WorldWideScience

Sample records for hedgehog-dependent full-length gli3

  1. Full length prototype SSC dipole test results

    Strait, J.; Brown, B.C.; Carson, J.

    1987-01-01

    Results are presented from tests of the first full length prototype SSC dipole magnet. The cryogenic behavior of the magnet during a slow cooldown to 4.5K and a slow warmup to room temperature has been measured. Magnetic field quality was measured at currents up to 2000 A. Averaged over the body field all harmonics with the exception of b 2 and b 8 are at or within the tolerances specified by the SSC Central Design Group. (The values of b 2 and b 8 result from known design and construction defects which will be be corrected in later magnets.) Using an NMR probe the average body field strength is measured to be 10.283 G/A with point to point variations on the order of one part in 1000. Data are presented on quench behavior of the magnet up to 3500 A (approximately 55% of full field) including longitudinal and transverse velocities for the first 250 msec of the quench

  2. GLI3 Links Environmental Arsenic Exposure and Human Fetal Growth

    Emily F. Winterbottom

    2015-06-01

    Full Text Available Although considerable evidence suggests that in utero arsenic exposure affects children's health, these data are mainly from areas of the world where groundwater arsenic levels far exceed the World Health Organization limit of 10 μg/L. We, and others, have found that more common levels of in utero arsenic exposure may also impact children's health. However, the underlying molecular mechanisms are poorly understood. To address this issue, we analyzed the expression of key developmental genes in fetal placenta in a birth cohort of women using unregulated water supplies in a US region with elevated groundwater arsenic. We identified several genes whose expression associated with maternal arsenic exposure in a fetal sex-specific manner. In particular, expression of the HEDGEHOG pathway component, GLI3, in female placentae was both negatively associated with arsenic exposure and positively associated with infant birth weight. This suggests that modulation of GLI3 in the fetal placenta, and perhaps in other fetal tissues, contributes to arsenic's detrimental effects on fetal growth. We showed previously that arsenic-exposed NIH3T3 cells have reduced GLI3 repressor protein. Together, these studies identify GLI3 as a key signaling node that is affected by arsenic, mediating a subset of its effects on developmental signaling and fetal health.

  3. A Novel Gli3 Enhancer Controls the Gli3 Spatiotemporal Expression Pattern through a TALE Homeodomain Protein Binding Site ▿‡

    Coy, Sarah; Caamaño, Jorge H.; Carvajal, Jaime; Cleary, Michael L.; Borycki, Anne-Gaëlle

    2011-01-01

    The zinc finger transcription factor Gli3 is an essential mediator of hedgehog signaling. Gli3 has a dynamic expression pattern during embryonic development. In the neural tube, Gli3 transcripts are patterned along the anteroposterior and dorsoventral axes such that the initial broad expression in the posterior neural tube becomes dorsally restricted as neurogenesis takes place. Little is known about the molecular mechanisms that regulate this dynamic expression. Here, we report on a phylogen...

  4. Full-length fuel rod behavior under severe accident conditions

    Lombardo, N.J.; Lanning, D.D.; Panisko, F.E.

    1992-12-01

    This document presents an assessment of the severe accident phenomena observed from four Full-Length High-Temperature (FLHT) tests that were performed by the Pacific Northwest Laboratory (PNL) in the National Research Universal (NRU) reactor at Chalk River, Ontario, Canada. These tests were conducted for the US Nuclear Regulatory Commission (NRC) as part of the Severe Accident Research Program. The objectives of the test were to simulate conditions and provide information on the behavior of full-length fuel rods during hypothetical, small-break, loss-of-coolant severe accidents, in commercial light water reactors

  5. A comparative phylogenetic analysis of full-length mariner elements

    Mariner like elements (MLEs) are widely distributed type II transposons with an open reading frame (ORF) for transposase. We studied comparative phylogenetic evolution and inverted terminal repeat (ITR) conservation of MLEs from Indian saturniid silkmoth, Antheraea mylitta with other full length MLEs submitted in the ...

  6. Irradiation performance of full-length metallic IFR fuels

    Tsai, H.; Neimark, L.A.

    1992-07-01

    An assembly irradiation of 169 full-length U-Pu-Zr metallic fuel pins was successfully completed in FFTF to a goal burnup of 10 at.%. All test fuel pins maintained their cladding integrity during the irradiation. Postirradiation examination showed minimal fuel/cladding mechanical interaction and excellent stability of the fuel column. Fission-gas release was normal and consistent with the existing data base from irradiation testing of shorter metallic fuel pins in EBR-II

  7. Gli3 is a negative regulator of Tas1r3-expressing taste cells

    Jyotaki, Masafumi; Redding, Kevin; Jiang, Peihua

    2018-01-01

    Mouse taste receptor cells survive from 3–24 days, necessitating their regeneration throughout adulthood. In anterior tongue, sonic hedgehog (SHH), released by a subpopulation of basal taste cells, regulates transcription factors Gli2 and Gli3 in stem cells to control taste cell regeneration. Using single-cell RNA-Seq we found that Gli3 is highly expressed in Tas1r3-expressing taste receptor cells and Lgr5+ taste stem cells in posterior tongue. By PCR and immunohistochemistry we found that Gli3 was expressed in taste buds in all taste fields. Conditional knockout mice lacking Gli3 in the posterior tongue (Gli3CKO) had larger taste buds containing more taste cells than did control wild-type (Gli3WT) mice. In comparison to wild-type mice, Gli3CKO mice had more Lgr5+ and Tas1r3+ cells, but fewer type III cells. Similar changes were observed ex vivo in Gli3CKO taste organoids cultured from Lgr5+ taste stem cells. Further, the expression of several taste marker and Gli3 target genes was altered in Gli3CKO mice and/or organoids. Mirroring these changes, Gli3CKO mice had increased lick responses to sweet and umami stimuli, decreased lick responses to bitter and sour taste stimuli, and increased glossopharyngeal taste nerve responses to sweet and bitter compounds. Our results indicate that Gli3 is a suppressor of stem cell proliferation that affects the number and function of mature taste cells, especially Tas1r3+ cells, in adult posterior tongue. Our findings shed light on the role of the Shh pathway in adult taste cell regeneration and may help devise strategies for treating taste distortions from chemotherapy and aging. PMID:29415007

  8. Technology development for gene discovery and full-length sequencing

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  9. Full-length Ebola glycoprotein accumulates in the endoplasmic reticulum

    Bhattacharyya Suchita

    2011-01-01

    Full Text Available Abstract The Filoviridae family comprises of Ebola and Marburg viruses, which are known to cause lethal hemorrhagic fever. However, there is no effective anti-viral therapy or licensed vaccines currently available for these human pathogens. The envelope glycoprotein (GP of Ebola virus, which mediates entry into target cells, is cytotoxic and this effect maps to a highly glycosylated mucin-like region in the surface subunit of GP (GP1. However, the mechanism underlying this cytotoxic property of GP is unknown. To gain insight into the basis of this GP-induced cytotoxicity, HEK293T cells were transiently transfected with full-length and mucin-deleted (Δmucin Ebola GP plasmids and GP localization was examined relative to the nucleus, endoplasmic reticulum (ER, Golgi, early and late endosomes using deconvolution fluorescent microscopy. Full-length Ebola GP was observed to accumulate in the ER. In contrast, GPΔmucin was uniformly expressed throughout the cell and did not localize in the ER. The Ebola major matrix protein VP40 was also co-expressed with GP to investigate its influence on GP localization. GP and VP40 co-expression did not alter GP localization to the ER. Also, when VP40 was co-expressed with the nucleoprotein (NP, it localized to the plasma membrane while NP accumulated in distinct cytoplasmic structures lined with vimentin. These latter structures are consistent with aggresomes and may serve as assembly sites for filoviral nucleocapsids. Collectively, these data suggest that full-length GP, but not GPΔmucin, accumulates in the ER in close proximity to the nuclear membrane, which may underscore its cytotoxic property.

  10. Simulations of The Dalles Dam Proposed Full Length Spillwall

    Rakowski, Cynthia L.; Perkins, William A.; Richmond, Marshall C.; Serkowski, John A.

    2008-02-25

    This report presents results of a computational fluid dynamics (CFD) modeling study to evaluatethe impacts of a full-length spillwall at The Dalles Dam. The full-length spillwall is being designed and evaluated as a structural means to improve tailrace egress and thus survival of juvenile fish passing through the spillway. During the course of this study, a full-length spillwall at Bays 6/7 and 8/9 were considered. The U.S. Army Corps of Engineers (USACE) has proposed extending the spillwall constructed in the stilling basin between spillway Bays 6 and 7 about 590 ft farther downstream. It is believed that the extension of the spillwall will improve egress conditions for downstream juvenile salmonids by moving them more rapidly into the thalweg of the river hence reducing their exposure to predators. A numerical model was created, validated, and applied the The Dalles Dam tailrace. The models were designed to assess impacts to flow, tailrace egress, navigation, and adult salmon passage of a proposed spill wall extension. The more extensive model validation undertaken in this study greatly improved our confidence in the numerical model to represent the flow conditions in The Dalles tailrace. This study used these validated CFD models to simulate the potential impacts of a spillwall extension for The Dalles Dam tailrace for two locations. We determined the following: (1)The construction of an extended wall (between Bays 6/7) will not adversely impact entering or exiting the navigation lock. Impact should be less if a wall were constructed between Bays 8/9. (2)The construction of a wall between Bays 6/7 will increase the water surface elevation between the wall and the Washington shore. Although the increased water surface elevation would be beneficial to adult upstream migrants in that it decreases velocities on the approach to the adult ladder, the increased flow depth would enhance dissolved gas production, impacting potential operations of the project because of

  11. Full length channel Pressure Tube sagging under completely voided full length pressure tube of an Indian PHWR

    Negi, Sujay, E-mail: negi.sujay@gmail.com [Indian Institute of Technology, Roorkee 247667 (India); Kumar, Ravi, E-mail: ravikfme@gmail.com [Indian Institute of Technology, Roorkee 247667 (India); Majumdar, P., E-mail: pmajum@barc.gov.in [Bhabha Atomic Research Centre, Mumbai 400085 (India); Mukopadhyay, D., E-mail: dmukho@barc.gov.in [Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2017-03-15

    Highlights: • At 16 kW/m input, thermal stability was attained at 595 °C, without PT-CT contact. • At 20 kW/m step input, PT-CT contact occurred at 637 °C near bottom-center of the tube. • PT integrity was maintained throughout the experiment. - Abstract: An experimental investigation was conducted to simulate the sagging behavior of a full length Pressure Tube of a channel of 220 MWe Indian PHWR. The investigation aimed to recreate a condition resembling Loss of Coolant Accident (LOCA) with Emergency Core Cooling System (ECCS) failure in a nuclear power plant. A full length channel assembly immersed in moderator was subjected to electrical resistance heating of Pressure Tube (PT) to simulate the residual heat after shutting down of reactor. The temperature of PT started rising and the contact between PT and CT was established at the center of the tube where average bottom temperature was 637 °C. The integrity of PT was maintained throughout the experiment and the PT heat up was arrested on contact with the CT due to transfer of heat to the moderator.

  12. Gli3 Regulation of Myogenesis Is Necessary for Ischemia-Induced Angiogenesis

    Renault, Marie-Ange; Vandierdonck, Soizic; Chapouly, Candice; Yu, Yang; Qin, Gangjian; Metras, Alexandre; Couffinhal, Thierry; Losordo, Douglas W.; Yao, Qinyu; Reynaud, Annabel; Jaspard-Vinassa, Béatrice; Belloc, Isabelle; Desgranges, Claude; Gadeau, Alain-Pierre

    2015-01-01

    Rationale A better understanding of the mechanism underlying skeletal muscle repair is required to develop therapies that promote tissue regeneration in adults. Hedgehog signaling has been shown previously to be involved in myogenesis and angiogenesis: 2 crucial processes for muscle development and regeneration. Objective The objective of this study was to identify the role of the hedgehog transcription factor Gli3 in the crosstalk between angiogenesis and myogenesis in adults. Methods and Results Using conditional knockout mice, we found that Gli3 deficiency in endothelial cells did not affect ischemic muscle repair, whereas in myocytes, Gli3 deficiency resulted in severely delayed ischemia-induced myogenesis. Moreover, angiogenesis was also significantly impaired in HSA-CreERT2; Gli3Flox/Flox mice, demonstrating that impaired myogenesis indirectly affects ischemia-induced angiogenesis. The role of Gli3 in myocytes was then further investigated. We found that Gli3 promotes myoblast differentiation through myogenic factor 5 regulation. In addition, we found that Gli3 regulates several proangiogenic factors, including thymidine phosphorylase and angiopoietin-1 both in vitro and in vivo, which indirectly promote endothelial cell proliferation and arteriole formation. In addition, we found that Gli3 is upregulated in proliferating myoblasts by the cell cycle–associated transcription factor E2F1. Conclusions This study shows for the first time that Gli3-regulated postnatal myogenesis is necessary for muscle repair–associated angiogenesis. Most importantly, it implies that myogenesis drives angiogenesis in the setting of skeletal muscle repair and identifies Gli3 as a potential target for regenerative medicine. PMID:24044950

  13. New insights into genotype-phenotype correlation for GLI3 mutations.

    Démurger, Florence; Ichkou, Amale; Mougou-Zerelli, Soumaya; Le Merrer, Martine; Goudefroye, Géraldine; Delezoide, Anne-Lise; Quélin, Chloé; Manouvrier, Sylvie; Baujat, Geneviève; Fradin, Mélanie; Pasquier, Laurent; Megarbané, André; Faivre, Laurence; Baumann, Clarisse; Nampoothiri, Sheela; Roume, Joëlle; Isidor, Bertrand; Lacombe, Didier; Delrue, Marie-Ange; Mercier, Sandra; Philip, Nicole; Schaefer, Elise; Holder, Muriel; Krause, Amanda; Laffargue, Fanny; Sinico, Martine; Amram, Daniel; André, Gwenaelle; Liquier, Alain; Rossi, Massimiliano; Amiel, Jeanne; Giuliano, Fabienne; Boute, Odile; Dieux-Coeslier, Anne; Jacquemont, Marie-Line; Afenjar, Alexandra; Van Maldergem, Lionel; Lackmy-Port-Lis, Marylin; Vincent-Delorme, Catherine; Chauvet, Marie-Liesse; Cormier-Daire, Valérie; Devisme, Louise; Geneviève, David; Munnich, Arnold; Viot, Géraldine; Raoul, Odile; Romana, Serge; Gonzales, Marie; Encha-Razavi, Ferechte; Odent, Sylvie; Vekemans, Michel; Attie-Bitach, Tania

    2015-01-01

    The phenotypic spectrum of GLI3 mutations includes autosomal dominant Greig cephalopolysyndactyly syndrome (GCPS) and Pallister-Hall syndrome (PHS). PHS was first described as a lethal condition associating hypothalamic hamartoma, postaxial or central polydactyly, anal atresia and bifid epiglottis. Typical GCPS combines polysyndactyly of hands and feet and craniofacial features. Genotype-phenotype correlations have been found both for the location and the nature of GLI3 mutations, highlighting the bifunctional nature of GLI3 during development. Here we report on the molecular and clinical study of 76 cases from 55 families with either a GLI3 mutation (49 GCPS and 21 PHS), or a large deletion encompassing the GLI3 gene (6 GCPS cases). Most of mutations are novel and consistent with the previously reported genotype-phenotype correlation. Our results also show a correlation between the location of the mutation and abnormal corpus callosum observed in some patients with GCPS. Fetal PHS observations emphasize on the possible lethality of GLI3 mutations and extend the phenotypic spectrum of malformations such as agnathia and reductional limbs defects. GLI3 expression studied by in situ hybridization during human development confirms its early expression in target tissues.

  14. New insights into genotype–phenotype correlation for GLI3 mutations

    Démurger, Florence; Ichkou, Amale; Mougou-Zerelli, Soumaya; Le Merrer, Martine; Goudefroye, Géraldine; Delezoide, Anne-Lise; Quélin, Chloé; Manouvrier, Sylvie; Baujat, Geneviève; Fradin, Mélanie; Pasquier, Laurent; Megarbané, André; Faivre, Laurence; Baumann, Clarisse; Nampoothiri, Sheela; Roume, Joëlle; Isidor, Bertrand; Lacombe, Didier; Delrue, Marie-Ange; Mercier, Sandra; Philip, Nicole; Schaefer, Elise; Holder, Muriel; Krause, Amanda; Laffargue, Fanny; Sinico, Martine; Amram, Daniel; André, Gwenaelle; Liquier, Alain; Rossi, Massimiliano; Amiel, Jeanne; Giuliano, Fabienne; Boute, Odile; Dieux-Coeslier, Anne; Jacquemont, Marie-Line; Afenjar, Alexandra; Van Maldergem, Lionel; Lackmy-Port-Lis, Marylin; Vincent- Delorme, Catherine; Chauvet, Marie-Liesse; Cormier-Daire, Valérie; Devisme, Louise; Geneviève, David; Munnich, Arnold; Viot, Géraldine; Raoul, Odile; Romana, Serge; Gonzales, Marie; Encha-Razavi, Ferechte; Odent, Sylvie; Vekemans, Michel; Attie-Bitach, Tania

    2015-01-01

    The phenotypic spectrum of GLI3 mutations includes autosomal dominant Greig cephalopolysyndactyly syndrome (GCPS) and Pallister–Hall syndrome (PHS). PHS was first described as a lethal condition associating hypothalamic hamartoma, postaxial or central polydactyly, anal atresia and bifid epiglottis. Typical GCPS combines polysyndactyly of hands and feet and craniofacial features. Genotype–phenotype correlations have been found both for the location and the nature of GLI3 mutations, highlighting the bifunctional nature of GLI3 during development. Here we report on the molecular and clinical study of 76 cases from 55 families with either a GLI3 mutation (49 GCPS and 21 PHS), or a large deletion encompassing the GLI3 gene (6 GCPS cases). Most of mutations are novel and consistent with the previously reported genotype–phenotype correlation. Our results also show a correlation between the location of the mutation and abnormal corpus callosum observed in some patients with GCPS. Fetal PHS observations emphasize on the possible lethality of GLI3 mutations and extend the phenotypic spectrum of malformations such as agnathia and reductional limbs defects. GLI3 expression studied by in situ hybridization during human development confirms its early expression in target tissues. PMID:24736735

  15. Copper Coordination in the Full-Length, Recombinant Prion Protein†

    Burns, Colin S.; Aronoff-Spencer, Eliah; Legname, Giuseppe; Prusiner, Stanley B.; Antholine, William E.; Gerfen, Gary J.; Peisach, Jack; Millhauser, Glenn L.

    2010-01-01

    The prion protein (PrP) binds divalent copper at physiologically relevant conditions and is believed to participate in copper regulation or act as a copper-dependent enzyme. Ongoing studies aim at determining the molecular features of the copper binding sites. The emerging consensus is that most copper binds in the octarepeat domain, which is composed of four or more copies of the fundamental sequence PHGGGWGQ. Previous work from our laboratory using PrP-derived peptides, in conjunction with EPR and X-ray crystallography, demonstrated that the HGGGW segment constitutes the fundamental binding unit in the octarepeat domain [Burns et al. (2002) Biochemistry 41, 3991–4001; Aronoff-Spencer et al. (2000) Biochemistry 39, 13760–13771]. Copper coordination arises from the His imidazole and sequential deprotonated glycine amides. In this present work, recombinant, full-length Syrian hamster PrP is investigated using EPR methodologies. Four copper ions are taken up in the octarepeat domain, which supports previous findings. However, quantification studies reveal a fifth binding site in the flexible region between the octarepeats and the PrP globular C-terminal domain. A series of PrP peptide constructs show that this site involves His96 in the PrP(92–96) segment GGGTH. Further examination by X-band EPR, S-band EPR, and electron spin–echo envelope spectroscopy, demonstrates coordination by the His96 imidazole and the glycine preceding the threonine. The copper affinity for this type of binding site is highly pH dependent, and EPR studies here show that recombinant PrP loses its affinity for copper below pH 6.0. These studies seem to provide a complete profile of the copper binding sites in PrP and support the hypothesis that PrP function is related to its ability to bind copper in a pH-dependent fashion. PMID:12779334

  16. New insights into genotype–phenotype correlation for GLI3 mutations

    Démurger, Florence; Ichkou, Amale; Mougou-Zerelli, Soumaya; Le Merrer, Martine; Goudefroye, Géraldine; Delezoide, Anne-Lise; Quélin, Chloé; Manouvrier, Sylvie; Baujat, Geneviève; Fradin, Mélanie; Pasquier, Laurent; Megarbané, André; Faivre, Laurence; Baumann, Clarisse; Nampoothiri, Sheela

    2014-01-01

    The phenotypic spectrum of GLI3 mutations includes autosomal dominant Greig cephalopolysyndactyly syndrome (GCPS) and Pallister–Hall syndrome (PHS). PHS was first described as a lethal condition associating hypothalamic hamartoma, postaxial or central polydactyly, anal atresia and bifid epiglottis. Typical GCPS combines polysyndactyly of hands and feet and craniofacial features. Genotype–phenotype correlations have been found both for the location and the nature of GLI3 mutations, highlightin...

  17. Penetrance of eye defects in mice heterozygous for mutation of Gli3 is enhanced by heterozygous mutation of Pax6

    Price David J

    2006-10-01

    Full Text Available Abstract Background Knowledge of the consequences of heterozygous mutations of developmentally important genes is important for understanding human genetic disorders. The Gli3 gene encodes a zinc finger transcription factor and homozygous loss-of-function mutations of Gli3 are lethal. Humans heterozygous for mutations in this gene suffer Greig cephalopolysyndactyly or Pallister-Hall syndromes, in which limb defects are prominent, and mice heterozygous for similar mutations have extra digits. Here we examined whether eye development, which is abnormal in mice lacking functional Gli3, is defective in Gli3+/- mice. Results We showed that Gli3 is expressed in the developing eye but that Gli3+/- mice have only very subtle eye defects. We then generated mice compound heterozygous for mutations in both Gli3 and Pax6, which encodes another developmentally important transcription factor known to be crucial for eye development. Pax6+/-; Gli3+/- eyes were compared to the eyes of wild-type, Pax6+/- or Gli3+/- siblings. They exhibited a range of abnormalities of the retina, iris, lens and cornea that was more extensive than in single Gli3+/- or Pax6+/- mutants or than would be predicted by addition of their phenotypes. Conclusion These findings indicate that heterozygous mutations of Gli3 can impact on eye development. The importance of a normal Gli3 gene dosage becomes greater in the absence of a normal Pax6 gene dosage, suggesting that the two genes co-operate during eye morphogenesis.

  18. Full-length enriched multistage cDNA library construction covering ...

    DR TONUKARI NYEROVWO

    2012-04-10

    Apr 10, 2012 ... Full Length Research Paper. Full-length enriched ... complementary DNA; pfu, plaque-forming unit. ... Chinese-native tree species in Populus section Leuce ... the infected bacteria, 2 ml melted top agar was added, and the.

  19. Differential requirements for Gli2 and Gli3 in the regional specification of the mouse hypothalamus

    Roberta eHaddad-Tóvolli

    2015-03-01

    Full Text Available Secreted protein Sonic hedgehog (Shh ventralizes the neural tube by modulating the crucial balance between activating and repressing functions (GliA, GliR of transcription factors Gli2 and Gli3. This balance—the Shh-Gli code—is species- and context-dependent and has been elucidated for the mouse spinal cord. The hypothalamus, a forebrain region regulating vital functions like homeostasis and hormone secretion, shows dynamic and intricate Shh expression as well as complex regional differentiation. Here we asked if particular combinations of Gli2 and Gli3 and of GliA and GliR functions contribute to the variety of hypothalamic regions, i.e. we wanted to clarify the hypothalamic version of the Shh-Gli code. Based on mouse mutant analysis, we show that: 1 hypothalamic regional heterogeneity is based in part on differentially stringent requirements for Gli2 or Gli3; 2 another source of diversity are differential requirements for Shh of neural vs non-neural origin; 3 Gli2 is indispensable for the specification of a medial progenitor domain generating several essential hypothalamic nuclei plus the pituitary and median eminence; 4 the suppression of Gli3R by neural and non-neural Shh is essential for hypothalamic specification. Finally, we have mapped our results on a recent model which considers the hypothalamus as a transverse region with alar and basal portions. Our data confirm the model and are explained by it.

  20. Gli3 acts as a repressor downstream of Ihh in regulating two distinct steps of chondrocyte differentiation.

    Koziel, Lydia; Wuelling, Manuela; Schneider, Sabine; Vortkamp, Andrea

    2005-12-01

    During endochondral ossification, the secreted growth factor Indian hedgehog (Ihh) regulates several differentiation steps. It interacts with a second secreted factor, parathyroid hormone-related protein (PTHrP), to regulate the onset of hypertrophic differentiation, and it regulates chondrocyte proliferation and ossification of the perichondrium independently of PTHrP. To investigate how the Ihh signal is translated in the different target tissues, we analyzed the role of the zinc-finger transcription factor Gli3, which acts downstream of hedgehog signals in other organs. Loss of Gli3 in Ihh mutants restores chondrocyte proliferation and delays the accelerated onset of hypertrophic differentiation observed in Ihh-/- mutants. Furthermore the expression of the Ihh target genes patched (Ptch) and PTHrP is reactivated in Ihh-/-;Gli3-/- mutants. Gli3 seems thus to act as a strong repressor of Ihh signals in regulating chondrocyte differentiation. In addition, loss of Gli3 in mice that overexpress Ihh in chondrocytes accelerates the onset of hypertrophic differentiation by reducing the domain and possibly the level of PTHrP expression. Careful analysis of chondrocyte differentiation in Gli3-/- mutants revealed that Gli3 negatively regulates the differentiation of distal, low proliferating chondrocytes into columnar, high proliferating cells. Our results suggest a model in which the Ihh/Gli3 system regulates two distinct steps of chondrocyte differentiation: (1) the switch from distal into columnar chondrocytes is repressed by Gli3 in a PTHrP-independent mechanism; (2) the transition from proliferating into hypertrophic chondrocytes is regulated by Gli3-dependent expression of PTHrP. Furthermore, by regulating distal chondrocyte differentiation, Gli3 seems to position the domain of PTHrP expression.

  1. Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

    Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk; Yoo, Young A.

    2012-01-01

    p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)–Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh–Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3–p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expression of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2–p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.

  2. Radiation-induced chemical evolution of glycine to (Gly)2, (Gly)3, and (Gly)4

    Matsui, T.; Izumi, Y.; Kamohara, M.; Nakagawa, K.; Yokoya, A.

    2006-01-01

    Recently amino acids were detected from some meteorites. Since these amino acids were found after hydrolysis, some oligopeptides were possibly formed in space. A simulation experiment of chemical evolution from Glycine (Gly) to Glycylglycine ((Gly)2) was reported by Kaneko et al. In this work, we irradiated (Gly)2 with 8 eV vacuum ultraviolet photons or with 530 eV soft X-ray photons and examined absolute values of quantum yield of radiation-induced chemical evolution from Gly2 to Glycylglycylglycine ((Gly)3) and Glycylglycylglycylglycine ((Gly)4). Thin films of (Gly)2 were prepared on quartz plate or CuBe plate with a vacuum evaporation technique. These samples were irradiated by 8 eV photons from a Xe 2 * excimer lamp or by 530 eV soft X-ray photons at SPring-8 Synchrotron Radiation Facility. Irradiated samples were analyzed with a high performance liquid chromatography HPLC. Decomposition of (Gly)2 and production of Gly, (Gly)3 and (Gly)4 were observed. Quantum yield Y was defined to be N = Y N 0 , where N is the number of produced or decomposed molecule, and N 0 is the number of (Gly)2 molecules excited by photons. Obtained results by 8 eV irradiation were summarized in Table 1. The similar magnitude of decomposition of (Gly)2 may show that yield of the primary breaking reaction upon photo-excitation is of similar magnitude. It should be noted that (Gly)3 and (Gly)4 was produced by irradiation with the yield of 10 -4 without any catalysis. For soft X-ray irradiation, yield of Gly was tentatively determined to be about 40. This largervalue than that for 8 eV irradiation may originate from large energy of incident soft X-ray photons just like a result reported by Simakov et al. We will discuss in detail at the conference. (authors)

  3. Msx genes are important apoptosis effectors downstream of the Shh/Gli3 pathway in the limb.

    Lallemand, Yvan; Bensoussan, Vardina; Cloment, Cécile Saint; Robert, Benoît

    2009-07-15

    In tetrapods, the anteroposterior (AP) patterning of the limb is under the control of the antagonistic activities of the secreted factor Sonic hedgehog (Shh) and Gli3R, the truncated repressor form of the transcription factor Gli3. In this report, we show that Msx1 and Msx2 are targets and downstream effectors of Gli3R. Consequently, in Shh null mutants, Msx genes are overexpressed and, furthermore, partially responsible for the limb phenotype. This is exemplified by the fact that reducing Msx activity in Shh mutants partially restores a normal limb development. Finally, we show that the main action of the Msx genes, in both normal and Shh(-/-) limb development, is to control cell death in the mesenchyme. We propose that, in the limb, Msx genes act downstream of the Shh/Gli3 pathway by transducing BMP signaling and that, in the absence of Shh signaling, their deregulation contributes to the extensive apoptosis that impairs limb development.

  4. Regulation of Calvarial Osteogenesis by Concomitant De-repression of GLI3 and Activation of IHH Targets

    Lotta K. Veistinen; Tuija Mustonen; Tuija Mustonen; Md. Rakibul Hasan; Maarit Takatalo; Yukiho Kobayashi; Yukiho Kobayashi; Dörthe A. Kesper; Andrea Vortkamp; David P. Rice; David P. Rice

    2017-01-01

    Loss-of-function mutations in GLI3 and IHH cause craniosynostosis and reduced osteogenesis, respectively. In this study, we show that Ihh ligand, the receptor Ptch1 and Gli transcription factors are differentially expressed in embryonic mouse calvaria osteogenic condensations. We show that in both Ihh−/− and Gli3Xt−J/Xt−J embryonic mice, the normal gene expression architecture is lost and this results in disorganized calvarial bone development. RUNX2 is a master regulatory transcription facto...

  5. Regulation of Calvarial Osteogenesis by Concomitant De-repression of GLI3 and Activation of IHH Targets

    Lotta K. Veistinen

    2017-12-01

    Full Text Available Loss-of-function mutations in GLI3 and IHH cause craniosynostosis and reduced osteogenesis, respectively. In this study, we show that Ihh ligand, the receptor Ptch1 and Gli transcription factors are differentially expressed in embryonic mouse calvaria osteogenic condensations. We show that in both Ihh−/− and Gli3Xt−J/Xt−J embryonic mice, the normal gene expression architecture is lost and this results in disorganized calvarial bone development. RUNX2 is a master regulatory transcription factor controlling osteogenesis. In the absence of Gli3, RUNX2 isoform II and IHH are upregulated, and RUNX2 isoform I downregulated. This is consistent with the expanded and aberrant osteogenesis observed in Gli3Xt−J/Xt−J mice, and consistent with Runx2-I expression by relatively immature osteoprogenitors. Ihh−/− mice exhibited small calvarial bones and HH target genes, Ptch1 and Gli1, were absent. This indicates that IHH is the functional HH ligand, and that it is not compensated by another HH ligand. To decipher the roles and potential interaction of Gli3 and Ihh, we generated Ihh−/−;Gli3Xt−J/Xt−J compound mutant mice. Even in the absence of Ihh, Gli3 deletion was sufficient to induce aberrant precocious ossification across the developing suture, indicating that the craniosynostosis phenotype of Gli3Xt−J/Xt−J mice is not dependent on IHH ligand. Also, we found that Ihh was not required for Runx2 expression as the expression of RUNX2 target genes was unaffected by deletion of Ihh. To test whether RUNX2 has a role upstream of IHH, we performed RUNX2 siRNA knock down experiments in WT calvarial osteoblasts and explants and found that Ihh expression is suppressed. Our results show that IHH is the functional HH ligand in the embryonic mouse calvaria osteogenic condensations, where it regulates the progression of osteoblastic differentiation. As GLI3 represses the expression of Runx2-II and Ihh, and also elevates the Runx2-I expression

  6. Regulation of Calvarial Osteogenesis by Concomitant De-repression of GLI3 and Activation of IHH Targets.

    Veistinen, Lotta K; Mustonen, Tuija; Hasan, Md Rakibul; Takatalo, Maarit; Kobayashi, Yukiho; Kesper, Dörthe A; Vortkamp, Andrea; Rice, David P

    2017-01-01

    Loss-of-function mutations in GLI3 and IHH cause craniosynostosis and reduced osteogenesis, respectively. In this study, we show that Ihh ligand, the receptor Ptch1 and Gli transcription factors are differentially expressed in embryonic mouse calvaria osteogenic condensations. We show that in both Ihh -/- and Gli3 Xt - J / Xt - J embryonic mice, the normal gene expression architecture is lost and this results in disorganized calvarial bone development. RUNX2 is a master regulatory transcription factor controlling osteogenesis. In the absence of Gli3 , RUNX2 isoform II and IHH are upregulated, and RUNX2 isoform I downregulated. This is consistent with the expanded and aberrant osteogenesis observed in Gli3 Xt - J / Xt - J mice, and consistent with Runx2-I expression by relatively immature osteoprogenitors. Ihh -/- mice exhibited small calvarial bones and HH target genes, Ptch1 and Gli1 , were absent. This indicates that IHH is the functional HH ligand, and that it is not compensated by another HH ligand. To decipher the roles and potential interaction of Gli3 and Ihh, we generated Ihh -/- ; Gli3 Xt - J / Xt - J compound mutant mice. Even in the absence of Ihh, Gli3 deletion was sufficient to induce aberrant precocious ossification across the developing suture, indicating that the craniosynostosis phenotype of Gli3 Xt - J / Xt - J mice is not dependent on IHH ligand. Also, we found that Ihh was not required for Runx2 expression as the expression of RUNX2 target genes was unaffected by deletion of Ihh . To test whether RUNX2 has a role upstream of IHH, we performed RUNX2 siRNA knock down experiments in WT calvarial osteoblasts and explants and found that Ihh expression is suppressed. Our results show that IHH is the functional HH ligand in the embryonic mouse calvaria osteogenic condensations, where it regulates the progression of osteoblastic differentiation. As GLI3 represses the expression of Runx2-II and Ihh , and also elevates the Runx2-I expression, and as IHH

  7. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  8. Evaluation of full-length, cleaved and nitrosylated serum surfactant protein D as biomarkers for COPD

    Duvoix, Annelyse; Miranda, Elena; Perez, Juan

    2011-01-01

    . Serum levels of SP-D are raised in individuals with COPD but there is no correlation between the serum level of SP-D and the severity of airflow obstruction. Serum SP-D is present in different forms that may have more utility as a biomarker for COPD. We report here the development of new monoclonal...... antibodies to full length and cleaved SP-D. We have assessed these and existing antibodies in 98 individuals with COPD recruited to the Evaluation of COPD Longitudinally to Identify Predictive Surrogate Endpoints (ECLIPSE) cohort. Our data show that neither monoclonal antibodies to full length nor cleaved SP...

  9. Insertion of Introns: A Strategy to Facilitate Assembly of Infectious Full Length Clones

    Johansen, Ida Elisabeth; Lund, Ole Søgaard

    2008-01-01

    Some DNA fragments are difficult to clone in Escherichia coli by standard methods. It has been speculated that unintended transcription and translation result in expression of proteins that are toxic to the bacteria. This problem is frequently observed during assembly of infectious full-length vi...

  10. Construction experience with Fermilab-built full length 50mm SSC dipoles

    Blessing, M.J.; Hoffman, D.E.; Packer, M.D.; Gordon, M.; Higinbotham, W.; Sims, R.

    1992-03-01

    Fourteen full length SSC dipole magnets are being built and tested at Fermilab. Their purpose is to verify the magnet design as well as transfer the construction technology to industry. Magnet design is summarized. Construction problems and their solutions are discussed. Topics include coil winding, curing and measuring, collaring, instrumentation, end clamp installation, yoking and electrical and mechanical interconnection

  11. Ihh controls cartilage development by antagonizing Gli3, but requires additional effectors to regulate osteoblast and vascular development.

    Hilton, Matthew J; Tu, Xiaolin; Cook, Julie; Hu, Hongliang; Long, Fanxin

    2005-10-01

    Indian hedgehog (Ihh) controls multiple aspects of endochondral skeletal development, including proliferation and maturation of chondrocytes, osteoblast development and cartilage vascularization. Although it is known that Gli transcription factors are key effectors of hedgehog signaling, it has not been established which Gli protein mediates Ihh activity in skeletal development. Here, we show that removal of Gli3 in Ihh-null mouse embryos restored normal proliferation and maturation of chondrocytes, but only partially rescued the defects in osteoblast development and cartilage vascularization. Remarkably, in both Ihh-/- and Ihh-/-; Gli3-/- embryos, vascularization promoted osteoblast development in perichondrial progenitor cells. Our results not only establish Gli3 as a critical effector for Ihh activity in the developing skeleton, but also identify an osteogenic role for a vasculature-derived signal, which integrates with Ihh and Wnt signals to determine the osteoblast versus chondrocyte fate in the mesenchymal progenitors.

  12. Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements.

    Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

    2015-04-21

    Limb skeletal elements originate from the limb progenitor cells, which undergo expansion and patterning to develop each skeletal element. Posterior-distal skeletal elements, such as the ulna/fibula and posterior digits develop in a Sonic hedgehog (Shh)-dependent manner. However, it is poorly understood how anterior-proximal elements, such as the humerus/femur, the radius/tibia and the anterior digits, are developed. Here we show that the zinc finger factors Sall4 and Gli3 cooperate for proper development of the anterior-proximal skeletal elements and also function upstream of Shh-dependent posterior skeletal element development. Conditional inactivation of Sall4 in the mesoderm before limb outgrowth caused severe defects in the anterior-proximal skeletal elements in the hindlimb. We found that Gli3 expression is reduced in Sall4 mutant hindlimbs, but not in forelimbs. This reduction caused posteriorization of nascent hindlimb buds, which is correlated with a loss of anterior digits. In proximal development, Sall4 integrates Gli3 and the Plzf-Hox system, in addition to proliferative expansion of cells in the mesenchymal core of nascent hindlimb buds. Whereas forelimbs developed normally in Sall4 mutants, further genetic analysis identified that the Sall4-Gli3 system is a common regulator of the early limb progenitor cells in both forelimbs and hindlimbs. The Sall4-Gli3 system also functions upstream of the Shh-expressing ZPA and the Fgf8-expressing AER in fore- and hindlimbs. Therefore, our study identified a critical role of the Sall4-Gli3 system at the early steps of limb development for proper development of the appendicular skeletal elements.

  13. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  14. Highly efficient full-length hepatitis C virus genotype 1 (strain TN) infectious culture system

    Li, Yi-Ping; Ramirez, Santseharay; Jensen, Sanne B

    2012-01-01

    Chronic infection with hepatitis C virus (HCV) is an important cause of end stage liver disease worldwide. In the United States, most HCV-related disease is associated with genotype 1 infection, which remains difficult to treat. Drug and vaccine development was hampered by inability to culture...... full-length TN infection dose-dependently. Given the unique importance of genotype 1 for pathogenesis, this infectious 1a culture system represents an important advance in HCV research. The approach used and the mutations identified might permit culture development for other HCV isolates, thus......) culture systems in Huh7.5 cells. Here, we developed a highly efficient genotype 1a (strain TN) full-length culture system. We initially found that the LSG substitutions conferred viability to an intergenotypic recombinant composed of TN 5' untranslated region (5'UTR)-NS5A and JFH1 NS5B-3'UTR; recovered...

  15. Full-length high-temperature severe fuel damage test No. 2

    Hesson, G.M.; Lombardo, N.J.; Pilger, J.P.; Rausch, W.N.; King, L.L.; Hurley, D.E.; Parchen, L.J.; Panisko, F.E.

    1993-09-01

    Hazardous conditions associated with performing the Full-Length High- Temperature (FLHT). Severe Fuel Damage Test No. 2 experiment have been analyzed. Major hazards that could cause harm or damage are (1) radioactive fission products, (2) radiation fields, (3) reactivity changes, (4) hydrogen generation, (5) materials at high temperature, (6) steam explosion, and (7) steam pressure pulse. As a result of this analysis, it is concluded that with proper precautions the FLHT- 2 test can be safely conducted

  16. Purification and Fibrillation of Full-Length Recombinant PrP

    Makarava, Natallia; Baskakov, Ilia V.

    2012-01-01

    Misfolding and aggregation of prion protein (PrP) is related to several neurodegenerative diseases in humans such as Creutzfeldt–Jacob disease, fatal familial insomnia, and Gerstmann–Straussler–Sheinker disease. Certain applications in prion area require recombinant PrP of high purity and quality. Here, we report an experimental procedure for expression and purification of full-length mammalian PrP. This protocol has been proved to yield PrP of extremely high purity that lac...

  17. Increased circulating full-length betatrophin levels in drug-naïve metabolic syndrome.

    Liu, Dan; Li, Sheyu; He, He; Yu, Chuan; Li, Xiaodan; Liang, Libo; Chen, Yi; Li, Jianwei; Li, Jianshu; Sun, Xin; Tian, Haoming; An, Zhenmei

    2017-03-14

    Betatrophin is a newly identified circulating adipokine playing a role in the regulation of glucose homeostasis and lipid metabolism. But its role in metabolic syndrome (MetS) remains unknown. Therefore, we aimed to compare the circulating betatrophin concentrations between patients with MetS and healthy controls. We recruited 47 patients with MetS and 47 age and sex matched healthy controls. Anthropometric and biochemical measurements were performed, and serum betatrophin levels were detected by ELISA. Full-length betatrophin levels in patients with MetS were significantly higher than those in controls (694.84 ± 365.51 pg/ml versus 356.64 ± 287.92 pg/ml; P <0.001). While no significant difference of total betatrophin levels was found between the two groups (1.20 ± 0.79 ng/ml versus 1.31 ± 1.08 ng/ml; P = 0.524). Full-length betatrophin level was positively correlated with fasting plasma glucose (FPG) (r = 0.357, P = 0.014) and 2-hour plasma glucose (2hPG) (r = 0.38, P <0.01). Binary logistic regression models indicated that subjects in the tertile of the highest full-length betatrophin level experienced higher odds of having MetS (OR, 8.6; 95% CI 2.8-26.8; P <0.001). Our study showed that full-length betatrophin concentrations were increased in drug-naïve MetS patients.

  18. Scalable production in human cells and biochemical characterization of full-length normal and mutant huntingtin.

    Bin Huang

    Full Text Available Huntingtin (Htt is a 350 kD intracellular protein, ubiquitously expressed and mainly localized in the cytoplasm. Huntington's disease (HD is caused by a CAG triplet amplification in exon 1 of the corresponding gene resulting in a polyglutamine (polyQ expansion at the N-terminus of Htt. Production of full-length Htt has been difficult in the past and so far a scalable system or process has not been established for recombinant production of Htt in human cells. The ability to produce Htt in milligram quantities would be a prerequisite for many biochemical and biophysical studies aiming in a better understanding of Htt function under physiological conditions and in case of mutation and disease. For scalable production of full-length normal (17Q and mutant (46Q and 128Q Htt we have established two different systems, the first based on doxycycline-inducible Htt expression in stable cell lines, the second on "gutless" adenovirus mediated gene transfer. Purified material has then been used for biochemical characterization of full-length Htt. Posttranslational modifications (PTMs were determined and several new phosphorylation sites were identified. Nearly all PTMs in full-length Htt localized to areas outside of predicted alpha-solenoid protein regions. In all detected N-terminal peptides methionine as the first amino acid was missing and the second, alanine, was found to be acetylated. Differences in secondary structure between normal and mutant Htt, a helix-rich protein, were not observed in our study. Purified Htt tends to form dimers and higher order oligomers, thus resembling the situation observed with N-terminal fragments, although the mechanism of oligomer formation may be different.

  19. Expression of full-length and splice forms of FoxP3 in rheumatoid arthritis

    Ryder, L R; Woetmann, A; Madsen, H O

    2010-01-01

    OBJECTIVE: The aim of our study was to compare the presence of full-length and alternative splice forms of FoxP3 mRNA in CD4 cells from rheumatoid arthritis (RA) patients and healthy controls. METHODS: A quantitative real-time polymerase chain reaction (QRT-PCR) method was used to measure...... the amount of FoxP3 mRNA full-length and splice forms. CD4-positive T cells were isolated from peripheral blood from 50 RA patients by immunomagnetic separation, and the FoxP3 mRNA expression was compared with the results from 10 healthy controls. RESULTS: We observed an increased expression of full......-length FoxP3 mRNA in RA patients when compared to healthy controls, as well as an increase in CD25 mRNA expression, but no corresponding increase in CTLA-4 mRNA expression. The presence of an alternative splice form of FoxP3 lacking exon 2 was confirmed in both RA patients and healthy controls...

