synergistic effect (CI: 0.l - 0.3). The synergistic effects of the combination were due to their ability to induce apoptosis in the HeLa cells. According to the result, FHM was potential to be developed as a co-chemotherapeutic agent with Dox for cervical cancer.
Prevalence of 16S rRNA methylase genes among b-lactamase ...

African Journals Online (AJOL)

2014-07-07

Jul 7, 2014 ... School of Life Sciences, Pondicherry University, Pondicherry, India ... Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and .... Isolates positive for bla or 16S rRNA methylase genes.
Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

Science.gov (United States)

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.
Oxygen enhancement ratios in synchronous HeLa cells exposed to low-LET radiation

International Nuclear Information System (INIS)

Sapozink, M.D.

1977-01-01

HeLa cells were synchronized by the mitotic selection method and rendered hypoxic by coincubation with an excess of heavily irradiated, but metabolically active, feeder cells. An oxygen enhancement ratio (OER) of about 3 was obtained in interphase HeLa cells irradiated with x or gamma rays. A significantly lower OER was obtained with cells in, or close to, mitosis. The significance of this decrease in the oxygen effect in mitotic cells is discussed
Effect of Smac gene on apoptosis of HeLa cells induced by γ-rays

International Nuclear Information System (INIS)

Zhao Baofeng; Tian Mei; Ruan Jianlei; Su Xu

2007-01-01

To explore the effect of Smac gene on apoptosis of HeLa cells induced by γ-ray and its possible mechanisms, the full length cDNA of Smac gene was transferred into HeLa cells. 24 h after transferring, the results of Western Blot indicated the expression of Smac was increased but the expression of Survivin decreased. After HeLa cells was irradiated by γ-rays, Smac gene transferred HeLa/Smac cells showed more cell apoptosis rates and the higher activity of Caspase-3 than vector transferred control HeLa/pcDNA3.1 cells. However, the damage and repair of DNA and the cell cycle don't change significantly, comparing HeLa/Smac cells with HeLa/pcDNA3.1 cells. (authors)
Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

DEFF Research Database (Denmark)

Brown, S

1991-01-01

4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....
A time course study demonstrating mRNA, microRNA, 18S rRNA, and U6 snRNA changes to estimate PMI in deceased rat's spleen.

Science.gov (United States)

Lv, Ye-hui; Ma, Kai-jun; Zhang, Heng; He, Meng; Zhang, Ping; Shen, Yi-wen; Jiang, Nan; Ma, Duan; Chen, Long

2014-09-01

Determining the postmortem interval (PMI) is important in criminal, civil, and forensic cases. We examined the feasibility of using the transcript abundances of mRNAs, 18S rRNA, U6 snRNA, and microRNAs as a means to estimate the PMI. We removed spleen tissues from rats at different PMIs under 4°C or 25°C and examined gene transcript abundances in these samples by RT-qPCR. Using the algorithm geNorm, we found that microRNAs to be appropriate control markers because they were less affected by PMI and temperature. We also characterized relationships between observed PMI and the transcript levels of the above-mentioned RNAs. GAPDH1 and ACTB1 fluctuated slightly like cubic curves, while GAPDH2 and ACTB2 decreased rapidly. 18S rRNA transcript level exhibited a parabolic-like trend at 25°C and exponential growth at 4°C, while U6 transcript level exhibited exponential decay at 25°C and a parabolic-like trend at 4°C. Following validation, we conclude that GAPDH2, ACTB2, and 18S rRNA are suitable makers in the accurate determination of PMI. © 2014 American Academy of Forensic Sciences.
Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

Science.gov (United States)

Douzery, E; Catzeflis, F M

1995-11-01

The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced
HIF-1 and NDRG2 contribute to hypoxia-induced radioresistance of cervical cancer Hela cells

International Nuclear Information System (INIS)

Liu, Junye; Zhang, Jing; Wang, Xiaowu; Li, Yan; Chen, Yongbin; Li, Kangchu; Zhang, Jian; Yao, Libo; Guo, Guozhen

2010-01-01

Hypoxia inducible factor 1 (HIF-1), the key mediator of hypoxia signaling pathways, has been shown involved in hypoxia-induced radioresistance. However, the underlying mechanisms are unclear. The present study demonstrated that both hypoxia and hypoxia mimetic cobalt chloride could increase the radioresistance of human cervical cancer Hela cells. Meanwhile, ectopic expression of HIF-1 could enhance the resistance of Hela cells to radiation, whereas knocking-down of HIF-1 could increase the sensitivity of Hela cells to radiation in the presence of hypoxia. N-Myc downstream-regulated gene 2 (NDRG2), a new HIF-1 target gene identified in our lab, was found to be upregulated by hypoxia and radiation in a HIF-1-dependent manner. Overexpression of NDRG2 resulted in decreased sensitivity of Hela cells to radiation while silencing NDRG2 led to radiosensitization. Moreover, NDRG2 was proved to protect Hela cells from radiation-induced apoptosis and abolish radiation-induced upregulation of Bax. Taken together, these data suggest that both HIF-1 and NDRG2 contribute to hypoxia-induced tumor radioresistance and that NDRG2 acts downstream of HIF-1 to promote radioresistance through suppressing radiation-induced Bax expression. It would be meaningful to further explore the clinical application potential of HIF-1 and NDRG2 blockade as radiosensitizer for tumor therapy.

An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA.

Science.gov (United States)

Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O; Linne, Uwe; Albaum, Stefan P; Jiménez-Zurdo, José I; Becker, Anke

2018-01-01

Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans- encoded sRNA ( trans- sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving
Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

Science.gov (United States)

Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

2013-05-01

All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Using small RNA (sRNA) deep sequencing to understand global virus distribution in plants

Science.gov (United States)

Small RNAs (sRNAs), a class of regulatory RNAs, have been used to serve as the specificity determinants of suppressing gene expression in plants and animals. Next generation sequencing (NGS) uncovered the sRNA landscape in most organisms including their associated microbes. In the current study, w...
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

Science.gov (United States)

Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

2017-01-01

Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of
Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

Science.gov (United States)

Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

2017-06-01

Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

Science.gov (United States)

Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

2005-11-01

Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.
Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen

Directory of Open Access Journals (Sweden)

Deng D

2015-04-01

Full Text Available Dawei Deng,* Yang Li,* Jianpeng Xue, Jie Wang, Guanhua Ai, Xin Li, Yueqing GuDepartment of Biomedical Engineering, China Pharmaceutical University, Nanjing, People’s Republic of China*These authors contributed equally to this workAbstract: Messenger RNA (mRNA, a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP beacon containing a bare gold nanoparticle (AuNP as fluorescence quencher and thiol-terminated fluorescently labeled stem–loop–stem oligonucleotide sequences attached by Au–S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.Keywords: molecular beacon, bioinformatics, gold nanoparticle, STAT5b mRNA, visual detection
Securinine from Phyllanthus glaucus Induces Cell Cycle Arrest and Apoptosis in Human Cervical Cancer HeLa Cells.

