WorldWideScience

Sample records for hela 5s rna

  1. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    International Nuclear Information System (INIS)

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-01-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules

  2. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  3. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  4. Eukaryotic 5S rRNA biogenesis

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  5. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  6. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  7. Increased 5S rRNA oxidation in Alzheimer's disease.

    Science.gov (United States)

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  8. 5S rRNA-derived and tRNA-derived SINEs in fruit bats.

    Science.gov (United States)

    Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A

    2009-05-01

    Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.

  9. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  10. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  11. Genetic and epigenetic variation in 5S ribosomal RNA genes reveals genome dynamics in Arabidopsis thaliana.

    Science.gov (United States)

    Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V

    2018-04-06

    Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.

  12. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  13. Time of action of 4.5 S RNA in Escherichia coli translation

    DEFF Research Database (Denmark)

    Brown, S

    1989-01-01

    A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...

  14. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  16. How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?

    International Nuclear Information System (INIS)

    Pelczar, P.; Fiett, J.; Bartnik, E.

    1994-01-01

    We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig

  17. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  18. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry

    DEFF Research Database (Denmark)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....

  19. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    Science.gov (United States)

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  20. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    Science.gov (United States)

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  1. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells

    Directory of Open Access Journals (Sweden)

    Giuseppe Fiume

    2016-11-01

    Full Text Available The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03% of 63,128 mapped transcripts were differentially expressed in IBTK-shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7% and 698 downregulated (54.3% RNAs. In K562 cells, 1959 (3.1% of 63128 mapped RNAs were differentially expressed in IBTK-shRNA-transduced cells, including 1053 upregulated (53.7% and 906 downregulated (46.3%. Only 137 transcripts (0.22% were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3′- and 5′-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  2. IBTK Differently Modulates Gene Expression and RNA Splicing in HeLa and K562 Cells.

    Science.gov (United States)

    Fiume, Giuseppe; Scialdone, Annarita; Rizzo, Francesca; De Filippo, Maria Rosaria; Laudanna, Carmelo; Albano, Francesco; Golino, Gaetanina; Vecchio, Eleonora; Pontoriero, Marilena; Mimmi, Selena; Ceglia, Simona; Pisano, Antonio; Iaccino, Enrico; Palmieri, Camillo; Paduano, Sergio; Viglietto, Giuseppe; Weisz, Alessandro; Scala, Giuseppe; Quinto, Ileana

    2016-11-07

    The IBTK gene encodes the major protein isoform IBTKα that was recently characterized as substrate receptor of Cul3-dependent E3 ligase, regulating ubiquitination coupled to proteasomal degradation of Pdcd4, an inhibitor of translation. Due to the presence of Ankyrin-BTB-RCC1 domains that mediate several protein-protein interactions, IBTKα could exert expanded regulatory roles, including interaction with transcription regulators. To verify the effects of IBTKα on gene expression, we analyzed HeLa and K562 cell transcriptomes by RNA-Sequencing before and after IBTK knock-down by shRNA transduction. In HeLa cells, 1285 (2.03%) of 63,128 mapped transcripts were differentially expressed in IBTK -shRNA-transduced cells, as compared to cells treated with control-shRNA, with 587 upregulated (45.7%) and 698 downregulated (54.3%) RNAs. In K562 cells, 1959 (3.1%) of 63128 mapped RNAs were differentially expressed in IBTK -shRNA-transduced cells, including 1053 upregulated (53.7%) and 906 downregulated (46.3%). Only 137 transcripts (0.22%) were commonly deregulated by IBTK silencing in both HeLa and K562 cells, indicating that most IBTKα effects on gene expression are cell type-specific. Based on gene ontology classification, the genes responsive to IBTK are involved in different biological processes, including in particular chromatin and nucleosomal organization, gene expression regulation, and cellular traffic and migration. In addition, IBTK RNA interference affected RNA maturation in both cell lines, as shown by the evidence of alternative 3'- and 5'-splicing, mutually exclusive exons, retained introns, and skipped exons. Altogether, these results indicate that IBTK differently modulates gene expression and RNA splicing in HeLa and K562 cells, demonstrating a novel biological role of this protein.

  3. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  4. The positive transcription factor of the 5S RNA gene proteolyses during direct exchange between 5S DNA sites

    OpenAIRE

    1986-01-01

    We have examined the association, dissociation, and exchange of the 5S specific transcription factor (TFIIIA) with somatic- and oocyte-type 5S DNA. The factor associates faster with somatic than with oocyte 5S DNA, and the rate of complex formation is accelerated by vector DNA. Once formed, the TFIIIA-5S DNA complex is stable for greater than 4 h in the absence of free 5S DNA, and its dissociation is identical for somatic and for oocyte 5S DNA. In the presence of free 5S DNA, the factor trans...

  5. [RNA interference of HERC4 inhibits proliferation, apoptosis and migration of cervical cancer Hela cells].

    Science.gov (United States)

    Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo

    2016-02-20

    To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (PHela cells, increased the apoptosis rate (PHela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.

  6. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  7. Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

    NARCIS (Netherlands)

    Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

    2012-01-01

    Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

  8. Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

    Science.gov (United States)

    Kamina, Anyango D; Williams, Noreen

    2017-01-01

    RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

  9. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  10. The 4.5 S RNA gene of Escherichia coli is essential for cell growth

    DEFF Research Database (Denmark)

    Brown, S; Fournier, M J

    1984-01-01

    The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...

  11. Identification of CELF1 RNA targets by CLIP-seq in human HeLa cells

    Directory of Open Access Journals (Sweden)

    Olivier Le Tonquèze

    2016-06-01

    Full Text Available The specific interactions between RNA-binding proteins and their target RNAs are an essential level to control gene expression. By combining ultra-violet cross-linking and immunoprecipitation (CLIP and massive SoliD sequencing we identified the RNAs bound by the RNA-binding protein CELF1, in human HeLa cells. The CELF1 binding sites deduced from the sequence data allow characterizing specific features of CELF1-RNA association. We present therefore the first map of CELF1 binding sites in human cells.

  12. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    Science.gov (United States)

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Methylation of nucleolar RNA in HeLa cells studied by autoradiography

    International Nuclear Information System (INIS)

    Cervera, J.; Martinez, A.; Renau-Piqueras, J.

    1984-01-01

    Methylation of nucleolar RNA was studied by autoradiography in HeLa cells using L-[methyl- 3 H]methionine and S-adenosyl-L-[methyl- 3 H]methionine as radioactive precursors. Pulse-labeling experiments show that nucleolar RNA methylation occurs on the newly synthesized RNA at the nucleolar fibrillar RNP component and mostly on the fibrillar ring of fibrillar centers, where pre-rRNA is being synthesized. Pulse-chase experiments show a shift of silver grains from the nucleolar fibrillar RNP component to the nucleolar granular component first and then to the cytoplasm. Labeling of nucleolar RNA via specific methylation permits the study of intranucleolar processing of pre-rRNA and confirms the sequence of labeling of the two nucleolar RNP components observed with radioactive uridine

  14. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    Science.gov (United States)

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  15. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    Science.gov (United States)

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-02-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.

  16. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    Science.gov (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  17. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  18. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  19. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    Science.gov (United States)

    Leontis, N B; Westhof, E

    1998-09-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  20. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  1. Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons

    NARCIS (Netherlands)

    Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,

  2. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    Science.gov (United States)

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  3. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    Science.gov (United States)

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  4. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    Science.gov (United States)

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  5. The Conserved RNA Exonuclease Rexo5 Is Required for 3′ End Maturation of 28S rRNA, 5S rRNA, and snoRNAs

    Directory of Open Access Journals (Sweden)

    Stefanie Gerstberger

    2017-10-01

    Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.

  6. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  7. The invasion of tobacco mosaic virus RNA induces endoplasmic reticulum stress-related autophagy in HeLa cells

    Science.gov (United States)

    Li, Li; Wang, Li; Xiao, Ruijing; Zhu, Guoguo; Li, Yan; Liu, Changxuan; Yang, Ru; Tang, Zhiqing; Li, Jie; Huang, Wei; Chen, Lang; Zheng, Xiaoling; He, Yuling; Tan, Jinquan

    2011-01-01

    The ability of human cells to defend against viruses originating from distant species has long been ignored. Owing to the pressure of natural evolution and human exploration, some of these viruses may be able to invade human beings. If their ‘fresh’ host had no defences, the viruses could cause a serious pandemic, as seen with HIV, SARS (severe acute respiratory syndrome) and avian influenza virus that originated from chimpanzees, the common palm civet and birds, respectively. It is unknown whether the human immune system could tolerate invasion with a plant virus. To model such an alien virus invasion, we chose TMV (tobacco mosaic virus) and used human epithelial carcinoma cells (HeLa cells) as its ‘fresh’ host. We established a reliable system for transfecting TMV-RNA into HeLa cells and found that TMV-RNA triggered autophagy in HeLa cells as shown by the appearance of autophagic vacuoles, the conversion of LC3-I (light chain protein 3-I) to LC3-II, the up-regulated expression of Beclin1 and the accumulation of TMV protein on autophagosomal membranes. We observed suspected TMV virions in HeLa cells by TEM (transmission electron microscopy). Furthermore, we found that TMV-RNA was translated into CP (coat protein) in the ER (endoplasmic reticulum) and that TMV-positive RNA translocated from the cytoplasm to the nucleolus. Finally, we detected greatly increased expression of GRP78 (78 kDa glucose-regulated protein), a typical marker of ERS (ER stress) and found that the formation of autophagosomes was closely related to the expanded ER membrane. Taken together, our data indicate that HeLa cells used ERS and ERS-related autophagy to defend against TMV-RNA. PMID:21729006

  8. Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?

    DEFF Research Database (Denmark)

    Christiansen, J; Douthwaite, S R; Christensen, A

    1985-01-01

    Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...

  9. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  10. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Terao, K.; Uchiumi, T.; Ogata, K.

    1980-01-01

    After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)

  12. In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes

    International Nuclear Information System (INIS)

    Schubert, I.; Baeumlein, H.; Wobus, U.

    1978-01-01

    In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)

  13. Evolution of green plants as deduced from 5S rRNA sequences.

    Science.gov (United States)

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  14. Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

    Science.gov (United States)

    Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

    2017-11-01

    Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

  15. Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells

    International Nuclear Information System (INIS)

    Takeda, N.; Kuhn, R.J.; Yang, C.F.; Takegami, T.; Wimmer, E.

    1986-01-01

    An in vitro poliovirus RNA-synthesizing system derived from a crude membrance fraction of infected HeLa cells was used to analyze the mechanism of initiation of poliovirus plus-strand RNA synthesis. This system contains an activity that synthesizes the nucleotidyl proteins VPg-pU and VPg-pUpU. These molecules represent the 5'-terminal structure of nascent RNA molecules and of virion RNA. The membranous replication complex is also capable of synthesizing mucleotidyl proteins containing nine or more of the poliovirus 5'-proximal nucleotides as assayed by the formation of the RNase T 1 -resistant oligonucleotide VPg-pUUAAAACAGp or by fingerprint analysis of the in vitro-synthesized 32 P-RNA. Incubation of preformed VPg-pUpU with unlabeled nucleoside triphosphates resulted in the formation of VPg-pUUAAAACAGp. This reaction, which appeared to be an elongation of VPg-pUpU, was stimulated by the addition of a soluble fraction (S-10) obtained from uninfected HeLa cells. Preformed VPg-pU could be chased into VPg-pUpU in the presence of UTP. The data are consistent with a model that VPg-pU can function as a primer for poliovirus plus-strand RNA synthesis in the membranous replication complex and that the elongation reaction may be stimulated by a host cellular factor

  16. tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.

    Directory of Open Access Journals (Sweden)

    Mayumi Okamoto

    2014-09-01

    Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.

  17. A ribonuclease-resistant region of 5S RNA and its relation to the RNA binding sites of proteins L18 and L25

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A; Wagner, R

    1979-01-01

    An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....

  18. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    Science.gov (United States)

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  19. Evolution of primary and secondary structures in 5S and 5.8S rRNA

    International Nuclear Information System (INIS)

    Curtiss, W.C.

    1986-01-01

    The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented

  20. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    Science.gov (United States)

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  1. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  2. Chromosomal loop/nuclear matrix organization of transcriptionally active and inactive RNA polymerases in HeLa nuclei.

    Science.gov (United States)

    Roberge, M; Dahmus, M E; Bradbury, E M

    1988-06-05

    The relative distribution of transcriptionally active and inactive RNA polymerases I and II between the nuclear matrix/scaffold and chromosomal loops of HeLa cells was determined. Total RNA polymerase was assessed by immunoblotting and transcribing RNA polymerase by a photoaffinity labeling technique in isolated nuclei. Nuclear matrix/scaffold was isolated by three methods using high-salt, intermediate-salt or low-salt extraction. The distribution of RNA polymerases I and II were very similar within each of the methods, but considerable differences in distributions were found between the different preparation methods. Either intermediate-salt or high-salt treatment of DNase I-digested nuclei showed significant association of RNA polymerases with the nuclear matrix. However, intermediate-salt followed by high-salt treatment released all transcribing and non-transcribing RNA polymerases. Nuclear scaffolds isolated with lithium diiodosalicylate (low-salt) contained very little of the RNA polymerases. This treatment, however, caused the dissociation of RNA polymerase II transcription complexes. These results show unambiguously that RNA polymerases, both in their active and inactive forms, are not nuclear matrix proteins. The data support models in which the transcriptional machinery moves around DNA loops during transcription.

  3. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    Science.gov (United States)

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  4. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    Science.gov (United States)

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  5. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  6. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  7. Adenovirus DNA replication in vitro is stimulated by RNA from uninfected HeLa cells

    NARCIS (Netherlands)

    Vliet, P.C. van der; Dam, D. van; Kwant, M.M.

    1984-01-01

    Adenovirus DNA replication was studied in a partially reconstituted system consisting of purified viral proteins (DNA-binding protein, precursor terminal protein and Ad DNA polymerase) and a nuclear extract from uninfected HeLa cells. Optimal DNA replication required the presence of a heat-stable,

  8. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth

    Directory of Open Access Journals (Sweden)

    Stern David B

    2010-09-01

    Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  9. Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.

    OpenAIRE

    Kirpekar, F; Douthwaite, S; Roepstorff, P

    2000-01-01

    We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of post...

  10. Effects of mutation on the downfield proton nuclear magnetic resonance spectrum of the 5S RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Moore, P.B.

    1987-01-01

    The imino proton spectra of several mutants of the 5S RNA of Escherichia coli are compared with that of the wild type. Three of the variants discussed are point mutations, and the fourth is a deletion mutant lacking bases 11-69 of the parent sequence, all obtained by site-directed mutagenesis techniques. The spectroscopic effects of mutation are limited in all cases, and the differences between normal and mutant spectra can be used to make or confirm the assignments of resonances. Several new assignments in the 5S spectrum are reported. Spectroscopic differences due to sequence differences permit the products of single genes within the 5S gene family to be distinguished and their fates followed by NMR

  11. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA

    DEFF Research Database (Denmark)

    Ostergaard, P; Phan, H; Johansen, L B

    1998-01-01

    The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....

  13. Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

    Science.gov (United States)

    Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

    2009-02-01

    Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

  14. Quantitative Proteomics Analysis Reveals Novel Insights into Mechanisms of Action of Long Noncoding RNA Hox Transcript Antisense Intergenic RNA (HOTAIR) in HeLa Cells*

    Science.gov (United States)

    Zheng, Peng; Xiong, Qian; Wu, Ying; Chen, Ying; Chen, Zhuo; Fleming, Joy; Gao, Ding; Bi, Lijun; Ge, Feng

    2015-01-01

    Long noncoding RNAs (lncRNAs), which have emerged in recent years as a new and crucial layer of gene regulators, regulate various biological processes such as carcinogenesis and metastasis. HOTAIR (Hox transcript antisense intergenic RNA), a lncRNA overexpressed in most human cancers, has been shown to be an oncogenic lncRNA. Here, we explored the role of HOTAIR in HeLa cells and searched for proteins regulated by HOTAIR. To understand the mechanism of action of HOTAIR from a systems perspective, we employed a quantitative proteomic strategy to systematically identify potential targets of HOTAIR. The expression of 170 proteins was significantly dys-regulated after inhibition of HOTAIR, implying that they could be potential targets of HOTAIR. Analysis of this data at the systems level revealed major changes in proteins involved in diverse cellular components, including the cytoskeleton and the respiratory chain. Further functional studies on vimentin (VIM), a key protein involved in the cytoskeleton, revealed that HOTAIR exerts its effects on migration and invasion of HeLa cells, at least in part, through the regulation of VIM expression. Inhibition of HOTAIR leads to mitochondrial dysfunction and ultrastructural alterations, suggesting a novel role of HOTAIR in maintaining mitochondrial function in cancer cells. Our results provide novel insights into the mechanisms underlying the function of HOTAIR in cancer cells. We expect that the methods used in this study will become an integral part of functional studies of lncRNAs. PMID:25762744

  15. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  16. Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003

  17. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    Science.gov (United States)

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  18. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  19. Mutations in the gene for EF-G reduce the requirement for 4.5S RNA in the growth of E. coli

    DEFF Research Database (Denmark)

    Brown, S

    1987-01-01

    A general strategy is described for the isolation of suppressors of essential genes whose functions are unknown. This strategy was used to analyze the role of 4.5S RNA, an essential RNA of E. coli. In this strategy, the structural gene for 4.5S RNA is fused to the Ptac promoter in such a way...... that the strain becomes dependent upon inducers of lac for growth. Mutants mapping to fus, the structural gene for protein synthesis elongation factor G, appear as spontaneous, inducer-independent revertants. These mutants alter the intracellular distribution of 4.5S RNA such that it sediments at 70S or greater....... Furthermore, the increased sedimentation velocity is sensitive to the antibiotic puromycin. These results show that 4.5S RNA physically associates with the ribosome in performing its essential function, and that this association is mediated by elongation factor G....

  20. Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro

    Directory of Open Access Journals (Sweden)

    Wimmer Eckard

    2005-11-01

    Full Text Available Abstract Poliovirus protein 3CDpro possesses both proteinase and RNA binding activities, which are located in the 3Cpro domain of the protein. The RNA polymerase (3Dpol domain of 3CDpro modulates these activities of the protein. We have recently shown that the level of 3CDpro in HeLa cell-free in vitro translation-RNA replication reactions is suboptimal for efficient virus production. However, the addition of either 3CDpro mRNA or of purified 3CDpro protein to in vitro reactions, programmed with viral RNA, results in a 100-fold increase in virus yield. Mutational analyses of 3CDpro indicated that RNA binding by the 3Cpro domain and the integrity of interface I in the 3Dpol domain of the protein are both required for function. The aim of these studies was to determine the exact step or steps at which 3CDpro enhances virus yield and to determine the mechanism by which this occurs. Our results suggest that the addition of extra 3CDpro to in vitro translation RNA-replication reactions results in a mild enhancement of both minus and plus strand RNA synthesis. By examining the viral particles formed in the in vitro reactions on sucrose gradients we determined that 3CDpro has only a slight stimulating effect on the synthesis of capsid precursors but it strikingly enhances the maturation of virus particles. Both the stimulation of RNA synthesis and the maturation of the virus particles are dependent on the presence of an intact RNA binding site within the 3Cpro domain of 3CDpro. In addition, the integrity of interface I in the 3Dpol domain of 3CDpro is required for efficient production of mature virus. Surprisingly, plus strand RNA synthesis and virus production in in vitro reactions, programmed with full-length transcript RNA, are not enhanced by the addition of extra 3CDpro. Our results indicate that the stimulation of RNA synthesis and virus maturation by 3CDpro in vitro is dependent on the presence of a VPg-linked RNA template.

  1. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  2. Polynucleotide Phosphorylase, RNase E/G, and YbeY Are Involved in the Maturation of 4.5S RNA in Corynebacterium glutamicum.

    Science.gov (United States)

    Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki

    2017-03-01

    Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in

  3. Systems biology approach to transplant tolerance: proof of concept experiments using RNA interference (RNAi) to knock down hub genes in Jurkat and HeLa cells in vitro.

    Science.gov (United States)

    Lwin, Wint Wah; Park, Ken; Wauson, Matthew; Gao, Qin; Finn, Patricia W; Perkins, David; Khanna, Ajai

    2012-07-01

    Systems biology is gaining importance in studying complex systems such as the functional interconnections of human genes [1]. To investigate the molecular interactions involved in T cell immune responses, we used databases of physical gene-gene interactions to constructed molecular interaction networks (interconnections) with R language algorithms. This helped to identify highly interconnected "hub" genes AT(1)P5C1, IL6ST, PRKCZ, MYC, FOS, JUN, and MAPK1. We hypothesized that suppression of these hub genes in the gene network would result in significant phenotypic effects on T cells and examined this in vitro. The molecular interaction networks were then analyzed and visualized with Cytoscape. Jurkat and HeLa cells were transfected with siRNA for the selected hub genes. Cell proliferation was measured using ATP luminescence and BrdU labeling, which were measured 36, 72, and 96 h after activation. Following T cell stimulation, we found a significant decrease in ATP production (P cells. However, HeLa cells showed a significant (P cell proliferation when the genes MAPK1, IL6ST, ATP5C1, JUN, and FOS were knocked down. In both Jurkat and HeLa cells, targeted gene knockdown using siRNA showed decreased cell proliferation and ATP production in both Jurkat and HeLa cells. However, Jurkat T cells and HELA cells use different hub genes to regulate activation responses. This experiment provides proof of principle of applying siRNA knockdown of T cell hub genes to evaluate their proliferative capacity and ATP production. This novel concept outlines a systems biology approach to identify hub genes for targeted therapeutics. Published by Elsevier Inc.

  4. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    Science.gov (United States)

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  5. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    Science.gov (United States)

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  6. MicroRNA-433 negatively regulates the expression of thymidylate synthase (TYMS) responsible for 5-fluorouracil sensitivity in HeLa cells

    International Nuclear Information System (INIS)

    Gotanda, Keisuke; Hirota, Takeshi; Matsumoto, Nozomi; Ieiri, Ichiro

    2013-01-01

    Thymidylate synthase (TYMS) is an important folate-dependent enzyme in DNA synthesis and an important target for cancer chemotherapy. High TYMS expression levels in tumors are generally associated with resistance to 5-fluorouracil (5-FU). The cause of the variability in TYMS expression is still not fully understood, however, only a small proportion of the TYMS expression can be explained by TYMS genetic polymorphisms. The purpose of this study is to identify novel microRNAs (miRNAs) which regulate the expression of TYMS and to determine whether miRNAs binding to the 3′-untranslated region (UTR) of TYMS mRNA affect the proliferation of HeLa cells treated with 5-FU. An in silico search was performed to find potential binding sites of miRNAs in TYMS mRNA. The efficacy of predicted miRNAs at the 3′-UTR of TYMS mRNA was evaluated using a dual-luciferase reporter assay. TYMS mRNA and protein expression in HeLa cells was quantified with real-time RT-PCR and Western blotting, respectively. The effects of miR-433 on cell proliferative activity were determined by WST-8 assay. The overexpression of miR-433 was associated with significantly decreased reporter activity in the plasmid containing the 3′-UTR of TYMS mRNA (P < 0.01). The levels of TYMS mRNA and protein in HeLa cells were significantly decreased by the overexpression of miR-433 (P < 0.05). Furthermore, miR-433 increased inhibition of cell proliferation in HeLa cells treated with 5-FU at over 2.0 μM. The results indicate that miR-433 post-transcriptionally regulates the expression of TYMS mRNA and protein, and increases sensitivity to 5-FU in HeLa cells. This is the first report showing that a miRNA regulating TYMS expression has a significant impact on sensitivity to 5-FU treatment

  7. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    Science.gov (United States)

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  8. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    Science.gov (United States)

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  9. Increased expression of cyclin B1 mRNA coincides with diminished G2-phase arrest in irradiated HeLa cells treated with staurosporine or caffeine

    International Nuclear Information System (INIS)

    Bernhard, E.J.; Maity, A.; McKenna, W.G.; Muschel, R.J.

    1994-01-01

    The irradiation of cells results in delayed progression through the G 2 phase of the cell cycle. Treatment of irradiated HeLa cells with caffeine greatly reduces the G 2 -phase delay, while caffeine does not alter progression of cells through the cell cycle in unirradiated cells. In this report we demonstrate that treatment of HeLa cells with the kinase inhibitor staurosporine, but not with the inhibitor H7, also results in a reduction of the G 2 -phase arrest after irradiation. Cell cycle progression in unirradiated cells is unaffected by 4.4 nM (2ng/ml) staurosporine, which releases the radiation-induced G 2 -phase arrest. In HeLa cells, the G 2 -phase delay after irradiation in S phase is accompanied by decreased expression of cyclin B1 mRNA. Coincident with the reduction in G 2 -phase delay, we observed an increase in cyclin B1 mRNA accumulation in irradiated, staurosporine-treated cells compared to cells treated with irradiation alone. Caffeine treatment of irradiated HeLa cells also resulted in an elevation in the levels of cyclin B1 message. These results support the hypothesis that diminished cyclin B1 mRNA levels influence G 2 -phase arrest to some degree. The findings that both staurosporine and caffeine treatments reverse the depression in cyclin B1 expression suggest that these two compounds may act on a common pathway of cell cycle control in response to radiation injury. 33 refs., 6 figs

  10. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  11. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  12. DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Willson Richard C

    2010-12-01

    Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use

  13. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  14. An elongated model of the Xenopus laevis transcription factor IIIA-5S ribosomal RNA complex derived from neutron scattering and hydrodynamic measurements

    International Nuclear Information System (INIS)

    Timmins, P.A.; Langowski, J.; Brown, R.S.

    1988-01-01

    The precise molecular composition of the Xenopus laevis TFIIIA-5S ribosomal RNA complex (7S particle) has been established from small angle neutron and dynamic light scattering. The molecular weight of the particle was found to be 95,700±10,000 and 86,700±9,000 daltons from these two methods respectively. The observed match point of 54.4% D 2 O obtained from contrast variation experiments indicates a 1:1 molar ratio. It is concluded that only a single molecule of TFIIIA, a zinc-finger protein, and of 5S RNA are present in this complex. A simple elongated cylindrical model with dimensions of 140 angstrom length and 59 angstrom diameter is compatible with the neutron results. A globular model can be excluded by the shallow nature of the neutron scattering curves. It is proposed that the observed difference of 15 angstrom in length between the 7S particle and isolated 5S RNA most likely indicates that part(s) of the protein protrudes from the end(s) of the RNA molecule. There is no biochemical evidence for any gross alteration in 5S RNA conformation upon binding to TFIIIA

  15. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  16. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  17. Effects of growth state and 3H labeling level on RNA turnover in WI-38 fibroblasts and HeLa cells

    International Nuclear Information System (INIS)

    Sameshima, M.; Schlessinger, D.

    1981-01-01

    The rate of turnover of prelabeled RNA in WI-38 human diploid fibroblasts varied with the level of 3 H incorporated, the cell density of cultures, and the arrest of growth by senescence. The half-life of RNA in sparse cultures of growing WI-38 diploid fibroblasts depended on the level of [ 3 H]uridine incorporated; extrapolated to zero levels of incorporation, the half-life was 15 to 20 days. At any level of incorporated [ 3 H]uridine, however, RNA half-life decreased to 4 to 5 days in superconfluent cultures as the culture growth slowed. A similar shortening of half-life was observed when growth was stopped by 3 H irradiation or clonal senescence. However, the rate of turnover was not simply dependent on whether cells were growing; for example, turnover did not increase when growth was arrested by incubating cells in conditioned medium. HeLa and L cells also showed an RNA half-life of about 14 to 20 days with an increase in turnover rate of crowded cultures. However, this increase occurred at higher cell densities than with the diploid fibroblasts. Also, the growth rate and rate of RNA turnover of HeLa and L cells were much less affected by incorporated 3 H. The differential responses to confluence and 3 H label can explain the higher turnover rate of RNA in normal human fibroblasts compared to SV40-transformed cells [S.A. Liebhaber, S. Wolf, and D. Schlessinger, Cell 13, 121-127 (1978)

  18. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    International Nuclear Information System (INIS)

    Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

    2015-01-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

  19. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

    2015-05-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

  20. Determination of the number of copies of genes coding for 5s-rRNA and tRNA in the genomes of 43 species of wheat and Aegilops

    International Nuclear Information System (INIS)

    Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.

    1986-01-01

    The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical

  1. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  2. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  3. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  4. Full-length single-cell RNA-seq applied to a viral human cancer: applications to HPV expression and splicing analysis in HeLa S3 cells.

    Science.gov (United States)

    Wu, Liang; Zhang, Xiaolong; Zhao, Zhikun; Wang, Ling; Li, Bo; Li, Guibo; Dean, Michael; Yu, Qichao; Wang, Yanhui; Lin, Xinxin; Rao, Weijian; Mei, Zhanlong; Li, Yang; Jiang, Runze; Yang, Huan; Li, Fuqiang; Xie, Guoyun; Xu, Liqin; Wu, Kui; Zhang, Jie; Chen, Jianghao; Wang, Ting; Kristiansen, Karsten; Zhang, Xiuqing; Li, Yingrui; Yang, Huanming; Wang, Jian; Hou, Yong; Xu, Xun

    2015-01-01

    Viral infection causes multiple forms of human cancer, and HPV infection is the primary factor in cervical carcinomas. Recent single-cell RNA-seq studies highlight the tumor heterogeneity present in most cancers, but virally induced tumors have not been studied. HeLa is a well characterized HPV+ cervical cancer cell line. We developed a new high throughput platform to prepare single-cell RNA on a nanoliter scale based on a customized microwell chip. Using this method, we successfully amplified full-length transcripts of 669 single HeLa S3 cells and 40 of them were randomly selected to perform single-cell RNA sequencing. Based on these data, we obtained a comprehensive understanding of the heterogeneity of HeLa S3 cells in gene expression, alternative splicing and fusions. Furthermore, we identified a high diversity of HPV-18 expression and splicing at the single-cell level. By co-expression analysis we identified 283 E6, E7 co-regulated genes, including CDC25, PCNA, PLK4, BUB1B and IRF1 known to interact with HPV viral proteins. Our results reveal the heterogeneity of a virus-infected cell line. It not only provides a transcriptome characterization of HeLa S3 cells at the single cell level, but is a demonstration of the power of single cell RNA-seq analysis of virally infected cells and cancers.

  5. Targeting of a chimeric human histone fusion mRNA to membrane-bound polysomes in HeLa cells

    International Nuclear Information System (INIS)

    Zambetti, G.; Stein, J.; Stein, G.

    1987-01-01

    The subcellular location of histone mRNA-containing polysomes may play a key role in the posttranscriptional events that mediate histone mRNA turnover following inhibition of DNA synthesis. Previously, it has been shown that histone mRNA is found primarily on free polysomes that are associated with the cytoskeleton. The authors report here the construction of an Escherichia coli pBR322 β-lactamase signal peptide-human H3 histone fusion gene. The fusion transcript is targeted to membrane-bound polysomes and remains stable following interruption of DNA replication. Relocating mRNA within the cell may provide a procedure for studying the posttranscriptional regulation of gene expression

  6. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Science.gov (United States)

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    Science.gov (United States)

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  8. SOT1, a pentatricopeptide repeat protein with a small MutS-related domain, is required for correct processing of plastid 23S-4.5S rRNA precursors in Arabidopsis thaliana.

    Science.gov (United States)

    Wu, Wenjuan; Liu, Sheng; Ruwe, Hannes; Zhang, Delin; Melonek, Joanna; Zhu, Yajuan; Hu, Xupeng; Gusewski, Sandra; Yin, Ping; Small, Ian D; Howell, Katharine A; Huang, Jirong

    2016-03-01

    Ribosomal RNA processing is essential for plastid ribosome biogenesis, but is still poorly understood in higher plants. Here, we show that SUPPRESSOR OF THYLAKOID FORMATION1 (SOT1), a plastid-localized pentatricopeptide repeat (PPR) protein with a small MutS-related domain, is required for maturation of the 23S-4.5S rRNA dicistron. Loss of SOT1 function leads to slower chloroplast development, suppression of leaf variegation, and abnormal 23S and 4.5S processing. Predictions based on the PPR motif sequences identified the 5' end of the 23S-4.5S rRNA dicistronic precursor as a putative SOT1 binding site. This was confirmed by electrophoretic mobility shift assay, and by loss of the abundant small RNA 'footprint' associated with this site in sot1 mutants. We found that more than half of the 23S-4.5S rRNA dicistrons in sot1 mutants contain eroded and/or unprocessed 5' and 3' ends, and that the endonucleolytic cleavage product normally released from the 5' end of the precursor is absent in a sot1 null mutant. We postulate that SOT1 binding protects the 5' extremity of the 23S-4.5S rRNA dicistron from exonucleolytic attack, and favours formation of the RNA structure that allows endonucleolytic processing of its 5' and 3' ends. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  9. Increased expression of cyclin B1 mRNA coincides with diminished G{sub 2}-phase arrest in irradiated HeLa cells treated with staurosporine or caffeine

    Energy Technology Data Exchange (ETDEWEB)

    Bernhard, E.J.; Maity, A.; McKenna, W.G.; Muschel, R.J. [Univ. of Pennsylvania School of Medicine, Philadelphia, PA (United States)

    1994-12-01

    The irradiation of cells results in delayed progression through the G{sub 2} phase of the cell cycle. Treatment of irradiated HeLa cells with caffeine greatly reduces the G{sub 2}-phase delay, while caffeine does not alter progression of cells through the cell cycle in unirradiated cells. In this report we demonstrate that treatment of HeLa cells with the kinase inhibitor staurosporine, but not with the inhibitor H7, also results in a reduction of the G{sub 2}-phase arrest after irradiation. Cell cycle progression in unirradiated cells is unaffected by 4.4 nM (2ng/ml) staurosporine, which releases the radiation-induced G{sub 2}-phase arrest. In HeLa cells, the G{sub 2}-phase delay after irradiation in S phase is accompanied by decreased expression of cyclin B1 mRNA. Coincident with the reduction in G{sub 2}-phase delay, we observed an increase in cyclin B1 mRNA accumulation in irradiated, staurosporine-treated cells compared to cells treated with irradiation alone. Caffeine treatment of irradiated HeLa cells also resulted in an elevation in the levels of cyclin B1 message. These results support the hypothesis that diminished cyclin B1 mRNA levels influence G{sub 2}-phase arrest to some degree. The findings that both staurosporine and caffeine treatments reverse the depression in cyclin B1 expression suggest that these two compounds may act on a common pathway of cell cycle control in response to radiation injury. 33 refs., 6 figs.

  10. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells.

    Science.gov (United States)

    Wang, Xinyu; Ren, Yanli; Wang, Zhiqiong; Xiong, Xiangyu; Han, Sichong; Pan, Wenting; Chen, Hongwei; Zhou, Liqing; Zhou, Changchun; Yuan, Qipeng; Yang, Ming

    2015-12-21

    5S rRNA plays an important part in ribosome biology and is over-expression in multiple cancers. In this study, we found that 5S rRNA is a direct target of miR-150 and miR-383 in esophageal squamous cell carcinoma (ESCC). Overexpression of miR-150 and miR-383 inhibited ESCC cell proliferation in vitro and in vivo. Moreover, 5S rRNA silencing by miR-150 and miR-383 might intensify rpL11-c-Myc interaction, which attenuated role of c-Myc as an oncogenic transcriptional factor and dysregulation of multiple c-Myc target genes. Taken together, our results highlight the involvement of miRNAs in ribosomal regulation during tumorigenesis. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  11. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  12. Fluorescent in situ hybridization of the ribosomal RNA genes (5S and 35S in the genus Lolium: Lolium canariense, the missing link with Festuca?

    Directory of Open Access Journals (Sweden)

    Inda, Luis A.

    2013-06-01

    Full Text Available Two groups of taxa can be distinguished within the genus Lolium L. based on the pollination system, chromosome size, chromosomal location of nrDNA (5S and 35S (18S-5.8S-26S] and nrDNA phylogeny. The first group includes self-pollinated taxa (L. temulentum, L. persicum and L. remotum, whereas the second group comprises cross-pollinated species (L. perenne, L. multiflorum and L. rigidum. Here we describe that the autogamous species have two 5S sites and four 35S sites in their genome. Two of the 35S sites are present in the chromosomes containing the 5S regions. The allogamous taxa possess two 5S rDNA sites and 6-10 35S sites per genome, depending on the species. Two of these regions (35S may also be present in the chromosomes bearing 5S sites. Our study also demonstrates that Lolium canariense shows a distinctive pattern. It has two 5S and four 35S sites. In this case, the 35S loci are located in different chromosomes than the 5S. This cytogenetic pattern is consistent with that of Festuca pratensis. Thus, despite being allogamous, Lolium canariense does not entirely fit in either of the groups defined for the genus Lolium. The physical mapping of the nrDNA regions in L. canariense is different, and resembles that of F. pratensis, suggesting that this Macaronesian Lolium could be intermediate between Festuca and Lolium.En trabajos previos se ha descrito que el género Lolium L. está formado por dos grupos de taxones basados en el tipo de polinización, tamaño de los cromosomas, localización cromosómica de los loci del ADN ribosómico [5S y 35S (18S-5.8S-26S] y filogenia molecular basada en secuencias de ADN ribosómico. Los dos grupos son: especies autógamas (L. temulentum, L. persicum y L. remotum y especies alógamas (L. perenne, L. multiflorum y L. rigidum. Aquí describimos que según la localización cromosómica de los loci ribosómicos, las especies autógamas tienen dos sitios 5S y cuatro sitios 35S; dos de las cuales coinciden en

  13. Mapping of the 18S and 5S ribosomal RNA genes in Astyanax altiparanae Garutti & Britski, 2000 (Teleostei, Characidae from the upper Paraná river basin, Brazil

    Directory of Open Access Journals (Sweden)

    Carlos Alexandre Fernandes

    2006-01-01

    Full Text Available Fluorescence in situ hybridization (FISH was undertaken in order to determinate the chromosomal distribution pattern of 18S and 5S ribosomal DNAs (rDNA in four populations of the characid fish Astyanax altiparanae from the upper Paraná river basin, Brazil. The 18S rDNA probe FISH revealed numerical and positional variations among specimens from the Keçaba stream compared to specimens of the other populations studied. In contrast to the variable 18S rDNA distribution pattern, highly stable chromosomal positioning of the 5S rDNA sites was observed in the four A. altiparanae populations. Divergence in the distribution pattern of 18S and 5S rDNA sites is also discussed.

  14. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    Science.gov (United States)

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  15. Four years of HELAS

    Science.gov (United States)

    Roth, M.; Lühe, O. v. d.; Aerts, C.; Christensen-Dalsgaard, J.; Corbard, T.; Daszyńska-Daszkiewicz, J.; Di Mauro, M. P.; Gizon, L.; Jiménez-Reyes, S.; Monteiro, M. J. P. F. G.; Pallé, P. L.; Thompson, M. J.

    2010-12-01

    The European Coordination Action on HELio- and ASteroseismology (HELAS) has completed its fourth and final year of initial funding by the European Commission. Set up as a network which combines solar and stellar physics communities in the important and vigorously evolving field of seismology, HELAS has been able to coordinate the efforts of European astronomers with remarkable success. Four large international conferences including the HELAS-IV conference on Lanzarote as well as many workshops were organized with a substantial contribution from HELAS. About a dozen workshops, addressing specialized questions in global and local helioseismology and asteroseismology were entirely organized by HELAS. Data analysis tools to prepare the European communities for the upcoming influx of data from new missions have been prepared, tested and demonstrated. Lecture notes and outreach material have been assembled and prepared for general access. As a result, HELAS has an important impact on the scientific output of the astrophysics seismology communities and significantly increased the visibility of European research in this field. This paper summarizes the activities and accomplishments of HELAS.

  16. MicroRNA hsa-miR-29b potentiates etoposide toxicity in HeLa cells via down-regulation of Mcl-1.

    Science.gov (United States)

    Kollinerová, S; Dostál, Z; Modrianský, M

    2017-04-01

    Etoposide is commonly used as a monotherapy or in combination with other drugs for cancer treatments. In order to increase the drug efficacy, ceaseless search for novel combinations of drugs and supporting molecules is under way. MiRNAs are natural candidates for facilitating drug effect in various cell types. We used several systems to evaluate the effect of miR-29 family on etoposide toxicity in HeLa cells. We show that miR-29b significantly increases etoposide toxicity in HeLa cells. Because Mcl-1 protein has been recognized as a miR-29 family target, we evaluated downregulation of Mcl-1 protein splicing variant expression induced by miR-29 precursors and confirmed a key role of Mcl-1 protein in enhancing etoposide toxicity. Despite downregulation of Mcl-1 by all three miR-29 family members, only miR-29b significantly enhanced etoposide toxicity. We hypothesized that this difference may be linked to the change in Mcl-1L/Mcl-1S ratio induced by miR-29b. We hypothesized that the change could be due to miR-29b nuclear shuttling. Using specifically modified miR-29b sequences with enhanced cytosolic and nuclear localization we show that there is a difference, albeit statistically non-significant. In conclusion, we show that miR-29b has the synergistic effect with etoposide treatment in the HeLa cells and that this effect is linked to Mcl-1 protein expression and nuclear shuttling of miR-29b. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš

    2013-01-01

    Roč. 111, č. 1 (2013), s. 23-33 ISSN 0018-067X R&D Projects: GA ČR(CZ) GA13-10057S; GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : rRNA gene organisation * intergenic spacer * Ginkgo Subject RIV: BO - Biophysics Impact factor: 3.804, year: 2013

  18. Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

    International Nuclear Information System (INIS)

    Oesterberg, R.; Garrett, A.

    1977-01-01

    The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

  19. Expression proteomics of UPF1 knockdown in HeLa cells reveals autoregulation of hnRNP A2/B1 mediated by alternative splicing resulting in nonsense-mediated mRNA decay

    Directory of Open Access Journals (Sweden)

    Zavolan Mihaela

    2010-10-01

    Full Text Available Abstract Background In addition to acting as an RNA quality control pathway, nonsense-mediated mRNA decay (NMD plays roles in regulating normal gene expression. In particular, the extent to which alternative splicing is coupled to NMD and the roles of NMD in regulating uORF containing transcripts have been a matter of debate. Results In order to achieve a greater understanding of NMD regulated gene expression we used 2D-DiGE proteomics technology to examine the changes in protein expression induced in HeLa cells by UPF1 knockdown. QPCR based validation of the corresponding mRNAs, in response to both UPF1 knockdown and cycloheximide treatment, identified 17 bona fide NMD targets. Most of these were associated with bioinformatically predicted NMD activating features, predominantly upstream open reading frames (uORFs. Strikingly, however, the majority of transcripts up-regulated by UPF1 knockdown were either insensitive to, or even down-regulated by, cycloheximide treatment. Furthermore, the mRNA abundance of several down-regulated proteins failed to change upon UPF1 knockdown, indicating that UPF1's role in regulating mRNA and protein abundance is more complex than previously appreciated. Among the bona fide NMD targets, we identified a highly conserved AS-NMD event within the 3' UTR of the HNRNPA2B1 gene. Overexpression of GFP tagged hnRNP A2 resulted in a decrease in endogenous hnRNP A2 and B1 mRNA with a concurrent increase in the NMD sensitive isoforms. Conclusions Despite the large number of changes in protein expression upon UPF1 knockdown, a relatively small fraction of them can be directly attributed to the action of NMD on the corresponding mRNA. From amongst these we have identified a conserved AS-NMD event within HNRNPA2B1 that appears to mediate autoregulation of HNRNPA2B1 expression levels.

  20. Rev1, Rev3, or Rev7 siRNA Abolishes Ultraviolet Light-Induced Translesion Replication in HeLa Cells: A Comprehensive Study Using Alkaline Sucrose Density Gradient Sedimentation

    Directory of Open Access Journals (Sweden)

    Jun Takezawa

    2010-01-01

    Full Text Available When a replicative DNA polymerase stalls upon encountering a lesion on the template strand, it is relieved by other low-processivity polymerase(s, which insert nucleotide(s opposite the lesion, extend by a few nucleotides, and dissociate from the 3′-OH. The replicative polymerase then resumes DNA synthesis. This process, termed translesion replication (TLS or replicative bypass, may involve at least five different polymerases in mammals, although the participating polymerases and their roles have not been entirely characterized. Using siRNAs originally designed and an alkaline sucrose density gradient sedimentation technique, we verified the involvement of several polymerases in ultraviolet (UV light-induced TLS in HeLa cells. First, siRNAs to Rev3 or Rev7 largely abolished UV-TLS, suggesting that these 2 gene products, which comprise Polζ, play a main role in mutagenic TLS. Second, Rev1-targeted siRNA also abrogated UV-TLS, indicating that Rev1 is also indispensable to mutagenic TLS. Third, Polη-targeted siRNA also prevented TLS to a greater extent than our expectations. Forth, although siRNA to Polι had no detectable effect, that to Polκ delayed UV-TLS. To our knowledge, this is the first study reporting apparent evidence for the participation of Polκ in UV-TLS.

  1. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  2. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Karyotype characterization of Crotalaria juncea (L. by chromosome banding and physical mapping of 18S-5.8S-26S and 5S rRNA gene sites

    Directory of Open Access Journals (Sweden)

    Mateus Mondin

    2007-01-01

    Full Text Available The chromosomes of Crotalaria juncea, a legume of agronomic interest with a 2n = 16 karyotype composed of metacentric chromosomes, were analyzed using several cytogenetic techniques. C-banding revealed heterochromatic regions around the centromeres in all chromosomes and adjacent to the secondary constriction on the chromosome 1 short arm. Fluorescent staining with the GC-specific chromomycin A3 (CMA highlighted these heterochromatic regions and a tiny site on the chromosome 1 long arm while the AT-specific stain 4'-6-diamidino-2-phenylindole (DAPI induced a reversed pattern. Staining with CMA combined with AT-specific distamycin A (DA counterstaining quenched the pericentromeric regions of all chromosomes, but enhanced fluorescence was observed at the heterochromatic regions around the secondary constriction and on the long arms of chromosomes 1 and 4. Fluorescence in situ hybridization (FISH revealed 18S-5.8S-26S rRNA gene sites (45S rDNA on chromosomes 1 and 4, and one 5S rDNA locus on chromosome 1. All the rDNA sites were co-located with the positive-CMA/DA bands, suggesting they were very rich in GC. Silver staining revealed signals at the main 45S rDNA locus on chromosome 1 and, in some cells, chromosome 4 was labeled. Two small nucleoli were detected in a few interphase cells, suggesting that the minor site on chromosome 4 could be active at some stages of the cell cycle.

  4. Observations on the expression of human papillomavirus major capsid protein in HeLa cells.

    Science.gov (United States)

    Xiao, Chang-Yi; Fu, Bing-Bing; Li, Zhi-Ying; Mushtaq, Gohar; Kamal, Mohammad Amjad; Li, Jia-Hua; Tang, Gui-Cheng; Xiao, Shuo-Shuang

    2015-01-01

    The goal of this study was to identify the nature of the inclusion bodies that have been found in HeLa cells (cervical cancer immortal cell line) by electron microscope and to determine whether the major capsid protein (L1) of human papillomavirus (HPV) can be expressed in HPV-positive uterine cervix cancer cells. HPV L1 protein expression in HeLa cells was detected with anti-HPV L1 multivalent mice monoclonal antibody and rabbit polyclonal anti-HPV L1 antibody by ELISA, light microscope immunohistochemistry, electron microscope immunocytochemistry and Western blotting assays. Reverse transcriptional PCR (RT-PCR) was performed to detect the transcription of L1 mRNA in HeLa cells. The immortalized human keratinocyte HeCat was used as the negative control. HPV L1 proteins reacted positively in the lysate of HeLa cells by ELISA assays. HRP labeled light microscope immunohistochemistry assay showed that there was a strong HPV L1 positive reaction in HeLa cells. Under the electron microscope, irregular shaped inclusion bodies, assembled by many small and uniform granules, had been observed in the cytoplasm of some HeLa cells. These granules could be labeled by the colloidal gold carried by HPV L1 antibody. The Western blotting assay showed that there was a L1 reaction strap at 80-85 kDa in the HeLa cell lysates, hence demonstrating the existence of HPV18 L1 in HeLa cells. RT-PCR assay showed that the L1 mRNA was transcribed in HeLa cells. The inclusion bodies found in the cytoplasm of HeLa cells are composed of HPV18 L1 protein. Since HeLa cell line is a type of cervical cancer cells, this implies that HeLa cells have the ability to express HPV L1 proteins.

  5. Effect of inhibition of intermediate-conductance-Ca2+-activated K+ channels on HeLa cell proliferation

    Directory of Open Access Journals (Sweden)

    Ping Zhan

    2018-01-01

    Conclusion: CLT and blocking of IKCal gene expression effectively inhibits HeLa cell proliferation; therefore, the use of a blocking agent and RNAi both effectively downregulated the mRNA expression of IKCal, which in turn mediated the proliferation of HeLa cells, producing an antitumor effect.

  6. The Genomic and Transcriptomic Landscape of a HeLa Cell Line

    Science.gov (United States)

    Landry, Jonathan J. M.; Pyl, Paul Theodor; Rausch, Tobias; Zichner, Thomas; Tekkedil, Manu M.; Stütz, Adrian M.; Jauch, Anna; Aiyar, Raeka S.; Pau, Gregoire; Delhomme, Nicolas; Gagneur, Julien; Korbel, Jan O.; Huber, Wolfgang; Steinmetz, Lars M.

    2013-01-01

    HeLa is the most widely used model cell line for studying human cellular and molecular biology. To date, no genomic reference for this cell line has been released, and experiments have relied on the human reference genome. Effective design and interpretation of molecular genetic studies performed using HeLa cells require accurate genomic information. Here we present a detailed genomic and transcriptomic characterization of a HeLa cell line. We performed DNA and RNA sequencing of a HeLa Kyoto cell line and analyzed its mutational portfolio and gene expression profile. Segmentation of the genome according to copy number revealed a remarkably high level of aneuploidy and numerous large structural variants at unprecedented resolution. Some of the extensive genomic rearrangements are indicative of catastrophic chromosome shattering, known as chromothripsis. Our analysis of the HeLa gene expression profile revealed that several pathways, including cell cycle and DNA repair, exhibit significantly different expression patterns from those in normal human tissues. Our results provide the first detailed account of genomic variants in the HeLa genome, yielding insight into their impact on gene expression and cellular function as well as their origins. This study underscores the importance of accounting for the strikingly aberrant characteristics of HeLa cells when designing and interpreting experiments, and has implications for the use of HeLa as a model of human biology. PMID:23550136

  7. 5S IN QUALITY MANAGEMENT

    Directory of Open Access Journals (Sweden)

    BOCA GRATIELA DANA

    2015-07-01

    Full Text Available The fundamental principles of organization are customer satisfaction, eliminating waste, achieving a continuous flow in production and continuous improvement. The 5S method is a structured program for implementation the standardization and organization, simplifies the environment of the workplace (Gemba, reduce losses and unnecessary activities, and improve quality efficiency and safety. Keeping the workplace clean, providing a good working environment and promote productivity, reducing costs, ensure security and removes all types of losses. The case study present the 5S method as a tool which can be used efficiently to keep those things necessary for the proper conduct of the organization and the elimination of unless things.