  20. A new strategy for full-length Ebola virus glycoprotein expression in E.coli.

    Zai, Junjie; Yi, Yinhua; Xia, Han; Zhang, Bo; Yuan, Zhiming

    2016-12-01

    Ebola virus (EBOV) causes severe hemorrhagic fever in humans and non-human primates with high rates of fatality. Glycoprotein (GP) is the only envelope protein of EBOV, which may play a critical role in virus attachment and entry as well as stimulating host protective immune responses. However, the lack of expression of full-length GP in Escherichia coli hinders the further study of its function in viral pathogenesis. In this study, the vp40 gene was fused to the full-length gp gene and cloned into a prokaryotic expression vector. We showed that the VP40-GP and GP-VP40 fusion proteins could be expressed in E.coli at 16 °C. In addition, it was shown that the position of vp40 in the fusion proteins affected the yields of the fusion proteins, with a higher level of production of the fusion protein when vp40 was upstream of gp compared to when it was downstream. The results provide a strategy for the expression of a large quantity of EBOV full-length GP, which is of importance for further analyzing the relationship between the structure and function of GP and developing an antibody for the treatment of EBOV infection.

  1. Pulp regeneration in a full-length human tooth root using a hierarchical nanofibrous microsphere system.

    Li, Xiangwei; Ma, Chi; Xie, Xiaohua; Sun, Hongchen; Liu, Xiaohua

    2016-04-15

    While pulp regeneration using tissue engineering strategy has been explored for over a decade, successful regeneration of pulp tissues in a full-length human root with a one-end seal that truly simulates clinical endodontic treatment has not been achieved. To address this challenge, we designed and synthesized a unique hierarchical growth factor-loaded nanofibrous microsphere scaffolding system. In this system, vascular endothelial growth factor (VEGF) binds with heparin and is encapsulated in heparin-conjugated gelatin nanospheres, which are further immobilized in the nanofibers of an injectable poly(l-lactic acid) (PLLA) microsphere. This hierarchical microsphere system not only protects the VEGF from denaturation and degradation, but also provides excellent control of its sustained release. In addition, the nanofibrous PLLA microsphere integrates the extracellular matrix-mimicking architecture with a highly porous injectable form, efficiently accommodating dental pulp stem cells (DPSCs) and supporting their proliferation and pulp tissue formation. Our in vivo study showed the successful regeneration of pulp-like tissues that fulfilled the entire apical and middle thirds and reached the coronal third of the full-length root canal. In addition, a large number of blood vessels were regenerated throughout the canal. For the first time, our work demonstrates the success of pulp tissue regeneration in a full-length root canal, making it a significant step toward regenerative endodontics. The regeneration of pulp tissues in a full-length tooth root canal has been one of the greatest challenges in the field of regenerative endodontics, and one of the biggest barriers for its clinical application. In this study, we developed a unique approach to tackle this challenge, and for the first time, we successfully regenerated living pulp tissues in a full-length root canal, making it a significant step toward regenerative endodontics. This study will make positive scientific

  2. Loss-of-Function of Gli3 in Mice Causes Abnormal Frontal Bone Morphology and Premature Synostosis of the Interfrontal Suture

    Veistinen, Lotta; Takatalo, Maarit; Tanimoto, Yukiho; Kesper, Dörthe A.; Vortkamp, Andrea; Rice, David P. C.

    2012-01-01

    Greig cephalopolysyndactyly syndrome (GCPS) is an autosomal dominant disorder with polydactyly and syndactyly of the limbs and a broad spectrum of craniofacial abnormalities. Craniosynostosis of the metopic suture (interfrontal suture in mice) is an important but rare feature associated with GCPS. GCPS is caused by mutations in the transcription factor GLI3, which regulates Hedgehog signaling. The Gli3 loss-of-function (Gli3Xt-J/Xt-J) mouse largely phenocopies the human syndrome with the mice...

  3. The full-length form of the Drosophila amyloid precursor protein is involved in memory formation.

    Bourdet, Isabelle; Preat, Thomas; Goguel, Valérie

    2015-01-21

    The APP plays a central role in AD, a pathology that first manifests as a memory decline. Understanding the role of APP in normal cognition is fundamental in understanding the progression of AD, and mammalian studies have pointed to a role of secreted APPα in memory. In Drosophila, we recently showed that APPL, the fly APP ortholog, is required for associative memory. In the present study, we aimed to characterize which form of APPL is involved in this process. We show that expression of a secreted-APPL form in the mushroom bodies, the center for olfactory memory, is able to rescue the memory deficit caused by APPL partial loss of function. We next assessed the impact on memory of the Drosophila α-secretase kuzbanian (KUZ), the enzyme initiating the nonamyloidogenic pathway that produces secreted APPLα. Strikingly, KUZ overexpression not only failed to rescue the memory deficit caused by APPL loss of function, it exacerbated this deficit. We further show that in addition to an increase in secreted-APPL forms, KUZ overexpression caused a decrease of membrane-bound full-length species that could explain the memory deficit. Indeed, we observed that transient expression of a constitutive membrane-bound mutant APPL form is sufficient to rescue the memory deficit caused by APPL reduction, revealing for the first time a role of full-length APPL in memory formation. Our data demonstrate that, in addition to secreted APPL, the noncleaved form is involved in memory, raising the possibility that secreted and full-length APPL act together in memory processes. Copyright © 2015 the authors 0270-6474/15/351043-09$15.00/0.

  4. XenDB: Full length cDNA prediction and cross species mapping in Xenopus laevis

    Giegerich Robert

    2005-09-01

    Full Text Available Abstract Background Research using the model system Xenopus laevis has provided critical insights into the mechanisms of early vertebrate development and cell biology. Large scale sequencing efforts have provided an increasingly important resource for researchers. To provide full advantage of the available sequence, we have analyzed 350,468 Xenopus laevis Expressed Sequence Tags (ESTs both to identify full length protein encoding sequences and to develop a unique database system to support comparative approaches between X. laevis and other model systems. Description Using a suffix array based clustering approach, we have identified 25,971 clusters and 40,877 singleton sequences. Generation of a consensus sequence for each cluster resulted in 31,353 tentative contig and 4,801 singleton sequences. Using both BLASTX and FASTY comparison to five model organisms and the NR protein database, more than 15,000 sequences are predicted to encode full length proteins and these have been matched to publicly available IMAGE clones when available. Each sequence has been compared to the KOG database and ~67% of the sequences have been assigned a putative functional category. Based on sequence homology to mouse and human, putative GO annotations have been determined. Conclusion The results of the analysis have been stored in a publicly available database XenDB http://bibiserv.techfak.uni-bielefeld.de/xendb/. A unique capability of the database is the ability to batch upload cross species queries to identify potential Xenopus homologues and their associated full length clones. Examples are provided including mapping of microarray results and application of 'in silico' analysis. The ability to quickly translate the results of various species into 'Xenopus-centric' information should greatly enhance comparative embryological approaches. Supplementary material can be found at http://bibiserv.techfak.uni-bielefeld.de/xendb/.

  5. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  6. Full-Length High-Temperature Severe Fuel Damage Test No. 5: Final safety analysis

    Lanning, D.D.; Lombardo, N.J.; Panisko, F.E.

    1993-09-01

    This report presents the final safety analysis for the preparation, conduct, and post-test discharge operation for the Full-Length High Temperature Experiment-5 (FLHT-5) to be conducted in the L-24 position of the National Research Universal (NRU) Reactor at Chalk River Nuclear Laboratories (CRNL), Ontario, Canada. The test is sponsored by an international group organized by the US Nuclear Regulatory Commission. The test is designed and conducted by staff from Pacific Northwest Laboratory with CRNL staff support. The test will study the consequences of loss-of-coolant and the progression of severe fuel damage

  7. Performance of initial full-length RHIC [Relativistic Heavy Ion Collider] dipoles

    Dahl, P.; Cottingham, J.; Garber, M.

    1987-01-01

    The first four full-length (9.7 m) R and D dipoles for the proposed Relativistic Heavy Ion Collider (RHIC) have been successfully tested. The magnets reached a quench plateau of approximately 4.5 T with very reasonable training - a field level comfortably above the design field of 3.45 T required for operation with beams of 100 GeV/amu gold nuclei. Measured field multipoles are considered to be quite acceptable for this series of R and D magnets

  8. Human microcephaly protein RTTN interacts with STIL and is required to build full-length centrioles.

    Chen, Hsin-Yi; Wu, Chien-Ting; Tang, Chieh-Ju C; Lin, Yi-Nan; Wang, Won-Jing; Tang, Tang K

    2017-08-15

    Mutations in many centriolar protein-encoding genes cause primary microcephaly. Using super-resolution and electron microscopy, we find that the human microcephaly protein, RTTN, is recruited to the proximal end of the procentriole at early S phase, and is located at the inner luminal walls of centrioles. Further studies demonstrate that RTTN directly interacts with STIL and acts downstream of STIL-mediated centriole assembly. CRISPR/Cas9-mediated RTTN gene knockout in p53-deficient cells induce amplification of primitive procentriole bodies that lack the distal-half centriolar proteins, POC5 and POC1B. Additional analyses show that RTTN serves as an upstream effector of CEP295, which mediates the loading of POC1B and POC5 to the distal-half centrioles. Interestingly, the naturally occurring microcephaly-associated mutant, RTTN (A578P), shows a low affinity for STIL binding and blocks centriole assembly. These findings reveal that RTTN contributes to building full-length centrioles and illuminate the molecular mechanism through which the RTTN (A578P) mutation causes primary microcephaly.Mutations in many centriolar protein-encoding genes cause primary microcephaly. Here the authors show that human microcephaly protein RTTN directly interacts with STIL and acts downstream of STIL-mediated centriole assembly, contributing to building full-length centrioles.

  9. Evidence for a Complex Mosaic Genome Pattern in a Full-length Hepatitis C Virus Sequence

    R.S. Ross

    2008-01-01

    Full Text Available The genome of the hepatitis C virus (HCV exhibits a high genetic variability. This remarkable heterogeneity is mainly attributed to the gradual accumulation of mutational changes, whereas the contribution of recombination events to the evolution of HCV remains controversial so far. While performing phylogenetic analyses including a large number of sequences deposited in the GenBank, we encountered a full-length HCV sequence (AY651061 that showed evidence for inter-subtype recombination and was, therefore, subjected to a detailed analysis of its molecular structure. The obtained results indicated that AY651061 does not represent a “simple” HCV 1c isolate, but a complex 1a/1c mosaic genome, showing five putative breakpoints in the core to NS3 regions. To our knowledge, this is the first report on a mosaic HCV full- length sequence with multiple breakpoints. The molecular structure of AY651061 is reminiscent of complex homologous recombinant variants occurring among other members of the flaviviridae family, e.g. GB virus C, dengue virus, and Japanese encephalitis virus. Our finding of a mosaic HCV sequence may have important implications for many fields of current HCV research which merit careful consideration.

  10. Full-length Dysferlin Transfer by the Hyperactive Sleeping Beauty Transposase Restores Dysferlin-deficient Muscle

    Helena Escobar

    2016-01-01

    Full Text Available Dysferlin-deficient muscular dystrophy is a progressive disease characterized by muscle weakness and wasting for which there is no treatment. It is caused by mutations in DYSF, a large, multiexonic gene that forms a coding sequence of 6.2 kb. Sleeping Beauty (SB transposon is a nonviral gene transfer vector, already used in clinical trials. The hyperactive SB system consists of a transposon DNA sequence and a transposase protein, SB100X, that can integrate DNA over 10 kb into the target genome. We constructed an SB transposon-based vector to deliver full-length human DYSF cDNA into dysferlin-deficient H2K A/J myoblasts. We demonstrate proper dysferlin expression as well as highly efficient engraftment (>1,100 donor-derived fibers of the engineered myoblasts in the skeletal muscle of dysferlin- and immunodeficient B6. Cg-Dysfprmd Prkdcscid/J (Scid/BLA/J mice. Nonviral gene delivery of full-length human dysferlin into muscle cells, along with a successful and efficient transplantation into skeletal muscle are important advances towards successful gene therapy of dysferlin-deficient muscular dystrophy.

  11. Full-length genomic characterization and molecular evolution of canine parvovirus in China.

    Zhou, Ling; Tang, Qinghai; Shi, Lijun; Kong, Miaomiao; Liang, Lin; Mao, Qianqian; Bu, Bin; Yao, Lunguang; Zhao, Kai; Cui, Shangjin; Leal, Élcio

    2016-06-01

    Canine parvovirus type 2 (CPV-2) can cause acute haemorrhagic enteritis in dogs and myocarditis in puppies. This disease has become one of the most serious infectious diseases of dogs. During 2014 in China, there were many cases of acute infectious diarrhoea in dogs. Some faecal samples were negative for the CPV-2 antigen based on a colloidal gold test strip but were positive based on PCR, and a viral strain was isolated from one such sample. The cytopathic effect on susceptible cells and the results of the immunoperoxidase monolayer assay, PCR, and sequencing indicated that the pathogen was CPV-2. The strain was named CPV-NY-14, and the full-length genome was sequenced and analysed. A maximum likelihood tree was constructed using the full-length genome and all available CPV-2 genomes. New strains have replaced the original strain in Taiwan and Italy, although the CPV-2a strain is still predominant there. However, CPV-2a still causes many cases of acute infectious diarrhoea in dogs in China.

  12. Diversity, distribution and dynamics of full-length Copia and Gypsy LTR retroelements in Solanum lycopersicum.

    Paz, Rosalía Cristina; Kozaczek, Melisa Eliana; Rosli, Hernán Guillermo; Andino, Natalia Pilar; Sanchez-Puerta, Maria Virginia

    2017-10-01

    Transposable elements are the most abundant components of plant genomes and can dramatically induce genetic changes and impact genome evolution. In the recently sequenced genome of tomato (Solanum lycopersicum), the estimated fraction of elements corresponding to retrotransposons is nearly 62%. Given that tomato is one of the most important vegetable crop cultivated and consumed worldwide, understanding retrotransposon dynamics can provide insight into its evolution and domestication processes. In this study, we performed a genome-wide in silico search of full-length LTR retroelements in the tomato nuclear genome and annotated 736 full-length Gypsy and Copia retroelements. The dispersion level across the 12 chromosomes, the diversity and tissue-specific expression of those elements were estimated. Phylogenetic analysis based on the retrotranscriptase region revealed the presence of 12 major lineages of LTR retroelements in the tomato genome. We identified 97 families, of which 77 and 20 belong to the superfamilies Copia and Gypsy, respectively. Each retroelement family was characterized according to their element size, relative frequencies and insertion time. These analyses represent a valuable resource for comparative genomics within the Solanaceae, transposon-tagging and for the design of cultivar-specific molecular markers in tomato.

  13. Full-length high-temperature severe fuel damage test No. 5

    Lanning, D.D.; Lombardo, N.J.; Hensley, W.K.; Fitzsimmons, D.E.; Panisko, F.E.; Hartwell, J.K.

    1993-09-01

    This report describes and presents data from a severe fuel damage test that was conducted in the National Research Universal (NRU) reactor at Chalk River Nuclear Laboratories (CRNL), Ontario, Canada. The test, designated FLHT-5, was the fourth in a series of full-length high-temperature (FLHT) tests on light-water reactor fuel. The tests were designed and performed by staff from the US Department of Energy's Pacific Northwest Laboratory (PNL), operated by Battelle Memorial Institute. The test operation and test results are described in this report. The fuel bundle in the FLHT-5 experiment included 10 unirradiated full-length pressurized-water reactor (PWR) rods, 1 irradiated PWR rod and 1 dummy gamma thermometer. The fuel rods were subjected to a very low coolant flow while operating at low fission power. This caused coolant boilaway, rod dryout and overheating to temperatures above 2600 K, severe fuel rod damage, hydrogen generation, and fission product release. The test assembly and its effluent path were extensively instrumented to record temperatures, pressures, flow rates, hydrogen evolution, and fission product release during the boilaway/heatup transient. Post-test gamma scanning of the upper plenum indicated significant iodine and cesium release and deposition. Both stack gas activity and on-line gamma spectrometer data indicated significant (∼50%) release of noble fission gases. Post-test visual examination of one side of the fuel bundle revealed no massive relocation and flow blockage; however, rundown of molten cladding was evident

  14. Failure Mode and Effects Analysis (FMEA) of the solid state full length rod control system

    Shopsky, W.E.

    1977-01-01

    The Full Length Rod Control System (FLRCS) controls the power to the rod drive mechanisms for rod movement in response to signals received from the Reactor Control System or from signals generated through Reactor Operator action. Rod movement is used to control reactivity of the reactor during plant operation. The Full Length Rod Control System is designed to perform its reactivity control function in conjunction with the Reactor Control and Protection System, to maintain the reactor core within design safety limits. By the use of a Failure Mode and Effects Analysis, it is shown that the FLRCS will perform its reactivity control functions considering the loss of single active components. That is, sufficient fault limiting control circuits are provided which blocks control rod movement and/or indicates presence of a fault condition at the Control Board. Reactor operator action or automatic reactor trip will thus mitigate the consequences of potential failure of the FLRCS. The analysis also qualitatively demonstrates the reliability of the FLRCS to perform its intended function

  15. Impaired heat shock response in cells expressing full-length polyglutamine-expanded huntingtin.

    Sidhartha M Chafekar

    Full Text Available The molecular mechanisms by which polyglutamine (polyQ-expanded huntingtin (Htt causes neurodegeneration in Huntington's disease (HD remain unclear. The malfunction of cellular proteostasis has been suggested as central in HD pathogenesis and also as a target of therapeutic interventions for the treatment of HD. We present results that offer a previously unexplored perspective regarding impaired proteostasis in HD. We find that, under non-stress conditions, the proteostatic capacity of cells expressing full length polyQ-expanded Htt is adequate. Yet, under stress conditions, the presence of polyQ-expanded Htt impairs the heat shock response, a key component of cellular proteostasis. This impaired heat shock response results in a reduced capacity to withstand the damage caused by cellular stress. We demonstrate that in cells expressing polyQ-expanded Htt the levels of heat shock transcription factor 1 (HSF1 are reduced, and, as a consequence, these cells have an impaired a heat shock response. Also, we found reduced HSF1 and HSP70 levels in the striata of HD knock-in mice when compared to wild-type mice. Our results suggests that full length, non-aggregated polyQ-expanded Htt blocks the effective induction of the heat shock response under stress conditions and may thus trigger the accumulation of cellular damage during the course of HD pathogenesis.

  16. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  17. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining c

  18. Molecular and clinical analyses of Greig cephalopolysyndactyly and Pallister-Hall syndromes: Robust phenotype prediction from the type and position of GLI3 mutations

    Johnston, Jennifer J.; Olivos-Glander, Isabelle; Killoran, Christina; Elson, Emma; Turner, Joyce T.; Peters, Kathryn F.; Abbott, Margaret H.; Aughton, David J.; Aylsworth, Arthur S.; Bamshad, Michael J.; Booth, Carol; Curry, Cynthia J.; David, Albert; Dinulos, Mary Beth; Flannery, David B.; Fox, Michelle A.; Graham, John M.; Grange, Dorothy K.; Guttmacher, Alan E.; Hannibal, Mark C.; Henn, Wolfram; Hennekam, Raoul C. M.; Holmes, Lewis B.; Hoyme, H. Eugene; Leppig, Kathleen A.; Lin, Angela E.; Macleod, Patrick; Manchester, David K.; Marcelis, Carlo; Mazzanti, Laura; McCann, Emma; McDonald, Marie T.; Mendelsohn, Nancy J.; Moeschler, John B.; Moghaddam, Billur; Neri, Giovanni; Newbury-Ecob, Ruth; Pagon, Roberta A.; Phillips, John A.; Sadler, Laurie S.; Stoler, Joan M.; Tilstra, David; Walsh Vockley, Catherine M.; Zackai, Elaine H.; Zadeh, Touran M.; Brueton, Louise; Black, Graeme Charles M.; Biesecker, Leslie G.

    2005-01-01

    Mutations in the GLI3 zinc-finger transcription factor gene cause Greig cephalopolysyndactyly syndrome (GCPS) and Pallister-Hall syndrome (PHS), which are variable but distinct clinical entities. We hypothesized that GLI3 mutations that predict a truncated functional repressor protein cause PHS and

  19. Cocrystallization studies of full-length recombinant butyrylcholinesterase (BChE) with cocaine

    Asojo, Oluwatoyin Ajibola; Asojo, Oluyomi Adebola; Ngamelue, Michelle N.; Homma, Kohei; Lockridge, Oksana (Nebraska-Med)

    2011-09-16

    Human butyrylcholinesterase (BChE; EC 3.1.1.8) is a 340 kDa tetrameric glycoprotein that is present in human serum at about 5 mg l{sup -1} and has well documented therapeutic effects on cocaine toxicity. BChE holds promise as a therapeutic that reduces and finally eliminates the rewarding effects of cocaine, thus weaning an addict from the drug. There have been extensive computational studies of cocaine hydrolysis by BChE. Since there are no reported structures of BChE with cocaine or any of the hydrolysis products, full-length monomeric recombinant wild-type BChE was cocrystallized with cocaine. The refined 3 {angstrom} resolution structure appears to retain the hydrolysis product benzoic acid in sufficient proximity to form a hydrogen bond to the active-site Ser198.

  20. High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria

    Tutterrow, Yeung Lo; Salanti, Ali; Avril, Marion

    2012-01-01

    VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab) to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early...... in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2). Thus, the purpose...... of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low...

  1. Seismic inference of 57 stars using full-length Kepler data sets

    Creevey Orlagh

    2017-01-01

    Full Text Available We present stellar properties of 57 stars from a seismic inference using full-length data sets from Kepler (mass, age, radius, distances. These stars comprise active stars, planet-hosts, solar-analogs, and binary systems. We validate the distances derived from the astrometric Gaia-Tycho solution. Ensemble analysis of the stellar properties reveals a trend of mixing-length parameter with the surface gravity and effective temperature. We derive a linear relationship with the seismic quantity ‹r02› to estimate the stellar age. Finally, we define the stellar regimes where the Kjeldsen et al (2008 empirical surface correction for 1D model frequencies is valid.

  2. Quench start localization in full-length SSC R ampersand D dipoles

    Devred, A.; Chapman, M.; Cortella, J.; Desportes, A.; Kaugerts, J.; Kirk, T.; Mirk, K.; Schermer, R.; Tompkins, J.C.; Turner, J.; Bleadon, M.; Brown, B.C.; Hanft, R.; Kuchnir, M.; Lamm, M.; Mantsch, P.; Mazur, P.O.; Orris, D.; Peoples, J.; Strait, J.; Tool, G.; Caspi, S.; Gilbert, W.; Meuser, R.; Peters, C.; Rechen, J.; Royet, J.; Scanlan, R.; Taylor, C.; Zbasnik, J.

    1989-04-01

    Full-length SSC R ampersand D dipole magnets instrumented with four voltage taps on each turn of the inner quarter coils have been tested. These voltage taps enable accurate location of the point at which the quenches start and detailed studies of quench development in the coil. Attention here is focused on localizing the quench source. After recalling the basic mechanism of a quench (why it occurs and how it propagates), the method of quench origin analysis is described: the quench propagation velocity on the turn where the quench occurs is calculated, and the quench location is then verified by reiterating the analysis on the adjacent turns. Last, the velocity value, which appears to be higher than previously measured, is discussed

  3. Sall4-Gli3 system in early limb progenitors is essential for the development of limb skeletal elements

    Akiyama, Ryutaro; Kawakami, Hiroko; Wong, Julia; Oishi, Isao; Nishinakamura, Ryuichi; Kawakami, Yasuhiko

    2015-01-01

    The limb skeletal elements that have unique morphology and distinct locations are developed from limb progenitors, derived from the lateral plate mesoderm. These skeletal elements arise during limb development. In this study, we show genetic evidence that function of Sall4 is essential prior to limb outgrowth for development of the anterior-proximal skeletal elements. Furthermore, genetic interaction between Sall4 and Gli3 is upstream of establishing Shh (Sonic hedgehog) expression, and there...

  4. Conformational change in full-length mouse prion: A site-directed spin-labeling study

    Inanami, Osamu; Hashida, Shukichi; Iizuka, Daisuke; Horiuchi, Motohiro; Hiraoka, Wakako; Shimoyama, Yuhei; Nakamura, Hideo; Inagaki, Fuyuhiko; Kuwabara, Mikinori

    2005-01-01

    The structure of the mouse prion (moPrP) was studied using site-directed spin-labeling electron spin resonance (SDSL-ESR). Since a previous NMR study by Hornemanna et al., [Hornemanna, Korthb, Oeschb, Rieka, Widera, Wuethricha, Glockshubera, Recombinant full-length murine prion protein, mPrP (23-231): purification and spectroscopic characterization, FEBS Lett. 413 (1997) 277-281] has indicated that N96, D143, and T189 in moPrP are localized in a Cu 2+ binding region, Helix1 and Helix2, respectively, three recombinant moPrP mutations (N96C, D143C, and T189C) were expressed in an Escherichia coli system, and then refolded by dialysis under low pH and purified by reverse-phase HPLC. By using the preparation, we succeeded in preserving a target cystein residue without alteration of the α-helix structure of moPrP and were able to apply SDSL-ESR with a methane thiosulfonate spin label to the full-length prion protein. The rotational correlation times (τ) of 1.1, 3.3, and 4.8 ns were evaluated from the X-band ESR spectra at pH 7.4 and 20 deg C for N96R1, D143R1, and T189R1, respectively. τ reflects the fact that the Cu 2+ binding region is more flexible than Helix1 or Helix2. ESR spectra recorded at various temperatures revealed two phases together with a transition point at around 20 deg C in D143R1 and T189R1, but not in N96R1. With the variation of pH from 4.0 to 7.8, ESR spectra of T189R1 at 20 deg C showed a gradual increase of τ from 2.9 to 4.8 ns. On the other hand, the pH-dependent conformational changes in N96R1 and D143R1 were negligible. These results indicated that T189 located in Helix2 possessed a structure sensitive to physiological pH changes; simultaneously, N96 in the Cu 2+ binding region and D143 in Helix1 were conserved

  5. Non-destructive testing of full-length bonded rock bolts based on HHT signal analysis

    Shi, Z. M.; Liu, L.; Peng, M.; Liu, C. C.; Tao, F. J.; Liu, C. S.

    2018-04-01

    Full-length bonded rock bolts are commonly used in mining, tunneling and slope engineering because of their simple design and resistance to corrosion. However, the length of a rock bolt and grouting quality do not often meet the required design standards in practice because of the concealment and complexity of bolt construction. Non-destructive testing is preferred when testing a rock bolt's quality because of the convenience, low cost and wide detection range. In this paper, a signal analysis method for the non-destructive sound wave testing of full-length bonded rock bolts is presented, which is based on the Hilbert-Huang transform (HHT). First, we introduce the HHT analysis method to calculate the bolt length and identify defect locations based on sound wave reflection test signals, which includes decomposing the test signal via empirical mode decomposition (EMD), selecting the intrinsic mode functions (IMF) using the Pearson Correlation Index (PCI) and calculating the instantaneous phase and frequency via the Hilbert transform (HT). Second, six model tests are conducted using different grouting defects and bolt protruding lengths to verify the effectiveness of the HHT analysis method. Lastly, the influence of the bolt protruding length on the test signal, identification of multiple reflections from defects, bolt end and protruding end, and mode mixing from EMD are discussed. The HHT analysis method can identify the bolt length and grouting defect locations from signals that contain noise at multiple reflected interfaces. The reflection from the long protruding end creates an irregular test signal with many frequency peaks on the spectrum. The reflections from defects barely change the original signal because they are low energy, which cannot be adequately resolved using existing methods. The HHT analysis method can identify reflections from the long protruding end of the bolt and multiple reflections from grouting defects based on mutations in the instantaneous

  6. Stable preparations of tyrosine hydroxylase provide the solution structure of the full-length enzyme

    Bezem, Maria T.; Baumann, Anne; Skjærven, Lars; Meyer, Romain; Kursula, Petri; Martinez, Aurora; Flydal, Marte I.

    2016-01-01

    Tyrosine hydroxylase (TH) catalyzes the rate-limiting step in the biosynthesis of catecholamine neurotransmitters. TH is a highly complex enzyme at mechanistic, structural, and regulatory levels, and the preparation of kinetically and conformationally stable enzyme for structural characterization has been challenging. Here, we report on improved protocols for purification of recombinant human TH isoform 1 (TH1), which provide large amounts of pure, stable, active TH1 with an intact N-terminus. TH1 purified through fusion with a His-tagged maltose-binding protein on amylose resin was representative of the iron-bound functional enzyme, showing high activity and stabilization by the natural feedback inhibitor dopamine. TH1 purified through fusion with a His-tagged ZZ domain on TALON is remarkably stable, as it was partially inhibited by resin-derived cobalt. This more stable enzyme preparation provided high-quality small-angle X-ray scattering (SAXS) data and reliable structural models of full-length tetrameric TH1. The SAXS-derived model reveals an elongated conformation (Dmax = 20 nm) for TH1, different arrangement of the catalytic domains compared with the crystal structure of truncated forms, and an N-terminal region with an unstructured tail that hosts the phosphorylation sites and a separated Ala-rich helical motif that may have a role in regulation of TH by interacting with binding partners. PMID:27462005

  7. Use of Dried Blood Spots to Elucidate Full-Length Transmitted/Founder HIV-1 Genomes

    Jesus F. Salazar-Gonzalez

    2016-07-01

    Full Text Available Background: Identification of HIV-1 genomes responsible for establishing clinical infection in newly infected individuals is fundamental to prevention and pathogenesis research. Processing, storage, and transportation of the clinical samples required to perform these virologic assays in resource-limited settings requires challenging venipuncture and cold chain logistics. Here, we validate the use of dried-blood spots (DBS as a simple and convenient alternative to collecting and storing frozen plasma. Methods: We performed parallel nucleic acid extraction, single genome amplification (SGA, next generation sequencing (NGS, and phylogenetic analyses on plasma and DBS. Results: We demonstrated the capacity to extract viral RNA from DBS and perform SGA to infer the complete nucleotide sequence of the transmitted/founder (TF HIV-1 envelope gene and full-length genome in two acutely infected individuals. Using both SGA and NGS methodologies, we showed that sequences generated from DBS and plasma display comparable phylogenetic patterns in both acute and chronic infection. SGA was successful on samples with a range of plasma viremia, including samples as low as 1,700 copies/ml and an estimated ~50 viral copies per blood spot. Further, we demonstrated reproducible efficiency in gp160 env sequencing in DBS stored at ambient temperature for up to three weeks or at -20ºC for up to five months. Conclusions: These findings support the use of DBS as a practical and cost-effective alternative to frozen plasma for clinical trials and translational research conducted in resource-limited settings.

  8. Purification and Fibrillation of Full-Length Recombinant PrP.

    Makarava, Natallia; Savtchenko, Regina; Baskakov, Ilia V

    2017-01-01

    Misfolding and aggregation of prion protein are related to several neurodegenerative diseases in humans such as Creutzfeldt-Jakob disease, fatal familial insomnia, and Gerstmann-Straussler-Scheinker disease. A growing number of applications in the prion field including assays for detection of PrP Sc and methods for production of PrP Sc de novo require recombinant prion protein (PrP) of high purity and quality. Here, we report an experimental procedure for expression and purification of full-length mammalian prion protein. This protocol has been proved to yield PrP of extremely high purity that lacks PrP adducts, oxidative modifications, or truncation, which is typically generated as a result of spontaneous oxidation or degradation. We also describe methods for preparation of amyloid fibrils from recombinant PrP in vitro. Recombinant PrP fibrils can be used as a noninfectious synthetic surrogate of PrP Sc for development of prion diagnostics including generation of PrP Sc -specific antibody.

  9. Sequencing, mapping, and analysis of 27,455 maize full-length cDNAs.

    Carol Soderlund

    2009-11-01

    Full Text Available Full-length cDNA (FLcDNA sequencing establishes the precise primary structure of individual gene transcripts. From two libraries representing 27 B73 tissues and abiotic stress treatments, 27,455 high-quality FLcDNAs were sequenced. The average transcript length was 1.44 kb including 218 bases and 321 bases of 5' and 3' UTR, respectively, with 8.6% of the FLcDNAs encoding predicted proteins of fewer than 100 amino acids. Approximately 94% of the FLcDNAs were stringently mapped to the maize genome. Although nearly two-thirds of this genome is composed of transposable elements (TEs, only 5.6% of the FLcDNAs contained TE sequences in coding or UTR regions. Approximately 7.2% of the FLcDNAs are putative transcription factors, suggesting that rare transcripts are well-enriched in our FLcDNA set. Protein similarity searching identified 1,737 maize transcripts not present in rice, sorghum, Arabidopsis, or poplar annotated genes. A strict FLcDNA assembly generated 24,467 non-redundant sequences, of which 88% have non-maize protein matches. The FLcDNAs were also assembled with 41,759 FLcDNAs in GenBank from other projects, where semi-strict parameters were used to identify 13,368 potentially unique non-redundant sequences from this project. The libraries, ESTs, and FLcDNA sequences produced from this project are publicly available. The annotated EST and FLcDNA assemblies are available through the maize FLcDNA web resource (www.maizecdna.org.

  10. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  11. A novel copper(II) coordination at His186 in full-length murine prion protein

    Watanabe, Yasuko [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Hiraoka, Wakako [Laboratory of Biophysics, School of Science and Technology, Meiji University, Kawasaki 214-8571 (Japan); Igarashi, Manabu; Ito, Kimihito [Department of Global Epidemiology, Hokkaido University Research Center for Zoonosis Control, Sapporo 001-0020 (Japan); Shimoyama, Yuhei [Soft-Matter Physics Laboratory, Graduate School of Emergent Science, Muroran Institute of Technology, Muroran 050-8585 (Japan); Horiuchi, Motohiro [Laboratory of Prion Diseases, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Yamamori, Tohru; Yasui, Hironobu; Kuwabara, Mikinori [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan); Inagaki, Fuyuhiko [Laboratory of Structural Biology, Graduate School of Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812 (Japan); Inanami, Osamu, E-mail: inanami@vetmed.hokudai.ac.jp [Laboratory of Radiation Biology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818 (Japan)

    2010-04-09

    To explore Cu(II) ion coordination by His{sup 186} in the C-terminal domain of full-length prion protein (moPrP), we utilized the magnetic dipolar interaction between a paramagnetic metal, Cu(II) ion, and a spin probe introduced in the neighborhood of the postulated binding site by the spin labeling technique (SDSL technique). Six moPrP mutants, moPrP(D143C), moPrP(Y148C), moPrP(E151C), moPrP(Y156C), moPrP(T189C), and moPrP(Y156C,H186A), were reacted with a methane thiosulfonate spin probe and a nitroxide residue (R1) was created in the binding site of each one. Line broadening of the ESR spectra was induced in the presence of Cu(II) ions in moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) but not moPrP(D143R1). This line broadening indicated the presence of electron-electron dipolar interaction between Cu(II) and the nitroxide spin probe, suggesting that each interspin distance was within 20 A. The interspin distance ranges between Cu(II) and the spin probes of moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) were estimated to be 12.1 A, 18.1 A, 10.7 A, and 8.4 A, respectively. In moPrP(Y156R1,H186A), line broadening between Cu(II) and the spin probe was not observed. These results suggest that a novel Cu(II) binding site is involved in His186 in the Helix2 region of the C-terminal domain of moPrP{sup C}.

  12. A novel copper(II) coordination at His186 in full-length murine prion protein

    Watanabe, Yasuko; Hiraoka, Wakako; Igarashi, Manabu; Ito, Kimihito; Shimoyama, Yuhei; Horiuchi, Motohiro; Yamamori, Tohru; Yasui, Hironobu; Kuwabara, Mikinori; Inagaki, Fuyuhiko; Inanami, Osamu

    2010-01-01

    To explore Cu(II) ion coordination by His 186 in the C-terminal domain of full-length prion protein (moPrP), we utilized the magnetic dipolar interaction between a paramagnetic metal, Cu(II) ion, and a spin probe introduced in the neighborhood of the postulated binding site by the spin labeling technique (SDSL technique). Six moPrP mutants, moPrP(D143C), moPrP(Y148C), moPrP(E151C), moPrP(Y156C), moPrP(T189C), and moPrP(Y156C,H186A), were reacted with a methane thiosulfonate spin probe and a nitroxide residue (R1) was created in the binding site of each one. Line broadening of the ESR spectra was induced in the presence of Cu(II) ions in moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) but not moPrP(D143R1). This line broadening indicated the presence of electron-electron dipolar interaction between Cu(II) and the nitroxide spin probe, suggesting that each interspin distance was within 20 A. The interspin distance ranges between Cu(II) and the spin probes of moPrP(Y148R1), moPrP(Y151R1), moPrP(Y156R1), and moPrP(T189R1) were estimated to be 12.1 A, 18.1 A, 10.7 A, and 8.4 A, respectively. In moPrP(Y156R1,H186A), line broadening between Cu(II) and the spin probe was not observed. These results suggest that a novel Cu(II) binding site is involved in His186 in the Helix2 region of the C-terminal domain of moPrP C .

  13. High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria.

    Yeung Lo Tutterrow

    Full Text Available VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2. Thus, the purpose of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low transmission areas in Cameroon were evaluated for Ab to FV2 and the proportion of high avidity Ab (i.e., Ab that remain bound in the presence of 3M NH(4SCN was assessed. Ab levels and proportion of high avidity Ab were compared between women with placental malaria (PM(+ and those without (PM(- at delivery. Results showed that PM(- women had significantly higher Ab levels (p = 0.0047 and proportion of high avidity Ab (p = 0.0009 than PM(+ women throughout pregnancy. Specifically, women with moderate to high Ab levels (>5,000 MFI and those with ≥ 35% high avidity Ab at 5-6 months were found to have 2.3 (95% CI, 1.0-4.9 and 7.6-fold (p = 0.0013, 95% CI: 1.2-50.0 reduced risk of placental malaria, respectively. These data show that high levels of Ab to FV2, particularly those with high avidity for FV2, produced by mid-pregnancy are important in clearing parasites from the placenta. Both high Ab levels and proportion of high avidity Ab to FV2 may serve as correlates of protection for assessing immunity against placental malaria.

  14. Significance of urinary full-length megalin in patients with IgA nephropathy.

    Takuto Seki

    Full Text Available BACKGROUND AND OBJECTIVES: Megalin is highly expressed at the apical membranes of proximal tubular epithelial cells. A urinary full-length megalin (C-megalin assay is linked to the severity of diabetic nephropathy in type 2 diabetes. This study examined the relationship between levels of urinary C-megalin and histological findings in adult patients with IgA nephropathy (IgAN. DESIGN, SETTING, PARTICIPANTS, & MEASUREMENTS: Urine samples voided in the morning on the day of renal biopsy were obtained from 73 patients with IgAN (29 men and 44 women; mean age, 33 years and 5 patients with membranous nephropathy (MN. Renal pathologic variables were analyzed using the Oxford classification of IgAN, the Shigematsu classification and the Clinical Guidelines of IgAN in Japan. The levels of urinary C-megalin were measured by sandwich ELISA. RESULTS: Histological analysis based on the Oxford classification revealed that the levels of urinary C-megalin were correlated with mesangial hypercellularity in IgAN patients (OR = 1.76, 95% CI: 1.04-3.27, P<0.05. There was a significant correlation between the levels of urinary C-megalin and the severity of chronic extracapillary abnormalities according to the Shigematsu classification in IgAN patients (β = 0.33, P = 0.008. The levels of urinary C-megalin were significantly higher in all risk levels of IgAN patients requiring dialysis using the Clinical Guidelines of IgAN in Japan than in the control group. The levels of urinary C-megalin were significantly higher in the high risk and very high risk grades than in the low risk grade (P<0.05. The levels of urinary C-megalin were significantly higher in MN patients compared to the control group. CONCLUSIONS: The levels of urinary C-megalin are associated with histological abnormalities in adult IgAN patients. There is a possibility that urinary C-megalin is an independent predictor of disease progression of IgAN. In addition, our results suggest that

  15. The ability to form full-length intron RNA circles is a general property of nuclear group I introns

    Nielsen, Henrik; Fiskaa, Tonje; Birgisdottir, Asa Birna

    2003-01-01

    at the expense of the host. The circularization pathway has distinct structural requirements that differ from those of splicing and appears to be specifically suppressed in vivo. The ability to form full-length circles is found in all types of nuclear group I introns, including those from the Tetrahymena...... ribosomal DNA. The biological function of the full-length circles is not known, but the fact that the circles contain the entire genetic information of the intron suggests a role in intron mobility....

  16. Adult Gli2+/-;Gli3Δ699/+ Male and Female Mice Display a Spectrum of Genital Malformation.

    Fei He

    Full Text Available Disorders of sexual development (DSD encompass a broad spectrum of urogenital malformations and are amongst the most common congenital birth defects. Although key genetic factors such as the hedgehog (Hh family have been identified, a unifying postnatally viable model displaying the spectrum of male and female urogenital malformations has not yet been reported. Since human cases are diagnosed and treated at various stages postnatally, equivalent mouse models enabling analysis at similar stages are of significant interest. Additionally, all non-Hh based genetic models investigating DSD display normal females, leaving female urogenital development largely unknown. Here, we generated compound mutant mice, Gli2+/-;Gli3Δ699/+, which exhibit a spectrum of urogenital malformations in both males and females upon birth, and also carried them well into adulthood. Analysis of embryonic day (E18.5 and adult mice revealed shortened anogenital distance (AGD, open ventral urethral groove, incomplete fusion of scrotal sac, abnormal penile size and structure, and incomplete testicular descent with hypoplasia in male mice, whereas female mutant mice displayed reduced AGD, urinary incontinence, and a number of uterine anomalies such as vaginal duplication. Male and female fertility was also investigated via breeding cages, and it was identified that male mice were infertile while females were unable to deliver despite becoming impregnated. We propose that Gli2+/-;Gli3Δ699/+ mice can serve as a genetic mouse model for common DSD such as cryptorchidism, hypospadias, and incomplete fusion of the scrotal sac in males, and a spectrum of uterine and vaginal abnormalities along with urinary incontinence in females, which could prove essential in revealing new insights into their equivalent diseases in humans.

  17. High yield purification of full-length functional hERG K+ channels produced in Saccharomyces cerevisiae

    Molbaek, Karen; Scharff-Poulsen, Peter; Hélix-Nielsen, Claus

    2015-01-01

    knowledge this is the first reported high-yield production and purification of full length, tetrameric and functional hERG. This significant breakthrough will be paramount in obtaining hERG crystal structures, and in establishment of new high-throughput hERG drug safety screening assays....

  18. Characterization of near full-length genomes of HIV type 1 strains in Denmark: Basis for a universal therapeutic vaccine

    Andresen, Betina S.; Vinner, Lasse; Tang, Sheila Tuyet

    2007-01-01

    We report here the near full-length sequence characterization of 17 Danish clinical HIV-1 strains isolated from HLA-A02 patients not in need of ART, with relatively low viral loads and normal CD4 cell counts. Sequencing was performed directly on DNA extracted from short-term cocultures of PBMCs...... of a universal immunotherapeutic vaccine construct based on these epitopes....

  19. Transformation of Cowpea Vigna unguiculata with a Full-Length DNA Copy of Cowpea Mosaic Virus M-RNA

    Hille, Jacques; Goldbach, Rob

    1987-01-01

    A full-length DNA copy of the M-RNA of cowpea mosaic virus (CPMV), supplied with either the 35S promoter from cauliflower mosaic virus (CaMV) or the nopaline synthase promoter from Agrobacterium tumefaciens, was introduced into the T-DNA region of a Ti-plasmid-derived gene vector and transferred to

  20. Molecular cloning and expression of full-length DNA copies of the genomic RNAs of cowpea mosaic virus

    Vos, P.

    1987-01-01

    The experiments described in this thesis were designed to unravel various aspects of the mechanism of gene expression of cowpea mosaic virus (CPMV). For this purpose full-length DNA copies of both genomic RNAs of CPMV were constructed. Using powerful invitro

  1. Virtually full-length subtype F and F/D recombinant HIV-1 from Africa and South America

    Laukkanen, T.; Carr, J. K.; Janssens, W.; Liitsola, K.; Gotte, D.; McCutchan, F. E.; Op de Coul, E.; Cornelissen, M.; Heyndrickx, L.; van der Groen, G.; Salminen, M. O.