Directory of Open Access Journals (Sweden)

Justyna Stefanowicz-Hajduk

Full Text Available The Securinega-type alkaloids occur in plants belonging to Euphorbiaceae family. One of the most widely distributed alkaloid of this group is securinine, which was identified next to allosecurinine in Phyllanthus glaucus (leafflower. Recently, some Securinega-type alkaloids have paid attention to its antiproliferative potency towards different cancer cells. However, the cytotoxic properties of allosecurinine have not yet been evaluated.The cytotoxicity of the extract, alkaloid fraction obtained from P. glaucus, isolated securinine and allosecurinine against HeLa cells was evaluated by real-time xCELLigence system and 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay. Apoptosis was detected by annexin V and 7-amino-actinomycin (7-AAD staining and confirmed with fluorescent Hoechst 33342 dye. The assessment of mitochondrial membrane potential (MMP, reactive oxygen species (ROS generation, the level of extracellular signal-regulated protein kinases 1 and 2 (ERK1/2, caspase-3/7 activity and cell cycle analysis were measured by flow cytometry. The enzymatic activity of caspase-9 was assessed by a luminometric assay. The expression of apoptosis associated genes was analyzed by real-time PCR.The experimental data revealed that securinine and the alkaloid fraction were significantly potent on HeLa cells growth inhibition with IC50 values of 7.02 ± 0.52 μg/ml (32.3 μM and 25.46 ± 1.79 μg/ml, respectively. The activity of allosecurinine and Phyllanthus extract were much lower. Furthermore, our study showed that the most active securinine induced apoptosis in a dose-dependent manner in the tested cells, increased the percentage of ROS positive cells and depolarized cells as well as stimulated the activity of ERK1/2, caspase-9 and -3/7. Securinine also induced cell cycle arrest in S phase. Real-time PCR analysis showed high expression of TNFRSF genes in the cells stimulated with securinine.Securinine induces apoptosis and activates
Real-time observation of irradiated Hela-cell Modified by Fluorescent ubiquitination-based Cell Cycle Indicator Using Synchrotron X-Ray Microbeam

International Nuclear Information System (INIS)

Narita, A.; Noguchi, M.; Kaminaga, K.; Yokoya, A.; Kobayashi, K.; Usami, N.; Fujii, K.

2015-01-01

Fluorescent ubiquitination-based cell-cycle indicator (FUCCI) human cancer (HeLa) cells (red indicates G1; green, S/G2) were exposed to a synchrotron X-ray microbeam. Cells in either G1 or S/G2 were irradiated selectively according to their colour in the same microscopic field. Time-lapse micrographs of the irradiated cells were acquired for 24 h after irradiation. For fluorescent immunostaining, phosphorylated histone proteins (γ-H2AX) indicated the induction of DNA double-strand breaks. The cell cycle was arrested by irradiation at S/G2. In contrast, cells irradiated at G1 progressed to S/G2. The foci were induced in cells irradiated at both G1 and S/G2, suggesting that the G1-S (or S) checkpoint pathway does not function in HeLa cells due to the fact that the cells are functionally p53 deficient, even though X-ray microbeam irradiation significantly induces double-strand breaks. These results demonstrate that single FUCCI cell exposure and live cell imaging are powerful methods for studying the effects of radiation on the cell cycle. (authors)
Appearance of newly formed mRNA and rRNA as ribonucleoprotein-particles in the cytoplasmic subribosomal fraction of pea embryos

International Nuclear Information System (INIS)

Takahashi, Noribumi; Takaiwa, Fumio; Fukuei, Keisuke; Sakamaki, Tadashi; Tanifuji, Shigeyuki

1977-01-01

Incorporation studies with 3 H-uridine or 3 H-adenosine showed that germinating pea embryos synthesize all types of poly A(+) RNA, rRNA and 4-5S RNA at the early stage of germination. After the pulse labeling for 30 min, only heterodisperse RNA and 4-5S RNA appeared in the cytoplasm as labeled RNA species. At this time the radioactivity was associated with cytoplasmic structures heavier than 80S and RNP particles of 68-70S, 52-55S, 36-38S and 20-22S which are presumed to be free mRNP particles in plants. When the pulse-labeled embryos were incubated for a further 60 min in an isotope-free medium, the labeled 17S and 25S rRNA emerged in the cytoplasm, together with labeled heterodisperse and 4-5S RNAs. More radioactivity accumulated in the regions of the polysome, 62-65S and 38-42S particles. The results of analysis of RNAs extracted from the whole cytoplasm, polysome or subribosomal fractions indicated that small subunits of newly formed ribosomes appear more rapidly in the cytoplasm than new large subunits, which accumulate for a while as free particles in the cytoplasm than are incorporated into polysomes. The actinomycin treatment which caused preferential inhibition of rRNA synthesis reduced the accumulation of free, newly formed ribosome subunits and partially permitted detection of the presumed mRNP particles in the subribosomal region even after the chase treatment. (auth.)
TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

Directory of Open Access Journals (Sweden)

Thomas Spaller

Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells

International Nuclear Information System (INIS)

Zambetti, G.; Stein, J.; Stein, G.

1987-01-01

The subcellular location of histone mRNA-containing polysomes may play a key role in the posttranscriptional events that mediate histone mRNA turnover following inhibition of DNA synthesis. Previously, it has been shown that histone mRNA is found primarily on free polysomes that are associated with the cytoskeleton. The authors report here the construction of an Escherichia coli pBR322 β-lactamase signal peptide-human H3 histone fusion gene. The fusion transcript is targeted to membrane-bound polysomes and remains stable following interruption of DNA replication. Relocating mRNA within the cell may provide a procedure for studying the posttranscriptional regulation of gene expression
Growth and apoptosis of HeLa cells induced by intense picosecond pulsed electric field

Directory of Open Access Journals (Sweden)

Yuan-yuan HUA

2011-07-01

Full Text Available Objective To investigate the growth and apoptosis of HeLa cells induced by intense picosecond pulsed electric field(PEF in vitro.Methods HeLa cells cultured in vitro were divided into experimental group and control group(with or without intense picosecond PEF.With constant pulse width,frequency and voltage,the cells in experimental group were divided into 6 sub-groups according to the number of pulse(100,200,500,1000,1500,2000,the growth inhibition of HeLa cells by PEF and the dose-effect relationship were analyzed by MTT.Caspase 3 protein activity was detected in the cells in 500,1000 and 2000 sub-groups.Mitochondrial transmembrane potential was detected by rhodamine 123 staining with the cells in 2000 sub-groups.Results MTT assay demonstrated that intense picosecond PEF significantly inhibited the proliferation of HeLa cells in dose-dependent manner.The survival rates of cells declined along with the increase in pulse number,and were 96.23%±0.76%,94.11%±2.42%,90.31%±1.77%,64.59%±1.59%,32.95%±0.73%,23.85%±2.38% and 100%,respectively,in 100,200,500,1000,1500,2000 sub-groups and control group(P < 0.01.The Caspase 3 protein activity was significantly enhanced by intense picosecond PEF,and the absorbancy indexes(A were 0.174±0.012,0.232±0.017,0.365±0.016 and 0.122±0.011,respectively,in 500,1000,2000 sub-groups and control group(P < 0.05.The mitochondrial transmembrane potential of HeLa cells was significantly inhibited by intense picosecond PEF,and the fluorescence intensity in 2000 sub-group(76.66±13.38 was much lower than that in control group(155.81±2.33,P < 0.05.Conclusion Intense picosecond PEF may significantly inhibit the growth of HeLa cells,and induce cell apoptosis via mitochondrial pathway.
Synergistic Effects of SAM and Selenium Compounds on Proliferation, Migration and Adhesion of HeLa Cells.