  8. HELAS: local helioseismology data website

    International Nuclear Information System (INIS)

    Schunker, Hannah; Gizon, Laurent; Roth, Markus

    2008-01-01

    The Local Helioseismology Network Activity is part of the European Helio-and Asteroseismology Network (HELAS). One aspect of the network activity is to collate multipurpose data sets and make them available to the community for local helioseismic analysis. The first stage of the project is underway whereby high quality and useful data sets have been selected and acquired. The HELAS Local Helioseismology Network Activity website at http://www.mps.mpg.de/projects/seismo/NA4/ provides this data ready to download. Furthermore, the data is supplemented with relevant documentation necessary for further analysis, including details about the data reduction process that has already been applied. The data primarily consists of Doppler velocity observations but also includes observations of the line-of-sight magnetic field, vector magnetic field measurements, intensity and travel time maps. The website will be continuously updated with data thereby providing convenient access to comprehensive data sets appropriate for use in local helioseismology.

  9. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  10. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    Science.gov (United States)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  11. [Astragalus polysaccharide may increase sensitivity of cervical cancer HeLa cells to cisplatin by regulating cell autophagy].

    Science.gov (United States)

    Zhai, Qiu-Li; Hu, Xiang-Dan; Xiao, Jing; Yu, Dong-Qing

    2018-02-01

    This study aimed to investigate the possible sensitivity of Astragalus polysaccharides, in order to improve the chemosensitivity of cervical cancer HeLa cells to cisplatin by regulating the cell autophagy, and explore its possible mechanism. In this study, HeLa cells were divided into control group, cisplatin group, Astragalus polysaccharide group, and Astragalus polysaccharide combined with cisplatin group. MTT assay was used to detect the proliferation of cervical cancer HeLa cells. Flow cytometry was used to detect the apoptosis and cycle of HeLa cells in each experimental group. RT-PCR was used to detect the mRNA expression of autophagy-related proteins beclin1, LC3Ⅱ and p62. The expression levels of autophagy-related proteins beclin1, LC3Ⅱ, LC3Ⅰ and p62 were detected by WB method. MTT results showed that compared with the control group, the proliferation of HeLa cells was significantly inhibited in each administration group( P HeLa cells was significantly increased( P HeLa cells to cisplatin by regulating the cell autophagy. Its possible mechanism of action is correlated with the up-regulation of autophagy-related proteins beclin1, the promote the conversion from LC3Ⅰ to LC3Ⅱ, the down-regulation of labeled protein p62, and the enhancement of HeLa cell autophagic activity, thereby increasing the sensitivity of HeLa cells to cisplatin chemotherapy. Copyright© by the Chinese Pharmaceutical Association.

  12. Potential proteins targeted by let-7f-5p in HeLa cells.

    Science.gov (United States)

    Wang, Yu; Chen, Xiujuan; Zhang, Yi; Song, Jiandong

    2017-07-24

    MicroRNAs are a class of small, endogenous, non-coding RNAs mediating posttranscriptional gene silencing. The current authors hypothesized that let-7f-5p is likely involved in cell invasion and proliferation by regulating the expression of target genes. The current study combined let-7f-5p with iTRAQ to assess its effect on gene expression in HeLa cells. Results indicated that 164 proteins were expressed at different levels in HeLa cells overexpressing let-7f-5p and negative controls and that 172 proteins were expressed at different levels in let-7f-5p-silenced HeLa cells and negative controls. Results indicated that let-7f-5p may suppress insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) in HeLa cells.

  13. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  14. Knock-down of NDRG2 sensitizes cervical cancer Hela cells to cisplatin through suppressing Bcl-2 expression

    International Nuclear Information System (INIS)

    Liu, Junye; Guo, Guozhen; Yang, Le; Zhang, Jian; Zhang, Jing; Chen, Yongbin; Li, Kangchu; Li, Yurong; Li, Yan; Yao, Libo

    2012-01-01

    NDRG2, a member of N-Myc downstream regulated gene family, plays some roles in cellular stress, cell differentiation and tumor suppression. We have found that NDRG2 expression in cervical cancer Hela cells increases significantly upon stimulation with cisplatin, the most popular chemotherapeutic agent currently used for the treatment of advanced cervical cancer. This interesting phenomenon drove us to evaluate the role of NDRG2 in chemosensitivity of Hela cells. In the present study, RNA interference was employed to down-regulate NDRG2 expression in Hela cells. RT-PCR and Western blot were used to detect expression of NDRG2, Bcl-2 and Bax in cancer cells. Real-time PCR was applied to detect miR-15b and miR-16 expression levels. Drug sensitivity was determined with MTT assay. Cell cloning efficiency was evaluated by Colony-forming assay. Apoptotic cells were detected with annexin V staining and flow cytometry. In vitro drug sensitivity assay revealed that suppression of NDRG2 could sensitize Hela cells to cisplatin. Down-regulation of NDRG2 didn’t influence the colony-forming ability but promoted cisplatin-induced apoptosis of Hela cells. Inhibition of NDRG2 in Hela cells was accompanied by decreased Bcl-2 protein level. However, Bcl-2 mRNA level was not changed in Hela cells with down-regulation of NDRG2. Further study indicated that miR-15b and miR-16, two microRNAs targetting Bcl-2, were significantly up-regulated in NDRG2-suppressed Hela cells. These data suggested that down-regulation of NDRG2 could enhance sensitivity of Hela cells to cisplatin through inhibiting Bcl-2 protein expression, which might be mediated by up-regulating miR-15b and miR-16

  15. Matrix Metallopeptidase 14 Plays an Important Role in Regulating Tumorigenic Gene Expression and Invasion Ability of HeLa Cells.

    Science.gov (United States)

    Zhang, Ying-Hui; Wang, Juan-Juan; Li, Min; Zheng, Han-Xi; Xu, Lan; Chen, You-Guo

    2016-03-01

    The objectives of this study were to investigate the functional effect of matrix metallopeptidase 14 (MMP14) on cell invasion in cervical cancer cells (HeLa line) and to study the underlying molecular mechanisms. Expression vector of short hairpin RNA targeting MMP14 was treated in HeLa cells, and then, transfection efficiency was verified by a florescence microscope. Transwell assay was used to investigate cell invasion ability in HeLa cells. Quantitative polymerase chain reaction and Western blotting analysis were used to detect the expression of MMP14 and relative factors in messenger RNA and protein levels, respectively. Matrix metallopeptidase 14 short hairpin RNA expression vector transfection obviously decreased MMP14 expression in messenger RNA and protein levels. Down-regulation of MMP14 suppressed invasion ability of HeLa cells and reduced transforming growth factor β1 and vascular endothelial growth factor B expressions. Furthermore, MMP14 knockdown decreased bone sialoprotein and enhanced forkhead box protein L2 expression in both RNA and protein levels. Matrix metallopeptidase 14 plays an important role in regulating invasion of HeLa cells. Matrix metallopeptidase 14 knockdown contributes to attenuating the malignant phenotype of cervical cancer cell.

  16. Depletion of cellular poly (A) binding protein prevents protein synthesis and leads to apoptosis in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B. [Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G2W1 (Canada); Bag, Jnanankur, E-mail: jbag@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G2W1 (Canada)

    2011-05-13

    Highlights: {yields} Depletion of cellular PABP level arrests mRNA translation in HeLa cells. {yields} PABP knock down leads to apoptotic cell death. {yields} PABP depletion does not affect transcription. {yields} PABP depletion does not lead to nuclear accumulation of mRNA. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) is important in mRNA translation and stability. In yeast, depletion of PABP leads to translation arrest. Similarly, the PABP gene in Drosophila is important for proper development. It is however uncertain, whether mammalian PABP is essential for mRNA translation. Here we showed the effect of PABP depletion on mRNA metabolism in HeLa cells by using a small interfering RNA. Our results suggest that depletion of PABP prevents protein synthesis and consequently leads to cell death through apoptosis. Interestingly, no detectable effect of PABP depletion on transcription, transport and stability of mRNA was observed.

  17. Depletion of cellular poly (A) binding protein prevents protein synthesis and leads to apoptosis in HeLa cells

    International Nuclear Information System (INIS)

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

    2011-01-01

    Highlights: → Depletion of cellular PABP level arrests mRNA translation in HeLa cells. → PABP knock down leads to apoptotic cell death. → PABP depletion does not affect transcription. → PABP depletion does not lead to nuclear accumulation of mRNA. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) is important in mRNA translation and stability. In yeast, depletion of PABP leads to translation arrest. Similarly, the PABP gene in Drosophila is important for proper development. It is however uncertain, whether mammalian PABP is essential for mRNA translation. Here we showed the effect of PABP depletion on mRNA metabolism in HeLa cells by using a small interfering RNA. Our results suggest that depletion of PABP prevents protein synthesis and consequently leads to cell death through apoptosis. Interestingly, no detectable effect of PABP depletion on transcription, transport and stability of mRNA was observed.

  18. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  19. [Effect of NOR1 gene knockdown on the biological behavior of HeLa cells].

    Science.gov (United States)

    Tan, Yixin; Li, Wenjuan; Yi, Mei; Wang, Wei; Zheng, Pan; Zhang, Haijing; Xiang, Bo; Li, Guiyuan

    2014-08-01

    To explore the effect of the oxidored nitro domain containing protein 1 (NOR1) gene knockdown on the biological behavior of HeLa cells in cervical carcinoma. The recombinant plasmids pSUPER-shNOR1-1, pSUPER-shNOR1-2 and pSUPERscramble, which targeted to NOR1 gene, were constructed by pSUPER.neo+GFP vector, transfected into HeLa cells respectively using Lipofectamine 2000 reagent, and followed by G418 selection. The expression level of NOR1 mRNA and protein were determined by RT-PCR and Western blotting, respectively. Methyl thiazolyl tetrazolium (MTT) assay was performed to determine the growth curve of cell viability. The stable transfectants were treated with H₂O₂ and cell apoptosis was determined by Hoechst 33258 staining and terminal deoxynucleotidyl transferasemediated dUTP nick end labeling (TUNEL) assay. The expression levels of Bcl-2, cleaved caspase 9 and poly ADP-ribose polymerase (PARP) were measured by Western blot. NOR1- knockdown HeLa cells were successfully constructed by transfection of pSUPER-shNOR1-1 or pSUPER-shNOR1-2 plasmids into HeLa cells. MTT assay showed that the silence of endogenous NOR1 in HeLa cells could lead to the increase in cell viability and proliferation, and the inhibition of H₂O₂-induced apoptosis compared with the negative control. Western blot showed that the expression level of active caspase 9 and cleaved PARP was inhibited in NOR1-knockdown cells when they were treated with H₂O₂ while the expression level of Bcl-2 protein increased. Silence of endogenous NOR1 facilitates the cell viability and growth of HeLa cells, and attenuates HeLa cells apoptosis induced by H₂O₂, which might be mediated by up-regulation of Bcl-2 level and down-regulation of the cleaved caspase 9 cascade.

  20. [The Effect of TALENs-mediated Downregulation Expression of Nanog on Malignant Behavior of Cervical Cancer HeLa Cells].

    Science.gov (United States)

    Yu, Ai-qing; Li, Cheng-lin; Yang, Yi; Yan, Shi-rong

    2016-01-01

    To study the effect of downregulation expression of Nanog on malignant behavior of cervical cancer HeLa cells. Gene editing tool TALENs was employed to induce downregulation expression of Nanog, and Nanog mutation was evaluated by sequencing. RT-PCR and Western blot was used to detect the mRNA and protein expression level, respectively. Colony-formation assay, Transwell invasion assay, and chemotherapy sensibility assay was carried out to assess the capacity of colony-formation, invasion, and chemoresistance, respectively. TALENs successfully induced Nanog mutation and downregulated Nanog expression. Nanog mRNA and protein expression of Nanog-mutated monoclonal HeLa cells downregulated 3 times compared to thoses of wild-type HeLa cells (P HeLa cells were observed when compared to those of wild-type HeLa cells (P HeLa cells. Importantly, downregulation or silencing of Nanog is promising to be a novel strategy for the treatment of cervical carcinoma.

  1. Effects of DCK knockdown on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells.

    Science.gov (United States)

    Shang, Q-Y; Wu, C-S; Gao, H-R

    2017-09-01

    The present study explored the effect that deoxycytidine kinase (DCK) knockdown had on proliferation, apoptosis and tumorigenicity in vivo of cervical cancer HeLa cells. Human cervical cancer HeLa cells that had received no prior treatment were selected from the HeLa group. The HeLa-negative control (NC) group consisted of cells that had undergone an empty vector treatment, and finally the HeLa-short hairpin RNA (shRNA) group included cells that were treated by means of shRNA-DCK expression. DCK expressions were evaluated by quantitative real-time polymerase chain reaction in addition to western blotting assays. Cell proliferation was estimated using the Cell Counting Kit-8 (CCK-8) assay and cell cycle progression. Cell apoptosis was determined by flow cytometry. BALB/c nude mice (n=24) were selected to establish transplanted tumor models, with gross tumor volume measured every 3 days. The results in vitro were as follows: compared with the HeLa group, the HeLa-shRNA group exhibited downregulation of DCK expression and inhibition of cell proliferation at 48, 72 and 96 h. Additionally, more cells in the HeLa-shRNA group were arrested in G0/G1 stage and less in S and G2/M stages, as well as in promotion of cell apoptosis. In vivo results are as follows: when comparing the HeLa and HeLa-NC groups, the gross tumor volume of the transplanted tumor in nude mice in the HeLa-shRNA group was found to have decreased in 13, 16, 19 and 22 days. Based on these findings, our study suggests that DCK knockdown facilitates apoptosis while inhibiting proliferation and tumorigenicity in vivo of cervical cancer HeLa cells.

  2. Construction of cell model of silenced Ku80 and the radiobiology change of HeLa cell

    International Nuclear Information System (INIS)

    Zhuang Liang; Yu Shiying; Huang Xiaoyuan; Xiong Huihua; Xiong Hua; Li Xiaolan; Leng Yan

    2007-01-01

    Objective: To construct the cell model of Ku80 with expression inhibited by siRNA and to explore the role of Ku80 in radiobiology. Methods: Ku80-siRNA expression plasmids were constructed and HeLa cells were transfected with these plasmids by lipofectamine. Western blotting was used to measure the expression of Ku80. After irradiation with 6 MV X ray, cells were collected and analyzed by flow cytometry for apoptosis and cell cycle at 24, 48 and 72 h; The radiobiology parameters of four cell lines were acquired by clone formation array. Results: Three stable transfected cell clones were obtained, and the inhibition rates of Ku80 protein expression of two positive clones were 89.3% and 96.4%; The apoptosis rates of HeLa cells Ku80 inhibited were higher than control cells at 48 and 72 after X ray irradiation (P 0.05). HeLa cells of silenced Ku80 had lower SF 2 and D 0 than control cells, and their SER (sensitization enhancement ratio) based on D 10 were 1.315 and 1.365, respectively. Conclusions: The HeLa cell models with Ku80 expression suppressed were successfully established; the inhibition of Ku80 by siRNA could enhance the radiosensitivity of HeLa cells. (authors)

  3. Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

    Science.gov (United States)

    Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

    2016-01-01

    Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.

  4. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    Science.gov (United States)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  5. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  6. 5S-menetelmän implementointi

    OpenAIRE

    Kaikula, Kari-Marko

    2017-01-01

    Tässä opinnäytetyössä tavoiteltiin siisteyden ja järjestyksen tuomista 5S-menetelmän avulla Helen Oy:n kunnossapidon varaosavarastoon Salmisaaren voimalaitoksella. Helen Oy on Helsingin kaupungin omistama energia-alan yritys. Kehittämistehtävänä työssä oli 5S-menetelmän implementointi. Tutkimuksen tarkoituksena oli tutkia niitä seikkoja, jotka vaikuttavat 5S-menetelmän käyttöönottoon. 5S on menetelmä, jolla tuodaan siisteyttä ja järjestystä työympäristöön. Tutkimusmenetelmänä oli toiminta...

  7. [Cloning of human CD45 gene and its expression in Hela cells].

    Science.gov (United States)

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  8. Pro-inflammatory Cytokines Are Involved in Fluoride-Induced Cytotoxic Potential in HeLa Cells.

    Science.gov (United States)

    Wang, Hong-Wei; Zhou, Bian-Hua; Cao, Jian-Wen; Zhao, Jing; Zhao, Wen-Peng; Tan, Pan-Pan

    2017-01-01

    This study was designed to investigate the pro-inflammatory cytokines and their involvement in the cytotoxic potential of fluoride (F) in HeLa cells. HeLa cells were cultured with varying F concentrations (1-50 mg/L) for 48 h, and treatment effects were analyzed. The viability of HeLa cells was determined with a colorimetric method. The concentrations of IL-1β, IL-2, IL-6, and TNF-a in culture supernatant were measured through enzyme linked immunosorbent assay (ELISA). The mRNA expression levels of IL-1β, IL-2, IL-6 and TNF-a were subjected to transcript analysis and quantified through reverse transcription real-time PCR. Results showed that 10, 20 and 50 mg/L F significantly decreased the viability of HeLa cells incubated for 24 and 48 h. With their cytotoxic effect, the concentrations of IL-1β, IL-2, IL-6, and TNF-a decreased significantly in response to F, especially at 20 and 50 mg/L for 48 h. The mRNA expression levels of IL-1β, IL-2, IL-6, and TNF-a were downregulated at 50 mg/L F for 48 h. Therefore, F inhibited HeLa cell growth; as such, F could be used to alleviate the inhibition of pro-inflammatory cytokine expression.

  9. 5S-menetelmän pilotointi

    OpenAIRE

    Lampela, Saara

    2017-01-01

    Tämän opinnäytetyön tavoitteena oli siisteys- ja järjestystason parantaminen 5S-menetelmän avulla UPM Kaukaan paperitehtaalla. 5S on tuottavuuden parantamiseen keskittyvä lean-työkalu, jonka päätehtäväksi paperitehtaalla määritettiin erityisesti seisokkitilanteissa työvälineiden ja tavaroiden etsimiseen käytetyn ajan vähentäminen sekä työn yleinen jouhevoituminen. 5S-menetelmän nimi tulee japanin kielen sanoista Seiri, Seiton, Seiso, Seiketsu ja Shitsuke. Suomeksi vaiheet ovat lajittelu, järj...

  10. CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

    Science.gov (United States)

    Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

    2017-09-01

    The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Subnanomolar antisense activity of phosphonate-peptide nucleic acid (PNA) conjugates delivered by cationic lipids to HeLa cells

    DEFF Research Database (Denmark)

    Shiraishi, Takehiko; Hamzavi, Ramin; Nielsen, Peter E

    2008-01-01

    oligomer. This modification of the PNA does not interfere with the nucleic acid target binding affinity based on thermal stability of the PNA/RNA duplexes. When delivered to cultured HeLa pLuc705 cells by Lipofectamine, the PNAs showed dose-dependent nuclear antisense activity in the nanomolar range...

  12. The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

    International Nuclear Information System (INIS)

    Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

    1989-01-01

    The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

  13. Generalized oscillator strengths for 5s, 5s', and 5p excitations of krypton

    International Nuclear Information System (INIS)

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-01-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s ' , 5p [5/2] 3,2 , 5p [3/2] 1,2 , and 5p [1/2] 0 transitions of krypton have been determined in a large K 2 region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s ' transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s ' transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)

  14. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A

    1981-01-01

    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  15. ADN ribosomique 5S chez Arabidopsis thaliana : dynamique chromatinienne et ARN polymérase IV

    OpenAIRE

    Douet , Julien

    2008-01-01

    In Arabidopsis thaliana, 5S rRNA genes are found clustered at pericentromeric heterochromatin of chromosomes 3, 4 and 5. 5S rRNA genes transcription is epigenetically regulated through the formation of specific chromatin structure. In order to determine the events that lead to the establishment of such structures, a study during the first steps of post-germinative plant development was done. Unexpectedly, we observed a decondensation followed by a rapid "re"condensation of 5S rDNA chromatin. ...

  16. [Baicalein promotes the apoptosis of HeLa cells by inhibiting ERK1/2 expression].

    Science.gov (United States)

    Wang, Yongzhou; Xia, Jiyi; Tang, Xiaoping; Tang, Li; Mao, Xiguang; Zhang, Yujiao; Yu, Xiaolan

    2016-11-01

    Objective To investigate the effects of baicalein and U0126 treatment on the apoptosis of human cervical carcinoma HeLa cells and the potential mechanism. Methods HeLa cells were subjected to (1, 2, 5, 10, 20, 50, 100, 200, 300) μmol/L baicalein or (1, 2, 5, 10, 20, 30) μmol/L U0126 treatment for 24 hours. The optimal concentrations of baicalein and U0126 for HeLa inhibition was determined by a cell counting Kit-8 assay. HeLa cells were then treated with these inhibitory concentrations for 24 hours separately or in combination. The cell cycle and the degree of apoptosis were analyzed by flow cytometry. The cell apoptosis index was evaluated by the TUNEL assay. The expressions of extracellular signal-regulated kinase 1/2 (ERK1/2), Bax, and Bcl-2 at the mRNA and protein levels were examined by real-time PCR and Western blotting, respectively. Results Optimal inhibitory concentrations of baicalein and U0126 for HeLa cells were 200 μmol/L and 10 μmol/L, respectively. Compared with the control group, baicalein treatment increased the growth rate of cells in the G0/G1 phase but decreased the S phase. Combination treatment of 200 μmol/L baicalein and 10 μmol/L U0126 for 24 hours further reduced the S phase growth rate. Treatment with 10 μmol/L U0126 or 200 μmol/L baicalein for 24 hours induced cell apoptosis, and the combination treatment induced more apoptosis. Treatment by baicalein alone or in combination with U0126 for 24 hours significantly decreased ERK1/2 and Bcl-2 mRNA expressions, and upregulated Bax mRNA expression. It also downregulated ERK1/2 phosphorylation and Bcl-2 protein expression, while increasing Bax protein expression. Conclusion Both baicalein and U012 appear to inhibit proliferation, induce apoptosis, and increase the growth rate in the G0/G1 phase but reduce the S phase of HeLa cells. This effect is enhanced when they are used synergistically.

  17. Implementacija metode 5S v proces proizvodnje

    Directory of Open Access Journals (Sweden)

    Alojz Gorše

    2016-03-01

    Full Text Available Abstract: Research Question (RQ: The following research tries to show how the introduction of 5S methodology of work affects the production process itself, where the greatest changes are shown and how they are reflected in performance indicators. Purpose: The purpose of this project is to examine the existing methods and their application in practice as well as show the logic of actions we introduce in a particular process by using the 5S method. We will try to compare all the information using a practical example of company X. The results obtained are the basis for further improvements in an analyzed company. Method: We expect positive results in terms of certain improvements in the working environment within the company, as well as the opportunity for improvement in terms of increased efficiency and, consequently, more profit. Results: The results can represent the basis for achieving eve n better work in other processes in the studied company. It is very important to identify all the key activities that are important in generating profits while all the rest are eliminated from the process. Organization: The 5S model is applicable to all levels of the organization so it can be experienced by the highest levels of management in running a business. Society: The impact of the model will surely be seen by employees as they are offered a model after which they will work well, quickly, safely and without loss of time, which in today's world means competitive advantage. Originality: The research work represents an important contribution to the implementation of the 5S model in the company and to the positive things it brings. Limitations/Future Research: The survey as a case study was done in only one organization, in which they were implemented all phases of the method. In the direction of further research it is reasonable to make a quantitative analysis of the increase in profit, increase employee satisfaction analysis, to determine the reduction

  18. Cloning of smac gene and its overexpression effects on radiosensitivity of HeLa cells to γ-rays

    International Nuclear Information System (INIS)

    Zhao Baofeng; Tian Mei; Lei Hongwei; Su Xu

    2006-01-01

    Objective: To clone smac gene and construct eukaryocytic expression vector pcDNA3.1/ smac. The smac gene was transfected into HeLa cells to explore the effects of over-expression of extrinsic smac gene on radiosensitivity to γ-rays of HeLa cells. Methods: The full-length smac gene was amplified from total RNA of HeLa cells by RTPCR. The RTPCR product was ligated with the vector pcDNA3.1 and sequenced. The correct pcDNA3.1/smac was transfected into HeLa cells. The expression of smac gene was tested by RTPCR and Western blot. The cellular growth inhibition rates were evaluated by MTT 48 horns after irradiation with different doses of γ-rays. Results: Recombinant eukaryocytic expression vector pcDNA3.1/smac was successfully constructed. RTPCR and Western blot results indicated that the expression of smac gene of HeLa/smac cells was significantly enhanced compared with the expression of smac gene of HeLa/pcDNA3.1 and HeLa cells. 48 hours after different doses of γ-ray irradiation was significantly higher in pcDNA3.1/smac transfected HeLa/smac cells than those of non-transfected HeLa cells or pcDNA3.1 transfected HeLa/pcDNA3.1 cells, inhabitation rates were 38.85%, 17.64% and 20.32%, respectively. Conclusions: smac gene was successfully cloned. Extrinsic smac gene over-expression could significantly enhance radiosensitivity to γ-ray of HeLa cells, which would herald a new approach to improve radiosensitivity of cervical cancer. (authors)

  19. Combined treatment of ionizing radiation with genistein on cervical cancer HeLa cells

    International Nuclear Information System (INIS)

    Zhang Bei; Liu Jiayin; Han Suping; Pan Jinshun; Yin Xiaoxing; Wang Bing; Hu Gang

    2006-01-01

    The anticancer agent genistein inhibits cell growth of tumor cell lines from various malignancies. In our study, we investigated the effectiveness of combined treatment of ionizing radiation (IR) with genistein on cervical HeLa cells and its possible mechanism. It was found that the inhibitory rate in cells with combined treatment was significantly higher than that of the cells treated with IR or genistein alone. After treatments of IR (4 Gy) combined with genistein (40 μmol/L), the apoptotic index of the cells was significantly increased and the cells were arrested in the G2/M phase. Survivin mRNA expression increased after IR (4 Gy), while it significantly decreased after combined treatment. These findings indicated that genistein enhanced the radiosensitivity of cervical cancer HeLa cells, and the mechanisms for this action might include increase of apoptosis, decrease of survivin expression, and prolongation of cell cycle arrest. (author)

  20. Leukemia-associated gene MLAA-34 reduces arsenic trioxide-induced apoptosis in HeLa cells via activation of the Wnt/β-catenin signaling pathway.

    Science.gov (United States)

    Zhang, Pengyu; Zhao, Xuan; Zhang, Wenjuan; He, Aili; Lei, Bo; Zhang, Wanggang; Chen, Yinxia

    2017-01-01

    Our laboratory previously used the SEREX method in U937 cells and identified a novel leukemia-associated gene MLAA-34, a novel splice variant of CAB39L associated with acute monocytic leukemia, that exhibited anti-apoptotic activities in U937 cells. Whether MLAA-34 has an anti-apoptotic role in other tumor cells has not yet been reported. We explored whether MLAA-34 exhibited anti-apoptotic effects in HeLa cervical cancer cells and the possible mechanism of action. We generated a HeLa cell line stably expressing MLAA-34 and found that MLAA-34 overexpression had no effect on the growth, apoptosis and cell cycle of HeLa cells. However, upon treatment with arsenic trioxide (ATO) to induce apoptosis, the cell viability and colony formation ability of ATO-treated MLAA-34 stable HeLa cells were significantly higher than that of ATO-treated controls, and the apoptosis rate and proportion of G2/M cells also decreased. We found that ATO treatment of HeLa cells resulted in significant decreases in the expression of β-catenin mRNA and protein and the downstream target factors c-Myc, cyclin B1, and cyclin D1 in the Wnt signaling pathway. Notably, ATO-treated MLAA-34 stable HeLa cells showed a significant reduction in the ATO-mediated downregulation of these factors. In addition, MLAA-34 overexpression significantly increased the expression of nuclear β-catenin protein in ATO-treated cells compared with HeLa cells treated only with ATO. Thus, here we have found that the Wnt/β-catenin signaling pathway is involved in ATO-induced apoptosis in HeLa cells. MLAA-34 reduces ATO-induced apoptosis and G2/M arrest, and the anti-apoptotic effect may be achieved by activating the Wnt/β-catenin signaling pathway in HeLa cells.

  1. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  2. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    Science.gov (United States)

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Investigation of role of aspartame on apoptosis process in HeLa cells

    Directory of Open Access Journals (Sweden)

    Muthuraman Pandurangan

    2016-07-01

    Full Text Available Aspartame is an artificial sweetener used as an alternate for sugar in several foods and beverages. The study reports that consumption of aspartame containing product could lead to cancer. However, the effect of aspartame on apoptosis process in cancer is not yet understood clearly. HeLa cells were exposed to different concentrations (0.01–0.05 mg/ml of aspartame for 48 h. Cytotoxicity of aspartame on cancer cells was determined by SRB assay. The result indicates no significant changes on cell viability. Aspartame suppresses apoptosis process in cancer cells by down-regulation of mRNA expression of tumor suppressor gene p53, and pro-apoptotic gene bax. It up-regulates anti-apoptotic gene bcl-2 mRNA expression. In addition, Ki 67 and PCNA mRNA, and protein expressions were determined. Taking all these together, we conclude that aspartame may be a potent substance to slow-down the apoptosis process in HeLa cells. Further works are ongoing to understand the biochemical and molecular mechanism of aspartame in cancer cells.

  4. DNA damage in synchronized hela cells irradiated with ultraviolet

    International Nuclear Information System (INIS)

    Downes, C.S.; Collins, A.R.S.; Johnson, R.T.

    1979-01-01

    The lethal effect of uv radiation on HeLa cells is least in mitosis and greatest in late G 1 -early S. Photochemical damage to HeLa DNA, as measured by thymine-containing dimer formation and by alkaline sucrose sedimentation, also increases from mitosis towards early S phase. Computer simulations of uv absorption by an idealized HeLa cell at different stages of the cell cycle indicate that changes in damage could be due solely to changes in chromatin geometry. But survival is not exclusively a function of damage

  5. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    Science.gov (United States)

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  6. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Isolation of parafluorophenylalanine-resistant mutants from HeLa cell cultures

    International Nuclear Information System (INIS)

    Yim, L.K.; Stuart, W.D.

    1983-01-01

    This report describes a method to isolate temperature-conditional phenylalanine transport mutants from the transformed human cell line HeLa. Using ultraviolet light as a mutagenic agent and DL-parafluorophenylalanine (PFPA), a poisonous analogue of L-phenylalanine, as a selective agent, mutagenized cells were selected for survival in the presence of PFPA at a temperature of 39 degrees C. Survivors of the mutagenesis and selection procedures were removed from the culture dishes by trypsin and cloned at a temperature of 35 degrees C. Seven of these lines isolated demonstrated continued resistance to PFPA at 39 degrees C. These lines were tested for uptake of L-phenylalanine at an external concentration of 100 microM and for continued resistance to PFPA at two concentrations. Cells were tested at 35 and at 39 degrees C. The data were compared to those obtained for the parental HeLa cell line under identical conditions. The seven mutant cell lines demonstrated varying resistances to PFPA and varying levels of accumulation of L-phenylalanine when tested at 35 and 39 degrees C. Three mutant lines were additionally tested for L-phenylalanine tRNA charging levels and for transport of L-arginine. The lines had parental cell levels of tRNA charging and L-arginine transport which suggest that the induced genetic defect affects a specific L-phenylalanine transport system

  8. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  9. Making safety an integral part of 5S in healthcare.

    Science.gov (United States)

    Ikuma, Laura H; Nahmens, Isabelina

    2014-01-01

    Healthcare faces major challenges with provider safety and rising costs, and many organizations are using Lean to instigate change. One Lean tool, 5S, is becoming popular for improving efficiency of physical work environments, and it can also improve safety. This paper demonstrates that safety is an integral part of 5S by examining five specific 5S events in acute care facilities. We provide two arguments for how safety is linked to 5S:1. Safety is affected by 5S events, regardless of whether safety is a specific goal and 2. Safety can and should permeate all five S's as part of a comprehensive plan for system improvement. Reports of 5S events from five departments in one health system were used to evaluate how changes made at each step of the 5S impacted safety. Safety was affected positively in each step of the 5S through initial safety goals and side effects of other changes. The case studies show that 5S can be a mechanism for improving safety. Practitioners may reap additional safety benefits by incorporating safety into 5S events through a safety analysis before the 5S, safety goals and considerations during the 5S, and follow-up safety analysis.

  10. Paclitaxel-resistant HeLa cells have up-regulated levels of reactive oxygen species and increased expression of taxol resistance gene 1.

    Science.gov (United States)

    Bi, Wenxiang; Wang, Yuxia; Sun, Gaoying; Zhang, Xiaojin; Wei, Yongqing; Li, Lu; Wang, Xiaoyuan

    2014-07-01

    This study is to establish a paclitaxel (PTX)-resistant human cervical carcinoma HeLa cell line (HeLa/PTX) and to investigate its redox characteristics and the expression of taxol resistance gene 1 (Txr1). HeLa cells were treated with PTX and effects of PTX on cell proliferation were detected through cell counting and the MTT assay. Levels of cellular reactive oxygen species (ROS), reduced glutathione (GSH), and oxidized glutathione (GSSG) as well as the ratio of GSH to GSSG were measured by the 2,7-difluorescein diacetate (DCFH-DA) method and the 5,5'dithiobis(2-nitrobenzoic acid) (DTNB) method. Activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) were determined by the nitrite formation method, the molybdate colorimetric method, and the DTNB colorimetric method, respectively. The level of Txr1 mRNA was determined by real-time PCR. Compared with the regular HeLa cells, HeLa/PTX cells were larger in size and had more cytoplasmic granules. The population doubling time for HeLa/PTX cells was 1.32 times of that of HeLa cells (PHeLa/PTX cells showed stronger resistance to PTX than HeLa cells with a resistance index of 122.69. HeLa/PTX cells had higher levels of ROS (PHeLa cells. HeLa/PTX cells, with higher levels of ROS and Txr1 mRNA expression, are more resistant to PTX than HeLa cells.

  11. MCPIP1 contributes to the toxicity of proteasome inhibitor MG-132 in HeLa cells by the inhibition of NF-κB.

    Science.gov (United States)

    Skalniak, Lukasz; Dziendziel, Monika; Jura, Jolanta

    2014-10-01

    Recently, we have shown that the treatment of cells with proteasome inhibitor MG-132 results in the induction of expression of monocyte chemotactic protein-1 induced protein 1 (MCPIP1). MCPIP1 is a ribonuclease, responsible for the degradation of transcripts encoding certain pro-inflammatory cytokines. The protein is also known as an inhibitor of NF-κB transcription factor. Thanks to its molecular properties, MCPIP1 is considered as a regulator of inflammation, differentiation, and survival. Using siRNA technology, we show here that MCPIP1 expression contributes to the toxic properties of MG-132 in HeLa cells. The inhibition of proteasome by MG-132 and epoxomicin markedly increased MCPIP1 expression. While MG-132 induces HeLa cell death, down-regulation of MCPIP1 expression by siRNA partially protects HeLa cells from MG-132 toxicity and restores Nuclear factor-κB (NF-κB) activity, inhibited by MG-132 treatment. Inversely, overexpression of MCPIP1 decreased constitutive activity of NF-κB and limited the survival of HeLa cells, as we have shown in the previous study. Interestingly, although MG-132 decreased the expression of IκBα and increased p65 phosphorylation, the inhibition of constitutive NF-κB activity was observed in MG-132-treated cells. Since the elevated constitutive activity of NF-κB is one of the mechanisms providing increased survival of cancer cells, including HeLa cells, we propose that death-promoting properties of MCPIP1 in MG-132-treated HeLa cells may, at least partially, derive from the negative effect on the constitutive NF-κB activity.

  12. Radiosensitization of nitroindazole derivatives on HeLa cells

    International Nuclear Information System (INIS)

    Wang Hao; Shi Peiji; Zhou Xiaoliang; Wang Yan; Tang Weisheng

    2010-01-01

    Objective: To investigate the cytotoxicity and radiosensitization of 5-nitroindazole-3-formyliminodiacetic acid on HeLa cells. Methods: HeLa cells in exponential growth phase were incubated in culture media with different doses and the survival rate was determined by MTT assay. The survival rate of cells receiving radiation combined with different doses of medicine was compared with that of the control.Results: The cytotoxicity of S-nitroindazole-3-formyliminodiacetic acid on HeLa cells was very low. The drug had hypoxia radiosensitizing effect on HeLa cells. At doses of 0, 6, 12, 24, 48 and 96 μg/ml under hypoxia, the survival rate were 0.91 , 0.87, 0.84, 0.81, 0.76 and 0.60, respectively. At the dosage of 48 and 96 μg/ml, the survival rate were 0.85 and 0.73 under oxygenous). Conclusions: 5-Nitroindazole-3-formyliminodiacetic acid has low cytotoxicity and rediosensitizing effect on HeLa cells. (authors)

  13. Carbon magnetic resonance spectroscopy on carbon-13-labeled uracil in 5S ribonucleic acid

    International Nuclear Information System (INIS)

    Hamill, W.D.; Grant, D.M.; Cooper, R.B.; Harmon, S.A.

    1978-01-01

    The carbon-13 nuclear magnetic resonance spectra of the 13 C-enriched C-4 uridine carbons in 5S ribosomal ribonucleic acid of Salmonella typhimurium, strain JL-1055, was obtained. The most striking feature of the 5S RNA spectrum was the large number of well-resolved lines in the uridine band covering a chemical shift range of approximately 3.6 ppM. This data was used to obtain information on the secondary structure. The number of uridines involved in secondary interactions is estimated to be at least 75% and may be as high as 95%

  14. Autophagy Facilitates Salmonella Replication in HeLa Cells

    Science.gov (United States)

    Yu, Hong B.; Croxen, Matthew A.; Marchiando, Amanda M.; Ferreira, Rosana B. R.; Cadwell, Ken; Foster, Leonard J.; Finlay, B. Brett

    2014-01-01

    ABSTRACT Autophagy is a process whereby a double-membrane structure (autophagosome) engulfs unnecessary cytosolic proteins, organelles, and invading pathogens and delivers them to the lysosome for degradation. We examined the fate of cytosolic Salmonella targeted by autophagy and found that autophagy-targeted Salmonella present in the cytosol of HeLa cells correlates with intracellular bacterial replication. Real-time analyses revealed that a subset of cytosolic Salmonella extensively associates with autophagy components p62 and/or LC3 and replicates quickly, whereas intravacuolar Salmonella shows no or very limited association with p62 or LC3 and replicates much more slowly. Replication of cytosolic Salmonella in HeLa cells is significantly decreased when autophagy components are depleted. Eventually, hyperreplication of cytosolic Salmonella potentiates cell detachment, facilitating the dissemination of Salmonella to neighboring cells. We propose that Salmonella benefits from autophagy for its cytosolic replication in HeLa cells. PMID:24618251

  15. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Review on Implementation of 5S in Various Organization

    OpenAIRE

    Vipulkumar C. Patel; Dr. Hemant Thakkar

    2014-01-01

    This paper explains the methods and techniques of 5 S uses to increase the efficiency of all processes in the company. Special emphasis will be given to the implementation of 5S system and elimination of losses in the company. It can be observed that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs‟ reduction, increasing of effectiveness and efficiency in the processes, maintenance and improvement of the machines‟ effic...

  17. PROBLEMS OF IMPLEMENTATION 5S PRACTICES IN AN INDUSTRIAL COMPANY

    Directory of Open Access Journals (Sweden)

    Beata GALA

    2013-10-01

    Full Text Available 5S is a one of the tools of Lean Management enabling to organize workplace in an effective way. It could be implemented in all the spheres of the company. The article provides the theoretic description of Lean Management and 5S and also shows a case study based on gained experience. The author also describe the problems occured during the implementation of the 5S.

  18. Nuclear proteome analysis of cisplatin-treated HeLa cells

    International Nuclear Information System (INIS)

    Wu Wei; Yan Chunlan; Gan Tieer; Chen Zhanghui; Lu Xianghong; Duerksen-Hughes, Penelope J.; Zhu Xinqiang; Yang Jun

    2010-01-01

    Cisplatin has been widely accepted as one of the most efficient anticancer drugs for decades. However, the mechanisms for the cytotoxic effects of cisplatin are still not fully understood. Cisplatin primarily targets DNA, resulting in the formation of DNA double strand breaks and eventually causing cell death. In this study, we applied two-dimensional electrophoresis coupled with LC-MS/MS to analyze the nuclear proteome of HeLa cells treated with cisplatin, in an effort to uncover new mechanistic clues regarding the cellular response to cisplatin. A total of 19 proteins were successfully identified, and these proteins are involved in a variety of basal metabolic and biological processes in cells, including biosynthesis, cell cycle, glycolysis and apoptosis. Six were related to the regulation of mRNA splicing, and we therefore asked whether the Fas gene might undergo alternative splicing following cisplatin treatment. This proved to be the case, as the splicing forms of Fas were modified in cisplatin-treated HeLa cells. This work provides novel information, from the perspective of the nuclear response, for understanding the cytotoxicity caused by cisplatin-induced DNA damage.

  19. A systems biology analysis of the changes in gene expression via silencing of HPV-18 E1 expression in HeLa cells.

    Science.gov (United States)

    Castillo, Andres; Wang, Lu; Koriyama, Chihaya; Eizuru, Yoshito; Jordan, King; Akiba, Suminori

    2014-10-01

    Previous studies have reported the detection of a truncated E1 mRNA generated from HPV-18 in HeLa cells. Although it is unclear whether a truncated E1 protein could function as a replicative helicase for viral replication, it would still retain binding sites for potential interactions with different host cell proteins. Furthermore, in this study, we found evidence in support of expression of full-length HPV-18 E1 mRNA in HeLa cells. To determine whether interactions between E1 and cellular proteins play an important role in cellular processes other than viral replication, genome-wide expression profiles of HPV-18 positive HeLa cells were compared before and after the siRNA knockdown of E1 expression. Differential expression and gene set enrichment analysis uncovered four functionally related sets of genes implicated in host defence mechanisms against viral infection. These included the toll-like receptor, interferon and apoptosis pathways, along with the antiviral interferon-stimulated gene set. In addition, we found that the transcriptional coactivator E1A-binding protein p300 (EP300) was downregulated, which is interesting given that EP300 is thought to be required for the transcription of HPV-18 genes in HeLa cells. The observed changes in gene expression produced via the silencing of HPV-18 E1 expression in HeLa cells indicate that in addition to its well-known role in viral replication, the E1 protein may also play an important role in mitigating the host's ability to defend against viral infection.

  20. Fractionation of HeLa cell nuclear extracts reveals minor small nuclear ribonucleoprotein particles

    International Nuclear Information System (INIS)

    Kroemer, A.

    1987-01-01

    Upon chromatographic fractionation of HeLa cell nuclear extracts, small RNAs of 145 and 66/65 nucleotides, respectively, were detected that are distinct from the abundant small RNAs present in the extract. These RNAs are precipitated by antibodies directed against the trimethylguanosine cap structure, characteristic for small nuclear RNAs (snRNAs) of the U type. The RNAs of 145 and 66/65 nucleotides appear to be associated with at least one of the proteins common to the major small nuclear ribonucleoprotein particles U1 to U6, since they are specifically bound by anti-Sm antibodies. These criteria characterize the RNAs that are 145 and 66/65 nucleotides in length as U-type snRNAs. Upon gel filtration, the RNAs are found within particles of molecular weights ≅ 150,000 and 115,000 respectively. The RNA of 145 nucleotides represents a different minor snRNA, designated U11, whereas the RNA of 66/65 nucleotides may correspond to either mammalian U7 or U10 RNA

  1. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  2. Imaging of RNA in situ hybridization by atomic force microscopy

    NARCIS (Netherlands)

    Kalle, W.H.J.; Macville, M.V.E.; van de Corput, M.P.C.; de Grooth, B.G.; Tanke, H.J.; Raap, A.K.

    In this study we investigated the possibility of imaging internal cellular molecules after cytochemical detection with atomic force microscopy (AFM). To this end, rat 9G and HeLa cells were hybridized with haptenized probes for 28S ribosomal RNA, human elongation factor mRNA and cytomegalovirus

  3. Quantification of Functionalised Gold Nanoparticle-Targeted Knockdown of Gene Expression in HeLa Cells

    Science.gov (United States)

    Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.

    2014-01-01

    Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959

  4. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    Science.gov (United States)

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-03

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

    Directory of Open Access Journals (Sweden)

    Kazuho Nishimura

    2015-03-01

    Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  6. A phthalide derivative isolated from endophytic fungi Pestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, C. [College of Life Science, Hebei University, Baoding (China); Yang, R.L. [Key Laboratory of Microbial Diversity Research and Application of Hebei Province, Baoding, China, Key Laboratory of Microbial Diversity Research and Application of Hebei Province, Baoding (China)

    2013-07-30

    MP [4-(3′,3′-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniae isolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27{sup KIP1} protein and p21{sup CIP1} mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21{sup CIP1}, p16{sup INK4a} and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation of p73, JunB, FKHR, and Bim. The results indicate that MP may be a potential treatment for cervical cancer.

  7. A phthalide derivative isolated from endophytic fungi Pestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells

    International Nuclear Information System (INIS)

    Chen, C.; Yang, R.L.

    2013-01-01

    MP [4-(3′,3′-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniae isolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27 KIP1 protein and p21 CIP1 mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21 CIP1 , p16 INK4a and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation of p73, JunB, FKHR, and Bim. The results indicate that MP may be a potential treatment for cervical cancer

  8. Effects of Smac gene over-expression on radiotherapeutic sensitivity of cervical cancer cell line HeLa

    International Nuclear Information System (INIS)

    Zheng Liduan; Wang Liang; Tong Qiangsong; Fei Shihong; Xiong Yufang; Wu Gang

    2005-01-01

    Objective: To study the effects of extrinsic Smac gene transfection and its over-expression on radiotherapeutic sensitivity of cervical cancer cells, in order to explore a novel strategy for ameliorating radiotherapy of cervical cancer. Methods: After Smac gene was transferred into cells of cervical cancer cell line HeLa, the subclone cells were obtained by persistent G 418 selection. Cellular Smac gene expression was determined by RT-PCR and Western blot. After treatment with X-ray irradiation, cellular growth activity in vitro was investigated by MTT colorimetry. Cellular apoptosis and its rate were determined by electron microscopy, Annexin V-FITC and propidium iodide staining flow cytometry. Cellular Caspase-3 protein expression and its activity were assayed by Western blot and colorimetry. Results: RT-PCR and Western blot demonstrated that Smac mRNA and protein levels of HeLa/Smac cells, the selected subclone cells of cervical cancer cell line, were significantly higher than those of HeLa cells (P<0.01). After treated with 8 Gy X-ray irradiation, growth activity of HeLa/Smac cells reduced by 10.19%(P<0.01), as compared with that of HeLa cells. Partial HeLa/Smac cancer cells presented characteristic morphological changes of apoptosis under electron microscope, with an apoptosis rate of 16.4%, which was significantly higher than that of HeLa cells(6.2%, P<0.01). Compared with HeLa cells, Caspase-3 expression level in HeLa/Smac was improved significantly (P<0.01), while its activity was 3.42 times as much as that of HeLa cells (P<0.01). Conclusion: Stable transfection of extrinsic Smac gene and its over-expression in cervical cancer cell line could significantly enhance cellular caspase-3 expression and activity, ameliorate apoptosis-inducing effects of radiation on cancer cells, which would be a novel strategy to improve radiotherapeutic effects for cervical cancer. (authors)

  9. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    Science.gov (United States)

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  10. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  11. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B-Treated Cervical Cancer HeLa Cells.

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2017-09-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H 2 O 2 -induced cell death is via neutralization of reactive oxygen species.

  12. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B–Treated Cervical Cancer HeLa Cells

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2016-01-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H2O2–induced cell death is via neutralization of reactive oxygen species. PMID:27458249

  13. Co-encapsulation of chrysophsin-1 and epirubicin in PEGylated liposomes circumvents multidrug resistance in HeLa cells.

    Science.gov (United States)

    Lo, Yu-Li; Tu, Wei-Chen

    2015-12-05

    Chrysophsin-1, an amphipathic alpha-helical antimicrobial peptide, is isolated from the gills of the red sea bream and possesses different structure and mechanism(s) in comparison with traditional multidrug resistance (MDR) modulators. For the purpose of reducing off-target normal cell toxicity, it is rational to incorporate chrysophsin-1 and epirubicin in a PEGylated liposomal formulation. In the present study, we report a multifunctional liposomes with epirubicin as an antineoplastic agent and an apoptosis inducer, as well as chrysophsin-1 as a MDR transporter inhibitor and an apoptosis modulator in human cervical cancer HeLa cells. Co-incubation of HeLa cells with PEGylated liposomal formulation of epirubicin and chrysophsin-1 resulted in a significant increase in the cytotoxicity of epirubicin. The liposomal formulations of epirubicin and/or chrysophsin-1 were shown to considerably improve the intracellular H2O2 and O2(-) levels of HeLa cells. Furthermore, these treatments were found to extensively reduce mRNA expression levels of MDR1, MRP1, and MRP2. The addition of chrysophsin-1 in liposomes was demonstrated to substantially enhance the intracellular accumulation of epirubicin in HeLa cells. Moreover, the PEGylated liposomes of epirubicin and chrysophsin-1 were also found to significantly increase the mRNA expressions of p53, Bax, and Bcl-2. The ratio of Bax to Bcl-2 was noticeably amplified in the presence of these formulations. Apoptosis induction was also validated by chromatin condensation, a reduction in mitochondrial membrane potential, the increased sub-G1 phase of cell cycle, and more populations of apoptosis using annexin V/PI assay. These formulations were verified to increase the activity and mRNA expression levels of caspase-9 and caspases-3. Collectively, our findings provide the first evidence that cotreatment with free or liposomal chrysophsin-1 and epirubicin leads to cell death in human cervical cancer cells through the ROS

  14. Studies on radioresistance with HeLa cells

    International Nuclear Information System (INIS)

    Koiwai, Soichiro; Muta, Nobuyoshi

    1980-01-01

    In our previous experiments (15, 16), HeLa cells were successively irradiated with 1 kR of X-rays. After receiving 3, 5, 8, 11, 14, and 17 kR the iradiated HeLa cells showed progressively increasing radioresistance. In the present paper, the results of studies on the variation of the extrapolation number (n), mean lethal dose (D sub(o)), and quasi-threshold dose (D sub(q)) of survival curves for these radioresistant HeLa strains were reported. The values of n of the original and radioresistant strains were all found between 2 and 3, and a change of the n values with an increase in the total dose received by the cell strains was not noticed. On the other hand, the values of D sub(o) of the radioresistant strains progressively increased from 105 R in the original line to 148 R in the 17 kR strain with increasing doses of pre-irradiation. Similarly, the values of D sub(q) had a tendency to increase in the radioresistant strains. Repair of sublethal damage with the original and radioresistant strains was studied and the properties of the radioresistant strains were discussed. (author)

  15. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  16. Large Scale Construction Project Innovative Management Through 5-S

    Directory of Open Access Journals (Sweden)

    Hashim Hj. Abdul Ghani Mohd.