    2000-01-01

    For reliable classification of HIV-1 strains appropriate reference sequences are needed. The HIV-1 genetic subtype F has a wide geographic spread, causing significant epidemics in South America, Africa, and some regions of Europe. Previously only two full-length sequences of each of the HIV-1

  2. Assessment and optimization of theileria parva sporozoite full-length p67 antigen expression in mammalian cells

    Delivery of various forms of recombinant Theileria parva sporozoite antigen (p67) has been shown to elicit antibody responses in cattle capable of providing protection against East Coast fever, the clinical disease caused by T. parva. Previous formulations of full-length and shorter recombinant vers...

  3. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  4. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  5. Full Length Research paper

    Marcos

    2012-08-21

    Aug 21, 2012 ... Cut flowers have a very limited life after they have been cut off from the mother plant, as survival on their own reserves is ... One of the techniques used for the removal ... and vegetables (Pellegrini and Belle, 2008). There are ...

  6. Full Length Research Article

    Dr Ahmed

    providing energy storage and metabolic fuel, acting as functional and structural ... zoonotic and non-zoonotic diseases are been imported and exported in and out ..... rabbits infected with T. brucie and Gow et al., (2007) in which dog naturally ...

  7. Full Length Research Article

    Dr Ahmed

    some rural communities of Zaria, Nigeria for microbial index of water quality in relation to ... These factors, together with the inadequate waste treatment facilities and ..... The Need for an Integrated Approach to Water Supply and. Sanitation in ...

  8. Full Length Research Article

    Dr Ahmed

    Mbah & Amao (SWJ):11-14. Natural Foods and Feeding Habits Of The African Honey bee ... Keywords: natural food, nectar, pollen, african honeybee, Apis mellifera adansonii ..... Crailsheim, K. (1990). The Protein balance of the honeybee.

  9. Full Length Research Article

    Dr Ahmed

    ... Solarin (SWJ):1-6. On Existence Of Control For A Class Of Uncertain Dynamical Systems ... .m We apply the Conjugate Gradient Method. (C.G.M) in ...... Numerical Technique .... Some of its Applications; Journal of Mathematical Analysis and.

  10. Full Length Research Article

    Dr Ahmed

    other areas of business administration. ... mathematics, real estate, insurance, actuarial science and business administration (McCutcheon & Scott, 1989). Most textbooks written in these ..... Mathematics of Finance; Heinemann; Oxford. Murray ...

  11. Full length Research Article

    Dr Ahmed

    ABSTRACT. This paper considered contamination of aquifer resulting from petroleum spillage, which is a common phenomenal in the. Niger Delta area of Nigeria. We used the model given by. Bestman (1987) and assumed that some endogenous variables are built into the system. To achieve a level of desirable state, we ...

  12. Full Length Research Article

    Dr Ahmed

    SPECKLED PIGEON (Columba guinea HARTLAUB AND. FINSCH ... area of the Nigerian northern guinea savanna (Fry, 1965). The habit of the .... defined by Margolis et al., (1982). Chi-square ..... Southern Africa, Academic Press, London.. 4 ...

  13. Full Length Research Article

    Dr Ahmed

    In recent years, a new technique was introduced that combines both hydrolysis and ... Cassava Starch Preparation: The cassava starch used for this investigation was prepared ... One normal HCl and one normal NaOH were used to adjust the ...

  14. Full length Research Article

    Administrator

    chemical oxidation and reduction, electro-chemical treatment and ion-pair extraction were extensively used ... The present study is an effort to develop a fungal-based treatment system for the cleaning of dye industrial ..... Biochemical and Biophysical Research Communications 178:1056-. 1063. Raju, N. S., Venkataramana ...

  15. Full Length Research Article

    Administrator

    inorganic, synthetic organic polymer and naturally occurring coagulants .... Flash fast mixing was done for 2 mins at a speed of 100rpm, followed by slow mixing for ..... Moringa leaves from germplasm to plant, to food, to health. Symposium on ...

  16. Full Length Research Article

    Dr Ahmed

    The isotope techniques used in hydrology may be classified into three groups: environmental ..... In that case a solution may be found in measurements of 14C content of groundwaters. ... Applied Isotope Hydrogeology. Elsevier, New. York.

  17. Full Length Research Article

    MEMUNA

    markovian process could be reduced to a markovian chain with the homogenous .... x and y respectively. n= the value of the strategy i.e. number of dummies/virtual ..... Groove, CA. Feinberg, E. A. & Shwartz, A. (2002), Handbook of Markov.

  18. Full Length Research paper

    Marcos

    2012-08-21

    Aug 21, 2012 ... 1Universidade Estadual Paulista, Faculdade de Ciências Agronômicas, CEP: 18601-060, Botucatu, SP, Brasil. 2Universidade Federal de Alagoas, Centro de Ciências Agrárias-CECA, Maceio, AL, Brasil. 3Universidade Federal Rural do Semi-Árido, Departamento de Ciências Vegetais, Mossoró, RN, Brasil ...

  19. Caspase 3 inactivates biologically active full length interleukin-33 as a classical cytokine but does not prohibit nuclear translocation

    Ali, Shafaqat; Nguyen, Dang Quan; Falk, Werner; Martin, Michael Uwe

    2010-01-01

    IL-33 is a member of the IL-1 family of cytokines with dual function which either activates cells via the IL-33 receptor in a paracrine fashion or translocates to the nucleus to regulate gene transcription in an intracrine manner. We show that full length murine IL-33 is active as a cytokine and that it is not processed by caspase 1 to mature IL-33 but instead cleaved by caspase 3 at aa175 to yield two products which are both unable to bind to the IL-33 receptor. Full length IL-33 and its N-terminal caspase 3 breakdown product, however, translocate to the nucleus. Finally, bioactive IL-33 is not released by cells constitutively or after activation. This suggests that IL-33 is not a classical cytokine but exerts its function in the nucleus of intact cells and only activates others cells via its receptor as an alarm mediator after destruction of the producing cell.

  20. First full length sequences of the S gene of European isolates reveal further diversity among turkey coronaviruses.

    2011-01-01

    Abstract An increasing incidence of enteric disorders clinically evocative of the poult enteritis complex has been observed in turkeys in France since 2003. Using a newly designed real-time RT-PCR assay specific for the nucleocapsid (N) gene of infectious bronchitis virus (IBV) and turkey coronaviruses (TCoV), coronaviruses were identified in 37 % of the intestinal samples collected from diseased turkey flocks. The full length Spike (S) gene of these viruses was amplified, cloned a...

  1. Beam test of a full-length prototype of the BESIII drift chamber with the readout electronics

    Qin, Z.H.; Chen, Y.B.; Sheng, H.Y.; Wu, L.H.; Liu, J.B.; Zhuang, B.A.; Jiang, X.S.; Zhao, Y.B.; Zhu, K.J.; Yan, Z.K.; Chen, C.; Xu, M.H.; Wang, L.; Ma, X.Y.; Tang, X.; Liu, R.G.; Jin, Y.; Zhu, Q.M.; Zhang, G.F.; Wu, Z.; Li, R.Y.; Zhao, P.P.; Dai, H.L.; Li, X.P.; Li, J.

    2007-01-01

    A full-length prototype of the BESIII drift chamber together with its readout electronics was built and a beam test was performed. Two different methods, namely 'single-threshold method' and 'double-threshold method' for timing measurement, were studied. Test results show that the BESIII drift chamber and its readout electronics can reach their design specifications. The 'double-threshold method' results in a better timing accuracy and noise suppression capabilities as compared with the 'single-threshold method'

  2. Novel full-length major histocompatibility complex class I allele discovery and haplotype definition in pig-tailed macaques.

    Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H

    2017-11-13

    Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

  3. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

  5. Near Full-Length Identification of a Novel HIV-1 CRF01_AE/B/C Recombinant in Northern Myanmar.

    Zhou, Yan-Heng; Chen, Xin; Liang, Yue-Bo; Pang, Wei; Qin, Wei-Hong; Zhang, Chiyu; Zheng, Yong-Tang

    2015-08-01

    The Myanmar-China border appears to be the "hot spot" region for the occurrence of HIV-1 recombination. The majority of the previous analyses of HIV-1 recombination were based on partial genomic sequences, which obviously cannot reflect the reality of the genetic diversity of HIV-1 in this area well. Here, we present a near full-length characterization of a novel HIV-1 CRF01_AE/B/C recombinant isolated from a long-distance truck driver in Northern Myanmar. It is the first description of a near full-length genomic sequence in Myanmar since 2003, and might be one of the most complicated HIV-1 chimeras ever detected in Myanmar, containing four CRF01_AE, six B segments, and five C segments separated by 14 breakpoints throughout its genome. The discovery and characterization of this new CRF01_AE/B/C recombinant indicate that intersubtype recombination is ongoing in Myanmar, continuously generating new forms of HIV-1. More work based on near full-length sequence analyses is urgently needed to better understand the genetic diversity of HIV-1 in these regions.

  6. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  7. Species-Specific Expression of Full-Length and Alternatively Spliced Variant Forms of CDK5RAP2.

    John S Y Park

    Full Text Available CDK5RAP2 is one of the primary microcephaly genes that are associated with reduced brain size and mental retardation. We have previously shown that human CDK5RAP2 exists as a full-length form (hCDK5RAP2 or an alternatively spliced variant form (hCDK5RAP2-V1 that is lacking exon 32. The equivalent of hCDK5RAP2-V1 has been reported in rat and mouse but the presence of full-length equivalent hCDK5RAP2 in rat and mouse has not been examined. Here, we demonstrate that rat expresses both a full length and an alternatively spliced variant form of CDK5RAP2 that are equivalent to our previously reported hCDK5RAP2 and hCDK5RAP2-V1, repectively. However, mouse expresses only one form of CDK5RAP2 that is equivalent to the human and rat alternatively spliced variant forms. Knowledge of this expression of different forms of CDK5RAP2 in human, rat and mouse is essential in selecting the appropriate model for studies of CDK5RAP2 and primary microcephaly but our findings further indicate the evolutionary divergence of mouse from the human and rat species.

  8. Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo.

    Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

    2015-06-03

    Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. © 2015 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  9. Molecular Analysis of Gli3, Ihh, Rab23, and Jag1 in a Rabbit Model of Craniosynostosis: Likely Exclusion as the Loci of Origin.

    Gilbert, James R; Taylor, Gwen M; Losee, Joseph E; Mooney, Mark P; Cooper, Gregory M

    2018-03-01

    Craniosynostosis (CS) involves the premature fusion of one or more cranial sutures. The etiology of CS is complex and mutations in more than 50 distinct genes have been causally linked to the disorder. Many of the genes that have been associated with CS in humans play an essential role in tissue patterning and early craniofacial development. Among these genes are members of the Hedgehog (HH) and Notch signal transduction pathways, including the GLI family member Gli3, Indian Hedgehog ( Ihh), the RAS oncogene family member Rab23, and the Notch ligand JAGGED1 ( Jag1). We have previously described a colony of rabbits with a heritable pattern of coronal suture synostosis, although the genetic basis for synostosis within this model remains unknown. The present study was performed to determine if coding errors in Gli3, Ihh, Rab23, or Jag1 could be causally linked to craniosynostosis in this unique animal model. Sequencing of cDNA templates was performed using samples obtained from wild-type and craniosynostotic rabbits. Several nucleotide polymorphisms were identified in Gli3, Ihh, and Rab23, although these variants failed to segregate by phenotype. No nucleotide polymorphisms were identified in Jag1. These data indicate that the causal locus for heritable craniosynostosis in this rabbit model is not located within the protein coding regions of Gli3, Ihh, Rab23, or Jag1.

  10. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  11. dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

    Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

    2012-03-01

    The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones

    Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S.; Brown, Kevin E.

    2008-01-01

    Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showe...

  13. Construction of a normalized full-length cDNA library of cephalopod Amphioctopus fangsiao and development of microsatellite markers

    Feng, Yanwei; Liu, Wenfen; Xu, Xin; Yang, Jianmin; Wang, Weijun; Wei, Xiumei; Liu, Xiangquan; Sun, Guohua

    2017-10-01

    Amphioctopus fangsiao is one of the most economically important species and has been considered to be a candidate for aquaculture. In order to facilitate its fine-scale genetic analyses, we constructed a normalized full-length library successfully and developed a set of microsatellite markers in this study. The normalized full-length library had a storage capacity of 6.9×105 independent clones. The recombination efficiency was 95% and the average size of inserted fragments was longer than 1000 bp. A total of 3440 high quality ESTs were obtained, which were assembled into 1803 unigenes. Of these unigenes, 450 (25%) were assigned into 33 Gene Ontology terms, 576 (31.9%) into 153 Kyoto Encyclopedia of Genes and Genomes pathways, and 275 (15.3%) into 22 Clusters of Orthologous Groups. Seventy-six polymorphic microsatellite markers were identified. The number of alleles per locus ranged from 4 to 17, and the observed and expected heterozygosities varied between 0.167 and 0.967 and between 0.326 and 0.944, respectively. Twelve loci were significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction and no linkage disequilibrium was found between different loci. This study provided not only a useful resource for the isolation of the functional genes, but also a set of informative microsatellites for the assessment of population structure and conservation genetics of A. fangsiao.

  14. A Novel Strategy to Engineer Pre-Vascularized Full-Length Dental Pulp-like Tissue Constructs.

    Athirasala, Avathamsa; Lins, Fernanda; Tahayeri, Anthony; Hinds, Monica; Smith, Anthony J; Sedgley, Christine; Ferracane, Jack; Bertassoni, Luiz E

    2017-06-12

    The requirement for immediate vascularization of engineered dental pulp poses a major hurdle towards successful implementation of pulp regeneration as an effective therapeutic strategy for root canal therapy, especially in adult teeth. Here, we demonstrate a novel strategy to engineer pre-vascularized, cell-laden hydrogel pulp-like tissue constructs in full-length root canals for dental pulp regeneration. We utilized gelatin methacryloyl (GelMA) hydrogels with tunable physical and mechanical properties to determine the microenvironmental conditions (microstructure, degradation, swelling and elastic modulus) that enhanced viability, spreading and proliferation of encapsulated odontoblast-like cells (OD21), and the formation of endothelial monolayers by endothelial colony forming cells (ECFCs). GelMA hydrogels with higher polymer concentration (15% w/v) and stiffness enhanced OD21 cell viability, spreading and proliferation, as well as endothelial cell spreading and monolayer formation. We then fabricated pre-vascularized, full-length, dental pulp-like tissue constructs by dispensing OD21 cell-laden GelMA hydrogel prepolymer in root canals of extracted teeth and fabricating 500 µm channels throughout the root canals. ECFCs seeded into the microchannels successfully formed monolayers and underwent angiogenic sprouting within 7 days in culture. In summary, the proposed approach is a simple and effective strategy for engineering of pre-vascularized dental pulp constructs offering potentially beneficial translational outcomes.

  15. Global identification of the full-length transcripts and alternative splicing related to phenolic acid biosynthetic genes in Salvia miltiorrhiza

    Zhichao eXu

    2016-02-01

    Full Text Available Salvianolic acids are among the main bioactive components in Salvia miltiorrhiza, and their biosynthesis has attracted widespread interest. However, previous studies on the biosynthesis of phenolic acids using next-generation sequencing platforms are limited with regard to the assembly of full-length transcripts. Based on hybrid-seq (next-generation and single molecular real-time sequencing of the S. miltiorrhiza root transcriptome, we experimentally identified 15 full-length transcripts and 4 alternative splicing events of enzyme-coding genes involved in the biosynthesis of rosmarinic acid. Moreover, we herein demonstrate that lithospermic acid B accumulates in the phloem and xylem of roots, in agreement with the expression patterns of the identified key genes related to rosmarinic acid biosynthesis. According to co-expression patterns, we predicted that 6 candidate cytochrome P450s and 5 candidate laccases participate in the salvianolic acid pathway. Our results provide a valuable resource for further investigation into the synthetic biology of phenolic acids in S. miltiorrhiza.

  16. Effect of Full-Length Carbon Fiber Insoles on Lower Limb Kinetics in Patients With Midfoot Osteoarthritis: A Pilot Study.

    Yi, Taeim; Kim, Jung Hyun; Oh-Park, Mooyeon; Hwang, Ji Hye

    2018-03-01

    We investigated the effects of full-length carbon fiber (FCF) insoles on gait, muscle activity, kinetics, and pain in patients with midfoot osteoarthritis (OA). We enrolled 13 patients with unilateral midfoot OA (mild: Visual Analog Scale [VAS] range, 1-3; moderate, VAS range, 4-7) and healthy controls. All participants were asked to walk under two conditions: with and without FCF insole. The outcome measures were ground reaction force, quantitative gait parameters, electromyography activities and pain severity (VAS). In the patients with moderate midfoot OA, significantly longer gait cycle and higher muscle activity of lower limb during loading-response phase were observed while walking without FCF insoles. In the mild midfoot OA group, there was no significant difference in VAS score (without, 2.0 ± 1.0 vs. with, 2.0 ± 0.5) with FCF insole use. However, significantly reduced VAS score (without, 5.5 ± 1.4 vs. with, 2.0 ± 0.5) and muscle activity of the tibialis anterior and increased muscle activity of gastrocnemius were observed in the moderate midfoot OA group by using an FCF insole (P < 0.05). Full-length carbon fiber insoles can improve pain in individuals with moderate midfoot OA, which might be associated with changes in the kinetics and muscle activities of the lower limb. Taken together, the results of the present study suggest that FCF insoles may be used as a helpful option for midfoot OA.

  17. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  18. Full length articles published in BJOMS during 2010-11--an analysis by sub-specialty and study type.

    Arakeri, Gururaj; Colbert, Serryth; Rosenbaum, Gavin; Brennan, Peter A

    2012-12-01

    Full length articles such as prospective and retrospective studies, case series, laboratory-based research and reviews form the majority of papers published in the British Journal of Oral and Maxillofacial Surgery (BJOMS). We were interested to evaluate the breakdown of these types of articles both by sub-specialty and the type of study as well as the proportion that are written by UK colleagues compared to overseas authors over a 2 year period (2010-11). A total of 191 full length articles across all sub-specialties of our discipline were published, with 107 papers (56%) coming from UK authors. There were proportionately more oncology papers arising from the UK than overseas (60 and 30% of total respectively) while the opposite was found for cleft/deformity studies (10% and 22%). There was only one laboratory-based study published from the UK compared with 27 papers from overseas. The number of quality papers being submitted to the Journal continues to increase, and the type of article being published between UK and overseas probably reflects different practices and case-loads amongst colleagues. The relatively few UK laboratory based studies published in BJOMS compared to overseas authors are most likely due to authors seeking the most prestigious journals possible for their work. Copyright © 2012 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  19. Secretory production of tetrameric native full-length streptavidin with thermostability using Streptomyces lividans as a host.

    Noda, Shuhei; Matsumoto, Takuya; Tanaka, Tsutomu; Kondo, Akihiko

    2015-01-13

    Streptavidin is a tetrameric protein derived from Streptomyces avidinii, and has tight and specific biotin binding affinity. Applications of the streptavidin-biotin system have been widely studied. Streptavidin is generally produced using protein expression in Escherichia coli. In the present study, the secretory production of streptavidin was carried out using Streptomyces lividans as a host. In this study, we used the gene encoding native full-length streptavidin, whereas the core region is generally used for streptavidin production in E. coli. Tetrameric streptavidin composed of native full-length streptavidin monomers was successfully secreted in the culture supernatant of S. lividans transformants, and had specific biotin binding affinity as strong as streptavidin produced by E. coli. The amount of Sav using S. lividans was about 9 times higher than using E. coli. Surprisingly, streptavidin produced by S. lividans exhibited affinity to biotin after boiling, despite the fact that tetrameric streptavidin is known to lose its biotin binding ability after brief boiling. We successfully produced a large amount of tetrameric streptavidin as a secretory-form protein with unique thermotolerance.

  20. Integrative annotation of 21,037 human genes validated by full-length cDNA clones.

    Tadashi Imanishi

    2004-06-01

    Full Text Available The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/. It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs, identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA

  1. Full-Length Fibronectin Drives Fibroblast Accumulation at the Surface of Collagen Microtissues during Cell-Induced Tissue Morphogenesis.

    Jasper Foolen

    Full Text Available Generating and maintaining gradients of cell density and extracellular matrix (ECM components is a prerequisite for the development of functionality of healthy tissue. Therefore, gaining insights into the drivers of spatial organization of cells and the role of ECM during tissue morphogenesis is vital. In a 3D model system of tissue morphogenesis, a fibronectin-FRET sensor recently revealed the existence of two separate fibronectin populations with different conformations in microtissues, i.e. 'compact and adsorbed to collagen' versus 'extended and fibrillar' fibronectin that does not colocalize with the collagen scaffold. Here we asked how the presence of fibronectin might drive this cell-induced tissue morphogenesis, more specifically the formation of gradients in cell density and ECM composition. Microtissues were engineered in a high-throughput model system containing rectangular microarrays of 12 posts, which constrained fibroblast-populated collagen gels, remodeled by the contractile cells into trampoline-shaped microtissues. Fibronectin's contribution during the tissue maturation process was assessed using fibronectin-knockout mouse embryonic fibroblasts (Fn-/- MEFs and floxed equivalents (Fnf/f MEFs, in fibronectin-depleted growth medium with and without exogenously added plasma fibronectin (full-length, or various fragments. In the absence of full-length fibronectin, Fn-/- MEFs remained homogenously distributed throughout the cell-contracted collagen gels. In contrast, in the presence of full-length fibronectin, both cell types produced shell-like tissues with a predominantly cell-free compacted collagen core and a peripheral surface layer rich in cells. Single cell assays then revealed that Fn-/- MEFs applied lower total strain energy on nanopillar arrays coated with either fibronectin or vitronectin when compared to Fnf/f MEFs, but that the presence of exogenously added plasma fibronectin rescued their contractility. While collagen

  2. Construction of a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain

    2013-01-01

    Background Duck enteritis virus (DEV) is the causative agent of duck viral enteritis, which causes an acute, contagious and lethal disease of many species of waterfowl within the order Anseriformes. In recent years, two laboratories have reported on the successful construction of DEV infectious clones in viral vectors to express exogenous genes. The clones obtained were either created with deletion of viral genes and based on highly virulent strains or were constructed using a traditional overlapping fosmid DNA system. Here, we report the construction of a full-length infectious clone of DEV vaccine strain that was cloned into a bacterial artificial chromosome (BAC). Methods A mini-F vector as a BAC that allows the maintenance of large circular DNA in E. coli was introduced into the intergenic region between UL15B and UL18 of a DEV vaccine strain by homologous recombination in chicken embryoblasts (CEFs). Then, the full-length DEV clone pDEV-vac was obtained by electroporating circular viral replication intermediates containing the mini-F sequence into E. coli DH10B and identified by enzyme digestion and sequencing. The infectivity of the pDEV-vac was validated by DEV reconstitution from CEFs transfected with pDEV-vac. The reconstructed virus without mini-F vector sequence was also rescued by co-transfecting the Cre recombinase expression plasmid pCAGGS-NLS/Cre and pDEV-vac into CEF cultures. Finally, the in vitro growth properties and immunoprotection capacity in ducks of the reconstructed viruses were also determined and compared with the parental virus. Results The full genome of the DEV vaccine strain was successfully cloned into the BAC, and this BAC clone was infectious. The in vitro growth properties of these reconstructions were very similar to parental DEV, and ducks immunized with these viruses acquired protection against virulent DEV challenge. Conclusions DEV vaccine virus was cloned as an infectious bacterial artificial chromosome maintaining full-length

  3. Binding site analysis of full-length α1a adrenergic receptor using homology modeling and molecular docking

    Pedretti, Alessandro; Elena Silva, Maria; Villa, Luigi; Vistoli, Giulio

    2004-01-01

    The recent availability of crystal structure of bovine rhodopsin offers new opportunities in order to approach the construction of G protein coupled receptors. This study focuses the attention on the modeling of full-length α 1a adrenergic receptor (α 1a -AR) due to its biological role and significant implications in pharmacological treatment of benign prostate hyperplasia. This work could be considered made up by two main steps: (a) the construction of full structure of α 1a -AR, through homology modeling methods; (b) the automated docking of an endogenous agonist, norepinephrine, and of an antagonist, WB-4101, using BioDock program. The obtained results highlight the key residues involved in binding sites of both agonists and antagonists, confirming the mutagenesis data and giving new suggestions for the rational design of selective ligands

  4. A Novel mouse model of enhanced proteostasis: Full-length human heat shock factor 1 transgenic mice

    Pierce, Anson; Wei, Rochelle; Halade, Dipti; Yoo, Si-Eun; Ran, Qitao; Richardson, Arlan

    2010-01-01

    Research highlights: → Development of mouse overexpressing native human HSF1 in all tissues including CNS. → HSF1 overexpression enhances heat shock response at whole-animal and cellular level. → HSF1 overexpression protects from polyglutamine toxicity and favors aggresomes. → HSF1 overexpression enhances proteostasis at the whole-animal and cellular level. -- Abstract: The heat shock response (HSR) is controlled by the master transcriptional regulator heat shock factor 1 (HSF1). HSF1 maintains proteostasis and resistance to stress through production of heat shock proteins (HSPs). No transgenic model exists that overexpresses HSF1 in tissues of the central nervous system (CNS). We generated a transgenic mouse overexpressing full-length non-mutant HSF1 and observed a 2-4-fold increase in HSF1 mRNA and protein expression in all tissues studied of HSF1 transgenic (HSF1 +/0 ) mice compared to wild type (WT) littermates, including several regions of the CNS. Basal expression of HSP70 and 90 showed only mild tissue-specific changes; however, in response to forced exercise, the skeletal muscle HSR was more elevated in HSF1 +/0 mice compared to WT littermates and in fibroblasts following heat shock, as indicated by levels of inducible HSP70 mRNA and protein. HSF1 +/0 cells elicited a significantly more robust HSR in response to expression of the 82 repeat polyglutamine-YFP fusion construct (Q82YFP) and maintained proteasome-dependent processing of Q82YFP compared to WT fibroblasts. Overexpression of HSF1 was associated with fewer, but larger Q82YFP aggregates resembling aggresomes in HSF1 +/0 cells, and increased viability. Therefore, our data demonstrate that tissues and cells from mice overexpressing full-length non-mutant HSF1 exhibit enhanced proteostasis.

  5. A full-length Plasmodium falciparum recombinant circumsporozoite protein expressed by Pseudomonas fluorescens platform as a malaria vaccine candidate.

    Amy R Noe

    Full Text Available The circumsporozoite protein (CSP of Plasmodium falciparum is a major surface protein, which forms a dense coat on the sporozoite's surface. Preclinical research on CSP and clinical evaluation of a CSP fragment-based RTS, S/AS01 vaccine have demonstrated a modest degree of protection against P. falciparum, mediated in part by humoral immunity and in part by cell-mediated immunity. Given the partial protective efficacy of the RTS, S/AS01 vaccine in a recent Phase 3 trial, further improvement of CSP-based vaccines is crucial. In this report, we describe the preclinical development of a full-length, recombinant CSP (rCSP-based vaccine candidate against P. falciparum malaria suitable for current Good Manufacturing Practice (cGMP production. Utilizing a novel high-throughput Pseudomonas fluorescens expression platform, we demonstrated greater efficacy of full-length rCSP as compared to N-terminally truncated versions, rapidly down-selected a promising lead vaccine candidate, and developed a high-yield purification process to express immunologically active, intact antigen for clinical trial material production. The rCSP, when formulated with various adjuvants, induced antigen-specific antibody responses as measured by enzyme-linked immunosorbent assay (ELISA and immunofluorescence assay (IFA, as well as CD4+ T-cell responses as determined by ELISpot. The adjuvanted rCSP vaccine conferred protection in mice when challenged with transgenic P. berghei sporozoites containing the P. falciparum repeat region of CSP. Furthermore, heterologous prime/boost regimens with adjuvanted rCSP and an adenovirus type 35-vectored CSP (Ad35CS showed modest improvements in eliciting CSP-specific T-cell responses and anti-malarial protection, depending on the order of vaccine delivery. Collectively, these data support the importance of further clinical development of adjuvanted rCSP, either as a stand-alone product or as one of the components in a heterologous prime

  6. Construction of phosphorylation interaction networks by text mining of full-length articles using the eFIP system.

    Tudor, Catalina O; Ross, Karen E; Li, Gang; Vijay-Shanker, K; Wu, Cathy H; Arighi, Cecilia N

    2015-01-01

    Protein phosphorylation is a reversible post-translational modification where a protein kinase adds a phosphate group to a protein, potentially regulating its function, localization and/or activity. Phosphorylation can affect protein-protein interactions (PPIs), abolishing interaction with previous binding partners or enabling new interactions. Extracting phosphorylation information coupled with PPI information from the scientific literature will facilitate the creation of phosphorylation interaction networks of kinases, substrates and interacting partners, toward knowledge discovery of functional outcomes of protein phosphorylation. Increasingly, PPI databases are interested in capturing the phosphorylation state of interacting partners. We have previously developed the eFIP (Extracting Functional Impact of Phosphorylation) text mining system, which identifies phosphorylated proteins and phosphorylation-dependent PPIs. In this work, we present several enhancements for the eFIP system: (i) text mining for full-length articles from the PubMed Central open-access collection; (ii) the integration of the RLIMS-P 2.0 system for the extraction of phosphorylation events with kinase, substrate and site information; (iii) the extension of the PPI module with new trigger words/phrases describing interactions and (iv) the addition of the iSimp tool for sentence simplification to aid in the matching of syntactic patterns. We enhance the website functionality to: (i) support searches based on protein roles (kinases, substrates, interacting partners) or using keywords; (ii) link protein entities to their corresponding UniProt identifiers if mapped and (iii) support visual exploration of phosphorylation interaction networks using Cytoscape. The evaluation of eFIP on full-length articles achieved 92.4% precision, 76.5% recall and 83.7% F-measure on 100 article sections. To demonstrate eFIP for knowledge extraction and discovery, we constructed phosphorylation-dependent interaction

  7. Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri).

    Zheng, Yu; Yun, Chenxia; Wang, Qihui; Smith, Wanli W; Leng, Jing

    2015-02-01

    The tree shrew (Tupaia belangeri) diverges from the primate order (Primates) and is classified as a separate taxonomic group of mammals - Scandentia. It has been suggested that the tree shrew can be used as an animal model for studying human diseases; however, the genomic sequence of the tree shrew is largely unidentified. In the present study, we reported the full-length cDNA sequence of the housekeeping gene, β-actin, in the tree shrew. The amino acid sequence of β-actin in the tree shrew was compared to that of humans and other species; a simple phylogenetic relationship was discovered. Quantitative polymerase chain reaction (qPCR) and western blot analysis further demonstrated that the expression profiles of β-actin, as a general conservative housekeeping gene, in the tree shrew were similar to those in humans, although the expression levels varied among different types of tissue in the tree shrew. Our data provide evidence that the tree shrew has a close phylogenetic association with humans. These findings further enhance the potential that the tree shrew, as a species, may be used as an animal model for studying human disorders.

  8. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas.

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na; Wang, Xiao-Tong; Yue, Xi-Qing

    2016-01-01

    The shell of the pearl oyster ( Pinctada fucata ) mainly comprises aragonite whereas that of the Pacific oyster ( Crassostrea gigas ) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  9. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas

    Xing-Xia Li

    2016-01-01

    Full Text Available The shell of the pearl oyster (Pinctada fucata mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  10. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  11. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  12. Full-length model of the human galectin-4 and insights into dynamics of inter-domain communication

    Rustiguel, Joane K.; Soares, Ricardo O. S.; Meisburger, Steve P.; Davis, Katherine M.; Malzbender, Kristina L.; Ando, Nozomi; Dias-Baruffi, Marcelo; Nonato, Maria Cristina

    2016-09-01

    Galectins are proteins involved in diverse cellular contexts due to their capacity to decipher and respond to the information encoded by β-galactoside sugars. In particular, human galectin-4, normally expressed in the healthy gastrointestinal tract, displays differential expression in cancerous tissues and is considered a potential drug target for liver and lung cancer. Galectin-4 is a tandem-repeat galectin characterized by two carbohydrate recognition domains connected by a linker-peptide. Despite their relevance to cell function and pathogenesis, structural characterization of full-length tandem-repeat galectins has remained elusive. Here, we investigate galectin-4 using X-ray crystallography, small- and wide-angle X-ray scattering, molecular modelling, molecular dynamics simulations, and differential scanning fluorimetry assays and describe for the first time a structural model for human galectin-4. Our results provide insight into the structural role of the linker-peptide and shed light on the dynamic characteristics of the mechanism of carbohydrate recognition among tandem-repeat galectins.

  13. Full-length VP2 gene analysis of canine parvovirus reveals emergence of newer variants in India.

    Nookala, Mangadevi; Mukhopadhyay, Hirak Kumar; Sivaprakasam, Amsaveni; Balasubramanian, Brindhalakshmi; Antony, Prabhakar Xavier; Thanislass, Jacob; Srinivas, Mouttou Vivek; Pillai, Raghavan Madhusoodanan

    2016-12-01

    The canine parvovirus (CPV) infection is a highly contagious and serious enteric disease of dogs with high fatality rate. The present study was taken up to characterize the full-length viral polypeptide 2 (VP2) gene of CPV of Indian origin along with the commercially available vaccines. The faecal samples from parvovirus suspected dogs were collected from various states of India for screening by PCR assay and 66.29% of samples were found positive. Six CPV-2a, three CPV-2b, and one CPV-2c types were identified by sequence analysis. Several unique and existing mutations have been noticed in CPV types analyzed indicating emergence of newer variants of CPV in India. The phylogenetic analysis revealed that all the field CPV types were grouped in different subclades within two main clades, but away from the commercial vaccine strains. CPV-2b and CPV-2c types with unique mutations were found to be establishing in India apart from the prevailing CPV-2a type. Mutations and the positive selection of the mutants were found to be the major mechanism of emergence and evolution of parvovirus. Therefore, the incorporation of local strain in the vaccine formulation may be considered for effective control of CPV infections in India.

  14. Comparison of Newly Assembled Full Length HIV-1 Integrase With Prototype Foamy Virus Integrase: Structure-Function Prospective.

    Dayer, Mohammad Reza

    2016-05-01

    Drug design against human immunodeficiency virus type 1 (HIV-1) integrase through its mechanistic study is of great interest in the area in biological research. The main obstacle in this area is the absence of the full-length crystal structure for HIV-1 integrase to be used as a model. A complete structure, similar to HIV-1 of a prototype foamy virus integrase in complex with DNA, including all conservative residues, is available and has been extensively used in recent investigations. The aim of this study was to determine whether the above model is precisely representative of HIV-1 integrase. This would critically determine the success of any designed drug using the model in deactivation of integrase and AIDS treatment. Primarily, a new structure for HIV-1 was constructed, using a crystal structure of prototype foamy virus as the starting structure. The constructed structure of HIV-1 integrase was simultaneously simulated with a prototype foamy virus integrase on a separate occasion. Our results indicate that the HIV-1 system behaves differently from the prototype foamy virus in terms of folding, hydration, hydrophobicity of binding site and stability. Based on our findings, we can conclude that HIV-1 integrase is vastly different from the prototype foamy virus integrase and does not resemble it, and the modeling output of the prototype foamy virus simulations could not be simply generalized to HIV-1 integrase. Therefore, our HIV-1 model seems to be more representative and more useful for future research.

  15. Association of murine lupus and thymic full-length endogenous retroviral expression maps to a bone marrow stem cell

    Krieg, A.M.; Gourley, M.F.; Steinberg, A.D.

    1991-01-01

    Recent studies of thymic gene expression in murine lupus have demonstrated 8.4-kb (full-length size) modified polytropic (Mpmv) endogenous retroviral RNA. In contrast, normal control mouse strains do not produce detectable amounts of such RNA in their thymuses. Prior studies have attributed a defect in experimental tolerance in murine lupus to a bone marrow stem cell rather than to the thymic epithelium; in contrast, infectious retroviral expression has been associated with the thymic epithelium, rather than with the bone marrow stem cell. The present study was designed to determine whether the abnormal Mpmv expression associated with murine lupus mapped to thymic epithelium or to a marrow precursor. Lethally irradiated control and lupus-prone mice were reconstituted with T cell depleted bone marrow; one month later their thymuses were studied for endogenous retroviral RNA and protein expression. Recipients of bone marrow from nonautoimmune donors expressed neither 8.4-kb Mpmv RNA nor surface MCF gp70 in their thymuses. In contrast, recipients of bone marrow from autoimmune NZB or BXSB donors expressed thymic 8.4-kb Mpmv RNA and mink cell focus-forming gp70. These studies demonstrate that lupus-associated 8.4-kb Mpmv endogenous retroviral expression is determined by bone marrow stem cells

  16. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai

    2010-01-01

    Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

  17. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    Jessica A. Brown

    2010-01-01

    Full Text Available Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη, a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average than the ground-state binding step (18-fold on average. Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.

  18. VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones.

    Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Söderlund-Venermo, Maria; Young, Neal S; Brown, Kevin E

    2008-05-10

    Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus.

  19. VP1u phospholipase activity is critical for infectivity of full-length parvovirus B19 genomic clones✰

    Filippone, Claudia; Zhi, Ning; Wong, Susan; Lu, Jun; Kajigaya, Sachiko; Gallinella, Giorgio; Kakkola, Laura; Venermo, Maria S Söderlund; Young, Neal S.; Brown, Kevin E.

    2008-01-01

    Three full-length genomic clones (pB19-M20, pB19-FL and pB19-HG1) of parvovirus B19 were produced in different laboratories. pB19-M20 was shown to produce infectious virus. To determine the differences in infectivity, all three plasmids were tested by transfection and infection assays. All three clones were similar in viral DNA replication, RNA transcription, and viral capsid protein production. However, only pB19-M20 and pB19-HG1 produced infectious virus. Comparison of viral sequences showed no significant differences in ITR or NS regions. In the capsid region, there was a nucleotide sequence difference conferring an amino acid substitution (E176K) in the phospholipase A2-like motif of the VP1-unique (VP1u) region. The recombinant VP1u with the E176K mutation had no catalytic activity as compared with the wild-type. When this mutation was introduced into pB19-M20, infectivity was significantly attenuated, confirming the critical role of this motif. Investigation of the original serum from which pB19-FL was cloned confirmed that the phospholipase mutation was present in the native B19 virus. PMID:18252260

  20. Potency of full-length MGF to induce maximal activation of the IGF-I R Is similar to recombinant human IGF-I at high equimolar concentrations

    J.A.M.J.L. Janssen (Joseph); L.J. Hofland (Leo); C.J. Strasburger; E.S.R.D. Van Dungen (Elisabeth S.R. Den); M. Thevis (Mario)

    2016-01-01

    textabstractAims To compare full-length mechano growth factor (full-length MGF) with human recombinant insulin-like growth factor-I (IGF-I) and human recombinant insulin (HI) in their ability to activate the human IGF-I receptor (IGF-IR), the human insulin receptor (IR-A) and the human insulin

  1. Quench propagation study for the BNL-built, full-length, 50mm aperture SSC model dipoles

    Muratore, J.; Anerella, M.; Cottingham, G.

    1993-01-01

    As part of the program to build and test SSC 50mm aperture prototype dipole magnets, a series of seven full-length dipoles were built and tested at BNL. Important part of the testing program was the study of quench propagation velocity and hot spot temperature over a range of experimental conditions in order to characterize the safety of the conductor during quenches experienced under different circumstances. Such studies are important tools in design, implementation, and verification of quench protection strategies in superconducting accelerator magnets. This investigation was facilitated by artificially inducing quenches under controlled experimental conditions with spot heaters placed at carefully chosen locations on the magnet coils. Such studies were done as part of the 15m-long magnet test program and were performed on five of the magnets in the series. All were equipped with spot heaters on an inner coil, and two of these also had spot heaters on an outer coil. Therefore, in addition to the studies in the inner coils, it was also possible to study quench propagation in the outer coils, where slower quench velocities and higher conductor temperatures are expected, in comparison to that in the inner coils. In spontaneous quenches, where there may be no voltage taps, it is not possible to measure the conductor hot spot temperature. It is straightforward to measure the number of MIITs generated, since only the magnet current and voltage need be measured. The concept of MIITs then becomes a valuable diagnostic tool which can characterize the temperature behavior of a conductor during quench and can be used to determine limits for safe operation of the coil. With spot heaters placed at known locations and closely bracketed by voltage taps, hot spot temperature can be measured. Research such as is described in this paper is therefore important in order to determine the validity of the MIITs approach and to establish a correlation between temperature and MIITs

  2. Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

    Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

    2005-01-01

    Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

  3. Amplification and pyrosequencing of near-full-length hepatitis C virus for typing and monitoring antiviral resistant strains.

    Trémeaux, P; Caporossi, A; Ramière, C; Santoni, E; Tarbouriech, N; Thélu, M-A; Fusillier, K; Geneletti, L; François, O; Leroy, V; Burmeister, W P; André, P; Morand, P; Larrat, S

    2016-05-01

    Directly acting antiviral drugs have contributed considerable progress to hepatitis C virus (HCV) treatment, but they show variable activity depending on virus genotypes and subtypes. Therefore, accurate genotyping including recombinant form detection is still of major importance, as is the detection of resistance-associated mutations in case of therapeutic failure. To meet these goals, an approach to amplify the HCV near-complete genome with a single long-range PCR and sequence it with Roche GS Junior was developed. After optimization, the overall amplification success rate was 73% for usual genotypes (i.e. HCV 1a, 1b, 3a and 4a, 16/22) and 45% for recombinant forms RF_2k/1b (5/11). After pyrosequencing and subsequent de novo assembly, a near-full-length genomic consensus sequence was obtained for 19 of 21 samples. The genotype and subtype were confirmed by phylogenetic analysis for every sample, including the suspected recombinant forms. Resistance-associated mutations were detected in seven of 13 samples at baseline, in the NS3 (n = 3) or NS5A (n = 4) region. Of these samples, the treatment of one patient included daclatasvir, and that patient experienced a relapse. Virus sequences from pre- and posttreatment samples of four patients who experienced relapse after sofosbuvir-based therapy were compared: the selected variants seem too far from the NS5B catalytic site to be held responsible. Although tested on a limited set of samples and with technical improvements still necessary, this assay has proven to be successful for both genotyping and resistance-associated variant detection on several HCV types. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Structure and function of the first full-length murein peptide ligase (Mpl cell wall recycling protein.

    Debanu Das

    2011-03-01

    Full Text Available Bacterial cell walls contain peptidoglycan, an essential polymer made by enzymes in the Mur pathway. These proteins are specific to bacteria, which make them targets for drug discovery. MurC, MurD, MurE and MurF catalyze the synthesis of the peptidoglycan precursor UDP-N-acetylmuramoyl-L-alanyl-γ-D-glutamyl-meso-diaminopimelyl-D-alanyl-D-alanine by the sequential addition of amino acids onto UDP-N-acetylmuramic acid (UDP-MurNAc. MurC-F enzymes have been extensively studied by biochemistry and X-ray crystallography. In gram-negative bacteria, ∼30-60% of the bacterial cell wall is recycled during each generation. Part of this recycling process involves the murein peptide ligase (Mpl, which attaches the breakdown product, the tripeptide L-alanyl-γ-D-glutamyl-meso-diaminopimelate, to UDP-MurNAc. We present the crystal structure at 1.65 Å resolution of a full-length Mpl from the permafrost bacterium Psychrobacter arcticus 273-4 (PaMpl. Although the Mpl structure has similarities to Mur enzymes, it has unique sequence and structure features that are likely related to its role in cell wall recycling, a function that differentiates it from the MurC-F enzymes. We have analyzed the sequence-structure relationships that are unique to Mpl proteins and compared them to MurC-F ligases. We have also characterized the biochemical properties of this enzyme (optimal temperature, pH and magnesium binding profiles and kinetic parameters. Although the structure does not contain any bound substrates, we have identified ∼30 residues that are likely to be important for recognition of the tripeptide and UDP-MurNAc substrates, as well as features that are unique to Psychrobacter Mpl proteins. These results provide the basis for future mutational studies for more extensive function characterization of the Mpl sequence-structure relationships.

  5. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  6. Structure and function of the first full-length murein peptide ligase (Mpl) cell wall recycling protein.