Science.gov (United States)

Sun, Licui; Zhang, Jianxin; Yang, Qiu; Si, Yang; Liu, Yiqun; Wang, Qin; Han, Feng; Huang, Zhenwu

2017-08-01

To determine the antitumor activities and molecular mechanism of selenium compounds in HeLa cells. Western blotting was used to detect ERK and AKT activation in HeLa cells induced by selenium compounds selenomethionine (SeMet), methylselenocysteine (MeSeCys) and methylseleninic acids (MeSeA). Using MTT, wound-healing and Matrigel adhesion assays, the antitumor effects of SAM and selenium compounds were evaluated in HeLa cells. MeSeA inhibited ERK and AKT signaling pathways and suppressed the proliferation (peffects compared to the other treatments. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

Science.gov (United States)

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
Fibrillarin, a nucleolar protein, is required for normal nuclear morphology and cellular growth in HeLa cells

International Nuclear Information System (INIS)

Amin, Mohammed Abdullahel; Matsunaga, Sachihiro; Ma, Nan; Takata, Hideaki; Yokoyama, Masami; Uchiyama, Susumu; Fukui, Kiichi

2007-01-01

Fibrillarin is a key small nucleolar protein in eukaryotes, which has an important role in pre-rRNA processing during ribosomal biogenesis. Though several functions of fibrillarin are known, its function during the cell cycle is still unknown. In this study, we confirmed the dynamic localization of fibrillarin during the cell cycle of HeLa cells and also performed functional studies by using a combination of immunofluorescence microscopy and RNAi technique. We observed that depletion of fibrillarin has almost no effect on the nucleolar structure. However, fibrillarin-depleted cells showed abnormal nuclear morphology. Moreover, fibrillarin depletion resulted in the reduction of the cellular growth and modest accumulation of cells with 4n DNA content. Our data suggest that fibrillarin would play a critical role in the maintenance of nuclear shape and cellular growth
6S-1 RNA function leads to a delay in sporulation in Bacillus subtilis.

Science.gov (United States)

Cavanagh, Amy T; Wassarman, Karen M

2013-05-01

We have discovered that 6S-1 RNA (encoded by bsrA) is important for appropriate timing of sporulation in Bacillus subtilis in that cells lacking 6S-1 RNA sporulate earlier than wild-type cells. The time to generate a mature spore once the decision to sporulate has been made is unaffected by 6S-1 RNA, and, therefore, we propose that it is the timing of onset of sporulation that is altered. Interestingly, the presence of cells lacking 6S-1 RNA in coculture leads to all cell types exhibiting an early-sporulation phenotype. We propose that cells lacking 6S-1 RNA modify their environment in a manner that promotes early sporulation. In support of this model, resuspension of wild-type cells in conditioned medium from ΔbsrA cultures also resulted in early sporulation. Use of Escherichia coli growth as a reporter of the nutritional status of conditioned media suggested that B. subtilis cells lacking 6S-1 RNA reduce the nutrient content of their environment earlier than wild-type cells. Several pathways known to impact the timing of sporulation, such as the skf- and sdp-dependent cannibalism pathways, were eliminated as potential targets of 6S-1 RNA-mediated changes, suggesting that 6S-1 RNA activity defines a novel mechanism for altering the timing of onset of sporulation. In addition, 6S-2 RNA does not influence the timing of sporulation, providing further evidence of the independent influences of these two related RNAs on cell physiology.
The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

Science.gov (United States)

Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

1982-01-01

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.
Long noncoding RNA LISPR1 is required for S1P signaling and endothelial cell function.

Science.gov (United States)

Josipovic, Ivana; Pflüger, Beatrice; Fork, Christian; Vasconez, Andrea E; Oo, James A; Hitzel, Juliane; Seredinski, Sandra; Gamen, Elisabetta; Heringdorf, Dagmar Meyer Zu; Chen, Wei; Looso, Mario; Pullamsetti, Soni Savai; Brandes, Ralf P; Leisegang, Matthias S

2018-03-01

Sphingosine-1-Phosphate (S1P) is a potent signaling lipid. The effects of S1P are mediated by the five S1P receptors (S1PR). In the endothelium S1PR1 is the predominant receptor and thus S1PR1 abundance limits S1P signaling. Recently, lncRNAs were identified as a novel class of molecules regulating gene expression. Interestingly, the lncRNA NONHSAT004848 (LISPR1, Long intergenic noncoding RNA antisense to S1PR1), is closely positioned to the S1P1 receptors gene and in part shares its promoter region. We hypothesize that LISPR1 controls endothelial S1PR1 expression and thus S1P-induced signaling in endothelial cells. In vitro transcription and translation as well as coding potential assessment showed that LISPR1 is indeed noncoding. LISPR1 was localized in both cytoplasm and nucleus and harbored a PolyA tail at the 3'end. In human umbilical vein endothelial cells, as well as human lung tissue, qRT-PCR and RNA-Seq revealed high expression of LISPR1. S1PR1 and LISPR1 were downregulated in human pulmonary diseases such as COPD. LISPR1 but also S1PR1 were induced by inflammation, shear stress and statins. Knockdown of LISPR1 attenuated endothelial S1P-induced migration and spheroid outgrowth of endothelial cells. LISPR1 knockdown decreased S1PR1 expression, which was paralleled by an increase of the binding of the transcriptional repressor ZNF354C to the S1PR1 promoter and a reduction of the recruitment of RNA Polymerase II to the S1PR1 5'end. This resulted in attenuated S1PR1 expression and attenuated S1P downstream signaling. Collectively, the disease relevant lncRNA LISPR1 acts as a novel regulatory unit important for S1PR1 expression and endothelial cell function. Copyright © 2018 Elsevier Ltd. All rights reserved.
The UEA sRNA Workbench (version 4.4): a comprehensive suite of tools for analyzing miRNAs and sRNAs.

Science.gov (United States)

Stocks, Matthew B; Mohorianu, Irina; Beckers, Matthew; Paicu, Claudia; Moxon, Simon; Thody, Joshua; Dalmay, Tamas; Moulton, Vincent

2018-05-02

RNA interference, a highly conserved regulatory mechanism, is mediated via small RNAs. Recent technical advances enabled the analysis of larger, complex datasets and the investigation of microRNAs and the less known small interfering RNAs. However, the size and intricacy of current data requires a comprehensive set of tools, able to discriminate the patterns from the low-level, noise-like, variation; numerous and varied suggestions from the community represent an invaluable source of ideas for future tools, the ability of the community to contribute to this software is essential. We present a new version of the UEA sRNA Workbench, reconfigured to allow an easy insertion of new tools/workflows. In its released form, it comprises of a suite of tools in a user-friendly environment, with enhanced capabilities for a comprehensive processing of sRNA-seq data e.g. tools for an accurate prediction of sRNA loci (CoLIde) and miRNA loci (miRCat2), as well as workflows to guide the users through common steps such as quality checking of the input data, normalization of abundances or detection of differential expression represent the first step in sRNA-seq analyses. The UEA sRNA Workbench is available at: http://srna-workbench.cmp.uea.ac.uk The source code is available at: https://github.com/sRNAworkbenchuea/UEA_sRNA_Workbench. v.moulton@uea.ac.uk.

Anticancer Activity of a Hexapeptide from Skate (Raja porosa) Cartilage Protein Hydrolysate in HeLa Cells.