    2014-11-01

    Full Text Available It has been well-recognised that Japanese construction firms are good in safety, hygiene, quality, productivity and image. Over the last century, the Japanese have formalised the technique and name it as '5S' Practice. Through his research in Japan in 1988, the author has re-define the name as '5-S' and developed the world's first 5-S Audit Checklist. Since 1993, he used an innovative 5-S Checklist developed at SIRIM for training and consultancy in no less than 20 countries with over 100,000 persons from around 8,000 organisations world-wide. The objective of this paper is to explain the intricacy of the 5-S so that it can be understood easily and adopted readily by those who may find the tool useful. Some experience will also be shared in this article. It is hoped that this article can arouse the interest of the construction industry in Malaysia to take up this important and effective tool for quality improvement.

  17. Implementation of 5S Method for Ergonomic Laboratory

    Science.gov (United States)

    Dila Sari, Amarria; Ilma Rahmillah, Fety; Prabowo Aji, Bagus

    2017-06-01

    This article discusses 5S implementation in Work System Design and Ergonomic Laboratory, Department of Industrial Engineering, Islamic University of Indonesia. There are some problems related to equipment settings for activity involving students such as files which is accumulated over the previous year practicum, as well as the movement of waste in the form of time due to the placement of goods that do not fit. Therefore, this study aims to apply the 5S method in DSK & E laboratory to facilitate the work processes and reduce waste. The project is performed by laboratory management using 5S methods in response to continuous improvement (Kaizen). Moreover, some strategy and suggestions are promoted to impose 5S system within the laboratory. As a result, the tidiness and cleanliness can be achieved that lead to the great performance of laboratory users. Score assessment before implementing 5S DSKE laboratory is at 64 (2.56) while the score after implementation is 32 (1.28) and shows an improvement of 50%. This has implications for better use in the laboratory area, save time when looking for tools and materials due to its location and good visual control, as well as improving the culture and spirit of ‘5S’ on staff regarding better working environment

  18. Strong decays and dipion transitions of Y(5S)

    International Nuclear Information System (INIS)

    Simonov, Yu.A.; Veselov, A.I.

    2009-01-01

    Dipion transitions of Y(nS) with n=5, n ' =1,2,3 are studied using the Field Correlator Method, applied previously to dipion transitions with n=2,3,4. The only two parameters of effective Lagrangian were fixed in that earlier study, and total widths Γ ππ (5,n ' ) as well as pionless decay widths Γ BB (5S), Γ BB* (5S), Γ B*B* (5S) and Γ KK (5,n ' ) were calculated and are in a reasonable agreement with experiment. The experimental ππ spectra for (5,1) and (5,2) transitions are well reproduced taking into account FSI in the ππ

  19. Assessment of application of 5S practices in ceramic industry

    Directory of Open Access Journals (Sweden)

    Danel Kleszcz

    2017-10-01

    Full Text Available Results of research connected with determining the degree of implementation of 5S practices in ceramics industry are discussed in this paper. Direct survey with employees of companies plus ex-pert interview was used in the research. A 21 point scale was used to assess the degree of implemen-tation the 5S practices at individual stages of the manufacturing process. The specificity of produc-tion in ceramics industry enforces maintaining the regime of cleanliness during production. The research revealed that the level of conscious implementation of the 5S practices in companies de-pends on the culture of organization and the degree of involvement of employees in the improvement actions in their company. The presented results are a part of the research aimed at determining refer-ence requirements for companies in terms of implementation and making use of the Lean Manage-ment (LM instruments.

  20. [Effects of selenium compounds on proliferation, migration and adhesion of HeLa cells].

    Science.gov (United States)

    Sun, Licui; Lu, Jiaxi; Wang, Qin; Liu, Yiqun; Han, Feng; Yang, Yanhua; Zhang, Hongkun; Huang, Zhenwu

    2015-03-01

    To explore the effects of methylseleninic acid (MeSeA), selenomethionine (SeMet) and methylselenocysteine (MeSeCys) on proliferation, migration and adhesion of HeLa cells. HeLa cells were cultured and treated with MeSeA, SeMet and MeSeCys for 12 - 72 h respectively. MTT assay, healing assay and in vitro cell Matrigel adhesion assay were used to detect the proliferation, migration and adhesion of HeLa cells. Compared to the control group, the proliferation of HeLa cells was remarkably inhibited by MeSeA (P HeLa cells in MeSeA group was inhibited by 34% (P HeLa cells with inhibitions of 18% and 13% was in SeMet group in 4 h and 8 h. The inhibitions of HeLa cell migration in MeSeCys group was 28% (P HeLa cells in the MeSeA group, the SeMet group as well as the MeSeCys group were inhibited by 36% (P HeLa cell were effectively inhibited by MeSeA, while the adhesive function of HeLa cell was remarkably inhibited by MeSeCys.

  1. 5S-toimintamallin kehittäminen nostintuotannossa

    OpenAIRE

    Laine, Atte

    2017-01-01

    TIIVISTELMÄ Opinnäytetyön aiheena oli kehittää 5S-toimintamallia Konecranes Finland Oy:n nostintuotannossa Hämeenlinnan nostintehtaalla. Konecranesilla käytetään Lean Six Sigma -menetelmiä prosessien ja liiketoiminnan kehittämiseen ja 5S-toimintamalli on yksi näistä Lean Six Sigmaan kuuluvista menetelmistä. Se on jo osittain käytössä Hämeenlinnan nostintehtaalla ja nyt tehtaan nostinkokoonpanoon oli saatava sama toimintamalli kuin muillakin tehtaan osastoilla. Opinnäytetyössä perehdyttiin...

  2. Radiative transitions from Υ(5S) to molecular bottomonium

    International Nuclear Information System (INIS)

    Voloshin, M. B.

    2011-01-01

    The heavy quark spin symmetry implies that in addition to the recently observed Z(10610) and Z(10650) molecular resonances with I G =1 + , there should exist two or four molecular bottomonium-like states with I G =1 - . Properties of these G-odd states are considered, including their production in the radiative transitions from Υ(5S), by applying the same symmetry to the Υ(5S) resonance and the transition amplitudes. The considered radiative processes can provide a realistic option for observing the yet hypothetical states.

  3. TEXTILE INDUSTRY APPLICATION OF THE 5S METHOD

    Directory of Open Access Journals (Sweden)

    Raluca BRAD

    2015-05-01

    Full Text Available The paper presents the 5S method, developed to ensure ergonomics in the workplace, productivity growth, reducing defects and increasing cleaning. 5S is a fundamental tool to promote continuous improvement process in organizations and represents a transformation in 5 steps of a job, which is characterized by maximum efficiency at the micro level and minimum loss. The tools which can be used for implementing could be the Kaizen circles for training, analysis and implementation, as well as visual elements, posters or graphics. The 5 phases are Seiri, Seiton, Seiso, Seiketsu and Shitsuke, which can be translate as Sort, Set in order, Scrub, Standardize, and Sustain, focusing on orderliness and being applied especially in Japanese factories. The stages includes inputs objectives related to the efficiency and effectiveness of the process, but also subjective, which refers to moral values, education, training, culture. For each S stage, the most important elements which are underlying the implementation and maintain the compliance are described. Any company that applied the 5S program will have quick and visible results, reducing different types of waste. The final section presents a case study and some rules in order to sustain the designed standards and implement a continuous quality improvement. The concluding remarks could be considered as work instructions in order to implement the 5S rules.

  4. Analyzing Digital Library Initiatives: 5S Theory Perspective

    Science.gov (United States)

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  5. [miR-143 inhibits cell proliferation through targeted regulating the expression of K-ras gene in HeLa cells].

    Science.gov (United States)

    Qin, H X; Cui, H K; Pan, Y; Hu, R L; Zhu, L H; Wang, S J

    2016-12-23

    Objective: To explore the effect of microRNA miR-143 on the proliferation of cervical cancer HeLa cells through targeted regulating the expression of K-ras gene. Methods: The luciferase report carrier containing wild type 3'-UTR of K-ras gene (K-ras-wt) or mutated 3'-UTR of the K-ras (K-ras-mut) were co-transfected with iR-143 mimic into the HeLa cells respectively, and the targeting effect of miR-143 in the transfectants was verified by the dual luciferase report system. HeLa cells were also transfected with miR-143 mimic (miR-143 mimic group), mimic control (negative control group), and miR-143 mimic plus K-ras gene (miR-143 mimic+ K-ras group), respectively. The expression of miR-143 in the transfected HeLa cells was detected by real-time PCR (RT-PCR), and the expression of K-ras protein was detected by Western blot. The cell proliferation activity of each group was examined by MTT assay. In addition, human cervical cancer tissue samples ( n =5) and cervical intraepithelial neoplasia tissue samples ( n =5) were also examined for the expression of miR-143 and K-ras protein by RT-PCR and Western blot, respectively. Results: The luciferase report assay showed that co-transfection with miR-143 mimic decreased the luciferase activity of the K-ras-wt significantly, but did not inhibit the luciferase activity of the K-ras-mut. The expression of miR-143 in the HeLa cells transfected with miR-143 mimic was significantly higher than that in the HeLa cells transfected with the mimic control (3.31±0.45 vs 0.97±0.22, P cell proliferative activity of the miR-143 mimic group was significantly lower than that of the negative control group ( P cell proliferative activity of the miR-143 mimic+ K-ras group was also significantly lower than the control group ( P HeLa cells through targeted regulating the expression of K-ras gene. In human cervical cancer tissues of a small sample set, the expression of miR-143 is downregulated, and the expression of K-ras is upregulated.

  6. Irradiation And Papillomavirus E2 Proteins On Hela Cells

    International Nuclear Information System (INIS)

    Abderrafi, B.

    2005-01-01

    Exposure to relatively high doses ionizing radiation activates cellular responses that impair cell survival. These responses, for which the p53 protein plays a central role, form the basis for cancer radiotherapy. However, the efficacy of radiation treatments on cell killing is often reduced as a consequence of the frequent inactivation of the p53 protein in cancer cells. Loss of p53 protein is associated with later stages of most human tumors and resistance to anticancer agents. Carcinomas are frequent malignant tumors in humans. The majority of cervical carcinomas are etiologically linked to the presence of HPV virus (Human Papillomavirus). In carcinoma tumor cells, as well as in their derived-cell lines such as HeLa cells, the p53 protein is generally not detected due to its degradation by the product of the HPV-associated oncogenic E6 gene. Another characteristic of HPV-positive cervical cancer cells is the loss of the regulatory viral E2 gene expression as a consequence of viral DNA integration into the cellular genome. Reintroduction of E2 expression in HeLa cells reactivates p53, due to a negative effect on the expression of E6 protein, with a concomitant arrest of cell proliferation at the phase G1 of the cell cycle and delay in cell division via the repression of E2F-target genes. To elucidate whether reactivation of p53 would improve the cell killing effect of ionizing radiation in cancer cells, we studied the combined effects of radiation and E2 expression on the cell cycle distribution in HeLa cells

  7. Diversity of insect trypanosomatids assessed from the spliced leader RNA and 5S rRNA genes and intergenic regions

    Czech Academy of Sciences Publication Activity Database

    Podlipaev, Sergei; Sturm, N. R.; Fiala, Ivan; Fernandes, O.; Westenberger, S. J.; Dollet, M.; Campbell, D. A.; Lukeš, Julius

    2004-01-01

    Roč. 51, č. 3 (2004), s. 283-290 ISSN 1066-5234 Grant - others:European Community(XE) QLK 2-CT-2001-01810 Institutional research plan: CEZ:AV0Z6022909 Keywords : Kinetoplastida * phylogeny * Trypanosomatidae Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.403, year: 2004

  8. Photodynamic Effects of Pterin on HeLa Cells

    DEFF Research Database (Denmark)

    Denofrio, M. Paula; Lorente, Carolina; Breitenbach, Thomas

    2011-01-01

    cells (HeLa) and that these cells die upon UV-A irradiation of Ptr. Cell death was assessed using two tests: (1) the Rhodamine 123 fluorescence assay for mitochondrial viability and (2) the Trypan Blue assay for membrane integrity. The data suggest that, for Ptr-dependent photoinitiated cell death......Pterins, heterocyclic compounds widespread in biological systems, participate in relevant biological processes and are able to act as photosensitizers. In the present study, we ascertained that 2-aminopteridin-4(3H)-one, abbreviated as Ptr, is readily incorporated into and ⁄ or onto cervical cancer...

  9. Organization and transient expression of the gene for human U11 snRNA

    Science.gov (United States)

    Clemens, Suter-Crazzolara; Walter, Keller

    1991-01-01

    The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

  10. Effect of estrogens on bacterial adherence to HeLa cells.

    OpenAIRE

    Sugarman, B; Epps, L R

    1982-01-01

    Incubating confluent cell culture HeLa cells for 18 h with increasing concentrations of estrogens progressively enhanced the subsequent attachment of a variety of radiolabeled bacteria to the HeLa cells. This effect was not caused by other hormones and was not produced by 1-h incubations of HeLa cells or bacteria with hormones. Estrogens did not similarly affect two other receptor cell lines studied. The addition of metabolic inhibitors showed that this effect of estrogens on HeLa cells was e...

  11. Human cytosolic thymidine kinase: purification and physical characterization of the enzyme from HeLa cells

    International Nuclear Information System (INIS)

    Sherley, J.L.; Kelly, T.J.

    1988-01-01

    The mammalian cytosolic thymidine kinase is one of a number of enzymes involved in DNA replication whose activities increase dramatically during S phase of the cell cycle. As a first step in defining the mechanisms that control the S phase induction of thymidine kinase activity, the authors have purified the human enzyme from HeLa cells and raised a specific immune serum against the purified protein. The enzyme was isolated from cells arrested in S phase by treatment with methotrexate and purified to near homogeneity by ion-exchange and affinity chromatography. Stabilization of the purified enzyme was achieved by the addition of digitonin. An electrophoretic R/sub m/ of 0.2 in nondenaturing gels characterizes the purified enzyme activity as cytosolic thymidine kinase. The enzyme has a Stoke's radius of 40 A determined by gel filtration and a sedimentation coefficient of 5.5 S determined by glycerol gradient sedimentation. Based on these hydrodynamic values, a native molecular weight of 96,000 was calculated for the purified enzyme. When electrophoresed in denaturing sodium dodecyl sulfate-polyacrylamide gels under reducing conditions, the most purified enzyme fraction was found to contain one predominant polypeptide of M/sub r/ = 24,000. Several lines of evidence indicate that this polypeptide is responsible for thymidine kinase enzymatic activity

  12. Structural similarities between prokaryotic and eukaryotic 5S ribosomal RNAs

    International Nuclear Information System (INIS)

    Welfle, H.; Boehm, S.; Damaschun, G.; Fabian, H.; Gast, K.; Misselwitz, R.; Mueller, J.J.; Zirwer, D.; Filimonov, V.V.; Venyaminov, S.Yu.; Zalkova, T.N.

    1986-01-01

    5S RNAs from rat liver and E. coli have been studied by diffuse X-ray and dynamic light scattering and by infrared and Raman spectroscopy. Identical structures at a resolution of 1 nm can be deduced from the comparison of the experimental X-ray scattering curves and electron distance distribution functions and from the agreement of the shape parameters. A flat shape model with a compact central region and two protruding arms was derived. Double helical stems are eleven-fold helices with a mean base pair distance of 0.28 nm. The number of base pairs (26 GC, 9 AU for E. coli; 27 GC, 9 AU for rat liver) and the degree of base stacking are the same within the experimental error. A very high regularity in the ribophosphate backbone is indicated for both 5S RNAs. The observed structural similarity and the consensus secondary structure pattern derived from comparative sequence analyses suggest the conclusion that prokaryotic and eukaryotic 5S RNAs are in general very similar with respect to their fundamental structural features. (author)

  13. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  14. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  15. PMA synergistically enhances apicularen A-induced cytotoxicity by disrupting microtubule networks in HeLa cells

    International Nuclear Information System (INIS)

    Seo, Kang-Sik; Hwang, Byung-Doo; Kim, Jong-Seok; Park, Ji-Hoon; Song, Kyoung-Sub; Yun, Eun-Jin; Park, Jong-Il; Kweon, Gi Ryang; Yoon, Wan-Hee; Lim, Kyu

    2014-01-01

    Combination therapy is key to improving cancer treatment efficacy. Phorbol 12-myristate 13-acetate (PMA), a well-known PKC activator, increases the cytotoxicity of several anticancer drugs. Apicularen A induces cytotoxicity in tumor cells through disrupting microtubule networks by tubulin down-regulation. In this study, we examined whether PMA increases apicularen A-induced cytotoxicity in HeLa cells. Cell viability was examined by thiazolyl blue tetrazolium (MTT) assays. To investigate apoptotic potential of apicularen A, DNA fragmentation assays were performed followed by extracting genomic DNA, and caspase-3 activity assays were performed by fluorescence assays using fluorogenic substrate. The cell cycle distribution induced by combination with PMA and apicularen A was examined by flow cytometry after staining with propidium iodide (PI). The expression levels of target proteins were measured by Western blotting analysis using specific antibodies, and α-tubulin mRNA levels were assessed by reverse transcription polymerase chain reaction (RT-PCR). To examine the effect of combination of PMA and apicularen A on the microtubule architecture, α-tubulin protein and nuclei were visualized by immunofluorescence staining using an anti-α-tubulin antibody and PI, respectively. We found that apicularen A induced caspase-dependent apoptosis in HeLa cells. PMA synergistically increased cytotoxicity and apoptotic sub-G 1 population induced by apicularen A. These effects were completely blocked by the PKC inhibitors Ro31-8220 and Go6983, while caspase inhibition by Z-VAD-fmk did not prevent cytotoxicity. RNA interference using siRNA against PKCα, but not PKCβ and PKCγ, inhibited cytotoxicity induced by combination PMA and apicularen A. PMA increased the apicularen A-induced disruption of microtubule networks by further decreasing α- and β-tubulin protein levels in a PKC-dependent manner. These results suggest that the synergy between PMA and apicularen A is involved by

  16. Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing.

    Science.gov (United States)

    Goldfarb, Katherine C; Cech, Thomas R

    2017-01-01

    MRP RNA is an abundant, essential noncoding RNA whose functions have been proposed in yeast but are incompletely understood in humans. Mutations in the genomic locus for MRP RNA cause pleiotropic human diseases, including cartilage hair hypoplasia (CHH). Here we applied CRISPR-Cas9 genome editing to disrupt the endogenous human MRP RNA locus, thereby attaining what has eluded RNAi and RNase H experiments: elimination of MRP RNA in the majority of cells. The resulting accumulation of ribosomal RNA (rRNA) precursor-analyzed by RNA fluorescent in situ hybridization (FISH), Northern blots, and RNA sequencing-implicates MRP RNA in pre-rRNA processing. Amelioration of pre-rRNA imbalance is achieved through rescue of MRP RNA levels by ectopic expression. Furthermore, affinity-purified MRP ribonucleoprotein (RNP) from HeLa cells cleaves the human pre-rRNA in vitro at at least one site used in cells, while RNP isolated from cells with CRISPR-edited MRP loci loses this activity, and ectopic MRP RNA expression restores cleavage activity. Thus, a role for RNase MRP in human pre-rRNA processing is established. As demonstrated here, targeted CRISPR disruption is a valuable tool for functional studies of essential noncoding RNAs that are resistant to RNAi and RNase H-based degradation. © 2017 Goldfarb and Cech; Published by Cold Spring Harbor Laboratory Press.

  17. Identification of miRNA targets with stable isotope labeling by amino acids in cell culture

    DEFF Research Database (Denmark)

    Vinther, Jeppe; Hedegaard, Mads Marquardt; Gardner, Paul Phillip

    2006-01-01

    miRNAs are small noncoding RNAs that regulate gene expression. We have used stable isotope labeling by amino acids in cell culture (SILAC) to investigate the effect of miRNA-1 on the HeLa cell proteome. Expression of 12 out of 504 investigated proteins was repressed by miRNA-1 transfection...

  18. ADP-ribosylation of nonhistone proteins from metaphase and interphase HeLa cells: factors responsible for differences

    International Nuclear Information System (INIS)

    Adolph, K.W.

    1986-01-01

    A striking reduction was previously detected for HeLa metaphase chromosomes, compared to interphase nuclei, in the number of modified nonhistone species. Several factors which could contribute to this cell cycle change in ADP-ribosylation have therefore been examined. In these experiments, mitotic or interphase cells were incubated with [ 32 P]NAD, chromosomes and nuclei were prepared, and the proteins were resolved by polyacrylamide gel electrophoresis. The level of incorporation of 32 P label was found to be substantially influenced by chromosome expansion, DNA nicking, disruption of chromosomes or nuclei, and the growth activity of cells. The level of ADP-ribosylation was not greatly affected by the presence of inhibitors of RNA, DNA, and protein synthesis. NAD concentration influenced the extent of labelling but not the pattern of labeled species. A similar change in the pattern from interphase to mitosis was observed for whole cells as well as for isolated chromosomes and nuclei. The procedure used to arrest cells in mitosis was not artifactually responsible for the results. The difference in metaphase and interphase ADP-ribosylation is not confined to HeLa cells, since comparable patterns were found for chromosomes and nuclei from Novikoff rat hepatoma cells

  19. Juglans mandshurica Maxim extracts exhibit antitumor activity on HeLa cells in vitro.

    Science.gov (United States)

    Xin, Nian; Hasan, Murtaza; Li, Wei; Li, Yan

    2014-04-01

    The present study examined the potential application of Juglans mandshurica Maxim extracts (HT) for cancer therapy by assessing their anti‑proliferative activity, reduction of telomerase activity, induction of apoptosis and cell cycle arrest in S phase in HeLa cells. From the perspective of using HT as a herbal medicine, photomicroscopy and florescent microscopy techniques were utilized to characterize the effect of the extracts on telomerase activity and cell morphology. Flow cytometry was employed to study apoptosis and cell cycle of HeLa cells, and DNA laddering was performed. The results showed that HT inhibited cell proliferation and telomerase activity, induced apoptosis and caused S phase arrest of HeLa cells in vitro. HT inhibited HeLa cell proliferation significantly, and the highest inhibition rate was 83.7%. A trap‑silver staining assay showed that HT was capable of markedly decreasing telomerase activity of HeLa cells and this inhibition was enhanced in a time‑ and dose‑dependent manner. Results of a Hoechst 33258 staining assay showed that HeLa cells treated by HT induced cell death. Through DNA agarose gel electrophoresis, DNA ladders of HeLa cells treated with HT were observed, indicating apoptosis. In conclusion, the present study demonstrated that HT exhibited anti‑tumor effects comprising the inhibition of growth and telomerase activity as well as apoptosis and cell cycle arrest in HeLa cells.

  20. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...

  1. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells.

    Science.gov (United States)

    Hornstein, Benjamin D; Roman, Dany; Arévalo-Soliz, Lirio M; Engevik, Melinda A; Zechiedrich, Lynn

    2016-01-01

    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery.

  2. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  3. [S100A7 promotes the metastasis and epithelial-mesenchymal transition on HeLa and CaSki cells].

    Science.gov (United States)

    Tian, T; Hua, Z; Wang, L Z; Wang, X Y; Chen, H Y; Liu, Z H; Cui, Z M

    2018-02-25

    Objective: To elucidate the impact of over-expression of S100A7 on migration, invasion, proliferation, cell cycle, and epithelial-mesenchymal transition (EMT) in human cervical cancer HeLa and CaSki cells. Methods: (1) Immunohistochemistry of SP was used to examine the expression of S100A7 in 40 cases of squamous cervical cancer tissues and 20 cases of normal cervical tissues. (2) The vectors of pLVX-IRES-Neo-S100A7 and pLVX-IRES-Neo were used to transfect human cervical cancer HeLa and CaSki cells, and the positive clones were screened and identified. Next, transwell migration assay, cell counting kit-8 (CCK-8) assay and fluorescence activating cell sorter (FACS) were used to detect the effect of S100A7-overexpression on the migration, invasion, proliferation and cell cycle of cervical cancer cells. Furthermore, western blot was performed to observe the expression of epithelial marker (E-cadherin) and mesenchymal markers (N-cadherin, vimentin, and fibronectin) of EMT. Results: (1) S100A7 expression was significantly higher in cervical squamous cancer tissues (median 91.6) than that in normal cervical tissues (median 52.1; Z=- 2.948, P= 0.003) . (2) Stable S100A7-overexpressed cells were established using lentiviral-mediated gene delivery in HeLa and CaSki cells. S100A7 was detected by real-time quantitative reverse transcription PCR, S100A7 mRNA of S100A7-overexpressed cells were 119±3 and 177±16, increased significantly compared with control groups of median ( Pcells, the number of S100A7-overexpressed HeLa and CaSki cells that passed the transwell membrane assay were increased significanatly (572±51 vs 337±25, PHeLa and CaSki cells that passed the transwell membrane were respectively 441±15 and 110±14, elevated significantly compared with control cells (156±21 and 59±7; Pcell cycle progression of HeLa and CaSki cells ( P> 0.05) . Expression of E-cadherin was dramatically decreased, while N-cadherin, vimentin, and fibronectin increased in S100A7

  4. From HeLa cell division to infectious diarrhoea

    International Nuclear Information System (INIS)

    Stephen, J.; Osborne, M.P.; Spencer, A.J.; Warley, A.

    1990-01-01

    Hela S3 cells were grown in suspension both randomly and, synchronously using hydroxyurea which blocks cells at the G1/S interface. Cryosections were prepared, freeze-dried and analyzed by X-ray microanalysis. As cells moved into S and through M phases [Na] and [Cl] increased; both returned to normal levels upon re-entering G1 phase. The Na/K ratio was 1:1 in G1 phase. Infection of HeLa S3 cells in G1 phase with vaccinia virus resulted in no change in intracellular [Na]. Infection of neonatal mice with murine rotavirus was localized to villus tip enterocytes and gave rise to diarrhoea which was maximal at 72h post-infection (p.i.). Diarrhoea was preceded by ischemia of villi (18-42h p.i.) and villus shortening (maximal at 42h p.i.), and was also coincident with a dramatic regrowth of villi. At 48h p.i. a proliferative zone of electron lucent cells was observed in villus base regions. Cryosections of infected gut, taken before, during, and after infection, together with corresponding age-matched controls, were freeze-dried and analysed by X-ray microanalysis. At 48h p.i. electron lucent villus base cells were shown to be more hydrated, and, to contain higher levels of both Na and Cl and lower levels of P, S, K and Mg than corresponding control cells. These studies increase confidence in the use of X-ray microanalysis in studying biological systems, provide some insight into the process of cell division, and constitute the basis of a new concept of diarrhoeal secretion.27 references

  5. From HeLa cell division to infectious diarrhoea

    Energy Technology Data Exchange (ETDEWEB)

    Stephen, J.; Osborne, M.P.; Spencer, A.J.; Warley, A. (Univ. of Birmingham (England))

    1990-09-01

    Hela S3 cells were grown in suspension both randomly and, synchronously using hydroxyurea which blocks cells at the G1/S interface. Cryosections were prepared, freeze-dried and analyzed by X-ray microanalysis. As cells moved into S and through M phases (Na) and (Cl) increased; both returned to normal levels upon re-entering G1 phase. The Na/K ratio was 1:1 in G1 phase. Infection of HeLa S3 cells in G1 phase with vaccinia virus resulted in no change in intracellular (Na). Infection of neonatal mice with murine rotavirus was localized to villus tip enterocytes and gave rise to diarrhoea which was maximal at 72h post-infection (p.i.). Diarrhoea was preceded by ischemia of villi (18-42h p.i.) and villus shortening (maximal at 42h p.i.), and was also coincident with a dramatic regrowth of villi. At 48h p.i. a proliferative zone of electron lucent cells was observed in villus base regions. Cryosections of infected gut, taken before, during, and after infection, together with corresponding age-matched controls, were freeze-dried and analysed by X-ray microanalysis. At 48h p.i. electron lucent villus base cells were shown to be more hydrated, and, to contain higher levels of both Na and Cl and lower levels of P, S, K and Mg than corresponding control cells. These studies increase confidence in the use of X-ray microanalysis in studying biological systems, provide some insight into the process of cell division, and constitute the basis of a new concept of diarrhoeal secretion.27 references.

  6. Fibrillarin, a nucleolar protein, is required for normal nuclear morphology and cellular growth in HeLa cells

    International Nuclear Information System (INIS)

    Amin, Mohammed Abdullahel; Matsunaga, Sachihiro; Ma, Nan; Takata, Hideaki; Yokoyama, Masami; Uchiyama, Susumu; Fukui, Kiichi

    2007-01-01

    Fibrillarin is a key small nucleolar protein in eukaryotes, which has an important role in pre-rRNA processing during ribosomal biogenesis. Though several functions of fibrillarin are known, its function during the cell cycle is still unknown. In this study, we confirmed the dynamic localization of fibrillarin during the cell cycle of HeLa cells and also performed functional studies by using a combination of immunofluorescence microscopy and RNAi technique. We observed that depletion of fibrillarin has almost no effect on the nucleolar structure. However, fibrillarin-depleted cells showed abnormal nuclear morphology. Moreover, fibrillarin depletion resulted in the reduction of the cellular growth and modest accumulation of cells with 4n DNA content. Our data suggest that fibrillarin would play a critical role in the maintenance of nuclear shape and cellular growth

  7. CYTOCHEMICAL STUDIES OF THE NUCLEOPROTEINS OF HELA CELLS INFECTED WITH HERPES VIRUS.

    Science.gov (United States)

    Love, R; Wildy, P

    1963-05-01

    The morphological and cytochemical changes in HeLa cells infected with herpes virus have been studied at frequent intervals during infection and related to the growth of virus and the multiplicity of the virus inoculum. Infection with a high multiplicity inoculum produced enlargement and extrusion of small ribonucleoprotein (RNP) bodies in the nucleoli (nucleolini) to form RNP bodies in the nucleoplasm (B bodies) beginning (1/2) hour after infection. 3 hours after infection, RNP of the pars amorpha appeared to diffuse into the adjacent nucleoplasm, where, (1/2) hour later, the classical type A inclusion or A body first appeared. The A bodies displaced the B bodies and the nucleoli and eventually filled the nucleus. 6 hours after infection, minute granules containing RNA, DNA, and non-histone protein appeared inside the A bodies (A granules) and increased in number until the late stages of infection, when they disappeared. 18 hours after infection, at the time when the A bodies came to fill the nucleus completely, extrusion of RNP from the nucleus produced cytoplasmic masses which have been termed C bodies. B bodies were formed in the majority of cells before the maturation of infectious virus, but the number of B bodies could not be correlated with the amount of virus in the cell or with the multiplicity of the inoculum. It is suggested that the formation of B bodies may be the result of inhibition of the onset of mitotic division by a mechanism which does not inhibit the formation of RNA in the nucleolini. The nature of the A bodies, the A granules, and the C bodies is discussed and it is concluded that the A granules may represent aggregations of maturing virus in the nucleus. The progression of some C mitotic metaphases to the formation of post-C mitotic multinucleated giant cells is described. These are distinct from syncytia formed by cell fusion.

  8. Mifepristone sensitizing cisplatin for cervical adenocarcinoma HeLa cell sensitivity to chemotherapy and its mechanism.

    Science.gov (United States)

    Li, Caihong; Ye, Hong

    2013-01-01

    The study was designed to investigate proliferation inhibition for cervical adenocarcinoma HeLa cell treated with cisplatin combined with mifepristone and access its possible mechanism. HeLa cell was processed by different concentrations of mifepristone, cisplatin, and their combination respectively. Cell's proliferation inhibition rate and induction apoptosis ability were detected by MTT assay, FCM; the expression of P53, survivin and HPV E6 protein were measured by Western Blot. The results showed that cisplatin inhibits proliferation of HeLa cells in different concentrations (p 0.05). Mifepristone at low concentrations (cisplatin can significantly enhance the inhibitory effect of cisplatin on HeLa cell line. Flow cytometry showed that mifepristone at low concentrations (cisplatin can induce apparent apoptosis of HeLa cell line in concentration dependent manner. Western blotting demonstrated that the expression of P53 protein increased and the expression of HPV E6 survivin protein decreased in HeLa cells treated with MIF at low concentrations (cisplatin. Mifepristone at low concentrations (cisplatin to HeLa cells. The strengthening effect of growth inhibition and chemosensitivity to cisplatin of mifepristone are associated with down-regulating HPV E6 survivin protein and upregulating p53 protein.

  9. Auranofin induces apoptosis and necrosis in HeLa cells via oxidative stress and glutathione depletion.

    Science.gov (United States)

    You, Bo Ra; Shin, Hye Rim; Han, Bo Ram; Kim, Suhn Hee; Park, Woo Hyun

    2015-02-01

    Auranofin (Au), an inhibitor of thioredoxin reductase, is a known anti‑cancer drug. In the present study, the anti‑growth effect of Au on HeLa cervical cancer cells was examined in association with levels of reactive oxygen species (ROS) and glutathione (GSH). Au inhibited the growth of HeLa cells with an IC50 of ~2 µM at 24 h. This agent induced apoptosis and necrosis, accompanied by the cleavage of poly (ADP‑ribose) polymerase and loss of mitochondrial membrane potential. The pan‑caspase inhibitor, benzyloxycarbonyl‑Val‑Ala‑Asp‑fluoromethylketone, prevented apoptotic cell death and each of the assessed caspase inhibitors inhibited necrotic cell death induced by Au. With respect to the levels of ROS and GSH, Au increased intracellular O2•- in the HeLa cells and induced GSH depletion. The pan‑caspase inhibitor reduced the levels of O2•- and GSH depletion in Au‑treated HeLa cells. The antioxidant, N‑acetyl cysteine, not only attenuated apoptosis and necrosis in the Au‑treated HeLa cells, but also decreased the levels of O2•- and GSH depletion in the cells. By contrast, L‑buthionine sulfoximine, a GSH synthesis inhibitor, intensified cell death O2•- and GSH depletion in the Au‑treated HeLa cells. In conclusion, Au induced apoptosis and necrosis in HeLa cells via the induction of oxidative stress and the depletion of GSH.

  10. Cytotoxic effect and radiation enhancement of artemisinin in uterine cervical carcinoma cell line HeLa

    International Nuclear Information System (INIS)

    Gong Xiaomei; Zhou Daoan; Cao Jianping; Fan Saijun; Zhu Wei

    2010-01-01

    Objective: To investigate cytotoxic and radiosensitizing effect of Artemisinin on cervical carcinoma cell line HeLa. Methods: In order to measure the optimized effective time, cytotoxic effect of Artemisinin on HeLa cell line was investigated with MTT assay. The radiosensitization effect of different doses and different treatment duration of Artemisinin on HeLa cell line were evaluated by MTT test, the SER is 1.17 and radiosensitizing effect was measured with multi-target single hit model through SER of HeLa cell. Cell cycles in different groups were calculated by flow cytometry. Results: The 50% inhibition concentration of Artemisinin interacted with HeLa cells for 24 h is 600.19 nmol/ml, and for 48 h is 160.71 nmol/ml. The HeLa cells'surival ratio is 93.51%, 91.87%, and 87.28% after adding Atemisinin of 110.69 nmol/ml and 1 Gy radiation exposure. There are three groups: the chemotherapy only group, the radiotherapy only group and the combination group. The result of the cell cycles showed that cells in G 2 /M period decreased in the combination group. Conclusion: Artemisinin has radiosensitization effect on cervical carcinoma HeLa cells, whichshows dose and time dependent. Artemisinin can inhibit the G 2 /M block by ionizing radiation. (authors)

  11. HeLa DNA damage response induced by 12C6+ ions

    International Nuclear Information System (INIS)

    Chen Jidong; Li Ning; Zhang Hong; Wu Zhenhua

    2009-01-01

    The aim of this study is to explore the DNA damage response of HeLa irradiated by 12 C 6+ beam and the mechanism of the p53 activation change in this response.In our present study, double strands break(DSB)of HeLa cells irradiated with 12 C 6+ beam were detected through neutral single cell gel electrophoresis, and AO/EB staining was used to detect the apoptosis of irradiated HeLa in 24h irradiation. Moreover, HeLa was pre-treated with caffeine (ATM and ATR inhibiting) or wormannin with certain concentrations (20 μmol/L, ATM and DNA-PK inhibiting) and irradiated with 1Gy of 12 C 6+ beam,and the expression of p53 was detected with Western blot analysis. The results show that DSB of HeLa caused by 12 C 6+ beam increases with absorbed doses and decreases with the time after irradiation. The apoptosis percentage of irradiated HeLa increases with absorbed doses. It has been found that the p53 expression increases after irradiation, but has not significant increment with caffeine or wortmannin pre-treatment in cells.It can be deduced that the p53 activation is ATM-dependent, but not ATR and DNA-PK-dependent in HeLa DNA damage response induced by 12 C 6+ beam. (authors)

  12. Preferences of AAA/AAG codon recognition by modified nucleosides, τm5s2U34 and t6A37 present in tRNALys.

    Science.gov (United States)

    Sonawane, Kailas D; Kamble, Asmita S; Fandilolu, Prayagraj M

    2017-12-27

    Deficiency of 5-taurinomethyl-2-thiouridine, τm 5 s 2 U at the 34th 'wobble' position in tRNA Lys causes MERRF (Myoclonic Epilepsy with Ragged Red Fibers), a neuromuscular disease. This modified nucleoside of mt tRNA Lys , recognizes AAA/AAG codons during protein biosynthesis process. Its preference to identify cognate codons has not been studied at the atomic level. Hence, multiple MD simulations of various molecular models of anticodon stem loop (ASL) of mt tRNA Lys in presence and absence of τm 5 s 2 U 34 and N 6 -threonylcarbamoyl adenosine (t 6 A 37 ) along with AAA and AAG codons have been accomplished. Additional four MD simulations of multiple ASL mt tRNA Lys models in the context of ribosomal A-site residues have also been performed to investigate the role of A-site in recognition of AAA/AAG codons. MD simulation results show that, ASL models in presence of τm 5 s 2 U 34 and t 6 A 37 with codons AAA/AAG are more stable than the ASL lacking these modified bases. MD trajectories suggest that τm 5 s 2 U recognizes the codons initially by 'wobble' hydrogen bonding interactions, and then tRNA Lys might leave the explicit codon by a novel 'single' hydrogen bonding interaction in order to run the protein biosynthesis process smoothly. We propose this model as the 'Foot-Step Model' for codon recognition, in which the single hydrogen bond plays a crucial role. MD simulation results suggest that, tRNA Lys with τm 5 s 2 U and t 6 A recognizes AAA codon more preferably than AAG. Thus, these results reveal the consequences of τm 5 s 2 U and t 6 A in recognition of AAA/AAG codons in mitochondrial disease, MERRF.

  13. DEPLOYMENT OF 5S SYSTEM IN ARCHIVES MANAGEMENT

    Directory of Open Access Journals (Sweden)

    Marcelo Cavaglieri

    2017-06-01

    Full Text Available An efficient document management brings various benefits, not only for professionals of the area but, mainly, for business managers who can use this information in their decisionmaking to enjoy competitive advantages on competitors. Having in mind that effectiveness is a constant pursuit for any company in order to achieve their strategic goals and improve the techniques which enable more productivity using fewer financial resources. In this sense, it was sought to apply the 5S philosophy in the document file management of Santa Fé Company, once it is necessary to improve the current processes with less waste and more efficiency, with a view to the need to suit the client more efficiently before their information necessities. Regarding to the method used, it is characterized as a researchaction in a quali-quantitative approach, classified as exploratory and descriptive. Among the obtained research results, it stands out in a quantitative way the reduction of waste, with significant gains of Lead Time, diminishing the time to process the activities. Financial gains were also obtained with a better use of resources and a redesigning of the way to keeping the documents. In a qualitative way, a better working environment is highlighted and increase of the service efficiency in bringing more customer satisfaction.

  14. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  15. The effects of ascorbic acid on diphtheria toxin and intoxicated hela cells

    International Nuclear Information System (INIS)

    Clark, C.E.; Smith, T.J.

    1976-01-01

    Ascorbic acid (vitamin C) prevented diphtheria toxin from inhibiting the incorporation of [U- 14 C]-alanine into trichloroacetic acid precipitable material in HeLa cells. Ascorbic acid did not exhibit an effect on the adenosine diphosphate-ribosylation of amino acyl transferase 2 nor did it separate fragment A from fragment B in ''nicked'' toxin. A non-specific reducing agent, para-methylaminophenol sulfate, exhibited an effect of HeLa cells very similar to the results of ascorbic acid. Citric acid, a tricarboxylic acid, had no effect on HeLa cells. (auth.)

  16. Effect of Quercetin on radio-sensitivity of HeLa cells

    International Nuclear Information System (INIS)

    Wu Xiaofen; Hong Chengjiao; Guo Wenxiu; Pan Yanling; Zhang Baoguo

    2011-01-01

    In order to investigate the mechanism of Quercetin on radio-sensitivity of human Uterine Cervix Cancer HeLa cells, HeLa cells were cultured in different concentrations of Quercetin and different doses of irradiation. The clonogenic assay was used to observe the cell survival rate. The repair of DNA double-strand breaks and effect of Quercetin combination of radiation on the cell cycle were detected by flow cytometry. The results show that the radio-sensitivity of Quercetin on HeLa cells was obvious and the unrepaired DSBs after irradiation increased, but did not decrease G2/M cell cycle arrest. From this it can be inferred that the effect on HeLa cell radio-sensitivity may be related to the inhibition of the repair of DNA double-strand breaks induced by Quercetin, but it dose not reveal a significant relation with the cell cycle and G2/M arrest. (authors)

  17. Observation of the strongest 5s2 5p6 5d-(5s2 5p5 5d6s+5s25p6 7p) transitions in Au XI to Bi XV ions

    International Nuclear Information System (INIS)

    Churilov, S.S.; Joshi, Y.N.

    2001-01-01

    The spectra of gold till bismuth were studied in the 90-135 A region. Nine most intense lines belonging to the 5s 2 5p 6 5d-5s 2 5p 5 5d6s array were identified in Au XI to Bi XV ions. The 5s 2 5p 6 7p 2 P 3/2,1/2 levels in Au XI and the 5s 2 5p 6 7p 2 P 3/2 level in Hg XII were also identified. The observed wavelengths and intensities agree quite well with the Hartree-Fock calculations. (orig.)

  18. Effect of 17-AAG on radio-sensitivity of HeLa and V79 cells

    International Nuclear Information System (INIS)

    Pan Yanling; Hong Chengjiao; Zhang Baoguo

    2010-01-01

    In order to investigate the radio-sensitizing effect of 17-AAG, an inhibitor of Heat Shock Protein 90, on human Uterine Cervix Cancer HeLa and V79 cells, Clonogenic assay was used to observe the cell survival rate. The results show that 17-AAG can decrease obviously (p 0.05). This indicates that 17-AAG may enhance the radio-sensitivity of the HeLa cell line and has no effect on the V79 cell line. (authors)

  19. Oxygen enhancement ratios in synchronous HeLa cells exposed to low-LET radiation

    International Nuclear Information System (INIS)

    Sapozink, M.D.

    1977-01-01

    HeLa cells were synchronized by the mitotic selection method and rendered hypoxic by coincubation with an excess of heavily irradiated, but metabolically active, feeder cells. An oxygen enhancement ratio (OER) of about 3 was obtained in interphase HeLa cells irradiated with x or gamma rays. A significantly lower OER was obtained with cells in, or close to, mitosis. The significance of this decrease in the oxygen effect in mitotic cells is discussed

  20. Dissociation of histone and DNA synthesis in x-irradiated HeLa cells

    International Nuclear Information System (INIS)

    Bases, R.; Mendez, F.

    1971-01-01

    Although histone synthesis and DNA synthesis are normally very well coordinated in HeLa cells, their histone synthesis proved relatively resistant to inhibition by ionizing radiation. During the first 24 h after 1,000 R the rate of cellular DNA synthesis progressively fell to small fractions of control values while histone synthesis with much less relative reduction. Acrylamide gel electropherograms of the acid soluble nuclear histones synthesized by irradiated HeLa cells were qualitatively normal

  1. Study of radiation sensitization of artesunate on human HeLa cells of cervical cancer

    International Nuclear Information System (INIS)

    Ji Rong; Cao Jianping; Chen Xialin; Zhu Wei; Jiang Qing; Pan Chunyan; Zhou Yuanyuan; Feng Yang; Peng Xiaomei; Liu Yang; Fan Saijun

    2010-01-01

    Objective: To investigate the radiosensitizing effects of artesunate on human HeLa cells of cervical cancer in vitro. Methods: Hela cells irradiated with 60 Co γ-rays. The dose rate was 0.635 Gy/min and the radiation dose was 0, 1, 2, 4, 6 Gy, respectively. The anti-proliferation activities of artesunate on HeLa cells were evaluated with MTT assay, to determine the most appropriate drug concentration. The effect of radiosensitivity was observed by using clonogenic assay. The single-hit multi-target model was used to plot the HeLa cell's dose-survival curve, to calculate mean lethal dose, quasi-threshold dose and sensitization enhancement rate, and to evaluate its radiosensitization effect. The apoptosis was analyzed with flow cytometry (FCM) to further test the radiation sensitization of artesunate on HeLa cells. Results: The inhibition of artesunate on HeLa cells increased with concentration. In radiation group, the cell cloning efficiency were 91.67%, 82.02%, 58.06%, 25.01%, respectively, and in artesunate (2.0 μmol/L) + radiation group, the cell cloning efficiency were 74.93%, 60.53%, 22.38%, 5.05%. In radiation group and artesunate (2.0 μmol/L) + radiation group, the mean lethal dose (D 0 ) was 2.95 and 2.07 Gy, respectively, while the qusai-threshold dose (D q ) were 2.01 and 1.24 Gy, respectively, and SER was 1.43. Compared with 2 and 6 Gy radiation group, the apoptosis rate of drug + radiation group increased from 12.26%, 40.08% to 22.71%, 59.92. Conclusions: The inhibiting effect of artesunate on HeLa cells is concentration-dependent. Artesunate has radiosensitizing effect on HeLa cells in vitro. (authors)

  2. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  3. Effect of quercetin on radiosensitivity of human uterine cervix cancer HeLa cells

    International Nuclear Information System (INIS)

    Liang Xiaofang; Hong Chengjiao; Zhang Baoguo

    2009-01-01

    In order to investigate the effects of Quercetin on radiosensitivity of human Uterine Cervix Cancer HeLa cells, MTT assay and clonogenic assay were performed to evaluate the cytotoxicity of Quercetin on the cells. Clonogenic assay was used to observe its effects on the radiosensitivity of the cells. MTT result shows that the inhibition of Quercetin on the cells is in the dose-dependent and time-dependent. And the clonogenic assay result shows that the effect of Quercetin on HeLa cells can be divided into two parts, one for the inhibition of HeLa cells and another for the induction of HeLa cell death. The other clonogenic assay result also shows Quercetin can decrease clonogenic survival rate of HeLa cells exposed to X rays. The study shows Quercetin might enhance the radiosensitivity of the HeLa cell line. And it may provide a useful evaluation to combination of ionizing radiation and Quercetin for cancer patients. (authors)

  4. The critical role of quercetin in autophagy and apoptosis in HeLa cells.

    Science.gov (United States)

    Wang, Yijun; Zhang, Wei; Lv, Qiongying; Zhang, Juan; Zhu, Dingjun

    2016-01-01

    In recent years, the effects of quercetin on autophagy and apoptosis of cancer cells have been widely reported, while effects on HeLa cells are still unclear. Here, HeLa cells were subjected to quercetin treatment, and then proliferation, apoptosis, and autophagy were evaluated using MTT, flow cytometry, and MDC staining, respectively. The LC3-I/II, Beclin 1, active caspase-3, and S6K1 phosphorylation were detected using Western blot assay. The ultrastructure of HeLa was observed via transmission electron microscope (TEM). Our findings showed that quercetin can dose-dependently inhibit the growth of HeLa cells. The MDC fluorescence was enhanced with increased concentration of quercetin and hit a plateau at 50 μmol/l. Western blot assay revealed that LC3-I/II ratio, Beclin 1, and active caspase-3 protein were enforced in a dose-dependent method. However, the phosphorylation of S6K1 gradually decreased, concomitant with an increase of autophagy. In addition, TEM revealed that the number of autophagic vacuoles was peaked at 50 μmol/l of quercetin. Besides, interference of autophagy with 3-MA led to proliferation inhibition and increased apoptosis in HeLa cells, accompanied by the decreased LC3-I/II conversion and the increased active caspase-3. In conclusion, quercetin can inhibit HeLa cell proliferation and induce protective autophagy at low concentrations; thus, 3-MA plus quercetin would suppress autophagy and effectively increased apoptosis.