    Das, Debanu; Hervé, Mireille; Feuerhelm, Julie; Farr, Carol L; Chiu, Hsiu-Ju; Elsliger, Marc-André; Knuth, Mark W; Klock, Heath E; Miller, Mitchell D; Godzik, Adam; Lesley, Scott A; Deacon, Ashley M; Mengin-Lecreulx, Dominique; Wilson, Ian A

    2011-03-18

    Bacterial cell walls contain peptidoglycan, an essential polymer made by enzymes in the Mur pathway. These proteins are specific to bacteria, which make them targets for drug discovery. MurC, MurD, MurE and MurF catalyze the synthesis of the peptidoglycan precursor UDP-N-acetylmuramoyl-L-alanyl-γ-D-glutamyl-meso-diaminopimelyl-D-alanyl-D-alanine by the sequential addition of amino acids onto UDP-N-acetylmuramic acid (UDP-MurNAc). MurC-F enzymes have been extensively studied by biochemistry and X-ray crystallography. In gram-negative bacteria, ∼30-60% of the bacterial cell wall is recycled during each generation. Part of this recycling process involves the murein peptide ligase (Mpl), which attaches the breakdown product, the tripeptide L-alanyl-γ-D-glutamyl-meso-diaminopimelate, to UDP-MurNAc. We present the crystal structure at 1.65 Å resolution of a full-length Mpl from the permafrost bacterium Psychrobacter arcticus 273-4 (PaMpl). Although the Mpl structure has similarities to Mur enzymes, it has unique sequence and structure features that are likely related to its role in cell wall recycling, a function that differentiates it from the MurC-F enzymes. We have analyzed the sequence-structure relationships that are unique to Mpl proteins and compared them to MurC-F ligases. We have also characterized the biochemical properties of this enzyme (optimal temperature, pH and magnesium binding profiles and kinetic parameters). Although the structure does not contain any bound substrates, we have identified ∼30 residues that are likely to be important for recognition of the tripeptide and UDP-MurNAc substrates, as well as features that are unique to Psychrobacter Mpl proteins. These results provide the basis for future mutational studies for more extensive function characterization of the Mpl sequence-structure relationships.

  7. A simple strategy for the purification of native recombinant full-length human RPL10 protein from inclusion bodies.

    Pereira, Larissa M; Silva, Luana R; Alves, Joseane F; Marin, Nélida; Silva, Flavio Sousa; Morganti, Ligia; Silva, Ismael D C G; Affonso, Regina

    2014-09-01

    The L10 ribosomal protein (RPL10) plays a role in the binding of the 60 S and 40 S ribosomal subunits and in mRNA translation. The evidence indicates that RPL10 also has multiple extra-ribosomal functions, including tumor suppression. Recently, the presence of RPL10 in prostate and ovarian cancers was evaluated, and it was demonstrated to be associated with autistic disorders and premature ovarian failure. In the present work, we successfully cloned and expressed full-length human RPL10 (hRPL10) protein and isolated inclusion bodies containing this protein that had formed under mild growth conditions. The culture produced 376mg of hRPL10 protein per liter of induced bacterial culture, of which 102.4mg was present in the soluble fraction, and 25.6mg was recovered at approximately 94% purity. These results were obtained using a two-step process of non-denaturing protein extraction from pelleted inclusion bodies. We studied the characteristics of this protein using circular dichroism spectroscopy and by monitoring the changes induced by the presence or absence of zinc ions using fluorescence spectrometry. The results demonstrated that the protein obtained using these non-conventional methods retained its secondary and tertiary structure. The conformational changes induced by the incorporation of zinc suggested that this protein could interact with Jun or the SH3 domain of c-yes. The results suggested that the strategy used to obtain hRPL10 is simple and could be applied to obtaining other proteins that are susceptible to degradation. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Single-molecule study of full-length NaChBac by planar lipid bilayer recording.

    Andrew Jo

    Full Text Available Planar lipid bilayer device, alternatively known as BLM, is a powerful tool to study functional properties of conducting membrane proteins such as ion channels and porins. In this work, we used BLM to study the prokaryotic voltage-gated sodium channel (Nav NaChBac in a well-defined membrane environment. Navs are an essential component for the generation and propagation of electric signals in excitable cells. The successes in the biochemical, biophysical and crystallographic studies on prokaryotic Navs in recent years has greatly promoted the understanding of the molecular mechanism that underlies these proteins and their eukaryotic counterparts. In this work, we investigated the single-molecule conductance and ionic selectivity behavior of NaChBac. Purified NaChBac protein was first reconstituted into lipid vesicles, which is subsequently incorporated into planar lipid bilayer by fusion. At single-molecule level, we were able to observe three distinct long-lived conductance sub-states of NaChBac. Change in the membrane potential switches on the channel mainly by increasing its opening probability. In addition, we found that individual NaChBac has similar permeability for Na+, K+, and Ca2+. The single-molecule behavior of the full-length protein is essentially highly stochastic. Our results show that planar lipid bilayer device can be used to study purified ion channels at single-molecule level in an artificial environment, and such studies can reveal new protein properties that are otherwise not observable in in vivo ensemble studies.

  9. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  10. BACHD rats expressing full-length mutant huntingtin exhibit differences in social behavior compared to wild-type littermates.

    Manfré, Giuseppe; Novati, Arianna; Faccini, Ilaria; Rossetti, Andrea C; Bosch, Kari; Molteni, Raffaella; Riva, Marco A; Van der Harst, Johanneke E; Nguyen, Huu Phuc; Homberg, Judith R

    2018-01-01

    Huntington disease (HD) is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT) with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype. This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT) rats at different ages, using two different measures of sociability. Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF) to the observed behavioral alterations. In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats seemed to show a mild deficit in

  11. BACHD rats expressing full-length mutant huntingtin exhibit differences in social behavior compared to wild-type littermates.

    Giuseppe Manfré

    Full Text Available Huntington disease (HD is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype.This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT rats at different ages, using two different measures of sociability.Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF to the observed behavioral alterations.In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats seemed to show a mild

  12. BACHD rats expressing full-length mutant huntingtin exhibit differences in social behavior compared to wild-type littermates

    Manfré, Giuseppe; Novati, Arianna; Faccini, Ilaria; Rossetti, Andrea C.; Bosch, Kari; Molteni, Raffaella; Riva, Marco A.; Van der Harst, Johanneke E.; Homberg, Judith R.

    2018-01-01

    Background Huntington disease (HD) is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT) with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype. Objective This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT) rats at different ages, using two different measures of sociability. Methods Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF) to the observed behavioral alterations. Results In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats

  13. Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

    Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

    2016-02-02

    Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  15. Purification and characterization of recombinant full-length and protease domain of murine MMP-9 expressed in Drosophila S2 cells

    Rasch, Morten G; Lund, Ida K; Illemann, Martin

    2010-01-01

    MMP-9. Constructs encoding zymogens of full-length murine MMP-9 and a version lacking the O-glycosylated linker region and hemopexin domains were therefore generated and expressed in stably transfected Drosophila S2 insect cells. After 7 days of induction the expression levels of the full......-length and truncated versions were 5 mg/l and 2 mg/l, respectively. The products were >95% pure after gelatin Sepharose chromatography and possessed proteolytic activity when analyzed by gelatin zymography. Using the purified full-length murine MMP-9 we raised polyclonal antibodies by immunizations of rabbits......Matrix metalloproteinase-9 (MMP-9) is a 92-kDa soluble pro-enzyme implicated in pathological events including cancer invasion. It is therefore an attractive target for therapeutic intervention studies in mouse models. Development of inhibitors requires sufficient amounts of correctly folded murine...

  16. Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India

    Vijay P Bondre

    2016-01-01

    Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.

  17. Studies of nontarget-mediated distribution of human full-length IgG1 antibody and its FAb fragment in cardiovascular and metabolic-related tissues.

    Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter

    2015-05-01

    Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

  18. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning

    Deymier, Martin J., E-mail: mdeymie@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Claiborne, Daniel T., E-mail: dclaibo@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Ende, Zachary, E-mail: zende@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Ratner, Hannah K., E-mail: hannah.ratner@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Kilembe, William, E-mail: wkilembe@rzhrg-mail.org [Zambia-Emory HIV Research Project (ZEHRP), B22/737 Mwembelelo, Emmasdale Post Net 412, P/BagE891, Lusaka (Zambia); Allen, Susan, E-mail: sallen5@emory.edu [Zambia-Emory HIV Research Project (ZEHRP), B22/737 Mwembelelo, Emmasdale Post Net 412, P/BagE891, Lusaka (Zambia); Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Hunter, Eric, E-mail: eric.hunter2@emory.edu [Emory Vaccine Center, Yerkes National Primate Research Center, 954 Gatewood Road NE, Atlanta, GA 30329 (United States); Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States)

    2014-11-15

    The high genetic diversity of HIV-1 impedes high throughput, large-scale sequencing and full-length genome cloning by common restriction enzyme based methods. Applying novel methods that employ a high-fidelity polymerase for amplification and an unbiased fusion-based cloning strategy, we have generated several HIV-1 full-length genome infectious molecular clones from an epidemiologically linked transmission pair. These clones represent the transmitted/founder virus and phylogenetically diverse non-transmitted variants from the chronically infected individual's diverse quasispecies near the time of transmission. We demonstrate that, using this approach, PCR-induced mutations in full-length clones derived from their cognate single genome amplicons are rare. Furthermore, all eight non-transmitted genomes tested produced functional virus with a range of infectivities, belying the previous assumption that a majority of circulating viruses in chronic HIV-1 infection are defective. Thus, these methods provide important tools to update protocols in molecular biology that can be universally applied to the study of human viral pathogens. - Highlights: • Our novel methodology demonstrates accurate amplification and cloning of full-length HIV-1 genomes. • A majority of plasma derived HIV variants from a chronically infected individual are infectious. • The transmitted/founder was more infectious than the majority of the variants from the chronically infected donor.

  19. Patient-Specific Instruments Based on Knee Joint Computed Tomography and Full-Length Lower Extremity Radiography in Total Knee Replacement

    Hua Tian

    2018-01-01

    Conclusions: The use of PSIs based on knee joint CT and standing full-length lower extremity radiography in TKR resulted in acceptable alignment compared with the use of conventional instruments, although the marginal advantage was not statistically different. Surgical time and clinical results were also similar between the two groups. However, the PSI group had less postoperative drainage.

  20. Purification and characterization of recombinant full-length and protease domain of murine MMP-9 expressed in Drosophila S2 cells

    Rasch, Morten G; Lund, Ida K.; Illemann, Martin

    2010-01-01

    -length and truncated versions were 5 mg/l and 2 mg/l, respectively. The products were >95% pure after gelatin Sepharose chromatography and possessed proteolytic activity when analyzed by gelatin zymography. Using the purified full-length murine MMP-9 we raised polyclonal antibodies by immunizations of rabbits...

  1. Particle infectivity of HIV-1 full-length genome infectious molecular clones in a subtype C heterosexual transmission pair following high fidelity amplification and unbiased cloning

    Deymier, Martin J.; Claiborne, Daniel T.; Ende, Zachary; Ratner, Hannah K.; Kilembe, William; Allen, Susan; Hunter, Eric

    2014-01-01

    The high genetic diversity of HIV-1 impedes high throughput, large-scale sequencing and full-length genome cloning by common restriction enzyme based methods. Applying novel methods that employ a high-fidelity polymerase for amplification and an unbiased fusion-based cloning strategy, we have generated several HIV-1 full-length genome infectious molecular clones from an epidemiologically linked transmission pair. These clones represent the transmitted/founder virus and phylogenetically diverse non-transmitted variants from the chronically infected individual's diverse quasispecies near the time of transmission. We demonstrate that, using this approach, PCR-induced mutations in full-length clones derived from their cognate single genome amplicons are rare. Furthermore, all eight non-transmitted genomes tested produced functional virus with a range of infectivities, belying the previous assumption that a majority of circulating viruses in chronic HIV-1 infection are defective. Thus, these methods provide important tools to update protocols in molecular biology that can be universally applied to the study of human viral pathogens. - Highlights: • Our novel methodology demonstrates accurate amplification and cloning of full-length HIV-1 genomes. • A majority of plasma derived HIV variants from a chronically infected individual are infectious. • The transmitted/founder was more infectious than the majority of the variants from the chronically infected donor

  2. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  3. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  4. Functional characterization of a full length pregnane X receptor, expression in vivo, and identification of PXR alleles, in Zebrafish (Danio rerio)

    Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianópolis, SC 88040-900 (Brazil); Kubota, Akira; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Lille-Langøy, Roger [Department of Biology, University of Bergen, N-5020 Bergen (Norway); Karchner, Sibel I. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Celander, Malin C. [Department of Biological and Environmental Sciences, University of Gothenburg, SE 405 30 Göteborg (Sweden); Hahn, Mark E. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Goksøyr, Anders [Department of Biology, University of Bergen, N-5020 Bergen (Norway); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-15

    Highlights: •Full-length pxr has been cloned from zebrafish. •Alleles of pxr were identified in zebrafish. •Full length Pxr was activated less strongly than ligand binding domain in cell-based reporter assays. •High levels of pxr expression were found in eye and brain as well as in liver. •TCPOBOP and PB did not significantly alter expression of pxr in liver. -- Abstract: The pregnane X receptor (PXR) (nuclear receptor NR1I2) is a ligand activated transcription factor, mediating responses to diverse xenobiotic and endogenous chemicals. The properties of PXR in fish are not fully understood. Here we report on cloning and characterization of full-length PXR of zebrafish, Danio rerio, and pxr expression in vivo. Initial efforts gave a cDNA encoding a 430 amino acid protein identified as zebrafish pxr by phylogenetic and synteny analysis. The sequence of the cloned Pxr DNA binding domain (DBD) was highly conserved, with 74% identity to human PXR-DBD, while the ligand-binding domain (LBD) of the cloned sequence was only 44% identical to human PXR-LBD. Sequence variation among clones in the initial effort prompted sequencing of multiple clones from a single fish. There were two prominent variants, one sequence with S183, Y218 and H383 and the other with I183, C218 and N383, which we designate as alleles pxr*1 (nr1i2*1) and pxr*2 (nr1i2*2), respectively. In COS-7 cells co-transfected with a PXR-responsive reporter gene, the full-length Pxr*1 (the more common variant) was activated by known PXR agonists clotrimazole and pregnenolone 16α-carbonitrile but to a lesser extent than the full-length human PXR. Activation of full-length Pxr*1 was only 10% of that with the Pxr*1 LBD. Quantitative real time PCR analysis showed prominent expression of pxr in liver and eye, as well as brain and intestine of adult zebrafish. The pxr was expressed in heart and kidney at levels similar to that in intestine. The expression of pxr in liver was weakly induced by ligands for

  5. Genetic deletion of muscle RANK or selective inhibition of RANKL is not as effective as full-length OPG-fc in mitigating muscular dystrophy.

    Dufresne, Sébastien S; Boulanger-Piette, Antoine; Bossé, Sabrina; Argaw, Anteneh; Hamoudi, Dounia; Marcadet, Laetitia; Gamu, Daniel; Fajardo, Val A; Yagita, Hideo; Penninger, Josef M; Russell Tupling, A; Frenette, Jérôme

    2018-04-24

    Although there is a strong association between osteoporosis and skeletal muscle atrophy/dysfunction, the functional relevance of a particular biological pathway that regulates synchronously bone and skeletal muscle physiopathology is still elusive. Receptor-activator of nuclear factor κB (RANK), its ligand RANKL and the soluble decoy receptor osteoprotegerin (OPG) are the key regulators of osteoclast differentiation and bone remodelling. We thus hypothesized that RANK/RANKL/OPG, which is a key pathway for bone regulation, is involved in Duchenne muscular dystrophy (DMD) physiopathology. Our results show that muscle-specific RANK deletion (mdx-RANK mko ) in dystrophin deficient mdx mice improves significantly specific force [54% gain in force] of EDL muscles with no protective effect against eccentric contraction-induced muscle dysfunction. In contrast, full-length OPG-Fc injections restore the force of dystrophic EDL muscles [162% gain in force], protect against eccentric contraction-induced muscle dysfunction ex vivo and significantly improve functional performance on downhill treadmill and post-exercise physical activity. Since OPG serves a soluble receptor for RANKL and as a decoy receptor for TRAIL, mdx mice were injected with anti-RANKL and anti-TRAIL antibodies to decipher the dual function of OPG. Injections of anti-RANKL and/or anti-TRAIL increase significantly the force of dystrophic EDL muscle [45% and 17% gains in force, respectively]. In agreement, truncated OPG-Fc that contains only RANKL domains produces similar gains, in terms of force production, than anti-RANKL treatments. To corroborate that full-length OPG-Fc also acts independently of RANK/RANKL pathway, dystrophin/RANK double-deficient mice were treated with full-length OPG-Fc for 10 days. Dystrophic EDL muscles exhibited a significant gain in force relative to untreated dystrophin/RANK double-deficient mice, indicating that the effect of full-length OPG-Fc is in part independent of the RANKL

  6. Pharmacological efficacy of anti-IL-1β scFv, Fab and full-length antibodies in treatment of rheumatoid arthritis.

    Qi, Jianying; Ye, Xianlong; Ren, Guiping; Kan, Fangming; Zhang, Yu; Guo, Mo; Zhang, Zhiyi; Li, Deshan

    2014-02-01

    Rheumatoid arthritis (RA) is a chronic autoimmune inflammatory disease that mainly causes the synovial joint inflammation and cartilage destruction. Interleukin-1β (IL-1β) is an important proinflammatory cytokine involved in the pathogenesis of RA. In this study, we constructed and expressed anti-IL-1β-full-length antibody in CHO-K1-SV, anti-IL-1β-Fab and anti-IL-1β-scFv in Rosetta. We compared the therapeutic efficacy of three anti-IL-1β antibodies for CIA mice. Mice with CIA were subcutaneously injected with humanized anti-IL-1β-scFv, anti-IL-1β-Fab or anti-IL-1β-full-length antibody. The effects of treatment were determined by arthritis severity score, autoreactive humoral, cellular immune responses, histological lesion and cytokines production. Compared with anti-IL-1β-scFv treatments, anti-IL-1β-Fab and anti-IL-1β-full-length antibody therapy resulted in more significant effect in alleviating the severity of arthritis by preventing bone damage and cartilage destruction, reducing humoral and cellular immune responses, and down-regulating the expression of IL-1β, IL-6, IL-2, IFN-γ, TNF-α and MMP-3 in inflammatory tissue. The therapeutic effects of anti-IL-1β-Fab and anti-IL-1β-full-length antibodies on CIA mice had no significant difference. However, production of anti-IL-1β-full-length antibody in eukaryotic system is, in general, time-consuming and more expensive than that of anti-IL-1β-Fab in prokaryotic systems. In conclusion, as a small molecule antibody, anti-IL-1β-Fab is an ideal candidate for RA therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. The effect of two different renal denervation strategies on blood pressure in resistant hypertension: Comparison of full-length versus proximal renal artery ablation.

    Chen, Weijie; Ling, Zhiyu; Du, Huaan; Song, Wenxin; Xu, Yanping; Liu, Zengzhang; Su, Li; Xiao, Peilin; Yuan, Yuelong; Lu, Jiayi; Zhang, Jianhong; Li, Zhifeng; Shao, Jiang; Zhong, Bin; Zhou, Bei; Woo, Kamsang; Yin, Yuehui

    2016-11-01

    Renal denervation (RDN) is used to manage blood pressure (BP) in patients with resistant hypertension (rHT), but effectiveness is still a concern, and key arterial portion for successful RDN is not clear. The aim of this study was to investigate the efficacy and safety of proximal versus full-length renal artery ablation in patients with resistant hypertension (rHT). Forty-seven patients with rHT were randomly assigned to receive full-length ablation (n = 23) or proximal ablation (n = 24) of the renal arteries. All lesions were treated with radiofrequency energy via a saline-irrigated catheter. Office BP was measured during 12 months of follow-up and ambulatory BP at baseline and 6 months (n = 15 in each group). Compared with full-length ablation, proximal ablation reduced the number of ablation points in both the right (6.1 ± 0.7 vs. 3.3 ± 0.6, P renal arteries (6.2 ± 0.7 vs. 3.3 ± 0.8, P  0.5). Similar office BPs was reduced by -39.4 ± 11.5/-20.9 ± 7.1 mm Hg at 6 months and -38.2 ± 10.3/-21.5 ± 5.8 mm Hg at 12 months in the full-length group (P efficacy and safety profile compared with full-length RDN, and propose the proximal artery as the key portion for RDN. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. FULL LENGTH RESEARCH ARTICLE Gnut

    Dr Ahmed

    . Peanuts, Groundnuts microflora and pathogenesis of peanut pod. Root Phytopathology, 55(4):359-367. Halima, A. S. 2000. Isolation and preliminary Identification of fungi in stored groundnut. HND project. Department of Science Laboratory.

  9. Full-length genome sequences of five hepatitis C virus isolates representing subtypes 3g, 3h, 3i and 3k, and a unique genotype 3 variant.

    Lu, Ling; Li, Chunhua; Yuan, Jie; Lu, Teng; Okamoto, Hiroaki; Murphy, Donald G

    2013-03-01

    We characterized the full-length genomes of five distinct hepatitis C virus (HCV)-3 isolates. These represent the first complete genomes for subtypes 3g and 3h, the second such genomes for 3k and 3i, and of one novel variant presently not assigned to a subtype. Each genome was determined from 18-25 overlapping fragments. They had lengths of 9579-9660 nt and each contained a single ORF encoding 3020-3025 aa. They were isolated from five patients residing in Canada; four were of Asian origin and one was of Somali origin. Phylogenetic analysis using 64 partial NS5B sequences differentiated 10 assigned subtypes, 3a-3i and 3k, and two additional lineages within genotype 3. From the data of this study, HCV-3 full-length sequences are now available for six of the assigned subtypes and one unassigned. Our findings should add insights to HCV evolutionary studies and clinical applications.

  10. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  11. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  12. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    Brenner, Sydney; Kodzius, Rimantas; Tan, Yue Ying; Tay, Alice; Tay, Boon-Hui; Venkatesh, Byrappa

    2012-01-01

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the 'oligo-capping' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5'-ESTs and 41,317 3'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for whole

  13. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    Brenner, Sydney

    2012-10-08

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the \\'oligo-capping\\' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5\\'-ESTs and 41,317 3\\'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for

  14. Full-Length Characterization of Hepatitis C Virus Subtype 3a Reveals Novel Hypervariable Regions under Positive Selection during Acute Infection▿

    Humphreys, Isla; Fleming, Vicki; Fabris, Paolo; Parker, Joe; Schulenberg, Bodo; Brown, Anthony; Demetriou, Charis; Gaudieri, Silvana; Pfafferott, Katja; Lucas, Michaela; Collier, Jane; Huang, Kuan-Hsiang Gary; Pybus, Oliver G.; Klenerman, Paul; Barnes, Eleanor

    2009-01-01

    Hepatitis C virus subtype 3a is a highly prevalent and globally distributed strain that is often associated with infection via injection drug use. This subtype exhibits particular phenotypic characteristics. In spite of this, detailed genetic analysis of this subtype has rarely been performed. We performed full-length viral sequence analysis in 18 patients with chronic HCV subtype 3a infection and assessed genomic viral variability in comparison to other HCV subtypes. Two novel regions of int...

  15. Construction of occluded recombinant baculoviruses containing the full-length cry1Ab and cry1Ac genes from Bacillus thuringiensis

    B.M. Ribeiro

    1998-06-01

    Full Text Available The administration of baculoviruses to insects for bioassay purposes is carried out, in most cases, by contamination of food surfaces with a known amount of occlusion bodies (OBs. Since per os infection is the natural route of infection, occluded recombinant viruses containing crystal protein genes (cry1Ab and cry1Ac from Bacillus thuringiensis were constructed for comparison with the baculovirus prototype Autographa californica nucleopolyhedrovirus (AcNPV. The transfer vector pAcUW2B was used for construction of occluded recombinant viruses. The transfer vector containing the crystal protein genes was cotransfected with linearized DNA from a non-occluded recombinant virus. The isolation of recombinant viruses was greatly facilitated by the reduction of background "wild type" virus and the increased proportion of recombinant viruses. Since the recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve the pathogenicity of the recombinant viruses when compared with the wild type AcNPV, and in order to compare expression levels of the full-length crystal proteins produced by non-occluded and occluded recombinant viruses the full-length cry1Ab and cry1Ac genes were chosen for construction of occluded recombinant viruses. The recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve its pathogenicity but the size of the larvae infected with the recombinant viruses was significantly smaller than that of larvae infected with the wild type virus.

  16. PCR-based isolation and identification of full-length low-molecular-weight glutenin subunit genes in bread wheat (Triticum aestivum L.).

    Zhang, Xiaofei; Liu, Dongcheng; Jiang, Wei; Guo, Xiaoli; Yang, Wenlong; Sun, Jiazhu; Ling, Hongqing; Zhang, Aimin

    2011-12-01

    Low-molecular-weight glutenin subunits (LMW-GSs) are encoded by a multi-gene family and are essential for determining the quality of wheat flour products, such as bread and noodles. However, the exact role or contribution of individual LMW-GS genes to wheat quality remains unclear. This is, at least in part, due to the difficulty in characterizing complete sequences of all LMW-GS gene family members in bread wheat. To identify full-length LMW-GS genes, a polymerase chain reaction (PCR)-based method was established, consisting of newly designed conserved primers and the previously developed LMW-GS gene molecular marker system. Using the PCR-based method, 17 LMW-GS genes were identified and characterized in Xiaoyan 54, of which 12 contained full-length sequences. Sequence alignments showed that 13 LMW-GS genes were identical to those found in Xiaoyan 54 using the genomic DNA library screening, and the other four full-length LMW-GS genes were first isolated from Xiaoyan 54. In Chinese Spring, 16 unique LMW-GS genes were isolated, and 13 of them contained full-length coding sequences. Additionally, 16 and 17 LMW-GS genes in Dongnong 101 and Lvhan 328 (chosen from the micro-core collections of Chinese germplasm), respectively, were also identified. Sequence alignments revealed that at least 15 LMW-GS genes were common in the four wheat varieties, and allelic variants of each gene shared high sequence identities (>95%) but exhibited length polymorphism in repetitive regions. This study provides a PCR-based method for efficiently identifying LMW-GS genes in bread wheat, which will improve the characterization of complex members of the LMW-GS gene family and facilitate the understanding of their contributions to wheat quality.

  17. TypeLoader: A fast and efficient automated workflow for the annotation and submission of novel full-length HLA alleles.

    Surendranath, V; Albrecht, V; Hayhurst, J D; Schöne, B; Robinson, J; Marsh, S G E; Schmidt, A H; Lange, V

    2017-07-01

    Recent years have seen a rapid increase in the discovery of novel allelic variants of the human leukocyte antigen (HLA) genes. Commonly, only the exons encoding the peptide binding domains of novel HLA alleles are submitted. As a result, the IPD-IMGT/HLA Database lacks sequence information outside those regions for the majority of known alleles. This has implications for the application of the new sequencing technologies, which deliver sequence data often covering the complete gene. As these technologies simplify the characterization of the complete gene regions, it is desirable for novel alleles to be submitted as full-length sequences to the database. However, the manual annotation of full-length alleles and the generation of specific formats required by the sequence repositories is prone to error and time consuming. We have developed TypeLoader to address both these facets. With only the full-length sequence as a starting point, Typeloader performs automatic sequence annotation and subsequently handles all steps involved in preparing the specific formats for submission with very little manual intervention. TypeLoader is routinely used at the DKMS Life Science Lab and has aided in the successful submission of more than 900 novel HLA alleles as full-length sequences to the European Nucleotide Archive repository and the IPD-IMGT/HLA Database with a 95% reduction in the time spent on annotation and submission when compared with handling these processes manually. TypeLoader is implemented as a web application and can be easily installed and used on a standalone Linux desktop system or within a Linux client/server architecture. TypeLoader is downloadable from http://www.github.com/DKMS-LSL/typeloader. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  19. The full-length E1-circumflexE4 protein of human papillomavirus type 18 modulates differentiation-dependent viral DNA amplification and late gene expression

    Wilson, Regina; Ryan, Gordon B.; Knight, Gillian L.; Laimins, Laimonis A.; Roberts, Sally

    2007-01-01

    Activation of the productive phase of the human papillomavirus (HPV) life cycle in differentiated keratinocytes is coincident with high-level expression of E1-circumflexE4 protein. To determine the role of E1-circumflexE4 in the HPV replication cycle, we constructed HPV18 mutant genomes in which expression of the full-length E1-circumflexE4 protein was abrogated. Undifferentiated keratinocytes containing mutant genomes showed enhanced proliferation when compared to cells containing wildtype genomes, but there were no differences in maintenance of viral episomes. Following differentiation, cells with mutant genomes exhibited reduced levels of viral DNA amplification and late gene expression, compared to wildtype genome-containing cells. This indicates that HPV18 E1-circumflexE4 plays an important role in regulating HPV late functions, and it may also function in the early phase of the replication cycle. Our finding that full-length HPV18 E1-circumflexE4 protein plays a significant role in promoting viral genome amplification concurs with a similar report with HPV31, but is in contrast to an HPV11 study where viral DNA amplification was not dependent on full-length E1-circumflexE4 expression, and to HPV16 where only C-terminal truncations in E1-circumflexE4 abrogated vegetative genome replication. This suggests that type-specific differences exist between various E1-circumflexE4 proteins

  20. Molecular comparisons of full length metapneumovirus (MPV genomes, including newly determined French AMPV-C and -D isolates, further supports possible subclassification within the MPV Genus.

    Paul A Brown

    Full Text Available Four avian metapneumovirus (AMPV subgroups (A-D have been reported previously based on genetic and antigenic differences. However, until now full length sequences of the only known isolates of European subgroup C and subgroup D viruses (duck and turkey origin, respectively have been unavailable. These full length sequences were determined and compared with other full length AMPV and human metapneumoviruses (HMPV sequences reported previously, using phylogenetics, comparisons of nucleic and amino acid sequences and study of codon usage bias. Results confirmed that subgroup C viruses were more closely related to HMPV than they were to the other AMPV subgroups in the study. This was consistent with previous findings using partial genome sequences. Closer relationships between AMPV-A, B and D were also evident throughout the majority of results. Three metapneumovirus "clusters" HMPV, AMPV-C and AMPV-A, B and D were further supported by codon bias and phylogenetics. The data presented here together with those of previous studies describing antigenic relationships also between AMPV-A, B and D and between AMPV-C and HMPV may call for a subclassification of metapneumoviruses similar to that used for avian paramyxoviruses, grouping AMPV-A, B and D as type I metapneumoviruses and AMPV-C and HMPV as type II.

  1. Molecular Comparisons of Full Length Metapneumovirus (MPV) Genomes, Including Newly Determined French AMPV-C and –D Isolates, Further Supports Possible Subclassification within the MPV Genus

    Brown, Paul A.; Lemaitre, Evelyne; Briand, François-Xavier; Courtillon, Céline; Guionie, Olivier; Allée, Chantal; Toquin, Didier; Bayon-Auboyer, Marie-Hélène; Jestin, Véronique; Eterradossi, Nicolas

    2014-01-01

    Four avian metapneumovirus (AMPV) subgroups (A–D) have been reported previously based on genetic and antigenic differences. However, until now full length sequences of the only known isolates of European subgroup C and subgroup D viruses (duck and turkey origin, respectively) have been unavailable. These full length sequences were determined and compared with other full length AMPV and human metapneumoviruses (HMPV) sequences reported previously, using phylogenetics, comparisons of nucleic and amino acid sequences and study of codon usage bias. Results confirmed that subgroup C viruses were more closely related to HMPV than they were to the other AMPV subgroups in the study. This was consistent with previous findings using partial genome sequences. Closer relationships between AMPV-A, B and D were also evident throughout the majority of results. Three metapneumovirus “clusters” HMPV, AMPV-C and AMPV-A, B and D were further supported by codon bias and phylogenetics. The data presented here together with those of previous studies describing antigenic relationships also between AMPV-A, B and D and between AMPV-C and HMPV may call for a subclassification of metapneumoviruses similar to that used for avian paramyxoviruses, grouping AMPV-A, B and D as type I metapneumoviruses and AMPV-C and HMPV as type II. PMID:25036224

  2. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  3. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Alamar Santiago

    2009-09-01

    Full Text Available Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new

  4. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an

  5. Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo

    Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

    2015-01-01

    Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. PMID:25908840

  6. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  7. Construction of a full-length prototype of the BESIII drift chamber and on-detector test for the BESIII drift chamber electronics

    Qin Zhonghua; Wu Linghui; Liu Jianbei; Chinese Academy of Sciences, Beijing; Yan Zhikang; Hunan Univ., Changsha; Chen Yuanbo; Chen Chang; Xu Meihang; Wang Lan; Ma Xiaoyan; Jin Yan; Liu Rongguang; Tang Xiao; Zhang Guifang; Zhu Qiming; Sheng Huayi; Zhu Kejun

    2007-01-01

    A full-length prototype of the BESIII drift chamber was built. The experience gained on gas sealing, high voltage supply and front-end electronics installation should be greatly beneficial to the successful construction of the BESIII drift chamber. An on-detector test of the BESIII drift chamber electronics was carried out with the constructed prototype chamber. The noise performance, drift time and charge measurements, and electronics gains were examined specifically. The final test results indicate that the electronics have a good performance and can satisfy their design requirements. (authors)

  8. Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

    Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

    2013-01-01

    Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

  9. Inconsistencies of genome annotations in apicomplexan parasites revealed by 5'-end-one-pass and full-length sequences of oligo-capped cDNAs

    Sugano Sumio

    2009-07-01

    Full Text Available Abstract Background Apicomplexan parasites are causative agents of various diseases including malaria and have been targets of extensive genomic sequencing. We generated 5'-EST collections for six apicomplexa parasites using our full-length oligo-capping cDNA library method. To improve upon the current genome annotations, as well as to validate the importance for physical cDNA clone resources, we generated a large-scale collection of full-length cDNAs for several apicomplexa parasites. Results In this study, we used a total of 61,056 5'-end-single-pass cDNA sequences from Plasmodium falciparum, P. vivax, P. yoelii, P. berghei, Cryptosporidium parvum, and Toxoplasma gondii. We compared these partially sequenced cDNA sequences with the currently annotated gene models and observed significant inconsistencies between the two datasets. In particular, we found that on average 14% of the exons in the current gene models were not supported by any cDNA evidence, and that 16% of the current gene models may contain at least one mis-annotation and should be re-evaluated. We also identified a large number of transcripts that had been previously unidentified. For 732 cDNAs in T. gondii, the entire sequences were determined in order to evaluate the annotated gene models at the complete full-length transcript level. We found that 41% of the T. gondii gene models contained at least one inconsistency. We also identified and confirmed by RT-PCR 140 previously unidentified transcripts found in the intergenic regions of the current gene annotations. We show that the majority of these discrepancies are due to questionable predictions of one or two extra exons in the upstream or downstream regions of the genes. Conclusion Our data indicates that the current gene models are likely to still be incomplete and have much room for improvement. Our unique full-length cDNA information is especially useful for further refinement of the annotations for the genomes of

  10. Full-length characterization of A1/D intersubtype recombinant genomes from a therapy-induced HIV type 1 controller during acute infection and his noncontrolling partner

    Fomsgaard, A.; Vinner, L.; Therrien, D.

    2008-01-01

    To increase the understanding of mechanisms of HIV control we have genetically and immunologically characterized a full-length HIV-1 isolated from an acute infection in a rare case of undetectable viremia. The subject, a 43-year-old Danish white male (DK1), was diagnosed with acute HIV-1 infection...... and phylogenic trees were constructed and diversity and evolutionary distances were calculated. Intracellular IFN-gamma in CD8(+)CD3(+) T-lymphocyte reactions was investigated by intracellular flow cytometry (IC-FACS). Virus isolates from both patients were A1D intersubtype recombinants showing 98% sequence...

  11. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  12. Assessing the genetic diversity of Cu resistance in mine tailings through high-throughput recovery of full-length copA genes

    Li, Xiaofang; Zhu, Yong-Guan; Shaban, Babak; Bruxner, Timothy J. C.; Bond, Philip L.; Huang, Longbin

    2015-01-01

    Characterizing the genetic diversity of microbial copper (Cu) resistance at the community level remains challenging, mainly due to the polymorphism of the core functional gene copA. In this study, a local BLASTN method using a copA database built in this study was developed to recover full-length putative copA sequences from an assembled tailings metagenome; these sequences were then screened for potentially functioning CopA using conserved metal-binding motifs, inferred by evolutionary trace analysis of CopA sequences from known Cu resistant microorganisms. In total, 99 putative copA sequences were recovered from the tailings metagenome, out of which 70 were found with high potential to be functioning in Cu resistance. Phylogenetic analysis of selected copA sequences detected in the tailings metagenome showed that topology of the copA phylogeny is largely congruent with that of the 16S-based phylogeny of the tailings microbial community obtained in our previous study, indicating that the development of copA diversity in the tailings might be mainly through vertical descent with few lateral gene transfer events. The method established here can be used to explore copA (and potentially other metal resistance genes) diversity in any metagenome and has the potential to exhaust the full-length gene sequences for downstream analyses. PMID:26286020

  13. Crystal Structure of the Full-Length Feline Immunodeficiency Virus Capsid Protein Shows an N-Terminal β-Hairpin in the Absence of N-Terminal Proline

    Christelle Folio

    2017-11-01

    Full Text Available Feline immunodeficiency virus (FIV is a member of the Retroviridae family. It is the causative agent of an acquired immunodeficiency syndrome (AIDS in cats and wild felines. Its capsid protein (CA drives the assembly of the viral particle, which is a critical step in the viral replication cycle. Here, the first atomic structure of full-length FIV CA to 1.67 Å resolution is determined. The crystallized protein exhibits an original tetrameric assembly, composed of dimers which are stabilized by an intermolecular disulfide bridge induced by the crystallogenesis conditions. The FIV CA displays a standard α-helical CA topology with two domains, separated by a linker shorter than other retroviral CAs. The β-hairpin motif at its amino terminal end, which interacts with nucleotides in HIV-1, is unusually long in FIV CA. Interestingly, this functional β-motif is formed in this construct in the absence of the conserved N-terminal proline. The FIV CA exhibits a cis Arg–Pro bond in the CypA-binding loop, which is absent in known structures of lentiviral CAs. This structure represents the first tri-dimensional structure of a functional, full-length FIV CA.

  14. Differing Efficacies of Lead Group A Streptococcal Vaccine Candidates and Full-Length M Protein in Cutaneous and Invasive Disease Models

    Tania Rivera-Hernandez

    2016-06-01

    Full Text Available Group A Streptococcus (GAS is an important human pathogen responsible for both superficial infections and invasive diseases. Autoimmune sequelae may occur upon repeated infection. For this reason, development of a vaccine against GAS represents a major challenge, since certain GAS components may trigger autoimmunity. We formulated three combination vaccines containing the following: (i streptolysin O (SLO, interleukin 8 (IL-8 protease (Streptococcus pyogenes cell envelope proteinase [SpyCEP], group A streptococcal C5a peptidase (SCPA, arginine deiminase (ADI, and trigger factor (TF; (ii the conserved M-protein-derived J8 peptide conjugated to ADI; and (iii group A carbohydrate lacking the N-acetylglucosamine side chain conjugated to ADI. We compared these combination vaccines to a “gold standard” for immunogenicity, full-length M1 protein. Vaccines were adjuvanted with alum, and mice were immunized on days 0, 21, and 28. On day 42, mice were challenged via cutaneous or subcutaneous routes. High-titer antigen-specific antibody responses with bactericidal activity were detected in mouse serum samples for all vaccine candidates. In comparison with sham-immunized mice, all vaccines afforded protection against cutaneous challenge. However, only full-length M1 protein provided protection in the subcutaneous invasive disease model.

  15. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  16. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  17. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  18. Study of canine parvovirus evolution: comparative analysis of full-length VP2 gene sequences from Argentina and international field strains.

    Gallo Calderón, Marina; Wilda, Maximiliano; Boado, Lorena; Keller, Leticia; Malirat, Viviana; Iglesias, Marcela; Mattion, Nora; La Torre, Jose

    2012-02-01

    The continuous emergence of new strains of canine parvovirus (CPV), poorly protected by current vaccination, is a concern among breeders, veterinarians, and dog owners around the world. Therefore, the understanding of the genetic variation in emerging CPV strains is crucial for the design of disease control strategies, including vaccines. In this paper, we obtained the sequences of the full-length gene encoding for the main capsid protein (VP2) of 11 canine parvovirus type 2 (CPV-2) Argentine representative field strains, selected from a total of 75 positive samples studied in our laboratory in the last 9 years. A comparative sequence analysis was performed on 9 CPV-2c, one CPV-2a, and one CPV-2b Argentine strains with respect to international strains reported in the GenBank database. In agreement with previous reports, a high degree of identity was found among CPV-2c Argentine strains (99.6-100% and 99.7-100% at nucleotide and amino acid levels, respectively). However, the appearance of a new substitution in the 440 position (T440A) in four CPV-2c Argentine strains obtained after the year 2009 gives support to the variability observed for this position located within the VP2, three-fold spike. This is the first report on the genetic characterization of the full-length VP2 gene of emerging CPV strains in South America and shows that all the Argentine CPV-2c isolates cluster together with European and North American CPV-2c strains.

  19. Divergence of host range and biological properties between natural isolate and full-length infectious cDNA clone of the Beet mild yellowing virus 2ITB.

    Klein, Elodie; Brault, Véronique; Klein, Delphine; Weyens, Guy; Lefèbvre, Marc; Ziegler-Graff, Véronique; Gilmer, David

    2014-01-01

    Plant infection by poleroviruses is restricted to phloem tissues, preventing any classical leaf rub inoculation with viral RNA or virions. Efficient virus inoculation to plants is achieved by viruliferous aphids that acquire the virus by feeding on infected plants. The use of promoter-driven infectious cDNA is an alternative means to infect plants and allows reverse genetic studies to be performed. Using Beet mild yellowing virus isolate 2ITB (BMYV-2ITB), we produced a full-length infectious cDNA clone of the virus (named BMYV-EK) placed under the control of the T7 RNA polymerase and the Cauliflower mosaic virus 35S promoters. Infectivity of the engineered BMYV-EK virus was assayed in different plant species and compared with that of the original virus. We showed that in vitro- or in planta-derived transcripts were infectious in protoplasts and in whole plants. Importantly, the natural aphid vector Myzus persicae efficiently transmitted the viral progeny produced in infected plants. By comparing agroinoculation and aphid infection in a host range assay, we showed that the engineered BMYV-EK virus displayed a similar host range to BMYV-2ITB, except for Nicotiana benthamiana, which proved to be resistant to systemic infection with BMYV-EK. Finally, both the BMYV-EK P0 and the full-length clone were able to strongly interfere with post-transcriptional gene silencing. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  20. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  1. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics.

    Aoki, Koh; Yano, Kentaro; Suzuki, Ayako; Kawamura, Shingo; Sakurai, Nozomu; Suda, Kunihiro; Kurabayashi, Atsushi; Suzuki, Tatsuya; Tsugane, Taneaki; Watanabe, Manabu; Ooga, Kazuhide; Torii, Maiko; Narita, Takanori; Shin-I, Tadasu; Kohara, Yuji; Yamamoto, Naoki; Takahashi, Hideki; Watanabe, Yuichiro; Egusa, Mayumi; Kodama, Motoichiro; Ichinose, Yuki; Kikuchi, Mari; Fukushima, Sumire; Okabe, Akiko; Arie, Tsutomu; Sato, Yuko; Yazawa, Katsumi; Satoh, Shinobu; Omura, Toshikazu; Ezura, Hiroshi; Shibata, Daisuke

    2010-03-30

    The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs) was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706) was estimated to be 0.061%. The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the tomato whole-genome sequence and aid in tomato functional

  2. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum cultivar Micro-Tom, a reference system for the Solanaceae genomics

    Kikuchi Mari

    2010-03-01

    Full Text Available Abstract Background The Solanaceae family includes several economically important vegetable crops. The tomato (Solanum lycopersicum is regarded as a model plant of the Solanaceae family. Recently, a number of tomato resources have been developed in parallel with the ongoing tomato genome sequencing project. In particular, a miniature cultivar, Micro-Tom, is regarded as a model system in tomato genomics, and a number of genomics resources in the Micro-Tom-background, such as ESTs and mutagenized lines, have been established by an international alliance. Results To accelerate the progress in tomato genomics, we developed a collection of fully-sequenced 13,227 Micro-Tom full-length cDNAs. By checking redundant sequences, coding sequences, and chimeric sequences, a set of 11,502 non-redundant full-length cDNAs (nrFLcDNAs was generated. Analysis of untranslated regions demonstrated that tomato has longer 5'- and 3'-untranslated regions than most other plants but rice. Classification of functions of proteins predicted from the coding sequences demonstrated that nrFLcDNAs covered a broad range of functions. A comparison of nrFLcDNAs with genes of sixteen plants facilitated the identification of tomato genes that are not found in other plants, most of which did not have known protein domains. Mapping of the nrFLcDNAs onto currently available tomato genome sequences facilitated prediction of exon-intron structure. Introns of tomato genes were longer than those of Arabidopsis and rice. According to a comparison of exon sequences between the nrFLcDNAs and the tomato genome sequences, the frequency of nucleotide mismatch in exons between Micro-Tom and the genome-sequencing cultivar (Heinz 1706 was estimated to be 0.061%. Conclusion The collection of Micro-Tom nrFLcDNAs generated in this study will serve as a valuable genomic tool for plant biologists to bridge the gap between basic and applied studies. The nrFLcDNA sequences will help annotation of the

  3. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  4. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

    Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice

    2018-01-01

    Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine...... the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence...... the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies....