Science.gov (United States)

Pan, Xin; Zhao, Yu-Qin; Hu, Fa-Yuan; Chi, Chang-Feng; Wang, Bin

2016-08-16

In this study, the hexapeptide Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY), which has a molecular weight of 726.9 Da, was separated from skate (Raja porosa) cartilage protein hydrolysate using ultrafiltration and chromatographic methods, and its anticancer activity was evaluated in HeLa cells. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay indicated that FIMGPY exhibited high, dose-dependent anti-proliferation activities in HeLa cells with an IC50 of 4.81 mg/mL. Acridine orange/ethidium bromide (AO/EB) fluorescence staining and flow cytometry methods confirmed that FIMGPY could inhibit HeLa cell proliferation by inducing apoptosis. Western blot assay revealed that the Bax/Bcl-2 ratio and relative intensity of caspase-3 in HeLa cells treated with 7-mg/mL FIMGPY were 2.63 and 1.83, respectively, significantly higher than those of the blank control (p skate cartilage protein hydrolysate may have applications as functional foods and nutraceuticals for the treatment and prevention of cancer.
Integrated RNA-Seq and sRNA-Seq Analysis Identifies Chilling and Freezing Responsive Key Molecular Players and Pathways in Tea Plant (Camellia sinensis)

Science.gov (United States)

Zheng, Chao; Zhao, Lei; Wang, Yu; Shen, Jiazhi; Zhang, Yinfei; Jia, Sisi; Li, Yusheng; Ding, Zhaotang

2015-01-01

Tea [Camellia sinensis (L) O. Kuntze, Theaceae] is one of the most popular non-alcoholic beverages worldwide. Cold stress is one of the most severe abiotic stresses that limit tea plants’ growth, survival and geographical distribution. However, the genetic regulatory network and signaling pathways involved in cold stress responses in tea plants remain unearthed. Using RNA-Seq, DGE and sRNA-Seq technologies, we performed an integrative analysis of miRNA and mRNA expression profiling and their regulatory network of tea plants under chilling (4℃) and freezing (-5℃) stress. Differentially expressed (DE) miRNA and mRNA profiles were obtained based on fold change analysis, miRNAs and target mRNAs were found to show both coherent and incoherent relationships in the regulatory network. Furthermore, we compared several key pathways (e.g., ‘Photosynthesis’), GO terms (e.g., ‘response to karrikin’) and transcriptional factors (TFs, e.g., DREB1b/CBF1) which were identified as involved in the early chilling and/or freezing response of tea plants. Intriguingly, we found that karrikins, a new group of plant growth regulators, and β-primeverosidase (BPR), a key enzyme functionally relevant with the formation of tea aroma might play an important role in both early chilling and freezing response of tea plants. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-Seq and sRNA-Seq analysis. This is the first study to simultaneously profile the expression patterns of both miRNAs and mRNAs on a genome-wide scale to elucidate the molecular mechanisms of early responses of tea plants to cold stress. In addition to gaining a deeper insight into the cold resistant characteristics of tea plants, we provide a good case study to analyse mRNA/miRNA expression and profiling of non-model plant species using next-generation sequencing technology. PMID:25901577
Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

Science.gov (United States)

Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

2012-01-01

Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
Anti-apoptotic effect of caspase inhibitors on H₂O₂-treated HeLa cells through early suppression of its oxidative stress.

Science.gov (United States)

Park, Woo Hyun

2014-05-01

Oxidative stress-induced cytotoxicity in cervical cancer cells may be of toxicological interest. In the present study, the effects of exogenous H2O2 on cell growth and death in HeLa cervical cancer cells were investigated, and the anti-apoptotic effects of various caspase (pan-caspase, caspase-3, -8 or -9) inhibitors on H2O2-treated HeLa cells were also evaluated with regard to reactive oxygen species (ROS) and glutathione (GSH) levels. Based on MTT assays, H2O2 inhibited the growth of HeLa cells with an IC50 value of ~75 µM at 24 h. H2O2 increased the number of dead cells and Annexin V-FITC-positive cells in the HeLa cells, which was accompanied by the activation of caspase-3 and the loss of mitochondrial membrane potential (MMP; ΔΨm). However, relatively higher doses of H2O2 induced necrosis in HeLa cells. Caspase inhibitors significantly prevented H2O2-induced HeLa cell death. H2O2 increased ROS including O2•- at 24 h and increased the activity of catalase in HeLa cells. H2O2 also increased the ROS level at 1 h, and several caspase inhibitors attenuated the increased level at 1 h but not at 6, 12 and 24 h. H2O2 decreased the GSH level in HeLa cells at 1 h, and several caspase inhibitors attenuated the decreased level of GSH at this time. H2O2 induced GSH depletion at 24 h. In conclusion, H2O2 inhibited the growth of HeLa cells via apoptosis and/or necrosis, which was accompanied by intracellular increases in ROS levels and GSH depletion. Caspase inhibitors are suggested to suppress H2O2-induced oxidative stress to rescue HeLa cells at the early time point of 1 h.
Dual function of the McaS small RNA in controlling biofilm formation

DEFF Research Database (Denmark)

Jørgensen, Mikkel Girke; Thomason, Maureen K.; Havelund, Johannes

2013-01-01

, and biofilm formation. Moreover, ectopic McaS expression leads to induction of two additional CsrA-repressed genes encoding diguanylate cyclases. Collectively, our study shows that McaS is a dual-function sRNA with roles in the two major post-transcriptional regulons controlled by the RNA-binding proteins Hfq...
Prevalence of 16S rRNA methylase genes among β-lactamase ...

African Journals Online (AJOL)

Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...
Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

Energy Technology Data Exchange (ETDEWEB)

Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

2009-04-27

Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.
Cell cycle, apoptosis, cellular uptake and whole-transcriptome microarray gene expression analysis of HeLa cells treated with a ruthenium(II)-arene complex with an isoquinoline-3-carboxylic acid ligand.

Science.gov (United States)

Jovanović, Katarina K; Tanić, Miljana; Ivanović, Ivanka; Gligorijević, Nevenka; Dojčinović, Biljana P; Radulović, Siniša

2016-10-01

Ruthenium(II)-arene complexes are promising drug candidates for the therapy of solid tumors. In previous work, seven new compounds of the general formula [Ru(η 6 -p-cymene)(L 1-7 )Cl] were synthesized and characterized, of which the complex with L=isoquinoline-3-carboxylic acid (RuT 7 ) was two times as active on HeLa cells compared to normal cell line MRC-5, as indicated by IC 50 values determined after 48h of incubation (45.4±3.0 vs. 84.2±5.7μM, respectively). In the present study, cell cycle analysis of HeLa cells treated with RuT 7 showed S phase arrest and an increase in sub-G1 population. The apoptotic potential of the title compound was confirmed with the Annexin V-FITC/PI assay together with a morphological evaluation of cells using fluorescent microscopy. Analysis of the intracellular accumulation of ruthenium showed 8.9ng Ru/10 6 cells after 6h of incubation. To gain further insight in the molecular mechanism of action of RuT 7 on HeLa cells, a whole-transcriptome microarray gene expression analysis was performed. Analysis of functional categories and signaling and biochemical pathways associated with the response of HeLa cells to treatment with RuT 7 showed that it leads the cells through the intrinsic (mitochondrial) apoptotic pathway, via indirect DNA damage due to the action of reactive oxygen species, and through direct DNA binding of RuT 7 . Statistical analysis for enrichment of gene sets associated with known drug-induced toxicities identified fewer associated toxicity profiles in RuT 7 -treated cells compared to cisplatin treatment. Altogether these results provide the basis for further development of RuT 7 in animal and pre-clinical studies as a potential drug candidate. Copyright © 2016 Elsevier Inc. All rights reserved.
Sechium edule (Jacq. Swartz, a New Cultivar with Antiproliferative Potential in a Human Cervical Cancer HeLa Cell Line

Directory of Open Access Journals (Sweden)

Sandra Salazar-Aguilar

2017-07-01

Full Text Available The Sechium edule Perla Negra cultivar is a recently-obtained biological material whose progenitors are S. edule var. nigrum minor and S. edule var. amarus silvestrys, the latter of which has been reported to have antiproliferative activity against the HeLa P-388 and L-929 cancer cell lines. The present study aimed to determine if the methanolic extract of the fruit of the Perla Negra cultivar had the same biological activity. The methanolic extract was phytochemically characterized by thin layer chromatography (TLC and column chromatography (CC, identifying the terpenes and flavonoids. The compounds identified via high performance liquid chromatography (HPLC were Cucurbitacins B, D, E, and I for the terpene fractions, and Rutin, Phlorizidin, Myricetin, Quercetin, Naringenin, Phloretin, Apigenin, and Galangin for the flavonoid fractions. Biological activity was evaluated with different concentrations of the methanolic extract in the HeLa cell line and normal lymphocytes. The methanolic extract inhibited the proliferation of HeLa cells (IC50 1.85 µg·mL−1, but the lymphocytes were affected by the extract (IC50 30.04 µg·mL−1. Some fractions, and the pool of all of them, showed inhibition higher than 80% at a concentration of 2.11 µg·mL−1. Therefore, the biological effect shown by the methanolic extract of the Perla Negra has some specificity in inhibiting tumor cells and not normal cells; an unusual feature among molecules investigated as potential biomedical agents.
Sechium edule (Jacq.) Swartz, a New Cultivar with Antiproliferative Potential in a Human Cervical Cancer HeLa Cell Line.