  5. Radiation sensitization by CAPE on human HeLa cells of cervical cancer

    International Nuclear Information System (INIS)

    Wang Xiaoqiang; Cao Jianping; Fan Saijun; Zun Wei; Huang Xiaofei; Liu Yang; Chen Xialin; Gong Xiaomei; Peng Xiaomei; Zeng Jing

    2009-01-01

    Objective: To study the radiosensitizing effect of caffic acid phenethyl ester (CAPE) on human cervical cancer HeLa cells. Methods: MTT assay was used to measure the relation between the inhibition effect and CAPE concentrations by CAPE with different concentrations on HeLa cells for 24 hours. HeLa cells were divided into the control and experimental groups, both of which were given 0, 2, 4, 6 and 8 Gy of 60Co γ-irradiation, respectively. The cell clones were counted. Meanwhile HeLa cells were divided into the control, CAPE, irradiation and combination groups. Flow cytometric analysis was adopted to detect the changes of cell cycle distribution induced by CAPE. Results: The inhibition rate of CAPE acting on Hela cells increased with concentrations (F=126. 49 ∼ 3654.88, P 0 ) (1.45 and 1.82 Gy) and the quasi-threshold dose (D q ) (1.89 and 3.21 Gy) of HeLa cells in experimental group decreased comparing with control group, SER was 1.26. Compared with the sole irradiation group, cells in G 2 /M phase of the CAPE group and the sole irradiation group increased (P 2 /M arrest and may be related to the inhibition of the sub-lethal damage repair. (authors)

  6. Radiation sensitization by dihydroartemisinin on human HeLa cells of cervical cancer

    International Nuclear Information System (INIS)

    Chen Xialin; Cao Jianping; Ji Rong; Zhu Wei; Liu Yang; Gong Xiaomei; Tang Yan; Pan Chunyan; Fan Saijun

    2009-01-01

    Objective: To investigate the radiosensitizing effects of dihydroartemisinin (DHA) on human HeLa cells of cervical cancer irradiated by X rays. Methods: Cell growth kinetics was determined using MTF assay. Cell survival was analyzed by elonogenic assay. The change of cell cycle and apeptosis was measured by flow cytometry. Results: Dihydroartemisinin inhibited the growth of HeLa cells of human cervical cancer and showed a dose-dependent and time-dependent manner. Dihydroartemisinin (20 μmol/L) showed the radiosensitizing effects on HeLa cells, and the sensitizing enhancement ratio (SER) was 1.47. Dihydroartemisinin abrogated radiation-induced G 2 arrest of the tested HeLa cells, the G 2 ratio of medicine + radiation group dechned from 73.58% to 48.31%. Dihydroartemisinin enhanced the apoptosis of HeLa cells by X-irradiation, the apoptosis rates of medicine + radiation group significantly increased from 29.46%, 48.04%, 70.21% to 45.79%, 66.36% and 79.58%, respectively for 2, 4 and 6 Gy. Conclusions: Dihydroartemisinin could increase the radiosensitivity of HeLa cells of human cervical cancer. Abrogation of radiation-induced C 2 arrest could be part of the mechanism. (authors)

  7. Quercetin suppresses HeLa cells by blocking PI3K/Akt pathway.

    Science.gov (United States)

    Xiang, Tao; Fang, Yong; Wang, Shi-Xuan

    2014-10-01

    To explore the effect of quercetin on the proliferation and apoptosis of HeLa cells, HeLa cells were incubated with quercetin at different concentrations. Cell viability was evaluated by MTT assay, cell apoptosis was detected by Annexin-V/PI double labeled cytometry and DNA ladder assay. Cell cycle was flow cytometrically determined and the morphological changes of the cells were observed under a fluorescence microscope after Hoechst 33258 staining and the apoptosis-related proteins in the HeLa cells were assessed by Western blotting. The results showed that quercetin significantly inhibited the growth of HeLa cells and induced obvious apoptosis in vitro in a time- and dose-dependent manner. Moreover, quercetin induced apoptosis of HeLa cells in cell cycle-dependent manner because quercetin could induce arrest of HeLa cells at G0/G1 phase. Quercetin treatment down-regulated the expression of the PI3K and p-Akt. In addition, quercetin could down-regulate expression of bcl-2, up-regulate Bax, but exerted no effect on the overall expression of Akt. We are led to conclude that quercetin induces apoptosis via PI3k/Akt pathways, and quercetin has potential to be used as an anti-tumor agent against human cervix cancer.

  8. Effects of 3-AB on PARP expression of Hela cells and apoptosis and cell cycle progression of Hela cells after X-rays irradiation

    International Nuclear Information System (INIS)

    Du Xiang; Zhao Hongguang; Guo Wei; Gong Shouliang; Wang Wen

    2007-01-01

    Objective: To study the changes of apoptosis and cell cycle progression of Hela cells after the poly (ADP- ribose) polymerase (PARP) was inhibited by its inhibitor 3-aminobenzamid (3-AB) and the mechanisms of PARP interaction with Hela cells damaged by irradiation. Methods: Hela cell line was used. Flow cytometry (FCM) was used to examine the PARP expression of control and 3 AB groups at 0, 2, 4, 8, 12 h alter administration with 5 mmol·L -1 3-AB. The percentage of apoptotic cells and cell cycle progression ol control, irradiation, 3-AB plus irradiation groups were measured with FCM at 2, 8, 12, 24 h after exposure to 2 Gy irradiation following administration with 5 mmol·L -1 3-AB. Results: The percentage of Hela cells with positive expression of PARP protein decreased after administration with 3-AB and there was significant difference between 3-AB plus irradiation group and control group (P 2 cells in the 3-AB plus irradiation group were lower than those in the irradiation group (P 2 arrest induced by irradiation. (authors)

  9. The calculation of oscillator strengths for the 5s21S0→5s5p1,3P1 transitions in Cd-like ions

    International Nuclear Information System (INIS)

    Li Guangyuan

    1998-01-01

    The screened hydrogenic model is employed to calculate the oscillator strength of the 5s 2 1 S 0 -5s5p 1 P 1 resonance transition in Cd-like ions (Z = 48 -74). The expression for the oscillator strength of the 5s 2 1 S 0 -5s5p 3 P1 is given, with the introduction of the correctional coefficient K and the mixing angle in jj-coupling. The results are compared with that of other authors, and some discussions are also given

  10. Human SUV3 helicase regulates growth rate of the HeLa cells and can localize in the nucleoli.

    Science.gov (United States)

    Szewczyk, Maciej; Fedoryszak-Kuśka, Natalia; Tkaczuk, Katarzyna; Dobrucki, Jurek; Waligórska, Agnieszka; Stępień, Piotr P

    2017-01-01

    The human SUV3 helicase (SUV3, hSUV3, SUPV3L1) is a DNA/RNA unwinding enzyme belonging to the class of DexH-box helicases. It localizes predominantly in the mitochondria, where it forms an RNA-degrading complex called mitochondrial degradosome with exonuclease PNP (polynucleotide phosphorylase). Association of this complex with the polyA polymerase can modulate mitochondrial polyA tails. Silencing of the SUV3 gene was shown to inhibit the cell cycle and to induce apoptosis in human cell lines. However, since small amounts of the SUV3 helicase were found in the cell nuclei, it was not clear whether the observed phenotypes of SUV3 depletion were of mitochondrial or nuclear origin. In order to answer this question we have designed gene constructs able to inhibit the SUV3 activity exclusively in the cell nuclei. The results indicate that the observed growth rate impairment upon SUV3 depletion is due to its nuclear function(s). Unexpectedly, overexpression of the nuclear-targeted wild-type copies of the SUV3 gene resulted in a higher growth rate. In addition, we demonstrate that the SUV3 helicase can be found in the HeLa cell nucleoli, but it is not detectable in the DNA-repair foci. Our results indicate that the nucleolar-associated human SUV3 protein is an important factor in regulation of the cell cycle.

  11. O-5S quantitative real-time PCR: a new diagnostic tool for laboratory confirmation of human onchocerciasis.

    Science.gov (United States)

    Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz

    2017-10-02

    Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.

  12. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  13. Hyperfine structure in 5s4d 3D-5snf transitions of 87Sr

    International Nuclear Information System (INIS)

    Bushaw, B.A.; Kluge, H.J.; Lantzsch, J.; Schwalbach, R.; Stenner, J.; Stevens, H.; Wendt, K.; Zimmer, K.

    1993-01-01

    The hyperfine spectra of the 5s4d 3 D 1 -5s20f, 5s4d 3 D 2 -5s23f, and 5s4d 3 D 3 -5s32f transitions of 87 Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a 5s and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d 3 D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  14. [Essential oil from Artemisia lavandulaefolia induces apoptosis and necrosis of HeLa cells].

    Science.gov (United States)

    Zhang, Lu-min; Lv, Xue-wei; Shao, Lin-xiang; Ma, Yan-fang; Cheng, Wen-zhao; Gao, Hai-tao

    2013-12-01

    To investigate the effects of Artemisia lavandulaefolia essential oil on apoptosis and necrosis of HeLa cells. Cell viability was assayed using MTT method. The morphological and structure alterations in HeLa cells were observed by microscopy. Furthermore, cell apoptosis was measured by DNA Ladder and flow cytometry. DNA damage was measured by comet assay, and the protein expression was examined by Western blot analysis. MTT assay displayed essential oil from Artemisia lavandulaefolia could inhibit the proliferation of HeLa cells in a dose-dependent manner. After treated with essential oil of Artemisia lavadulaefolia for 24 h, HeLa cells in 100 and 200 microg/mL experiment groups exhibited the typical morphology changes of undergoing apoptosis, such as cell shrinkage and nucleus chromatin condensed. However, the cells in the 400 microg/mL group showed the necrotic morphology changes including cytomembrane rupture and cytoplasm spillover. In addition, DNA Ladder could be demonstrated by DNA electrophoresis in each experiment group. Apoptosis peak was also evident in flow cytometry in each experiment group. After treating the HeLa cells with essential oil of Artemisia lavadulaefolia for 6 h, comet tail was detected by comet assay. Moreover, western blotting analysis showed that caspase-3 was activated and the cleavage of PARP was inactivated. Essential oil from Artemisia lavadulaefolia can inhibit the proliferation of HeLa cells in vitro. Low concentration of essential oil from Artemisia lavadulaefolia can induce apoptosis, whereas high concentration of the compounds result in necrosis of HeLa cells. And,the mechanism may be related to the caspase-3-mediated-PARP apoptotic signal pathway.

  15. Anti-proliferative effect of RCE-4 from Reineckia carnea on human cervical cancer HeLa cells by inhibiting the PI3K/Akt/mTOR signaling pathway and NF-κB activation.

    Science.gov (United States)

    Bai, Caihong; Yang, Xiaojiao; Zou, Kun; He, Haibo; Wang, Junzhi; Qin, Huilin; Yu, Xiaoqin; Liu, Chengxiong; Zheng, Juyan; Cheng, Fan; Chen, Jianfeng

    2016-06-01

    Cervical cancer is the second leading cause of cancer deaths in women worldwide. In recent years, the studies find that inflammation is a critical component of tumor progression, and the ideal therapeutic methods should be aimed at the inflammation reaction triggers. (1β,3β,5β,25S)-spirostan-1,3-diol1-[α-L-rhamnopyranosyl-(1 → 2)-β-D-xylopyranoside] (RCE-4) was the main active composition of Reineckia carnea (Andr.) Kunth. It significantly induced apoptosis in cervical cancer Caski cells through the mitochondrial pathway in our previous studies; however, its underlying mechanism remains poorly understood. This study aimed to further evaluate the effect of RCE-4 on human cervical cancer HeLa cells. Based on this observation, we investigated the anti-cervical cancer effect of RCE-4 by modulating phosphatidylinositol 3-kinase/protein kinase-B/mammalian target of rapamycin (PI3K/Akt/mTOR) signaling pathway, nuclear factor-kappa B (NF-κB) activation, and inflammation-related key factors in HeLa cells. The results indicated that the HeLa cell was the most sensitive with an IC50 of 7.01 μM; RCE-4 significantly promoted the release of cellular lactate dehydrogenase (LDH); increased DNA fragmentation and apoptosis; reduced PI3K, Akt, mTOR, and NF-κBp65 phosphorylation levels; increased the Bax and cleaved poly (ADP-ribose) polymerase (PARP) protein levels; suppressed Bcl-2 protein expression; elevated the Bax/Bcl-2 expression ratio; and decreased the interleukin-1 beta (IL-1β) and interleukin-6 (IL-6) mRNA expressions in HeLa cells in a concentration-dependent manner. These findings suggest that RCE-4 exerted beneficially anti-cervical cancer effect on HeLa cells, mainly inhibiting PI3K/Akt/mTOR signaling pathway phosphorylation and NF-κB activation, promoting HeLa cell apoptosis. Graphical abstract Anti-tumor effect of RCE-4 on HeLa cells.

  16. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  17. Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

    International Nuclear Information System (INIS)

    Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

    2007-01-01

    The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

  18. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  19. Kaempferia parviflora Extract Exhibits Anti-cancer Activity against HeLa Cervical Cancer Cells.

    Science.gov (United States)

    Potikanond, Saranyapin; Sookkhee, Siriwoot; Na Takuathung, Mingkwan; Mungkornasawakul, Pitchaya; Wikan, Nitwara; Smith, Duncan R; Nimlamool, Wutigri

    2017-01-01

    Kaempferia parviflora (KP) has been traditionally used as a folk remedy to treat several diseases including cancer, and several studies have reported cytotoxic activities of extracts of KP against a number of different cancer cell lines. However, many aspects of the molecular mechanism of action of KP remain unclear. In particular, the ability of KP to regulate cancer cell growth and survival signaling is still largely unexplored. The current study aimed to investigate the effects of KP on cell viability, cell migration, cell invasion, cell apoptosis, and on signaling pathways related to growth and survival of cervical cancer cells, HeLa. We discovered that KP reduced HeLa cell viability in a concentration-dependent manner. The potent cytotoxicity of KP against HeLa cells was associated with a dose-dependent induction of apoptotic cell death as determined by flow cytometry and observation of nuclear fragmentation. Moreover, KP-induced cell apoptosis was likely to be mediated through the intrinsic apoptosis pathway since caspase 9 and caspase 7, but not BID, were shown to be activated after KP exposure. Based on the observation that KP induced apoptosis in HeLa cell, we further investigated the effects of KP at non-cytotoxic concentrations on suppressing signal transduction pathways relevant to cell growth and survival. We found that KP suppressed the MAPK and PI3K/AKT signaling pathways in cells activated with EGF, as observed by a significant decrease in phosphorylation of ERK1/2, Elk1, PI3K, and AKT. The data suggest that KP interferes with the growth and survival of HeLa cells. Consistent with the inhibitory effect on EGF-stimulated signaling, KP potently suppressed the migration of HeLa cells. Concomitantly, KP was demonstrated to markedly inhibit HeLa cell invasion. The ability of KP in suppressing the migration and invasion of HeLa cells was associated with the suppression of matrix metalloproteinase-2 production. These data strongly suggest that KP may slow

  20. Altered ganglioside GD3 in HeLa cells might influence the cytotoxic abilities of NK cells

    OpenAIRE

    Lee, Wen-Chi; Lee, Wen-Ling; Shyong, Wen-Yuann; Yang, Lin-Wei; Ko, Min-Chun; Yeh, Chang-Ching; Edmond Hsieh, Shie-Liang; Wang, Peng-Hui

    2012-01-01

    Objective: Previously, we found that altered sialidases in HeLa cells in a natural killer-HeLa (NK-HeLa) coculture system contributed to the decreased cytotoxic ability of NK cells. However, changes that occur in the glycosylation of the HeLa cells in the NK-HeLa coculture system remain unknown. Materials and Methods: An NK-HeLa coculture system was used to examine the changes that occur in the gangliosides of HeLa cells. Results: GD3 expression in HeLa cells was significantly increased...

  1. Effects of TGF-β1 on the Proliferation and Apoptosis of Human Cervical Cancer Hela Cells In Vitro.

    Science.gov (United States)

    Tao, Ming-Zhu; Gao, Xia; Zhou, Tie-Jun; Guo, Qing-Xi; Zhang, Qiang; Yang, Cheng-Wan

    2015-12-01

    To investigate the effects of TGF-β1 on the proliferation and apoptosis of cervical cancer Hela cells in vitro. Human cervical cancer Hela cells were cultured in vitro and divided into the experimental and control groups. In the experimental groups, Hela cells were stimulated with different concentrations of TGF-β1 (0.01, 0.1, 1, and 10 ng/mL), while Hela cells cultured in serum-free medium without TGF-β1 were used as controls. The CCK8 method was adopted to detect the effect of TGF-β1 on Hela cell proliferation, and flow cytometry was used to determine cell apoptosis 72 h after TGF-β1 treatment. Compared with the control group, the CCK-8 tests showed that different concentrations of TGF-β1 had no obvious effect on Hela cell proliferation 24 h after treatment (P > 0.05). However, upon 48 or 72 h of treatment, TGF-β1 significantly inhibited the proliferation of Hela cells in a time- and dose-dependent manner (P Hela cells in a dose-dependent manner after 72 h of treatment (P Hela cells in vitro.

  2. In Vitro Ultramorphological Assessment of Apoptosis Induced by Zerumbone on (HeLa

    Directory of Open Access Journals (Sweden)

    Siddig Ibrahim Abdel Wahab

    2009-01-01

    Full Text Available Zerumbone (ZER, a potential anticancer compound, isolated from the fresh rhizomes of Zingiber zerumbet. In this investigation, the cytotoxic properties of ZER were evaluated, on cancer cells of human cervix (HeLa, breast and ovary, and normal cells of Chinese Hamster ovary, using MTT assay. Apoptogenic effects of ZER on HeLa were studied using fluorescence microscopy (AO/PI double staining, scanning and transmission electron microscopy (SEM and TEM, and colorimetric assay of the apoptosis promoter enzyme, caspase-3. The results of MTT assay showed that ZER has less effect on normal cells compared to cancer cells. The lowest IC50 of ZER was observed on HeLa cells. Cytological observations showed nuclear and chromatin condensation, cell shrinkage, multinucleation, abnormalities of mitochondrial cristae, membrane blebbing, holes, cytoplasmic extrusions and formation of apoptotic bodies as confirmed collectively by double staining of AO/PI, SEM and TEM. Statistical analysis (two-tailed t-test of differential counting of 200 cells under fluorescence microscope revealed significant difference in apoptotic cells populations between treated and untreated HeLa cells. In addition, ZER has increased the cellular level of caspase-3 on the treated HeLa cells. It could be concluded that ZER was able to produce distinctive morphological features of cell death that corresponds to apoptosis.

  3. Characterization of the association of radiolabeled bleomycin A2 with HeLa cells

    International Nuclear Information System (INIS)

    Roy, S.N.; Horwitz, S.B.

    1984-01-01

    The association of [ 3 H]bleomycin A2 and Cu(II):[ 3 H]bleomycin A2 with HeLa cells has been characterized. Under the conditions of our experiments, approximately 0.1% of the total drug in the medium associates with HeLa cells. Both forms of the drug bind to HeLa cells in a specific and saturable manner, with a Km of 20 microM and a Vmax of 2.5 pmol/min/10(6) cells. Scatchard analysis of the specific binding data demonstrates a single set of high-affinity binding sites. Cytotoxic activities of both forms of the drug are similar, with a 50% lethal dose of 0.5 microM at 48 hr. The specific binding in HeLa cells of either the labeled metal-free drug or its copper complex is reversible by a 100-fold excess of either unlabeled drug. Interaction of the drug with cells is temperature sensitive but is unaffected by metabolic poisons, suggesting that this process is not energy dependent. Isolation of DNA from HeLa cells incubated with the drug indicates that 1 mol of either [ 3 H]bleomycin A2 or Cu(II):[ 3 H]bleomycin A2 binds per 10(8) nucleotides. Further studies with the radiolabeled drug are required to define precisely the mechanisms involved in bleomycin uptake and compartmentalization within the cell

  4. Dynamic behavior of histone H1 microinjected into HeLa cells

    International Nuclear Information System (INIS)

    Wu, L.H.; Kuehl, L.; Rechsteiner, M.

    1986-01-01

    Histone H1 was purified from bovine thymus and radiolabeled with tritium by reductive methylation or with 125 I using chloramine-T. Red blood cell-mediated microinjection was then used to introduce the labeled H1 molecules into HeLa cells synchronized in S phase. The injected H1 molecules rapidly entered HeLa nuclei, and a number of tests indicate that their association with chromatin was equivalent to that of endogenous histone H1. The injected molecules copurified with HeLa cell nucleosomes, exhibited a half-life of ∼100h, and were hyperphosphorylated at mitosis. When injected HeLa cells were fused with mouse 3T3 fibroblasts < 10% of the labeled H1 molecules migrated to mouse nuclei during the next 48 h. Despite their slow rate of migration between nuclei, the injected H1 molecules were evenly distributed on mouse and human genomes soon after mitosis of HeLa-3T3 heterokaryons. These results suggest that although most histone H1 molecules are stably associated with interphase chromatin, they undergo extensive redistribution after mitosis

  5. The reducibility of heLa cell viability by Sargassum polycystum extracts

    Science.gov (United States)

    Firdaus, M.; Setijawati, D.; Islam, I.; Nursyam, H.; Kartikaningsih, H.; Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

    2018-04-01

    Cervical cancer is the second largest cause of death-related cancer in women. The efficacy of cancer drugs is still low. Bioactive of brown seaweed has been studied by in vitro and in vivo as anticancer. The aim of this study was to evaluate the cytotoxicity of Sargassum polycystum extracts on HeLa cell, to recognize bioactive on extract and estimate the interaction between the bioactive and target protein. S. polycystum was found from Talango Island waters and HeLa cell was obtained from Indonesian Science Institute. Sample was extracted by ethanol, ethyl acetate and hexane, concentrated and finally, extracts were assayed on HeLa cell. The viability of this cell was quantified on ELISA-Reader. The bioactive compounds of the extract were elucidated by GC-MS. The interaction between bioactive and target protein was evaluated by using in silico method. The result showed that the lowest viability of HeLa cell on n-hexane extracts treatment. The n-hexane extract of this seaweed contained benzenepropanoic acid. This compound reduced HeLa cell viability by reducing of thrombin concentration. In conclusion, the benzene propanoic acid of S. polycystum was the cytotoxic agent and it is potential agent for anti-cervical cancer.

  6. HIF-1 and NDRG2 contribute to hypoxia-induced radioresistance of cervical cancer Hela cells

    International Nuclear Information System (INIS)

    Liu, Junye; Zhang, Jing; Wang, Xiaowu; Li, Yan; Chen, Yongbin; Li, Kangchu; Zhang, Jian; Yao, Libo; Guo, Guozhen

    2010-01-01

    Hypoxia inducible factor 1 (HIF-1), the key mediator of hypoxia signaling pathways, has been shown involved in hypoxia-induced radioresistance. However, the underlying mechanisms are unclear. The present study demonstrated that both hypoxia and hypoxia mimetic cobalt chloride could increase the radioresistance of human cervical cancer Hela cells. Meanwhile, ectopic expression of HIF-1 could enhance the resistance of Hela cells to radiation, whereas knocking-down of HIF-1 could increase the sensitivity of Hela cells to radiation in the presence of hypoxia. N-Myc downstream-regulated gene 2 (NDRG2), a new HIF-1 target gene identified in our lab, was found to be upregulated by hypoxia and radiation in a HIF-1-dependent manner. Overexpression of NDRG2 resulted in decreased sensitivity of Hela cells to radiation while silencing NDRG2 led to radiosensitization. Moreover, NDRG2 was proved to protect Hela cells from radiation-induced apoptosis and abolish radiation-induced upregulation of Bax. Taken together, these data suggest that both HIF-1 and NDRG2 contribute to hypoxia-induced tumor radioresistance and that NDRG2 acts downstream of HIF-1 to promote radioresistance through suppressing radiation-induced Bax expression. It would be meaningful to further explore the clinical application potential of HIF-1 and NDRG2 blockade as radiosensitizer for tumor therapy.

  7. [Antiapoptotic Effect of the Leukemia Associated Gene MLAA-34 in HeLa Cells].

    Science.gov (United States)

    Zhang, Peng-Yu; Zhao, Xuan; Zhang, Wen-Juan; Zhang, Wang-Gang; Chen, Yin-Xia

    2016-04-01

    To study the antiapoptotic effect of leukemia-associated gene MLAA-34 in HeLa cells. The MLAA-34 recombinant lentiviral expression vector was constructed, and the stably transfected HeLa cell line with high expression of MLAA-34 was set up; As(2)O(3) was used to induce apoptosis; the MTT assay, colony formation test and flow cytometry were used to detect the ability of cell proliferation, colong formation, apoptosis and cell cycle changes respectively. After treatment with As(2)O(3), the survival rate of HeLa cells with MLAA-34 overexpression was significantly higher than that of the control cells, and the colony formation ability of MLAA-34 significantly increased, and the high expression of MLAA-34 gene significantly decreased the apoptosis rate of HeLa cells, and decreased the proportion of G(2)/M phase cells. The leukemia-associated gene MLAA-34 has been comfirmed to show antiapoptotic effect in HeLa cells which are induced by As(2)O(3).

  8. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  9. Radiosensitivity of Hela cells in various O2 concentrations and consideration of oxygen effect in radiotherapy

    International Nuclear Information System (INIS)

    Kuroda, Yoshikazu; Nyunoya, Koichiro

    1979-01-01

    The aim of this paper is the study of the radiosensitivity of HeLa cells in vitro in various oxygen concentrations and the consideration of the utilization of oxygen effect in radiation therapy, based on the data of HeLa cells and tumor oxygen tension. Survival curves of HeLa cells are found to be exponential as a function of radiation dose and the radiosensitivity is dependent on oxygen tension of culture medium. Relative radiosensitivity decreases remarkably at low level of oxygen, especially under 9 mmHg pO 2 . The utilization of oxygen effect in radiation may be useful in hyperbaric oxygen inhalation and not useful under local tissue hypoxia induced by tourniquet application. Reoxygenation occurs with shrinkage of tumor after irradiation and this phenomenon will diminish the value of hyperbaric oxygen in radiation therapy. (author)

  10. Effect of Smac gene on apoptosis of HeLa cells induced by γ-rays

    International Nuclear Information System (INIS)

    Zhao Baofeng; Tian Mei; Ruan Jianlei; Su Xu

    2007-01-01

    To explore the effect of Smac gene on apoptosis of HeLa cells induced by γ-ray and its possible mechanisms, the full length cDNA of Smac gene was transferred into HeLa cells. 24 h after transferring, the results of Western Blot indicated the expression of Smac was increased but the expression of Survivin decreased. After HeLa cells was irradiated by γ-rays, Smac gene transferred HeLa/Smac cells showed more cell apoptosis rates and the higher activity of Caspase-3 than vector transferred control HeLa/pcDNA3.1 cells. However, the damage and repair of DNA and the cell cycle don't change significantly, comparing HeLa/Smac cells with HeLa/pcDNA3.1 cells. (authors)

  11. Exportin-5 mediates nuclear export of SRP RNA in vertebrates.

    Science.gov (United States)

    Takeiwa, Toshihiko; Taniguchi, Ichiro; Ohno, Mutsuhito

    2015-04-01

    The signal recognition particle is a ribonucleoprotein complex that is essential for the translocation of nascent proteins into the endoplasmic reticulum. It has been shown that the RNA component (SRP RNA) is exported from the nucleus by CRM1 in the budding yeast. However, how SRP RNA is exported in higher species has been elusive. Here, we show that SRP RNA does not use the CRM1 pathway in Xenopus oocytes. Instead, SRP RNA uses the same export pathway as pre-miRNA and tRNA as showed by cross-competition experiments. Consistently, the recombinant Exportin-5 protein specifically stimulated export of SRP RNA as well as of pre-miRNA and tRNA, whereas an antibody raised against Exportin-5 specifically inhibited export of the same RNA species. Moreover, biotinylated SRP RNA can pull down Exportin-5 but not CRM1 from HeLa cell nuclear extracts in a RanGTP-dependent manner. These results, taken together, strongly suggest that the principal export receptor for SRP RNA in vertebrates is Exportin-5 unlike in the budding yeast. © 2015 The Authors. Genes to Cells published by Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  12. Toxicity of cadmium sulfide (CdS) nanoparticles against Escherichia coli and HeLa cells

    International Nuclear Information System (INIS)

    Hossain, Sk Tofajjen; Mukherjee, Samir Kumar

    2013-01-01

    Highlights: • Toxic effect of CdS NPs on the growth and cell division in E. coli was studied. • CdS NPs affected cell surface topology and cell division. • Downregulation of both FtsZ and FtsQ was observed due to NPs exposure. • CdS NPs affected HeLa cell morphology with fragmented nuclei. • All such effects might be due to elevated oxidative stress. -- Abstract: The present study endeavours to assess the toxic effect of synthesized CdS nanoparticles (NPs) on Escherichia coli and HeLa cells. The CdS NPs were characterized by DLS, XRD, TEM and AFM studies and the average size of NPs was revealed as ∼3 nm. On CdS NPs exposure bacterial cells changed morphological features to filamentous form and damage of the cell surface was found by AFM study. The expression of two conserved cell division components namely ftsZ and ftsQ in E. coli was decreased both at transcriptional and translational levels upon CdS NPs exposure. CdS NPs inhibited proper cell septum formation without affecting the nucleoid segregation. Viability of HeLa cells declined with increasing concentration of CdS NPs and the IC 50 value was found to be 4 μg/mL. NPs treated HeLa cells showed changed morphology with condensed and fragmented nuclei. Increased level of reactive oxygen species (ROS) was found both in E. coli and HeLa cells on CdS NPs exposure. The inverse correlation between declined cell viabilities and elevated ROS level suggested that oxidative stress seems to be the key event by which NPs induce toxicity both in E. coli and HeLa cells

  13. Je-Chun-Jun induced apoptosis of human cervical carcinoma HeLa cells

    Institute of Scientific and Technical Information of China (English)

    Han-jung CHAE; Kyung-mi PARK; Geun-youn LEE; Gi-seup JEONG; Hyung-rae PARK; Hyung-min KIM; Soo-wan CHAE; Shim-keun YOO; Hyung-ryong KIM

    2004-01-01

    AIM: To study the mechanism of Je-Chun-Jun (JCJ)-inducing the apoptosis of the human cervical carcinoma,HeLa cells. METHODS: The cell viability was assessed using MTT assay. The optical density was measured at 570 nm. The caspase activity was measured using 50 mmol/L of fluorogenic substrate, AC-DEVD-AMC (caspase3), AC-VEID-AMC (caspase-8) or AC-LEHD-AFC (caspase-9). To confirm the expression of proteins, Western blotting was performed. To detect the characteristic of apoptosis chromatin condensation, HeLa cells were stained with Hoechst 33258 in the presence of JCJ. For the cell cycle analysis, HeLa cells were incubated with Propidium iodide (PI) solution. Fluorescence intensity of cell cycle was measured using flow cytometry system. RESULTS:The loss of viability occurred following the exposure of 10 g/L JCJ. Cells treated with 10 g/L JCJ for 3 d exhibited the apoptotic morphology (brightly blue-fluorescent condensed nuclei by Hoechst 33258-staining) and the reduction of cell volume. Cells incubated with JCJ for 48 h were arrested at the G1 phase of cell cycle and their G1 checkpoint related gene products such as cyclin D1 were transiently decreased. We showed that JCJ induced the p38 MAPK activation in HeLa cells. The p38 MAPK inhibitor, SB203580 protected Hela cells from the JCJ-induced death as well as intervened the JCJ-induced accumulation of cells at the G1 phase. In contrast, MEK1 (-ERK upstream) inhibitor, PD98059 had no effect on HeLa cells. CONCLUSION: JCJ induced cell cycle arrest and apoptosis of HeLa cells through p38 MAPK pathway.

  14. Low concentrations of doxycycline attenuates FasL-induced apoptosis in HeLa cells.

    Science.gov (United States)

    Yoon, Jung Mi; Koppula, Sushruta; Huh, Se Jong; Hur, Sun Jin; Kim, Chan Gil

    2015-07-24

    Doxycycline (DC) has been shown to possess non-antibiotic properties including Fas/Fas Ligand (FasL)-mediated apoptosis against several tumor types in the concentration range of 10-40 µg/mL. However, the effect of DC in apoptotic signaling at much low concentrations was not studied. The present study investigated the attenuation effect of low dose of DC on FasL-induced apoptosis in HeLa cell by the methods of MTT assay, fluorescence microscopy, DNA fragmentation, flow cytometry analysis, and western blotting. In the present findings we showed that low concentration of DC (HeLa cells. FasL treatment to HeLa cells resulted in a concentration-dependent induction of cell death, and treatment with low concentrations of DC (0.1-2 µg/mL) significantly (p cell death as measured by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Further, the FasL-induced apoptotic features in HeLa cells, such as morphological changes, DNA fragmentation and cell cycle arrest was also inhibited by DC (0.5 µg/mL). Tetracycline and minocycline also showed similar anti-apoptotic effects but were not significant when compared to DC, tested at same concentrations. Further, DC (0.01-16 µg/mL) did not influence the hydrogen peroxide- or cisplatin-induced intrinsic apoptotic pathway in HeLa cells. Protein analysis using Western blotting confirmed that FasL-induced cleavage/activation of caspase-8 and caspase-3, were inhibited by DC treatment at low concentration (0.5 µg/mL). Considering the overall data, we report for the first time that DC exhibited anti-apoptotic effects at low concentrations in HeLa cells by inhibition of caspase activation via FasL-induced extrinsic pathway.

  15. Cytotoxic and apoptotic activities of black widow spiderling extract against HeLa cells.

    Science.gov (United States)

    Peng, Xiaozhen; Dai, Zhipan; Lei, Qian; Liang, Long; Yan, Shuai; Wang, Xianchun

    2017-06-01

    Black widow spiders contain toxic components not only in the venom glands but also in other parts of the spider body, including the legs and abdomen. Additionally, both the eggs and newborn spiderlings of the black widow spider contain venom. It is important to investigate their potential effects on cancer cells. In the present study, the effects of newborn black widow spiderling extract on human HeLa cells were evaluated in vitro . When applied at different concentrations, the total extract decreased HeLa cell viability in a dose-dependent manner, with an IC 50 value of 158 µg/ml. Flow cytometry indicated that treatment of HeLa cells with the total extract of the spiderlings induced apoptosis in HeLa cells in a dose-dependent manner and led to cell cycle arrest in the S-phase. Additionally, application of the total extract at different concentrations increased apoptosis-related caspase 3 activity in a dose-dependent manner. HeLa cells treated with the total extract appeared to be morphologically changed, exhibiting membrane blebbing, nuclear fragmentation and condensation of chromatin. Further separation and activity screening demonstrated that the cytotoxic and apoptotic activities of the total extract were attributable mainly to its high molecular mass proteins, one of which was purified and characterized to determine its anti-tumor activities on HeLa cells. The results of the present study therefore have expanded understanding regarding the effect of spider toxins on cancer cells and suggested that components of black widow spiderlings may be developed as a promising novel agent to treat cancer.

  16. Involvement of S6K1 in mitochondria function and structure in HeLa cells.

    Science.gov (United States)

    Park, Jisoo; Tran, Quangdon; Mun, Kisun; Masuda, Kouhei; Kwon, So Hee; Kim, Seon-Hwan; Kim, Dong-Hoon; Thomas, George; Park, Jongsun

    2016-12-01

    The major biological function of mitochondria is to generate cellular energy through oxidative phosphorylation. Apart from cellular respiration, mitochondria also play a key role in signaling processes, including aging and cancer metabolism. It has been shown that S6K1-knockout mice are resistant to obesity due to enhanced beta-oxidation, with an increased number of large mitochondria. Therefore, in this report, the possible involvement of S6K1 in regulating mitochondria dynamics and function has been investigated in stable lenti-shS6K1-HeLa cells. Interestingly, S6K1-stably depleted HeLa cells showed phenotypical changes in mitochondria morphology. This observation was further confirmed by detailed image analysis of mitochondria shape. Corresponding molecular changes were also observed in these cells, such as the induction of mitochondrial fission proteins (Drp1 and Fis1). Oxygen consumption is elevated in S6K1-depeleted HeLa cells and FL5.12 cells. In addition, S6K1 depletion leads to enhancement of ATP production in cytoplasm and mitochondria. However, the relative ratio of mitochondrial ATP to cytoplasmic ATP is actually decreased in lenti-shS6K1-HeLa cells compared to control cells. Lastly, induction of mitophagy was found in lenti-shS6K1-HeLa cells with corresponding changes of mitochondria shape on electron microscope analysis. Taken together, our results indicate that S6K1 is involved in the regulation of mitochondria morphology and function in HeLa cells. This study will provide novel insights into S6K1 function in mitochondria-mediated cellular signaling. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. IER5 gene's mRNA expression after irradiation

    International Nuclear Information System (INIS)

    Ding Kuke; Shen Jingjing; Xu Lili; Li Yanling; Zhou Ping; Ma Binrong; Zhao Zengqiang; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To explore the effect of irradiation on IER5 gene expression. Methods: Two kinds of cells (AHH-1 and HeLa) and the BALB/c-nu mice inoculated with tumor cells were exposed to 60 Co γ- rays and analyzed by real-time PCR. The above-mentioned irradiated objects were firstly divided into groups by different doses and post-radiation time, then mRNA were extracted and reverse-transcripted to DNA before real-time PCR test. Results: Under the same condition, AHH-1 was more sensitive to radiation than HeLa. The dose level corresponding to the expression peak of AHH-1 was less than that of HeLa. For AHH-1 cells, the response to 2 Gy irradiation was earlier than that to 10 Gy. But there was not remarkable difference for HeLa response between 2 and 10 Gy, and the top transcriptional levels for both cells nearly simultaneously appeared at 2 h after irradiation. In addition, the IER5 gene of human liver tumor was more sensitive than that of lung cancer and brain tumor. Conclusions: IER5 might be a candidate biomarker of radiation injury, and had the potential value in radiation-therapy for liver tumor. (authors)

  18. Evaluation of Antiproliferative Potential of Cerium Oxide Nanoparticles on HeLa Human Cervical Tumor Cell

    Directory of Open Access Journals (Sweden)

    Zoriţa Diaconeasa

    2015-05-01

    Full Text Available Cerium oxide nanoparticles (CeO2 nanoparticles as nanomaterials have promising biomedical applications. In this paper, the cytotoxicity induced by CONPs human cervical tumor cells was investigated. Cerium oxide nanoparticles were synthesized using the precipitation method. The nanoparticles were found to inhibit the proliferation of HeLa human cervical tumor cells in a dose dependent manner but did not showed to be cytotoxic as analyzed by MTT assay. The administrated treatment decreased the HeLa cell viability cells from 100% to 65% at the dose of 100 μg/mL.

  19. Radiation response of Hela cells at the stationary phase of growth

    International Nuclear Information System (INIS)

    Semenyak, O.Yu.; Kalendo, G.S.; Serebryakov, N.G.

    1988-01-01

    The early stages of a repopulation process of HeLa cells under the effect of irradiation 5 Gy dose and an influence of a preliminary 0.1 Gy dose irradiation at that process were investigated. As it was shown the fraction of cell with a great proliferation potential appeared in one day after lethal 5 Gy dose irradiation of the resting HeLa cells. If the other irradiation regime was used: 0.1 Gy dose plus 4.9 dose in 3 min after the first action, the part of cells with a great proliferation potential became considerably less

  20. Study of Paclitaxel-Treated HeLa Cells by Differential Electrical Impedance Flow Cytometry

    DEFF Research Database (Denmark)

    Kirkegaard, Julie; Clausen, Casper Hyttel; Rodriguez-Trujíllo, Romén

    2014-01-01

    This work describes the electrical investigation of paclitaxel-treated HeLa cells using a custom-made microfluidic biosensor for whole cell analysis in continuous flow. We apply the method of differential electrical impedance spectroscopy to treated HeLa cells in order to elucidate the changes...... on investigating the changes in the electrical properties of the cell membrane caused by the effect of paclitaxel. We observe good agreement between the model and the obtained results. This establishes the proof-of-concept for the application in cell drug therapy....

  1. Pennogenyl Saponins from Paris quadrifolia L. Induce Extrinsic and Intrinsic Pathway of Apoptosis in Human Cervical Cancer HeLa Cells

    Science.gov (United States)

    Stefanowicz-Hajduk, Justyna; Bartoszewski, Rafal; Bartoszewska, Sylwia; Kochan, Kinga; Adamska, Anna; Kosiński, Igor; Ochocka, J. Renata

    2015-01-01

    Pennogenyl saponins are the active compounds of large number of plant species and consequently many polyherbal formulations. Hence, great interest has been shown in their characterization and in the investigation of their pharmacological and biological properties, especially anticancer. This present study reports on the evaluation of cytotoxic effects and explanation of the molecular mechanisms of action of the two pennogenyl saponins (PS 1 and PS 2) isolated from Paris quadrifolia L. rhizomes on human cervical adenocarcinoma cell line HeLa. To determine the viability of the cells treated with the compounds we used real-time cell proliferation analysis and found that the pennogenyl saponins PS 1 and PS 2 strongly inhibited the tumor cells growth with IC50 values of 1.11 ± 0.04 μg/ml and 0.87 ± 0.05 μg/ml, respectively. The flow cytometry analysis indicated that the two compounds induced apoptosis in a dose-dependent manner and decreased mitochondrial membrane potential in HeLa cells in the early stage of apoptosis. Quantitative PCR and Western Blot analysis showed that the two saponins significantly increased mRNA expression of FADD and BID as well as induced caspase-8 via increased of procaspase-8 processing in the treated cells. The results of this study suggest that both the extrinsic death receptor and intrinsic mitochondrial pathways are involved in the programmed cell death. PMID:26295969

  2. A class of DNA-binding peptides from wheat bud causes growth inhibition, G2 cell cycle arrest and apoptosis induction in HeLa cells

    Directory of Open Access Journals (Sweden)

    Elgjo Kjell

    2009-07-01

    Full Text Available Abstract Background Deproteinized DNA from eukaryotic and prokaryotic cells still contains a low-molecular weight peptidic fraction which can be dissociated by alkalinization of the medium. This fraction inhibits RNA transcription and tumor cell growth. Removal from DNA of normal cells causes amplification of DNA template activity. This effect is lower or absent in several cancer cell lines. Likewise, the amount of active peptides in cancer cell DNA extracts is lower than in DNA preparation of the corresponding normal cells. Such evidence, and their ubiquitous presence, suggests that they are a regulatory, conserved factor involved in the control of normal cell growth and gene expression. Results We report that peptides extracted from wheat bud chromatin induce growth inhibition, G2 arrest and caspase-dependent apoptosis in HeLa cells. The growth rate is decreased in cells treated during the S phase only and it is accompanied by DNA damage and DNA synthesis inhibition. In G2 cells, this treatment induces inactivation of the CDK1-cyclin B1 complex and an increase of active chk1 kinase expression. Conclusion The data indicate that the chromatin peptidic pool inhibits HeLa cell growth by causing defective DNA replication which, in turn, arrests cell cycle progression to mitosis via G2 checkpoint pathway activation.

  3. Polydatin inhibits cell proliferation and induces apoptosis in laryngeal cancer and HeLa cells via suppression of the PDGF/AKT signaling pathway.

    Science.gov (United States)

    Li, Haixia; Shi, Baoyuan; Li, Yanyun; Yin, Fengfang

    2017-07-01

    Polydatin (PD), a stilbene compound extracted from Polygonum cuspidatum, is suggested to possess anti-cancer activities, including inhibition of cell proliferation, cell cycle arrest, and induction of apoptosis. The platelet-derived growth factor (PDGF)/AKT signaling pathway plays complex roles in tumor suppression. However, the effect of PD on the PDGF/AKT signaling pathway in laryngeal cancer and HeLa cells has not been explored. MTT assay and flow cytometry showed that PD inhibited cell proliferation and induced apoptosis in Hep-2 and AMC-HN-8 cells. Western blot analysis indicated that PD inhibited the expression levels of PDGF-B and phosphorylated AKT (p-AKT) in both cells. Treatment of PDGF-B siRNA or PDGFR inhibitor found that after the PDGF signaling was inactivated, p-AKT expression was significantly decreased in Hep-2 cells. Tumor xenograft experiment in nude mice indicated PD significantly inhibited the growth of Hep-2 cells in vivo. In conclusion, PD inhibited cell proliferation and induced apoptosis in laryngeal cancer and HeLa cells via inactivation of the PDGF/AKT signaling pathway. © 2017 Wiley Periodicals, Inc.

  4. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  5. The influence of pH on the excision of UV-photoproducts from HeLa cells

    International Nuclear Information System (INIS)

    Masek, F.; Hochmann, J.; Duraj, J.

    1977-01-01

    Excision of pyrimidine dimers with pH decreasing in UV irradiated HeLa cells can be depressed. This depression is independent of the UV dose within the investigated range. The excision capacity of the HeLa repair system from absolute amount of excised dimers is shown. (author)

  6. Effect of endoplasmic reticulum stress on the response of HeLa cells to carbon ion radiation

    International Nuclear Information System (INIS)

    Xia Jiefang; Wang Zhuanzi; Wei Wei; Dang Bingrong; Li Wenjian

    2015-01-01

    To investigate the effect of endoplasmic reticulum stress on HeLa cells to "1"2C"6"+ ion irradiation, HeLa cells were pretreated with 2.5 mmol/L dithiothreitol and irradiated by "1"2C"6"+ ions with different doses. The results showed that, compared with IR alone, dithiothreitol combined with carbon ion irradiation caused HeLa cell survival decreased, and the apoptosis increased. Moreover, dithiothreitol and carbon ion radiation combination treatment led to a significant increase of G_2/M phase, and autophagy was activated obviously in combination treatment group. The results imply that continuous endoplasmic reticulum stress can change the response of HeLa cells to "1"2C"6"+ irradiation, and dithiothreitol may affect HeLa cells through the autophagy cell death pathway. (authors)

  7. Immuno-detection of OCTN1 (SLC22A4) in HeLa cells and characterization of transport function.

    Science.gov (United States)

    Pochini, Lorena; Scalise, Mariafrancesca; Indiveri, Cesare

    2015-11-01

    OCTN1 was immuno-detected in the cervical cancer cell HeLa, in which the complete pattern of acetylcholine metabolizing enzymes is expressed. Comparison of immuno-staining intensity of HeLa OCTN1 with the purified recombinant human OCTN1 allowed measuring the specific OCTN1 concentration in the HeLa cell extract and, hence calculating the HeLa OCTN1 specific transport activity that was about 10 nmol×min(-1)×mg protein(-1), measured as uptake of [(3)H]acetylcholine in proteoliposomes reconstituted with HeLa extract. This value was very similar to the specific activity of the recombinant protein. Acetylcholine transport was suppressed by incubation of the protein or proteoliposomes with the anti-OCTN1 antibody and was strongly inhibited by PLP and MTSEA, known inhibitors of OCTN1. The absence of ATP in the internal side of proteoliposomes strongly impaired transport function of both the HeLa and, as expected, the recombinant OCTN1. HeLa OCTN1 was inhibited by spermine, NaCl (Na(+)), TEA, γ-butyrobetaine, choline, acetylcarnitine and ipratropium but not by neostigmine. Besides acetylcholine, choline was taken up by HeLa OCTN1 proteoliposomes. The transporter catalyzed also acetylcholine and choline efflux which, differently from uptake, was not inhibited by MTSEA. Time course of [(3)H]acetylcholine uptake in intact HeLa cells was measured. As in proteoliposomes, acetylcholine transport in intact cells was inhibited by TEA and NaCl. Efflux of [(3)H]acetylcholine occurred in intact cells, as well. The experimental data concur in demonstrating a role of OCTN1 in transporting acetylcholine and choline in HeLa cells. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Visualizing the molecular sociology at the HeLa cell nuclear periphery

    NARCIS (Netherlands)

    Mahamid, Julia; Pfeffer, Stefan; Schaffer, Miroslava; Villa, Elizabeth; Danev, Radostin; Cuellar, Luis Kuhn; Förster, Friedrich|info:eu-repo/dai/nl/412516438; Hyman, Anthony A; Plitzko, Jürgen M; Baumeister, Wolfgang

    2016-01-01

    The molecular organization of eukaryotic nuclear volumes remains largely unexplored. Here we combined recent developments in cryo-electron tomography (cryo-ET) to produce three-dimensional snapshots of the HeLa cell nuclear periphery. Subtomogram averaging and classification of ribosomes revealed

  9. Protein kinase C β inhibits autophagy and sensitizes cervical cancer Hela cells to cisplatin.

    Science.gov (United States)

    Li, Na; Zhang, Wei

    2017-04-28

    Recently, autophagy has been indicated to play an essential role in various biological events, such as the response of cervical cancer cells to chemotherapy. However, the exact signalling mechanism that regulates autophagy during chemotherapy remains unclear. In the present study, we investigated the regulation by cisplatin on protein kinase C β (PKC β), on B-cell lymphoma 2 (Bcl-2) and on apoptosis in cervical cancer Hela cells. And then we examined the regulation by cisplatin on autophagy and the role of autophagy on the chemotherapy in Hela cells. In addition, the regulation of the PKC β on the autophagy was also investigated. Our results indicated that cisplatin promoted PKC β in Hela cells. The PKC β inhibitor reduced the cisplatin-induced apoptosis, whereas increased the cisplatin-induced autophagy in Hela cells. On the other side, the PKC β overexpression aggravated the cisplatin-induced apoptosis, whereas down-regulated the cisplatin-induced autophagy. Taken together, our study firstly recognized the involvement of PKC β in the cytotoxicity of cisplatin via inhibiting autophagy in cervical cancer cells. We propose that PKC β would sensitize cervical cancer cells to chemotherapy via reducing the chemotherapy induced autophagy in cancer cells. © 2017 The Author(s).

  10. Caveolae-mediated endocytosis of biocompatible gold nanoparticles in living Hela cells

    DEFF Research Database (Denmark)

    Hao, Xian; Wu, Jiazhen; Shan, Yuping

    2012-01-01

    the internalization mechanism of small-size AuNPs by living Hela cells. Herein, we found that the caveolae-mediated endocytosis was the dominant pathway for the intracellular delivery of small-size AuNPs. The intracellular delivery was suppressed when we depleted the cholesterol with methyl-β-cyclodextrin (M beta CD...