  5. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  6. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  7. Production of full length and splicing form of chymosin using pETexpression system in E-coli and investigation its enzyme activity and preplasmic secretion

    M. Ahmadi Zeydabadi

    2008-05-01

    Full Text Available Introduction: Chymosin (Rennin EC 3.4.23.4 is an aspartyl proteinas (the major proteolyticenzyme in the fourth stomach of the unweaned calf that is formed by proteolytic activation fromzymogene prochymosin. The aim of his study was to produce the full length and splicing form ofchymosin using pETexpression system in E-coli and to assay the activity of expressed enzyme andpreplasmic secretion.Materials and Methods: The sense primer F-prochy(+ (5´-ggggccatgGCTGAGATCACCAGGAincluding NCOI restriction site. The anti sense R-prochy(- (5´-gggcggccgcGATGGCTTTGGCCAGC -3´ hybridizing to the C-terminal end of calf preprocymosincDNA and contains an additional NotI restriction site at its 5´-end . The cells were disrupted bysonication and proteins were purified by using Ni-NTA beads from Qiagen under native conditional.The preprochymosin and AS6 preprochymosin were activated at pH 4.7. The enzyme solutions werediluted 20-fold with 50 mM phosphate buffer .Results: Sequencing data analysis showed that the exon six has been spliced out and, therefore thegene product is 114 bp shorter in length, both chymosin forms were expressed together in E.coli.Under the same expression conditions, at least AS6 preprochymosin was produced 7-fold highexpression in comparison to a full-length recombinant chymosin. Following acid activation andneutralization, the purified fractions were tested in a qualitative milk clotting assay. The clottingactivity of preprochymosin and exon6-less preprochymosin were comparable.Conclusion: High expression of this alternatively expressed transcript in bacteria, and properfolding of the AS6 chymosin protein molecule in the absence of exon six are the two most importantaspects distinguished in this research.

  8. Lyso-myristoyl phosphatidylcholine micelles sustain the activity of Dengue non-structural (NS) protein 3 protease domain fused with the full-length NS2B.

    Huang, Qiwei; Li, Qingxin; Joy, Joma; Chen, Angela Shuyi; Ruiz-Carrillo, David; Hill, Jeffrey; Lescar, Julien; Kang, Congbao

    2013-12-01

    Dengue virus (DENV), a member of the flavivirus genus, affects 50-100 million people in tropical and sub-tropical regions. The DENV protease domain is located at the N-terminus of the NS3 protease and requires for its enzymatic activity a hydrophilic segment of the NS2B that acts as a cofactor. The protease is an important antiviral drug target because it plays a crucial role in virus replication by cleaving the genome-coded polypeptide into mature functional proteins. Currently, there are no drugs to inhibit DENV protease activity. Most structural and functional studies have been conducted using protein constructs containing the NS3 protease domain connected to a soluble segment of the NS2B membrane protein via a nine-residue linker. For in vitro structural and functional studies, it would be useful to produce a natural form of the DENV protease containing the NS3 protease domain and the full-length NS2B protein. Herein, we describe the expression and purification of a natural form of DENV protease (NS2BFL-NS3pro) containing the full-length NS2B protein and the protease domain of NS3 (NS3pro). The protease was expressed and purified in detergent micelles necessary for its folding. Our results show that this purified protein was active in detergent micelles such as lyso-myristoyl phosphatidylcholine (LMPC). These findings should facilitate further structural and functional studies of the protease and will facilitate drug discovery targeting DENV. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Computational Insight Into the Structural Organization of Full-Length Toll-Like Receptor 4 Dimer in a Model Phospholipid Bilayer

    Mahesh Chandra Patra

    2018-03-01

    Full Text Available Toll-like receptors (TLRs are a unique category of pattern recognition receptors that recognize distinct pathogenic components, often utilizing the same set of downstream adaptors. Specific molecular features of extracellular, transmembrane (TM, and cytoplasmic domains of TLRs are crucial for coordinating the complex, innate immune signaling pathway. Here, we constructed a full-length structural model of TLR4—a widely studied member of the interleukin-1 receptor/TLR superfamily—using homology modeling, protein–protein docking, and molecular dynamics simulations to understand the differential domain organization of TLR4 in a membrane-aqueous environment. Results showed that each functional domain of the membrane-bound TLR4 displayed several structural transitions that are biophysically essential for plasma membrane integration. Specifically, the extracellular and cytoplasmic domains were partially immersed in the upper and lower leaflets of the membrane bilayer. Meanwhile, TM domains tilted considerably to overcome the hydrophobic mismatch with the bilayer core. Our analysis indicates an alternate dimerization or a potential oligomerization interface of TLR4-TM. Moreover, the helical properties of an isolated TM dimer partly agree with that of the full-length receptor. Furthermore, membrane-absorbed or solvent-exposed surfaces of the toll/interleukin-1 receptor domain are consistent with previous X-ray crystallography and biochemical studies. Collectively, we provided a complete structural model of membrane-bound TLR4 that strengthens our current understanding of the complex mechanism of receptor activation and adaptor recruitment in the innate immune signaling pathway.

  10. Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

    Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2015-02-02

    Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  12. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  13. Llama immunization with full-length VAR2CSA generates cross-reactive and inhibitory single-domain antibodies against the DBL1X domain.

    Nunes-Silva, Sofia; Gangnard, Stéphane; Vidal, Marta; Vuchelen, Anneleen; Dechavanne, Sebastien; Chan, Sherwin; Pardon, Els; Steyaert, Jan; Ramboarina, Stephanie; Chêne, Arnaud; Gamain, Benoît

    2014-12-09

    VAR2CSA stands today as the leading vaccine candidate aiming to protect future pregnant women living in malaria endemic areas against the severe clinical outcomes of pregnancy associated malaria (PAM). The rational design of an efficient VAR2CSA-based vaccine relies on a profound understanding of the molecular interactions associated with P. falciparum infected erythrocyte sequestration in the placenta. Following immunization of a llama with the full-length VAR2CSA recombinant protein, we have expressed and characterized a panel of 19 nanobodies able to recognize the recombinant VAR2CSA as well as the surface of erythrocytes infected with parasites originating from different parts of the world. Domain mapping revealed that a large majority of nanobodies targeted DBL1X whereas a few of them were directed towards DBL4ε, DBL5ε and DBL6ε. One nanobody targeting the DBL1X was able to recognize the native VAR2CSA protein of the three parasite lines tested. Furthermore, four nanobodies targeting DBL1X reproducibly inhibited CSA adhesion of erythrocytes infected with the homologous NF54-CSA parasite strain, providing evidences that DBL1X domain is part or close to the CSA binding site. These nanobodies could serve as useful tools to identify conserved epitopes shared between different variants and to characterize the interactions between VAR2CSA and CSA.

  14. The full-length microRNA cluster in the intron of large latency transcript is associated with the virulence of pseudorabies virus.

    Wang, Xin; Zhang, Mei-Mei; Yan, Kai; Tang, Qi; Wu, Yi-Quan; He, Wen-Bo; Chen, Huan-Chun; Liu, Zheng-Fei

    2018-07-01

    Pseudorabies virus (PRV), the etiological pathogen of Aujeszky's disease, belongs to the Alphaherpesvirus subfamily. Large latency transcript (LLT), the most abundant PRV transcript, harbors a ~ 4.6 kb microRNA (miRNA) cluster-encoding intron. To investigate the function of the LLT miRNA cluster during the life cycle of PRV, we generated a miRNA cluster mutation virus (PRV-∆miR cluster) and revertant virus. Analysis of the growth kinetics of PRV-ΔmiR cluster-infected cells revealed significantly smaller plaques and lower titers than the wild-type and revertant viruses. The mutation virus exhibited increased IE180 and decreased EP0 expression. The clinical symptoms observed in mice infected with PRV-ΔmiR cluster revealed that the miRNA cluster is involved in the pathogenesis of PRV. Physical parameters, virus shedding assays, and the SN 50 titers revealed that the miRNA cluster enhances PRV virulence in pigs. Collectively, our findings suggest that the full-length miRNA cluster is involved in PRV replication and virulence. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Construction and characterisation of a full-length infectious molecular clone from a fast replicating, X4-tropic HIV-1 CRF02.AG primary isolate

    Tebit, Denis M.; Zekeng, Leopold; Kaptue, Lazare; Kraeusslich, Hans-Georg; Herchenroeder, Ottmar

    2003-01-01

    Based on our previous analysis of HIV-1 isolates from Cameroon, we constructed a full-length infectious molecular clone from a primary isolate belonging to the CRF02.AG group of recombinant viruses which dominate the HIV-epidemic in West and Central Africa. The virus derived by transfection of the proviral clone pBD6-15 replicated with similar efficiency compared to its parental isolate and used CXCR4 as coreceptor as well. Furthermore, HIV-1 BD6-15 exhibited similar replication properties and virus yield as the reference B-type HIV-1 strain NL4-3. Sequence analysis revealed open reading frames for all structural and accessory genes apart from vpr. Phylogenetic and bootscanning analyses confirmed that BD6-15 clusters with CRF02.AG recombinant strains from West and Central Africa with similar cross-over points as described for the CRF02.AG prototype strain lbNG. Thus, pBD6-15 represents the first non-subtype B infectious molecular clone of a fast replicating, high producer, X4-tropic primary HIV-1 isolate, which had only been briefly passaged in primary cells

  16. An RNA-Seq strategy to detect the complete coding and non-coding transcriptome including full-length imprinted macro ncRNAs.

    Ru Huang

    Full Text Available Imprinted macro non-protein-coding (nc RNAs are cis-repressor transcripts that silence multiple genes in at least three imprinted gene clusters in the mouse genome. Similar macro or long ncRNAs are abundant in the mammalian genome. Here we present the full coding and non-coding transcriptome of two mouse tissues: differentiated ES cells and fetal head using an optimized RNA-Seq strategy. The data produced is highly reproducible in different sequencing locations and is able to detect the full length of imprinted macro ncRNAs such as Airn and Kcnq1ot1, whose length ranges between 80-118 kb. Transcripts show a more uniform read coverage when RNA is fragmented with RNA hydrolysis compared with cDNA fragmentation by shearing. Irrespective of the fragmentation method, all coding and non-coding transcripts longer than 8 kb show a gradual loss of sequencing tags towards the 3' end. Comparisons to published RNA-Seq datasets show that the strategy presented here is more efficient in detecting known functional imprinted macro ncRNAs and also indicate that standardization of RNA preparation protocols would increase the comparability of the transcriptome between different RNA-Seq datasets.

  17. Characterization of the cloned full-length and a truncated human target of rapamycin: Activity, specificity, and enzyme inhibition as studied by a high capacity assay

    Toral-Barza, Lourdes; Zhang Weiguo; Lamison, Craig; LaRocque, James; Gibbons, James; Yu, Ker

    2005-01-01

    The mammalian target of rapamycin (mTOR/TOR) is implicated in cancer and other human disorders and thus an important target for therapeutic intervention. To study human TOR in vitro, we have produced in large scale both the full-length TOR (289 kDa) and a truncated TOR (132 kDa) from HEK293 cells. Both enzymes demonstrated a robust and specific catalytic activity towards the physiological substrate proteins, p70 S6 ribosomal protein kinase 1 (p70S6K1) and eIF4E binding protein 1 (4EBP1), as measured by phosphor-specific antibodies in Western blotting. We developed a high capacity dissociation-enhanced lanthanide fluorescence immunoassay (DELFIA) for analysis of kinetic parameters. The Michaelis constant (K m ) values of TOR for ATP and the His6-S6K substrate were shown to be 50 and 0.8 μM, respectively. Dose-response and inhibition mechanisms of several known inhibitors, the rapamycin-FKBP12 complex, wortmannin and LY294002, were also studied in DELFIA. Our data indicate that TOR exhibits kinetic features of those shared by traditional serine/threonine kinases and demonstrate the feasibility for TOR enzyme screen in searching for new inhibitors

  18. Transgenic Parasites Stably Expressing Full-Length Plasmodium falciparum Circumsporozoite Protein as a Model for Vaccine Down-Selection in Mice Using Sterile Protection as an Endpoint

    Porter, Michael D.; Nicki, Jennifer; Pool, Christopher D.; DeBot, Margot; Illam, Ratish M.; Brando, Clara; Bozick, Brooke; De La Vega, Patricia; Angra, Divya; Spaccapelo, Roberta; Crisanti, Andrea; Murphy, Jittawadee R.; Bennett, Jason W.; Schwenk, Robert J.; Ockenhouse, Christian F.

    2013-01-01

    Circumsporozoite protein (CSP) of Plasmodium falciparum is a protective human malaria vaccine candidate. There is an urgent need for models that can rapidly down-select novel CSP-based vaccine candidates. In the present study, the mouse-mosquito transmission cycle of a transgenic Plasmodium berghei malaria parasite stably expressing a functional full-length P. falciparum CSP was optimized to consistently produce infective sporozoites for protection studies. A minimal sporozoite challenge dose was established, and protection was defined as the absence of blood-stage parasites 14 days after intravenous challenge. The specificity of protection was confirmed by vaccinating mice with multiple CSP constructs of differing lengths and compositions. Constructs that induced high NANP repeat-specific antibody titers in enzyme-linked immunosorbent assays were protective, and the degree of protection was dependent on the antigen dose. There was a positive correlation between antibody avidity and protection. The antibodies in the protected mice recognized the native CSP on the parasites and showed sporozoite invasion inhibitory activity. Passive transfer of anti-CSP antibodies into naive mice also induced protection. Thus, we have demonstrated the utility of a mouse efficacy model to down-select human CSP-based vaccine formulations. PMID:23536694

  19. Improvement of genome assembly completeness and identification of novel full-length protein-coding genes by RNA-seq in the giant panda genome.

    Chen, Meili; Hu, Yibo; Liu, Jingxing; Wu, Qi; Zhang, Chenglin; Yu, Jun; Xiao, Jingfa; Wei, Fuwen; Wu, Jiayan

    2015-12-11

    High-quality and complete gene models are the basis of whole genome analyses. The giant panda (Ailuropoda melanoleuca) genome was the first genome sequenced on the basis of solely short reads, but the genome annotation had lacked the support of transcriptomic evidence. In this study, we applied RNA-seq to globally improve the genome assembly completeness and to detect novel expressed transcripts in 12 tissues from giant pandas, by using a transcriptome reconstruction strategy that combined reference-based and de novo methods. Several aspects of genome assembly completeness in the transcribed regions were effectively improved by the de novo assembled transcripts, including genome scaffolding, the detection of small-size assembly errors, the extension of scaffold/contig boundaries, and gap closure. Through expression and homology validation, we detected three groups of novel full-length protein-coding genes. A total of 12.62% of the novel protein-coding genes were validated by proteomic data. GO annotation analysis showed that some of the novel protein-coding genes were involved in pigmentation, anatomical structure formation and reproduction, which might be related to the development and evolution of the black-white pelage, pseudo-thumb and delayed embryonic implantation of giant pandas. The updated genome annotation will help further giant panda studies from both structural and functional perspectives.

  20. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  1. ASC-J9 Suppresses Castration-Resistant Prostate Cancer Growth through Degradation of Full-length and Splice Variant Androgen Receptors

    Shinichi Yamashita

    2012-01-01

    Full Text Available Early studies suggested androgen receptor (AR splice variants might contribute to the progression of prostate cancer (PCa into castration resistance. However, the therapeutic strategy to target these AR splice variants still remains unresolved. Through tissue survey of tumors from the same patients before and after castration resistance, we found that the expression of AR3, a major AR splice variant that lacks the AR ligand-binding domain, was substantially increased after castration resistance development. The currently used antiandrogen, Casodex, showed little growth suppression in CWR22Rv1 cells. Importantly, we found that AR degradation enhancer ASC-J9 could degrade both full-length (fAR and AR3 in CWR22Rv1 cells as well as in C4-2 and C81 cells with addition of AR3. The consequences of such degradation of both fAR and AR3 might then result in the inhibition of AR transcriptional activity and cell growth in vitro. More importantly, suppression of AR3 specifically by short-hairpin AR3 or degradation of AR3 by ASC-J9 resulted in suppression of AR transcriptional activity and cell growth in CWR22Rv1-fARKD (fAR knockdown cells in which DHT failed to induce, suggesting the importance of targeting AR3. Finally, we demonstrated the in vivo therapeutic effects of ASC-J9 by showing the inhibition of PCa growth using the xenografted model of CWR22Rv1 cells orthotopically implanted into castrated nude mice with undetectable serum testosterone. These results suggested that targeting both fAR- and AR3-mediated PCa growth by ASC-J9 may represent the novel therapeutic approach to suppress castration-resistant PCa. Successful clinical trials targeting both fAR and AR3 may help us to battle castration-resistant PCa in the future.

  2. Dysregulation of gene expression in the striatum of BACHD rats expressing full-length mutant huntingtin and associated abnormalities on molecular and protein levels.

    Yu-Taeger, Libo; Bonin, Michael; Stricker-Shaver, Janice; Riess, Olaf; Nguyen, Hoa Huu Phuc

    2017-05-01

    Huntington disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for the huntingtin protein (HTT). Mutant HTT (mHTT) has been proposed to cause neuronal dysfunction and neuronal loss through multiple mechanisms. Transcriptional changes may be a core pathogenic feature of HD. Utilizing the Affymetrix platform we performed a genome-wide RNA expression analysis in two BACHD transgenic rat lines (TG5 and TG9) at 12 months of age, both of which carry full-length human mHTT but with different expression levels. By defining the threshold of significance at p < 0.01, we found 1608 genes and 871 genes differentially expressed in both TG5 and TG9 rats when compared to the wild type littermates, respectively. We only chose the highly up-/down-regulated genes for further analysis by setting an additional threshold of 1.5 fold change. Comparing gene expression profiles of human HD brains and BACHD rats revealed a high concordance in both functional and IPA (Ingenuity Pathway Analysis) canonical pathways relevant to HD. In addition, we investigated the causes leading to gene expression changes at molecular and protein levels in BACHD rats including the involvement of polyQ-containing transcription factors TATA box-binding protein (TBP), Sp1 and CBP as well as the chromatin structure. We demonstrate that the BACHD rat model recapitulates the gene expression changes of the human disease supporting its role as a preclinical research animal model. We also show for the first time that TFIID complex formation is reduced, while soluble TBP is increased in an HD model. This finding suggests that mHTT is a competitor instead of a recruiter of polyQ-containing transcription factors in the transcription process in HD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Full-length soluble CD147 promotes MMP-2 expression and is a potential serological marker in detection of hepatocellular carcinoma.

    Wu, Jiao; Hao, Zhi-Wei; Zhao, You-Xu; Yang, Xiang-Min; Tang, Hao; Zhang, Xin; Song, Fei; Sun, Xiu-Xuan; Wang, Bin; Nan, Gang; Chen, Zhi-Nan; Bian, Huijie

    2014-07-04

    As a surface glycoprotein, CD147 is capable of stimulating the production of matrix metalloproteinases (MMPs) from neighboring fibroblasts. The aim of the present study is to explore the role of soluble CD147 on MMPs secretion from hepatocellular carcinoma (HCC) cells, and to investigate the diagnostic value of serum soluble CD147 in the HCC detection. We identified the form of soluble CD147 in cell culture supernate of HCC cells and serum of patients with HCC, and explored the role of soluble CD147 on MMPs secretion. Serum CD147 levels were detected by the enzyme-linked immunosorbent assay, and the value of soluble CD147 as a marker in HCC detection was analyzed. Full length soluble CD147 was presented in the culture medium of HCC cells and serum of patients with HCC. The extracellular domain of soluble CD147 promoted the expression of CD147 and MMP-2 from HCC cells. Knockdown of CD147 markedly diminished the up-regulation of CD147 and MMP-2 which induced by soluble CD147. Soluble CD147 activated ERK, FAK, and PI3K/Akt pathways, leading to the up-regulation of MMP-2. The level of soluble CD147 in serum of patients with HCC was significantly elevated compared with healthy individuals (P CD147 levels were found to be associated with HCC tumor size (P = 0.007) and Child-Pugh grade (P = 0.007). Moreover, soluble CD147 showed a better performance in distinguishing HCC compared with alpha-fetoprotein. The extracellular domain of soluble CD147 enhances the secretion of MMP-2 from HCC cells, requiring the cooperation of membrane CD147 and activation of ERK, FAK, and PI3K/Akt signaling. The measurement of soluble CD147 may offer a useful approach in diagnosis of HCC.

  4. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  5. Effect of the electrostatic surface potential on the oligomerization of full-length human recombinant prion protein at single-molecule level

    Wang, Bin; Xu, Bingqian, E-mail: bxu@engr.uga.edu [Single Molecule Study Laboratory, College of Engineering and Nanoscale Science, and Engineering Center, University of Georgia, Athens, Georgia 30605 (United States); Lou, Zhichao [Single Molecule Study Laboratory, College of Engineering and Nanoscale Science, and Engineering Center, University of Georgia, Athens, Georgia 30605 (United States); College of Materials Science and Technology, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China); Zhang, Haiqian [College of Materials Science and Technology, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)

    2016-03-21

    The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.

  6. Effect of the electrostatic surface potential on the oligomerization of full-length human recombinant prion protein at single-molecule level

    Wang, Bin; Xu, Bingqian; Lou, Zhichao; Zhang, Haiqian

    2016-01-01

    The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.

  7. Characterization of a Full-Length Endogenous Beta-Retrovirus, EqERV-Beta1, in the Genome of the Horse (Equus caballus

    Antoinette C. van der Kuyl

    2011-06-01

    Full Text Available Information on endogenous retroviruses fixed in the horse (Equus caballus genome is scarce. The recent availability of a draft sequence of the horse genome enables the detection of such integrated viruses by similarity search. Using translated nucleotide fragments from gamma-, beta-, and delta-retroviral genera for initial searches, a full-length beta-retrovirus genome was retrieved from a horse chromosome 5 contig. The provirus, tentatively named EqERV-beta1 (for the first equine endogenous beta-retrovirus, was 10434 nucleotide (nt in length with the usual retroviral genome structure of 5’LTR-gag-pro-pol-env-3’LTR. The LTRs were 1361 nt long, and differed approximately 1% from each other, suggestive of a relatively recent integration. Coding sequences for gag, pro and pol were present in three different reading-frames, as common for beta-retroviruses, and the reading frames were completely open, except that the env gene was interrupted by a single stopcodon. No reading frame was apparent downstream of the env gene, suggesting that EqERV-beta1 does not encode a superantigen like mouse mammary tumor virus (MMTV. A second proviral genome of EqERV-beta1, with no stopcodon in env, is additionally integrated on chromosome 5 downstream of the first virus. Single EqERV-beta1 LTRs were abundantly present on all chromosomes except chromosome 24. Phylogenetically, EqERV-beta1 most closely resembles an unclassified retroviral sequence from cattle (Bos taurus, and the murine beta-retrovirus MMTV.

  8. The crystal structure of full-length Sizzled from Xenopus laevis yields insights into Wnt-antagonistic function of secreted Frizzled-related proteins.

    Bu, Qixin; Li, Zhiqiang; Zhang, Junying; Xu, Fei; Liu, Jianmei; Liu, Heli

    2017-09-29

    The Wnt-signaling pathway is crucial to cell proliferation, differentiation, and migration. The secreted Frizzled-related proteins (sFRPs) represent the largest family of secreted Wnt inhibitors. However, their function in antagonizing Wnt signaling has remained somewhat controversial. Here, we report the crystal structure of Sizzled from Xenopus laevis , the first full-length structure of an sFRP. Tethered by an inter-domain disulfide bond and a linker, the N-terminal cysteine-rich domain (CRD) and the C-terminal netrin-like domain (NTR) of Sizzled are arranged in a tandem fashion, with the NTR domain occluding the groove of CRD for Wnt accessibility. A Dual-Luciferase assay demonstrated that removing the NTR domain and replacing the CRD groove residues His-116 and His-118 with aromatic residues may significantly enhance antagonistic function of Sizzled in inhibiting Wnt3A signaling. Sizzled is a monomer in solution, and Sizzled CRD exhibited different packing in the crystal, suggesting that sFRPs do not have a conserved CRD dimerization mode. Distinct from the canonical NTR domain, the Sizzled NTR adopts a novel α/β folding with two perpendicular helices facing the central mixed β-sheet. The subgroup of human sFRP1/2/5 and Sizzled should have a similar NTR domain that features a highly positively charged region, opposite the NTR-CRD interface, suggesting that the NTR domain in human sFRPs, at least sFRP1/2/5, is unlikely to bind to Wnt but is likely involved in biphasic Wnt signaling modulation. In summary, the Sizzled structure provides the first insights into how the CRD and the NTR domains relate to each other for modulating Wnt-antagonistic function of sFRPs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Crystal Structure of Full-length Mycobacterium tuberculosis H37Rv Glycogen Branching Enzyme; Insights of N-Terminal [beta]-Sandwich in Sustrate Specifity and Enzymatic Activity

    Pal, Kuntal; Kumar, Shiva; Sharma, Shikha; Garg, Saurabh Kumar; Alam, Mohammad Suhail; Xu, H. Eric; Agrawal, Pushpa; Swaminathan, Kunchithapadam (NU Sinapore); (Van Andel); (IMT-India)

    2010-07-13

    The open reading frame Rv1326c of Mycobacterium tuberculosis (Mtb) H37Rv encodes for an {alpha}-1,4-glucan branching enzyme (MtbGlgB, EC 2.4.1.18, Uniprot entry Q10625). This enzyme belongs to glycoside hydrolase (GH) family 13 and catalyzes the branching of a linear glucose chain during glycogenesis by cleaving a 1 {yields} 4 bond and making a new 1 {yields} 6 bond. Here, we show the crystal structure of full-length MtbGlgB (MtbGlgBWT) at 2.33-{angstrom} resolution. MtbGlgBWT contains four domains: N1 {beta}-sandwich, N2 {beta}-sandwich, a central ({beta}/{alpha}){sub 8} domain that houses the catalytic site, and a C-terminal {beta}-sandwich. We have assayed the amylase activity with amylose and starch as substrates and the glycogen branching activity using amylose as a substrate for MtbGlgBWT and the N1 domain-deleted (the first 108 residues deleted) Mtb{Delta}108GlgB protein. The N1 {beta}-sandwich, which is formed by the first 105 amino acids and superimposes well with the N2 {beta}-sandwich, is shown to have an influence in substrate binding in the amylase assay. Also, we have checked and shown that several GH13 family inhibitors are ineffective against MtbGlgBWT and Mtb{Delta}108GlgB. We propose a two-step reaction mechanism, for the amylase activity (1 {yields} 4 bond breakage) and isomerization (1 {yields} 6 bond formation), which occurs in the same catalytic pocket. The structural and functional properties of MtbGlgB and Mtb{Delta}108GlgB are compared with those of the N-terminal 112-amino acid-deleted Escherichia coli GlgB (EC{Delta}112GlgB).

  10. Effect of the electrostatic surface potential on the oligomerization of full-length human recombinant prion protein at single-molecule level

    Wang, Bin; Lou, Zhichao; Zhang, Haiqian; Xu, Bingqian

    2016-03-01

    The electrostatic surface potential (ESP) of prion oligomers has critical influences on the aggregating processes of the prion molecules. The atomic force microscopy (AFM) and structural simulation were combined to investigate the molecular basis of the full-length human recombinant prion oligomerization on mica surfaces. The high resolution non-intrusive AFM images showed that the prion oligomers formed different patterns on mica surfaces at different buffer pH values. The basic binding units for the large oligomers were determined to be prion momoners (Ms), dimers (Ds), and trimers (Ts). The forming of the D and T units happened through the binding of hydrophobic β-sheets of the M units. In contrast, the α-helices of these M, D, and T units were the binding areas for the formation of large oligomers. At pH 4.5, the binding units M, D, and T showed clear polarized ESP distributions on the surface domains, while at pH 7.0, they showed more evenly distributed ESPs. Based on the conformations of oligomers observed from AFM images, the D and T units were more abundantly on mica surface at pH 4.5 because the ESP re-distribution of M units helped to stabilize these larger oligomers. The amino acid side chains involved in the binding interfaces were stabilized by hydrogen bonds and electrostatic interactions. The detailed analysis of the charged side chains at pH 4.5 indicated that the polarized ESPs induced the aggregations among M, D, and T to form larger oligomers. Therefore, the hydrogen bonds and electrostatic interactions worked together to form the stabilized prion oligomers.

  11. Blue light-excited LOV1 and LOV2 domains cooperatively regulate the kinase activity of full-length phototropin2 from Arabidopsis.

    Oide, Mao; Okajima, Koji; Nakagami, Hirofumi; Kato, Takayuki; Sekiguchi, Yuki; Oroguchi, Tomotaka; Hikima, Takaaki; Yamamoto, Masaki; Nakasako, Masayoshi

    2018-01-19

    Phototropin2 (phot2) is a blue-light (BL) receptor that regulates BL-dependent activities for efficient photosynthesis in plants. phot2 comprises two BL-receiving light-oxygen-voltage-sensing domains (LOV1 and LOV2) and a kinase domain. BL-excited LOV2 is thought to be primarily responsible for the BL-dependent activation of the kinase. However, the molecular mechanisms by which small BL-induced conformational changes in the LOV2 domain are transmitted to the kinase remain unclear. Here, we used full-length wild-type and mutant phot2 proteins from Arabidopsis to study their molecular properties in the dark and under BL irradiation. Phosphorylation assays and absorption measurements indicated that the LOV1 domain assists the thermal relaxation of BL-excited LOV2 and vice versa. Using small-angle X-ray scattering and electron microscopy, we observed that phot2 forms a dimer and has a rod shape with a maximum length of 188 Å and a radius of gyration of 44 Å. Under BL, phot2 displayed large conformational changes that bent the rod shape. By superimposing the crystal structures of the LOV1 dimer, LOV2, and a homology model of the kinase to the observed changes, we inferred that the BL-dependent change consisted of positional shifts of both LOV2 and the kinase relative to LOV1. Furthermore, phot2 mutants lacking the photocycle in LOV1 or LOV2 still exhibited conformational changes under BL, suggesting that LOV1 and LOV2 cooperatively contribute to the conformational changes that activate the kinase. These results suggest that BL-activated LOV1 contributes to the kinase activity of phot2. We discuss the possible intramolecular interactions and signaling mechanisms in phot2. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Safety of PEGylated recombinant human full-length coagulation factor VIII (BAX 855) in the overall context of PEG and PEG conjugates.

    Stidl, R; Fuchs, S; Bossard, M; Siekmann, J; Turecek, P L; Putz, M

    2016-01-01

    BAX 855 is a PEGylated human full-length recombinant factor VIII (rFVIII) based on licensed rFVIII (ADVATE). The applied PEGylation technology has been optimized to retain functionality of the FVIII molecule, improve its pharmacokinetic properties and allow less frequent injections while maintaining efficacy. The aim of this study was to confirm that the excellent safety profile of ADVATE remains unchanged after PEGylation. Non-clinical safety studies with BAX 855 and its respective unbound polyethylene glycol (PEG) were conducted in several species. The distribution of a single dose of radiolabelled BAX 855 was further investigated in rats. Publically available safety data on PEG alone and PEGylated biomolecules were summarized and reviewed for specific safety findings attributable to PEG or PEGylated biopharmaceuticals. Safety pharmacology studies in rabbits and macaques and repeated dose toxicity studies in rats and macaques identified no safety issues. Results of a distribution study in rats administered radiolabelled BAX 855 showed that radioactivity was completely excreted; urine was the major elimination route. A 28-day study in rats dosed with the unbound PEG constituent (PEG2ru20KCOOH) of BAX 855 showed no adverse or non-adverse effects. Safety data for PEG and PEG-protein conjugates indicate no safety concerns associated with PEG at clinically relevant dose levels. Although vacuolation of certain cell types has been reported in mammals, no such vacuolation was observed with BAX 855 or with the unbound PEG constituent. Non-clinical safety evaluation of PEG and BAX 855 identified no safety signals; the compound is now in clinical development for the treatment of patients with haemophilia A. © 2015 Baxalta Innovations GmbH. Haemophilia Published by John Wiley & Sons Ltd.

  13. Subtype-independent near full-length HIV-1 genome sequencing and assembly to be used in large molecular epidemiological studies and clinical management.

    Grossmann, Sebastian; Nowak, Piotr; Neogi, Ujjwal

    2015-01-01

    HIV-1 near full-length genome (HIV-NFLG) sequencing from plasma is an attractive multidimensional tool to apply in large-scale population-based molecular epidemiological studies. It also enables genotypic resistance testing (GRT) for all drug target sites allowing effective intervention strategies for control and prevention in high-risk population groups. Thus, the main objective of this study was to develop a simplified subtype-independent, cost- and labour-efficient HIV-NFLG protocol that can be used in clinical management as well as in molecular epidemiological studies. Plasma samples (n=30) were obtained from HIV-1B (n=10), HIV-1C (n=10), CRF01_AE (n=5) and CRF01_AG (n=5) infected individuals with minimum viral load >1120 copies/ml. The amplification was performed with two large amplicons of 5.5 kb and 3.7 kb, sequenced with 17 primers to obtain HIV-NFLG. GRT was validated against ViroSeq™ HIV-1 Genotyping System. After excluding four plasma samples with low-quality RNA, a total of 26 samples were attempted. Among them, NFLG was obtained from 24 (92%) samples with the lowest viral load being 3000 copies/ml. High (>99%) concordance was observed between HIV-NFLG and ViroSeq™ when determining the drug resistance mutations (DRMs). The N384I connection mutation was additionally detected by NFLG in two samples. Our high efficiency subtype-independent HIV-NFLG is a simple and promising approach to be used in large-scale molecular epidemiological studies. It will facilitate the understanding of the HIV-1 pandemic population dynamics and outline effective intervention strategies. Furthermore, it can potentially be applicable in clinical management of drug resistance by evaluating DRMs against all available antiretrovirals in a single assay.

  14. Full-length cellular β-secretase has a trimeric subunit stoichiometry, and its sulfur-rich transmembrane interaction site modulates cytosolic copper compartmentalization.

    Liebsch, Filip; Aurousseau, Mark R P; Bethge, Tobias; McGuire, Hugo; Scolari, Silvia; Herrmann, Andreas; Blunck, Rikard; Bowie, Derek; Multhaup, Gerd

    2017-08-11

    The β-secretase (BACE1) initiates processing of the amyloid precursor protein (APP) into Aβ peptides, which have been implicated as central players in the pathology of Alzheimer disease. BACE1 has been described as a copper-binding protein and its oligomeric state as being monomeric, dimeric, and/or multimeric, but the native cellular stoichiometry has remained elusive. Here, by using single-molecule fluorescence and in vitro cross-linking experiments with photo-activatable unnatural amino acids, we show that full-length BACE1, independently of its subcellular localization, exists as trimers in human cells. We found that trimerization requires the BACE1 transmembrane sequences (TMSs) and cytoplasmic domains, with residues Ala 463 and Cys 466 buried within the trimer interface of the sulfur-rich core of the TMSs. Our 3D model predicts that the sulfur-rich core of the trimeric BACE1 TMS is accessible to metal ions, but copper ions did not trigger trimerization. The results of functional assays of endogenous BACE1 suggest that it has a role in intracellular copper compartmentalization by transferring cytosolic copper to intracellular compartments, while leaving the overall cellular copper concentration unaltered. Adding to existing physiological models, our results provide novel insight into the atypical interactions between copper and BACE1 and into its non-enzymatic activities. In conclusion, therapeutic Alzheimer disease prevention strategies aimed at decreasing BACE1 protein levels should be regarded with caution, because adverse effects in copper homeostasis may occur. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Characterization of a new full length TMPRSS3 isoform and identification of mutant alleles responsible for nonsyndromic recessive deafness in Newfoundland and Pakistan

    Shotland Lawrence I

    2004-09-01

    Full Text Available Abstract Background Mutant alleles of TMPRSS3 are associated with nonsyndromic recessive deafness (DFNB8/B10. TMPRSS3 encodes a predicted secreted serine protease, although the deduced amino acid sequence has no signal peptide. In this study, we searched for mutant alleles of TMPRSS3 in families from Pakistan and Newfoundland with recessive deafness co-segregating with DFNB8/B10 linked haplotypes and also more thoroughly characterized the genomic structure of TMPRSS3. Methods We enrolled families segregating recessive hearing loss from Pakistan and Newfoundland. Microsatellite markers flanking the TMPRSS3 locus were used for linkage analysis. DNA samples from participating individuals were sequenced for TMPRSS3. The structure of TMPRSS3 was characterized bioinformatically and experimentally by sequencing novel cDNA clones of TMPRSS3. Results We identified mutations in TMPRSS3 in four Pakistani families with recessive, nonsyndromic congenital deafness. We also identified two recessive mutations, one of which is novel, of TMPRSS3 segregating in a six-generation extended family from Newfoundland. The spectrum of TMPRSS3 mutations is reviewed in the context of a genotype-phenotype correlation. Our study also revealed a longer isoform of TMPRSS3 with a hitherto unidentified exon encoding a signal peptide, which is expressed in several tissues. Conclusion Mutations of TMPRSS3 contribute to hearing loss in many communities worldwide and account for 1.8% (8 of 449 of Pakistani families segregating congenital deafness as an autosomal recessive trait. The newly identified TMPRSS3 isoform e will be helpful in the functional characterization of the full length protein.

  16. The inhibition of cAMP-dependent protein kinase by full-length hepatitis C virus NS3/4A complex is due to ATP hydrolysis.

    Aoubala, M; Holt, J; Clegg, R A; Rowlands, D J; Harris, M

    2001-07-01

    Hepatitis C virus (HCV) is an important cause of chronic liver disease, but the molecular mechanisms of viral pathogenesis remain to be established. The HCV non-structural protein NS3 complexes with NS4A and has three enzymatic activities: a proteinase and a helicase/NTPase. Recently, catalytically inactive NS3 fragments containing an arginine-rich motif have been reported to interact with, and inhibit, the catalytic subunit of cAMP-dependent protein kinase (PKA C-subunit). Here we demonstrate that full-length, catalytically active NS3/4A, purified from recombinant baculovirus-infected insect cells, is also able to inhibit PKA C-subunit in vitro. This inhibition was abrogated by mutation of either the arginine-rich motif or the conserved helicase motif II, both of which also abolished NTPase activity. As PKA C-subunit inhibition was also enhanced by poly(U) (an activator of NS3 NTPase activity), we hypothesized that PKA C-subunit inhibition could be due to NS3/4A-mediated ATP hydrolysis. This was confirmed by experiments in which a constant ATP concentration was maintained by addition of an ATP regeneration system--under these conditions PKA C-subunit inhibition was not observed. Interestingly, the mutations also abrogated the ability of wild-type NS3/4A to inhibit the PKA-regulated transcription factor CREB in transiently transfected hepatoma cells. Our data are thus not consistent with the previously proposed model in which the arginine-rich motif of NS3 was suggested to act as a pseudosubstrate inhibitor of PKA C-subunit. However, in vivo effects of NS3/4A suggest that ATPase activity may play a role in viral pathology in the infected liver.

  17. Targeting the Full Length of the Motor End Plate Regions in the Mouse Forelimb Increases the Uptake of Fluoro-Gold into Corresponding Spinal Cord Motor Neurons

    Andrew Paul Tosolini

    2013-05-01

    Full Text Available Lower motor neuron dysfunction is one of the most debilitating motor conditions. In this regard, transgenic mouse models of various lower motor neuron dysfunctions provide insight into the mechanisms underlying these pathologies and can also aid the development of new therapies. Viral-mediated gene therapy can take advantage of the muscle-motor neuron topographical relationship to shuttle therapeutic genes into specific populations of motor neurons in these mouse models. In this context, motor end plates (MEPs are highly specialised regions on the skeletal musculature that offer direct access to the pre-synaptic nerve terminals, henceforth to the spinal cord motor neurons. The aim of this study was two-folded. First it was to characterise the exact position of the MEP regions for several muscles of the mouse forelimb using acetylcholinesterase histochemistry. This MEP-muscle map was then used to guide a series of intramuscular injections of Fluoro-Gold (FG in order to characterise the distribution of the innervating motor neurons. This analysis revealed that the MEPs are typically organised in an orthogonal fashion across the muscle fibres and extending throughout the full width of each muscle. Furthermore, targeting the full length of the MEP regions gave rise to a seemingly greater number of labelled motor neurons that are organised into columns spanning through more spinal cord segments than previously reported. The present analysis suggests that targeting the full width of the muscles’ MEP regions with FG increases the somatic availability of the tracer. This process ensures a greater uptake of the tracer by the pre-synaptic nerve terminals, hence maximising the labelling in spinal cord motor neurons. This investigation should have positive implications for future studies involving the somatic delivery of therapeutic genes into motor neurons for the treatment of various motor dysfunctions.

  18. Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors.

    Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha

    2018-01-01

    The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

  19. Characterization of partial and near full-length genomes of HIV-1 strains sampled from recently infected individuals in São Paulo, Brazil.

    Sabri Saeed Sanabani

    Full Text Available BACKGROUND: Genetic variability is a major feature of human immunodeficiency virus type 1 (HIV-1 and is considered the key factor frustrating efforts to halt the HIV epidemic. A proper understanding of HIV-1 genomic diversity is a fundamental prerequisite for proper epidemiology, genetic diagnosis, and successful drugs and vaccines design. Here, we report on the partial and near full-length genomic (NFLG variability of HIV-1 isolates from a well-characterized cohort of recently infected patients in São Paul, Brazil. METHODOLOGY: HIV-1 proviral DNA was extracted from the peripheral blood mononuclear cells of 113 participants. The NFLG and partial fragments were determined by overlapping nested PCR and direct sequencing. The data were phylogenetically analyzed. RESULTS: Of the 113 samples (90.3% male; median age 31 years; 79.6% homosexual men studied, 77 (68.1% NFLGs and 32 (29.3% partial fragments were successfully subtyped. Of the successfully subtyped sequences, 88 (80.7% were subtype B sequences, 12 (11% BF1 recombinants, 3 (2.8% subtype C sequences, 2 (1.8% BC recombinants and subclade F1 each, 1 (0.9% CRF02 AG, and 1 (0.9% CRF31 BC. Primary drug resistance mutations were observed in 14/101 (13.9% of samples, with 5.9% being resistant to protease inhibitors and nucleoside reverse transcriptase inhibitors (NRTI and 4.9% resistant to non-NRTIs. Predictions of viral tropism were determined for 86 individuals. X4 or X4 dual or mixed-tropic viruses (X4/DM were seen in 26 (30.2% of subjects. The proportion of X4 viruses in homosexuals was detected in 19/69 (27.5%. CONCLUSIONS: Our results confirm the existence of various HIV-1 subtypes circulating in São Paulo, and indicate that subtype B account for the majority of infections. Antiretroviral (ARV drug resistance is relatively common among recently infected patients. The proportion of X4 viruses in homosexuals was significantly higher than the proportion seen in other study populations.

  20. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  1. Bioinorganic Chemistry of Parkinson's Disease: Affinity and Structural Features of Cu(I) Binding to the Full-Length β-Synuclein Protein.