Science.gov (United States)

Salazar-Aguilar, Sandra; Ruiz-Posadas, Lucero Del Mar; Cadena-Iñiguez, Jorge; Soto-Hernández, Marcos; Santiago-Osorio, Edelmiro; Aguiñiga-Sánchez, Itzen; Rivera-Martínez, Ana Rocío; Aguirre-Medina, Juan Francisco

2017-07-25

The Sechium edule Perla Negra cultivar is a recently-obtained biological material whose progenitors are S. edule var. nigrum minor and S. edule var. amarus silvestrys, the latter of which has been reported to have antiproliferative activity against the HeLa P-388 and L-929 cancer cell lines. The present study aimed to determine if the methanolic extract of the fruit of the Perla Negra cultivar had the same biological activity. The methanolic extract was phytochemically characterized by thin layer chromatography (TLC) and column chromatography (CC), identifying the terpenes and flavonoids. The compounds identified via high performance liquid chromatography (HPLC) were Cucurbitacins B, D, E, and I for the terpene fractions, and Rutin, Phlorizidin, Myricetin, Quercetin, Naringenin, Phloretin, Apigenin, and Galangin for the flavonoid fractions). Biological activity was evaluated with different concentrations of the methanolic extract in the HeLa cell line and normal lymphocytes. The methanolic extract inhibited the proliferation of HeLa cells (IC 50 1.85 µg·mL -1 ), but the lymphocytes were affected by the extract (IC 50 30.04 µg·mL -1 ). Some fractions, and the pool of all of them, showed inhibition higher than 80% at a concentration of 2.11 µg·mL -1 . Therefore, the biological effect shown by the methanolic extract of the Perla Negra has some specificity in inhibiting tumor cells and not normal cells; an unusual feature among molecules investigated as potential biomedical agents.
Lamprey Prohibitin2 Arrest G2/M Phase Transition of HeLa Cells through Down-regulating Expression and Phosphorylation Level of Cell Cycle Proteins.

Science.gov (United States)

Shi, Ying; Guo, Sicheng; Wang, Ying; Liu, Xin; Li, Qingwei; Li, Tiesong

2018-03-02

Prohibitin 2(PHB2) is a member of the SFPH trans-membrane family proteins. It is a highly conserved and functionally diverse protein that plays an important role in preserving the structure and function of the mitochondria. In this study, the lamprey PHB2 gene was expressed in HeLa cells to investigate its effect on cell proliferation. The effect of Lm-PHB2 on the proliferation of HeLa cells was determined by treating the cells with pure Lm-PHB2 protein followed by MTT assay. Using the synchronization method with APC-BrdU and PI double staining revealed rLm-PHB2 treatment induced the decrease of both S phase and G0/G1 phase and then increase of G2/M phase. Similarly, cells transfected with pEGFP-N1-Lm-PHB2 also exhibited remarkable reduction in proliferation. Western blot and quantitative real-time PCR(qRT-PCR) assays suggested that Lm-PHB2 caused cell cycle arrest in HeLa cells through inhibition of CDC25C and CCNB1 expression. According to our western blot analysis, Lm-PHB2 was also found to reduce the expression level of Wee1 and PLK1 and the phosphorylation level of CCNB1, CDC25C and CDK1 in HeLa cells. Lamprey prohibitin 2 could arrest G2/M phase transition of HeLa cells through down-regulating expression and phosphorylation level of cell cycle proteins.
Study of Paclitaxel-Treated HeLa Cells by Differential Electrical Impedance Flow Cytometry

DEFF Research Database (Denmark)

Kirkegaard, Julie; Clausen, Casper Hyttel; Rodriguez-Trujíllo, Romén

2014-01-01

This work describes the electrical investigation of paclitaxel-treated HeLa cells using a custom-made microfluidic biosensor for whole cell analysis in continuous flow. We apply the method of differential electrical impedance spectroscopy to treated HeLa cells in order to elucidate the changes...... on investigating the changes in the electrical properties of the cell membrane caused by the effect of paclitaxel. We observe good agreement between the model and the obtained results. This establishes the proof-of-concept for the application in cell drug therapy....
Non-thermal plasma induces mitochondria-mediated apoptotic signaling pathway via ROS generation in HeLa cells.

Science.gov (United States)

Li, Wei; Yu, K N; Ma, Jie; Shen, Jie; Cheng, Cheng; Zhou, Fangjian; Cai, Zhiming; Han, Wei

2017-11-01

Non-thermal plasma (NTP) has been proposed as a novel therapeutic method for anticancer treatment. Although increasing evidence suggests that NTP selectively induces apoptosis in some types of tumor cells, the molecular mechanisms underlying this phenomenon remain unclear. In this study, we further investigated possible molecular mechanisms for NTP-induced apoptosis of HeLa cells. The results showed that NTP exposure significantly inhibited the growth and viability of HeLa cells. Morphological observation and flow cytometry analysis demonstrated that NTP exposure induced HeLa cell apoptosis. NTP exposure also activated caspase-9 and caspase-3, which subsequently cleaved poly (ADP- ribose) polymerase. Furthermore, NTP exposure suppressed Bcl-2 expression, enhanced Bax expression and translocation to mitochondria, activated mitochondria-mediated apoptotic pathway, followed by the release of cytochrome c. Further studies showed that NTP treatment led to ROS generation, whereas blockade of ROS generation by N-acetyl-l-cysteine (NAC, ROS scavengers) significantly prevented NTP-induced mitochondrial alteration and subsequent apoptosis of HeLa cells via suppressing Bax translocation, cytochrome c and caspase-3 activation. Taken together, our results indicated that NTP exposure induced mitochondria-mediated intrinsic apoptosis of HeLa cells was activated by ROS generation. These findings provide insights to the therapeutic potential and clinical research of NTP as a novel tool in cervical cancer treatment. Copyright © 2017. Published by Elsevier Inc.
Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein

International Nuclear Information System (INIS)

Dong Hongping; Zhang Bo; Shi Peiyong

2008-01-01

Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5 binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis
Ribozyme Activity of RNA Nonenzymatically Polymerized from 3 ',5 '-Cyclic GMP

Czech Academy of Sciences Publication Activity Database

Pino, S.; Costanzo, G.; Giorgi, A.; Šponer, Jiří; Šponer, Judit E.; Di Mauro, E.

2013-01-01

Roč. 15, č. 12 (2013), s. 5362-5383 ISSN 1099-4300 R&D Projects: GA ČR(CZ) GAP208/10/2302; GA MŠk(CZ) ED1.1.00/02.0068 Institutional support: RVO:68081707 Keywords : RNA polymerization * RNA origin * ribozymes Subject RIV: BO - Biophysics Impact factor: 1.564, year: 2013
PAX5α and PAX5β mRNA expression in breast Cancer: Relation to ...