  11. Inhibition of EGFR nuclear shuttling decreases irradiation resistance in HeLa cells.

    Science.gov (United States)

    Wei, Hong; Zhu, Zijie; Lu, Longtao

    2017-01-01

    Cervical cancer is a leading cause of mortality in women worldwide. The resistance to irradiation at the advanced stage is the main reason for the poor prognosis and high mortality. This work aims to elucidate the molecular mechanism underlying the radio-resistance. In this study, we determined the pEGFR-T654 and pDNA-PK-T2609 expression level changes in irradiated HeLa cells treated with T654 peptide, a nuclear localization signal (NLS) inhibitor, to inhibit EGFR nuclear transport. Cell viability, cell cycle and migratory capacity were analyzed. Xenograft animal model was used to evaluate the effect of EGFR nuclear transport inhibition on the tumor growth in vivo. The enhanced translocation of nuclear EGFR in the irradiated HeLa cells correlated with the increasing level of pEGFR-T654 and pDNA-PK-T2609. Inhibition of EGFR nuclear translocation by NLS peptide inhibitor attenuated DNA damage repair in the irradiated HeLa cells, decreased cell viability and promoted cell death through arrest at G0 phase. NLS peptide inhibitor impaired the migratory capacity of irradiated HeLa cells, and negatively affected tumorigenesis in xenograft mice. This work puts forward a potential molecular mechanism of the irradiation resistance in cervical cancer cells, providing a promising direction towards an efficient therapy of cervical cancer.

  12. Bioactive compounds from crocodile (Crocodylus siamensis) white blood cells induced apoptotic cell death in hela cells.

    Science.gov (United States)

    Patathananone, Supawadee; Thammasirirak, Sompong; Daduang, Jureerut; Chung, Jing Gung; Temsiripong, Yosapong; Daduang, Sakda

    2016-08-01

    Crocodile (Crocodylus siamensis) white blood cell extracts (WBCex) were examined for anticancer activity in HeLa cell lines using the MTT assay. The percentage viability of HeLa cells significantly deceased after treatment with WBCex in a dose- and time-dependent manner. The IC50 dose was suggested to be approximately 225 μg/mL protein. Apoptotic cell death occurred in a time-dependent manner based on investigation by flow cytometry using annexin V-FITC and PI staining. DAPI nucleic acid staining indicated increased chromatin condensation. Caspase-3, -8 and -9 activities also increased, suggesting the induction of the caspase-dependent apoptotic pathway. Furthermore, the mitochondrial membrane potential (ΔΨm ) of HeLa cells was lost as a result of increasing levels of Bax and reduced levels of Bcl-2, Bcl-XL, Bcl-Xs, and XIAP. The decreased ΔΨm led to the release of cytochrome c and the activation of caspase-9 and -3. Apoptosis-inducing factor translocated into the nuclei, and endonuclease G (Endo G) was released from the mitochondria. These results suggest that anticancer agents in WBCex can induce apoptosis in HeLa cells via both caspase-dependent and -independent pathways. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 986-997, 2016. © 2015 Wiley Periodicals, Inc.

  13. Phosphofructokinase-P Modulates P44/42 MAPK Levels in HeLa Cells.

    Science.gov (United States)

    Cardim Pires, Thyago Rubens; Albanese, Jamille Mansur; Schwab, Michael; Marette, André; Carvalho, Renato Sampaio; Sola-Penna, Mauro; Zancan, Patricia

    2017-05-01

    It is known that interfering with glycolysis leads to profound modification of cancer cell proliferation. However, energy production is not the major reason for this correlation. Here, using HeLa cells as a model for cancer, we demonstrate that phosphofructokinase-P (PFK-P), which is overexpressed in diverse types of cancer including HeLa cells, modulates expression of P44/42 mitogen-activated protein kinase (MAPK). Silencing of PFK-P did not alter HeLa cell viability or energy production, including the glycolytic rate. On the other hand, silencing of PFK-P induced the downregulation of p44/42 MAPK, augmenting the sensitivity of HeLa cells to different drugs. Conversely, overexpression of PFK-P promotes the upregulation of p44/42 MAPK, making the cells more resistant to the drugs. These results indicate that overexpression of PFK-P by cancer cells is related to activation of survival pathways via upregulation of MAPK and suggest PFK-P as a promising target for cancer therapy. J. Cell. Biochem. 118: 1216-1226, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Cholesterol esters are detected by Raman microspectroscopy in HeLa cells

    NARCIS (Netherlands)

    van Manen, H.J.; Otto, Cornelis

    2009-01-01

    The detection of trans-unsaturated lipids in single HeLa cells by Raman microspectroscopy was recently reported in this journal by Onogi et al. Based on our previously published Raman microspectroscopy data of individual macrophage foam cells, a detailed comparison between our spectra and spectrum

  15. Apoptotic effects of bovine apo-lactoferrin on HeLa tumor cells.

    Science.gov (United States)

    Luzi, Carla; Brisdelli, Fabrizia; Iorio, Roberto; Bozzi, Argante; Carnicelli, Veronica; Di Giulio, Antonio; Lizzi, Anna Rita

    2017-01-01

    Lactoferrin (Lf), a cationic iron-binding glycoprotein of 80 kDa present in body secretions, is known as a compound with marked antimicrobial activity. In the present study, the apoptotic effect of iron-free bovine lactoferrin (apo-bLf) on human epithelial cancer (HeLa) cells was examined in association with reactive oxygen species and glutathione (GSH) levels. Apoptotic effect of iron-free bovine lactoferrin inhibited the growth of HeLa cells after 48 hours of treatment while the diferric-bLf was ineffective in the concentration range tested (from 1 to 12.5 μM). Western blot analysis showed that key apoptotic regulators including Bax, Bcl-2, Sirt1, Mcl-1, and PARP-1 were modulated by 1.25 μM of apo-bLf. In the same cell line, apo-bLf induced apoptosis together with poly (ADP-ribose) polymerase cleavage, caspase activation, and a significant drop of NAD + . In addition, apo-bLf-treated HeLa cells showed a marked increase of reactive oxygen species level and a significant GSH depletion. On the whole, apo-bLf triggered apoptosis of HeLa cells upon oxygen radicals burst and GSH decrease. Copyright © 2017 John Wiley & Sons, Ltd.

  16. Establishment of HeLa cell mutants deficient in sphingolipid-related genes using TALENs.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Yamaji

    Full Text Available Sphingolipids are essential components in eukaryotes and have various cellular functions. Recent developments in genome-editing technologies have facilitated gene disruption in various organisms and cell lines. We here show the disruption of various sphingolipid metabolic genes in human cervical carcinoma HeLa cells by using transcription activator-like effector nucleases (TALENs. A TALEN pair targeting the human CERT gene (alternative name COL4A3BP encoding a ceramide transport protein induced a loss-of-function phenotype in more than 60% of HeLa cells even though the cell line has a pseudo-triploid karyotype. We have isolated several loss-of-function mutant clones for CERT, UGCG (encoding glucosylceramide synthase, and B4GalT5 (encoding the major lactosylceramide synthase, and also a CERT/UGCG double-deficient clone. Characterization of these clones supported previous proposals that CERT primarily contributes to the synthesis of SM but not GlcCer, and that B4GalT5 is the major LacCer synthase. These newly established sphingolipid-deficient HeLa cell mutants together with our previously established stable transfectants provide a 'sphingolipid-modified HeLa cell panel,' which will be useful to elucidate the functions of various sphingolipid species against essentially the same genomic background.

  17. Effects of Geven root extract on proliferation of HeLa cells and bcl-2 ...

    African Journals Online (AJOL)

    Yomi

    2012-03-01

    , Turkey. 3Research ... Geven (Astragalus L.) root extract is used for asthma, diarrhea, and cancer therapy in Chinese ... 0.1 mg/ml concentrations of Astragalus root extract were applied to HeLa cell cultures for 24, 48 and 72 h.

  18. Growth regulation of HeLa cells by 1060 nm photons

    International Nuclear Information System (INIS)

    Torghele, K. F.

    1993-12-01

    Living organisms are open systems dominated by electromagnetic interaction. An essential feature of a living system is its cybernetic process which imply their capability of adaptation and sensitivity to internal and external fluctuations. The experimental results show that coherent and incoherent light of 1060 nm wavelength influences the metabolic processes and consequently the proliferation of cancer cell cultures (HeLa). Light induced regulation of HeLa cell growth depends on the cell density, the state of the cell culture and the amount of light irradiation. Best proliferation inhibiting effects can be obtained by application of 200 J/m 2 on HeLa cells in Lag-Phase and a typical cell density of 5.10 4 cells/cm 2 . Proceeding on the singlet oxygen hypothesis (KLIMA, H. et al.; 1990), it is shown mathematically that the dynamical behaviour of the NADH model is influenced by 1060 nm photons. Both, the experimental and the numerical results support our hypothesis: 1060 nm photons regulate the proliferation of HeLa cells. (author)

  19. PHA-induced cytotoxicity of human lymphocytes against adherent hela-cells

    NARCIS (Netherlands)

    Huges-Law, G.; de Gast, G. C.; The, T. Hauw

    The conditions for a phytohaemagglutinin(PHA)-induced cytotoxicity test of human peripheral blood lymphocytes were investigated. [3H]thymidine prelabelled HeLa cells were used as target cells. Stimulation with 10 μl PHA/ml during 24 h gave the best measure of lymphocyte cytotoxic capacity.

  20. Achieve Sustainable Hospital Excellence Through 5-S in an Emergency Department in Hong Kong

    Directory of Open Access Journals (Sweden)

    Tsoi Vincent F. K.

    2014-11-01

    Full Text Available 5-S is the first step towards TQM. Over the last century, the Japanese have formalised the technique and named it as 5-S Practice. Since 1993, Sam Ho has improved and defined its terms in English/Chinese and developed the world's first 5-S Audit Checklist. In the article, an emergency department of a Hong Kong hospital was examined against 5-S 50-point Checklist for the improvement of their quality assurance systems towards its accreditation process with Australian standards. The findings evidently reveal that the impact of 5-S on hospital quality assurance in the unit are positive. Riding on the above scenario, the research aim is to identify whether the 5-S practice is a suitable and effective tool for healthcare quality assurance in an emergency setting which is led towards its accreditation process set by other mechanisms.

  1. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    Science.gov (United States)

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  2. The 5S methodology as a tool for improving the organisation

    OpenAIRE

    J. Michalska; D. Szewieczek

    2007-01-01

    Purpose: The aim of this paper is showing the 5S methodology. In this paper it was introduced the way of implementing the 5S methodology in the company.Design/methodology/approach: In the frames of own research it has been analysed and implemented the 5S rules in the production process.Findings: On the basis of the own research it can be stated, that introducing the 5S rules bring the great changes in the company, for example: process improvement by costs’ reduction, increasing of effectivene...

  3. Interaction of higher plant ribosomal 5S RNAs with ''Xenopus laevis'' transcriptional factor IIIA

    International Nuclear Information System (INIS)

    Barciszewska, M.Z.

    1994-01-01

    In this paper transcriptional factor IIIA (TFIIIA) has been used as a probe for identity of three-dimensional-structure of eukaryotic 5S rRNAs. I was interested in finding a common motif in plant and ''Xenopus'' 5S rRNAs for TFIIIA recognition. I found that the two eukaryotic 5S rRNAs (from wheat germ and lupin seeds) are recognized by ''X. laevis'' TFIIIA and the data clearly suggest that these 5S rRNAs have very similar if not identical three-dimensional structures. Also effects of various conditions on stability of these complexes have been studied. (author). 30 refs, 6 figs, 1 tab

  4. Manifestation of Strongly Delocalized Atomic States in the 5s Photoionization of Xenon

    International Nuclear Information System (INIS)

    Schmoranzer, H.; Lauer, S.; Vollweiler, F.; Reichardt, G.; Schartner, K.; Mentzel, G.; Wilhelmi, O.; Sukhorukov, V.L.; Lagutin, B.M.; Petrov, I.D.

    1997-01-01

    The photoionization (PI) of the Xe atom was investigated in the vicinity of the 5s -shell threshold by photon-induced fluorescence spectroscopy. The highest resolution so far attained of 2meV enabled us to observe a new series of resonance structures in the 5s -PI cross section closely above threshold. Calculations of the partial 5s - and 5p -PI cross sections were performed taking into account many-electron correlations. These structures were related with strongly delocalized f -resonances which affect the 5s -PI cross section due to their mixing with p -resonances. copyright 1997 The American Physical Society

  5. 4p-5s transitions in In XIII, In XIV and In XV

    International Nuclear Information System (INIS)

    Carroll, P.K.; Costello, J.T.; O'Sullivan, G.

    1986-01-01

    The spectrum of an indium plasma produced by a 1.5 J, 25 ns ruby laser was recorded in the XUV. At wavelengths below 100 A, the spectrum is dominated by 4p-5s transitions in a number of ion stages. Many lines arising from 4p 6 4d-4p 5 4d5s, 4p 6 -4p 5 5s and 4p 5 -4p 4 5s transitions in In XIII, In XIV and In XV have been identified by isoelectronic extrapolation and Dirac-Fock calculations. (orig.)

  6. Implementation Of 5S Methodology In The Small Scale Industry A Case Study

    Directory of Open Access Journals (Sweden)

    R. S. Agrahari

    2015-04-01

    Full Text Available Abstract 5S is a basic foundation of Lean Manufacturing systems. It is a tool for cleaning sorting organizing and providing the necessary groundwork for workpiece improvement. This paper dealt with the implementation of 5S methodology in the small scale industry. By following the 5S methodology it shows significant improvements to safety productivity efficiency and housekeeping. The improvements before and after 5S implementation is shown by pictures in the paper. It also intends to build a stronger work ethic within the management and workers who would be expected to continue the good practices.

  7. Implementation Of 5S Quality Tool In Manufacturing Company A Case Study

    Directory of Open Access Journals (Sweden)

    Vibhor Kakkar

    2015-02-01

    Full Text Available Abstract 5S system is a technique which maintains the quality of working conditions in the organization. Amongst various available Lean resources 5S is a powerful technique that can bolster objectives of the organization to get continuous improvement in performance and productivity. This paper presents the implementation of 5S in a manufacturing company amp 5S rating system was used to audit all changes in the company which enhanced the efficiency of the workers amp ultimately the productivity of the company is enhanced to 91 .

  8. Proteomic investigation into betulinic acid-induced apoptosis of human cervical cancer HeLa cells.

    Science.gov (United States)

    Xu, Tao; Pang, Qiuying; Zhou, Dong; Zhang, Aiqin; Luo, Shaman; Wang, Yang; Yan, Xiufeng

    2014-01-01

    Betulinic acid is a pentacyclic triterpenoid that exhibits anticancer functions in human cancer cells. This study provides evidence that betulinic acid is highly effective against the human cervical cancer cell line HeLa by inducing dose- and time-dependent apoptosis. The apoptotic process was further investigated using a proteomics approach to reveal protein expression changes in HeLa cells following betulinic acid treatment. Proteomic analysis revealed that there were six up- and thirty down-regulated proteins in betulinic acid-induced HeLa cells, and these proteins were then subjected to functional pathway analysis using multiple analysis software. UDP-glucose 6-dehydrogenase, 6-phosphogluconate dehydrogenase decarboxylating, chain A Horf6-a novel human peroxidase enzyme that involved in redox process, was found to be down-regulated during the apoptosis process of the oxidative stress response pathway. Consistent with our results at the protein level, an increase in intracellular reactive oxygen species was observed in betulinic acid-treated cells. The proteins glucose-regulated protein and cargo-selection protein TIP47, which are involved in the endoplasmic reticulum pathway, were up-regulated by betulinic acid treatment. Meanwhile, 14-3-3 family proteins, including 14-3-3β and 14-3-3ε, were down-regulated in response to betulinic acid treatment, which is consistent with the decrease in expression of the target genes 14-3-3β and 14-3-3ε. Furthermore, it was found that the antiapoptotic bcl-2 gene was down-regulated while the proapoptotic bax gene was up-regulated after betulinic acid treatment in HeLa cells. These results suggest that betulinic acid induces apoptosis of HeLa cells by triggering both the endoplasmic reticulum pathway and the ROS-mediated mitochondrial pathway.

  9. Carnosine inhibits carbonic anhydrase IX-mediated extracellular acidosis and suppresses growth of HeLa tumor xenografts

    International Nuclear Information System (INIS)

    Ditte, Zuzana; Ditte, Peter; Labudova, Martina; Simko, Veronika; Iuliano, Filippo; Zatovicova, Miriam; Csaderova, Lucia; Pastorekova, Silvia; Pastorek, Jaromir

    2014-01-01

    Carbonic anhydrase IX (CA IX) is a transmembrane enzyme that is present in many types of solid tumors. Expression of CA IX is driven predominantly by the hypoxia-inducible factor (HIF) pathway and helps to maintain intracellular pH homeostasis under hypoxic conditions, resulting in acidification of the tumor microenvironment. Carnosine (β-alanyl-L-histidine) is an anti-tumorigenic agent that inhibits the proliferation of cancer cells. In this study, we investigated the role of CA IX in carnosine-mediated antitumor activity and whether the underlying mechanism involves transcriptional and translational modulation of HIF-1α and CA IX and/or altered CA IX function. The effect of carnosine was studied using two-dimensional cell monolayers of several cell lines with endogenous CA IX expression as well as Madin Darby canine kidney transfectants, three-dimensional HeLa spheroids, and an in vivo model of HeLa xenografts in nude mice. mRNA and protein expression and protein localization were analyzed by real-time PCR, western blot analysis, and immunofluorescence staining, respectively. Cell viability was measured by a flow cytometric assay. Expression of HIF-1α and CA IX in tumors was assessed by immunohistochemical staining. Real-time measurement of pH was performed using a sensor dish reader. Binding of CA IX to specific antibodies and metabolon partners was investigated by competitive ELISA and proximity ligation assays, respectively. Carnosine increased the expression levels of HIF-1α and HIF targets and increased the extracellular pH, suggesting an inhibitory effect on CA IX-mediated acidosis. Moreover, carnosine significantly inhibited the growth of three-dimensional spheroids and tumor xenografts compared with untreated controls. Competitive ELISA showed that carnosine disrupted binding between CA IX and antibodies specific for its catalytic domain. This finding was supported by reduced formation of the functional metabolon of CA IX and anion exchanger 2 in the

  10. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    Science.gov (United States)

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  11. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  12. Mitochondria-targeted superoxide dismutase (SOD2) regulates radiation resistance and radiation stress response in HeLa cells

    International Nuclear Information System (INIS)

    Hosoki, Ayaka; Yonekura, Shin-Ichiro; Zhao, Qing-Li

    2012-01-01

    Reactive oxygen species (ROS) act as a mediator of ionizing radiation-induced cellular damage. Previous studies have indicated that MnSOD (SOD2) plays a critical role in protection against ionizing radiation in mammalian cells. In this study, we constructed two types of stable HeLa cell lines overexpressing SOD2, HeLa S3/SOD2 and T-REx HeLa/SOD2, to elucidate the mechanisms underlying the protection against radiation by SOD2. SOD2 overexpression in mitochondria enhanced the survival of HeLa S3 and T-REx HeLa cells following γ-irradiation. The levels of γH2AX significantly decreased in HeLa S3/SOD2 and T-REx HeLa/SOD2 cells compared with those in the control cells. MitoSox TM Red assays showed that both lines of SOD2-expressing cells showed suppression of the superoxide generation in mitochondria. Furthermore, flow cytometry with a fluorescent probe (2',7'-dichlorofluorescein) revealed that the cellular levels of ROS increased in HeLa S3 cells during post-irradiation incubation, but the increase was markedly attenuated in HeLa S3/SOD2 cells. DNA microarray analysis revealed that, of 47,000 probe sets analyzed, 117 and 166 probes showed more than 2-fold changes after 5.5 Gy of γ-irradiation in control and HeLa S3/SOD2 cells, respectively. Pathway analysis revealed different expression profiles in irradiated control cells and irradiated SOD2-overexpressing cells. These results indicate that SOD2 protects HeLa cells against cellular effects of γ-rays through suppressing oxidative stress in irradiated cells caused by ROS generated in the mitochondria and through regulating the expression of genes which play a critical role in protection against ionizing radiation. (author)

  13. The prohibition order according to paragraph 5 S. 4 EnWG; Die Untersagungsverfuegung nach paragraph 5 S. 4 EnWG

    Energy Technology Data Exchange (ETDEWEB)

    Rauch, Karsten [WSW Netz GmbH, Wuppertal (Germany)

    2011-02-10

    The introduction of prosecutorial investigation on suspicion of delaying the insolvency proceedings published in the autumn 2010 results to a general question of whether and to what extent a concomitant intervention of the regulatory authorities is indicated. Central to this are the basis for authorization given in paragraph 5 S. 4 Energy Economy Law and the related prohibition authority.

  14. Decay rate ratios of Υ(5S)→B anti B reactions

    International Nuclear Information System (INIS)

    Hwang, Dae Sung; Son, Hyungsuk

    2010-01-01

    We calculate the decay rate ratios for OZI allowed decays of Υ(5S) to two B mesons by using the decay amplitudes which incorporate the wave function of the Υ(5S) state. We obtain the result that the branching ratio of the Υ(5S) decay to B s * anti B s * is much larger than the branching ratio to B s anti B s * or anti B s B s * , in good agreement with the recent experimental results of CLEO and BELLE. This agreement with the experimental results is made possible since the nodes of the Υ(5S) radial wave function induce the nodes of the decay amplitude. We find that the results for the Υ(5S) decays to B u (*) anti B u (*) or B d (*) anti B d (*) pairs are sensitive to the parameter values used for the potential between heavy quarks. (orig.)

  15. The 5S lean method as a tool of industrial management performances

    Science.gov (United States)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  16. The transitions 4p-5s in Y VI, Zr VII, Nb VIII and Mo IX

    International Nuclear Information System (INIS)

    Chaghtai, M.S.Z.; Rahimullah, K.; Khatoon, S.

    1976-01-01

    With the help of the spectra recorded in the Physics Department of Lund University, Y VI, Zr VII, Nb VIII and Mo IX are freshly analysed. The five 4s 2 4p 4 ground levels and the ten 4s 2 4p 3 5s levels of previous analyses are confirmed in the first three spectra, except for revising in Y VI the 4p 4 1 S 0 and 4p 3 5s( 4 Ssub(3/2)) 2 levels and interchanging 5s( 2 Dsub(3/2)) 1 with 5s( 2 Dsub(3/2)) 2 . All level values are improved due to the new measurements. A new analysis of Mo IX establishing all the 4p 4 and 4p 3 5s levels is being reported. (Auth.)

  17. Synergistic Effects of SAM and Selenium Compounds on Proliferation, Migration and Adhesion of HeLa Cells.

    Science.gov (United States)

    Sun, Licui; Zhang, Jianxin; Yang, Qiu; Si, Yang; Liu, Yiqun; Wang, Qin; Han, Feng; Huang, Zhenwu

    2017-08-01

    To determine the antitumor activities and molecular mechanism of selenium compounds in HeLa cells. Western blotting was used to detect ERK and AKT activation in HeLa cells induced by selenium compounds selenomethionine (SeMet), methylselenocysteine (MeSeCys) and methylseleninic acids (MeSeA). Using MTT, wound-healing and Matrigel adhesion assays, the antitumor effects of SAM and selenium compounds were evaluated in HeLa cells. MeSeA inhibited ERK and AKT signaling pathways and suppressed the proliferation (peffects compared to the other treatments. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  18. Growth and apoptosis of HeLa cells induced by intense picosecond pulsed electric field

    Directory of Open Access Journals (Sweden)

    Yuan-yuan HUA

    2011-07-01

    Full Text Available Objective To investigate the growth and apoptosis of HeLa cells induced by intense picosecond pulsed electric field(PEF in vitro.Methods HeLa cells cultured in vitro were divided into experimental group and control group(with or without intense picosecond PEF.With constant pulse width,frequency and voltage,the cells in experimental group were divided into 6 sub-groups according to the number of pulse(100,200,500,1000,1500,2000,the growth inhibition of HeLa cells by PEF and the dose-effect relationship were analyzed by MTT.Caspase 3 protein activity was detected in the cells in 500,1000 and 2000 sub-groups.Mitochondrial transmembrane potential was detected by rhodamine 123 staining with the cells in 2000 sub-groups.Results MTT assay demonstrated that intense picosecond PEF significantly inhibited the proliferation of HeLa cells in dose-dependent manner.The survival rates of cells declined along with the increase in pulse number,and were 96.23%±0.76%,94.11%±2.42%,90.31%±1.77%,64.59%±1.59%,32.95%±0.73%,23.85%±2.38% and 100%,respectively,in 100,200,500,1000,1500,2000 sub-groups and control group(P < 0.01.The Caspase 3 protein activity was significantly enhanced by intense picosecond PEF,and the absorbancy indexes(A were 0.174±0.012,0.232±0.017,0.365±0.016 and 0.122±0.011,respectively,in 500,1000,2000 sub-groups and control group(P < 0.05.The mitochondrial transmembrane potential of HeLa cells was significantly inhibited by intense picosecond PEF,and the fluorescence intensity in 2000 sub-group(76.66±13.38 was much lower than that in control group(155.81±2.33,P < 0.05.Conclusion Intense picosecond PEF may significantly inhibit the growth of HeLa cells,and induce cell apoptosis via mitochondrial pathway.

  19. Curcumin targeting the thioredoxin system elevates oxidative stress in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Wenqing; Zhang, Baoxin; Duan, Dongzhu [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou, Gansu 730000 (China); Wu, Jincai [College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000 (China); Fang, Jianguo, E-mail: fangjg@lzu.edu.cn [State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou, Gansu 730000 (China); College of Chemistry and Chemical Engineering, Lanzhou University, Lanzhou, Gansu 730000 (China)

    2012-08-01

    The thioredoxin system, composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH, is ubiquitous in all cells and involved in many redox-dependent signaling pathways. Curcumin, a naturally occurring pigment that gives a specific yellow color in curry food, is consumed in normal diet up to 100 mg per day. This molecule has also been used in traditional medicine for the treatment of a variety of diseases. Curcumin has numerous biological functions, and many of these functions are related to induction of oxidative stress. However, how curcumin elicits oxidative stress in cells is unclear. Our previous work has demonstrated the way by which curcumin interacts with recombinant TrxR1 and alters the antioxidant enzyme into a reactive oxygen species (ROS) generator in vitro. Herein we reported that curcumin can target the cytosolic/nuclear thioredoxin system to eventually elevate oxidative stress in HeLa cells. Curcumin-modified TrxR1 dose-dependently and quantitatively transfers electrons from NADPH to oxygen with the production of ROS. Also, curcumin can drastically down-regulate Trx1 protein level as well as its enzyme activity in HeLa cells, which in turn remarkably decreases intracellular free thiols, shifting the intracellular redox balance to a more oxidative state, and subsequently induces DNA oxidative damage. Furthermore, curcumin-pretreated HeLa cells are more sensitive to oxidative stress. Knockdown of TrxR1 sensitizes HeLa cells to curcumin cytotoxicity, highlighting the physiological significance of targeting TrxR1 by curcumin. Taken together, our data disclose a previously unrecognized prooxidant mechanism of curcumin in cells, and provide a deep insight in understanding how curcumin works in vivo. -- Highlights: ► Curcumin induces oxidative stress by targeting the thioredoxin system. ► Curcumin-modified TrxR quantitatively oxidizes NADPH to generate ROS. ► Knockdown of TrxR1 augments curcumin's cytotoxicity in HeLa cells.

  20. Curcumin targeting the thioredoxin system elevates oxidative stress in HeLa cells

    International Nuclear Information System (INIS)

    Cai, Wenqing; Zhang, Baoxin; Duan, Dongzhu; Wu, Jincai; Fang, Jianguo

    2012-01-01

    The thioredoxin system, composed of thioredoxin reductase (TrxR), thioredoxin (Trx), and NADPH, is ubiquitous in all cells and involved in many redox-dependent signaling pathways. Curcumin, a naturally occurring pigment that gives a specific yellow color in curry food, is consumed in normal diet up to 100 mg per day. This molecule has also been used in traditional medicine for the treatment of a variety of diseases. Curcumin has numerous biological functions, and many of these functions are related to induction of oxidative stress. However, how curcumin elicits oxidative stress in cells is unclear. Our previous work has demonstrated the way by which curcumin interacts with recombinant TrxR1 and alters the antioxidant enzyme into a reactive oxygen species (ROS) generator in vitro. Herein we reported that curcumin can target the cytosolic/nuclear thioredoxin system to eventually elevate oxidative stress in HeLa cells. Curcumin-modified TrxR1 dose-dependently and quantitatively transfers electrons from NADPH to oxygen with the production of ROS. Also, curcumin can drastically down-regulate Trx1 protein level as well as its enzyme activity in HeLa cells, which in turn remarkably decreases intracellular free thiols, shifting the intracellular redox balance to a more oxidative state, and subsequently induces DNA oxidative damage. Furthermore, curcumin-pretreated HeLa cells are more sensitive to oxidative stress. Knockdown of TrxR1 sensitizes HeLa cells to curcumin cytotoxicity, highlighting the physiological significance of targeting TrxR1 by curcumin. Taken together, our data disclose a previously unrecognized prooxidant mechanism of curcumin in cells, and provide a deep insight in understanding how curcumin works in vivo. -- Highlights: ► Curcumin induces oxidative stress by targeting the thioredoxin system. ► Curcumin-modified TrxR quantitatively oxidizes NADPH to generate ROS. ► Knockdown of TrxR1 augments curcumin's cytotoxicity in HeLa cells. ► Curcumin

  1. Low concentrations of doxycycline attenuates FasL-induced apoptosis in HeLa cells

    Directory of Open Access Journals (Sweden)

    Jung Mi Yoon

    2015-01-01

    Full Text Available BACKGROUND: Doxycycline (DC has been shown to possess non-antibiotic properties including Fas/Fas Ligand (FasL-mediated apoptosis against several tumor types in the concentration range of 10-40 μg/mL. However, the effect of DC in apoptotic signaling at much low concentrations was not studied. METHODS: The present study investigated the attenuation effect of low dose of DC on FasL-induced apoptosis in HeLa cell by the methods of MTT assay, fluorescence microscopy, DNA fragmentation, flow cytometry analysis, and western blotting. RESULTS AND CONCLUSION: In the present findings we showed that low concentration of DC (<2.0 μg/mL exhibited protective effects against FasL-induced apoptosis in HeLa cells. FasL treatment to HeLa cells resulted in a concentration-dependent induction of cell death, and treatment with low concentrations of DC (0.1-2 μg/mL significantly (p < 0.001 attenuated the FasL-induced cell death as measured by 3-(4,5-Dimethylthiazol-2-yl-2,5-diphenyltetrazo-lium bromide (MTT assay. Further, the FasL-induced apoptotic features in HeLa cells, such as morphological changes, DNA fragmentation and cell cycle arrest was also inhibited by DC (0.5 μg/mL. Tetracycline and minocycline also showed similar anti-apoptotic effects but were not significant when compared to DC, tested at same concentrations. Further, DC (0.01-16 μg/mL did not influence the hydrogen peroxide- or cisplatin-induced intrinsic apoptotic pathway in HeLa cells. Protein analysis using Western blotting confirmed that FasL-induced cleavage/activation of cas-pase-8 and caspase-3, were inhibited by DC treatment at low concentration (0.5 μg/mL. Considering the overall data, we report for the first time that DC exhibited anti-apoptotic effects at low concentrations in HeLa cells by inhibition of caspase activation via FasL-induced extrinsic pathway.

  2. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  3. Calcium mobilization in HeLa cells induced by nitric oxide.

    Science.gov (United States)

    Huang, Yimei; Zheng, Liqin; Yang, Hongqin; Chen, Jiangxu; Wang, Yuhua; Li, Hui; Xie, Shusen

    2014-01-01

    Nitric oxide (NO) has been proposed to be involved in tumor growth and metastasis. However, the mechanism by which nitric oxide modulates cancer cell growth and metastasis on cellular and molecular level is still not fully understood. This work utilized confocal microscopy and fluorescence microplate reader to investigate the effects of exogenous NO on the mobilization of calcium, which is one of the regulators of cell migration, in HeLa cells. The results show that NO elevates calcium in concentration-dependent manner in HeLa cells. And the elevation of calcium induced by NO is due to calcium influx and calcium release from intracellular calcium stores. Moreover, calcium release from intracellular stores is dominant. Furthermore, calcium release from mitochondria is one of the modulation pathways of NO. These findings would contribute to recognizing the significance of NO in cancer cell proliferation and metastasis. © Wiley Periodicals, Inc.

  4. Effect of different stress factors on IL-6 and leptin expression in HELA cell cultures

    International Nuclear Information System (INIS)

    Chu Zhenwei; Yang Tao; Wang Luhuan; Hao Xiuhua; Yan Guangtao

    2009-01-01

    Objective: To study the effect of three stress factors high glucose (HG), lipopolysaccharide (LPS) and hydrogen peroxide (H 2 O 2 ) on the expression of culture supernatant IL-6 (IL-6) and leptin contents of HELA cell line. Methods: HELA cell culture models of severe inflammatory response syndrome were prepared with cultures treated with 50 mmol/L glucose (HG), 4 μg/ ml LPS and 100 μmol/L H 2 O 2 respectively and supernatant contents of IL-6 and leptin were measured with RIA at 1h, 6h and 24h. Results: Generally speaking, the culture supernatant contents of IL-6 gradually increased and leptin contents gradually decreased with significant differences from those in cultures not treated with either stress factor at 6h and 12h (P<0.05). Conclusion: Leptin as a possible anti-inflammatory cytokine might plays an important protective role in severe inflammatory response. (authors)

  5. Coxsackievirus B5 induced apoptosis of HeLa cells: Effects on p53 and SUMO

    International Nuclear Information System (INIS)

    Gomes, Rogerio; Guerra-Sa, Renata; Arruda, Eurico

    2010-01-01

    Coxsackievirus B5 (CVB5), a human enterovirus of the family Picornaviridae, is a frequent cause of acute and chronic human diseases. The pathogenesis of enteroviral infections is not completely understood, and the fate of the CVB5-infected cell has a pivotal role in this process. We have investigated the CVB5-induced apoptosis of HeLa cells and found that it happens by the intrinsic pathway by a mechanism dependent on the ubiquitin-proteasome system, associated with nuclear aggregation of p53. Striking redistribution of both SUMO and UBC9 was noted at 4 h post-infection, simultaneously with a reduction in the levels of the ubiquitin-ligase HDM2. Taken together, these results suggest that CVB5 infection of HeLa cells elicit the intrinsic pathway of apoptosis by MDM2 degradation and p53 activation, destabilizing protein sumoylation, by a mechanism that is dependent on a functional ubiquitin-proteasome system.

  6. IR-induced autophagy plays a role in survival of HeLa cells

    International Nuclear Information System (INIS)

    Kang, Mi Young; Jang, Eun Yeong; Ryu, Tae Ho; Chung, Dong Min; Kim, Jin Hong; Kim, Jin Kyu

    2014-01-01

    Cells respond to stress with repair, or are diverted into irreversible cell cycle exit (senescence) or are eliminated through programmed cell death. There are two major morphologically distinctive forms of programmed cell death, apoptosis and autophagic cell death. Apoptosis contribute to cell death, whereas autophagy can play a dual role in mediating either cell survival or death in response to various stress stimuli. Here we analysed cellular responses induced by IR. The understanding of an appropriate cellular stress response is of crucial importance in foreseeing the cell fate. Apoptotic feagures were not detected in HeLa under our experimental irradiation condition. Autophagic cell death in HeLa may play an important role in cell protection and can result in cell survival

  7. The comparison of radiation responses in MCF-7 and HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Mi Young; Jang, Eun Yeong; Ryu, Tae Ho; Chung, Dong-Min; Kim, Jin Hong; Kim, Jin Kyu [Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    Activation of this pathway temporarily arrests cells at the G1 or G2 checkpoints of cell cycle, or terminates DNA replication and cell division. The present study was carried out to identify the fate of cells to cope with DNA damage stress. Cellular responses following IR treatment were different depending on the characteristics (origin, organism and genes expressed etc.) of cell line used and extent of genomic injury. p53 expression level was increased in a dose-dependent manner in both cells. IR induced a drastic increase in expression of p21 in MCF-7 compared to that in HeLa cells. Cell cycle analysis using flow cytometry showed a significant accumulation in G2/M phase after treatment of MCF-7 with IR. This study identified that IR-induced cell fates were determined through p53-dependent activation of p21, which resulted in senescence of MCF-7 cells and autophagy of HeLa cells.

  8. Study of Paclitaxel-Treated HeLa Cells by Differential Electrical Impedance Flow Cytometry

    Directory of Open Access Journals (Sweden)

    Julie Kirkegaard

    2014-08-01

    Full Text Available This work describes the electrical investigation of paclitaxel-treated HeLa cells using a custom-made microfluidic biosensor for whole cell analysis in continuous flow. We apply the method of differential electrical impedance spectroscopy to treated HeLa cells in order to elucidate the changes in electrical properties compared with non-treated cells. We found that our microfluidic system was able to distinguish between treated and non-treated cells. Furthermore, we utilize a model for electrical impedance spectroscopy in order to perform a theoretical study to clarify our results. This study focuses on investigating the changes in the electrical properties of the cell membrane caused by the effect of paclitaxel. We observe good agreement between the model and the obtained results. This establishes the proof-of-concept for the application in cell drug therapy.

  9. γ-irradiation induces radioresistant DNA synthesis in HeLa cells

    International Nuclear Information System (INIS)

    Synzynys, B.I.; Aminev, A.G.; Konstantinova, S.A.; Saenko, A.S.

    1987-01-01

    Cells of suspension HeLa culture at the logarithmic phase of growth were exposed to 60 Co-γ-rays (5 Gy), incubated in the nutritious medium, and in 4 h subjected to repeated irradiation: the dose-response function and the dynamics of DNA synthesis inhibition were determined. It was shown that DNA synthesis was inhibited to a lesser extent after preirradiation, in other words, DNA synthesis was radioresistant. A correlation between this synthesis and reproductive cell death is discussed

  10. Neutron activation analysis of antimony in chromatin and nucleoids of HeLa cells

    International Nuclear Information System (INIS)

    Ashry, H.A.; Topaloglou, A.; Altmann, H.

    1988-02-01

    Antimony seems to be cancerogenic in men. In the present investigations we tried to find out if Sb +++ are also bound to the cell nucleus. HeLa cells were incubated with SbCl 3 and after a 18 h incubation time cells were lysed and crude chromatin isolated. In this preparation Sb was determined by neutron activation analysis. From the same cell culture nucleoids were prepared by ultracentrifugation and also Sb detected in these structures. 12 refs., 2 tabs. (Author)

  11. The Pathway Analysis of Micrornas Regulated Drug-Resistant Responses in HeLa Cells.

    Science.gov (United States)

    Yang, Yubo; Dai, Cuihong; Cai, Zhipeng; Hou, Aiju; Cheng, Dayou; Wu, Guanying; Li, Jing; Cui, Jie; Xu, Dechang

    2016-03-01

    Chemotherapy is the main strategy in the treatment of cancer; however, the development of drug-resistance is the obstacle in long-term treatment of cervical cancer. Cisplatin is one of the most common drugs used in cancer therapy. Recently, accumulating evidence suggests that miRNAs are involved in various bioactivities in oncogenesis. It is not unexpected that miRNAs play a key role in acquiring of drug-resistance in the progression of tumor. In this study, we induced and maintained four levels of cisplatin-resistant HeLa cell lines (HeLa/CR1, HeLa/CR2, HeLa/CR3, and HeLa/CR4). According to the previous studies and existing evidence, we selected five miRNAs (miR-183, miR-182, miR-30a, miR-15b, and miR-16) and their potential target mRNAs as our research targets. The real-time RT-PCR was adopted to detect the relative expression of miRNAs and their mRNAs. The results show that miR-182 and miR-15b were up-regulated in resistant cell lines, while miR-30a was significantly down-regulated. At the same time, their targets are related to drug resistance. Compared to their parent HeLa cell line, the expression of selected miRNAs in resistant cell lines altered. The alteration suggests that HeLa cell drug resistance is associated with distinct miRNAs, which indicates that miRNAs may be one of the therapy targets in the treatment of cervical cancer by sensitizing cell to chemotherapy. We suggested a possible network diagram based on the existing theory and the preliminary results of candidate miRNAs and their targets in HeLa cells during development of drug resistance.

  12. Glucose capped silver nanoparticles induce cell cycle arrest in HeLa cells.

    Science.gov (United States)

    Panzarini, Elisa; Mariano, Stefania; Vergallo, Cristian; Carata, Elisabetta; Fimia, Gian Maria; Mura, Francesco; Rossi, Marco; Vergaro, Viviana; Ciccarella, Giuseppe; Corazzari, Marco; Dini, Luciana

    2017-06-01

    This study aims to determine the interaction (uptake and biological effects on cell viability and cell cycle progression) of glucose capped silver nanoparticles (AgNPs-G) on human epithelioid cervix carcinoma (HeLa) cells, in relation to amount, 2×10 3 or 2×10 4 NPs/cell, and exposure time, up to 48h. The spherical and well dispersed AgNPs (30±5nm) were obtained by using glucose as reducing agent in a green synthesis method that ensures to stabilize AgNPs avoiding cytotoxic soluble silver ions Ag + release. HeLa cells take up abundantly and rapidly AgNPs-G resulting toxic to cells in amount and incubation time dependent manner. HeLa cells were arrested at S and G2/M phases of the cell cycle and subG1 population increased when incubated with 2×10 4 AgNPs-G/cell. Mitotic index decreased accordingly. The dissolution experiments demonstrated that the observed effects were due only to AgNPs-G since glucose capping prevents Ag + release. The AgNPs-G influence on HeLa cells viability and cell cycle progression suggest that AgNPs-G, alone or in combination with chemotherapeutics, may be exploited for the development of novel antiproliferative treatment in cancer therapy. However, the possible influence of the cell cycle on cellular uptake of AgNPs-G and the mechanism of AgNPs entry in cells need further investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Ascorbyl Stearate Promotes Apoptosis Through Intrinsic Mitochondrial Pathway in HeLa Cancer Cells.

    Science.gov (United States)

    Mane, Shirish D; Thoh, Maikho; Sharma, Deepak; Sandur, Santosh K; Naidu, K Akhilender

    2016-12-01

    Ascorbic acid is proposed to have antitumor potential against certain cancer types but has the limitation of requiring high doses for treating cancer. Ascorbyl stearate (ASC-S) is a fatty acid ester derivative of ascorbic acid with comparable potent apoptotic activity. The present study was aimed at understanding the pathway involved in apoptotic activity of ASC-S in cervical cancer cells. The effect of ASC-S on reactive oxygen species (ROS), and mitochondrial membrane potential (MMP) was studied in HeLa cells. Furthermore, the dose-dependent effect of ASC-S on release of cytochrome c, pro-caspase-9, caspase-3, BH3 interacting-domain death agonist (BID), truncated BH3 interacting-domain death agonist (t-BID), FAS ligand (FASL) and transcription factors nuclear factor-kappa B (NF-ĸB), nuclear factor of activated T-cells (NFAT) and activator protein-1 (AP1) were studied in HeLa cells. Treatment of HeLa cells with ASC-S significantly increased the MMP. The modulation of MMP resulted in cleavage of BID, expression of FAS, cleavage of pro-caspase-9 and release of cytochrome c into cytosol. In addition, ASC-S treatment resulted in deregulation of transcription factors NF-ĸB, NFAT and AP1, which play an important role in the development of inflammation and cancer. Our data, for the first time, suggest that ASC-S has an apoptotic effect against HeLa cells by inducing change in mitochondrial membrane permeability, cytochrome c release and subsequent activation of caspase-3 and NF-ĸB. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  14. Caspase-3-dependent apoptosis of citreamicin ε-induced heLa iells Is associated with reactive oxygen species generation

    KAUST Repository

    Liu, Lingli; He, Lisheng; Xü , Ying; Han, Zhuang; Li, Yongxin; Zhong, Jialiang; Guo, Xianrong; Zhang, Xixiang; Ko, Kamming; Qian, Peiyuan

    2013-01-01

    . The relative configurations of these two diastereomers were determined using NMR spectroscopy and successful crystallization of citreamicin ε A (1). Both diastereomers showed potent cytotoxic activity against HeLa (cervical cancer) and HepG2 (hepatic carcinoma

  15. Surface glycosaminoglycans mediate adherence between HeLa cells and Lactobacillus salivarius Lv72.

    Science.gov (United States)

    Martín, Rebeca; Martín, Carla; Escobedo, Susana; Suárez, Juan E; Quirós, Luis M

    2013-09-17

    The adhesion of lactobacilli to the vaginal surface is of paramount importance to develop their probiotic functions. For this reason, the role of HeLa cell surface proteoglycans in the attachment of Lactobacillus salivarius Lv72, a mutualistic strain of vaginal origin, was investigated. Incubation of cultures with a variety of glycosaminoglycans (chondroitin sulfate A and C, heparin and heparan sulfate) resulted in marked binding interference. However, no single glycosaminoglycan was able to completely abolish cell binding, the sum of all having an additive effect that suggests cooperation between them and recognition of specific adhesins on the bacterial surface. In contrast, chondroitin sulfate B enhanced cell to cell attachment, showing the relevance of the stereochemistry of the uronic acid and the sulfation pattern on binding. Elimination of the HeLa surface glycosaminoglycans with lyases also resulted in severe adherence impairment. Advantage was taken of the Lactobacillus-glycosaminoglycans interaction to identify an adhesin from the bacterial surface. This protein, identify as a soluble binding protein of an ABC transporter system (OppA) by MALDI-TOF/(MS), was overproduced in Escherichia coli, purified and shown to interfere with L. salivarius Lv72 adhesion to HeLa cells. These data suggest that glycosaminoglycans play a fundamental role in attachment of mutualistic bacteria to the epithelium that lines the cavities where the normal microbiota thrives, OppA being a bacterial adhesin involved in the process.

  16. Three-dimensional printing of Hela cells for cervical tumor model in vitro

    International Nuclear Information System (INIS)

    Zhao, Yu; Yao, Rui; Ouyang, Liliang; Ding, Hongxu; Zhang, Ting; Sun, Wei; Zhang, Kaitai; Cheng, Shujun

    2014-01-01

    Advances in three-dimensional (3D) printing have enabled the direct assembly of cells and extracellular matrix materials to form in vitro cellular models for 3D biology, the study of disease pathogenesis and new drug discovery. In this study, we report a method of 3D printing for Hela cells and gelatin/alginate/fibrinogen hydrogels to construct in vitro cervical tumor models. Cell proliferation, matrix metalloproteinase (MMP) protein expression and chemoresistance were measured in the printed 3D cervical tumor models and compared with conventional 2D planar culture models. Over 90% cell viability was observed using the defined printing process. Comparisons of 3D and 2D results revealed that Hela cells showed a higher proliferation rate in the printed 3D environment and tended to form cellular spheroids, but formed monolayer cell sheets in 2D culture. Hela cells in 3D printed models also showed higher MMP protein expression and higher chemoresistance than those in 2D culture. These new biological characteristics from the printed 3D tumor models in vitro as well as the novel 3D cell printing technology may help the evolution of 3D cancer study. (paper)

  17. Kelussia odoratissima potentiates cytotoxic effects of radiation in HeLa cancer cell line

    Directory of Open Access Journals (Sweden)

    Azar Hosseini

    2017-02-01

    Full Text Available Objective: Cervical cancer is the second most common cause of death from cancer in women throughout the world. The aim of this study was to evaluate the cytotoxic activity of Kelussia odoratissima (K. odoratissima extract associated with radiotherapy in cervical cancer cells (HeLa cell line.Materials and Methods: Different concentration of the extract (25-500µg/ml was tested in HeLa cell lines. Cell cytotoxicity of the extract and the effects of the extract on radiation (2Gy/min-induced damages were assessed by MTT assay. Apoptosis was assessed using flow cytometric analysis.Result: K. odoratissima decreased cell viability in HeLa cell line in a concentration and time-dependent manner. When compared to the control,K. odoratissima induced a sub-G1 peak in the flow cytometry histogram of treated cells, indicating that apoptotic cell death is involved in K. odoratissima-induced toxicity. It was also shown that K. odoratissima sensitizes cells to radiation-induced toxicity.Conclusion: Our result showed the extract increased the radiation effect. This observation may be related to the presence of active compounds such as phthalides and ferulic acid.

  18. Cytotoxicity and apoptotic effects of nickel oxide nanoparticles in cultured HeLa cells

    Directory of Open Access Journals (Sweden)

    Kezban Ada

    2010-04-01

    Full Text Available The aim of this study was to observe the cytotoxicity and apoptotic effects of nickel oxide nanoparticles on humancervix epithelioid carcinoma cell line (HeLa. Nickel oxide precursors were synthesized by an nickel sulphate-excess ureareaction in boiling aqueous solution. The synthesized NiO nanoparticles (<200 nm were investigated by X-ray diffractionanalysis and transmission electron microscopy techniques. For cytotoxicity experiments, HeLa cells were incubated in50-500 μg/mL NiO for 2, 6, 12 and 16 hours. The viable cells were counted with a haemacytometer using light microscopy.The cytotoxicity was observed low in 50-200 μg/mL concentration for 16 h, but high in 400-500 μg/mL concentration for2-6 h. HeLa cells' cytoplasm membrane was lysed and detached from the well surface in 400 μg/mL concentration NiOnanoparticles. Double staining and M30 immunostaining were performed to quantify the number of apoptotic cells in cultureon the basis of apoptotic cell nuclei scores. The apoptotic effect was observed 20% for 16 h incubation.