    Miotto, Marco C; Pavese, Mayra D; Quintanar, Liliana; Zweckstetter, Markus; Griesinger, Christian; Fernández, Claudio O

    2017-09-05

    Alterations in the levels of copper in brain tissue and formation of α-synuclein (αS)-copper complexes might play a key role in the amyloid aggregation of αS and the onset of Parkinson's disease (PD). Recently, we demonstrated that formation of the high-affinity Cu(I) complex with the N-terminally acetylated form of the protein αS substantially increases and stabilizes local conformations with α-helical secondary structure and restricted motility. In this work, we performed a detailed NMR-based structural characterization of the Cu(I) complexes with the full-length acetylated form of its homologue β-synuclein (βS), which is colocalized with αS in vivo and can bind copper ions. Our results show that, similarly to αS, the N-terminal region of βS constitutes the preferential binding interface for Cu(I) ions, encompassing two independent and noninteractive Cu(I) binding sites. According to these results, βS binds the metal ion with higher affinity than αS, in a coordination environment that involves the participation of Met-1, Met-5, and Met-10 residues (site 1). Compared to αS, the shift of His from position 50 to 65 in the N-terminal region of βS does not change the Cu(I) affinity features at that site (site 2). Interestingly, the formation of the high-affinity βS-Cu(I) complex at site 1 in the N-terminus promotes a short α-helix conformation that is restricted to the 1-5 segment of the AcβS sequence, which differs with the substantial increase in α-helix conformations seen for N-terminally acetylated αS upon Cu(I) complexation. Our NMR data demonstrate conclusively that the differences observed in the conformational transitions triggered by Cu(I) binding to AcαS and AcβS find a correlation at the level of their backbone dynamic properties; added to the potential biological implications of these findings, this fact opens new avenues of investigations into the bioinorganic chemistry of PD.

  2. Revised genomic consensus for the hypermethylated CpG island region of the human L1 transposon and integration sites of full length L1 elements from recombinant clones made using methylation-tolerant host strains

    Crowther, P J; Doherty, J P; Linsenmeyer, M E

    1991-01-01

    preferentially from L1 members which have accumulated mutations that have removed sites of methylation. We present a revised consensus from the 5' presumptive control region of these elements. This revised consensus contains a consensus RNA polymerase III promoter which would permit the synthesis of transcripts......Efficient recovery of clones from the 5' end of the human L1 dispersed repetitive elements necessitates the use of deletion mcr- host strains since this region contains a CpG island which is hypermethylated in vivo. Clones recovered with conventional mcr+ hosts seem to have been derived...... from the 5' end of full length L1 elements. Such potential transcripts are likely to exhibit a high degree of secondary structure. In addition, we have determined the flanking sequences for 6 full length L1 elements. The majority of full length L1 clones show no convincing evidence for target site...

  3. First full-length genome sequence of the polerovirus luffa aphid-borne yellows virus (LABYV) reveals the presence of at least two consensus sequences in an isolate from Thailand.

    Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf

    2015-10-01

    Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

  4. A cyclic carbo-isosteric penta-depsipeptide: cyclo(Phe1–d-Ala2–Gly3–Phe4–APO5

    Stéphanie M. Guéret

    2015-01-01

    Full Text Available The title compound, cyclo(Phe1–d-Ala2–Gly3–Phe4–APO5, C26H32N4O5, is the minor diastereoisomer of a cyclic penta-peptidomimetic analogue containing a novel 2-aminopropyl lactone (APO motif, which displays the same number of atoms as the native amino acid glycine and has a methyl group in place of the carbonyl O atom. The crystal structure presented here allows the analysis of the secondary structure of this unprecedented cyclic carbo-isosteric depsipeptide. The conformation of the central ring is stabilized by an intramolecular N—H...O hydrogen bond between the carbonyl O atom of the first residue (Phe1 and the amide group H atom of the fourth residue (Phe4. Based on the previously reported hydrogen bond and on the values of the torsion angles ϕ and ψ, the loop formed by the first, second, third and fourth residues (Phe1, d-Ala2, Gly3 and Phe4 can be classified as a type II′ β-turn. The loop around the new peptidomimetic motif, on the other hand, resembles an open γ-turn containing a weak N—H...O hydrogen bond between the carbonyl group O atom of the fourth residue (Phe4 and the amide unit H atom of the first residue (Phe1. In the crystal, the peptidomimetic molecules are arranged in chains along the b-axis direction. Within such a chain, the molecules of the structure are linked via N—H...O hydrogen bonds between the amide group H atom of the secondary residue (d-Ala2 and the carboxy unit O atom of the fourth residue (Phe4 in a neighboring molecule. The newly formed methyl stereocentre of the APO peptidomimetic motif (APO5 was obtained as the minor diastereoisomer in a ring-closing reductive amination reaction and adopts an R configuration.

  5. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  6. The small FOXP1 isoform predominantly expressed in activated B cell-like diffuse large B-cell lymphoma and full-length FOXP1 exert similar oncogenic and transcriptional activity in human B cells.

    van Keimpema, Martine; Grüneberg, Leonie J; Schilder-Tol, Esther J M; Oud, Monique E C M; Beuling, Esther A; Hensbergen, Paul J; de Jong, Johann; Pals, Steven T; Spaargaren, Marcel

    2017-03-01

    The forkhead transcription factor FOXP1 is generally regarded as an oncogene in activated B cell-like diffuse large B-cell lymphoma. Previous studies have suggested that a small isoform of FOXP1 rather than full-length FOXP1, may possess this oncogenic activity. Corroborating those studies, we herein show that activated B cell-like diffuse large B-cell lymphoma cell lines and primary activated B cell-like diffuse large B-cell lymphoma cells predominantly express a small FOXP1 isoform, and that the 5'-end of the Foxp1 gene is a common insertion site in murine lymphomas in leukemia virus- and transposon-mediated insertional mutagenesis screens. By combined mass spectrometry, (quantative) reverse transcription polymerase chain reaction/sequencing, and small interfering ribonucleic acid-mediated gene silencing, we determined that the small FOXP1 isoform predominantly expressed in activated B cell-like diffuse large B-cell lymphoma lacks the N-terminal 100 amino acids of full-length FOXP1. Aberrant overexpression of this FOXP1 isoform (ΔN100) in primary human B cells revealed its oncogenic capacity; it repressed apoptosis and plasma cell differentiation. However, no difference in potency was found between this small FOXP1 isoform and full-length FOXP1. Furthermore, overexpression of full-length FOXP1 or this small FOXP1 isoform in primary B cells and diffuse large B-cell lymphoma cell lines resulted in similar gene regulation. Taken together, our data indicate that this small FOXP1 isoform and full-length FOXP1 have comparable oncogenic and transcriptional activity in human B cells, suggesting that aberrant expression or overexpression of FOXP1, irrespective of the specific isoform, contributes to lymphomagenesis. These novel insights further enhance the value of FOXP1 for the diagnostics, prognostics, and treatment of diffuse large B-cell lymphoma patients. Copyright© Ferrata Storti Foundation.

  7. EXPRESSION AND CHARACTERIZATION OF FULL-LENGTH HUMAN HEME OXYGENASE-1: PRESENCE OF INTACT MEMBRANE-BINDING REGION LEADS TO INCREASED BINDING AFFINITY FOR NADPH-CYTOCHROME P450 REDUCTASE

    Huber, Warren J.; Backes, Wayne L.

    2009-01-01

    Heme oxygenase (HO) is the chief regulatory enzyme in the oxidative degradation of heme to biliverdin. In the process of heme degradation, this NADPH and cytochrome P450 reductase (CPR)-dependent oxidation of heme also releases free iron and carbon monoxide. Much of the recent research involving heme oxygenase is done using a 30-kDa soluble form of the enzyme, which lacks the membrane binding region (C-terminal 23 amino acids). The goal of this study was to express and purify a full-length human HO-1 (hHO-1) protein; however, due to the lability of the full-length form, a rapid purification procedure was required. This was accomplished by use of a GST-tagged hHO-1 construct. Although the procedure permitted the generation of a full-length HO-1, this form was contaminated with a 30-kDa degradation product that could not be eliminated. Therefore, we attempted to remove a putative secondary thrombin cleavage site by a conservative mutation of amino acid 254, which replaces lysine with arginine. This mutation allowed the expression and purification of a full length hHO-1 protein. Unlike wild-type HO-1, the K254R mutant could be purified to a single 32-kDa protein capable of degrading heme at the same rate as the wild-type enzyme. The K254R full-length form had a specific activity of ~200–225 nmol bilirubin hr−1nmol−1 HO-1 as compared to ~140–150 nmol bilirubin hr−1nmol−1 for the WT form, which contains the 30-kDa contaminant. This is a 2–3-fold increase from the previously reported soluble 30-kDa HO-1, suggesting that the C-terminal 23 amino acids are essential for maximal catalytic activity. Because the membrane spanning domain is present, the full-length hHO-1 has the potential to incorporate into phospholipid membranes, which can be reconstituted at known concentrations, in combination with other ER-resident enzymes. PMID:17915953

  8. Expression and characterization of full-length human heme oxygenase-1: the presence of intact membrane-binding region leads to increased binding affinity for NADPH cytochrome P450 reductase.

    Huber, Warren J; Backes, Wayne L

    2007-10-30

    Heme oxygenase-1 (HO-1) is the chief regulatory enzyme in the oxidative degradation of heme to biliverdin. In the process of heme degradation, HO-1 receives the electrons necessary for catalysis from the flavoprotein NADPH cytochrome P450 reductase (CPR), releasing free iron and carbon monoxide. Much of the recent research involving heme oxygenase has been done using a 30 kDa soluble form of the enzyme, which lacks the membrane binding region (C-terminal 23 amino acids). The goal of this study was to express and purify a full-length human HO-1 (hHO-1) protein; however, due to the lability of the full-length form, a rapid purification procedure was required. This was accomplished by use of a glutathione-s-transferase (GST)-tagged hHO-1 construct. Although the procedure permitted the generation of a full-length HO-1, this form was contaminated with a 30 kDa degradation product that could not be eliminated. Therefore, attempts were made to remove a putative secondary thrombin cleavage site by a conservative mutation of amino acid 254, which replaces arginine with lysine. This mutation allowed the expression and purification of a full-length hHO-1 protein. Unlike wild type (WT) HO-1, the R254K mutant could be purified to a single 32 kDa protein capable of degrading heme at the same rate as the WT enzyme. The R254K full-length form had a specific activity of approximately 200-225 nmol of bilirubin h-1 nmol-1 HO-1 as compared to approximately 140-150 nmol of bilirubin h-1 nmol-1 for the WT form, which contains the 30 kDa contaminant. This is a 2-3-fold increase from the previously reported soluble 30 kDa HO-1, suggesting that the C-terminal 23 amino acids are essential for maximal catalytic activity. Because the membrane-spanning domain is present, the full-length hHO-1 has the potential to incorporate into phospholipid membranes, which can be reconstituted at known concentrations, in combination with other endoplasmic reticulum resident enzymes.

  9. RESEARCH ARTICLE Full length sequencing and novel ...

    Navya

    2016-12-16

    Dec 16, 2016 ... TOLONE, ANNA MARIA SUTERA, MARIA TERESA SARDINA, BALDASSARE ... finding of novel SNPs that might be important in future studies and laid the .... power, precision and quality to assess the relationship between ...

  10. Full Length R esearch A rticle

    Germ tube tests were performed for identification of the isolates. Susceptibility ... agents for the treatment of genitourinary tract infections caused by Candida species. Keywords: ..... contraceptives, drug abuse or even due to sexual promiscuity.

  11. FULL LENGTH RESEARCH ARTICLE Adamu & Babatunde (2008 ...

    Dr. Ahmed

    standards which now appear in BS 1006 (standard method 1978). These properties are fundamental in the ... to increase its affinity for disperse colours and make it possible to dye the fibre easily. Determination of dye ... Colour fastness to washing test results are shown in Table 4. The procedure was also repeated for dye ...

  12. FULL LENGTH RESEARCH ARTICLE Onuh & Ohazurike (2008 ...

    Dr. Ahmed

    flasks containing 50 ml of Reese and Levinson's solution, consisting of Sodium Polypectate (NaPP) as carbon source, and incubated for 7 days at 38oC. ... containing 50ml of Reese and Levinson's medium with Carboxylmethyl. Cellulose (CMC) as the .... from the brown rot fungus Postia placenta. Applied Microbiology and.

  13. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  14. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  15. Peptide analysis as amino alcohols by gas chromatography-mass spectrometry. Application to hyperoligopeptiduria. Detection of Gly-3Hyp-4Hyp and Gly-Pro-4Hyp-Gly.

    Steiner, W; Niederwieser, A

    1979-03-15

    A method for the qualitative analysis of oligopeptides in human urine in cases of peptiduria is described. After sample precleaning on a strongly acidic ion exchanger, the trifluoroacetyl/methyl esters were formed and the peptide derivatives were transformed into trifluoroethyl oligoamino alcohols according to Nau and Biemann. It was found that oligoamino alcohols could be isolated selectively on a weakly acidic ion exchanger. The O-trimethylsilylated trifluoroethyl oligoamino alcohols were separated on a SE-30 glass capillary column and analyzed by computer-assisted gas chromatography-mass spectrometry. In order to increase specificity and to facilitate mass spectrometric interpretation, aliquots of the sample were reduced separately with lithium-aluminium deuteride and hydride. Each peptide gave a pair of derivatives with characteristic mass differences of the ions, namely 2 mass units per reduced oxo group (deuterium-hydrogen-labelling of oxo groups by reduction). Correct identification is assumed only if both mass spectral patterns fit the theory. Sample volumes of 5--100 ml of urine are needed. About six samples can be derivatized per week. Three cases with suspected peptiduria were investigated and the following peptides were found: Gly-Pro-4Hyp-Gly; Gly-Pro-4Hyp; Gly-Hyp-Hyp (postulated isomer Gly-3Hyp-4Hyp); Pro-4Hyp and Gly-Pro. With exception of the tetrapeptide, these compounds could be detected also in the urine of a healthy child.

  16. Functional PAK-2 knockout and replacement with a caspase cleavage-deficient mutant in mice reveals differential requirements of full-length PAK-2 and caspase-activated PAK-2p34.

    Marlin, Jerry W; Chang, Yu-Wen E; Ober, Margaret; Handy, Amy; Xu, Wenhao; Jakobi, Rolf

    2011-06-01

    p21-Activated protein kinase 2 (PAK-2) has both anti- and pro-apoptotic functions depending on its mechanism of activation. Activation of full-length PAK-2 by the monomeric GTPases Cdc42 or Rac stimulates cell survival, whereas caspase activation of PAK-2 to the PAK-2p34 fragment is involved in the apoptotic response. In this study we use functional knockout of PAK-2 and gene replacement with the caspase cleavage-deficient PAK-2D212N mutant to differentiate the biological functions of full-length PAK-2 and caspase-activated PAK-2p34. Knockout of PAK-2 results in embryonic lethality at early stages before organ development, whereas replacement with the caspase cleavage-deficient PAK-2D212N results in viable and healthy mice, indicating that early embryonic lethality is caused by deficiency of full-length PAK-2 rather than lack of caspase activation to the PAK-2p34 fragment. However, deficiency of caspase activation of PAK-2 decreased spontaneous cell death of primary mouse embryonic fibroblasts and increased cell growth at high cell density. In contrast, stress-induced cell death by treatment with the anti-cancer drug cisplatin was not reduced by deficiency of caspase activation of PAK-2, but switched from an apoptotic to a nonapoptotic, caspase-independent mechanism. Homozygous PAK-2D212N primary mouse embryonic fibroblasts that lack the ability to generate the proapoptotic PAK-2p34 show less activation of the effector caspase 3, 6, and 7, indicating that caspase activation of PAK-2 amplifies the apoptotic response through a positive feedback loop resulting in more activation of effector caspases.

  17. Production of enzymatically active recombinant full-length barley high pI alpha-glucosidase of glycoside family 31 by high cell-density fermentation of Pichia pastoris and affinity purification

    Næsted, Henrik; Kramhøft, Birte; Lok, F.

    2006-01-01

    Recombinant barley high pI alpha-glucosidase was produced by high cell-density fermentation of Pichia pastoris expressing the cloned full-length gene. The gene was amplified from a genomic clone and exons (coding regions) were assembled by overlap PCR. The resulting cDNA was expressed under contr...... nM x s(-1), and 85 s(-1) using maltose as substrate. This work presents the first production of fully active recombinant alpha-glucosidase of glycoside hydrolase family 31 from higher plants. (c) 2005 Elsevier Inc. All rights reserved....

  18. Tula hantavirus isolate with the full-length ORF for nonstructural protein NSs survives for more consequent passages in interferon-competent cells than the isolate having truncated NSs ORF.

    Jääskeläinen, Kirsi M; Plyusnina, Angelina; Lundkvist, Ake; Vaheri, Antti; Plyusnin, Alexander

    2008-01-11

    The competitiveness of two Tula hantavirus (TULV) isolates, TULV/Lodz and TULV/Moravia, was evaluated in interferon (IFN) -competent and IFN-deficient cells. The two isolates differ in the length of the open reading frame (ORF) encoding the nonstructural protein NSs, which has previously been shown to inhibit IFN response in infected cells. In IFN-deficient Vero E6 cells both TULV isolates survived equally well. In contrast, in IFN-competent MRC5 cells TULV/Lodz isolate, that possesses the NSs ORF for the full-length protein of 90 aa, survived for more consequent passages than TULV/Moravia isolate, which contains the ORF for truncated NSs protein (66-67 aa). Our data show that expression of a full-length NSs protein is beneficial for the virus survival and competitiveness in IFN-competent cells and not essential in IFN-deficient cells. These results suggest that the N-terminal aa residues are important for the full activity of the NSs protein.

  19. Pseudo-polyprotein translated from the full-length ORF1 of capillovirus is important for pathogenicity, but a truncated ORF1 protein without variable and CP regions is sufficient for replication.

    Hirata, Hisae; Yamaji, Yasuyuki; Komatsu, Ken; Kagiwada, Satoshi; Oshima, Kenro; Okano, Yukari; Takahashi, Shuichiro; Ugaki, Masashi; Namba, Shigetou

    2010-09-01

    The first open-reading frame (ORF) of the genus Capillovirus encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP), while other viruses in the family Flexiviridae have separate ORFs encoding these proteins. To investigate the role of the full-length ORF1 polyprotein of capillovirus, we generated truncation mutants of ORF1 of apple stem grooving virus by inserting a termination codon into the variable region located between the putative Rep- and CP-coding regions. These mutants were capable of systemic infection, although their pathogenicity was attenuated. In vitro translation of ORF1 produced both the full-length polyprotein and the smaller Rep protein. The results of in vivo reporter assays suggested that the mechanism of this early termination is a ribosomal -1 frame-shift occurring downstream from the conserved Rep domains. The mechanism of capillovirus gene expression and the very close evolutionary relationship between the genera Capillovirus and Trichovirus are discussed. Copyright (c) 2010. Published by Elsevier B.V.

  20. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  1. Intersubunit distances in full-length, dimeric, bacterial phytochrome Agp1, as measured by pulsed electron-electron double resonance (PELDOR) between different spin label positions, remain unchanged upon photoconversion.

    Kacprzak, Sylwia; Njimona, Ibrahim; Renz, Anja; Feng, Juan; Reijerse, Edward; Lubitz, Wolfgang; Krauss, Norbert; Scheerer, Patrick; Nagano, Soshichiro; Lamparter, Tilman; Weber, Stefan

    2017-05-05

    Bacterial phytochromes are dimeric light-regulated histidine kinases that convert red light into signaling events. Light absorption by the N-terminal photosensory core module (PCM) causes the proteins to switch between two spectrally distinct forms, Pr and Pfr, thus resulting in a conformational change that modulates the C-terminal histidine kinase region. To provide further insights into structural details of photoactivation, we investigated the full-length Agp1 bacteriophytochrome from the soil bacterium Agrobacterium fabrum using a combined spectroscopic and modeling approach. We generated seven mutants suitable for spin labeling to enable application of pulsed EPR techniques. The distances between attached spin labels were measured using pulsed electron-electron double resonance spectroscopy to probe the arrangement of the subunits within the dimer. We found very good agreement of experimental and calculated distances for the histidine-kinase region when both subunits are in a parallel orientation. However, experimental distance distributions surprisingly showed only limited agreement with either parallel- or antiparallel-arranged dimer structures when spin labels were placed into the PCM region. This observation indicates that the arrangements of the PCM subunits in the full-length protein dimer in solution differ significantly from that in the PCM crystals. The pulsed electron-electron double resonance data presented here revealed either no or only minor changes of distance distributions upon Pr-to-Pfr photoconversion. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. RiceFOX: a database of Arabidopsis mutant lines overexpressing rice full-length cDNA that contains a wide range of trait information to facilitate analysis of gene function.

    Sakurai, Tetsuya; Kondou, Youichi; Akiyama, Kenji; Kurotani, Atsushi; Higuchi, Mieko; Ichikawa, Takanari; Kuroda, Hirofumi; Kusano, Miyako; Mori, Masaki; Saitou, Tsutomu; Sakakibara, Hitoshi; Sugano, Shoji; Suzuki, Makoto; Takahashi, Hideki; Takahashi, Shinya; Takatsuji, Hiroshi; Yokotani, Naoki; Yoshizumi, Takeshi; Saito, Kazuki; Shinozaki, Kazuo; Oda, Kenji; Hirochika, Hirohiko; Matsui, Minami

    2011-02-01

    Identification of gene function is important not only for basic research but also for applied science, especially with regard to improvements in crop production. For rapid and efficient elucidation of useful traits, we developed a system named FOX hunting (Full-length cDNA Over-eXpressor gene hunting) using full-length cDNAs (fl-cDNAs). A heterologous expression approach provides a solution for the high-throughput characterization of gene functions in agricultural plant species. Since fl-cDNAs contain all the information of functional mRNAs and proteins, we introduced rice fl-cDNAs into Arabidopsis plants for systematic gain-of-function mutation. We generated >30,000 independent Arabidopsis transgenic lines expressing rice fl-cDNAs (rice FOX Arabidopsis mutant lines). These rice FOX Arabidopsis lines were screened systematically for various criteria such as morphology, photosynthesis, UV resistance, element composition, plant hormone profile, metabolite profile/fingerprinting, bacterial resistance, and heat and salt tolerance. The information obtained from these screenings was compiled into a database named 'RiceFOX'. This database contains around 18,000 records of rice FOX Arabidopsis lines and allows users to search against all the observed results, ranging from morphological to invisible traits. The number of searchable items is approximately 100; moreover, the rice FOX Arabidopsis lines can be searched by rice and Arabidopsis gene/protein identifiers, sequence similarity to the introduced rice fl-cDNA and traits. The RiceFOX database is available at http://ricefox.psc.riken.jp/.

  3. Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

    Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

    2010-08-01

    Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as

  4. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.

    Carole F S Koning-Boucoiran

    2015-04-01

    Full Text Available In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array.Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L. genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.

  5. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.).

    Koning-Boucoiran, Carole F S; Esselink, G Danny; Vukosavljev, Mirjana; van 't Westende, Wendy P C; Gitonga, Virginia W; Krens, Frans A; Voorrips, Roeland E; van de Weg, W Eric; Schulz, Dietmar; Debener, Thomas; Maliepaard, Chris; Arens, Paul; Smulders, Marinus J M

    2015-01-01

    In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa multiflora using 454 sequencing. Separate de novo assemblies were performed in order to identify single nucleotide polymorphisms (SNPs) within and between rose varieties. SNPs among tetraploid roses were selected for constructing a genotyping array that can be employed for genetic mapping and marker-trait association discovery in breeding programs based on tetraploid germplasm, both from cut roses and from garden roses. In total 68,893 SNPs were included on the WagRhSNP Axiom array. Next, an orthology-guided assembly was performed for the construction of a non-redundant rose transcriptome database. A total of 21,740 transcripts had significant hits with orthologous genes in the strawberry (Fragaria vesca L.) genome. Of these 13,390 appeared to contain the full-length coding regions. This newly established transcriptome resource adds considerably to the currently available sequence resources for the Rosaceae family in general and the genus Rosa in particular.

  6. Construction and characterization of a full-length infectious cDNA clone of foot-and-mouth disease virus strain O/JPN/2010 isolated in Japan in 2010.

    Nishi, Tatsuya; Onozato, Hiroyuki; Ohashi, Seiichi; Fukai, Katsuhiko; Yamada, Manabu; Morioka, Kazuki; Kanno, Toru

    2016-06-01

    A full-length infectious cDNA clone of the genome of a foot-and-mouth disease virus isolated from the 2010 epidemic in Japan was constructed and designated pSVL-f02. Transfection of Cos-7 or IBRS-2 cells with this clone allowed the recovery of infectious virus. The recovered virus had the same in vitro characterization as the parental virus with regard to antigenicity in neutralization and indirect immunofluorescence tests, plaque size and one-step growth. Pigs were experimentally infected with the parental virus or the recombinant virus recovered from pSVL-f02 transfected cells. There were no significant differences in clinical signs or antibody responses between the two groups, and virus isolation and viral RNA detection from clinical samples were similar. Virus recovered from transfected cells therefore retained the in vitro characteristics and the in vivo pathogenicity of their parental strain. This cDNA clone should be a valuable tool to analyze determinants of pathogenicity and mechanisms of virus replication, and to develop genetically engineered vaccines against foot-and-mouth disease virus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Crystal structure of full-length Zika virus NS5 protein reveals a conformation similar to Japanese encephalitis virus NS5

    Upadhyay, Anup K.; Cyr, Matthew; Longenecker, Kenton; Tripathi, Rakesh; Sun, Chaohong; Kempf, Dale J. (AbbVie)

    2017-02-21

    The rapid spread of the recentZika virus(ZIKV) epidemic across various countries in the American continent poses a major health hazard for the unborn fetuses of pregnant women. To date, there is no effective medical intervention. The nonstructural protein 5 ofZika virus(ZIKV-NS5) is critical for ZIKV replication through the 5'-RNA capping and RNA polymerase activities present in its N-terminal methyltransferase (MTase) and C-terminal RNA-dependent RNA polymerase (RdRp) domains, respectively. The crystal structure of the full-length ZIKV-NS5 protein has been determined at 3.05 Å resolution from a crystal belonging to space groupP21212 and containing two protein molecules in the asymmetric unit. The structure is similar to that reported for the NS5 protein fromJapanese encephalitis virusand suggests opportunities for structure-based drug design targeting either its MTase or RdRp domain.

  8. Full-length single-cell RNA-seq applied to a viral human cancer: applications to HPV expression and splicing analysis in HeLa S3 cells.

    Wu, Liang; Zhang, Xiaolong; Zhao, Zhikun; Wang, Ling; Li, Bo; Li, Guibo; Dean, Michael; Yu, Qichao; Wang, Yanhui; Lin, Xinxin; Rao, Weijian; Mei, Zhanlong; Li, Yang; Jiang, Runze; Yang, Huan; Li, Fuqiang; Xie, Guoyun; Xu, Liqin; Wu, Kui; Zhang, Jie; Chen, Jianghao; Wang, Ting; Kristiansen, Karsten; Zhang, Xiuqing; Li, Yingrui; Yang, Huanming; Wang, Jian; Hou, Yong; Xu, Xun

    2015-01-01

    Viral infection causes multiple forms of human cancer, and HPV infection is the primary factor in cervical carcinomas. Recent single-cell RNA-seq studies highlight the tumor heterogeneity present in most cancers, but virally induced tumors have not been studied. HeLa is a well characterized HPV+ cervical cancer cell line. We developed a new high throughput platform to prepare single-cell RNA on a nanoliter scale based on a customized microwell chip. Using this method, we successfully amplified full-length transcripts of 669 single HeLa S3 cells and 40 of them were randomly selected to perform single-cell RNA sequencing. Based on these data, we obtained a comprehensive understanding of the heterogeneity of HeLa S3 cells in gene expression, alternative splicing and fusions. Furthermore, we identified a high diversity of HPV-18 expression and splicing at the single-cell level. By co-expression analysis we identified 283 E6, E7 co-regulated genes, including CDC25, PCNA, PLK4, BUB1B and IRF1 known to interact with HPV viral proteins. Our results reveal the heterogeneity of a virus-infected cell line. It not only provides a transcriptome characterization of HeLa S3 cells at the single cell level, but is a demonstration of the power of single cell RNA-seq analysis of virally infected cells and cancers.

  9. Temporomandibular joint formation requires two distinct hedgehog-dependent steps.

    Purcell, Patricia; Joo, Brian W; Hu, Jimmy K; Tran, Pamela V; Calicchio, Monica L; O'Connell, Daniel J; Maas, Richard L; Tabin, Clifford J

    2009-10-27

    We conducted a genetic analysis of the developing temporo-mandibular or temporomandi-bular joint (TMJ), a highly specialized synovial joint that permits movement and function of the mammalian jaw. First, we used laser capture microdissection to perform a genome-wide expression analysis of each of its developing components. The expression patterns of genes identified in this screen were examined in the TMJ and compared with those of other synovial joints, including the shoulder and the hip joints. Striking differences were noted, indicating that the TMJ forms via a distinct molecular program. Several components of the hedgehog (Hh) signaling pathway are among the genes identified in the screen, including Gli2, which is expressed specifically in the condyle and in the disk of the developing TMJ. We found that mice deficient in Gli2 display aberrant TMJ development such that the condyle loses its growth-plate-like cellular organization and no disk is formed. In addition, we used a conditional strategy to remove Smo, a positive effector of the Hh signaling pathway, from chondrocyte progenitors. This cell autonomous loss of Hh signaling allows for disk formation, but the resulting structure fails to separate from the condyle. Thus, these experiments establish that Hh signaling acts at two distinct steps in disk morphogenesis, condyle initiation, and disk-condyle separation and provide a molecular framework for future studies of the TMJ.

  10. Prophylaxis vs. on-demand treatment with BAY 81-8973, a full-length plasma protein-free recombinant factor VIII product: results from a randomized trial (LEOPOLD II).

    Kavakli, K; Yang, R; Rusen, L; Beckmann, H; Tseneklidou-Stoeter, D; Maas Enriquez, M

    2015-03-01

    BAY 81-8973 is a new full-length human recombinant factor VIII product manufactured with technologies to improve consistency in glycosylation and expression to optimize clinical performance. To demonstrate superiority of prophylaxis vs. on demand therapy with BAY 81-8973 in patients with severe hemophilia A. In this multinational,randomized, open-label crossover study (LEOPOLD II;ClinicalTrials.gov identifier: NCT01233258), males aged 12–65 years with severe hemophilia A were randomized to twice-weekly prophylaxis (20-30 IU kg(-1)), 3-times-weekly prophylaxis (30-40 IU kg(-1)), or on-demand treatment with BAY 81-8973. Potency labeling for BAY 81-8973 was based on the chromogenic substrate assay or adjusted to the one-stage assay. Primary efficacy endpoint was annualized number of all bleeds (ABR). Adverse events (AEs)and immunogenicity were also assessed. Eighty patients (on demand, n = 21; twice-weekly prophylaxis, n = 28; 3-times-weekly prophylaxis, n = 31) were treated and analyzed. Mean ± SD ABR was significantly lower with prophylaxis (twice-weekly, 5.7 ± 7.2; 3-times-weekly, 4.3 ± 6.5; combined, 4.9 ± 6.8) vs. on-demand treatment (57.7 ± 24.6; P demand treatment (60.0). Median ABR was higher with twice-weekly vs. 3-times-weekly prophylaxis during the first 6-month treatment period (4.1 vs. 2.0) but was comparable in the second 6-month period (1.1 vs. 2.0). Few patients reported treatment-related AEs (4%); no treatment-related serious AEs or inhibitors were reported. Twice weekly or 3-times-weekly prophylaxis with BAY 81-8973 reduced median ABR by 97% compared with on-demand therapy, confirming the superiority of prophylaxis. Treatment with BAY 81-8973 was well tolerated.

  11. Comparison of radiation dose, workflow, patient comfort and financial break-even of standard digital radiography and a novel biplanar low-dose X-ray system for upright full-length lower limb and whole spine radiography

    Dietrich, Tobias J.; Pfirrmann, Christian W.A.; Pankalla, Katja; Buck, Florian M.; Schwab, Alexander

    2013-01-01

    To compare the radiation dose, workflow, patient comfort, and financial break-even of a standard digital radiography and a biplanar low-dose X-ray system. A standard digital radiography system (Ysio, Siemens Healthcare, Erlangen, Germany) was compared with a biplanar X-ray unit (EOS, EOS imaging, Paris, France) consisting of two X-ray tubes and slot-scanning detectors, arranged at an angle of 90 allowing simultaneous vertical biplanar linear scanning in the upright patient position. We compared data of standing full-length lower limb radiographs and whole spine radiographs of both X-ray systems. Dose-area product was significantly lower for radiographs of the biplanar X-ray system than for the standard digital radiography system (e.g. whole spine radiographs; standard digital radiography system: 392.2 ± 231.7 cGy*cm 2 versus biplanar X-ray system: 158.4 ± 103.8 cGy*cm 2 ). The mean examination time was significantly shorter for biplanar radiographs compared with standard digital radiographs (e.g. whole spine radiographs: 449 s vs 248 s). Patients' comfort regarding noise was significantly higher for the standard digital radiography system. The financial break-even point was 2,602 radiographs/year for the standard digital radiography system compared with 4,077 radiographs/year for the biplanar X-ray unit. The biplanar X-ray unit reduces radiation exposure and increases subjective noise exposure to patients. The biplanar X-ray unit demands a higher number of examinations per year for the financial break-even point, despite the lower labour cost per examination due to the shorter examination time. (orig.)

  12. The α-helical C-terminal domain of full-length recombinant PrP converts to an in-register parallel β-sheet structure in PrP fibrils: evidence from solid state nuclear magnetic resonance.

    Tycko, Robert; Savtchenko, Regina; Ostapchenko, Valeriy G; Makarava, Natallia; Baskakov, Ilia V

    2010-11-09

    We report the results of solid state nuclear magnetic resonance (NMR) measurements on amyloid fibrils formed by the full-length prion protein PrP (residues 23−231, Syrian hamster sequence). Measurements of intermolecular 13C−13C dipole−dipole couplings in selectively carbonyl-labeled samples indicate that β-sheets in these fibrils have an in-register parallel structure, as previously observed in amyloid fibrils associated with Alzheimer’s disease and type 2 diabetes and in yeast prion fibrils. Two-dimensional 13C−13C and 15N−13C solid state NMR spectra of a uniformly 15N- and 13C-labeled sample indicate that a relatively small fraction of the full sequence, localized to the C-terminal end, forms the structurally ordered, immobilized core. Although unique site-specific assignments of the solid state NMR signals cannot be obtained from these spectra, analysis with a Monte Carlo/simulated annealing algorithm suggests that the core is comprised primarily of residues in the 173−224 range. These results are consistent with earlier electron paramagnetic resonance studies of fibrils formed by residues 90−231 of the human PrP sequence, formed under somewhat different conditions [Cobb, N. J., Sonnichsen, F. D., McHaourab, H., and Surewicz, W. K. (2007) Proc. Natl. Acad. Sci. U.S.A. 104, 18946−18951], suggesting that an in-register parallel β-sheet structure formed by the C-terminal end may be a general feature of PrP fibrils prepared in vitro.

  13. Multiple different defense mechanisms are activated in the young transgenic tobacco plants which express the full length genome of the Tobacco mosaic virus, and are resistant against this virus.

    Jada, Balaji; Soitamo, Arto J; Siddiqui, Shahid Aslam; Murukesan, Gayatri; Aro, Eva-Mari; Salakoski, Tapio; Lehto, Kirsi

    2014-01-01

    Previously described transgenic tobacco lines express the full length infectious Tobacco mosaic virus (TMV) genome under the 35S promoter (Siddiqui et al., 2007. Mol Plant Microbe Interact, 20: 1489-1494). Through their young stages these plants exhibit strong resistance against both the endogenously expressed and exogenously inoculated TMV, but at the age of about 7-8 weeks they break into TMV infection, with typical severe virus symptoms. Infections with some other viruses (Potato viruses Y, A, and X) induce the breaking of the TMV resistance and lead to synergistic proliferation of both viruses. To deduce the gene functions related to this early resistance, we have performed microarray analysis of the transgenic plants during the early resistant stage, and after the resistance break, and also of TMV-infected wild type tobacco plants. Comparison of these transcriptomes to those of corresponding wild type healthy plants indicated that 1362, 1150 and 550 transcripts were up-regulated in the transgenic plants before and after the resistance break, and in the TMV-infected wild type tobacco plants, respectively, and 1422, 1200 and 480 transcripts were down-regulated in these plants, respectively. These transcriptome alterations were distinctly different between the three types of plants, and it appears that several different mechanisms, such as the enhanced expression of the defense, hormone signaling and protein degradation pathways contributed to the TMV-resistance in the young transgenic plants. In addition to these alterations, we also observed a distinct and unique gene expression alteration in these plants, which was the strong suppression of the translational machinery. This may also contribute to the resistance by slowing down the synthesis of viral proteins. Viral replication potential may also be suppressed, to some extent, by the reduction of the translation initiation and elongation factors eIF-3 and eEF1A and B, which are required for the TMV replication

  14. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  15. Low risk of inhibitor formation in haemophilia A patients following en masse switch in treatment to a third generation full length plasma and albumin-free recombinant factor VIII product (ADVATE®).

    Bacon, C L

    2011-05-01

    Previous studies have suggested that development of inhibitors in previously treated patients (PTPs) may be attributable to a switch in factor VIII (FVIII) therapeutic product. Consequently, it is widely recognized that inhibitor development must be assessed in PTPs following the introduction of any new FVIII product. Following a national tender process in 2006, all patients with haemophilia A in Ireland changed their FVIII treatment product en masse to a plasma and albumin-free recombinant full-length FVIII product (ADVATE(®)). In this study, we retrospectively reviewed the case records of Irish PTPs to evaluate risk of inhibitor formation following this treatment switch. One hundred and thirteen patients participated in the study. Most patients (89%) had severe haemophilia. Only one of 96 patients with no inhibitor history developed an inhibitor. Prior to the switch in his recombinant FVIII (rFVIII) treatment of choice, this child had only experienced three exposure days (EDs). Consequently, in total he had only received 6 EDs when his inhibitor was first diagnosed. In keeping with this lack of de novo inhibitor development, we observed no evidence of any recurrent inhibitor formation in any of 16 patients with previously documented inhibitors. Similarly, following a previous en masse switch, we have previously reported that changing from a Chinese hamster ovary cell-produced to a baby hamster kidney cell-produced rFVIII was also associated with a low risk of inhibitor formation in PTPs. Our cumulative findings from these two studies clearly emphasizes that the risk of inhibitor development for PTPs following changes in commercial rFVIII product is low, at least in the Irish population.

  16. PDGF-induced migration of synthetic vascular smooth muscle cells through c-Src-activated L-type Ca2+ channels with full-length CaV1.2 C-terminus.

    Guo, Xiaoguang; Kashihara, Toshihide; Nakada, Tsutomu; Aoyama, Toshifumi; Yamada, Mitsuhiko

    2018-06-01

    In atherosclerosis, vascular smooth muscle cells (VSMC) migrate from the media toward the intima of the arteries in response to cytokines, such as platelet-derived growth factor (PDGF). However, molecular mechanism underlying the PDGF-induced migration of VSMCs remains unclear. The migration of rat aorta-derived synthetic VSMCs, A7r5, in response to PDGF was potently inhibited by a Ca V 1.2 channel inhibitor, nifedipine, and a Src family tyrosine kinase (SFK)/Abl inhibitor, bosutinib, in a less-than-additive manner. PDGF significantly increased Ca V 1.2 channel currents without altering Ca V 1.2 protein expression levels in A7r5 cells. This reaction was inhibited by C-terminal Src kinase, a selective inhibitor of SFKs. In contractile VSMCs, the C-terminus of Ca V 1.2 is proteolytically cleaved into proximal and distal C-termini (PCT and DCT, respectively). Clipped DCT is noncovalently reassociated with PCT to autoinhibit the channel activity. Conversely, in synthetic A7r5 cells, full-length Ca V 1.2 (Ca V 1.2FL) is expressed much more abundantly than truncated Ca V 1.2. In a heterologous expression system, c-Src activated Ca V 1.2 channels composed of Ca V 1.2FL but not truncated Ca V 1.2 (Ca V 1.2Δ1763) or Ca V 1.2Δ1763 plus clipped DCT. Further, c-Src enhanced the coupling efficiency between the voltage-sensing domain and activation gate of Ca V 1.2FL channels by phosphorylating Tyr1709 and Tyr1758 in PCT. Compared with Ca V 1.2Δ1763, c-Src could more efficiently bind to and phosphorylate Ca V 1.2FL irrespective of the presence or absence of clipped DCT. Therefore, in atherosclerotic lesions, phenotypic switching of VSMCs may facilitate pro-migratory effects of PDGF on VSMCs by suppressing posttranslational Ca V 1.2 modifications.

  17. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  18. Full-length sequencing and identification of novel polymorphisms in ...

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  19. Full Length Research Paper Seed germination and in vitro plant ...

    Parkia biglobosa is an important leguminous forest species which is being threatened of going into extinction in Senegal. To preserve this genetic resource of great economic value, studies on germination were carried out and in vitro conservation option through tissue culture technique was adopted. 100% of germination ...

  20. FULL LENGTH RESEARCH ARTICLE Yoriyo et al.(2008) SWJ:35 ...

    Dr. Ahmed

    poultry industry to its full capacity. These factors include poor management systems and diseases. Poultry diseases are the major cause of financial loss in poultry production (Oluyemi & Rober, 1979). Intestinal parasitism is a common problem in poultry especially those reared under extensive systems. Ajayi & Ajayi (1983) ...

  1. Computer Assisted Instruction in Teacher Education: A Full Length Course.

    Cartwright, G. Phillip

    Pennsylvania State University has developed, evaluated, and implemented a series of modules and an entire three-credit teacher education course which is offered completely by microcomputer. The course is entitled "Educating Special Learners." The modules use the Apple II series and the IBM PC series. Evaluation of the course, based on…

  2. Full Length Research Paper LTR-retrotransposons-based molecular ...

    LTR-retrotransposons possess unique properties that make them appropriate for investigating relationships between closely related species and populations. The aim of the current study was to employ Ty1-copia group retrotransposons as molecular markers in cultivated Egyptian cottons, G. barbadense L. Restriction site ...

  3. Full-length genomic analysis of korean porcine sapelovirus strains

    Son, Kyu-Yeol; Kim, Deok-Song; Kwon, Joseph

    2014-01-01

    the typical picornavirus genome organization; 5'untranslated region (UTR)-L-VP4-VP2-VP3-VP1-2A-2B-2C-3A-3B-3C-3D-3'UTR. Three distinct cis-active RNA elements, the internal ribosome entry site (IRES) in the 5'UTR, a cis-replication element (CRE) in the 2C coding region and 3'UTR were identified...... and their structures were predicted. Interestingly, the structural features of the CRE and 3'UTR were different between PSV strains. The availability of these first complete genome sequences for PSV strains will facilitate future investigations of the molecular pathogenesis and evolutionary characteristics of PSV....

  4. Full Length Research Paper Plant regeneration of Michelia ...

    Michelia champaca L. is a woody ornamental tree species which has high commercial value to be used as a basic material for perfume, cosmetic, and medicine. The development of an efficient plant regeneration system for M. champaca is essential for the production of Champaca planting material and precondition for ...

  5. Full-length sequencing and identification of novel polymorphisms in ...

    Rosalia Di Gerlando

    2017-08-16

    Aug 16, 2017 ... ANNA MARIA SUTERA, MARIA TERESA SARDINA. ∗ ... SNPs that might be important in future studies and laid the basis for further association analyses needed to ..... Haplotype-based analysis can provide higher power,.

  6. A comparative phylogenetic analysis of full-length mariner elements ...

    Unknown

    recent study showing non-occurance of inter-subfamily excisions because of .... length shown in our figure is greater because of the gaps introduced to maintain an ... to test the feasibility of transforming silkmoths with a foreign gene of ...

  7. FULL LENGTH RESEARCH ARTICLE Dr Bayo type set

    Dr Ahmed

    WORLD JOURNAL VOL 2(NO2) 2007 www.sciecnceworldjournal.com ... 1Department of Pure and Applied Mathematics. Ladoke Akintola ... This paper presents the simplified version of the Freeman-Tukey test statistic for testing hypothesis ...

  8. FULL LENGTH RESEARCH ARTICLE Agashe & Bodhe(2008) SWJ ...

    Dr. Ahmed

    Mobile networks allow users to access services while on the move .... chosen from a random Gaussian distribution with mean equal to zero ... da and. )( db when mobile is at a distance d from A is. ),0(. )6....(. )......... () log(. )( )5.( .... This denial of.

  9. Cinemeducation: teaching family assessment skills using full-length movies.

    Wilson, Astrid H; Blake, Barbara J; Taylor, Gloria A; Hannings, Glenda

    2013-05-01

    A thorough family assessment provides a foundation for the nursing process when working with families. Therefore, nurses, along with other health care providers must develop expertise in conducting family assessments to provide the best possible care within the community. This article describes an innovative educational strategy using movies to teach family assessment skills and puts forth recommendations for future research to provide evidence to support this teaching modality. © 2013 Wiley Periodicals, Inc.