African Journals Online (AJOL)

Background: Many studies evaluated the role of paired box gene 5 (PAX5) in breast cancer. However, few investigated PAX5α and PAX5β isoforms individually. Objective: The aim of the present study is to evaluate mRNA expression of PAX5α and PAX5β in breast cancer and assessing their underlying pathological roles ...
microRNA in Cerebral Spinal Fluid as Biomarkers of Alzheimer’s Disease Risk After Brain Injury

Science.gov (United States)

2017-08-01

AWARD NUMBER: W81XWH-15-1-0318 TITLE: microRNA in Cerebral Spinal Fluid as Biomarkers of Alzheimer’s Disease Risk After Brain Injury...After Brain Injury 5b. GRANT NUMBER AZ14046 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) J 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER...responses to brain injury that precede, and likely drive, changes in protein expression that lead to the development of AD. We have additional preliminary
Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

DEFF Research Database (Denmark)

Triman, K; Becker, E; Dammel, C

1989-01-01

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature......-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between...
SKI2 mediates degradation of RISC 5′-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis

Science.gov (United States)

Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

2015-01-01

Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441
A Lentinus edodes polysaccharide induces mitochondrial-mediated apoptosis in human cervical carcinoma HeLa cells.

Science.gov (United States)

Ya, Guowei

2017-10-01

In this study, a homogeneous polysaccharide (LEP1) with an average molecular weight of 53kDa was successfully purified from the fruiting bodies of Lentinus edodes and its anticancer efficacy on human cervical carcinoma HeLa cells in vitro and associated possible molecular mechanism were also evaluated. MTT assay showed that LEP1 exhibited a dose-dependent inhibitory effect on the proliferation of HeLa cells and caused apoptotic death. Our present findings provided the first evidence that LEP1 induced the apoptosis of HeLa cells via a mitochondria dependent pathway, as indicated by an increase in Bax/Bcl-2 ratio, a loss of mitochondrial membrane potential (Δym), the release of cytochrome c from the mitochondria to the cytosol, activation of caspase-9 and caspase-3, and cleavage of poly (ADP-ribose) polymerase (PARP) in HeLa cells. These combined results unequivocally indicated that the involvement of mitochondria-mediated signaling pathway in LEP1-induced apoptosis and strongly provided experimental evidence for the use of LEP1 as a potential therapeutic agent in the prevention and treatment of human cervical carcinoma. Copyright © 2017 Elsevier B.V. All rights reserved.

Induction of apoptosis in HeLa cells by chloroform fraction of seed extracts of Nigella sativa

Directory of Open Access Journals (Sweden)

Alshatwi Ali A

2009-11-01

Full Text Available Abstract Background Cancer remains one of the most dreaded diseases causing an astonishingly high death rate, second only to cardiac arrest. The fact that conventional and newly emerging treatment procedures like chemotherapy, catalytic therapy, photodynamic therapy and radiotherapy have not succeeded in reverting the outcome of the disease to any drastic extent, has made researchers investigate alternative treatment options. The extensive repertoire of traditional medicinal knowledge systems from various parts of the world are being re-investigated for their healing properties. This study progresses in the direction of identifying component(s from Nigella sativa with anti cancer acitivity. In the present study we investigated the efficacy of Organic extracts of Nigella sativa seed powder for its clonogenic inhibition and induction of apoptosis in HeLa cancer cell. Results Methanolic, n-Hexane and chloroform extracts of Nigella sativa seedz effectively killed HeLa cells. The IC50 values of methanolic, n-hexane, and chloroform extracts of Nigella sativa were 2.28 μg/ml, 2.20 μg/ml and 0.41 ng/ml, respectively. All three extracts induced apoptosis in HeLa cells. Apoptosis was confirmed by DNA fragmentation, western blot and terminal transferase-mediated dUTP-digoxigenin-end labeling (TUNEL assay. Conclusion Western Blot and TUNEL results suggested that Nigella sativa seed extracts regulated the expression of pro- and anti- apoptotic genes, indicating its possible development as a potential therapeutic agent for cervical cancer upon further investigation.
How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

Science.gov (United States)

Shanker, Sudhanshu; Bandyopadhyay, Pradipta

2017-08-01

The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.
Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

Science.gov (United States)

Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

1995-01-16

We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.
18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

Directory of Open Access Journals (Sweden)

Cory Ann Leonard

2016-01-01

Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.
Phosphorylated Akt Protein at Ser473 Enables HeLa Cells to Tolerate Nutrient-Deprived Conditions

Science.gov (United States)

Fathy, Moustafa; Awale, Suresh; Nikaido, Toshio

2017-12-29

Background: Despite angiogenesis, many tumours remain hypovascular and starved of nutrients while continuing to grow rapidly. The specific biochemical mechanisms associated with starvation resistance, austerity, may be new biological characters of cancer that are critical for cancer progression. Objective: This study aim was to investigate the effect of nutrient starvation on HeLa cells and the possible mechanism by which the cells are able to tolerate nutrient-deprived conditions. Methods: Nutrient starvation was achieved by culturing HeLa cells in nutrient-deprived medium (NDM) and cell survival was estimated by using cell counting kit-8. The effect of starvation on cell cycle distribution and the quantitative analysis of apoptotic cells were investigated by flow cytometry using propidium iodide staining. Western blotting was used to detect the expression levels of Akt and phosphorylated Akt at Ser473 (Ser473p-Akt) proteins. Results: HeLa cells displayed extremely long survival when cultured in NDM. The percentage of apoptotic HeLa cells was significantly increased by starvation in a time-dependent manner. A significant increase in the expression of Ser473p-Akt protein after starvation was also observed. Furthermore, it was found that Akt inhibitor III molecule inhibited the cells proliferation in a concentration- and time-dependent manner. Conclusion: Results of the present study provide evidence that Akt activation may be implicated in the tolerance of HeLa cells for nutrient starvation and may help to suggest new therapeutic strategies designed to prevent austerity of cervical cancer cells through inhibition of Akt activation. Creative Commons Attribution License
DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

Science.gov (United States)

Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

2013-10-01

We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.
LncRNA GAS5 Represses Osteosarcoma Cells Growth and Metastasis via Sponging MiR-203a

Directory of Open Access Journals (Sweden)

Yang Wang

2018-01-01

Full Text Available Background/Aims: LncRNA GAS5, a growth suppressor, has been reported to exert anti-tumor actions in various cancers, whereas the exact mechanism underling the anti-tumor action is still unclear. This study was aimed to investigate the effect of lncRNA GAS5 on osteosarcoma and tried to decode the underling mechanisms. Methods: Expressions of lncRNA GAS5 in MG-63 cells were silenced by shRNA transfection, while were overexpressed by vector transfection. Cell viability, migration, invasion and apoptosis were respectively assessed by MTT, Transwell assay and flow cytometry. Regulations between lncRNA GAS5 and miR-203a, as well as between miR-203a and TIMP2 were detected by qPCR, western blot and dual luciferase activity assay. Results: LncRNA GAS5 was down-regulated in MG-63 and OS-732 cells compared to hFOB1.19 cells. Silence of lncRNA GAS5 significantly promoted MG-63 cells viability, migration and invasion, and up-regulated Cyclin D1, Cyclin B1, CDK1 and CDK4 expressions. miR-203a was negatively regulated by lncRNA GAS5. The promoting activities of lncRNA GAS5 silence on MG-63 cells growth and metastasis were reversed by miR-203a suppression. TIMP2 was a target of miR-203a and the anti-growth and anti-metastasis actions of miR-203a suppression were reversed by TIMP2 silence. Further, lncRNA GAS5 silence, miR-203a overexpression, and TIMP2 silence could activate PI3K/AKT/GSK3β signaling while block NF-κB signaling. Conclusion: LncRNA GAS5 might be a tumor suppressor in osteosarcoma via sponging miR-203a, sequestering miR-203a away from TIMP2.
Study on effect of artemisinin combined with 60Co γ-ray on DNA damage in HeLa and SiHa cells