  19. Photokinetic and ultrastructural studies on porphyrin photosensitization of HeLa cells

    International Nuclear Information System (INIS)

    Milanesi, Carla; Sorgato, Fiorella; Jori, Giulio

    1989-01-01

    Liposome-bound haematoporphyrin or haematoporphyrin dimethylester, as well as haematoporphyrin dissolved in phosphate-buffered saline, were added to HeLa cell monolayers at a dose of 1 μg of porphyrin per 10 5 cells. After 2 min or 20 min incubation liposome-bound porphyrins were accumulated by cells in an about two-fold larger amount than the water-dissolved haematoporphyrin. This caused a more efficient photosensitization of HeLa cells by liposome-delivered porphyrins upon illumination with 366 nm light. Ultrastructural studies of HeLa cells, which had been incubated in a physiological medium for 24 h after the end of irradiation, showed that liposomal porphyrins induce an early and extensive endocytoplasmic damage, leading to mitochondrial swelling and vesiculation; changes of permeability of the cytoplasmic membrane are also evident, especially in the case of haematoporphyrin dimethylester. On the other hand, water-dissolved haematoporphyrin predominantly photosensitizes damage of the plasma membrane. The different pattern of cell photodamage probably reflects a different subcellular distribution of the photosensitizing drugs. (author)

  20. A key inactivation factor of HeLa cell viability by a plasma flow

    Energy Technology Data Exchange (ETDEWEB)

    Sato, Takehiko; Yokoyama, Mayo [Institute of Fluid Science, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577 (Japan); Johkura, Kohei, E-mail: sato@ifs.tohoku.ac.jp [Department of Histology and Embryology, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621 (Japan)

    2011-09-21

    Recently, a plasma flow has been applied to medical treatment using effects of various kinds of stimuli such as chemical species, charged particles, heat, light, shock wave and electric fields. Among them, the chemical species are known to cause an inactivation of cell viability. However, the mechanisms and key factors of this event are not yet clear. In this study, we focused on the effect of H{sub 2}O{sub 2} in plasma-treated culture medium because it is generated in the culture medium and it is also chemically stable compared with free radicals generated by the plasma flow. To elucidate the significance of H{sub 2}O{sub 2}, we assessed the differences in the effects of plasma-treated medium and H{sub 2}O{sub 2}-added medium against inactivation of HeLa cell viability. These two media showed comparable effects on HeLa cells in terms of the survival ratios, morphological features of damage processes, permeations of H{sub 2}O{sub 2} into the cells, response to H{sub 2}O{sub 2} decomposition by catalase and comprehensive gene expression. The results supported that among chemical species generated in a plasma-treated culture medium, H{sub 2}O{sub 2} is one of the main factors responsible for inactivation of HeLa cell viability. (fast track communication)

  1. Effect of hyperthermia and radiation on the cell cycle progression of HeLa cells

    International Nuclear Information System (INIS)

    Kubota, Nobuo

    1982-01-01

    The effect of hyperthermia and irradiation on cytokinetics was studied using exponentially growing HeLa cells. To determine the effect of heat and/or radiation on the cell cycle progression, the changes in the DNA distribution of the cell population after time intervals after treatment were studied. The cellular DNA content of the cell population was measured by flow cytometry. The results obtained were as follows: 1. Compared with the control, the cellular DNA content distribution of HeLa cells treated with 43 0 C for 20 min and 60 min showed cell accumulation in S and G 2 M phases 8 hours after treatment. 2. Hyperthermic treatment at 45 0 C for 20 min caused cells to accumulate in S phase in the first 4 hours and G 2 M phase after 8 to 14.5 hours, whereas heat treatment at 45 0 C for 60 min caused cells to accumulate in G 2 M phase after 24 hours. 3. Irradiation of exponentially growing cells induced a block in the progress from G 2 M to G 1 phase. 4. Dose survival curves of HeLa cells with and without postirradiation thermal treatment (43 0 C, 60 min) showed significant enhancement of radiosensitivity by hyperthermia. 5. The sequential treatment, i.e. 5 Gy irradiation followed immediately by heat treatment at 43 0 C for 60 min, caused more cells to accumulate in G 2 M phase after 24 and 48 hours, as compared with 5 Gy irradiation alone. (author)

  2. Variability of the nucleoli number in the progenies of intact and UV-irradiated clonogenic Hela cells

    International Nuclear Information System (INIS)

    Kucheryavaya, N.A.; Zavol'naya, E.S.; Vakhtin, Yu.B.

    1981-01-01

    The coefficient of the ''nucleoli number'' character heritability (h 2 ) in the population of intact Hela cells equals 0.21 to 0.33. UV-irradiation enhances almost equally both the intraclonic and population variability of the nucleoli number and, as a result, the coefficient of the ''nucleoli number'' character heritability does not change in the population of UV-irradiated Hela cells

  3. Variability of the nucleoli number in the progenies of intact and UV-irradiated clonogenic Hela cells

    Energy Technology Data Exchange (ETDEWEB)

    Kucheryavaya, N.A.; Zavol' naya, E.S.; Vakhtin, Yu.B. (AN SSSR, Leningrad. Inst. Tsitologii)

    1981-01-01

    The coefficient of the ''nucleoli number'' character heritability (h/sup 2/) in the population of intact Hela cells equals 0.21 to 0.33. UV-irradiation enhances almost equally both the intraclonic and population variability of the nucleoli number and, as a result, the coefficient of the ''nucleoli number'' character heritability does not change in the population of UV-irradiated Hela cells.

  4. [miR-25 promotes cell proliferation by targeting RECK in human cervical carcinoma HeLa cells].

    Science.gov (United States)

    Qiu, Gang; Fang, Baoshuan; Xin, Guohong; Wei, Qiang; Yuan, Xiaoye; Wu, Dayong

    2015-01-01

    To investigate the effect of miR-25 on the proliferation of human cervical carcinoma HeLa cells and its association with reversion-inducing cysteine-rich protein with Kazal motifs (RECK). The recombinant plasmids of pcDNATM6.2-GW-pre-miR-25, pmirGLO-RECK-WT, pmirGLO-RECK-MT and anti-miR-25 were constructed, and their transfection efficiencies into HeLa cells were identified by real-time quantitative PCR (qRT-PCR). The potential proliferation-stimulating function of miR-25 was analyzed by MTT assay in HeLa cells. Furthermore, the target effect of miR-25 on the RECK was determined by dual-luciferase reporter assay system, qRT-PCR and Western blotting. Sequence analysis demonstrated that the recombinant plasmids of pcDNATM6.2-GW-pre-miR-25 and pmirGLO-RECK-WT, pmirGLO-RECK-MT were successfully constructed, and qRT-PCR revealed that the transfection efficiencies of pre-miR-25 and anti-miR-25 were desirable in HeLa cells. MTT assay showed that miR-25 over-expression promoted the proliferation of HeLa cells. In addition, the luciferase activity was significantly reduced in HeLa cells cotransfected with pre-miR-25 and RECK-WT. The qRT-PCR and Western blotting indicated that the expression level of RECK was up-regulated in HeLa cells transfected with anti-miR-25 at the transcriptional and posttranscriptional levels. miR-25 could promote cell proliferation by targeting RECK in HeLa cells.

  5. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Science.gov (United States)

    Czifra, György

    2017-09-01

    Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: "YES", because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  6. Hyperfine splitting of B mesons and Bs production at the Υ(5S)

    International Nuclear Information System (INIS)

    Lee-Franzini, J.; Heintz, U.; Lovelock, D.M.J.; Narain, M.; Schamberger, R.D.; Willins, J.; Yanagisawa, C.; Franzini, P.; Tuts, P.M.

    1990-01-01

    Using the Columbia University--Stony Brook (CUSB-II) detector we have studied the inclusive photon spectrum from 2.9x10 4 Υ(5S) decays. We observe a strong signal due to B * →Bγ decays. From this we obtain (i) the average B * -B mass difference, 46.7±0.4 MeV, (ii) the photon yield per Υ(5S) decay, left-angle γ/Υ(5S)right-angle=1.09±0.06, and (iii) the average velocity of the B * 's, left-angle β right-angle=0.156±0.010, for a mix of nonstrange (B) and strange (B s ) B * mesons from Υ(5S) decays. From the shape of the photon line, we find that both B and B s mesons are produced with nearly equal values for the hyperfine splitting of the B and B s meson systems

  7. Peak shifts due to B(*)-B(*) rescattering in Υ(5S) dipion transitions

    International Nuclear Information System (INIS)

    Meng Ce; Chao Kuangta

    2008-01-01

    We study the energy distributions of dipion transitions Υ(5S) to Υ(1S,2S,3S)π + π - in the final-state rescattering model. Since the Υ(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes Υ(5S)→B ( * ) B ( * ) and B ( * ) B ( * ) →Υ(1S,2S,3S)π + π - . We find that the energy distributions of Υ(1S,2S,3S)π + π - markedly differ from that of Υ(5S)→B ( * ) B ( * ) . In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  8. Y(5S): What has been learned and what can be learned

    International Nuclear Information System (INIS)

    Blusk, S.R.

    2007-01-01

    We present recent measurements of B and B s 0 production using data collected on the Y(5S) resonance at CLEO and Belle. We also briefly discuss what can be learned using sufficiently larger data samples in the future

  9. Implementation Process of 5S for a Company in Real Life - Problems, Solutions, Successes

    Directory of Open Access Journals (Sweden)

    Czifra György

    2017-09-01

    Full Text Available Developed in Japan, 5S is a system of organizing workplace for efficiency, effectiveness and safety. Is 5s important? The answer is: “YES”, because the implementation is about empowering employees to control their work area and create an environment where they want to work every day. It is a program that only works with grass roots level engagement. With commitment to safety, we are equally committed to 5S to ensure a safe place to work. It enabled us to indicate where waste was occurring and thus improve the work area sustainably. We recognized real problems, found solutions and ultimately we were successful in our endeavors. Throughout different companies, various words of similar meaning are used. No matter what specific words are used to identify the steps in 5S, the purpose remains the same: create a clean, organized and efficient work environment.

  10. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    Science.gov (United States)

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p5S it was observed and determined that facilitating the job and setting up a safe environment created a statistically significant effect on

  11. O5S, Calibration of Organic Scintillation Detector by Monte-Carlo

    International Nuclear Information System (INIS)

    1985-01-01

    1 - Nature of physical problem solved: O5S is designed to directly simulate the experimental techniques used to obtain the pulse height distribution for a parallel beam of mono-energetic neutrons incident on organic scintillator systems. Developed to accurately calibrate the nominally 2 in. by 2 in. liquid organic scintillator NE-213 (composition CH-1.2), the programme should be readily adaptable to many similar problems. 2 - Method of solution: O5S is a Monte Carlo programme patterned after the general-purpose Monte Carlo neutron transport programme system, O5R. The O5S Monte Carlo experiment follows the course of each neutron through the scintillator and obtains the energy-deposits of the ions produced by elastic scatterings and reactions. The light pulse produced by the neutron is obtained by summing up the contributions of the various ions with the use of appropriate light vs. ion-energy tables. Because of the specialized geometry and simpler cross section needs O5S is able to by-pass many features included in O5R. For instance, neutrons may be followed individually, their histories analyzed as they occur, and upon completion of the experiment, the results analyzed to obtain the pulse-height distribution during one pass on the computer. O5S does allow the absorption of neutrons, but does not allow splitting or Russian roulette (biased weighting schemes). SMOOTHIE is designed to smooth O5S histogram data using Gaussian functions with parameters specified by the user

  12. Radioprotective effect of calorie restriction in Hela cells and SD rats

    International Nuclear Information System (INIS)

    Yang Yang; Chong Yu; Jiao Yang; Xu Jiaying; Fan Saijun

    2012-01-01

    Objective: To explore the effect of low calorie metabolism on the survival of HeLa cells exposed to X-rays, and the influence of starvation on the antioxidative factors in the blood of rats after irradiation. Methods: MTT method was used to evaluate the impact of different concentration glucose on the proliferation of HeLa cells. Colony formation assay was employed to detect the influence of glucose (1, 5, 10 and 25 mmol/L) on radiosensitivity of HeLa cells. Flow cytometry assay was used to analyze distribution of cell cycle and apoptosis. 60 male SD rats were randomly divided into 6 groups with 10 rats each. Rats in every two groups were fed ad libitum, fasted for 24 h and fasted for 48 h, respectively. Rats in one group of each approach were respectively exposed to whole-body X-rays at 11 Gy. At 2 h after irradiation,all of rats were sacrificed and their venous blood was collected. Elisa kits were used to detect superoxide dismutase (SOD) and total antioxidant capacity (T-AOC). Results: An increased viability was observed in HeLa cells treated with the glucose at low concentration (<25 mmol/L), while HeLa cell growth was inhibited by glucose at doses of >25 mmol/L. Relevant to cells treated with 1 mmoL/L glucose, SERs (sensitive enhancement ratio) in cells exposed to 5, 10 and 25 mmol/L glucose were 1.07, 1.10 and 1.23,respectively. A reduction of G 2 /M and S arrests and apoptosis caused by 6 Gy X-ray irradiation were observed [(49.68 ±1.88)% and (35.54±1.45)% at G 2 /M phase, (16.88 ±1.22)% and (10.23 ±1.65)% at S phase, t=10.42, 5.61, P<0.05] and in the cells treated with 1 mmol/L glucose compared with cells treated with 25 mmol/L glucose [(25.50 ± 0.95)% and (7.56 ± 1.07)%, t=21.72, P<0.05].Without irradiation, calorie restriction exhibited a negligible influence on SOD and T-AOC in rats. However, after 11 Gy irradiation, compared with rats fed ad libitum, the levels of SOD and T-AOC were significantly increased in rats with calorie restriction (t=40

  13. Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells.

    Science.gov (United States)

    Casanova, Alain; Low, Shyan H; Emmenlauer, Mario; Conde-Alvarez, Raquel; Salcedo, Suzana P; Gorvel, Jean-Pierre; Dehio, Christoph

    2016-08-05

    Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections. Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring. In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells. In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular

  14. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

  15. Measurement of B(Υ(5S)→Bs(*)Bs(*)) using φ mesons

    International Nuclear Information System (INIS)

    Huang, G. S.; Miller, D. H.; Pavlunin, V.; Sanghi, B.; Shipsey, I. P. J.; Xin, B.; Adams, G. S.; Anderson, M.; Cummings, J. P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C. S.; Thorndike, E. H.; Yang, F.; Coan, T. E.; Gao, Y. S.; Liu, F.

    2007-01-01

    Knowledge of the B s decay fraction of the Υ(5S) resonance, f S , is important for B s meson studies at the Υ(5S) energy. Using a data sample collected by the CLEO III detector at CESR consisting of 0.423 fb -1 on the Υ(5S) resonance, 6.34 fb -1 on the Υ(4S) and 2.32 fb -1 in the continuum below the Υ(4S), we measure B(Υ(5S)→φX)=(13.8±0.7 -1.5 +2.3 )% and B(Υ(4S)→φX)=(7.1±0.1±0.6)%; the ratio of the two rates is (1.9±0.1 -0.2 +0.3 ). This is the first measurement of the φ meson yield from the Υ(5S). Using these rates, and a model dependent estimate of B(B s →φX), we determine f S =(24.6±2.9 -5.3 +11.0 )%. We also update our previous independent measurement of f S made using the inclusive D s yields to now be (16.8±2.6 -3.4 +6.7 )%, due to a better estimate of the number of hadronic events. We also report the total Υ(5S) hadronic cross section above continuum to be σ(e + e - →Υ(5S))=(0.301±0.002±0.039) nb. This allows us to extract the fraction of B mesons as (58.9±10.0±9.2)%, equal to 1-f S . Averaging the three methods gives a model dependent result of f S =(21 -3 +6 )%

  16. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  17. Implementation of 5S in Manufacturing Industry: A Case of Foreign Workers in Melaka

    Directory of Open Access Journals (Sweden)

    Chee Houa San

    2018-01-01

    Full Text Available Lean manufacturing system has been infiltrated in manufacturing sectors across the world. In fact, Lean manufacturing system is a practice which regards the use of the resources, creation of value for the end customers, and as the ways to eliminate the waste. There are several tools that can be used to eliminate the waste within the industry. This research is a study of the implementation of 5S in manufacturing industry. Despite this, the research study focused on manufacturing industry, which has been implemented 5S system in Melaka State. Although there are number of tools and technique available to help in improving the manufacturing process, however, there is only few industries could implement the tools successfully. In this research, foreign workers play a main role in implement the 5S systems as the manufacturing industry in Malaysia adopt large amount of foreign workers to work as employees. Therefore, it is important to ensure the foreign workers truly understand the concept of 5S system and adopt the best ways to implement it in order to have better performance. This research study has been proposed by the research model of the barriers to implementation of 5S in manufacturing industry among foreign workers. A several research method has been adopted to do the research, such as descriptive research design with quantitative methods, survey questionnaire and cross-sectional studies.

  18. Dose-rate effects on the cell cycle and survival of S3 HeLa and V79 cells

    International Nuclear Information System (INIS)

    Mitchell, J.B.; Bedford, J.S.; Bailey, S.M.

    1979-01-01

    The effects of continuous irradiation at different dose rates on the cell cycle and on cell survival were studied using synchronized S3 HeLa and V79 cells. The minimum dose rate necessary to stop cell division was found to be approximately 23 rad/hr for HeLa cells and 270 rad/hr for V79 cells. For dose rates that stop cell division, cells progress through G 1 and S, with a small delay in the S phase, and are blocked in G 2 . Appreciable mitotic accumulation was observed for HeLa cells at dose rates which stopped cell division. By comparison, much less mitotic accumulation was observed for V79 cells over a range of dose rates from 37 to 270 rad/hr. Minimum mitotic delays for a variety of dose rates were determined for both cell lines. S3 HeLa cells are much more sensitive in this respect than V79 cells; however, it appeared that for higher dose rates the minimum mitotic delay in HeLa cells asymptotically approached a value of about 35 hr. In addition to the qualitative differences observed for the two cell lines in regard to mitotic accumulation, HeLa cells accumulated for prolonged periods in the presence of colcemid while V79 cells were blocked for only a few hours, HeLa cells show a dramatic effect of redistribution of cells into sensitive phases of the cell cycle during exposure, which was reflected in the survival curves at low dose rate. More cell killing per unit dose was observed at 37 than at 74 rad/hr

  19. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.

    1988-01-01

    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  20. Studies of inelastic cross-section in Rb(7S) + Rb(5S) collisions

    International Nuclear Information System (INIS)

    Caiyan, L.; Ekers, A.; Latvia Univ., Riga; Klavins, J.; Jansons, M.

    1996-01-01

    The cross section σ = (8 ± 4) x 10 -15 cm 2 was determined for the Rb(7S) + Rb(5S) → Rb(5D) + Rb(5S) excitation energy transfer process, and the quenching cross section σ q = (2 ± 1) x 10 -14 cm 2 for the Rb(5D) state in collisions with ground state Rb atoms. Applying rubidium quasimolecular asymptotic potential curves at relatively large internuclear distances, a qualitative interpretation of the experimental results is presented. It is shown that the quenching of the Rb(5D) atoms in collisions may be explained by a reversed energy pooling process Rb(5D) + Rb(5S) → Rb(5P) + Rb(5P). (orig.)

  1. IMPLEMENTING THE 5S METHOD IN THE PRODUCTION SYSTEM OF DACIA & RENAULT

    Directory of Open Access Journals (Sweden)

    Marin CIOBANU

    2014-11-01

    Full Text Available The aim of this paper is to demonstrate the usefulness of the 5S method in addressing the issues of continuous improvement of productivity and quality of work. There are presented the 5 steps, techniques and the adjacent tools. Solutions implemented in the production system Dacia & Renault are indicated. This article provides a practical framework. The 5S method follows the Deming PDCA cycle which constitutes the starting point of the SDCA cycle of continuous improvement of the company's activities in order to obtain excellence. The implementing time of the method depends on the resources and materials allocated. Deployment of 5S is achieved by a scheme of "3+2": the first 3S are tangible and immediate actions, the last 2S appeal to specific management actions. The efficacy of their own workplace in total autonomy creates comfort in the work environment and gives personal benefits to workers.

  2. Ethical and psychological factors in 5S and total productive maintenance

    Directory of Open Access Journals (Sweden)

    Jamal Ahmed Hama Kareem

    2017-08-01

    Full Text Available Purpose: The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results.  Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b Panneerselvam (2012 Singh et al. (2013 and Poduval & Pramod (2015 in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM that are used to bring out the best productivity.

  3. Ethical and psychological factors in 5S and total productive maintenance

    International Nuclear Information System (INIS)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-01-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  4. Ethical and psychological factors in 5S and total productive maintenance

    Energy Technology Data Exchange (ETDEWEB)

    Jamal Ahmed Hama Kareem; Othman Abdul-Qader Hama Amin

    2017-07-01

    The purpose of this paper is to investigate the role of ethical and psychological factors in the implementation of 5S and TPM at cement plants in Kurdistan Region of Iraq. Design/methodology/approach: The mixed methods represented in a questionnaire survey and semi-structured interviews for data collection in the framework of the case study were chosen. The questionnaire survey already has been tested. Findings: The findings of this paper revealed that ethical factors had a larger role than psychological factors in the implementation. Thus, based on the findings, organisations are recommended to provide financial and moral support to employees to enable a comprehensive implementation of 5S and TPM aimed at obtaining the desired results. Originality/value: The current paper tried to introduce a new theoretical contribution by filling the gap in the literature regarding the important role that can be played by ethical and psychological factors of employees in the successful implementation of contemporary techniques, such as 5S and TPM in industrial organizations. This is contrary to what was done most of previous studies such as Ahuja & Khamba, (2008b) Panneerselvam (2012) Singh et al. (2013) and Poduval & Pramod (2015) in the area of 5S and TPM. Where, these studies have focused on studying the other factors such as (organizational, technological, operational and others) in implementing 5S and TPM. This without realizing the fact that it is also necessary to examine factors such as (ethical and psychological) that would affect the capabilities and employee morale before and during the implementation of those techniques (5S and TPM) that are used to bring out the best productivity.

  5. Early RNA of adenovirus type 3 in permissive and abortive infections.

    OpenAIRE

    Groff, D E; Daniell, E

    1981-01-01

    Early adenovirus type 3 cytoplasmic polyadenylated RNAs from HeLa and BHK-21 cells were detected and mapped on the viral genome by gel blotting and hybridization techniques. The sizes and locations of the 16 adenovirus type 3 RNAs were identical in the two cell types, although relative molarities of the various RNA species differed. Each of the early adenovirus type 3 RNAs was associated with polysomes in both cell types, suggesting that the abortive infection of hamster cells does not result...

  6. 5S-MENETELMÄN KÄYTTÖÖNOTTO SERVICEPOINTILLA

    OpenAIRE

    Ovaskainen, Tatu-Pekka

    2014-01-01

    Opinnäytetyö on tehty Servicepoint Kuopio Oy:n toimeksiannosta. Servicepoint Kuopio on teollisuuden kunnossapitoon automaatio- ja sähköistysprojekteihin sekä robottisovelluksiin erikoistunut yritys. Yrityksen kahden toimipisteen yhdistyminen lisäsi toimipisteellä henkilöstön ja työkalujen määrää. Yrityksessä toteutetaan sovelletusti Lean-ajattelumallia. Yksi Leanin työkaluista on 5S, joka haluttiin ottaa käyttöön yrityksessä. Opinnäytetyön tavoitteena oli ottaa käyttöön 5S-menetelmä Servi...

  7. 5S-menetelmän käyttöönotto Case: Planmeca Oy

    OpenAIRE

    Velic, Adel

    2014-01-01

    Opinnäytetyön tavoitteena on tutkia Planmeca Oy:n panoraamaröntgentuotannossa syksyllä 2012 toteutetun 5S-projektin onnistuneisuutta. Työ kattaa sekä 5S-periaatteiden mukaisesti suunniteltujen ja toteutettujen panoraamaröntgentuotannon Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiimin työpisteiden että projektin toteutustavan onnistuneisuuden mittaamisen. Tutkimusmenetelmänä käytetään Elko-, Pystytys 1 -, Pystytys 2 - sekä Potilastuki- ja skannausmekanismitiim...

  8. Photodynamic Effect of Ni Nanotubes on an HeLa Cell Line.

    Directory of Open Access Journals (Sweden)

    Muhammad Hammad Aziz

    Full Text Available Nickel nanomaterials are promising in the biomedical field, especially in cancer diagnostics and targeted therapy, due to their distinctive chemical and physical properties. In this experiment, the toxicity of nickel nanotubes (Ni NTs were tested in an in vitro cervical cancer model (HeLa cell line to optimize the parameters of photodynamic therapy (PDT for their greatest effectiveness. Ni NTs were synthesized by electrodeposition. Morphological analysis and magnetic behavior were examined using a Scanning electron microscope (SEM, an energy dispersive X-ray analysis (EDAX and a vibrating sample magnetometer (VSM analysis. Phototoxic and cytotoxic effects of nanomaterials were studied using the Ni NTs alone as well as in conjugation with aminolevulinic acid (5-ALA; this was performed both in the dark and under laser exposure. Toxic effects on the HeLa cell model were evaluated by a neutral red assay (NRA and by detection of intracellular reactive oxygen species (ROS production. Furthermore, 10-200 nM of Ni NTs was prepared in solution form and applied to HeLa cells in 96-well plates. Maximum toxicity of Ni NTs complexed with 5-ALA was observed at 100 J/cm2 and 200 nM. Up to 65-68% loss in cell viability was observed. Statistical analysis was performed on the experimental results to confirm the worth and clarity of results, with p-values = 0.003 and 0.000, respectively. Current results pave the way for a more rational strategy to overcome the problem of drug bioavailability in nanoparticulate targeted cancer therapy, which plays a dynamic role in clinical practice.

  9. Photodynamic Effect of Ni Nanotubes on an HeLa Cell Line

    Science.gov (United States)

    Hammad Aziz, Muhammad; Fakhar-e-Alam, M.; Fatima, Mahvish; Shaheen, Fozia; Iqbal, Seemab; Atif, M.; Talha, Muhammad; Mansoor Ali, Syed; Afzal, Muhammad; Majid, Abdul; Shelih Al.Harbi, Thamir; Ismail, Muhammad; Wang, Zhiming M.; AlSalhi, M. S.; Alahmed, Z. A.

    2016-01-01

    Nickel nanomaterials are promising in the biomedical field, especially in cancer diagnostics and targeted therapy, due to their distinctive chemical and physical properties. In this experiment, the toxicity of nickel nanotubes (Ni NTs) were tested in an in vitro cervical cancer model (HeLa cell line) to optimize the parameters of photodynamic therapy (PDT) for their greatest effectiveness. Ni NTs were synthesized by electrodeposition. Morphological analysis and magnetic behavior were examined using a Scanning electron microscope (SEM), an energy dispersive X-ray analysis (EDAX) and a vibrating sample magnetometer (VSM) analysis. Phototoxic and cytotoxic effects of nanomaterials were studied using the Ni NTs alone as well as in conjugation with aminolevulinic acid (5-ALA); this was performed both in the dark and under laser exposure. Toxic effects on the HeLa cell model were evaluated by a neutral red assay (NRA) and by detection of intracellular reactive oxygen species (ROS) production. Furthermore, 10–200 nM of Ni NTs was prepared in solution form and applied to HeLa cells in 96-well plates. Maximum toxicity of Ni NTs complexed with 5-ALA was observed at 100 J/cm2 and 200 nM. Up to 65–68% loss in cell viability was observed. Statistical analysis was performed on the experimental results to confirm the worth and clarity of results, with p-values = 0.003 and 0.000, respectively. Current results pave the way for a more rational strategy to overcome the problem of drug bioavailability in nanoparticulate targeted cancer therapy, which plays a dynamic role in clinical practice. PMID:26990435

  10. Radiosensitizing effect of artesunate on nude mice transplanted with HeLa cells of cervical cancer

    International Nuclear Information System (INIS)

    Zhou Yuanyuan; Feng Yang; Zhang Xuguang; Zhu Wei; Ni Qianying; Geng Chong; Chen Guanglie; Luo Judong; Fan Saijun; Cao Jianping

    2011-01-01

    Objective: To investigate the radiosensitization of artesunate on nude mouse transplanted with HeLa cells,and to explore its possible mechanisms. Methods: HeLa cells were inoculated into the nude mice to establish tumor model. Mice were randomly divided into 4 groups as blank control,artesunate group, radiation group and artesunate + radiation group when average volume of tumor were about 5 mm × 5 mm× 5 mm. During the term of treatment, the volume of tumors were measured every 2 days. After 14 days treatment, the mice were killed and tumor tissues were harvested for flow cytometry to detect the alteration of cell cycle. Meanwhile, the pathological change of the tumor tissue was observed with HE staining method, and the change of expression of cycle regulatory protein Cyclin B1, Cdc2 and Wee1 were detected by Western blot. Results: The growth of tumor was significantly inhibited by artesunate combined with radiation and its inhibition rate was 72.34%. Flow cytometry results showed that the percent of cells in G 1 phase increased and G 2 phase decreased in the artesunate + radiation group compared with those in irradiation group (t=4.41, 4.12, P<0.05). The expression level of Cyclin B1 was obviously increased while that of Wee1 decreased in the artesunate + radiation compared with irradiation group. There was no difference in the expression of Cdc2 among the four groups. Conclusions: Artesunate can dramatically increase the radiosensitivity of transplanted tumor of HeLa cells. The possible mechanism might be related to the decreasing G 2 phase by regulating the expression of Cyclin B1 and Wee1. (authors)

  11. Protolichesterinic acid enhances doxorubicin-induced apoptosis in HeLa cells in vitro.

    Science.gov (United States)

    Brisdelli, Fabrizia; Perilli, Mariagrazia; Sellitri, Doriana; Bellio, Pierangelo; Bozzi, Argante; Amicosante, Gianfranco; Nicoletti, Marcello; Piovano, Marisa; Celenza, Giuseppe

    2016-08-01

    The aim of this study was to investigate the effect of protolichesterinic acid, a lichen secondary metabolite, on anti-proliferative activity of doxorubicin in three human cancer cell lines, HeLa, SH-SY5Y and K562 cells. The data obtained from MTT assays, performed on cells treated with protolichesterinic acid and doxorubicin alone and in combination, were analysed by the median-effect method as proposed by Chou and Talalay and the Bliss independence model. Apoptosis rate was evaluated by fluorescence microscopy, caspase-3, 8 and 9 activities were detected by spectrofluorimetric analysis and protein expression of Bim, Bid, Bax and Mcl-2 was analysed by Western blotting. The interaction of protolichesterinic acid with thioesterase domain of human fatty acid synthase (hFAS) was investigated by a molecular docking study. The in vitro activity of doxorubicin against HeLa cancer cell line, but not against SH-SY5Y and K562 cells, was synergically increased by protolichesterinic acid. The increased cytotoxicity caused by protolichesterinic acid in HeLa cells was due to a pro-apoptotic effect and was associated to caspase-3, 8 and 9 activation. The simultaneous treatment for 24h with protolichesterinic acid plus doxorubicin caused an increase of Bim protein expression and the appearance of cleaved form of Bid protein. The molecular modelling analysis showed that protolichesterinic acid seemed to behave as a competitive inhibitor of hFAS. These results suggest that protolichesterinic acid could be envisaged as an useful tool against certain types of tumor cells in combination with anticancer drugs. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. A "bulged" double helix in a RNA-protein contact site

    DEFF Research Database (Denmark)

    Peattie, D A; Douthwaite, S; Garrett, R A

    1981-01-01

    as a singly bulged nucleotide extending the Fox and Woese central helix by two base pairs in the E. coli sequence (to positions 16-23/60-68) as well as in each of 61 (prokaryotic and eukaryotic) aligned 5S RNA sequences. In each case, the single bulged nucleotide is at the relative position of adenosine-66...... in the RNA sequences. The presence of this putative bulged nucleotide appears to have been conserved in 5S RNA sequences throughout evolution, and its identity varies with major phylogenetic divisions. This residue is likely involved in specific 5S RNA-protein recognition or interaction in prokaryotic...... and eukaryotic ribosomes. The uridine-65 to adenosine-66 internucleotide bond is protected from RNase A digestion in the complex, and carbethoxylation of E. coli adenosine-66 prior to L18 binding affects formation of a stable RNA-protein complex. Thus, we identify a region of E. coli 5S RNA protected...

  13. Effect of 5-fluorodeoxyuridine on DNA replication in ultraviolet-irradiated HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Brozmanova, J.; Masek, F.; Synzynys, B.I.; Saenko, A.S.

    1985-11-05

    In HeLa cells precultivated for 6 hours with 5-fluorodeoxyuridine (FUdR) and for 18 hours in FUdR-free medium, DNA synthesis was much more resistant to UV irradiation than that of untreated cells. DNA synthesized in FUdR-pretreated and UV irradiated cells represents a semiconservative DNA replication and shows more rapid shift of the pulse-labelled chased DNA to high molecular weight. This DNA synthesis is not induced by synchronization of the cell cycle. It is assumed that either the changes of chromatine structure, or an enhanced level of some enzymes might be involved in the replication of the damaged template. (author).

  14. Deficit in DNA content relative to histones in X-irradiated HeLa cells

    International Nuclear Information System (INIS)

    Bases, R.; Mendez, F.; Neubort, S.

    1976-01-01

    The DNA and histone content of HeLa S-3 cell cultures was measured by direct mass assays 21 hours after 1000 rad of X-irradiation, when the cells were arrested in G2 phase. The nuclear DNA content of such cultures was found to be deficient (73 per cent of control values). In contrast, the synthesis of nuclear histones persisted, and the total histone content was close to 100 per cent of control values. When synchronously-growing cultures were irradiated in mid-S phase and examined 3.5 hours later in G2 phase, both DNA and histone content were equal to control values. (author)

  15. Surface enhanced Raman spectroscopy analysis of HeLa cells using a multilayer substrate

    Science.gov (United States)

    Aguilar-Hernández, I. A.; Pichardo-Molina, J. L.; Lopez-Luke, T.; Ornelas-Soto, N.

    2017-08-01

    Single cell analysis can provide important information regarding cell composition, and can be used for biomedical applications. In this work, a SERS active substrate formed by 3 layers of gold nanospheres and a final layer of gold nanocubes was used for the label-free SERS analysis of HeLa cells. Nanocubes were selected due to the high electromagnetic enhancement expected in nanoparticles with sharp corners. Significant improvement in the reproducibility and quality of SERS spectra was found when compared to the spectra obtained using a nanosphere-only substrate and normal Raman spectroscopy.

  16. Chlamydia trachomatis serovar L2 induces protein tyrosine phosphorylation during uptake by HeLa cells

    DEFF Research Database (Denmark)

    Birkelund, Svend; Johnsen, H; Christiansen, Gunna

    1994-01-01

    . By use of a monoclonal antibody against phosphotyrosine, we showed that three classes of proteins are tyrosine phosphorylated: a triple band of 68, 66, and 64 kDa, a 97-kDa band, and a 140-kDa band. The phosphorylation could be detected by immunoblotting from 15 min after infection of HeLa cells. We...... inactive. Attachment of EBs to host cells is medicated by a heparan sulfate-like glycosaminoglycan. Following attachment, the EB is internalized within a membrane-bound vesicle, and during the first 8 h of infection the vesicles are transported to a perinuclear location where they aggregate and fuse...

  17. HeLa cells response to photodynamic treatment with Radachlorin at various irradiation parameters

    Science.gov (United States)

    Belashov, A. V.; Zhikhoreva, A. A.; Belyaeva, T. N.; Kornilova, E. S.; Petrov, N. V.; Salova, A. V.; Semenova, I. V.; Vasyutinskii, O. S.

    2017-07-01

    Measurements of average phase shifts introduced by living HeLa cells to probe wave front were carried out. Variations of this value were monitored in the course of morphological changes caused by photodynamic treatment at various irradiation doses. Observations of changes in living cells were also performed by means of far field optical microscopy and confocal fluorescent microscopy. Quantitative analysis of the data obtained shows that average phase shift introduced by the cells may either increase or decrease depending upon major parameters of the treatment.

  18. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  19. Relationship between RNA polymerase II and efficiency of vaccinia virus replication

    International Nuclear Information System (INIS)

    Wilton, S.; Dales, S.

    1989-01-01

    It is clear from previous studies that host transcriptase or RNA polymerase II (pol II) has a role in poxvirus replication. To elucidate the participation of this enzyme further, in this study the authors examined several parameters related to pol II during the cycle of vaccinia virus infection in L-strain fibroblasts, HeLa cells, and L 6 H 9 rat myoblasts. Nucleocytoplasmic transposition of pol II into virus factories and virions was assessed by immunofluorescence and immunoblotting by using anti-pol II immunoglobulin G. RNA polymerase activities were compared in nuclear extracts containing cured enzyme preparations. Rates of translation into cellular or viral polypeptides were ascertained by labeling with [ 35 S]methionine. In L and HeLa cells, which produced vaccinia virus more abundantly, the rate of RNA polymerase and translation in controls and following infection were higher than in myoblasts. The data on synthesis and virus formation could be correlated with observations on transmigration of pol II, which was more efficient and complete in L and HeLa cells. The stimulus for pol II to leave the nucleus required the expression of both early and late viral functions. On the basis of current and past information, the authors suggest that mobilization of pol II depends on the efficiency of vaccinia virus replication and furthermore that control over vaccinia virus production by the host is related to the content or availability (or both) of pol II in different cell types

  20. Discovery of HeLa Cell Contamination in HES Cells: Call for Cell Line Authentication in Reproductive Biology Research.

    Science.gov (United States)

    Kniss, Douglas A; Summerfield, Taryn L

    2014-08-01

    Continuous cell lines are used frequently in reproductive biology research to study problems in early pregnancy events and parturition. It has been recognized for 50 years that many mammalian cell lines contain inter- or intraspecies contaminations with other cells. However, most investigators do not routinely test their culture systems for cross-contamination. The most frequent contributor to cross-contamination of cell lines is the HeLa cell isolated from an aggressive cervical adenocarcinoma. We report on the discovery of HeLa cell contamination of the human endometrial epithelial cell line HES isolated in our laboratory. Short tandem repeat analysis of 9 unique genetic loci demonstrated molecular identity between HES and HeLa cells. In addition, we verified that WISH cells, isolated originally from human amnion epithelium, were also contaminated with HeLa cells. Inasmuch as our laboratory did not culture HeLa cells at the time of HES cell derivations, the source of contamination was the WISH cell line. These data highlight the need for continued diligence in authenticating cell lines used in reproductive biology research. © The Author(s) 2014.

  1. [Production effect comparison of SEPP and GPx between HepG2 and Hela cells with different selenocompounds].

    Science.gov (United States)

    Wang, Qin; Gao, Lina; Han, Feng; Lu, Jiaxi; Liu, Yiqun; Sun, Licui; Huang, Zhenwu

    2016-03-01

    To compare the effect of several selenocompounds on the productions of SEPP and GPx in HepG2 and Hela cells. The cultured HepG2 and Hela cells were divided into the control, Na2SeO3, SeMet and MeSeCys groups. After adding the selected selenocompounds (with the respective concentration 0.01 and 0.1 μmol/L), the experimental groups were then incubated for 48 h and 72 h. Finally, the cell culture supernatants and homogenates were collected for the SEPP and GPx concentrations detection by a double-antibody sandwich enyme-linked immuno-sorbent-assay (ELISA). The SEPP and GPx concentrations in Hela cells treated with 0.1 μmol/L SeMet and MeSeCys were significantly higher than that in the control group (P cell treated with 0.1 μmol/L selenocompounds were significantly higher than that in Hela cells (P cells are more beneficial to the production of selenoproteins than Hela cells.

  2. Changes in distribution of cell cycle phases and DNA content in HeLa S3 cell after irradiation

    International Nuclear Information System (INIS)

    Wang Shunbao

    1992-01-01

    The effects of irradiation and hyperthermia on the distribution in various phases and DNA content of HeLa S 3 cells were analyzed by flow cytometry and an image analysis instrument. A marked increase in DNA content from 6.718 to 9.614(AU) in HeLa S 3 cells after 6 Gy irradiation was seen to correspond with the changes in the distribution of various phases in G 2 + M, from 22% to 52%. Meanwhile, the surviving fraction of HeLa S 3 cells after 6 Gy irradiation was less than 1%. However, after heating at 44 deg C for 10 min, the amount of cells in G 2 + M increased from 22.5% to 52.5% and the surviving fraction after hyperthermia was less than 2.65%. The changes in distribution of various phases after Ir-192 irradiation were similar to those seen after X-ray irradiation. The delay of G 2 + M phase after treatment with 8 Gy plus heating at 44 deg C for 7 min in HeLa S 3 cells was similar to that seen in the case of treatment with 8 Gy alone. As the surviving fraction accompanying the G 2 + M delay after irradiation plus heat treatment was very low, we suggest that the changes of distribution in various phases of HeLa S 3 cells after treatment might be used as a rapid indicator of serious injury

  3. Cysteine-rich buccal gland protein suppressed the proliferation, migration and invasion of hela cells through akt pathway.

    Science.gov (United States)

    Han, Jianmei; Liu, Yu; Jiang, Qi; Xiao, Rong

    2017-11-01

    Cysteine-rich buccal gland protein (CRBGP) as a member of cysteine-rich secretory proteins (CRISPs) superfamily was isolated from the buccal glands of Lampetra japonica, the blood suckers in the marine. Previous studies showed CRBGP could suppress angiogenesis probably due to its ion channel blocking activity. Whether CRBGP could also affect the activity of tumor cells has not been reported yet. In this study, CRBGP suppressed the proliferation of Hela cells with an IC 50 of 6.7 μM by inducing apoptosis. Both microscopic observation and Western blot indicated that CRBGP was able to induce the nuclei shrinking, downregulate the protein level of BCL2 and caspase 3 as well as upregulate the level of BAX in Hela cells, suggested that CRBGP might induce apoptosis of Hela cells in a mitochondrial-dependent pathway. Furthermore, CRBGP could disturb F-actin organization, which would finally cause the Hela cells to lose their shape and to lessen their abilities on adhesion, migration and invasion. Finally, CRBGP was shown to reduce the phosphorylation level of Akt, which indicated that CRBGP might inhibit the proliferation and metastasis of Hela cells through Akt pathway. CRBGP, as a voltage-gated sodium channel blocker, also possesses the anti-tumor abilities which provided information on the effects and action manner of the other CRISPs. © 2017 IUBMB Life, 69(11):856-866, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  4. Non-thermal plasma induces mitochondria-mediated apoptotic signaling pathway via ROS generation in HeLa cells.

    Science.gov (United States)

    Li, Wei; Yu, K N; Ma, Jie; Shen, Jie; Cheng, Cheng; Zhou, Fangjian; Cai, Zhiming; Han, Wei

    2017-11-01

    Non-thermal plasma (NTP) has been proposed as a novel therapeutic method for anticancer treatment. Although increasing evidence suggests that NTP selectively induces apoptosis in some types of tumor cells, the molecular mechanisms underlying this phenomenon remain unclear. In this study, we further investigated possible molecular mechanisms for NTP-induced apoptosis of HeLa cells. The results showed that NTP exposure significantly inhibited the growth and viability of HeLa cells. Morphological observation and flow cytometry analysis demonstrated that NTP exposure induced HeLa cell apoptosis. NTP exposure also activated caspase-9 and caspase-3, which subsequently cleaved poly (ADP- ribose) polymerase. Furthermore, NTP exposure suppressed Bcl-2 expression, enhanced Bax expression and translocation to mitochondria, activated mitochondria-mediated apoptotic pathway, followed by the release of cytochrome c. Further studies showed that NTP treatment led to ROS generation, whereas blockade of ROS generation by N-acetyl-l-cysteine (NAC, ROS scavengers) significantly prevented NTP-induced mitochondrial alteration and subsequent apoptosis of HeLa cells via suppressing Bax translocation, cytochrome c and caspase-3 activation. Taken together, our results indicated that NTP exposure induced mitochondria-mediated intrinsic apoptosis of HeLa cells was activated by ROS generation. These findings provide insights to the therapeutic potential and clinical research of NTP as a novel tool in cervical cancer treatment. Copyright © 2017. Published by Elsevier Inc.

  5. Suppressive effect on HeLa cells proliferation by phenothiazine derivatives alone and combining with ionizing radiation

    International Nuclear Information System (INIS)

    Yan Yuqian; Wang Lin; Sui Jianli; Bai Bei; Zhou Pingkun; Yan Yuqiu; Sun Weijian

    2006-01-01

    Objective: To examine the antiproliferative effects of phenothiazine derivatives (PTZDs) alone on HeLa cells and in combination with ionizing radiation. Methods: MTT and colony-forming method were used to evaluate the proliferation activity and cellular radiosensitivity of HeLa cells. Results: We compared the antiproliferative effects of six phenothiazine derivatives, and found that the derivatives α-chloro-N-dimethylamine phenothiazine (PTZD2), α-triflumethyl-N-α(dimethylamine ethyl) phenothiazine (PTZD3) and α-chloro-N-(dimethylamine ethyl) phenothiazine (PTZD5) showed a significant antiproliferative effect at concentration of 10 μmol/L. HeLa cells proliferation was completely suppressed when treated with PTZDs of 40-50 μmol/L. PTZD2/PTZD3 and cobalt-60 gamma-irradiation showed synergistic suppressive effect on proliferation of HeLa cells. The enhancement ratios of 10 μmol/L PTZD3 combination with 2 Gy and 4 Gy irradiations were 3.5 and 1.8, respectively. The maximum synergistic suppressive effect was observed when cells administered with PTZD3 at 18 h before being irradiated. Conclusion: Phenothiazine derivatives show antiproliferations on HeLa cells, and differ in degrees. The synergistic anticancer effect could be obtained by combining phenothiazine derivatives with radiotherapy. (authors)

  6. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study.

    Science.gov (United States)

    Hanf, Matthieu; Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-11-08

    To assess at country level the association of mortality in under 5s with a large set of determinants. Longitudinal study. 193 United Nations member countries, 2000-09. Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. National rate of deaths in under 5s per 1000 live births The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015.

  7. Ba 5s photoionization in the region of the second Cooper minimum

    International Nuclear Information System (INIS)

    Whitfield, S B; Wehlitz, R; Dolmatov, V K

    2011-01-01

    We investigate the 5s angular distribution parameter and partial photoionization cross section of atomic Ba in the region of the second Cooper minimum covering a photon energy region from 120 to 260 eV. We observe a strong drop in the Ba 5s β value from 2.0, reaching a minimum of 1.57 ± 0.07 at a photon energy of 150 eV. The β value then slowly rises back towards its nominal value of 2.0 at photon energies beyond the minimum. Our measured 5s partial cross section also shows a pronounced dip around 170 eV due to interchannel coupling with the Ba 4d photoelectrons. After combining our measurements with previous experimental values at lower photon energies, we obtain a consistent data set spanning the photon energy range prior to the onset of the partial cross section maximum and through the cross section minimum. We also calculate the 5s partial cross section under several different levels of approximation. We find that the generalized random-phase approximation with exchange calculation models the shape and position of the combined experimental cross section data set rather well after incorporating experimental ionization energies and a shift in the photon energy scale.

  8. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  9. Dramatic nondipole effects in low-energy photoionization: Experimental and theoretical study of Xe 5s

    International Nuclear Information System (INIS)

    Hemmers, O.; Lindle, D.W.; Baker, J.; Hudson, A.; Lotrakul, M.; Tran, I.C.; Guillemin, R.; Stolte, W.C.; Wolska, A.; Yu, S.W.; Kanter, E.P.; Kraessig, B.; Southworth, S.H.; Wehlitz, R.; Rolles, D.; Amusia, M.Ya.; Cheng, K.T.; Chernysheva, L.V.; Johnson, W.R.; Manson, S.T.

    2003-01-01

    The Xe 5s nondipole photoelectron parameter γ is obtained experimentally and theoretically from threshold to ∼200 eV photon energy. Significant nondipole effects are seen even in the threshold region of this valence shell photoionization. In addition, contrary to previous understanding, clear evidence of interchannel coupling among quadrupole photoionization channels is found

  10. Extraforaminal Lumbar Interbody Fusion at the L5-S1 Level: Technical Considerations and Feasibility.

    Science.gov (United States)

    Kurzbuch, Arthur Robert; Kaech, Denis; Baranowski, Pawel; Baranowska, Alicja; Recoules-Arche, Didier

    2017-09-01

    Background  Extraforaminal lumbar interbody fusion (ELIF) surgery is a muscle-sparing approach that allows the treatment of various degenerative spinal diseases. It is technical challenging to perform the ELIF approach at the L5-S1 level because the sacral ala obstructs the view of the intervertebral disk space. Methods  We reported earlier on the ELIF technique in which the intervertebral disk is targeted at an angle of 45 degrees relative to the midline. In this article we describe the technical process we developed to overcome the anatomic relation between the sacral ala and the intervertebral disk space L5-S1 that hinders the ELIF approach at this level. We then report in a retrospective analysis on the short-term clinical and radiologic outcome of 100 consecutive patients with degenerative L5-S1 pathologies who underwent ELIF surgery. Results  The L5-S1 ELIF approach could be realized in all patients. The short-term clinical outcome was evaluated 5 months after surgery: 92% of the patients were satisfied with their postoperative result; 8% had a poor result. Overall, 17% of the patients presented light radicular or low back pain not influencing their daily activity, and 82% of the patients working before surgery returned to work 3 to 7 months after surgery. The radiologic outcome was documented by computed tomography at 5 months after surgery and showed fusion in 99% of the patients. Lumbar magnetic resonance imaging performed in 5 patients at 6 months after surgery revealed the integrity of the paraspinal muscles. Conclusions  ELIF surgery at the L5-S1 level is technically feasible for various degenerative spinal diseases. Analysis of the clinical and radiologic data in a consecutive retrospective cohort of patients who underwent this surgical procedure showed a good short-term clinical outcome and fusion rate. Georg Thieme Verlag KG Stuttgart · New York.

  11. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  12. Molecular Beacon-Based MicroRNA Imaging During Neurogenesis.

    Science.gov (United States)

    Lee, Jonghwan; Kim, Soonhag

    2016-01-01

    The fluorescence monitoring system for examining endogenous microRNA (miRNA) activity in cellular level provides crucial information on not only understanding a critical role of miRNA involving a variety of biological processes, but also evaluating miRNA expression patterns in a noninvasive manner. In this protocol, we report the details of a new procedure for a molecular beacon-based miRNA monitoring system, which includes the illustration scheme for miRNA detection strategy, exogenous miRNA detection, and measurement of endogenous miRNA expression level during neurogenesis. The fluorescence signal of miR-124a beacon quenched by BHQ2 was gradually recovered as increasing concentration of the miR-124a in tube. The functional work of miR-124a beacon was examined in intracellular environment, allowing for the internalization of the miR-124a beacon by lipofectamine, which resulted in activated fluorescent signals of the miR-124a beacon in the HeLa cells after the addition of synthetic miR-124a. The endogenous miR-124a expression level was detected by miR-124a beacon system during neurogenesis, showing brighter fluorescence intensity in cytoplasmic area of P19 cells after induction of neuronal differentiation by retinoic acid. The molecular beacon based-miRNA detection technique could be applicable to the simultaneous visualization of a variety of miRNA expression patterns using different fluorescence dyes. For the study of examining endogenous miRNA expression level using miRNA-beacon system, if cellular differentiation step is already prepared, transfection step of miR-124a beacon into P19 cells, and acquisition of activated fluorescence signal measured by confocal microscope can be conducted approximately within 6 h.