  10. Full Length Research Paper Curcumin induces cleavage of -catenin ...

    β-Catenin/Tcf-4 signaling pathway plays important roles in colorectal tumorigenesis. RT-PCR, western blotting and immunoprecipitation were used to study the effects of curcumin on β-catenin/Tcf-4 signaling pathway in HT-29 cells. Treatment of curcumin could induce cleavage of β-catenin and the cleavage could be ...

  11. Full Length Research Paper Biochemical and textural properties of ...

    Skinned, vacuum packed post-rigor gilthead seabream (Sparus aurata) fillets were stored frozen at -22°C for up to 340 days. Sampling was carried out on fresh fillets at days 34, 91, 183, 266 and 340 of frozen storage. Tests related to muscle integrity (activity of -glucosidase and the protein content of centrifugal tissue fluids), ...

  12. FULL LENGTH RESEARCH ARTICLE Jauro et al. (2008) SWJ:79 ...

    Dr. Ahmed

    environmental, economic, technological and human health impacts. (Renton 1982 ... 5g of the sample was weighed into a platinum crucible and ignited in a muffle furnace .... also enhances the risk of lung cancer (Lenntech 2008). Magnesium.

  13. th R ese arch Full Length R esearch A rticle

    status, workability and erosion were matched with irrigated rice land use requirements. The current suitability evaluation of Tomas irrigation scheme for irrigated rice, using the nonparametric method indicates that all the mapping units fall into the marginally suitable (S3fs) class, with low fertility status and coarse sandy ...

  14. FULL LENGTH RESEARCH ARTICLE Hassan et al. (2008) SWJ ...

    Dr. Ahmed

    1Department of Biological Sciences. Kaduna State University ... From hydrological statistics, the volume of water world-wide amounts to some 1.4 x 109 km3. ... most striking features of the past water assessment procedures has been reliance ...

  15. Full Length Research Paper Production of emodin from Aspergillus ...

    In order to study the chemical constituents in the pigmented culture produced from Aspergillus ochraceus, solid phase extraction method was employed to isolate the pigment molecules from the primary culture, followed by fractionation on preparative liquid chromatography. Structural characterization confirmed that one of ...

  16. Full length SSC R and D dipole magnet test results

    Strait, J.; Bleadon, M.; Brown, B.C.

    1989-03-01

    Four full scale SSC development dipole magnets have been tested for mechanical and quench behavior. Two are of a design similar to previous magnets but contain a number of improvements, including more uniform coil size, higher pre-stress and a redesigned inner-outer coil splice. One exceeds the SSC operating current on the second quench but the other appears to be limited by damaged superconductor to a lower current. The other two magnets are of alternate designs. One trains erratically and fails to reach a plateau and the other reaches plateau after four quenches. 12 refs., 4 figs

  17. Molecular cloning of full-length coding sequences and ...

    DR TONUKARI NYEROVWO

    structure and function of collagen, the distribution patterns of these two characteristic residues in α chains of ... the extracellular matrix. Besides ... number in collagen family and the major matrix protein in ..... Dashes represent missing residues.

  18. Function of Brg1 Chromatin Remodeling Factor in Sonic Hedgehog-Dependent Medulloblastoma Initiation and Maintenance

    2015-12-01

    tumor suppressors and REST-targeted neuronal genes. Brg1 deletion led to the inhibition of Shh-type medulloblastoma growth by deregulation of the...China University of Rostock & Research Institute for the Biology of Farm Animals, Germany University of Texas Southwestern Medical Center at...of Rostock & Research Institute for the Biology of Farm Animals, Germany . Mentor: Prof. Dr. Hans-Martin Seyfert 2010- 2014 Postdoctoral

  19. The C-terminal domain of Nrf1 negatively regulates the full-length CNC-bZIP factor and its shorter isoform LCR-F1/Nrf1β; both are also inhibited by the small dominant-negative Nrf1γ/δ isoforms that down-regulate ARE-battery gene expression.

    Zhang, Yiguo; Qiu, Lu; Li, Shaojun; Xiang, Yuancai; Chen, Jiayu; Ren, Yonggang

    2014-01-01

    The C-terminal domain (CTD, aa 686-741) of nuclear factor-erythroid 2 p45-related factor 1 (Nrf1) shares 53% amino acid sequence identity with the equivalent Neh3 domain of Nrf2, a homologous transcription factor. The Neh3 positively regulates Nrf2, but whether the Neh3-like (Neh3L) CTD of Nrf1 has a similar role in regulating Nrf1-target gene expression is unknown. Herein, we report that CTD negatively regulates the full-length Nrf1 (i.e. 120-kDa glycoprotein and 95-kDa deglycoprotein) and its shorter isoform LCR-F1/Nrf1β (55-kDa). Attachment of its CTD-adjoining 112-aa to the C-terminus of Nrf2 yields the chimaeric Nrf2-C112Nrf1 factor with a markedly decreased activity. Live-cell imaging of GFP-CTD reveals that the extra-nuclear portion of the fusion protein is allowed to associate with the endoplasmic reticulum (ER) membrane through the amphipathic Neh3L region of Nrf1 and its basic c-tail. Thus removal of either the entire CTD or the essential Neh3L portion within CTD from Nrf1, LCR-F1/Nrf1β and Nrf2-C112Nrf1, results in an increase in their transcriptional ability to regulate antioxidant response element (ARE)-driven reporter genes. Further examinations unravel that two smaller isoforms, 36-kDa Nrf1γ and 25-kDa Nrf1δ, act as dominant-negative inhibitors to compete against Nrf1, LCR-F1/Nrf1β and Nrf2. Relative to Nrf1, LCR-F1/Nrf1β is a weak activator, that is positively regulated by its Asn/Ser/Thr-rich (NST) domain and acidic domain 2 (AD2). Like AD1 of Nrf1, both AD2 and NST domain of LCR-F1/Nrf1β fused within two different chimaeric contexts to yield Gal4D:Nrf1β607 and Nrf1β:C270Nrf2, positively regulate their transactivation activity of cognate Gal4- and Nrf2-target reporter genes. More importantly, differential expression of endogenous ARE-battery genes is attributable to up-regulation by Nrf1 and LCR-F1/Nrf1β and down-regulation by Nrf1γ and Nrf1δ.

  20. ORNL capability to conduct post irradiation examination of full-length commercial nuclear fuel rods

    Spellman, Donald J.

    2007-01-01

    Hot cells at Oak Ridge National Laboratory (ORNL) are nearing completion of a multi-year upgrade program to implement 21. century capabilities to meet the examination demands for higher burnup fuels and the future demands that will come from fuel recycling programs. Fuel reliability and zero tolerance for fuel failure is more than an industry goal. Fuel reliability is becoming a requirement that supports the renaissance of nuclear power generation. Thus, fuel development and management of new forms of waste that will come from programs such as the Global Nuclear Energy Partnership (GNEP) will require extensive use of the flexible, high-quality, technically advanced hot cells at ORNL. ORNL has the capability to perform post irradiation examination (PIE) of irradiated commercial nuclear fuel rods and the management structure to ensure a timely, cost-effective result. ORNL can: 1) Handle the transportation issues, 2) Perform macroscopic fuel rod examinations, 3) Perform microscopic fuel and clad examinations, and 4) Manage legacy material and waste disposal issues from PIE activities. All four of these items will be managed in a way that allows the customer day-to-day access to the results and data. Hot cell examination equipment that is necessary to determine the characteristics and performance of irradiated materials must operate in a hostile environment and is subject to long-term degradation that may result in reliability and quality assurance (QA) issues. ORNL has modernized its hot cell nuclear fuel examination equipment, installing state-of-the-art automated examination equipment and data gathering capabilities. ORNL is planning a major commitment to nuclear fuel examination and development, and future improvements will continue to be made over the next few years. (author)

  1. Dosimetry with semiconductor diodes in the application to the full-length irradiation technique of electrons

    Madrid G, O. A.; Rivera M, T.

    2012-10-01

    The use of charged particles as electrons for the tumor-like lesions treatment to total surface of skin is not very frequent, the types of fungo id mycosis and cutaneous lymphomas compared with other neoplasms they are relatively scarce, however for the existent cases a non conventional technique should be contemplated as treatment alternative that can reach an effective control. In this work the variables of more influence with ionization chamber and semiconductor diodes are studied for to determine the quality of an electrons beam. (Author)

  2. A cryogenic test stand for full length SSC magnets with superfluid capability

    Peterson, T.J.; Mazur, P.O.

    1989-02-01

    The Fermilab Magnet Test Facility performs testing of the full scale SSC magnets on test stands capable of simulating the cryogenic environment of the SSC main ring. One of these test stands, Stand 5, also has the ability to operate the magnet under test at temperatures from 1.8K to 4.5K with either supercritical helium or subcooled liquid, providing at least 25 Watts of refrigeration. At least 50 g/s flow is available from 2.3K to 4.5K, whereas superfluid operation occurs with zero flow. Cooldown time from 4.5K to 1.8K is 1.5 hours. A maximum current capability of 10,000 amps is provided, as is instrumentation to monitor and control the cryogenic conditions. This paper describes the cryogenic design of this test stand. 8 refs., 6 figs

  3. A FULL LENGTH RESEARCH ARTICLE Udeh et al., (2008) SWJ:1-4 ...

    hp

    malabsorption, malnutrition and anaemia among Nigerians (James et al., 1988). Intestinal protozoans are frequently transmitted by unhygienic habits that include direct transfer of ova or cysts to mouth, eating with unwashed hands, eating and drinking of contaminated food and drink and poor sanitary conditions (Okpala et ...

  4. Full length cluster level swell data at pressures from 2 to 40 bar

    Pearson, K.G.

    1987-11-01

    This paper gives results of level swell experiments at pressures up to 40 bar, performed at Winfrith in 1981 as described elsewhere. The results have been used by a number of workers to develop voidage correlations and to assess safety codes. The experiment and experimental rig used are described. The results are tabulated. (author)

  5. Effect of metal ions on de novo aggregation of full-length prion protein

    Giese, Armin; Levin, Johannes; Bertsch, Uwe; Kretzschmar, Hans

    2004-01-01

    It is well established that the prion protein (PrP) contains metal ion binding sites with specificity for copper. Changes in copper levels have been suggested to influence incubation time in experimental prion disease. Therefore, we studied the effect of heavy metal ions (Cu 2+ , Mn 2+ , Ni 2+ , Co 2+ , and Zn 2+ ) in vitro in a model system that utilizes changes in the concentration of SDS to induce structural conversion and aggregation of recombinant PrP. To quantify and characterize PrP aggregates, we used fluorescently labelled PrP and cross-correlation analysis as well as scanning for intensely fluorescent targets in a confocal single molecule detection system. We found a specific strong pro-aggregatory effect of Mn 2+ at low micromolar concentrations that could be blocked by nanomolar concentration of Cu 2+ . These findings suggest that metal ions such as copper and manganese may also affect PrP conversion in vivo

  6. Determination and analysis of the full-length chicken parvovirus genome.

    Viral enteric disease in poultry is an ongoing problem in many parts of the world. Many enteric viruses have been identified in turkeys and chickens, including avian astroviruses, rotaviruses, reoviruses, and coronaviruses. Through the application of a molecular screening method targeting particle-a...

  7. An Efficient Algorithm for the Discrete Gabor Transform using full length Windows

    Søndergaard, Peter Lempel

    2007-01-01

    This paper extends the efficient factorization of the Gabor frame operator developed by Strohmer in [1] to the Gabor analysis/synthesis operator. This provides a fast method for computing the discrete Gabor transform (DGT) and several algorithms associated with it. The algorithm is used...

  8. Milligram quantities of homogeneous recombinant full-length mouse Munc18c from Escherichia coli cultures.

    Asma Rehman

    Full Text Available Vesicle fusion is an indispensable cellular process required for eukaryotic cargo delivery. The Sec/Munc18 protein Munc18c is essential for insulin-regulated trafficking of glucose transporter4 (GLUT4 vesicles to the cell surface in muscle and adipose tissue. Previously, our biophysical and structural studies have used Munc18c expressed in SF9 insect cells. However to maximize efficiency, minimize cost and negate any possible effects of post-translational modifications of Munc18c, we investigated the use of Escherichia coli as an expression host for Munc18c. We were encouraged by previous reports describing Munc18c production in E. coli cultures for use in in vitro fusion assay, pulldown assays and immunoprecipitations. Our approach differs from the previously reported method in that it uses a codon-optimized gene, lower temperature expression and autoinduction media. Three N-terminal His-tagged constructs were engineered, two with a tobacco etch virus (TEV or thrombin protease cleavage site to enable removal of the fusion tag. The optimized protocol generated 1-2 mg of purified Munc18c per L of culture at much reduced cost compared to Munc18c generated using insect cell culture. The purified recombinant Munc18c protein expressed in bacteria was monodisperse, monomeric, and functional. In summary, we developed methods that decrease the cost and time required to generate functional Munc18c compared with previous insect cell protocols, and which generates sufficient purified protein for structural and biophysical studies.

  9. Accumulation of Stable Full-Length Circular Group I Intron RNAs during Heat-Shock

    Andersen, Kasper L.; Beckert, Bertrand; Masquida, Benoit

    2016-01-01

    the potential to linearize the circle. To understand the structural features that maintain circle integrity, we performed chemical and enzymatic probing of the splicing ribozyme combined with molecular modeling to arrive at models of the inactive circular form and its active linear counterpart. We show...... integration and thus supports the notion that the circular form is a biologically significant molecule possibly with a role in intron mobility...

  10. Full Len gth Res earc h Arti cle Full Length Research Article

    functioning of adults as well as children, often with significant ... learning disability particularly in children (Albert,. 1999 ... Signs and Symptoms of this infection include, mild to ..... Isolation and Antimicrobial ... Bayesian Statistics for Social.

  11. A combined computational and structural model of the full-length human prolactin receptor

    Bugge, Katrine Østergaard; Papaleo, Elena; Haxholm, Gitte Wolfsberg

    2016-01-01

    The prolactin receptor is an archetype member of the class I cytokine receptor family, comprising receptors with fundamental functions in biology as well as key drug targets. Structurally, each of these receptors represent an intriguing diversity, providing an exceptionally challenging target for...... 40 different receptor chains, and reveals that the extracellular domain is merely the tip of a molecular iceberg....

  12. analysis of a normalized full-length cDNA library from the pinewood

    SAM

    2014-08-13

    Aug 13, 2014 ... With a disulfide as acceptor. 3 ... Acting on paired donors, with incorporation or reduction of molecular oxygen. 4 ... Acting on peptide bonds (peptidases). 12 ... Acting on carbon-nitrogen bonds, other than peptide bonds. 3.

  13. Full-length genomic and molecular characterization of Canine parvovirus in dogs from North of Brazil.

    Silva, S P; Silva, L N P P; Rodrigues, E D L; Cardoso, J F; Tavares, F N; Souza, W M; Santos, C M P; Martins, F M S; Jesus, I S; Brito, T C; Moura, T P C; Nunes, M R T; Casseb, L M N; Silva Filho, E; Casseb, A R

    2017-09-21

    With the objective of characterizing Canine parvovirus (CPV) from some suspected fecal samples of dogs collected from the Veterinarian Hospital in Belém city, five positive samples were found by PCR assay and an update molecular characterization was provided of the CPV-2 circulation in Belém. Through sequencing of the complete DNA sequences (NS1, NS2, VP1, and VP2 genes), the CPV-2 strain was identified as CPV-2b (Asn426Asp) circulating in Belém. The CPV-2b strain with a different change at the position Tyr324Leu was detected in all samples assessed and thus reported for the first time for the scientific community. Phylogenetic analysis indicated that Belém CPV-2b and CPV-2a strains would be related to a cluster with samples after the 1990s, suggesting that CPV-2b in Belém originated from CPV-2a circulating in Brazil after the 1990s. Potential recombination events were analyzed using RDP4 and SplitsTree4; therefore, results suggest that CPV-2 sequences here described were not potentially recombination events. Continuous monitoring and molecular characterization of CPV-2 samples are needed not only to identify possible genetic and antigenic changes that may interfere with the effectiveness of vaccines but also to bring a better understanding of the mechanisms that drive the evolution of CPV-2 in Brazil.

  14. Full-length RNA structure prediction of the HIV-1 genome reveals a conserved core domain

    Sükösd, Zsuzsanna; Andersen, Ebbe Sloth; Seemann, Ernst Stefan

    2015-01-01

    of the HIV-1 genome is highly variable in most regions, with a limited number of stable and conserved RNA secondary structures. Most interesting, a set of long distance interactions form a core organizing structure (COS) that organize the genome into three major structural domains. Despite overlapping...

  15. Construction of full-length cDNA library of white flower Salvia ...

    In order to screen and isolate secondary metabolite biosynthesis related gene, we construct a cDNA library of white flower Salvia miltiorrhiza bge. f.alba. High quality of total RNA was successfully isolated from roots of white flower S. miltiorrhiza using modified CTAB method. Double strand cDNA was cloned into pDNR-LIB ...

  16. Crystallization and preliminary X-ray characterization of full-length Chlamydomonas reinhardtii centrin

    Alfaro, Elisa; Valle Sosa, Liliana del; Sanoguet, Zuleika; Pastrana-Ríos, Belinda; Schreiter, Eric R.

    2008-01-01

    C. reinhardtii centrin, an EF-hand calcium-binding protein localized to the microtubule-organizing center of eukaryotic organisms, has been crystallized in the presence of the model peptide melittin. X-ray diffraction data were collected to 2.2 Å resolution. Chlamydomonas reinhardtii centrin is a member of the EF-hand calcium-binding superfamily. It is found in the basal body complex and is important for flagellar motility. Like other members of the EF-hand family, centrin interacts with and modulates the function of other proteins in a calcium-dependent manner. To understand how C. reinhardtii centrin interacts with its protein targets, it has been crystallized in the presence of the model peptide melittin and X-ray diffraction data have been collected to 2.2 Å resolution. The crystals are orthorhombic, with unit-cell parameters a = 52.1, b = 114.4, c = 34.8 Å, and are likely to belong to space group P2 1 2 1 2

  17. Analysis of the full-length VP2 protein of canine parvoviruses circulating in Hungary.

    Cságola, Attila; Varga, Szilvia; Lőrincz, Márta; Tuboly, Tamás

    2014-09-01

    In recent years, the number of cases of disease caused by canine parvovirus 2 (CPV-2) in vaccinated dogs has increased. The aim of the present study was to identify CPV-2 strains present in Hungary. Forty-two out of 50 faecal specimens examined were positive, and 25 VP2 sequences were determined and analysed. Based on the current classification, the Hungarian viruses belong to New CPV-2a type, except two viruses that are recombinants of vaccine viruses and CPV-2a strains. The Tyr324Ile alteration was detected for the first time in Europe, and a "Hungarian-specific" substitution (Ala516Thr) was also identified in this study. The immunologically important parts of the currently spreading canine parvoviruses were examined and found to differ greatly from the vaccine strains that are widely used in Hungary.

  18. Inhibitor discovery of full-length New Delhi metallo-β-lactamase-1 (NDM-1.

    Bingzheng Shen

    Full Text Available New Delhi metallo-β-lactmase-1 (NDM-1 has recently attracted extensive attention for its biological activities to catalyze the hydrolysis of almost all of β-lactam antibiotics. To study the catalytic property of NDM-1, the steady-kinetic parameters of NDM-1 toward several kinds of β-lactam antibiotics have been detected. It could effectively hydrolyze most β-lactams (k cat/K m ratios between 0.03 to 1.28 µmol⁻¹.s⁻¹, except aztreonam. We also found that thiophene-carboxylic acid derivatives could inhibit NDM-1 and have shown synergistic antibacterial activity in combination with meropenem. Flexible docking and quantum mechanics (QM study revealed electrostatic interactions between the sulfur atom of thiophene-carboxylic acid derivatives and the zinc ion of NDM-1, along with hydrogen bond between inhibitor and His189 of NDM-1. The interaction models proposed here can be used in rational design of NDM-1 inhibitors.

  19. Construction of a full-length cDNA library and analysis of expressed ...

    ... in the GenBank databases. Cluster analysis allowed the identification of 61 unique sequences. These genes were classified into six types by Gene Ontology (GO) annotation. The results also indicated that unigenes of C. capsularis have higher homology to Populus trichocarpa, Ricinus communis and Corchorus olitorius.

  20. FULL LENGTH RESEARCH ARTICLE Osue et al. (2008) SWJ:1-4 ...

    Dr. Ahmed

    Current mass distribution of ivermectin to the ... antibodies, and the hazard of working with radioactive substances. .... using a modified protocol (Engelbrecht et al. .... in assumed endemic normal individuals show they have been exposed.

  1. The X-ray Crystal Structure of Full-Length Human Plasminogen

    Ruby H.P. Law

    2012-03-01

    Full Text Available Plasminogen is the proenzyme precursor of the primary fibrinolytic protease plasmin. Circulating plasminogen, which comprises a Pan-apple (PAp domain, five kringle domains (KR1-5, and a serine protease (SP domain, adopts a closed, activation-resistant conformation. The kringle domains mediate interactions with fibrin clots and cell-surface receptors. These interactions trigger plasminogen to adopt an open form that can be cleaved and converted to plasmin by tissue-type and urokinase-type plasminogen activators. Here, the structure of closed plasminogen reveals that the PAp and SP domains, together with chloride ions, maintain the closed conformation through interactions with the kringle array. Differences in glycosylation alter the position of KR3, although in all structures the loop cleaved by plasminogen activators is inaccessible. The ligand-binding site of KR1 is exposed and likely governs proenzyme recruitment to targets. Furthermore, analysis of our structure suggests that KR5 peeling away from the PAp domain may initiate plasminogen conformational change.

  2. Construction of full-length cDNA library of white flower Salvia ...

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  3. Molecular characterisation of the full-length genome of olive latent virus 1 isolated from tomato.

    Hasiów-Jaroszewska, Beata; Borodynko, Natasza; Pospieszny, Henryk

    2011-05-01

    Olive latent virus 1 (OLV-1) is a species of the Necrovirus genus. So far, it has been reported to infect olive, citrus tree and tulip. Here, we determined and analysed the complete genomic sequence of an isolate designated as CM1, which was collected from tomato plant in the Wielkopolska region of Poland and represents the prevalent isolate of OLV-1. The CM1 genome consists of monopartite single-stranded positive-sense RNA genome sized 3,699 nt with five open reading frames (ORFs) and small inter-cistronic regions. ORF1 encodes a polypeptide with a molecular weight of 23 kDa and the read-through (RT) of its amber stop codon results in ORF1 RT that encodes the virus RNA-dependent RNA polymerase. ORF2 and ORF3 encode two peptides, with 8 kDa and 6 kDa, respectively, which appear to be involved in cell-to-cell movement. ORF4 is located in the 3' terminal and encodes a protein with 30 kDa identified as the viral coat protein (CP). The differences in CP region of four OLV-1 isolates whose sequences have been deposited in GenBank were observed. Nucleotide sequence identities of the CP of tomato CM1 isolate with those of olive, citrus and tulip isolates were 91.8%, 89.5% and 92.5%, respectively. In contrast to other OLV-1 isolates, CM1 induced necrotic spots on tomato plants and elicited necrotic local lesions on Nicotiana benthamiana, followed by systemic infection. This is the third complete genomic sequence of OLV-1 reported and the first one from tomato.

  4. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    Kodzius, Rimantas; Tay, Boon-Hui; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa

    2009-01-01

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a

  5. Magnetic field measurements of full length 50 mm aperture SSC dipole magnets at Fermilab

    Strait, J.; Bossert, R.; Carson, J.; Delchamps, S.W.; Gourlay, S.; Hanft, R.; Koska, W.; Kuchnir, M.; Lamm, M.J.; Mazur, P.O.; Mokhtarani, A.; Orris, D.; Ozelis, J.; Wake, M.; Devred, A.; DiMarco, J.; Kuzminski, J.; Puglisi, M.; Tompkins, J.C.; Yu, Y.; Zhao, Y.; Zheng, H.; Ogitsu, T.

    1992-09-01

    Thirteen 16 m long, 50 mm aperture SSC dipole magnets, designed jointly by Fermilab, Brookhaven National Laboratory, Lawrence Berkeley Laboratory and the SSC Laboratory, have been built at Fermilab. The first nine magnets have been fully tested to date. The allowed harmonics are systematically shifted from zero by amounts larger than the specification. The unallowed harmonics, with the exception of the skew sextupole, are consistent with zero. The magnet-to-magnet RMS variation of all harmonics is much smaller than the specification

  6. Full Length Research Paper Lack of correlation between H 2O 2 ...

    Lactobacilli are considered to play important roles in human health as they are known to secrete inhibitory substances to prevent infection by pathogenic organisms. Previously we have isolated 77 strains of Lactobacillus spp. from human vaginas. In this study, using the plate diffusion method, strains showing in vitro ...

  7. Sonic Hedgehog dependent phosphorylation by CK1α and GRK2 is required for ciliary accumulation and activation of smoothened.

    Yongbin Chen

    2011-06-01

    Full Text Available Hedgehog (Hh signaling regulates embryonic development and adult tissue homeostasis through the GPCR-like protein Smoothened (Smo, but how vertebrate Smo is activated remains poorly understood. In Drosophila, Hh dependent phosphorylation activates Smo. Whether this is also the case in vertebrates is unclear, owing to the marked sequence divergence between vertebrate and Drosophila Smo (dSmo and the involvement of primary cilia in vertebrate Hh signaling. Here we demonstrate that mammalian Smo (mSmo is activated through multi-site phosphorylation of its carboxyl-terminal tail by CK1α and GRK2. Phosphorylation of mSmo induces its active conformation and simultaneously promotes its ciliary accumulation. We demonstrate that graded Hh signals induce increasing levels of mSmo phosphorylation that fine-tune its ciliary localization, conformation, and activity. We show that mSmo phosphorylation is induced by its agonists and oncogenic mutations but is blocked by its antagonist cyclopamine, and efficient mSmo phosphorylation depends on the kinesin-II ciliary motor. Furthermore, we provide evidence that Hh signaling recruits CK1α to initiate mSmo phosphorylation, and phosphorylation further increases the binding of CK1α and GRK2 to mSmo, forming a positive feedback loop that amplifies and/or sustains mSmo phosphorylation. Hence, despite divergence in their primary sequences and their subcellular trafficking, mSmo and dSmo employ analogous mechanisms for their activation.

  8. Leukotriene synthesis is required for hedgehog-dependent neurite projection in neuralized embryoid bodies but not for motor neuron differentiation

    Bijlsma, Maarten F.; Peppelenbosch, Maikel P.; Spek, C. Arnold; Roelink, Henk

    The hedgehog (Hh) pathway is required for many developmental processes,. as well as for adult homeostasis. Although all known effects of Hh signaling affecting patterning and differentiation are mediated by members of the Gli family of zinc ringer transcription factors, we demonstrate that the

  9. hPOC5 is a centrin-binding protein required for assembly of full-length centrioles.

    Azimzadeh, Juliette; Hergert, Polla; Delouvée, Annie; Euteneuer, Ursula; Formstecher, Etienne; Khodjakov, Alexey; Bornens, Michel

    2009-04-06

    Centrin has been shown to be involved in centrosome biogenesis in a variety of eukaryotes. In this study, we characterize hPOC5, a conserved centrin-binding protein that contains Sfi1p-like repeats. hPOC5 is localized, like centrin, in the distal portion of human centrioles. hPOC5 recruitment to procentrioles occurs during G2/M, a process that continues up to the full maturation of the centriole during the next cell cycle and is correlated with hyperphosphorylation of the protein. In the absence of hPOC5, RPE1 cells arrest in G1 phase, whereas HeLa cells show an extended S phase followed by cell death. We show that hPOC5 is not required for the initiation of procentriole assembly but is essential for building the distal half of centrioles. Interestingly, the hPOC5 family reveals an evolutionary divergence between vertebrates and organisms like Drosophila melanogaster or Caenorhabditis elegans, in which the loss of hPOC5 may correlate with the conspicuous differences in centriolar structure.

  10. Full-length genome analysis of Čalovo strains of Batai orthobunyavirus (Bunyamwera serogroup): Implications to taxonomy

    Dufková, L.; Pachler, K.; Kilian, Patrik; Chrudimský, Tomáš; Danielová, V.; Růžek, Daniel; Nowotny, N.

    2014-01-01

    Roč. 27, 2014-Oct (2014), s. 96-104 ISSN 1567-1348 R&D Projects: GA ČR GAP502/11/2116; GA ČR(CZ) GA14-29256S Institutional support: RVO:60077344 Keywords : Batai virus * Orthobunyavirus * Phylogenetic analysis * Calovo virus Subject RIV: EE - Microbiology, Virology Impact factor: 3.015, year: 2014

  11. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  12. Facile method for the site-specific, covalent attachment of full-length IgG onto nanoparticles.

    Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T; Tsourkas, Andrew

    2014-08-27

    Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled the crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzocyclooctyne-modified nanoparticles, via copper-free click chemistry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Full-length huntingtin levels modulate body weight by influencing insulin-like growth factor 1 expression

    Pouladi, Mahmoud A; Xie, Yuanyun; Skotte, Niels Henning

    2010-01-01

    of the IGF-1 pathway in mediating the effect of htt on body weight. IGF-1 expression was examined in transgenic mouse lines expressing different levels of FL wild-type (WT) htt (YAC18 mice), FL mutant htt (YAC128 and BACHD mice) and truncated mutant htt (shortstop mice). We demonstrate that htt influences...... body weight by modulating the IGF-1 pathway. Plasma IGF-1 levels correlate with body weight and htt levels in the transgenic YAC mice expressing human htt. The effect of htt on IGF-1 expression is independent of CAG size. No effect on body weight is observed in transgenic YAC mice expressing...... and decreases the body weight of YAC128 animals to WT levels. Furthermore, given the ubiquitous expression of IGF-1 within the central nervous system, we also examined the impact of FL htt levels on IGF-1 expression in different regions of the brain, including the striatum, cerebellum of YAC18, YAC128...

  14. FULL-LENGTH PEPTIDE ASSAY OF ANTIGENIC PROFILE OF ENVELOPE PROTEINS FROM SIBERIAN ISOLATES OF HEPATITIS C VIRUS

    A. A. Grazhdantseva

    2010-01-01

    Full Text Available Antigenic profiles of envelope glycoproteins of hepatitis C virus presented by three genotypes 1b, 2a/2c and 3a, which are most widespread in the territory of Russia and, in particular, in Novosibirsk, were studied using a panel of overlapping synthetic peptides. It was shown that highly immunogenic peptide epitopes of Е1 and Е2 proteins common for all HCV genotypes, are located in amino acid positions 250-260, 315-325 (Е1 protein, 390-400 (hypervariable region 1, 430-440, and 680-690 (Е2 protein. The greatest inter-genotypic differences were recorded in positions 280-290, 410-430 and 520-540. A novel antigenic determinant was detected in the region of aa 280-290 of the Е1 protein which was typical only for HCV 2a/2c genotype. A broad variation in the boundaries for the most epitopes suggests a high variability of the Е1 and Е2 viral proteins; however, a similar repertoire of antibodies induced by different HCV genotypes indicates to an opportunity of designing a new generation of cross-reactive HCV vaccines based on mapping of the E1 and E2 antigenic regions.

  15. Full-length genome sequence analysis of four subgroup J avian leukosis virus strains isolated from chickens with clinical hemangioma.

    Lin, Lulu; Wang, Peikun; Yang, Yongli; Li, Haijuan; Huang, Teng; Wei, Ping

    2017-12-01

    Since 2014, cases of hemangioma associated with avian leukosis virus subgroup J (ALV-J) have been emerging in commercial chickens in Guangxi. In this study, four strains of the subgroup J avian leukosis virus (ALV-J), named GX14HG01, GX14HG04, GX14LT07, and GX14ZS14, were isolated from chickens with clinical hemangioma in 2014 by DF-1 cell culture and then identified with ELISA detection of ALV group specific antigen p27, the detection of subtype specific PCR and indirect immunofluorescence assay (IFA) with ALV-J specific monoclonal antibody. The complete genomes of the isolates were sequenced and it was found that the gag and pol were relatively conservative, while env was variable especially the gp85 gene. Homology analysis of the env gene sequences showed that the env gene of all the four isolates had higher similarities with the hemangioma (HE)-type reference strains than that of the myeloid leukosis (ML)-type strains, and moreover, the HE-type strains' specific deletion of 205-bp sequence covering the rTM and DR1 in 3'UTR fragment was also found in the four isolates. Further analysis on the sequences of subunits of env gene revealed an interesting finding: the gp85 of isolates GX14ZS14 and GX14HG04 had a higher similarity with HPRS-103 and much lower similarity with the HE-type reference strains resulting in GX14ZS14, GX14HG04, and HPRS-103 being clustered in the same branch, while gp37 had higher similarities with the HE-type reference strains when compared to that of HPRS-103, resulted in GX14ZS14, GX14HG04, and HE-type reference strains being clustered in the same branch. The results suggested that isolates GX14ZS14 and GX14HG04 may be the recombinant strains of the foreign strain HPRS-103 with the local epidemic HE-type strains of ALV-J.

  16. Structural Study of the Partially Disordered Full-Length delta Subunit of RNA Polymerase from Bacillus subtilis

    Papoušková, V.; Kadeřávek, P.; Otrusinová, O.; Rabatinová, Alžběta; Šanderová, Hana; Nováček, J.; Krásný, Libor; Sklenář, V.; Žídek, L.

    2013-01-01

    Roč. 14, č. 14 (2013), s. 1772-1779 ISSN 1439-4227 R&D Projects: GA ČR GA204/09/0583; GA ČR GA13-16842S Institutional support: RVO:61388971 Keywords : NMR spectroscopy * partially disordered proteins * protein structures Subject RIV: CE - Biochemistry Impact factor: 3.060, year: 2013

  17. Construction of cold mass assembly for full-length dipoles for the SSC [Superconducting Super Collider] accelerator

    Dahl, P.; Cottingham, J.; Garber, M.

    1986-10-01

    Four of the initial six 17m long demonstration dipole magnets for the proposed Superconducting Super Collider have been constructed, and the first one is now being tested. This paper describes the magnet design and construction of the cold mass assembly. The magnets are cold iron (and cold bore) 1-in-1 dipoles, wound with partially keystoned current density-graded high homogeneity NbTi cable in a two-layer cos θ coil of 40 mm inner diameter. The magnetic length is 16.6 m. The coil is prestressed by 15 mm wide stainless steel collars, and mounted in a circular, split iron yoke of 267 mm outer diameter, supported by a cylindrical yoke (and helium) containment vessel of stainless steel. The magnet bore tube assembly incorporates superconducting sextupole trim coils produced by an industrial, automatic process akin to printed circuit fabrication

  18. Full length migration of plastic biliary stent into the left lobe of liver and its endoscopic retrieval

    Zubaidi, A.M.; Qureshi, L.A.; Haroon, E.E.

    2014-01-01

    An elderly female was admitted with obstructive jaundice, secondary to an impacted 1.7 cm size stone in distal CBD. Cholangiogram obtained during ERCP revealed dilated biliary system with large, immobile stone at the lower end of CBD. A large size sphincterotomy was performed and stone extraction using biliary balloon / dormia basket attempted which was unsuccessful as the stone was impacted in distal CBD. Therefore, a plastic biliary stent of 9 cm/8.5 french size was inserted successfully to secure the biliary drainage. Patient improved clinically and discharged home on ursodeoxycholic acid. Four weeks later, she presented to emergency department with signs of cholangitis. An emergency ERCP was performed. The stent had migrated up completely into the left intra hepatic duct. In this session, the stone was extracted and biliary drainage secured. Migrated stent was removed later on by another ERCP procedure. (author)

  19. Construction and expression of eukaryotic expression vectors of full-length, amino-terminus and carboxyl-terminus Raf gene

    Zhuomin WANG

    2008-06-01

    Full Text Available Background and objective Raf is a key molecule in the Ras-Raf-MEK-ERK signal transduction pathway and is highly activated in different human carcinomas. However, its biological functions and regulation mechanisms are still unclear. The aims of this study were to construct eukaryotic expression vectors with Raf full encoding region, truncated amino-terminus and carboxyl-terminus, respectively. Methods Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were constructed by gene recombination technique and confirmed by restriction enzyme analysis and DNA sequencing. Furthermore, the expression of these fusion proteins was detected by western blot in transient transfected 293T cells. Results The sequences and open reading frames of these three vectors were completely consistent with experimental design. All target proteins can be detected in 293T cells. Conclusion Eukaryotic expression vectors of pCMV-Tag2b-Raf-1, pCMV-Tag2b-N-Raf and pCMV-Tag2b-C-Raf were successfully constructed and can be expressed in 293T cells.

  20. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

    Misako Yajima

    2018-04-01

    Full Text Available Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

  1. Crystal structure of the vitamin B3 transporter PnuC, a full-length SWEET homolog

    Jähme, Michael; Guskov, Albert; Slotboom, Dirk Jan

    2014-01-01

    PnuC transporters catalyze cellular uptake of the NAD(+) precursor nicotinamide riboside (NR) and belong to a large superfamily that includes the SWEET sugar transporters. We present a crystal structure of Neisseria mucosa PnuC, which adopts a highly symmetrical fold with 3 + 1 + 3 membrane topology

  2. Molecular characterization of full-length MLV-related endogenous retrovirus ChiRV1 from the chicken, Gallus gallus

    Borysenko, L.; Stepanets, Volodymyr; Rynditch, A.V.

    2008-01-01

    Roč. 376, č. 1 (2008), s. 199-204 ISSN 0042-6822 Institutional research plan: CEZ:AV0Z50520514 Keywords : endogenous retrovirus * chicken * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.539, year: 2008

  3. A Comparison of the Psychometric Properties of the Psychopathic Personality Inventory Full-Length and Short-Form Versions

    Kastner, Rebecca M.; Sellbom, Martin; Lilienfeld, Scott O.

    2012-01-01

    The Psychopathic Personality Inventory (PPI) has shown promising construct validity as a measure of psychopathy. Because of its relative efficiency, a short-form version of the PPI (PPI-SF) was developed and has proven useful in many psychopathy studies. The validity of the PPI-SF, however, has not been thoroughly examined, and no studies have…

  4. De novo assembly and next-generation sequencing to analyse full-length gene variants from codon-barcoded libraries.

    Cho, Namjin; Hwang, Byungjin; Yoon, Jung-ki; Park, Sangun; Lee, Joongoo; Seo, Han Na; Lee, Jeewon; Huh, Sunghoon; Chung, Jinsoo; Bang, Duhee

    2015-09-21

    Interpreting epistatic interactions is crucial for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. Although high resolution mapping of en masse variant libraries renders molecular biologists to address genotype-phenotype relationships, long-read sequencing technology remains indispensable to assess functional relationship between mutations that lie far apart. Here, we introduce JigsawSeq for multiplexed sequence identification of pooled gene variant libraries by combining a codon-based molecular barcoding strategy and de novo assembly of short-read data. We first validate JigsawSeq on small sub-pools and observed high precision and recall at various experimental settings. With extensive simulations, we then apply JigsawSeq to large-scale gene variant libraries to show that our method can be reliably scaled using next-generation sequencing. JigsawSeq may serve as a rapid screening tool for functional genomics and offer the opportunity to explore evolutionary trajectories of protein variants.

  5. Minnelide Inhibits Androgen Dependent, Castration Resistant Prostate Cancer Growth by Decreasing Expression of Androgen Receptor Full Length and Splice Variants.

    Isharwal, Sumit; Modi, Shrey; Arora, Nivedita; Uhlrich, Charles; Giri, Bhuwan; Barlass, Usman; Soubra, Ayman; Chugh, Rohit; Dehm, Scott M; Dudeja, Vikas; Saluja, Ashok; Banerjee, Sulagna; Konety, Badrinath

    2017-05-01

    With almost 30,000 deaths per year, prostate cancer is the second-leading cause of cancer-related death in men. Androgen Deprivation Therapy (ADT) has been the corner stone of prostate cancer treatment for decades. However, despite an initial response of prostate cancer to ADT, this eventually fails and the tumors recur, resulting in Castration Resistant Prostate Cancer (CRPC). Triptolide, a diterpene triepoxide, has been tested for its anti-tumor properties in a number of cancers for over a decade. Owing to its poor solubility in aqueous medium, its clinical application had been limited. To circumvent this problem, we have synthesized a water-soluble pro-drug of triptolide, Minnelide, that is currently being evaluated in a Phase 1 clinical trial against gastrointestinal tumors. In the current study, we assessed the therapeutic potential of Minnelide and its active compound triptolide against androgen dependent prostate cancer both in vitro as well as in vivo. Cell viability was measured by a MTT based assay after treating prostate cancer cells with multiple doses of triptolide. Apoptotic cell death was measured using a caspase 3/7 activity. Androgen Receptor (AR) promoter-binding activity was evaluated by using luciferase reporter assay. For evaluating the effect in vivo, 22Rv1 cells were implanted subcutaneously in animals, following which, treatment was started with 0.21 mg/kg Minnelide. Our study showed that treatment with triptolide induced apoptotic cell death in CRPC cells. Triptolide treatment inhibited AR transcriptional activity and decreased the expression of AR and its splice variants both at the mRNA and the protein level. Our studies show that triptolide inhibits nuclear translocation of Sp1, resulting in its decreased transcriptional activity leading to downregulation of AR and its splice variants in prostate cancer cells. In vivo, Minnelide (0.21 mg/kg) regressed subcutaneous tumors derived from CRPC 22RV1 at our study endpoint. Our animal studies further confirmed that Minnelide was more efficacious than the standard of care therapies, Docetaxel and Enzalutamide. Our study indicates that Minnelide is very effective as a therapeutic option against CRPC at a dose that is currently tolerated by patients in the ongoing clinical trials. Prostate 77: 584-596, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  6. Identification of full-length transmitted/founder viruses and their progeny in primary HIV-1 infection

    Korber, Bette [Los Alamos National Laboratory; Hraber, Peter [Los Alamos National Laboratory; Giorgi, Elena [Los Alamos National Laboratory; Bhattacharya, T [Los Alamos National Laboratory

    2009-01-01

    Identification of transmitted/founder virus genomes and their progeny by is a novel strategy for probing the molecular basis of HIV-1 transmission and for evaluating the genetic imprint of viral and host factors that act to constrain or facilitate virus replication. Here, we show in a cohort of twelve acutely infected subjects (9 clade B; 3 clade C), that complete genomic sequences of transmitted/founder viruses could be inferred using single genome amplification of plasma viral RNA, direct amplicon sequencing, and a model of random virus evolution. This allowed for the precise identification, chemical synthesis, molecular cloning, and biological analysis of those viruses actually responsible for productive clinical infection and for a comprehensive mapping of sequential viral genomes and proteomes for mutations that are necessary or incidental to the establishment of HIV-1 persistence. Transmitted/founder viruses were CD4 and CCR5 tropic, replicated preferentially in activated primary T-Iymphocytes but not monocyte-derived macrophages, and were effectively shielded from most heterologous or broadly neutralizing antibodies. By 3 months of infection, the evolving viral quasispecies in three subjects showed mutational fixation at only 2-5 discreet genomic loci. By 6-12 months, mutational fixation was evident at 18-27 genomic loci. Some, but not all, of these mutations were attributable to virus escape from cytotoxic Tlymphocytes or neutralizing antibodies, suggesting that other viral or host factors may influence early HIV -1 fitness.

  7. 78 FR 13071 - Guidance for Industry: Implementation of an Acceptable Full-Length and Abbreviated Donor History...

    2013-02-26

    ... 20852- 1448. Send one self-addressed adhesive label to assist the office in processing your requests... of Dockets Management (HFA-305), Food and Drug Administration, 5630 Fishers Lane, rm. 1061, Rockville...