International Nuclear Information System (INIS)

Feng Yang; Zhou Yuanyuan; Yang Wei; Chen Qiu; Li Ming; Zhang Shuyu; Zhu Wei; Cao Jianping; Zhang Xuguang

2011-01-01

Objective: To investigate the effect of Artemisinin combined with 60 Co γ-ray on DNA damage in HeLa and SiHa cells of human cervical cancer. Methods: Cell growth kinetics was evaluated by MTT assay to determine the most appropriate drug concentration. Effects of Artemisinin combined with 60 Co γ-ray on DNA damage in HeLa and SiHa cells were detected by single cell gel electrophoresis. Results: With the concentration increased during the effect of Artemisinin, the HeLa and SiHa cells had higher inhibition on cell proliferation. The SCGE showed that:the comet cell analysis indexes (the comet cells ratio, Tail Length, Olive Tail Moment and Tail DNA%) there was no statistic difference in between the artemisinin group and the control group (P>0.05). With radiation in the same dose, the comet cell analysis indexes of Hela cells treated with both artermisinin and exposed to radiation were higher than that only exposed to radiation group(P 0.05). Conclusion: Artemisinin can not induce DNA damage in both HeLa and SiHa cells, but it can make irradiated HeLa cells DNA damage to be aggravated and enhance HeLa cells' radiation sensitivity. However, Artemisinin has no radiosensitizing effect on SiHa cells. (authors)
Effect of 17-AAG on radio-sensitivity of HeLa and V79 cells

International Nuclear Information System (INIS)

Pan Yanling; Hong Chengjiao; Zhang Baoguo

2010-01-01

In order to investigate the radio-sensitizing effect of 17-AAG, an inhibitor of Heat Shock Protein 90, on human Uterine Cervix Cancer HeLa and V79 cells, Clonogenic assay was used to observe the cell survival rate. The results show that 17-AAG can decrease obviously (p 0.05). This indicates that 17-AAG may enhance the radio-sensitivity of the HeLa cell line and has no effect on the V79 cell line. (authors)
Early RNA of adenovirus type 3 in permissive and abortive infections.

OpenAIRE

Groff, D E; Daniell, E

1981-01-01

Early adenovirus type 3 cytoplasmic polyadenylated RNAs from HeLa and BHK-21 cells were detected and mapped on the viral genome by gel blotting and hybridization techniques. The sizes and locations of the 16 adenovirus type 3 RNAs were identical in the two cell types, although relative molarities of the various RNA species differed. Each of the early adenovirus type 3 RNAs was associated with polysomes in both cell types, suggesting that the abortive infection of hamster cells does not result...
Irradiation And Papillomavirus E2 Proteins On Hela Cells

International Nuclear Information System (INIS)

Abderrafi, B.

2005-01-01

Exposure to relatively high doses ionizing radiation activates cellular responses that impair cell survival. These responses, for which the p53 protein plays a central role, form the basis for cancer radiotherapy. However, the efficacy of radiation treatments on cell killing is often reduced as a consequence of the frequent inactivation of the p53 protein in cancer cells. Loss of p53 protein is associated with later stages of most human tumors and resistance to anticancer agents. Carcinomas are frequent malignant tumors in humans. The majority of cervical carcinomas are etiologically linked to the presence of HPV virus (Human Papillomavirus). In carcinoma tumor cells, as well as in their derived-cell lines such as HeLa cells, the p53 protein is generally not detected due to its degradation by the product of the HPV-associated oncogenic E6 gene. Another characteristic of HPV-positive cervical cancer cells is the loss of the regulatory viral E2 gene expression as a consequence of viral DNA integration into the cellular genome. Reintroduction of E2 expression in HeLa cells reactivates p53, due to a negative effect on the expression of E6 protein, with a concomitant arrest of cell proliferation at the phase G1 of the cell cycle and delay in cell division via the repression of E2F-target genes. To elucidate whether reactivation of p53 would improve the cell killing effect of ionizing radiation in cancer cells, we studied the combined effects of radiation and E2 expression on the cell cycle distribution in HeLa cells
Proteomic investigation into betulinic acid-induced apoptosis of human cervical cancer HeLa cells.

Science.gov (United States)

Xu, Tao; Pang, Qiuying; Zhou, Dong; Zhang, Aiqin; Luo, Shaman; Wang, Yang; Yan, Xiufeng

2014-01-01

Betulinic acid is a pentacyclic triterpenoid that exhibits anticancer functions in human cancer cells. This study provides evidence that betulinic acid is highly effective against the human cervical cancer cell line HeLa by inducing dose- and time-dependent apoptosis. The apoptotic process was further investigated using a proteomics approach to reveal protein expression changes in HeLa cells following betulinic acid treatment. Proteomic analysis revealed that there were six up- and thirty down-regulated proteins in betulinic acid-induced HeLa cells, and these proteins were then subjected to functional pathway analysis using multiple analysis software. UDP-glucose 6-dehydrogenase, 6-phosphogluconate dehydrogenase decarboxylating, chain A Horf6-a novel human peroxidase enzyme that involved in redox process, was found to be down-regulated during the apoptosis process of the oxidative stress response pathway. Consistent with our results at the protein level, an increase in intracellular reactive oxygen species was observed in betulinic acid-treated cells. The proteins glucose-regulated protein and cargo-selection protein TIP47, which are involved in the endoplasmic reticulum pathway, were up-regulated by betulinic acid treatment. Meanwhile, 14-3-3 family proteins, including 14-3-3β and 14-3-3ε, were down-regulated in response to betulinic acid treatment, which is consistent with the decrease in expression of the target genes 14-3-3β and 14-3-3ε. Furthermore, it was found that the antiapoptotic bcl-2 gene was down-regulated while the proapoptotic bax gene was up-regulated after betulinic acid treatment in HeLa cells. These results suggest that betulinic acid induces apoptosis of HeLa cells by triggering both the endoplasmic reticulum pathway and the ROS-mediated mitochondrial pathway.
Three-dimensional printing of Hela cells for cervical tumor model in vitro

International Nuclear Information System (INIS)

Zhao, Yu; Yao, Rui; Ouyang, Liliang; Ding, Hongxu; Zhang, Ting; Sun, Wei; Zhang, Kaitai; Cheng, Shujun

2014-01-01

Advances in three-dimensional (3D) printing have enabled the direct assembly of cells and extracellular matrix materials to form in vitro cellular models for 3D biology, the study of disease pathogenesis and new drug discovery. In this study, we report a method of 3D printing for Hela cells and gelatin/alginate/fibrinogen hydrogels to construct in vitro cervical tumor models. Cell proliferation, matrix metalloproteinase (MMP) protein expression and chemoresistance were measured in the printed 3D cervical tumor models and compared with conventional 2D planar culture models. Over 90% cell viability was observed using the defined printing process. Comparisons of 3D and 2D results revealed that Hela cells showed a higher proliferation rate in the printed 3D environment and tended to form cellular spheroids, but formed monolayer cell sheets in 2D culture. Hela cells in 3D printed models also showed higher MMP protein expression and higher chemoresistance than those in 2D culture. These new biological characteristics from the printed 3D tumor models in vitro as well as the novel 3D cell printing technology may help the evolution of 3D cancer study. (paper)
Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

Science.gov (United States)

Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

2015-06-01

Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Mapping and identification of HeLa cell proteins separated by immobilized pH-gradient two-dimensional gel electrophoresis and construction of a two-dimensional polyacrylamide gel electrophoresis database

DEFF Research Database (Denmark)

Shaw, AC; Rossel Larsen, M; Roepstorff, P

1999-01-01

The HeLa cell line, a human adenocarcinoma, is used in many research fields, since it can be infected with a wide range of viruses and intracellular bacteria. Therefore, the mapping of HeLa cell proteins is useful for the investigation of parasite host cell interactions. Because of the recent imp...... these and future data accessible for interlaboratory comparison, we constructed a 2-D PAGE database on the World Wide Web....... the mapping of [35S]methionine/cysteine-labeled HeLa cell proteins with the 2-D PAGE (IPG)-system, using matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) and N-terminal sequencing for protein identification. To date 21 proteins have been identified and mapped. In order to make...
Pennogenyl Saponins from Paris quadrifolia L. Induce Extrinsic and Intrinsic Pathway of Apoptosis in Human Cervical Cancer HeLa Cells

Science.gov (United States)

Stefanowicz-Hajduk, Justyna; Bartoszewski, Rafal; Bartoszewska, Sylwia; Kochan, Kinga; Adamska, Anna; Kosiński, Igor; Ochocka, J. Renata

2015-01-01

Pennogenyl saponins are the active compounds of large number of plant species and consequently many polyherbal formulations. Hence, great interest has been shown in their characterization and in the investigation of their pharmacological and biological properties, especially anticancer. This present study reports on the evaluation of cytotoxic effects and explanation of the molecular mechanisms of action of the two pennogenyl saponins (PS 1 and PS 2) isolated from Paris quadrifolia L. rhizomes on human cervical adenocarcinoma cell line HeLa. To determine the viability of the cells treated with the compounds we used real-time cell proliferation analysis and found that the pennogenyl saponins PS 1 and PS 2 strongly inhibited the tumor cells growth with IC50 values of 1.11 ± 0.04 μg/ml and 0.87 ± 0.05 μg/ml, respectively. The flow cytometry analysis indicated that the two compounds induced apoptosis in a dose-dependent manner and decreased mitochondrial membrane potential in HeLa cells in the early stage of apoptosis. Quantitative PCR and Western Blot analysis showed that the two saponins significantly increased mRNA expression of FADD and BID as well as induced caspase-8 via increased of procaspase-8 processing in the treated cells. The results of this study suggest that both the extrinsic death receptor and intrinsic mitochondrial pathways are involved in the programmed cell death. PMID:26295969
Time-course of 5-HT(6) receptor mRNA expression during memory consolidation and amnesia.

Science.gov (United States)

Huerta-Rivas, A; Pérez-García, G; González-Espinosa, C; Meneses, A

2010-01-01

Growing evidence indicates that antagonists of the 5-hydroxytryptamine (serotonin) receptor(6) (5-HT(6)) improve memory and reverse amnesia although the mechanisms involved are poorly understood. Hence, in this paper RT-PCR was used to evaluate changes in mRNA expression of 5-HT(6) receptor in trained and untrained rats treated with the 5-HT(6) receptor antagonist SB-399885 and amnesic drugs scopolamine or dizocilpine. Changes in mRNA expression of 5-HT(6) receptor were investigated at different times in prefrontal cortex, hippocampus and striatum. Data indicated that memory in the Pavlovian/instrumental autoshaping task was a progressive process associated to reduced mRNA expression of 5-HT(6) receptor in the three structures examined. SB-399885 improved long-term memory at 48h, while the muscarinic receptor antagonist scopolamine or the non-competitive NMDA receptor antagonist dizocilpine impaired it at 24h. Autoshaping training and treatment with SB-399885 increased 5-HT(6) receptor mRNA expression in (maximum increase) prefrontal cortex and striatum, 24 or 48h. The scopolamine-induced amnesia suppressed 5-HT(6) receptor mRNA expression while the dizocilpine-induced amnesia did not modify 5-HT(6) receptor mRNA expression. SB-399885 and scopolamine or dizocilpine were able to reestablish memory and 5-HT(6) receptor mRNA expression. These data confirmed previous memory evidence and of more interest is the observation that training, SB-399885 and amnesic drugs modulated 5-HT(6) receptor mRNA expression in prefrontal cortex, hippocampus and striatum. Further investigation in different memory tasks, times and amnesia models together with more complex control groups might provide further clues. Copyright 2009 Elsevier Inc. All rights reserved.
Lethal response of HeLa cells to x irradiation in the latter part of the generation cycle

International Nuclear Information System (INIS)

Griffith, T.D.; Tolmach, L.J.

1976-01-01

The age-response for the killing of HeLa S3 cells by x rays during the latter part of the generation cycle has been examined in detail. As synchronous cells move from the G1/S boundary through S phase, the relatively high sensitivity of late G1 cells gradually decreases; minimum sensitivity is reached in mid-S and maintained during the remainder of that phase. The response of cells as they progress from S to the point in G2 at which they are temporarily arrested by radiation (or by inhibitors of protein synthesis) was measured in populations free of both S phase cells and late G2 cells that had passed the arrest point: cells retain their high resistance from early G2 up to the arrest point. The response of G2 cells that have passed the arrest point before being irradiated was examined by exposing randomly growing cultures to x rays and collecting cells periodically thereafter, as they entered mitosis. Survival values very close to those of sensitive mitotic cells were found in the 2 h period after irradiation during which unarrested cells continued to reach mitosis. Values typical of late S/early G2 were found only after cells that had been arrested began arriving at mitosis. Thus, HeLa S3 cells undergo an abrupt increase in sensitivity at or near the arrest point. The sensitivity to a second irradiation of cells arrested in G2 by a conditioning x-ray dose increases rapidly in the early part of the arrest period
In vitro studies of the toxic effects of silver nanoparticles on HeLa and U937 cells

Directory of Open Access Journals (Sweden)

Kaba SI

2015-03-01

Full Text Available Said I Kaba, Elena M Egorova Institute of General Pathology and Pathophysiology, Moscow, Russia Abstract: In the last decade, much attention has been paid to studies of the effect of silver nanoparticles (Ag NPs on tumor cells. Apart from elucidation of the mechanism of NPs’ interaction with mammalian cells, these studies are aimed at discovering new effective antitumor drugs. In this work, we report about the toxic effects of Ag NPs observed on two types of tumor cells: HeLa (adhesive cells and U937 (suspension cells. The Ag NPs were obtained by an original method of biochemical synthesis. Particle size was 13.2±4.72 nm, and zeta potential was -61.9±3.2 mV. The toxicity of Ag NPs in the concentration range 0.5–8.0 µg Ag/mL was determined by means of 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide assay and cytofluorometry after 4 and 24 hours' incubation. It was found that Ag NPs had high toxicity toward both cell types. The minimal concentrations where a toxicity effect was registered (toxicity thresholds lied in the range 0.5–2.0 µg Ag/mL. In parallel with the Ag NP solution, cells were incubated with water solutions of the NP stabilizer (aerosol-OT and Ag+ ions (as silver nitrate. It was shown that aerosol-OT had no effect on the viability on HeLa cells, but was moderately toxic toward U937, though less dangerous for these cells than Ag NPs. With Ag+ ions, for HeLa no toxic effect was observed, while for U937 they were as toxic as the Ag NPs. The data obtained indicate that Ag NPs as used in this study may prove to be useful for the creation of medicines for cancer therapy. Keywords: silver nanoparticles, cell viability, apoptosis, tumor cells

Some links on this page may take you to non-federal websites. Their policies may differ from this site.