  13. Electroporation of micro-droplet encapsulated HeLa cells in oil phase

    KAUST Repository

    Xiao, Kang

    2010-08-27

    Electroporation (EP) is a method widely used to introduce foreign genes, drugs or dyes into cells by permeabilizing the plasma membrane with an external electric field. A variety of microfluidic EP devices have been reported so far. However, further integration of prior and posterior EP processes turns out to be very complicated, mainly due to the difficulty of developing an efficient method for precise manipulation of cells in microfluidics. In this study, by means of a T-junction structure within a delicate microfluidic device, we encapsulated HeLa cells in micro-droplet of poration medium in oil phase before EP, which has two advantages: (i) precise control of cell-encapsulating droplets in oil phase is much easier than the control of cell populations or individuals in aqueous buffers; (ii) this can minimize the electrochemical reactions on the electrodes. Finally, we successfully introduced fluorescent dyes into the micro-droplet encapsulated HeLa cells in oil phase. Our results reflected a novel way to realize the integrated biomicrofluidic system for EP. © 2010 Wiley-VCH Verlag GmbH & Co. KGaA.

  14. Evaluation of Radiosensitivity of HeLa Cells Infected with Polio Virus Irradiated by Co 60

    Directory of Open Access Journals (Sweden)

    F Seif

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: The main purpose of radiotherapy is exposing enough doses of radiation to tumor tissue and protecting the normal tissues around it. Tumor dose for each session in radiotherapy will be considered based on radiosensitivity of the tissues. The presence of viral diseases in tumoral area can affect the radiosensitivity of cells. This study aimed to evaluate the radiosensitivity of Hela cells infected with poliomyelitis virus irradiated by Co 60. Materials & Methods: In this study, the radiosensitivity of HeLa cells, with or without the viral infection, after gamma radiation of cobalt 60, was assessed. Results: Results of comparison of the radisensitivity of infected and uninfected cells indicates that after 2 Gy irradiation by Co 60, polio infection in low, moderate and high virus load, increases the cell death by 20-30%, 30-40% and 70-90% respectively. Conclusion : Radiosensitivity of tumoral cells increase when they are infected with viral agents. Results of this study showed that non cancer diseases should be considered when prescribing dose fraction in radiotherapy of cancers.

  15. The effect of caffeine on x-ray repair of radioresistant HeLa cells

    International Nuclear Information System (INIS)

    Kubo, Kihei; Koiwai, Soichiro; Morita, Kazuo

    1985-01-01

    The contribution of caffeine-modifiable repair process to the radiosensitivity of a radioresistant HeLa strain (RC-355) has been investigated in comparison with control HeLa strain (CC-24). Both the final slope and the shoulder of X-ray survival curve for log-phase cells were affected by caffeine posttreatment. When the treatment with 10 mM caffeine delayed, an increase in survival was observed with increasing interval between irradiation and the treatment. During first several hours of the repair interval, the steepness of the final slope of survival curve decreased rapidly, and rate of the decrease was found to be higher in RC-355 than in CC-24 cells. Longer time (24 hours or more) before the initiation of caffeine treatment was required for the complete recovery of the shoulder. When the cells were incubated in plateau-phase after irradiation, an appreciable increase in survival was observed in comparison with when plated immediately following X-ray. The increase was found to be greater for RC-355 than for CC-24. The results suggest that the radioresistant RC-355 cells repaired more X-ray-induced PLD than CC-24 cells did. (author)

  16. Degradation of structurally characterized proteins injected into HeLa cells. Basic measurements

    International Nuclear Information System (INIS)

    Rogers, S.W.; Rechsteiner, M.

    1988-01-01

    Thirty-five proteins of known x-ray structure were labeled by chloramine-T radioiodination or by reaction with 125I-Bolton-Hunter reagent and introduced into HeLa cells using red cell-mediated microinjection. Degradation rates of the injected proteins were then determined over the next 50 h by measuring the release of soluble isotope to the culture medium. Control experiments demonstrated that the measured rates were not compromised by proteolysis within RBCs, the presence of unfused RBCs, or degradation of protein released from RBCs to the medium. Degradation of some injected proteins was faster during the first 12 h after fusion than at later times, apparently a response of HeLa cells to trypsinization. However, all proteins exhibited first-order degradation rates between 24 and 48 h post injection. Except for seven proteins, stabilities measured during this interval were unaffected by the labeling procedure. Reductive methylation was used to choose among the seven discordant values, and half-lives for the 35 proteins ranged from 16 h for lysozyme to 214 h for yeast alcohol dehydrogenase. Since half-lives for six of the injected proteins closely match values obtained by in vivo measurements, we consider our estimates of the metabolic stabilities of the injected proteins to be generally accurate. Therefore, the half-lives obtained by microinjection should prove useful in the search for relationships between protein structure and intracellular stability

  17. The Response of HeLa Cells to Fluorescent NanoDiamond Uptake

    Directory of Open Access Journals (Sweden)

    Simon R. Hemelaar

    2018-01-01

    Full Text Available Fluorescent nanodiamonds are promising probes for nanoscale magnetic resonance measurements. Their physical properties predict them to have particularly useful applications in intracellular analysis. Before using them in intracellular experiments however, it should be clear whether diamond particles influence cell biology. While cytotoxicity has already been ruled out in previous studies, we consider the non-fatal influence of fluorescent nanodiamonds on the formation of reactive oxygen species (an important stress indicator and potential target for intracellular sensing for the first time. We investigated the influence of different sizes, shapes and concentrations of nanodiamonds on the genetic and protein level involved in oxidative stress-related pathways of the HeLa cell, an important model cell line in research. The changes in viability of the cells and the difference in intracellular levels of free radicals, after diamond uptake, are surprisingly small. At lower diamond concentrations, the cellular metabolism cannot be distinguished from that of untreated cells. This research supports the claims of non-toxicity and includes less obvious non-fatal responses. Finally, we give a handhold concerning the diamond concentration and size to use for non-toxic, intracellular measurements in favour of (cancer research in HeLa cells.

  18. Enhanced incorporation of radioactive inorganic phosphate into phospholipids of HeLa cells by tumor promoters

    International Nuclear Information System (INIS)

    Nishino, H.; Fujiki, H.; Terada, M.; Sato, S.

    1983-01-01

    Teleocidin, a new tumor promoter, increased incorporation of radioactive inorganic phosphate ( 32 P/sub i/) into phospholipids in HeLa cells. This effect was detected within 1 h on incubation of the cells in medium containing teleocidin. The half-maximum effective dose of teleocidin was approximately 10 ng/ml. The main effect of teleocidin was on the incorporation of 32 P/sub i/ into the phosphatidylcholine fraction, with a lesser effect on 32 P/sub i/ incorporation into other phospholipid fractions. Increased incorporation of 32 P/sub i/ into phospholipids was also observed on incubation of the cells with 12-O-tetradecanoylphorbol-13-acetate (TPA), dihydroteleocidin B, or lyngbyatoxin A, which are all complete tumor promoters, and also with mezerein, which is an incomplete and second stage promoter. On the other hand, at concentrations of up to 1 microgram/ml, 4-O-methyl TPA and C/sub a/ 2 + ionophore A23187, which are incomplete and first stage promoters, and phorbol, which has no promoting activity in skin carcinogenesis, did not cause any increased incorporation of 32 P/sub i/ into phospholipid fractions of HeLa cells

  19. Action of caffeine on x-irradiated HeLa cells. II. Synergistic lethality

    International Nuclear Information System (INIS)

    Busse, P.M.; Bose, S.K.; Jones, R.W.; Tolmach, L.J.

    1977-01-01

    Postirradiation treatment of HeLa S3 cells with 1 mM caffeine results in a marked diminution of the surviving fraction as scored by colony formation. The decrease is dose dependent; the effect of a 24-hour postirradiation treatment of a nonsynchronous population with caffeine is to change the terminal slope of the survival curve and its intercept. D 0 is reduced from 130 to 60 rad; the extrapolation number is increased about twofold. The amount of postirradiation killing is maximal if cells are exposed to caffeine at a concentration of at least 1 mM for 8 hours; less than 10% of unirradiated cells are killed under these conditions. Dose-response curves were also obtained for synchronous cells at various phases of the cell cycle. Similar results were obtained at all cell ages, but the magnitude of the effect is age dependent. This age dependence was further explored in experiments in which mitotically collected cells were exposed to 300 or 500 rad doses at 2-hour intervals throughout the cell cycle. Treatment with caffeine for 24 hours after irradiation enchances the killing of cells late in the cycle more than cells in G1. The sensitivities of two other cell lines, CHO and EMT6, also were examined; both are substantially less sensitive to caffeine. The smaller cell-cycle dependence of CHO cells is qualitatively the same as that of HeLa cells

  20. Electroporation of micro-droplet encapsulated HeLa cells in oil phase

    KAUST Repository

    Xiao, Kang; Zhang, Mengying; Chen, Shuyu; Wang, Limu; Chang, Donald Choy; Wen, Weijia

    2010-01-01

    Electroporation (EP) is a method widely used to introduce foreign genes, drugs or dyes into cells by permeabilizing the plasma membrane with an external electric field. A variety of microfluidic EP devices have been reported so far. However, further integration of prior and posterior EP processes turns out to be very complicated, mainly due to the difficulty of developing an efficient method for precise manipulation of cells in microfluidics. In this study, by means of a T-junction structure within a delicate microfluidic device, we encapsulated HeLa cells in micro-droplet of poration medium in oil phase before EP, which has two advantages: (i) precise control of cell-encapsulating droplets in oil phase is much easier than the control of cell populations or individuals in aqueous buffers; (ii) this can minimize the electrochemical reactions on the electrodes. Finally, we successfully introduced fluorescent dyes into the micro-droplet encapsulated HeLa cells in oil phase. Our results reflected a novel way to realize the integrated biomicrofluidic system for EP. © 2010 Wiley-VCH Verlag GmbH & Co. KGaA.

  1. Exposure to TiO2 nanoparticles increases Staphylococcusaureusinfection of HeLa cells

    Science.gov (United States)

    Xu, Yan; Wei, Ming-Tzo; Walker, Stephen. G.; Wang, Hong Zhan; Gondon, Chris; Brink, Peter; Guterman, Shoshana; Zawacki, Emma; Applebaum, Eliana; Rafailovich, Miriam; Ou-Yang, H. Daniel; Mironava, Tatsiana

    TiO2 is one of the most common nanoparticles in industry from food additives to energy generation. Even though TiO2 is also used as an anti-bacterial agent in combination with UV, we found that, in the absence of UV, exposure of HeLa cells to TiO2 nanoparticles largely increased their risk of bacterial invasion. HeLa cells cultured with low dosage rutile and anatase TiO2 nanoparticles (0.1 mg/ml) for 24 hrs prior to exposure to bacteria had 350% and 250% respectively more bacteria infected per cell. The increase was attributed to increased LDH leakage, and changes in the mechanical response of the cell membrane. On the other hand, macrophages exposed to TiO2 particles ingested 40% fewer bacteria, further increasing the risk of infection. In combination, these two factors raise serious concerns regarding the impact of exposure to TiO2 nanoparticles on the ability of organisms to resist bacterial infection.

  2. Biological response of HeLa cells to gold nanoparticles coated with organic molecules.

    Science.gov (United States)

    Cardoso Avila, P E; Rangel Mendoza, A; Pichardo Molina, J L; Flores Villavicencio, L L; Castruita Dominguez, J P; Chilakapati, M K; Sabanero Lopez, M

    2017-08-01

    In this work, gold nanospheres functionalized with low weight organic molecules (4-aminothiphenol and cysteamine) were synthesized in a one-step method for their in vitro cytotoxic evaluation on HeLa cells. To enhance the biocompatibility of the cysteamine-capped GNPs, BSA was used due to its broad PH stability and high binding affinity to gold nanoparticles. Besides, the widely reported silica coated gold nanorods were tested here to contrast their toxic response against our nanoparticles coated with organic molecules. Our results shown, the viability measured at 1.9×10 -5 M did not show significant differences against negative controls for all the samples; however, the metabolic activity of HeLa cells dropped when they were exposed to silica gold nanorods in the range of concentrations from 2.9×10 -7 M to 3.0×10 -4 M, while in the cases of gold nanospheres, we found that only at concentrations below 1.9×10 -5 M metabolic activity was normal. Our preliminary results did not indicate any perceivable harmful toxicity to cell membrane, cytoskeleton or nucleus due to our nanospheres at 1.9×10 -5 M. Additional test should be conducted in order to ensure a safe use of them for biological applications, and to determine the extent of possible damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. The Response of HeLa Cells to Fluorescent NanoDiamond Uptake.

    Science.gov (United States)

    Hemelaar, Simon R; Saspaanithy, Babujhi; L'Hommelet, Severin R M; Perona Martinez, Felipe P; van der Laan, Kiran J; Schirhagl, Romana

    2018-01-26

    Fluorescent nanodiamonds are promising probes for nanoscale magnetic resonance measurements. Their physical properties predict them to have particularly useful applications in intracellular analysis. Before using them in intracellular experiments however, it should be clear whether diamond particles influence cell biology. While cytotoxicity has already been ruled out in previous studies, we consider the non-fatal influence of fluorescent nanodiamonds on the formation of reactive oxygen species (an important stress indicator and potential target for intracellular sensing) for the first time. We investigated the influence of different sizes, shapes and concentrations of nanodiamonds on the genetic and protein level involved in oxidative stress-related pathways of the HeLa cell, an important model cell line in research. The changes in viability of the cells and the difference in intracellular levels of free radicals, after diamond uptake, are surprisingly small. At lower diamond concentrations, the cellular metabolism cannot be distinguished from that of untreated cells. This research supports the claims of non-toxicity and includes less obvious non-fatal responses. Finally, we give a handhold concerning the diamond concentration and size to use for non-toxic, intracellular measurements in favour of (cancer) research in HeLa cells.

  4. Analysis of differentially expressed proteins in Yersinia enterocolitica-infected HeLa cells.

    Science.gov (United States)

    Alugubelly, Navatha; Hercik, Kamil; Kibler, Peter; Nanduri, Bindu; Edelmann, Mariola J

    2016-05-01

    Yersinia enterocolitica is a facultative intracellular pathogen and a causative agent of yersiniosis, which can be contracted by ingestion of contaminated food. Yersinia secretes virulence factors to subvert critical pathways in the host cell. In this study we utilized shotgun label-free proteomics to study differential protein expression in epithelial cells infected with Y.enterocolitica. We identified a total of 551 proteins, amongst which 42 were downregulated (including Prostaglandin E Synthase 3, POH-1 and Karyopherin alpha) and 22 were upregulated (including Rab1 and RhoA) in infected cells. We validated some of these results by western blot analysis of proteins extracted from Caco-2 and HeLa cells. The proteomic dataset was used to identify host canonical pathways and molecular functions modulated by this infection in the host cells. This study constitutes a proteome of Yersinia-infected cells and can support new discoveries in the area of host-pathogen interactions. We describe a proteome of Yersinia enterocolitica-infected HeLa cells, including a description of specific proteins differentially expressed upon infection, molecular functions as well as pathways altered during infection. This proteomic study can lead to a better understanding of Y. enterocolitica pathogenesis in human epithelial cells. Copyright © 2016. Published by Elsevier B.V.

  5. Proteomic analysis of effects by x-rays and heavy ion in HeLa cells.

    Science.gov (United States)

    Bing, Zhitong; Yang, Guanghui; Zhang, Yanan; Wang, Fengling; Ye, Caiyong; Sun, Jintu; Zhou, Guangming; Yang, Lei

    2014-06-01

    Carbon ion therapy may be better against cancer than the effects of a photon beam. To investigate a biological advantage of carbon ion beam over X-rays, the radioresistant cell line HeLa cells were used. Radiation-induced changes in the biological processes were investigated post-irradiation at 1 h by a clinically relevant radiation dose (2 Gy X-ray and 2 Gy carbon beam). The differential expression proteins were collected for analysing biological effects. The radioresistant cell line Hela cells were used. In our study, the stable isotope labelling with amino acids (SILAC) method coupled with 2D-LC-LTQ Orbitrap mass spectrometry was applied to identity and quantify the differentially expressed proteins after irradiation. The Western blotting experiment was used to validate the data. A total of 123 and 155 significantly changed proteins were evaluated with treatment of 2 Gy carbon and X-rays after radiation 1 h, respectively. These deregulated proteins were found to be mainly involved in several kinds of metabolism processes through Gene Ontology (GO) enrichment analysis. The two groups perform different response to different types of irradiation. The radioresistance of the cancer cells treated with 2 Gy X-rays irradiation may be largely due to glycolysis enhancement, while the greater killing effect of 2 Gy carbon may be due to unchanged glycolysis and decreased amino acid metabolism.

  6. Proteomic analysis of effects by x-rays and heavy ion in HeLa cells

    International Nuclear Information System (INIS)

    Bing, Zhitong; Yang, Guanghui; Zhang, Yanan; Wang, Fengling; Ye, Caiyong; Sun, Jintu; Zhou, Guangming; Yang, Lei

    2014-01-01

    Carbon ion therapy may be better against cancer than the effects of a photon beam. To investigate a biological advantage of carbon ion beam over X-rays, the radioresistant cell line HeLa cells were used. Radiation-induced changes in the biological processes were investigated post-irradiation at 1 h by a clinically relevant radiation dose (2 Gy X-ray and 2 Gy carbon beam). The differential expression proteins were collected for analysing biological effects. The radioresistant cell line Hela cells were used. In our study, the stable isotope labelling with amino acids (SILAC) method coupled with 2D-LC-LTQ Orbitrap mass spectrometry was applied to identity and quantify the differentially expressed proteins after irradiation. The Western blotting experiment was used to validate the data. A total of 123 and 155 significantly changed proteins were evaluated with treatment of 2 Gy carbon and X-rays after radiation 1 h, respectively. These deregulated proteins were found to be mainly involved in several kinds of metabolism processes through Gene Ontology (GO) enrichment analysis. The two groups perform different response to different types of irradiation. The radioresistance of the cancer cells treated with 2 Gy X-rays irradiation may be largely due to glycolysis enhancement, while the greater killing effect of 2 Gy carbon may be due to unchanged glycolysis and decreased amino acid metabolism

  7. Primordial oscillations in life: Direct observation of glycolytic oscillations in individual HeLa cervical cancer cells

    Science.gov (United States)

    Amemiya, Takashi; Shibata, Kenichi; Itoh, Yoshihiro; Itoh, Kiminori; Watanabe, Masatoshi; Yamaguchi, Tomohiko

    2017-10-01

    We report the first direct observation of glycolytic oscillations in HeLa cervical cancer cells, which we regard as primordial oscillations preserved in living cells. HeLa cells starved of glucose or both glucose and serum exhibited glycolytic oscillations in nicotinamide adenine dinucleotide (NADH), exhibiting asynchronous intercellular behaviors. Also found were spatially homogeneous and inhomogeneous intracellular NADH oscillations in the individual cells. Our results demonstrate that starved HeLa cells may be induced to exhibit glycolytic oscillations by either high-uptake of glucose or the enhancement of a glycolytic pathway (Crabtree effect or the Warburg effect), or both. Their asynchronous collective behaviors in the oscillations were probably due to a weak intercellular coupling. Elucidation of the relationship between the mechanism of glycolytic dynamics in cancer cells and their pathophysiological characteristics remains a challenge in future.

  8. Primary and secondary structure of U8 small nuclear RNA

    International Nuclear Information System (INIS)

    Reddy, R.; Henning, D.; Busch, H.

    1985-01-01

    U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus. In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively

  9. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  10. Hesperidin inhibits HeLa cell proliferation through apoptosis mediated by endoplasmic reticulum stress pathways and cell cycle arrest

    International Nuclear Information System (INIS)

    Wang, Yaoxian; Yu, Hui; Zhang, Jin; Gao, Jing; Ge, Xin; Lou, Ge

    2015-01-01

    Hesperidin (30, 5, 9-dihydroxy-40-methoxy-7-orutinosyl flavanone) is a flavanone that is found mainly in citrus fruits and has been shown to have some anti-neoplastic effects. The aim of the present study was to investigate the effect of hesperidin on apoptosis in human cervical cancer HeLa cells and to identify the mechanism involved. Cells were treated with hesperidin (0, 20, 40, 60, 80, and 100 μM) for 24, 48, or 72 h and relative cell viability was assessed using the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. Hesperidin inhibited the proliferation of HeLa cells in a concentration- and time-dependent manner. Hesperidin-induced apoptosis in HeLa cells was characterized by increased nuclear condensation and DNA fragmentation. Furthermore, increased levels of GADD153/CHOP and GRP78 indicated hesperidin-induced apoptosis in HeLa cells involved a caspase-dependent pathway, presumably downstream of the endoplasmic reticulum stress pathway. Both of these proteins are hallmarks of endoplasmic reticulum stress. Hesperidin also promoted the formation of reactive oxygen species, mobilization of intracellular Ca 2+ , loss of mitochondrial membrane potential (ΔΨm), increased release of cytochrome c and apoptosis-inducing factor from mitochondria, and promoted capase-3 activation. It also arrested HeLa cells in the G0/G1 phase in the cell cycle by downregulating the expression of cyclinD1, cyclinE1, and cyclin-dependent kinase 2 at the protein level. The effect of hesperidin was also verified on the human colon cancer cell HT-29 cells. We concluded that hesperidin inhibited HeLa cell proliferation through apoptosis involving endoplasmic reticulum stress pathways and cell cycle arrest

  11. γ-Tocotrienol Inhibits Proliferation and Induces Apoptosis via the Mitochondrial Pathway in Human Cervical Cancer HeLa Cells

    Directory of Open Access Journals (Sweden)

    Weili Xu

    2017-08-01

    Full Text Available γ-Tocotrienol, a kind of isoprenoid phytochemical, has antitumor activity. However, there is limited evidence that it has an effect on cervical cancer. In this study, the capacity to inhibit proliferation and induce apoptosis in human cervical cancer HeLa cells and the mechanism underlying these effects were examined. The results indicated that a γ-tocotrienol concentration over 30 μM inhibited the growth of HeLa cells with a 50% inhibitory concentration (IC50 of 46.90 ± 3.50 μM at 24 h, and significantly down-regulated the expression of proliferative cell nuclear antigen (PCNA and Ki-67. DNA flow cytometric analysis indicated that γ-tocotrienol arrested the cell cycle at G0/G1 phase and reduced the S phase in HeLa cells. γ-tocotrienol induced apoptosis of HeLa cells in a time- and dose-dependent manner. γ-tocotrienol-induced apoptosis in HeLa cells was accompanied by down-regulation of Bcl-2, up-regulation of Bax, release of cytochrome from mitochondria, activation of caspase-9 and caspase-3, and subsequent poly (ADP-ribose polymerase (PARP cleavage. These results suggested that γ-tocotrienol could significantly inhibit cell proliferation through G0/G1 cell cycle arrest, and induce apoptosis via the mitochondrial apoptotic pathway in human cervical cancer HeLa cells. Thus, our findings revealed that γ-tocotrienol may be considered as a potential agent for cervical cancer therapy.

  12. Nicotinamide induces mitochondrial-mediated apoptosis through oxidative stress in human cervical cancer HeLa cells.

    Science.gov (United States)

    Feng, Yi; Wang, Yonghua; Jiang, Chengrui; Fang, Zishui; Zhang, Zhiqiang; Lin, Xiaoying; Sun, Liwei; Jiang, Weiying

    2017-07-15

    Nicotinamide participates in energy metabolism and influences cellular redox status and modulates multiple pathways related with both cellular survival and death. Recent studies have shown that it induced proliferation inhibition and apoptosis in many cancer cells. However, little is known about the effects of nicotinamide on human cervical cancer cells. We aimed to evaluate the effects of the indicated concentrations nicotinamide on cell proliferation, apoptosis and redox-related parameters in HeLa cells and investigated the apoptotic mechanism. After the treatment of the indicated concentrations nicotinamide, HeLa cell proliferation was evaluated by the CCK-8 assay and the production of ROS (reactive oxygen species) was measured using 2',7'-Dichlorofluorescin diacetate. The apoptotic effect was confirmed by observing the cellular and nuclear morphologies with fluorescence microscope and apoptotic rate of HeLa cell apoptosis was measured by flow cytometry using Annexin-V method. Moreover, we examined the mitochondrial membrane potential by JC-1 method and measured the expression of apoptosis related genes using qRT-PCR and immunoblotting. Nicotinamide restrained the HeLa cell proliferation and significantly increased the accumulation of ROS and depletion of GSH at relatively high concentrations. Furthermore, nicotinamide promoted HeLa cell apoptosis via the intrinsic mitochondrial apoptotic pathway. Our study revealed that nicotinamide induced the apoptosis through oxidative stress and intrinsic mitochondrial apoptotic pathways in HeLa cell. The results emerge that nicotinamide may be an inexpensive, safe and promising therapeutic agent or a neoadjuvant chemotherapy for cervical cancer patients, as well useful to find new drugs for cervical cancer therapy. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. γ-Tocotrienol Inhibits Proliferation and Induces Apoptosis Via the Mitochondrial Pathway in Human Cervical Cancer HeLa Cells.

    Science.gov (United States)

    Xu, Weili; Mi, Yaqing; He, Pan; He, Shenghua; Niu, Lingling

    2017-08-04

    γ-Tocotrienol, a kind of isoprenoid phytochemical, has antitumor activity. However, there is limited evidence that it has an effect on cervical cancer. In this study, the capacity to inhibit proliferation and induce apoptosis in human cervical cancer HeLa cells and the mechanism underlying these effects were examined. The results indicated that a γ-tocotrienol concentration over 30 μM inhibited the growth of HeLa cells with a 50% inhibitory concentration (IC 50 ) of 46.90 ± 3.50 μM at 24 h, and significantly down-regulated the expression of proliferative cell nuclear antigen (PCNA) and Ki-67. DNA flow cytometric analysis indicated that γ-tocotrienol arrested the cell cycle at G0/G1 phase and reduced the S phase in HeLa cells. γ-tocotrienol induced apoptosis of HeLa cells in a time- and dose-dependent manner. γ-tocotrienol-induced apoptosis in HeLa cells was accompanied by down-regulation of Bcl-2, up-regulation of Bax, release of cytochrome from mitochondria, activation of caspase-9 and caspase-3, and subsequent poly (ADP-ribose) polymerase (PARP) cleavage. These results suggested that γ-tocotrienol could significantly inhibit cell proliferation through G0/G1 cell cycle arrest, and induce apoptosis via the mitochondrial apoptotic pathway in human cervical cancer HeLa cells. Thus, our findings revealed that γ-tocotrienol may be considered as a potential agent for cervical cancer therapy.

  14. Treatment of HeLa cells with Giloe (Tinospora cordifolia meirs) increases the radiosensitivity by increasing DNA damage

    International Nuclear Information System (INIS)

    Varma, Hari Krishna; Jagetia, Ganesh Chandra; Nayak, Vijayashree

    2014-01-01

    Radiotherapy is an important treatment modality and screening of phytoceuticals may enhance the clinical outcome of radiotherapy, therefore radiosensitizing activity of various guduchi (Tinospora cordifolia) extracts was studied in HeLa cells. Chromosomal aberrations were scored in HeLa cells treated with 10 μg/ml of aqueous, methanol, or methylene chloride guduchi extracts or doxorubicin before exposure to 0, 0.5, 1, 2 or 3 Gy of γ-radiation at 12, 24, 36 or 48 h post-irradiation. Irradiation of HeLa cells caused a dose dependent rise in the chromatid breaks, chromosome breaks, dicentric, centric rings, acentric fragments and total aberrations at all post-irradiation times and the dose response was linear quadratic for all types of aberrations scored. Chromatid breaks increased up to 12 h post-irradiation and declined steadily up to 48 h post-irradiation, whereas chromosome breaks, dicentric, acentric fragments and total aberrations elevated up to 24 h post-irradiation and declined thereafter. However, centric rings continued to rise steadily up to 48 h post-irradiation. Treatment of HeLa cells with aqueous, methanol or methylene chloride guduchi extract or doxorubicin before irradiation significantly enhanced various types of chromosomal aberrations and a maximum rise in the chromosome aberrations was observed in the HeLa cells treated with methylene chloride extract before irradiation when compared to other groups. Various guduchi extracts enhanced the effect of radiation in HeLa cells by increasing the molecular damage to cellular genome and their effect was similar to or even greater than doxorubicin (positive control) pretreatment, depending on the type of guduchi extract used. (author)

  15. Radiation-induced thymine base damage and its excision repair in active and inactive chromatin of HeLa cells

    International Nuclear Information System (INIS)

    Patil, M.S.; Locher, S.E.; Hariharan, P.V.

    1985-01-01

    The extent of production and excision repair of 5,6-dihydroxydihydrothymine type base (t') damage was determined in transcriptionally active and inactive chromatin of HeLa cells after exposure to 6.8 MeV electrons. It was observed that not only the yield but also rate of repair of t' products was greater in the active chromatin compared to the inactive chromatin of HeLa cells. The results strongly indicate that the conformation of chromatin is an important factor in determining the sensitivity to radiation damage and accessibility to enzymes required for repair of such damage. (author)

  16. Rapid increase of inositol 1,4,5-trisphosphate in the HeLa cells after hypergravity exposure

    Science.gov (United States)

    Kumei, Yasuhiro; Whitson, Peggy A.; Cintron, Nitza M.; Sato, Atsushige

    1990-01-01

    The IP3 level in HeLa cells has been elevated through the application in hypergravity in a time-dependent manner. The data obtained for the hydrolytic products of PIP2, IP3, and DG are noted to modulate c-myc gene expression. It is also established that the cAMP accumulation by the IBMX in hypergravity-exposed cells was suppressed relative to the control. In light of IP3 increase and cAMP decrease results, a single GTP-binding protein may play a role in the hypergravity signal transduction of HeLa cells by stimulating PLC while inhibiting adenylate cyclase.

  17. Ellipsometry study of optical parameters of AgIn5S8 crystals

    Science.gov (United States)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  18. Ellipsometry study of optical parameters of AgIn{sub 5}S{sub 8} crystals

    Energy Technology Data Exchange (ETDEWEB)

    Isik, Mehmet, E-mail: mehmet.isik@atilim.edu.tr [Department of Electrical and Electronics Engineering, Atilim University, 06836 Ankara (Turkey); Gasanly, Nizami [Department of Physics, Middle East Technical University, 06800 Ankara (Turkey); Virtual International Scientific Research Centre, Baku State University, 1148 Baku (Azerbaijan)

    2015-12-01

    AgIn{sub 5}S{sub 8} crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2–6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn{sub 5}S{sub 8} crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  19. Perception and analysis of the 5S program at a business service provider

    Directory of Open Access Journals (Sweden)

    André Luiz Emmel Silva

    2016-09-01

    Full Text Available Given the importance that the service sector represents in our economy, the application of concepts and techniques for its administration and models aimed at improving its quality is growing. This article aims to analyze the main aspects of the 5S program in the implementation phase and in the course of its evolution at a service company. The methodology used is qualitative, implemented through a case study structured in 6 steps. The company under study performs strongly on the national market and therefore has a large amount of documents circulating daily through different sectors, which generated the need to implement a methodology capable of streamlining document flow management and reducing the time spent on bureaucracy by its employees. The 5S program was shown to have brought the company greater administrative efficiency and a more pleasant, safe and organized working environment, motivating employees, reducing costs and providing competitive advantages.

  20. Implementation of 5S tools as a starting point in business process reengineering

    Directory of Open Access Journals (Sweden)

    Vorkapić Miloš 0000-0002-3463-8665

    2017-01-01

    Full Text Available The paper deals with the analysis of elements which represent a starting point in implementation of a business process reengineering. We have used Lean tools through the analysis of 5S model in our research. On the example of finalization of the finished transmitter in IHMT-CMT production, 5S tools were implemented with a focus on Quality elements although the theory shows that BPR and TQM are two opposite activities in an enterprise. We wanted to distinguish the significance of employees’ self-discipline which helps the process of product finalization to develop in time and without waste and losses. In addition, the employees keep their work place clean, tidy and functional.

  1. The blue light indicator in rubidium 5S-5P-5D cascade excitation

    Science.gov (United States)

    Raja, Waseem; Ali, Md. Sabir; Chakrabarti, Alok; Ray, Ayan

    2017-07-01

    The cascade system has played an important role in contemporary research areas related to fields like Rydberg excitation, four wave mixing and non-classical light generation, etc. Depending on the specific objective, co or counter propagating pump-probe laser experimental geometry is followed. However, the stepwise excitation of atoms to states higher than the first excited state deals with increasingly much fewer number of atoms even compared to the population at first excited level. Hence, one needs a practical indicator to study the complex photon-atom interaction of the cascade system. Here, we experimentally analyze the case of rubidium 5S → 5P → 5D as a specimen of two-step excitation and highlight the efficacy of monitoring one branch, which emits 420 nm, of associated cascade decay route 5D → 6P → 5S, as an effective monitor of the coherence in the system.

  2. Attosecond relative delay among xenon 5p, 5s, and 4d photoionization

    Science.gov (United States)

    Magrakvelidze, Maia; Madjet, Mohamed; Chakraborty, Himadri

    2017-04-01

    Attosecond Wigner-Smith (WS) time delays of the photoemissions of Xe valence 5p, 5s, and core 4d electrons are investigated in details using the time-dependent local density approximation (TDLDA). Electron correlations determine the energy-dependent structures in ionization phases of the dipole channels and in the resulting WS delays at various shape resonances, induced by the collective motion of 4d electrons, and at various Cooper minima. We find that our calculation closely agrees with the streaking measurement for the delay of 4d relative to 5s, and predicts accelerated emission of 5p with respect to 4d as was experimentally observed at similar photon energies for Xe atoms adsorbed on the tungsten surface. This work was supported by the U.S. National Science Foundation.

  3. New antiferromagnetic semiconductor CuCr1.5Sb0.5S4

    International Nuclear Information System (INIS)

    Kesler, Ya.A.; Koroleva, L.I.; Mikheev, M.G.; Odintsov, A.G.; Filimonov, D.S.

    1993-01-01

    New halcogenide compound with spinel-antiferromagnetic semiconductor CuCr 1.5 Sb 0.5 S 4 are obtained and studied for the first time. Magnetic properties of this compound, namely, magnetization linear dependence, maximum on PHI(T) curve in the low-temperature area and realization of the Curie-Weis law for paramagnetic susceptibility with negative paramagnetic temperature testiby to the fact that this compound is antiferromagnetic

  4. Uudised : Eesti muusikalistaarid Euroopas. Tüüri 5.sümfoonia Tallinnas

    Index Scriptorium Estoniae

    2005-01-01

    Koit Toome, Ele Millistver ja Lauri Liiv alustavad 1. detsembril Brnos rahvusvahelises muusikalitrupis "Hairi" proovidega. Esietendus on 26. dets. Iserlohni linnas Saksamaal ning etendusi antakse järgmise aasta 16. aprillini Saksa linnades, Austrias, Šveitsis ja Taanis. Erkki-Sven Tüüri 5. sümfoonia tuleb Eestis esiettekandele 10. dets. Estonia Kontserdisaalis, teose esiettekannet selle aasta veebruaris Stuttgardis dirigeeris Olari Elts

  5. Fuel and coolant motions following pin failure: EPIC models and the PBE-5S experiment

    International Nuclear Information System (INIS)

    Garner, P.L.; Abramson, P.B.

    1979-01-01

    The EPIC computer code has been used to analyze the post-fuel-pin-failure behavior in the PBE-5S experiment performed at Sandia Laboratories. The effects of modeling uncertainties on the calculation are examined. The calculations indicate that the majority of the piston motion observed in the test is due to the initial pressurization of the coolant channel by fuel vapor at cladding failure. A more definitive analysis requires improvements in calculational capabilities and experiment diagnostics

  6. The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

    Science.gov (United States)

    Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

    2017-10-27

    The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  7. Ectopic overexpression of LAPTM5 results in lysosomal targeting and induces Mcl-1 down-regulation, Bak activation, and mitochondria-dependent apoptosis in human HeLa cells.

    Directory of Open Access Journals (Sweden)

    Do Youn Jun

    Full Text Available Human lysosomal-associated protein multispanning membrane 5 (LAPTM5 was identified by an ordered differential display-polymerase chain reaction (ODD-PCR as an up-regulated cDNA fragment during 12-O-tetradecanoylphorbol 13-acetate (TPA-induced differentiation of U937 cells into monocytes/macrophages. After TPA-treatment, the levels of LAPTM5 mRNA and protein increased and reached a maximum at 18-36 h. In healthy human tissues, LAPTM5 mRNA was expressed at high levels in hematopoietic cells and tissues, at low levels in the lung and fetal liver, and was not detected in other non-hematopoietic tissues. LAPTM5 mRNA was detected in immature malignant cells of myeloid lineage, such as K562, HL-60, U937, and THP-1 cells, and in unstimulated peripheral T cells, but was absent or barely detectable in lymphoid malignant or non-hematopoietic malignant cells. The LAPTM5 level in HL-60 cells increased more significantly during TPA-induced monocyte/macrophage differentiation than during DMSO-induced granulocyte differentiation. Ectopic expression of GFP-LAPTM5 or LAPTM5 in HeLa cells exhibited the localization of LAPTM5 to the lysosome. In HeLa cells overexpressing LAPTM5, the Mcl-1 and Bid levels declined markedly and apoptosis was induced via Bak activation, Δψm loss, activation of caspase-9, -8 and -3, and PARP degradation without accompanying necrosis. However, these LAPTM5-induced apoptotic events except for the decline of Bid level were completely abrogated by concomitant overexpression of Mcl-1. The pan-caspase inhibitor (z-VAD-fmk could suppress the LAPTM5-induced apoptotic sub-G1 peak by ~40% but failed to block the induced Δψm loss, whereas the broad-range inhibitor of cathepsins (Cathepsin Inhibitor I could suppress the LAPTM5-induced apoptotic sub-G1 peak and Δψm loss, by ~22% and ~23%, respectively, suggesting that the LAPTM5-mediated Δψm loss was exerted at least in part in a cathepsin-dependent manner. Together, these results

  8. Ectopic overexpression of LAPTM5 results in lysosomal targeting and induces Mcl-1 down-regulation, Bak activation, and mitochondria-dependent apoptosis in human HeLa cells

    Science.gov (United States)

    Jun, Do Youn; Kim, Hyejin; Jang, Won Young; Lee, Ji Young; Fukui, Kiyoshi; Kim, Young Ho

    2017-01-01

    Human lysosomal-associated protein multispanning membrane 5 (LAPTM5) was identified by an ordered differential display-polymerase chain reaction (ODD-PCR) as an up-regulated cDNA fragment during 12-O-tetradecanoylphorbol 13-acetate (TPA)-induced differentiation of U937 cells into monocytes/macrophages. After TPA-treatment, the levels of LAPTM5 mRNA and protein increased and reached a maximum at 18–36 h. In healthy human tissues, LAPTM5 mRNA was expressed at high levels in hematopoietic cells and tissues, at low levels in the lung and fetal liver, and was not detected in other non-hematopoietic tissues. LAPTM5 mRNA was detected in immature malignant cells of myeloid lineage, such as K562, HL-60, U937, and THP-1 cells, and in unstimulated peripheral T cells, but was absent or barely detectable in lymphoid malignant or non-hematopoietic malignant cells. The LAPTM5 level in HL-60 cells increased more significantly during TPA-induced monocyte/macrophage differentiation than during DMSO-induced granulocyte differentiation. Ectopic expression of GFP-LAPTM5 or LAPTM5 in HeLa cells exhibited the localization of LAPTM5 to the lysosome. In HeLa cells overexpressing LAPTM5, the Mcl-1 and Bid levels declined markedly and apoptosis was induced via Bak activation, Δψm loss, activation of caspase-9, -8 and -3, and PARP degradation without accompanying necrosis. However, these LAPTM5-induced apoptotic events except for the decline of Bid level were completely abrogated by concomitant overexpression of Mcl-1. The pan-caspase inhibitor (z-VAD-fmk) could suppress the LAPTM5-induced apoptotic sub-G1 peak by ~40% but failed to block the induced Δψm loss, whereas the broad-range inhibitor of cathepsins (Cathepsin Inhibitor I) could suppress the LAPTM5-induced apoptotic sub-G1 peak and Δψm loss, by ~22% and ~23%, respectively, suggesting that the LAPTM5-mediated Δψm loss was exerted at least in part in a cathepsin-dependent manner. Together, these results demonstrate that

  9. Multiple isoelectric forms of poliovirus RNA-dependent RNA polymerase: Evidence for phosphorylation

    International Nuclear Information System (INIS)

    Ransone, L.J.; Dasgupta, A.

    1989-01-01

    Poliovirus-specific RNA-dependent RNA polymerase (3Dpol) was purified to apparent homogeneity. A single polypeptide of an apparent molecular weight of 63,000 catalyzes the synthesis of dimeric and monomeric RNA products in response to the poliovirion RNA template. Analysis of purified 3Dpol by two-dimensional electrophoresis showed multiple forms of 3Dpol, suggesting posttranslational modification of the protein in virus-infected cells. The two major forms of 3Dpol appear to have approximate pI values of 7.1 and 7.4. Incubation of purified 3Dpol with calf intestinal phosphatase resulted in almost complete disappearance of the pI 7.1 form and a concomitant increase in the intensity of the pI 7.4 form of 3Dpol. Addition of 32P-labeled Pi during infection of HeLa cells with poliovirus resulted in specific labeling of 3Dpol and 3CD, a viral protein which contains the entire 3Dpol sequence. Both 3Dpol and 3CD appear to be phosphorylated at serine residues. Ribosomal salt washes prepared from both mock- and poliovirus-infected cells contain phosphatases capable of dephosphorylating quantitatively the phosphorylated form (pI 7.1) of 3Dpol

  10. Synthesis and growth mechanism of Zn0.5Cd0.5S nanohexagon dendrite

    Science.gov (United States)

    Yu, Wen; Fang, Pengfei; Wang, Shaojie

    2014-12-01

    Hierarchical Zn0.5Cd0.5S nanohexagon dendrites were synthesized by a one-step hydrothermal method. The Zn0.5Cd0.5S nanohexagon dendrites were made up of nanohexagons with a side length of about 90 nm. The nanohexagons were regularly arranged forming as embranchments which were parallel to each other along certain hexagonal directions. Furthermore, these embranchments made up primary trunks shaping as dendrites. The growth mechanism of Zn0.5Cd0.5S nanohexagon dendrites was proposed in which molecular soft template and lowest energy principle played key roles. By adjusting the composition of the reactants, a series of ZnxCd1-xS solid solutions could be obtained. The morphology of the synthesized ZnxCd1-xS depended much on the x value. The UV-vis spectra absorb edges of the ZnxCd1-xS samples continuously shifted indicating the changes of the band gap.

  11. Evidence-based management of otitis media: a 5S model approach.

    Science.gov (United States)

    Wasson, J D; Yung, M W

    2015-02-01

    The 5S model proposes five hierarchical levels (systems, summaries, synopses, syntheses and studies) of pre-appraised evidence to guide evidence-based practice. This review aimed to identify and summarise pre-appraised evidence at the highest available 5S level for the management of different subsets of otitis media: acute otitis media, otitis media with effusion, chronic suppurative otitis media and cholesteatoma in both adults and children. Data sources were pre-appraised evidence resources. Evidence freely available from sources at the highest available level of the 5S model were summarised for this review. System level evidence exists for acute otitis media and otitis media with effusion. Summary level evidence exists for recurrent acute otitis media and medical management of chronic suppurative otitis media. There is an absence of randomised controlled trials to prove the efficacy of surgical management of chronic suppurative otitis media and cholesteatoma. Until randomised controlled trial data are generated, consensus publications on the surgical management of chronic suppurative otitis media and cholesteatoma should be used to guide best practice.

  12. Why are our children wasting: Determinants of wasting among under 5s in Ghana.

    Science.gov (United States)

    Darteh, Eugene Kofuor Maafo; Acquah, Evelyn; Darteh, Florie

    2017-09-01

    Wasting is one of the indicators of malnutrition known to contribute to the deaths occurring from childhood malnutrition. It is the measure of body mass in relation to body length used to explain recent nutritional status. This paper examines the determinants of wasting among under 5s in Ghana. Data were drawn from the 2014 Ghana Demographic and Health Survey children's records file to examine the determinants of wasting among children. A total of 2720 children under 5 years with valid anthropometric data were used. Data on wasting were collected by measuring the weight and height of all children under 5 years of age. Bi-variate and multi-variate statistics are used to examine the determinants of wasting. The bi-variate analysis showed significant differences ( p 5s according to age of the child, region, and wealth status. On the other hand, the multi-variate analysis revealed that the odds of wasting were lower among children aged 24-35 months (Odds ratio (OR) = 0.37; p 5s. Also, efforts should be made by the relevant government agencies and other stakeholders to strengthen the socio-economic status of mothers to enable them to provide adequate nutrition and improve access to health insurance for their children in order to reduce the incidence of wasting among these children.

  13. Distraction manipulation reduction of an L5-S1 disk herniation.

    Science.gov (United States)

    Cox, J M; Hazen, L J; Mungovan, M

    1993-06-01

    A computed tomography (CT)-confirmed L5-S1 disk protrusion is reported to be reduced following chiropractic adjustment, as seen on repeat CT scanning. Correlation of the CT reports with the patient's symptoms before and after manipulation is reported. A 38-yr-old female was treated for low back pain and right lower extremity first sacral dermatome sciatica. CT confirmed disk herniations at both the L4-L5 and L5-S1 levels were found. Motor weakness of the right gluteus maximus muscle was found and extremely tight hamstring muscles accompanying positive straight leg signs were elicited. A clinical and imaging diagnosis of an L5-S1 disk herniation was made. Distraction type chiropractic manipulation, electrical stimulation, exercises, nutrition advice and low back wellness class were administered with complete relief of sciatic pain and nearly complete relief of low back pain. Chiropractic distraction manipulation is an effective treatment of lumbar disk herniation, if the chiropractor is observant during its administration for patient tolerance to manipulation under distraction and any signs of neurological deficit demanding other types of care.

  14. Short-term desensitization of the histamine H1 receptor in human HeLa cells : involvement of protein kinase C dependent and independent pathways

    NARCIS (Netherlands)

    Smit, M J; Bloemers, S M; Leurs, R; Tertoolen, L G; Bast, A; de Laat, S W; Timmerman, H

    1992-01-01

    1. In this study we have investigated the effects of short-term exposure of cells to histamine on the subsequent H1 receptor responsiveness in HeLa cells, using Ca2+ fluorescence microscopy and video digital imaging. 2. In HeLa cells, histamine (100 microM) induces an immediate H1 receptor-mediated

  15. Expression of cancer stem markers could be influenced by silencing of p16 gene in HeLa cervical carcinoma cells.

    Science.gov (United States)

    Wu, H; Zhang, J; Shi, H

    2016-01-01

    Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.

  16. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  17. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  18. In vitro studies on radiosensitization effect of glucose capped gold nanoparticles in photon and ion irradiation of HeLa cells

    International Nuclear Information System (INIS)

    Kaur, Harminder; Pujari, Geetanjali; Semwal, Manoj K.; Sarma, Asitikantha; Avasthi, Devesh Kumar

    2013-01-01

    Highlights: ► Glucose capped gold nanoparticles (Glu-AuNPs) are synthesized for internalization in HeLa cells (cervical cancer cells). ► Internalization of Glu-AuNPs in HeLa cells is confirmed by cross section TEM of cells. ► Irradiation (by C ion or γ-rays) of HeLa cells with internalized Glu-AuNPs results in enhanced radiosensitization. ► There is about 30% reduction in radiation dose for 90% cell killing of HeLa cells, when internalized by Glu-AuNPs. ► The enhanced radiosensitization due to Glu-AuNPs is of interest for researchers in nanobiotechnology and radiation biology. -- Abstract: Noble metal nanoparticles are of great interest due to their potential applications in diagnostics and therapeutics. In the present work, we synthesized glucose capped gold nanoparticle (Glu-AuNP) for internalization in the HeLa cell line (human cervix cancer cells). The capping of glucose on Au nanoparticle was confirmed by Raman spectroscopy. The Glu-AuNP did not show any toxicity to the HeLa cell. The γ-radiation and carbon ion irradiation of HeLa cell with and without Glu-AuNP were performed to evaluate radiosensitization effects. The study revealed a significant reduction in radiation dose for killing the HeLa cells with internalized Glu-AuNPs as compared to the HeLa cells without Glu-AuNP. The Glu-AuNP treatment resulted in enhancement of radiation effect as evident from increase in relative biological effectiveness (RBE) values for carbon ion irradiated HeLa cells

  19. Autoradiography of DNA from Hela cells under normal conditions and after treatment with hydroxyurea

    International Nuclear Information System (INIS)

    Martinova, Y.S.; Angelova, P.A.; Roeva, I.G.

    1984-01-01

    The results are presented of the first stage of the elaboration of the novel autoradiographic technique for studying the replication of DNA fibers from nonsynchronized Hela cell cultures under normal conditions and after treatment with hydroxyurea. The preparations were covered with liquid nuclear emulsion Ilford L 4 . Exposure was carried out for 3 months at 4 deg C. After development, the autoradiograms were recorded quantitatively, and the length of the individual replicative segments was measured by means of an object micrometers. For each group (control and experimental) 100 segments from different cells were recorded. The results obtained were subjected to mathematical-statistical processing for determining the standard deviation. The application of hidroxyurea highly reduces the replicative elements, i.e. it actually inhibits DNA synthesis. This inhibition is due to reduction in the production of the four endogenous deoxynucleotides and affects the length of growth of the DNA chain, but the interreplicative distance as well

  20. Monitoring the elasticity changes of HeLa cells during mitosis by atomic force microscopy

    Science.gov (United States)

    Jiang, Ningcheng; Wang, Yuhua; Zeng, Jinshu; Ding, Xuemei; Xie, Shusen; Yang, Hongqin

    2016-10-01

    Cell mitosis plays a crucial role in cell life activity, which is one of the important phases in cell division cycle. During the mitosis, the cytoskeleton micro-structure of the cell changed and the biomechanical properties of the cell may vary depending upon different mitosis stages. In this study, the elasticity property of HeLa cells during mitosis was monitored by atomic force microscopy. Also, the actin filaments in different mitosis stages of the cells were observed by confocal imaging. Our results show that the cell in anaphase is stiffer than that in metaphase and telophase. Furthermore, lots of actin filaments gathered in cells' center area in anaphase, which contributes to the rigidity of the cell in this phase. Our findings demonstrate that the nano-biomechanics of living cells could provide a new index for characterizing cell physiological states.

  1. Plasma generated in culture medium induces damages of HeLa cells due to flow phenomena

    Science.gov (United States)

    Sato, Yusuke; Sato, Takehiko; Yoshino, Daisuke

    2018-03-01

    Plasma in a liquid has been anticipated as an effective tool for medical applications, however, few reports have described cellular responses to plasma generated in a liquid similar to biological fluids. Herein we report the effects of plasma generated in a culture medium on HeLa cells. The plasma in the culture medium produced not only heat, shock waves, and reactive chemical species but also a jet flow with sub millimeter-sized bubbles. Cells exposed to the plasma exhibited detachment, morphological changes, and changes in the actin cytoskeletal structure. The experimental results suggest that wall shear stress over 160 Pa was generated on the surface of the cells by the plasma. It is one of the main factors that cause those cellular responses. We believe that our findings would provide valuable insight into advancements in medical applications of plasma in a liquid.

  2. Visualizing the molecular sociology at the HeLa cell nuclear periphery.

    Science.gov (United States)

    Mahamid, Julia; Pfeffer, Stefan; Schaffer, Miroslava; Villa, Elizabeth; Danev, Radostin; Cuellar, Luis Kuhn; Förster, Friedrich; Hyman, Anthony A; Plitzko, Jürgen M; Baumeister, Wolfgang

    2016-02-26

    The molecular organization of eukaryotic nuclear volumes remains largely unexplored. Here we combined recent developments in cryo-electron tomography (cryo-ET) to produce three-dimensional snapshots of the HeLa cell nuclear periphery. Subtomogram averaging and classification of ribosomes revealed the native structure and organization of the cytoplasmic translation machinery. Analysis of a large dynamic structure-the nuclear pore complex-revealed variations detectable at the level of individual complexes. Cryo-ET was used to visualize previously elusive structures, such as nucleosome chains and the filaments of the nuclear lamina, in situ. Elucidation of the lamina structure provides insight into its contribution to metazoan nuclear stiffness. Copyright © 2016, American Association for the Advancement of Science.

  3. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  4. Evaluation of the effects of paederus beetle extract and gamma irradiation on HeLa cells

    Directory of Open Access Journals (Sweden)

    Fariba Samani

    2014-04-01

    Full Text Available Objective(s:Cervical cancer is a malignancy that is the second most common cause of death from cancer in women throughout the world. Paederus beetle (Paederus fuscipes extract (PBE, contains bioactive compounds such as pederine which has cytotoxic properties and blocks DNA and protein synthesis at very low concentrations. In this investigation we tried to determine the effects co-treatment with PBE and gamma irradiation on HeLa cells. Materials and Methods: The viability of the cells was measured by two methods: MTT and Colony assay. Results: We found that supplementing gamma irradiation therapy with PBE does not increase cell death and it might even interfere with its cytotoxicty at the concentrations below 0.1 ng/ml and the viability for irradiation vs irradiation + PBE was 37%: 60%.   Conclusion: This finding might be due to radioprotective effects of the very low doses of PBE against gamma radiation.

  5. The nonstructural protein NP1 of human bocavirus 1 induces cell cycle arrest and apoptosis in Hela cells

    International Nuclear Information System (INIS)

    Sun, Bin; Cai, Yingyue; Li, Yongshu; Li, Jingjing; Liu, Kaiyu; Li, Yi; Yang, Yongbo

    2013-01-01

    Human bocavirus type 1 (HBoV1) is a newly identified pathogen associated with human respiratory tract illnesses. Previous studies demonstrated that proteins of HBoV1 failed to cause cell death, which is considered as a possible common feature of bocaviruses. However, our work showed that the NP1 of HBoV1 induced apoptotic cell death in Hela cells in the absence of viral genome replication and expression of other viral proteins. Mitochondria apoptotic pathway was involved in the NP1-induced apoptosis that was confirmed by apoptotic characteristics including morphological changes, DNA fragmentation and caspase activation. We also demonstrated that the cell cycle of NP1-transfected Hela cells was transiently arrested at G2/M phase followed by rapid appearance of apoptosis and that the N terminal domain of NP1 was critical to its nuclear localization and function in apoptosis induction in Hela cells. These findings might provide alternative information for further study of mechanism of HBoV1 pathogenesis. - Highlights: ► NP1 protein of HBoV1 induced apoptosis in Hela cells was first reported. ► NP1 induced-apoptosis followed the cell cycle arrest at G2/M phase. ► The NP1 induced-apoptosis was mediated by mitochondrion apoptotic pathway. ► N terminal of NP1 was critical for apoptosis induction and nuclear localization

  6. Anticancer Activity of a Hexapeptide from Skate (Raja porosa Cartilage Protein Hydrolysate in HeLa Cells

    Directory of Open Access Journals (Sweden)

    Xin Pan

    2016-08-01

    Full Text Available In this study, the hexapeptide Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY, which has a molecular weight of 726.9 Da, was separated from skate (Raja porosa cartilage protein hydrolysate using ultrafiltration and chromatographic methods, and its anticancer activity was evaluated in HeLa cells. Methylthiazolyldiphenyl-tetrazolium bromide (MTT assay indicated that FIMGPY exhibited high, dose-dependent anti-proliferation activities in HeLa cells with an IC50 of 4.81 mg/mL. Acridine orange/ethidium bromide (AO/EB fluorescence staining and flow cytometry methods confirmed that FIMGPY could inhibit HeLa cell proliferation by inducing apoptosis. Western blot assay revealed that the Bax/Bcl-2 ratio and relative intensity of caspase-3 in HeLa cells treated with 7-mg/mL FIMGPY were 2.63 and 1.83, respectively, significantly higher than those of the blank control (p < 0.01. Thus, FIMGPY could induce apoptosis by upregulating the Bax/Bcl-2 ratio and caspase-3 activation. Using a DNA ladder method further confirmed that the anti-proliferation activity of FIMGPY was attributable to its role in inducing apoptosis. These results suggest that FIMGPY from skate cartilage protein hydrolysate may have applications as functional foods and nutraceuticals for the treatment and prevention of cancer.

  7. Anticancer Activity of a Hexapeptide from Skate (Raja porosa) Cartilage Protein Hydrolysate in HeLa Cells.

    Science.gov (United States)

    Pan, Xin; Zhao, Yu-Qin; Hu, Fa-Yuan; Chi, Chang-Feng; Wang, Bin

    2016-08-16

    In this study, the hexapeptide Phe-Ile-Met-Gly-Pro-Tyr (FIMGPY), which has a molecular weight of 726.9 Da, was separated from skate (Raja porosa) cartilage protein hydrolysate using ultrafiltration and chromatographic methods, and its anticancer activity was evaluated in HeLa cells. Methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay indicated that FIMGPY exhibited high, dose-dependent anti-proliferation activities in HeLa cells with an IC50 of 4.81 mg/mL. Acridine orange/ethidium bromide (AO/EB) fluorescence staining and flow cytometry methods confirmed that FIMGPY could inhibit HeLa cell proliferation by inducing apoptosis. Western blot assay revealed that the Bax/Bcl-2 ratio and relative intensity of caspase-3 in HeLa cells treated with 7-mg/mL FIMGPY were 2.63 and 1.83, respectively, significantly higher than those of the blank control (p skate cartilage protein hydrolysate may have applications as functional foods and nutraceuticals for the treatment and prevention of cancer.

  8. Intense picosecond pulsed electric fields induce apoptosis through a mitochondrial-mediated pathway in HeLa cells

    Science.gov (United States)

    HUA, YUAN-YUAN; WANG, XIAO-SHU; ZHANG, YU; YAO, CHEN-GUO; ZHANG, XI-MING; XIONG, ZHENG-AI

    2012-01-01

    The application of pulsed electric fields (PEF) is emerging as a new technique for tumor therapy. Picosecond pulsed electric fields (psPEF) can be transferred to target deep tissue non-invasively and precisely, but the research of the biological effects of psPEF on cells is limited. Electric theory predicts that intense psPEF will target mitochondria and lead to changes in transmembrane potential, therefore, it is hypothesized that it can induce mitochondrial-mediated apoptosis. HeLa cells were exposed to psPEF in this study to investigate this hypothesis. MTT assay demonstrated that intense psPEF significantly inhibited the proliferation of HeLa cells in a dose-dependent manner. Typical characteristics of apoptosis in HeLa cells were observed, using transmission electron microscopy. Loss of mitochondrial transmembrane potential was explored using laser scanning confocal microscopy with Rhodamine-123 (Rh123) staining. Furthermore, the mitochondrial apoptotic events were also confirmed by western blot analysis for the release of cytochrome C and apoptosis-inducing factor from mitochondria into the cytosol. In addition, activation of caspase-3, caspase-9, upregulation of Bax, p53 and downregulation of Bcl-2 were observed in HeLa cells also indicating apoptosis. Taken together, these results demonstrate that intense psPEF induce cell apoptosis through a mitochondrial-mediated pathway. PMID:22307872

  9. The nonstructural protein NP1 of human bocavirus 1 induces cell cycle arrest and apoptosis in Hela cells

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Bin; Cai, Yingyue; Li, Yongshu [College of Life Science, Central China Normal University, Wuhan 430079, Hubei (China); Li, Jingjing [College of Life Science, Hubei Normal University, Huangshi 435002, Hubei (China); Liu, Kaiyu [College of Life Science, Central China Normal University, Wuhan 430079, Hubei (China); Li, Yi, E-mail: johnli2668@hotmail.com [College of Life Science, Central China Normal University, Wuhan 430079, Hubei (China); Bioengineering Department, Wuhan Bioengineering Institute, Wuhan 430415, Hubei (China); Yang, Yongbo, E-mail: yongboyang@mail.ccnu.edu.cn [College of Life Science, Central China Normal University, Wuhan 430079, Hubei (China)

    2013-05-25

    Human bocavirus type 1 (HBoV1) is a newly identified pathogen associated with human respiratory tract illnesses. Previous studies demonstrated that proteins of HBoV1 failed to cause cell death, which is considered as a possible common feature of bocaviruses. However, our work showed that the NP1 of HBoV1 induced apoptotic cell death in Hela cells in the absence of viral genome replication and expression of other viral proteins. Mitochondria apoptotic pathway was involved in the NP1-induced apoptosis that was confirmed by apoptotic characteristics including morphological changes, DNA fragmentation and caspase activation. We also demonstrated that the cell cycle of NP1-transfected Hela cells was transiently arrested at G2/M phase followed by rapid appearance of apoptosis and that the N terminal domain of NP1 was critical to its nuclear localization and function in apoptosis induction in Hela cells. These findings might provide alternative information for further study of mechanism of HBoV1 pathogenesis. - Highlights: ► NP1 protein of HBoV1 induced apoptosis in Hela cells was first reported. ► NP1 induced-apoptosis followed the cell cycle arrest at G2/M phase. ► The NP1 induced-apoptosis was mediated by mitochondrion apoptotic pathway. ► N terminal of NP1 was critical for apoptosis induction and nuclear localization.

  10. Cytotoxic Effects of Native and Recombinant Frutalin, a Plant Galactose-Binding Lectin, on HeLa Cervical Cancer Cells

    Directory of Open Access Journals (Sweden)

    Carla Oliveira

    2011-01-01

    Full Text Available Frutalin is the α-D-galactose-binding lectin isolated from breadfruit seeds. Frutalin was obtained from two different sources: native frutalin was purified from its natural origin, and recombinant frutalin was produced and purified from Pichia pastoris. This work aimed to study and compare the effect of native and recombinant frutalin on HeLa cervical cancer cells proliferation and apoptosis. Furthermore, the interaction between frutalin and the HeLa cells was investigated by confocal microscopy. Despite having different carbohydrate-binding affinities, native and recombinant frutalin showed an identical magnitude of cytotoxicity on HeLa cells growth (IC50~100 μg/mL and equally induced cell apoptosis. The interaction studies showed that both lectins were rapidly internalised and targeted to HeLa cell's nucleus. Altogether, these results indicate that frutalin action is not dependent on its sugar-binding properties. This study provides important information about the bioactivity of frutalin and contributes to the understanding of the plant lectins cytotoxic activity.

  11. Efficacy of Proliferation of HeLa Cells under Three Different Low-Intensity Red Lasers Irradiation

    Directory of Open Access Journals (Sweden)

    H. Q. Yang

    2012-01-01

    Full Text Available This study was intended to compare the efficacy of proliferation of HeLa cells under three different low-intensity laser irradiation (LIL, that is, 633 nm, 658 nm, and 785 nm. The time-dependent responses of proliferation of HeLa cells after the red laser irradiation and the influence of fetal bovine serum (FBS at 1%, 2%, 5%, or 10% on the proliferation of cells were also investigated. The results indicated that the proliferation of HeLa cells in 10% FBS was in proliferation-specific homeostasis (PSH so that it was not modulated with LIL; the proliferation in FBS at 1%, 2%, or 5% was far from PSH so that it may be wavelength dependently modulated with LIL, and the maximum proliferation promotion was conducted with LIL at 633 nm amongst the three different LIL. It was concluded the wavelength-dependent photobiomodulation of LIL on proliferation of HeLa cells may be homeostatic.

  12. A Lentinus edodes polysaccharide induces mitochondrial-mediated apoptosis in human cervical carcinoma HeLa cells.

    Science.gov (United States)

    Ya, Guowei

    2017-10-01

    In this study, a homogeneous polysaccharide (LEP1) with an average molecular weight of 53kDa was successfully purified from the fruiting bodies of Lentinus edodes and its anticancer efficacy on human cervical carcinoma HeLa cells in vitro and associated possible molecular mechanism were also evaluated. MTT assay showed that LEP1 exhibited a dose-dependent inhibitory effect on the proliferation of HeLa cells and caused apoptotic death. Our present findings provided the first evidence that LEP1 induced the apoptosis of HeLa cells via a mitochondria dependent pathway, as indicated by an increase in Bax/Bcl-2 ratio, a loss of mitochondrial membrane potential (Δym), the release of cytochrome c from the mitochondria to the cytosol, activation of caspase-9 and caspase-3, and cleavage of poly (ADP-ribose) polymerase (PARP) in HeLa cells. These combined results unequivocally indicated that the involvement of mitochondria-mediated signaling pathway in LEP1-induced apoptosis and strongly provided experimental evidence for the use of LEP1 as a potential therapeutic agent in the prevention and treatment of human cervical carcinoma. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Extracellular ATP elevates cytoplasmatic free Ca2+ in HeLa cells by the interaction with a 5'-nucleotide receptor

    NARCIS (Netherlands)

    Smit, M J; Leurs, R; Bloemers, S M; Tertoolen, L G; Bast, A; De Laat, S W; Timmerman, H

    1993-01-01

    In the present study we have characterized the effects of ATP and several other nucleotides on the intracellular Ca2+ levels of HeLa cells. Using fura-2 microscopy fluorescence measurements, the ATP-mediated increase in intracellular Ca2+ was shown to consist of a rapid rise which decreased after a

  14. Newly synthesized bis-benzimidazole compound 8 induces apoptosis, autophagy and reactive oxygen species generation in HeLa cells.

    Science.gov (United States)

    Chu, Naying; Yao, Guodong; Liu, Yuan; Cheng, Maosheng; Ikejima, Takashi

    2016-09-01

    Compound 8 (C8) is a newly synthesized bis-benzimidazole derivative and exerts significant anti-tumor activity in vitro. Previous studies demonstrated that C8 induced apoptosis and autophagy in human promyelocytic leukemia HL60 cells. However, cytotoxicity study on human peripheral blood mononuclear cells (hPBMC) showed that C8 exhibited less toxicity in normal cells. In this study, the molecular mechanism of C8 on human cervical carcinoma HeLa cells was investigated. The results showed that C8 inhibited the growth of HeLa cells and triggered both apoptotic and autophagic cell death. Subsequent experiment also indicated that reactive oxygen species (ROS) generation was induced in C8-treated HeLa cells. Since ROS scavenger decreased the ratio of apoptotic and autophagic cells, ROS generation contributed to C8-induced apoptosis and autophagy. Furthermore, inhibitors of apoptosis and autophagy also reduced ROS generation, respectively. Autophagy inhibition increased cell growth compared to C8-treated group and attenuated apoptotic cell death, indicating that C8-induced autophagy promoted apoptosis for cell death. However, the percentage of autophagic cells was enhanced when limiting apoptosis process. Taken together, C8 induced ROS-mediated apoptosis and autophagy in HeLa cells, autophagy promoted apoptosis but the former was antagonized by the latter. The data also gave us a new perspective on the anti-tumor effect of C8. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Suppression of postmitochondrial signaling and delayed response to UV-induced nuclear apoptosis in HeLa cells

    International Nuclear Information System (INIS)

    Sasai, Kaori; Yajima, Hirohiko; Suzuki, Fumio

    2002-01-01

    Activation of postmitochondrial pathways by UV irradiation was examined using mouse lymphoma 3SB and human leukemic Jurkat cells and two human carcinoma cell lines (HeLa and MCF-7). Exposure of 3SB and Jurkat cells resulted in large amounts of cytochrome c and apoptosis-inducing factor (AIF) being released into the cytosol, and a clear laddering pattern of DNA fragments was observed within 3 h of incubation after irradiation. Simultaneously, activation of caspase-9 and its downstream caspases was detected. HeLa and MCF-7 cells also showed extensive release of mitochondrial factors and caspase-9 activation at 4 to 6 h after exposure, but apoptotic nuclear changes appeared much later. Compared with 3SB and Jurkat cells, these carcinoma cell lines exhibited reduced activation of caspase-9-like proteolytic activity by UV radiation, and levels of caspase-3-like activity in HeLa cells were extremely low, similar to those in caspase-3-deficient MCF-7 cells. These results suggest that the delayed response to UV-induced nuclear apoptosis in HeLa cells is due to a reduced activation of the caspase cascade downstream of cytochrome c release and suppression of caspase-3 activity. (author)

  16. Serum ferritin in patients with cancer: determination with antibodies to HeLa cell and spleen ferritin

    International Nuclear Information System (INIS)

    Jones, B.M.; Worwood, M.; Jacobs, A.

    1980-01-01

    Some malignant tissues and cell lines contain acidic isoferritins and it has been suggested that the assay of such isoferritins in serum may be of value in the diagnosis of malignancy. This paper describes a radioimmunoassay for acidic ferritin purified from HeLa cells. Examination of purified heart, kidney, liver and spleen ferritin showed that the assay was highly specific for acidic isoferritins. Ferritin concentrations have been measured with antibodies to HeLa cell and spleen ferritin in extracts of normal and tumour tissue. Although the tumours contained more HeLa type ferritin than the corresponding normal tissue the HeLa/spleen type ferritin ratio was low. HeLa-type ferritin concentrations have been compared with values obtained with anti-spleen ferritin in over 1000 sera from normal subjects and patients with cancer and leukaemia. HeLa-type ferritin was not detected (<2 μg/l) in most normal sera. Concentrations of up to 53 μg/l were found in sera from patients with malignant disease but the HeLa/spleen type ferritin ratio was always very low. There appears to be little application for antibodies to HeLa cell or heart ferritin in the diagnosis or monitoring of cancer. (Auth.)

  17. Dimethylfumarate induces cell cycle arrest and apoptosis via regulating intracellular redox systems in HeLa cells.

    Science.gov (United States)

    Han, Guocan; Zhou, Qiang

    2016-12-01

    Dimethylfumarate (DMF) is cytotoxic to several kinds of cells and serves as an anti-tumor drug. This study was designed to investigate the effects and underlying mechanism of DMF on cervical cancer cells. HeLa cells were cultured and treated with 0, 50, 100, 150, and 200 μM DMF, respectively. After 24 h, cell growth was evaluated using Cell Counting Kit-8 (CCK-8) assay and the cell cycle was examined using flow cytometry. In addition, cell apoptosis was detected by Annexin V/propidium iodide (PI) staining and the expressions of caspase-3 and poly-ADP-ribose polymerase (PARP) were detected using western blotting. The redox-related factors were then assessed. Furthermore, all of the indicators were detected in HeLa cells after combined treatment of DMF and N-acetyl-L-cysteine (NAC, an oxygen-free radical scavenger). The cell number and cell growth of HeLa were obviously inhibited by DMF in a dose-dependent manner, as the cell cycle was arrested at G0/G1 phase (P HeLa cells were markedly increased, and the expression levels of caspase-3 and PARP were significantly increased in a DMF concentration-dependent way (P cell proliferation and apoptosis of HeLa cells was mainly related to the intracellular redox systems by depletion of intracellular GSH.

  18. Yeast CUP1 protects HeLa cells against copper-induced stress

    Energy Technology Data Exchange (ETDEWEB)

    Xie, X.X. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China); College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou (China); Ma, Y.F.; Wang, Q.S.; Chen, Z.L.; Liao, R.R.; Pan, Y.C. [Department of Animal Sciences, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai (China); Shanghai Key Laboratory of Veterinary Biotechnology, Shanghai (China)

    2015-06-12

    As an essential trace element, copper can be toxic in mammalian cells when present in excess. Metallothioneins (MTs) are small, cysteine-rich proteins that avidly bind copper and thus play an important role in detoxification. YeastCUP1 is a member of the MT gene family. The aim of this study was to determine whether yeast CUP1 could bind copper effectively and protect cells against copper stress. In this study,CUP1 expression was determined by quantitative real-time PCR, and copper content was detected by inductively coupled plasma mass spectrometry. Production of intracellular reactive oxygen species (ROS) was evaluated using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) assay. Cellular viability was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, and the cell cycle distribution of CUP1 was analyzed by fluorescence-activated cell sorting. The data indicated that overexpression of yeast CUP1 in HeLa cells played a protective role against copper-induced stress, leading to increased cellular viability (P<0.05) and decreased ROS production (P<0.05). It was also observed that overexpression of yeast CUP1 reduced the percentage of G1 cells and increased the percentage of S cells, which suggested that it contributed to cell viability. We found that overexpression of yeast CUP1 protected HeLa cells against copper stress. These results offer useful data to elucidate the mechanism of the MT gene on copper metabolism in mammalian cells.

  19. Magnetic capture of polydopamine-encapsulated Hela cells for the analysis of cell surface proteins.

    Science.gov (United States)

    Liu, Yiying; Yan, Guoquan; Gao, Mingxia; Zhang, Xiangmin

    2018-02-10

    A novel method to characterize cell surface proteins and complexes has been developed. Polydopamine (PDA)-encapsulated Hela cells were prepared for plasma membrane proteome research. Since the PDA protection, the encapsulated cells could be maintained for more than two weeks. Amino groups functionalized magnetic nanoparticles were also used for cell capture by the reaction with the PDA coatings. Plasma membrane fragments were isolated and enriched with assistance of an external magnetic field after disruption of the coated cells by ultrasonic treatment. Plasma membrane proteins (PMPs) and complexes were well preserved on the fragments and identified by shot-gun proteomic analytical strategy. 385 PMPs and 1411 non-PMPs were identified using the method. 85.2% of these PMPs were lipid-raft associated proteins. Ingenuity Pathway Analysis was employed for bio-information extraction from the identified proteins. It was found that 653 non-PMPs had interactions with 140 PMPs. Among them, epidermal growth factor receptor and its complexes, and a series of important pathways including STAT3 pathway were observed. All these results demonstrated that the new approach is of great importance in applying to the research of physiological function and mechanism of the plasma membrane proteins. This work developed a novel strategy for the proteomic analysis of cell surface proteins. According to the results, 73.3% of total identified proteins were lipid-raft associated proteins, which imply that the proposed method is of great potential in the identification of lipid-raft associated proteins. In addition, a series of protein-protein interactions and pathways related to Hela cells were pointed out. All these results demonstrated that our proposed approach is of great importance and could well be applied to the physiological function and mechanism research of plasma membrane proteins. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Spontaneous and radiation induced cell death in HeLa S3 human carcinoma

    International Nuclear Information System (INIS)

    Zaric, B.; Milosavljevic, B.; Radojcic, M.

    2001-01-01

    Radiation biologists have classified radiation-induced cell death based on cell proliferative capacity to either mitotic or interphase death. Cytologists have revealed two morphologically and biochemically diverse forms of cell death, apoptosis and necrosis. While the knowledge of the former is already well exploited by radiologists, cell susceptibility to apoptosis and necrosis is still under investigation. We studied characteristics of spontaneous cell death, and dose dependence and time course of radiation-induced cell death of human uterine cervix epitheloid carcinoma HeLaS 3 in culture. Cells were irradiated with 2-40 Gy of γ-rays. The effect on growth, viability, morphology and genomic DNA structure were followed 24-72 h after irradiation. Cell viability was evaluated by trypan-blue exclusion assay and cell morphology by in situ DNA staining with propidium iodide. Cell genomic DNA fragmentation pattern was determined by electrophoresis on 2% agarose gels. At all cell densities 25-35% cells were PI positive and their DNA was fragmented to a high molecular size (≥20 kbp), but the internucleosomal ladder was not observed. A significant decrease in viability to 33% was observed 72 h post 40 Gy irradiation. It corresponded to 55% of PI positive cells. A smear of smaller DNA fragments (0.1-1 kbp), 24 h after 10-20 Gy irradiation was considered as proof that the dominant form of radiation-induced cell death was necrosis. It was concluded that the dominant form of radiation-induced cell death in HeLaS 3 population was necrosis and the radiation dose which caused 50% of cell death after 72 h (termed ND 50 ) was between 30-40 Gy. (author)

  1. N-methylation of the heterogeneous nuclear ribonucleoproteins in HeLa cells

    International Nuclear Information System (INIS)

    Rieker, J.P.

    1984-01-01

    Several of the core proteins on the 40S heterogeneous nuclear ribonucleoprotein particles (hnRNP) from HeLa cells contain N/sup G/,N/sup G/-dimethyl-L-arginine (uDMA). 3-deazaadenosine (c 3 Ado), an inhibitor of and substrate for s-adenosyl-L-homocysteine hydrolase, has been used to study the methylation patterns of the individual polypeptides. Trimethyllysine and uDMA formation in total cellular protein were inhibited in the presence of the drug while other methylated basic amino acids were unaffected. This inhibition was reversed within 60 min after removal of the drug from the medium. Monolayer HeLa cultures were incubated with [methyl- 3 H]-L-methoinine for 12 hours in the presence of 50 uM c 3 Ado. Purified particles were obtained by centrifugation of nuclear extracts on sucrose density gradients. The core proteins were isolated by two-dimensional gel electrophoresis, acid hydrolyzed and analyzed for radioactivity incorporated into methionine and methylated basic amino acids. The ratio of radioactivity incorporated into uDMA relative to that into methionine for the two major particle proteins with molecular weights of 31,000 (A 1 ) and 43,000 (A 2 ) was about 2.0 and 0.2 in control cultures. In the presence of c 3 Ado, these ratios were depressed 60 to 80%. Results of pulse-chase experiments suggested that A 1 and A 2 are metabolically stable proteins (t/sub 0.5/ > 75 hr), whether or not the proteins were undermethylated. Monomethyl-L-arginine may be a precursor in the formation of u-DMA

  2. Total Alkaloids of Sophora alopecuroides Inhibit Growth and Induce Apoptosis in Human Cervical Tumor HeLa Cells In vitro.

    Science.gov (United States)

    Li, Jian-Guang; Yang, Xiao-Yi; Huang, Wei

    2016-05-01

    Uygur females of Xinjiang have the higher incidence of cervical tumor in the country. Alkaloids are the major active ingredients in Sophora alopecuroides, and its antitumor effect was recognized by the medical profession. Xinjiang is the main site of S. alopecuroides production in China so these plants are abundant in the region. Studies on the antitumor properties of total alkaloids of S. alopecuroides (TASA) can take full use of the traditional folk medicine in antitumor unique utility. To explore the effects of TASA on proliferation and apoptosis of human cervical tumor HeLa cells in vitro. TASA was extracted, purified, and each monomer component was analyzed by high-performance liquid chromatography. The effect of TASA at different concentrations on the survival of HeLa cells was determined after 24 h using the Cell Counting Kit-8. In addition, cells were photographed using an inverted microscope to document morphological changes. The effect of TASA on apoptotic rate of HeLa cells was assessed by flow cytometry. Monomers of TASA were found to be sophoridine, matrine, and sophocarpine. On treatment with 8.75 mg/ml of TASA, more than 50% of HeLa cells died, and cell death rate increased further with longer incubation. The apoptotic rates of HeLa cells in the experimental groups were 16.0% and 33.3% at concentrations of 6.25 mg/ml and 12.50 mg/ml, respectively. TASA can induce apoptosis in cervical tumor HeLa cells, and it has obvious inhibitory effects on cell growth. Total alkaloids of Sophora alopecuroides (TASA) exhibits anti-human cervical tumor propertiesMonomer component of TASA was analyzed by high-performance liquid chromatography, and its main effect component are sophoridine, matrine, and sophocarpineTASA inhibits growth and induces apoptosis in HeLa cells. Abbreviations used: TASA: Total alkaloids of S. alopecuroides, CCK-8: Cell Counting Kit-8, FBS: Fetal bovine serum, PBS: Phosphate buffered saline, DMEM: Dulbecco's modified Eagle medium.

  3. 5S-MENETELMÄN KÄYTTÖÖNOTTO: LUVATA PORI OY

    OpenAIRE

    Rantanen, Suvi

    2015-01-01

    Opinnäytetyön aiheena oli 5S-menetelmän käyttöönotto Luvata Pori Oy:n tuotannos-sa. Tutkimuksen lähtökohtana ja ongelmana oli siisteyden ja järjestyksen puute. Ta-voitteena oli aikaansaada valittuun pilottikohteeseen toimivat, siistit ja turvalliset tuotantotilat sekä luoda järjestelmä, jonka avulla ylläpidetään saavutettu taso. Lisäksi tavoiteltiin hukan poistamista ja Luvatan Lean toimintatavan syventämistä. Projekti toteutettiin toimintatutkimuksena syksyn 2015 aikana. Tutkimuksen teor...

  4. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  5. HTP Nutraceutical Screening for Histone Deacetylase Inhibitors and Effects of HDACis on Tumor-suppressing miRNAs by Trichostatin A and Grapeseed (Vitis vinifera) in HeLa cells.

    Science.gov (United States)

    Mazzio, Elizabeth A; Soliman, Karam F A

    2017-01-02

    Aggressive tumor malignancies are a consequence of delayed diagnosis, epigenetic/phenotype changes and chemo-radiation resistance. Histone deacetylases (HDACs) are a major epigenetic regulator of transcriptional repression, which are highly overexpressed in advanced malignancy. While original chemotherapy drugs were modeled after phytochemicals elucidated by botanical screenings, HDAC inhibitors (HDACi) such as apicidin, trichostatin A (TSA) and butyrate were discovered as products of fungus and microbes, in particular, gut microbiota. Therefore, a persistent question remains as to the inherent existence of HDACis in raw undigested dietary plant material. In this study, we conduct a high-throughput (HTP) screening of ~1,600 non-fermented commonly used nutraceuticals (spices, herbs, teas, vegetables, fruits, seeds, rinds etc.) at (HeLa cell lysates. Human HDAC kinetic validation was performed using a standard fluorometric activity assay, followed by an enzymatic-linked immuno-captured ELISA. Both methods were verified using HDACi panel drugs: TSA, apicidin, suberohydroxamic acid, M344, CL-994, valproic acid and sodium phenylbutyrate. The HTP screening was then conducted, followed by a study comparing biological effects of HDACis in HeLa cells, including analysis of whole-transcriptome non-coding RNAs using Affymetrix miRNA 4.1-panel arrays. The HTP screening results confirmed 44/1600 as potential HDACis to which 31 were further eliminated as false-positives. Methodological challenges/concerns are addressed regarding plant product false-positives that arise from the signal reduction of commercial lysine development reagents. Only 13 HDACis were found having an IC 50 under HeLa cells, where the data suggest predominant effects are anti-mitotic rather than cytotoxic. Lastly, differential effects of TSA vs. GSE at sub-lethal concentrations tested on HeLa cells show 6,631 miRNAs expressed in resting cells, 35 significantly up-regulated (TSA) and 81 up-regulated (GSE

  6. Identification and characterization of a DNA primase activity present in herpes simplex virus type 1-infected HeLa cells

    International Nuclear Information System (INIS)

    Holmes, A.M.; Wietstock, S.M.; Ruyechan, W.T.

    1988-01-01

    A novel DNA primase activity has been identified in HeLa cells infected with herpes simplex virus type 1 (HSV-1). Such an activity has not been detected in mock-infected cells. The primase activity coeluted with a portion of HSV-1 DNA polymerase from single-stranded DNA agarose columns loaded with high-salt extracts derived from infected cells. This DNA primase activity could be distinguished from host HeLa cell DNA primase by several criteria. First, the pH optimum of the HSV primase was relatively broad and peaked at 8.2 to 8.7 pH units. Second, freshly isolated HSV DNA primase was less salt sensitive than the HeLa primase. Third, antibodies raised against individual peptides of the calf thymus DNA polymerase:primase complex cross-reacted with the HeLa primase but did not react with the HSV DNA primase. Fourth, freshly prepared HSV DNA primase appeared to be associated with the HSV polymerase, but after storage at 4 degree C for several weeks, the DNA primase separated from the viral DNA polymerase. This free DNA primase had an apparent molecular size of approximately 40 kilodaltons, whereas free HeLa DNA primase had an apparent molecular size of approximately 110 kilodaltons. On the basis of these data, the authors believe that the novel DNA primase activity in HSV-infected cells may be virus coded and that this enzyme represents a new and important function involved in the replication of HSV DNA

  7. On enhancing drugs effect on radiosensitivity of HeLa cells by inhibiting P13K/Akt signal transduction

    International Nuclear Information System (INIS)

    Xia Shu; Yu Shiying

    2006-01-01

    Objective: To explore the mechanism of PI3K/Akt in radiosensitization of docetaxel and cisplatin by inhibiting PI3K/Akt pathway in HeLa cells. Methods: To detect the 50% inhibition concentration (IC 50 ) of cisplatin and docetaxel in Hela cells by mono-nuclear cell direct cytotoxicity assay (MTT) in vitro. Using the IC 20 of cisplatin and docetaxel in Hela cell or in association with LY294002 for 24 h, then, the cells were irradiated by X-ray with 2,3,4,6,8 Gy. The cell survival fraction was computed by clone formation. Cell survival curve was fitted by multitarget one-hit model, and D q , D 0 , SF 2 , sensitizing enhancing ratio(SER) was calculated. The expression of pAkt and total Akt by western blot were detected. Apoptosis was detected by flow cytometry. Results: 1. Docetaxel and cisplatin improved the phosphorylation of Akt by irradiation obviously. 2. The SER of docetaxel + LY294002 + irradiation group (1.92) was higher than that of docetaxel + irradiation group(1.41). The SER of cisplatin + LY294002 + irradiation group(1.71) was higher than the cisplatin + irradiation group (1.37). 3. Apoptosis rate of docetaxel + LY294002 + irradiation and cisplatin + LY294002 + irradiation groups(12.5%, 10.2%) were higher than those of docetaxel + irradiation and cisplatin + irradiation groups(6.1%, 5.1%). Conclusions: PI3K/Akt signal transduction activation may be as an important reason of radiosensitization reduction of docetaxel and cisplatin in the HeLa cells. Our results show that inhibiting PI3K/Akt can improve the radiosensitization of docetaxel and cisplatin in the HeLa cells. (authors)

  8. Phosphorylated Akt Protein at Ser473 Enables HeLa Cells to Tolerate Nutrient-Deprived Conditions

    Science.gov (United States)

    Fathy, Moustafa; Awale, Suresh; Nikaido, Toshio

    2017-12-29

    Background: Despite angiogenesis, many tumours remain hypovascular and starved of nutrients while continuing to grow rapidly. The specific biochemical mechanisms associated with starvation resistance, austerity, may be new biological characters of cancer that are critical for cancer progression. Objective: This study aim was to investigate the effect of nutrient starvation on HeLa cells and the possible mechanism by which the cells are able to tolerate nutrient-deprived conditions. Methods: Nutrient starvation was achieved by culturing HeLa cells in nutrient-deprived medium (NDM) and cell survival was estimated by using cell counting kit-8. The effect of starvation on cell cycle distribution and the quantitative analysis of apoptotic cells were investigated by flow cytometry using propidium iodide staining. Western blotting was used to detect the expression levels of Akt and phosphorylated Akt at Ser473 (Ser473p-Akt) proteins. Results: HeLa cells displayed extremely long survival when cultured in NDM. The percentage of apoptotic HeLa cells was significantly increased by starvation in a time-dependent manner. A significant increase in the expression of Ser473p-Akt protein after starvation was also observed. Furthermore, it was found that Akt inhibitor III molecule inhibited the cells proliferation in a concentration- and time-dependent manner. Conclusion: Results of the present study provide evidence that Akt activation may be implicated in the tolerance of HeLa cells for nutrient starvation and may help to suggest new therapeutic strategies designed to prevent austerity of cervical cancer cells through inhibition of Akt activation. Creative Commons Attribution License

  9. LyGDI expression in HeLa cells increased its sensitivity to radiation-induced apoptosis

    International Nuclear Information System (INIS)

    Zhou Xinwen; Xu Yaxiang

    2006-01-01

    Objective: In order to confirm whether LyGDI has apoptotic signal transduction function and can increase the apoptotic rate of radiation-induced cell death, the lyGDI and mutant D19lyGDI gene, which constructed with the pCDNA3. 1 His A, were transfected into no-endogenous lyGDI HeLa cells. Methods Transient expressions of lyGDI and D19lyGDI in HeLa cells were analyzed by Western blot using anti-mono antibody of LyGDI and Xpress tag. Cell apoptosis was assayed with Annexin V-FITC apoptosis kit. To select stable clone, the transferred HeLa cells had been maintained in G418 medium for 3 weeks, then a cell line, which stably expressed LyGDI and mutant D19lyGDI, was selected. The selected cell line was irradiated with 12 Gy 60 Co y-rays. Caspase-3 activity of the cells was determined by Western blot and cell viability by clone-forming assay after 48 hours post-irradiation culture. Results: Western blot and Annexin V-FITC apoptotic analysis revealed that lyGDI and D19lyGDI transient expressions in HeLa cells induced apoptosis; Caspase-3 activity measurement and clone-forming assay showed that lyGDI increased sensitivity to radiation-induced cell apoptosis. Conclusions: lyGDI performs function in apoptosis signal transduction, its expression in HeLa cells can increase the sensitivity to radiation-induced cell apoptosis. (authors)

  10. PARP-1 depletion in combination with carbon ion exposure significantly reduces MMPs activity and overall increases TIMPs expression in cultured HeLa cells

    International Nuclear Information System (INIS)

    Ghorai, Atanu; Sarma, Asitikantha; Chowdhury, Priyanka; Ghosh, Utpal

    2016-01-01

    Hadron therapy is an innovative technique where cancer cells are precisely killed leaving surrounding healthy cells least affected by high linear energy transfer (LET) radiation like carbon ion beam. Anti-metastatic effect of carbon ion exposure attracts investigators into the field of hadron biology, although details remain poor. Poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors are well-known radiosensitizer and several PARP-1 inhibitors are in clinical trial. Our previous studies showed that PARP-1 depletion makes the cells more radiosensitive towards carbon ion than gamma. The purpose of the present study was to investigate combining effects of PARP-1 inhibition with carbon ion exposure to control metastatic properties in HeLa cells. Activities of matrix metalloproteinases-2, 9 (MMP-2, MMP-9) were measured using the gelatin zymography after 85 MeV carbon ion exposure or gamma irradiation (0- 4 Gy) to compare metastatic potential between PARP-1 knock down (HsiI) and control cells (H-vector - HeLa transfected with vector without shRNA construct). Expression of MMP-2, MMP-9, tissue inhibitor of MMPs such as TIMP-1, TIMP-2 and TIMP-3 were checked by immunofluorescence and western blot. Cell death by trypan blue, apoptosis and autophagy induction were studied after carbon ion exposure in each cell-type. The data was analyzed using one way ANOVA and 2-tailed paired-samples T-test. PARP-1 silencing significantly reduced MMP-2 and MMP-9 activities and carbon ion exposure further diminished their activities to less than 3 % of control H-vector. On the contrary, gamma radiation enhanced both MMP-2 and MMP-9 activities in H-vector but not in HsiI cells. The expression of MMP-2 and MMP-9 in H-vector and HsiI showed different pattern after carbon ion exposure. All three TIMPs were increased in HsiI, whereas only TIMP-1 was up-regulated in H-vector after irradiation. Notably, the expressions of all TIMPs were significantly higher in HsiI than H-vector at 4 Gy. Apoptosis was

  11. Facilitating RNA structure prediction with microarrays.

    Science.gov (United States)

    Kierzek, Elzbieta; Kierzek, Ryszard; Turner, Douglas H; Catrina, Irina E

    2006-01-17

    Determining RNA secondary structure is important for understanding structure-function relationships and identifying potential drug targets. This paper reports the use of microarrays with heptamer 2'-O-methyl oligoribonucleotides to probe the secondary structure of an RNA and thereby improve the prediction of that secondary structure. When experimental constraints from hybridization results are added to a free-energy minimization algorithm, the prediction of the secondary structure of Escherichia coli 5S rRNA improves from 27 to 92% of the known canonical base pairs. Optimization of buffer conditions for hybridization and application of 2'-O-methyl-2-thiouridine to enhance binding and improve discrimination between AU and GU pairs are also described. The results suggest that probing RNA with oligonucleotide microarrays can facilitate determination of secondary structure.

  12. Intelligent Diagnostic Assistant for Complicated Skin Diseases through C5's Algorithm.

    Science.gov (United States)

    Jeddi, Fatemeh Rangraz; Arabfard, Masoud; Kermany, Zahra Arab

    2017-09-01

    Intelligent Diagnostic Assistant can be used for complicated diagnosis of skin diseases, which are among the most common causes of disability. The aim of this study was to design and implement a computerized intelligent diagnostic assistant for complicated skin diseases through C5's Algorithm. An applied-developmental study was done in 2015. Knowledge base was developed based on interviews with dermatologists through questionnaires and checklists. Knowledge representation was obtained from the train data in the database using Excel Microsoft Office. Clementine Software and C5's Algorithms were applied to draw the decision tree. Analysis of test accuracy was performed based on rules extracted using inference chains. The rules extracted from the decision tree were entered into the CLIPS programming environment and the intelligent diagnostic assistant was designed then. The rules were defined using forward chaining inference technique and were entered into Clips programming environment as RULE. The accuracy and error rates obtained in the training phase from the decision tree were 99.56% and 0.44%, respectively. The accuracy of the decision tree was 98% and the error was 2% in the test phase. Intelligent diagnostic assistant can be used as a reliable system with high accuracy, sensitivity, specificity, and agreement.

  13. Spondylolysis and End Plate Arthrosis at L5-S1: A Cadaveric Study.

    Science.gov (United States)

    McCunniff, Peter T; Yoo, Hojun; Yu, Charles; Bajwa, Navkirat S; Toy, Jason O; Ahn, Uri M; Ahn, Nicholas

    2017-01-01

    This study examined the effect of bilateral and unilateral L5 pars defects on the degree of disk degeneration at the L5-S1 level in cadaveric specimens. An observational study was performed of 690 cadaveric specimens selected at random. These specimens represent individuals who died between 1893 and 1938. The study included 558 male and 132 female cadavers. Of the 120 specimens with L5 spondylolysis, 95 cases were bilateral and 25 were unilateral. The remaining 544 specimens were used as the control cohort. Degenerative disk disease was measured by the classification of Eubanks et al. According to this classification, degenerative disk disease was graded from no arthrosis (grade 0) to complete ankylosis (grade IV). Linear regression analysis corrected for age, sex, and race showed that subjects with bilateral spondylolysis at L5 had a statistically significant increase in the amount of disk degeneration (P=.02) compared with those with unilateral lesions. Student's t tests showed significant differences (Pspondylolysis above what would be predicted in the normal control population. A positive correlation was found between the number of pars defects at L5 and the degree of disk degeneration at L5-S1. These results support the idea that individuals with spondylolysis at these levels may be at increased risk for development of low back pain and reduced quality of life. [Orthopedics. 2017; 40(1):e59-e64.]. Copyright 2016, SLACK Incorporated.

  14. Extrachromosomal circles of satellite repeats and 5S ribosomal DNA in human cells

    Directory of Open Access Journals (Sweden)

    Cohen Sarit

    2010-03-01

    Full Text Available Abstract Background Extrachomosomal circular DNA (eccDNA is ubiquitous in eukaryotic organisms and was detected in every organism tested, including in humans. A two-dimensional gel electrophoresis facilitates the detection of eccDNA in preparations of genomic DNA. Using this technique we have previously demonstrated that most of eccDNA consists of exact multiples of chromosomal tandemly repeated DNA, including both coding genes and satellite DNA. Results Here we report the occurrence of eccDNA in every tested human cell line. It has heterogeneous mass ranging from less than 2 kb to over 20 kb. We describe eccDNA homologous to human alpha satellite and the SstI mega satellite. Moreover, we show, for the first time, circular multimers of the human 5S ribosomal DNA (rDNA, similar to previous findings in Drosophila and plants. We further demonstrate structures that correspond to intermediates of rolling circle replication, which emerge from the circular multimers of 5S rDNA and SstI satellite. Conclusions These findings, and previous reports, support the general notion that every chromosomal tandem repeat is prone to generate eccDNA in eukryoric organisms including humans. They suggest the possible involvement of eccDNA in the length variability observed in arrays of tandem repeats. The implications of eccDNA on genome biology may include mechanisms of centromere evolution, concerted evolution and homogenization of tandem repeats and genomic plasticity.

  15. Condurango (Gonolobus condurango Extract Activates Fas Receptor and Depolarizes Mitochondrial Membrane Potential to Induce ROS-dependent Apoptosis in Cancer Cells in vitro CE-treatment on HeLa: a ROS-dependent mechanism

    Directory of Open Access Journals (Sweden)

    Kausik Bishayee

    2015-09-01

    Full Text Available Objectives: Condurango (Gonolobus condurango extract is used by complementary and alternative medicine (CAM practitioners as a traditional medicine, including homeopathy, mainly for the treatment of syphilis. Condurango bark extract is also known to reduce tumor volume, but the underlying molecular mechanisms still remain unclear. Methods: Using a cervical cancer cell line (HeLa as our model, the molecular events behind condurango extract’s (CE’s anticancer effect were investigated by using flow cytometry, immunoblotting and reverse transcriptase-polymerase chain reaction (RT-PCR. Other included cell types were prostate cancer cells (PC3, transformed liver cells (WRL-68, and peripheral blood mononuclear cells (PBMCs. Results: Condurango extract (CE was found to be cytotoxic against target cells, and this was significantly deactivated in the presence of N-acetyl cysteine (NAC, a scavenger of reactive oxygen species (ROS, suggesting that its action could be mediated through ROS generation. CE caused an increase in the HeLa cell population containing deoxyribonucleic acid (DNA damage at the G zero/Growth 1 (G0/G1 stage. Further, CE increased the tumor necrosis factor alpha (TNF-α and the fas receptor (FasR levels both at the ribonucleic acid (RNA and the protein levels, indicating that CE might have a cytotoxic mechanism of action. CE also triggered a sharp decrease in the expression of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB both at the RNA and the protein levels, a possible route to attenuation of B-cell lymphoma 2 (Bcl-2, and caused an opening of the mitochondrial membrane’s permeability transition (MPT pores, thus enhancing caspase activities. Conclusion: Overall, our results suggest possible pathways for CE mediated cytotoxicity in model cancer cells.

  16. Neutral Polymeric Micelles for RNA Delivery

    Science.gov (United States)

    Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.

    2013-01-01

    RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates

  17. Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

    International Nuclear Information System (INIS)

    Sharma, M.K.; Tauheed, A.; Rahimullah, K.

    2014-01-01

    The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

  18. Hyperfine structure in 5s4d [sup 3]D-5snf transitions of [sup 87]Sr

    Energy Technology Data Exchange (ETDEWEB)

    Bushaw, B.A. (Pacific Northwest Lab., Richland, WA (United States)); Kluge, H.J. (Mainz Univ. (Germany). Inst. fuer Physik); Lantzsch, J. (Mainz Univ. (Germany). Inst. fuer Physik); Schwalbach, R. (Mainz Univ. (Germany). Inst. fuer Physik); Stenner, J. (Mainz Univ. (Germany). Inst. fuer Physik); Stevens, H. (Mainz Univ. (Germany). Inst. fuer Physik); Wendt, K. (Mainz Univ. (Germany). Inst. fuer Physik); Zimmer, K. (Mainz Univ. (Germany). Inst. fuer Physik)

    1993-12-01

    The hyperfine spectra of the 5s4d[sup 3]D[sub 1]-5s20f, 5s4d[sup 3]D[sub 2]-5s23f, and 5s4d[sup 3]D[sub 3]-5s32f transitions of [sup 87]Sr (I=9/2) have been measured by collinear fast beam laser spectroscopy. The structure in the upper configurations is highly perturbed by fine structure splitting that is of comparable size to the hyperfine interaction energy. These perturbations can be adequately treated with conventional matrix diagonalization methods, using the 5s-electron magnetic dipole interaction term a[sub 5s] and the unperturbed fine structure splittings as input parameters. Additionally, hyperfine constants for the lower 5s4d[sup 3]D configurations, including the A- and B-factors and a separation of the individual s- and d-electron contributions to these factors, are derived. (orig.)

  19. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  20. Study on effect of artemisinin combined with 60Co γ-ray on DNA damage in HeLa and SiHa cells

    International Nuclear Information System (INIS)

    Feng Yang; Zhou Yuanyuan; Yang Wei; Chen Qiu; Li Ming; Zhang Shuyu; Zhu Wei; Cao Jianping; Zhang Xuguang

    2011-01-01

    Objective: To investigate the effect of Artemisinin combined with 60 Co γ-ray on DNA damage in HeLa and SiHa cells of human cervical cancer. Methods: Cell growth kinetics was evaluated by MTT assay to determine the most appropriate drug concentration. Effects of Artemisinin combined with 60 Co γ-ray on DNA damage in HeLa and SiHa cel