  8. Full-length U-xPu-10Zr (x = 0, 8, 19 wt.%) fast reactor fuel test in FFTF

    Porter, D.L., E-mail: Douglas.Porter@inl.gov [Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415-6188 (United States); Tsai Hanchung [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439-4803 (United States)

    2012-08-15

    The Integral Fast Reactor-1 (IFR-1) experiment performed in the Fast Flux Test Facility (FFTF) was the only U-Pu-10Zr (Pu-0, 8 and 19 wt.%) metallic fast reactor test with commercial-length (91.4-cm active fuel-column length) conducted to date. With few remaining test reactors, there is little opportunity for performing another test with a long active fuel column. The assembly was irradiated to the goal burnup of 10 at.%. The beginning-of-life (BOL) peak cladding temperature of the hottest pin was 608 Degree-Sign C, cooling to 522 Degree-Sign C at end-of-life (EOL). Selected fuel pins were examined non-destructively using neutron radiography, precision axial gamma scanning, and both laser and spiral contact cladding profilometry. Destructive exams included plenum gas pressure, volume, and gas composition determinations on a number of pins followed by optical metallography, electron probe microanalysis (EPMA), and alpha and beta-gamma autoradiography on a single U-19Pu-10Zr pin. The post-irradiation examinations (PIEs) showed very few differences compared to the short-pin (34.3-cm fuel column) testing performed on fuels of similar composition in Experimental Breeder Reactor-II (EBR-II). The fuel column grew axially slightly less than observed in the short pins, but with the same pattern of decreasing growth with increasing Pu content. There was a difference in the fuel-cladding chemical interaction (FCCI) in that the maximum cladding penetration by interdiffusion with fuel/fission products did not occur at the top of the fuel column where the cladding temperature is highest, as observed in EBR-II tests. Instead, the more exaggerated fission-rate profile of the FFTF pins resulted in a peak FCCI at {approx}0.7 X/L axial location along the fuel column. This resulted from a higher production of rare-earth fission products at this location and a higher {Delta}T between fuel center and cladding than at core center, together providing more rare earths at the cladding and more FCCI. This behavior could actually help extend the life of a fuel pin in a 'long pin' reactor design to a higher peak fuel burnup.

  9. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  10. Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

    Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

    2018-04-03

    Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

  11. Full-length fibronectin drives fibroblast accumulation at the surface of collagen microtissues during cell-induced tissue morphogenesis

    Foolen, J.; Shiu, J.-Y.; Mitsi, M.; Zhang, Y.; Chen, C.; Vogel, Viola

    2016-01-01

    Generating and maintaining gradients of cell density and extracellular matrix (ECM) components is a prerequisite for the development of functionality of healthy tissue. Therefore, gaining insights into the drivers of spatial organization of cells and the role of ECM during tissue morphogenesis is

  12. Full-length genomic sequence of hepatitis B virus genotype C2 isolated from a native Brazilian patient

    Mónica Viviana Alvarado-Mora

    2011-06-01

    Full Text Available The hepatitis B virus (HBV is among the leading causes of chronic hepatitis, cirrhosis and hepatocellular carcinoma. In Brazil, genotype A is the most frequent, followed by genotypes D and F. Genotypes B and C are found in Brazil exclusively among Asian patients and their descendants. The aim of this study was to sequence the entire HBV genome of a Caucasian patient infected with HBV/C2 and to infer the origin of the virus based on sequencing analysis. The sequence of this Brazilian isolate was grouped with four other sequences described in China. The sequence of this patient is the first complete genome of HBV/C2 reported in Brazil.

  13. Antibody responses to the full-length VAR2CSA and its DBL domains in Cameroonian children and teenagers

    Fodjo, Barriere A Y; Atemnkeng, Njika; Esemu, Livo

    2016-01-01

    villages and 160 children with severe malaria from the city.  Results: Low Ab levels to VAR2CSA were detected in children; however, Ab levels to FV2 in teenagers were rare. Children preferentially recognized DBL2 (56-70%) and DBL4 (50-60%), while multigravidae produced high levels of IgG to DBL3, DBL5...... and FV2. Sixty-seven percent of teenage girls (n = 16/24) recognized ID1-ID2a region of VAR2CSA. Children with severe forms of malaria had significantly higher IgG to merozoite antigens (all p 0.05) when compared to the healthy children.  Conclusion: The study...... suggests that children, including teenage girls acquire Ab to VAR2CSA domains and FV2, but Ab levels are much lower than those needed to protect women from placental infections and repertoire of Ab responses to DBL domains is different from those in pregnant women. Interestingly, children with severe...

  14. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

    Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

    2017-01-01

    To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae . Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae . Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  15. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  16. Recombination events and variability among full-length genomes of co-circulating molluscum contagiosum virus subtypes 1 and 2.

    López-Bueno, Alberto; Parras-Moltó, Marcos; López-Barrantes, Olivia; Belda, Sylvia; Alejo, Alí

    2017-05-01

    Molluscum contagiosum virus (MCV) is the sole member of the Molluscipoxvirus genus and causes a highly prevalent human disease of the skin characterized by the formation of a variable number of lesions that can persist for prolonged periods of time. Two major genotypes, subtype 1 and subtype 2, are recognized, although currently only a single complete genomic sequence corresponding to MCV subtype 1 is available. Using next-generation sequencing techniques, we report the complete genomic sequence of four new MCV isolates, including the first one derived from a subtype 2. Comparisons suggest a relatively distant evolutionary split between both MCV subtypes. Further, our data illustrate concurrent circulation of distinct viruses within a population and reveal the existence of recombination events among them. These results help identify a set of MCV genes with potentially relevant roles in molluscum contagiosum epidemiology and pathogenesis.

  17. Sonic hedgehog-dependent induction of microRNA 31 and microRNA 150 regulates Mycobacterium bovis BCG-driven toll-like receptor 2 signaling.

    Ghorpade, Devram Sampat; Holla, Sahana; Kaveri, Srini V; Bayry, Jagadeesh; Patil, Shripad A; Balaji, Kithiganahalli Narayanaswamy

    2013-02-01

    Hedgehog (HH) signaling is a significant regulator of cell fate decisions during embryogenesis, development, and perpetuation of various disease conditions. Testing whether pathogen-specific HH signaling promotes unique innate recognition of intracellular bacteria, we demonstrate that among diverse Gram-positive or Gram-negative microbes, Mycobacterium bovis BCG, a vaccine strain, elicits a robust activation of Sonic HH (SHH) signaling in macrophages. Interestingly, sustained tumor necrosis factor alpha (TNF-α) secretion by macrophages was essential for robust SHH activation, as TNF-α(-/-) macrophages exhibited compromised ability to activate SHH signaling. Neutralization of TNF-α or blockade of TNF-α receptor signaling significantly reduced the infection-induced SHH signaling activation both in vitro and in vivo. Intriguingly, activated SHH signaling downregulated M. bovis BCG-mediated Toll-like receptor 2 (TLR2) signaling events to regulate a battery of genes associated with divergent functions of M1/M2 macrophages. Genome-wide expression profiling as well as conventional gain-of-function or loss-of-function analysis showed that SHH signaling-responsive microRNA 31 (miR-31) and miR-150 target MyD88, an adaptor protein of TLR2 signaling, thus leading to suppression of TLR2 responses. SHH signaling signatures could be detected in vivo in tuberculosis patients and M. bovis BCG-challenged mice. Collectively, these investigations identify SHH signaling to be what we believe is one of the significant regulators of host-pathogen interactions.

  18. Purification of MUC1 from Bovine Milk-Fat Globules and Characterization of a Corresponding Full-Length cDNA Clone

    Pallesen, Lone Tjener; Andersen, Mikkel Holmen; Nielsen, Rune

    2001-01-01

    acid sequences obtained by peptide mapping. The complete amino acid sequence of MUC1 was determined by cloning and sequencing the corresponding bovine mammary gland cDNA, which was shown to encode a protein of 580 amino acid residues comprising a cleavable signal peptide of 22 residues. The deduced...

  19. Full-length human placental sFlt-1-e15a isoform induces distinct maternal phenotypes of preeclampsia in mice.

    Gabor Szalai

    Full Text Available Most anti-angiogenic preeclampsia models in rodents utilized the overexpression of a truncated soluble fms-like tyrosine kinase-1 (sFlt-1 not expressed in any species. Other limitations of mouse preeclampsia models included stressful blood pressure measurements and the lack of postpartum monitoring. We aimed to 1 develop a mouse model of preeclampsia by administering the most abundant human placental sFlt-1 isoform (hsFlt-1-e15a in preeclampsia; 2 determine blood pressures in non-stressed conditions; and 3 develop a survival surgery that enables the collection of fetuses and placentas and postpartum (PP monitoring.Pregnancy status of CD-1 mice was evaluated with high-frequency ultrasound on gestational days (GD 6 and 7. Telemetry catheters were implanted in the carotid artery on GD7, and their positions were verified by ultrasound on GD13. Mice were injected through tail-vein with adenoviruses expressing hsFlt-1-e15a (n = 11 or green fluorescent protein (GFP; n = 9 on GD8/GD11. Placentas and pups were delivered by cesarean section on GD18 allowing PP monitoring. Urine samples were collected with cystocentesis on GD6/GD7, GD13, GD18, and PPD8, and albumin/creatinine ratios were determined. GFP and hsFlt-1-e15a expression profiles were determined by qRT-PCR. Aortic ring assays were performed to assess the effect of hsFlt-1-e15a on endothelia.Ultrasound predicted pregnancy on GD7 in 97% of cases. Cesarean section survival rate was 100%. Mean arterial blood pressure was higher in hsFlt-1-e15a-treated than in GFP-treated mice (∆MAP = 13.2 mmHg, p = 0.00107; GD18. Focal glomerular changes were found in hsFlt-1-e15a -treated mice, which had higher urine albumin/creatinine ratios than controls (109.3 ± 51.7 μg/mg vs. 19.3 ± 5.6 μg/mg, p = 4.4 x 10(-2; GD18. Aortic ring assays showed a 46% lesser microvessel outgrowth in hsFlt-1-e15a-treated than in GFP-treated mice (p = 1.2 x 10(-2. Placental and fetal weights did not differ between the groups. One mouse with liver disease developed early-onset preeclampsia-like symptoms with intrauterine growth restriction (IUGR.A mouse model of late-onset preeclampsia was developed with the overexpression of hsFlt-1-e15a, verifying the in vivo pathologic effects of this primate-specific, predominant placental sFlt-1 isoform. HsFlt-1-e15a induced early-onset preeclampsia-like symptoms associated with IUGR in a mouse with a liver disease. Our findings support that hsFlt-1-e15a is central to the terminal pathway of preeclampsia, and it can induce the full spectrum of symptoms in this obstetrical syndrome.

  20. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    Phillip R. Myer

    2016-09-01

    Full Text Available Amplicon sequencing utilizing next-generation platforms has significantly transformed how research is conducted, specifically microbial ecology. However, primer and sequencing platform biases can confound or change the way scientists interpret these data. The Pacific Biosciences RSII instrument may also preferentially load smaller fragments, which may also be a function of PCR product exhaustion during sequencing. To further examine theses biases, data is provided from 16S rRNA rumen community analyses. Specifically, data from the relative phylum-level abundances for the ruminal bacterial community are provided to determine between-sample variability. Direct sequencing of metagenomic DNA was conducted to circumvent primer-associated biases in 16S rRNA reads and rarefaction curves were generated to demonstrate adequate coverage of each amplicon. PCR products were also subjected to reduced amplification and pooling to reduce the likelihood of PCR product exhaustion during sequencing on the Pacific Biosciences platform. The taxonomic profiles for the relative phylum-level and genus-level abundance of rumen microbiota as a function of PCR pooling for sequencing on the Pacific Biosciences RSII platform were provided. For more information, see “Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers” P.R. Myer, M. Kim, H.C. Freetly, T.P.L. Smith (2016 [1]. Keywords: 16S rRNA gene, MiSeq, Pacific Biosciences, Rumen microbiome

  1. Generation of a vector system facilitating cloning of DMBT1 variants and recombinant expression of functional full-length DMBT1

    End, Caroline; Lyer, Stefan; Renner, Marcus

    2005-01-01

    of a vector system that facilitates cloning of DMBT1 variants. We demonstrate applicability of the vector system by expression of the largest DMBT1 variant in a tetracycline-inducible mammalian expression system using the Chinese hamster ovary cell line. Yields up to 30 mg rDMBT1 per litre of cell culture......Deleted in malignant brain tumours 1 (DMBT1) codes for a approximately 340kDa glycoprotein with highly repetitive scavenger receptor cysteine-rich (SRCR) domains. DMBT1 was implicated in cancer, defence against viral and bacterial infections, and differentiation of epithelial cells. Recombinant...... yields, and protein preparations which may substantially vary due to differential processing and genetic polymorphism, all of which impedes functional research on DMBT1. Cloning of DMBT1 cDNAs is hampered because of the size and the 13 highly homologous SRCR exons. In this study, we report on the setup...

  2. Full-length soluble CD147 promotes MMP-2 expression and is a potential serological marker in detection of hepatocellular carcinoma

    Wu, Jiao; Hao, Zhi-Wei; Zhao, You-Xu; Yang, Xiang-Min; Tang, Hao; Zhang, Xin; Song, Fei; Sun, Xiu-Xuan; Wang, Bin; Nan, Gang; Chen, Zhi-Nan; Bian, Huijie

    2014-01-01

    Background As a surface glycoprotein, CD147 is capable of stimulating the production of matrix metalloproteinases (MMPs) from neighboring fibroblasts. The aim of the present study is to explore the role of soluble CD147 on MMPs secretion from hepatocellular carcinoma (HCC) cells, and to investigate the diagnostic value of serum soluble CD147 in the HCC detection. Methods We identified the form of soluble CD147 in cell culture supernate of HCC cells and serum of patients with HCC, and explored...

  3. Murine polyomavirus virus-like particles carrying full-length human PSA protect BALB/c mice from outgrowth of a PSA expressing tumor.

    Mathilda Eriksson

    Full Text Available Virus-like particles (VLPs consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV VLPs carrying the entire human Prostate Specific Antigen (PSA (PSA-MPyVLPs for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs. Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4(+ and CD8(+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4(+ and CD8(+ cells with a low induction of anti-VLP antibodies.

  4. The numeracy test workbook everything you need for a successful programme of self study including quick tests and full-length realistic mock-ups

    Bryon, Mike

    2011-01-01

    One of the most common types of psychometric test used in assessment and selection procedures, The Numeracy Test Workbook provides practice questions and mock tests designed to build confidence and improve performance.

  5. Secretion of full-length Tau or Tau fragments in cell culture models. Propagation of Tau in vivo and in vitro.

    Pérez, Mar; Medina, Miguel; Hernández, Félix; Avila, Jesús

    2018-03-05

    The microtubule-associated protein Tau plays a crucial role in stabilizing neuronal microtubules. In Tauopathies, Tau loses its ability to bind microtubules, detach from them and forms intracellular aggregates. Increasing evidence in recent years supports the notion that Tau pathology spreading throughout the brain in AD and other Tauopathies is the consequence of the propagation of specific Tau species along neuroanatomically connected brain regions in a so-called "prion-like" manner. A number of steps are assumed to be involved in this process, including secretion, cellular uptake, transcellular transfer and/or seeding, although the precise mechanisms underlying propagation of Tau pathology are not fully understood yet. This review summarizes recent evidence on the nature of the specific Tau species that are propagated and the different mechanisms of Tau pathology spreading.

  6. Proteome analysis of liver cells expressing a full-length hepatitis C virus (HCV) replicon and biopsy specimens of posttransplantation liver from HCV-infected patients

    Jacobs, J. M.; Diamond, D. L.; Chan, E. Y.; Gritsenko, M. A.; Qian, W.; Šťastná, Miroslava; Baas, T.; Camp II, D. G .H.; Carithers Jr., R. L.; Smith, R. D.; Katze, M. G.

    2005-01-01

    Roč. 79, č. 12 (2005), s. 7558-7569 ISSN 0022-538X Institutional research plan: CEZ:AV0Z40310501 Keywords : proteome analysis * hepatitis C Virus * mass spectrometry Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 5.178, year: 2005

  7. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  8. Detection, molecular characterization and phylogenetic analysis of full-length equine infectious anemia (EIAV) gag genes isolated from Shackleford Banks wild horses.

    Capomaccio, S; Willand, Z A; Cook, S J; Issel, C J; Santos, E M; Reis, J K P; Cook, R F

    2012-06-15

    The genetically distinct wild horse herds inhabiting Shackleford Banks, North Carolina are probably the direct descendents of Spanish stock abandoned after failed attempts to settle mid-Atlantic coastal regions of North America in the Sixteenth Century. In a 1996 island survey, 41% of the gathered horses were discovered seropositive for Equine Infectious Anemia Virus (EIAV) with additional cases identified in 1997 and 1998. As a result of their unique genetic heritage, EIAV seropositive individuals identified in the two latter surveys were transferred to a quarantine facility on the mainland. In September 2008 two of the horses SB1 and SB2 after 10 and 11 years in quarantine respectively, developed clinical signs of EIA. In the case of SB2 these were so severe that the only humane option was euthanasia. Although SB1, survived it experienced a second clinical episode one month later. In May 2009, a third horse in quarantine, SB3, developed extremely severe clinical EIA and was euthanized. This demonstrates naturally infected long-term inapparent carriers can experience recrudescence of very severe disease many years after initial exposure to EIAV. Phylogenetic analysis of complete EIAV gag gene sequences obtained from each of three Shackleford horses demonstrated they were infected with very closely related viruses. Although these were distinguishable from all other strains examined, they belong to a monophyletic group comprising almost exclusively of New World isolates that is distinct from a number of recently characterized Central European EIAV strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Low-Resolution Structure of the Full-Length Barley (Hordeum vulgare) SGT1 Protein in Solution, Obtained Using Small-Angle X-Ray Scattering

    Taube, Michał; Pieńkowska, Joanna R.; Jarmołowski, Artur; Kozak, Maciej

    2014-01-01

    SGT1 is an evolutionarily conserved eukaryotic protein involved in many important cellular processes. In plants, SGT1 is involved in resistance to disease. In a low ionic strength environment, the SGT1 protein tends to form dimers. The protein consists of three structurally independent domains (the tetratricopeptide repeats domain (TPR), the CHORD- and SGT1-containing domain (CS), and the SGT1-specific domain (SGS)), and two less conserved variable regions (VR1 and VR2). In the present study, we provide the low-resolution structure of the barley (Hordeum vulgare) SGT1 protein in solution and its dimer/monomer equilibrium using small-angle scattering of synchrotron radiation, ab-initio modeling and circular dichroism spectroscopy. The multivariate curve resolution least-square method (MCR-ALS) was applied to separate the scattering data of the monomeric and dimeric species from a complex mixture. The models of the barley SGT1 dimer and monomer were formulated using rigid body modeling with ab-initio structure prediction. Both oligomeric forms of barley SGT1 have elongated shapes with unfolded inter-domain regions. Circular dichroism spectroscopy confirmed that the barley SGT1 protein had a modular architecture, with an α-helical TPR domain, a β-sheet sandwich CS domain, and a disordered SGS domain separated by VR1 and VR2 regions. Using molecular docking and ab-initio protein structure prediction, a model of dimerization of the TPR domains was proposed. PMID:24714665

  10. Heterologous expression of full-length capsid protein of porcine circovirus 2 in Escherichia coli and its potential use for detection of antibodies

    Marčeková, Zuzana; Psikal, P.; Kosinová, E.; Benada, Oldřich; Šebo, Peter; Bumba, Ladislav

    2009-01-01

    Roč. 162, 1-2 (2009), s. 133-141 ISSN 0166-0934 R&D Projects: GA ČR GP310/07/P115; GA MŠk 2B06161 Institutional research plan: CEZ:AV0Z50200510 Keywords : PCV 2 * Porcine circovirus * Capsid protein Subject RIV: EE - Microbiology, Virology Impact factor: 2.133, year: 2009

  11. Full Length Article Role of glypican-3 immunocytochemistry in differentiating hepatocellular carcinoma from metastatic carcinoma of the liver utilizing fine needle aspiration cytology

    Zaakook, M.; Abu Sinna, E.; Ayoub, M.; El-Sheikh, S.

    2013-01-01

    Purpose: Evaluation of the sensitivity and specificity of glypican3 (GPC3) in differentiating hepatocellular carcinoma (HCC) from metastatic carcinomas of the liver in cell block material. Patients and methods: Sixty cell blocks were prepared from liver FNAs performed in the radiodiagnosis department, National Cancer Institute, in the period between August 2011 and May 2012. Cases diagnosed as hepatocellular carcinoma, or metastatic carcinoma were included in the study. Cell block sections were stained with anti GPC-3. Sensitivity, specificity, and positive and negative predictive values, of GPC3 were calculated. The final diagnosis was based on the triple approach of clinical data, radiological findings, as well as cytomorphologic features aided by GPC-3 results. Results: 70% of cases were diagnosed as HCC, and 30% as metastatic carcinomas. 95.2% of HCC cases expressed GPC3. Poorly differentiated cases showed the highest GPC3 sensitivity (100%), followed by moderately differentiated cases (96.5%), while well differentiated cases expressed GPC3 in 90% of cases. 83.3% of metastatic carcinomas were negative for GPC3. In this study, sensitivity of GPC-3 in HCC was 95.2%, specificity was 83.3%, positive and negative predictive values were 93% and 88.2% respectively, and total accuracy was 91.7%. Conclusion: Immunocytochemical staining for GPC3 in cell block material is a highly sensitive and specific method capable of distinguishing HCC from the vast majority of metastatic carcinomas of the liver

  12. Gene expression of a truncated and the full-length growth hormone (GH) receptor in subcutaneous fat and skeletal muscle in GH-deficient adults

    Fisker, Sidse; Kristensen, K; Rosenfalck, A M

    2001-01-01

    the relationship of circulating GHBP and body composition to GHR and GHRtr gene expression. Eleven adult GH-deficient patients were studied before and after 4 months of GH substitution therapy. Abdominal fat obtained by liposuction and femoral muscle biopsies were taken at baseline and after 4 months. Gene...... expression of GHR and GHRtr in adipose tissue and skeletal muscle was determined and expressed relative to the expression of beta-actin. Gene expression of GHR in abdominal sc adipose tissue was not altered, whereas the expression of GHRtr increased significantly. In skeletal muscle inverse changes were seen...... in the expression of messenger ribonucleic acid (mRNA) levels for the two GH receptor forms: expression of GHR increased significantly, whereas mRNA levels for GHRtr decreased. As expected, body composition changed with reduction of body fat mass after 4 months of GH treatment. Levels of circulating GHBP decreased...

  13. Full-length cloning and phylogenetic analyses of translationally controlled tumour protein and ferritin genes from the Indian white prawn, Fenneropenaeus indicus (H. Milne Edwards)

    Nayak, S.; Ramaiah, N.; Meena, R.M.; Sreepada, R.A.

    -length sequences of these immune-relevant genes, this study highlighted their conserved natures, which perhaps make them important defence-related proteins in the innate immune system of F. indicus....

  14. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Zhijun Zhong

    2014-07-01

    Full Text Available Canine parvovirus 2 (CPV-2 was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04% encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China.

  15. First Isolation of New Canine Parvovirus 2a from Tibetan Mastiff and Global Analysis of the Full-Length VP2 Gene of Canine Parvoviruses 2 in China

    Zhong, Zhijun; Liang, Luqi; Zhao, Juan; Xu, Xiaoyang; Cao, Xuefeng; Liu, Xuehan; Zhou, Ziyao; Ren, Zhihua; Shen, Liuhong; Geng, Yi; Gu, Xiaobin; Peng, Guangneng

    2014-01-01

    Canine parvovirus 2 (CPV-2) was first identified in 1978, and is responsible for classic parvoviral enteritis. Despite the widespread vaccination of domestic carnivores, CPVs have remained important pathogens of domestic and wild carnivores. In this study, we isolated CPV-2 from Tibetan mastiffs and performed a global analysis of the complete VP2 gene sequences of CPV-2 strains in China. Six isolates were typed as new CPV-2a, according to key amino acid positions. On a phylogenetic tree, these six sequences formed a distinct clade. Five isolates occurred on the same branch as KF785794 from China and GQ379049 from Thailand; CPV-LS-ZA1 formed a separate subgroup with FJ435347 from China. One hundred ninety-eight sequences from various parts of China and the six sequences isolated here formed seven distinct clusters, indicating the high diversity of CPVs in China. Of 204 VP2 sequences, 183 (91.04%) encoded the mutation Ser297Ala, regardless of the antigenic type, implying that most Chinese CPV-2 strains contain the VP2 mutation Ser297Ala. However, the biological significance of this change from prototype CPV-2a/2b to new CPV-2a/2b types remains unclear. This study is the first to isolate new CPV-2a from the Tibetan mastiff. Our data show that new CPV-2a/2b variants are now circulating in China. PMID:25007818

  16. The N-terminal domain plays a crucial role in the structure of a full-length human mitochondrial Lon protease

    Kereiche, S.; Kováčik, L.; Bednár, J.; Pevala, V.; Kunová, N.; Ondrovičová, G.; Bauer, J.; Ambro, L.; Bellová, J.; Kutejová, Eva; Raška, I.

    2016-01-01

    Roč. 6, SEP 16 (2016), s. 33631 ISSN 2045-2322 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ESCHERICHIA-COLI LON * SUBSTRATE TRANSLOCATION * PROTEOLYTIC MACHINE Subject RIV: EE - Microbiology, Virology Impact factor: 4.259, year: 2016

  17. Full-length recombinant Plasmodium falciparum VAR2CSA binds specifically to CSPG and induces potent parasite adhesion blocking antibodies

    Khunrae, Pongsak; Dahlbäck, Madeleine; Nielsen, Morten A

    2010-01-01

    in the pathogenesis of severe P. falciparum infection. In pregnant women the parasites express a single and unique member of the PfEMP1 family named VAR2CSA, which is associated with the ability of the infected erythrocytes to adhere specifically to chondroitin sulphate A (CSA) in the placenta. Several DBL domains......Plasmodium falciparum malaria remains one of the world's leading causes of human suffering and poverty. Each year, the disease takes 1-3 million lives, mainly in sub-Saharan Africa. The adhesion of parasite-infected erythrocytes to the vascular endothelium or the placenta is the key event...

  18. Murine Polyomavirus Virus-Like Particles Carrying Full-Length Human PSA Protect BALB/c Mice from Outgrowth of a PSA Expressing Tumor

    Eriksson, Mathilda; Andreasson, Kalle; Weidmann, Joachim; Lundberg, Kajsa; Tegerstedt, Karin

    2011-01-01

    Virus-like particles (VLPs) consist of capsid proteins from viruses and have been shown to be usable as carriers of protein and peptide antigens for immune therapy. In this study, we have produced and assayed murine polyomavirus (MPyV) VLPs carrying the entire human Prostate Specific Antigen (PSA) (PSA-MPyVLPs) for their potential use for immune therapy in a mouse model system. BALB/c mice immunized with PSA-MPyVLPs were only marginally protected against outgrowth of a PSA-expressing tumor. To improve protection, PSA-MPyVLPs were co-injected with adjuvant CpG, either alone or loaded onto murine dendritic cells (DCs). Immunization with PSA-MPyVLPs loaded onto DCs in the presence of CpG was shown to efficiently protect mice from tumor outgrowth. In addition, cellular and humoral immune responses after immunization were examined. PSA-specific CD4+ and CD8+ cells were demonstrated, but no PSA-specific IgG antibodies. Vaccination with DCs loaded with PSA-MPyVLPs induced an eight-fold lower titre of anti-VLP antibodies than vaccination with PSA-MPyVLPs alone. In conclusion, immunization of BALB/c mice with PSA-MPyVLPs, loaded onto DCs and co-injected with CpG, induces an efficient PSA-specific tumor protective immune response, including both CD4+ and CD8+ cells with a low induction of anti-VLP antibodies. PMID:21858228

  19. Full-Length Human Placental sFlt-1-e15a Isoform Induces Distinct Maternal Phenotypes of Preeclampsia in Mice

    Szalai, Gabor; Romero, Roberto; Chaiworapongsa, Tinnakorn; Xu, Yi; Wang, Bing; Ahn, Hyunyoung; Xu, Zhonghui; Chiang, Po Jen; Sundell, Birgitta; Wang, Rona; Jiang, Yang; Plazyo, Olesya; Olive, Mary; Tarca, Adi L.; Dong, Zhong; Qureshi, Faisal; Papp, Zoltan; Hassan, Sonia S.; Hernandez-Andrade, Edgar; Than, Nandor Gabor

    2015-01-01

    Objective Most anti-angiogenic preeclampsia models in rodents utilized the overexpression of a truncated soluble fms-like tyrosine kinase-1 (sFlt-1) not expressed in any species. Other limitations of mouse preeclampsia models included stressful blood pressure measurements and the lack of postpartum monitoring. We aimed to 1) develop a mouse model of preeclampsia by administering the most abundant human placental sFlt-1 isoform (hsFlt-1-e15a) in preeclampsia; 2) determine blood pressures in non-stressed conditions; and 3) develop a survival surgery that enables the collection of fetuses and placentas and postpartum (PP) monitoring. Methods Pregnancy status of CD-1 mice was evaluated with high-frequency ultrasound on gestational days (GD) 6 and 7. Telemetry catheters were implanted in the carotid artery on GD7, and their positions were verified by ultrasound on GD13. Mice were injected through tail-vein with adenoviruses expressing hsFlt-1-e15a (n = 11) or green fluorescent protein (GFP; n = 9) on GD8/GD11. Placentas and pups were delivered by cesarean section on GD18 allowing PP monitoring. Urine samples were collected with cystocentesis on GD6/GD7, GD13, GD18, and PPD8, and albumin/creatinine ratios were determined. GFP and hsFlt-1-e15a expression profiles were determined by qRT-PCR. Aortic ring assays were performed to assess the effect of hsFlt-1-e15a on endothelia. Results Ultrasound predicted pregnancy on GD7 in 97% of cases. Cesarean section survival rate was 100%. Mean arterial blood pressure was higher in hsFlt-1-e15a-treated than in GFP-treated mice (∆MAP = 13.2 mmHg, p = 0.00107; GD18). Focal glomerular changes were found in hsFlt-1-e15a -treated mice, which had higher urine albumin/creatinine ratios than controls (109.3±51.7μg/mg vs. 19.3±5.6μg/mg, p = 4.4x10-2; GD18). Aortic ring assays showed a 46% lesser microvessel outgrowth in hsFlt-1-e15a-treated than in GFP-treated mice (p = 1.2x10-2). Placental and fetal weights did not differ between the groups. One mouse with liver disease developed early-onset preeclampsia-like symptoms with intrauterine growth restriction (IUGR). Conclusions A mouse model of late-onset preeclampsia was developed with the overexpression of hsFlt-1-e15a, verifying the in vivo pathologic effects of this primate-specific, predominant placental sFlt-1 isoform. HsFlt-1-e15a induced early-onset preeclampsia-like symptoms associated with IUGR in a mouse with a liver disease. Our findings support that hsFlt-1-e15a is central to the terminal pathway of preeclampsia, and it can induce the full spectrum of symptoms in this obstetrical syndrome. PMID:25860260

  20. A Genetic Screen Reveals that Synthesis of 1,4-Dihydroxy-2-Naphthoate (DHNA), but Not Full-Length Menaquinone, Is Required for Listeria monocytogenes Cytosolic Survival.

    Chen, Grischa Y; McDougal, Courtney E; D'Antonio, Marc A; Portman, Jonathan L; Sauer, John-Demian

    2017-03-21

    Through unknown mechanisms, the host cytosol restricts bacterial colonization; therefore, only professional cytosolic pathogens are adapted to colonize this host environment. Listeria monocytogenes is a Gram-positive intracellular pathogen that is highly adapted to colonize the cytosol of both phagocytic and nonphagocytic cells. To identify L. monocytogenes determinants of cytosolic survival, we designed and executed a novel screen to isolate L. monocytogenes mutants with cytosolic survival defects. Multiple mutants identified in the screen were defective for synthesis of menaquinone (MK), an essential molecule in the electron transport chain. Analysis of an extensive set of MK biosynthesis and respiratory chain mutants revealed that cellular respiration was not required for cytosolic survival of L. monocytogenes but that, instead, synthesis of 1,4-dihydroxy-2-naphthoate (DHNA), an MK biosynthesis intermediate, was essential. Recent discoveries showed that modulation of the central metabolism of both host and pathogen can influence the outcome of host-pathogen interactions. Our results identify a potentially novel function of the MK biosynthetic intermediate DHNA and specifically highlight how L. monocytogenes metabolic adaptations promote cytosolic survival and evasion of host immunity. IMPORTANCE Cytosolic bacterial pathogens, such as Listeria monocytogenes and Francisella tularensis , are exquisitely evolved to colonize the host cytosol in a variety of cell types. Establishing an intracellular niche shields these pathogens from effectors of humoral immunity, grants access to host nutrients, and is essential for pathogenesis. Through yet-to-be-defined mechanisms, the host cytosol restricts replication of non-cytosol-adapted bacteria, likely through a combination of cell autonomous defenses (CADs) and nutritional immunity. Utilizing a novel genetic screen, we identified determinants of L. monocytogenes cytosolic survival and virulence and identified a role for the synthesis of the menaquinone precursor 1,4-dihydroxy-2-naphthoate (DHNA) in cytosolic survival. Together, these data begin to elucidate adaptations that allow cytosolic pathogens to survive in their intracellular niches. Copyright © 2017 Chen et al.

  1. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Alvarez, Rene; Seal, Bruce S

    2005-01-01

    Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the Paramyxoviridae. Genomic sequence analyses of related members of the Pneumovirinae other than aMPV, including human respiratory syncytial virus and bovine respiratory syncytial virus demonstrated the presence of this second potential ORF among these agents. PMID:15826312

  2. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Alvarez Rene

    2005-04-01

    Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the Paramyxoviridae. Genomic sequence analyses of related members of the Pneumovirinae other than aMPV, including human respiratory syncytial virus and bovine respiratory syncytial virus demonstrated the presence of this second potential ORF among these agents.

  3. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  4. Robust full-length hepatitis C virus genotype 2a and 2b infectious cultures using mutations identified by a systematic approach applicable to patient strains

    Li, Yi-Ping; Ramirez, Santseharay; Gottwein, Judith M

    2012-01-01

    Hepatitis C virus (HCV) infection is a leading cause of chronic liver diseases worldwide, but treatment options are limited. Basic HCV research required for vaccine and drug development has been hampered by inability to culture patient isolates, and to date only the JFH1 (genotype 2a) recombinant...... represents an important advance, and the approach used might permit culture development of other isolates, with implications for improved individualized treatments of HCV patients and for development of broadly efficient vaccines....

  5. Improving Tumor Uptake and Pharmacokinetics of 64Cu-Labeled Cyclic RGD Peptide Dimers with Gly3 and PEG4 Linkers

    Shi, Jiyun; Kim, Young-Seung; Zhai, Shizhen; Liu, Zhaofei; Chen, Xiaoyuan; Liu, Shuang

    2009-01-01

    Radiolabeled cyclic RGD (Arg-Gly-Asp) peptides represent a new class of radiotracers with potential for the early tumor detection and non-invasive monitoring of tumor metastasis and therapeutic response in cancer patients. This report describes the synthesis of two cyclic RGD peptide dimer conjugates, DOTA-PEG4-E[PEG4-c(RGDfK)]2 (DOTA-3PEG4-dimer: DOTA = 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid; PEG4 = 15-amino-4,7,10,13-tetraoxapentadecanoic acid) and DOTA-G3-E[G3-c(RGDfK)]2 ...

  6. Spop promotes skeletal development and homeostasis by positively regulating Ihh signaling.

    Cai, Hongchen; Liu, Aimin

    2016-12-20

    Indian Hedgehog (Ihh) regulates chondrocyte and osteoblast differentiation through the Glioma-associated oncogene homolog (Gli) transcription factors. Previous in vitro studies suggested that Speckle-type POZ protein (Spop), part of the Cullin-3 (Cul3) ubiquitin ligase complex, targets Gli2 and Gli3 for degradation and negatively regulates Hedgehog (Hh) signaling. In this study, we found defects in chondrocyte and osteoblast differentiation in Spop-null mutant mice. Strikingly, both the full-length and repressor forms of Gli3, but not Gli2, were up-regulated in Spop mutants, and Ihh target genes Patched 1 (Ptch1) and parathyroid hormone-like peptide (Pthlh) were down-regulated, indicating compromised Hh signaling. Consistent with this finding, reducing Gli3 dosage greatly rescued the Spop mutant skeletal defects. We further show that Spop directly targets the Gli3 repressor for ubiquitination and degradation. Finally, we demonstrate in a conditional mutant that loss of Spop results in brachydactyly and osteopenia, which can be rescued by reducing the dosage of Gli3. In summary, Spop is an important positive regulator of Ihh signaling and skeletal development.

  7. Gli2 activator function in preosteoblasts is sufficient to mediate Ihh-dependent osteoblast differentiation, whereas the repressor function of Gli2 is dispensable for endochondral ossification.

    Kesper, Dörthe Andrea; Didt-Koziel, Lydia; Vortkamp, Andrea

    2010-06-01

    Signaling of Indian hedgehog (Ihh), one of the key regulators of endochondral ossification is mediated by transcription factors of the Gli family, Gli1, Gli2, and Gli3. Gli3 and to a lesser extent Gli2 can be proteolytically processed into short repressor proteins. Upon Ihh signaling, processing is inhibited and the full-length proteins function as activators of transcription. Gli3 has been shown to mainly act as a repressor of Ihh target genes in chondrocytes, but the role of other Gli isoforms is less clear. Analyzing mouse mutants deficient for Ihh;Gli2 or Gli3;Gli2, we show here that the Gli2 repressor has no detectable function in chondrocyte or osteoblast differentiation. Instead, Gli2 seems to act as an activator to fully induce the expression of Ihh target genes in skeletal tissues. Furthermore, we show that, in the absence of Gli3, the activator function of Gli2 is sufficient to induce Ihh-dependent osteoblast differentiation.

  8. Analysis of ORF5 and Full-Length Genome Sequences of Porcine Reproductive and Respiratory Syndrome Virus Isolates of Genotypes 1 and 2 Retrieved Worldwide Provides Evidence that Recombination Is a Common Phenomenon and May Produce Mosaic Isolates

    Martín-Valls, G. E.; Kvisgaard, Lise Kirstine; Tello, M.

    2014-01-01

    Recombination is currently recognized as a factor for high genetic diversity, but the frequency of such recombination events and the genome segments involved are not well known. In the present study, we initially focused on the detection of recombinant porcine reproductive and respiratory syndrom...

  9. Complete nucleotide sequences and construction of full-length infectious cDNA clones of Cucumber green mottle virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters

    Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with Cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon...

  10. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  11. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development

    Konstantin A. Tsetsarkin

    2016-08-01

    Full Text Available An arthropod-borne virus, Zika virus (ZIKV, has recently emerged as a major human pathogen. Associated with complications during perinatal development and Guillain-Barré syndrome in adults, ZIKV raises new challenges for understanding the molecular determinants of flavivirus pathogenesis. This underscores the necessity for the development of a reverse genetic system based on an epidemic ZIKV strain. Here, we describe the generation and characterization in cell cultures of an infectious cDNA clone of ZIKV isolated from the 2015 epidemic in Brazil. The cDNA-derived ZIKV replicated efficiently in a variety of cell lines, including those of both neuronal and placental origin. We observed that the growth of cDNA-derived virus was attenuated compared to the growth of the parental isolate in most cell lines, which correlates with substantial differences in sequence heterogeneity between these viruses that were determined by deep-sequencing analysis. Our findings support the role of genetic diversity in maintaining the replicative fitness of viral populations under changing conditions. Moreover, these results indicate that caution should be exercised when interpreting the results of reverse-genetics experiments in attempts to accurately predict the biology of natural viruses. Finally, a Vero cell-adapted cDNA clone of ZIKV was generated that can be used as a convenient platform for studies aimed at the development of ZIKV vaccines and therapeutics.

  12. Using RNA-Seq to assemble a rose transcriptome with more than 13,000 full-length expressed genes and to develop the WagRhSNP 68k Axiom SNP array for rose (Rosa L.)

    Koning, C.F.S.; Esselink, G.; Vukosavljev, M.; Westende, van 't W.P.C.; Gitonga, V.W.; Krens, F.A.; Voorrips, R.E.; Weg, van de W.E.; Schulz, D.; Debener, T.; Maliepaard, C.A.; Arens, P.F.P.; Smulders, M.J.M.

    2015-01-01

    In order to develop a versatile and large SNP array for rose, we set out to mine ESTs from diverse sets of rose germplasm. For this RNA-Seq libraries containing about 700 million reads were generated from tetraploid cut and garden roses using Illumina paired-end sequencing, and from diploid Rosa

  13. Full-length genome sequence analysis of an avian leukosis virus subgroup J (ALV-J) as contaminant in live poultry vaccine: The commercial live vaccines might be a potential route for ALV-J transmission.

    Wang, P; Lin, L; Li, H; Shi, M; Gu, Z; Wei, P

    2018-02-25

    One avian leukosis virus subgroup J (ALV-J) strain was isolated from 67 commercial live poultry vaccines produced by various manufacturers during 2013-2016 in China. The complete genomes of the isolate were sequenced and it was found that the genes gag and pol of the strain were relatively conservative, while the gp85 gene of the strain GX14YYA1 had the highest similarities with a field strain GX14ZS14, which was isolated from the chickens of a farm that had once used the same vaccine as the one found to be contaminated with the GX14YYA1. This is the first report of ALV-J contaminant in live poultry vaccine in China. Our finding demonstrates that vaccination of the commercial live vaccines might be a potential new route for ALV-J transmission in chickens and highlights the need for more extensive monitoring of the commercial live vaccines in China. © 2018 Blackwell Verlag GmbH.

  14. Selective silencing of full-length CD80 but not IgV-CD80 leads to impaired clonal deletion of self-reactive T cells and altered regulation of immune responses.

    Bugeon, L; Hargreaves, R E; Crompton, T; Outram, S; Rahemtulla, A; Porter, A C; Dallman, M J

    2001-01-01

    Co-stimulation provided by the B7 family of proteins underpins the development of protective immunity. There are three identified members of this family: CD80, its splice variant IgV-CD80 and CD86. It has hitherto been difficult to analyze the expression and function of IgV-CD80 since there are no appropriate reagents capable of distinguishing it from CD80. We have generated mice, by gene targeting, the lack CD80 whilst maintaining expression of IgV-CD80. Mutant animals did not delete T cells bearing mammary tumor virus-reactive TCR as efficiently as wild-type animals. We also demonstrate the importance of IgV-CD80 in the responses of recently activated cells and reveal a role for CD80 in sustaining T cell responses. CD86, whilst critical to primary T cell activation, made only a minor contribution to re-activation of normal cells.

  15. Altered balance between self-reactive T helper (Th)17 cells and Th10 cells and between full-length forkhead box protein 3 (FoxP3) and FoxP3 splice variants in Hashimoto's thyroiditis

    Kristensen, B; Hegedüs, Laszlo; Madsen, H O

    2015-01-01

    cells from healthy donors and patients with Hashimoto's thyroiditis (HT) or Graves' disease (GD) to polyclonal stimulation, or stimulation with human thyroglobulin (TG), human thyroid peroxidase (TPO), or Esherichia coli lipopolysaccharide (LPS). TPO and LPS induced increased differentiation of naive CD...

  16. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).

  17. Dosimetry with semiconductor diodes in the application to the full-length irradiation technique of electrons; Dosimetria con diodos semiconductores en la aplicacion a la tecnica de irradiacion de cuerpo entero de electrones

    Madrid G, O. A.; Rivera M, T. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Calz. Legaria No. 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico)

    2012-10-15

    The use of charged particles as electrons for the tumor-like lesions treatment to total surface of skin is not very frequent, the types of fungo id mycosis and cutaneous lymphomas compared with other neoplasms they are relatively scarce, however for the existent cases a non conventional technique should be contemplated as treatment alternative that can reach an effective control. In this work the variables of more influence with ionization chamber and semiconductor diodes are studied for to determine the quality of an electrons beam. (Author)

  18. (1)H, (13)C, and (15)N backbone resonance assignments of the full-length 40 kDa S. acidocaldarius Y-family DNA polymerase, dinB homolog.

    Moro, Sean L; Cocco, Melanie J

    2015-10-01

    The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains.

  19. 中国驯鹿生长素(ghrelin)全长cDNA的克隆及序列分析%Cloning and analysis of the full-length cDNA of China reindeer ghrelin

    杨银凤; 余兴邦; 王冠玉; 都格尔斯仁; 包花尔; 徐斯日古楞

    2014-01-01

    采用cDNA末端快速扩增技术(rapid amplification of cDNA ends,RACE),在本课题组已获得的驯鹿ghrelincDNA的部分片段的基础上进行3'和5'RACE.结果成功克隆出驯鹿ghrelin cDNA的3 '和5 '末端序列,从而得到604 bp的驯鹿ghrelin cDNA全序列.其中包含57 bp 5'非翻译区(UTR)、405 bp的开放读码框(ORF)、128 bp的3'UTR和poly(A)14.405 bp的ORF编码134个氨基酸残基的前原ghrelin(preproghrelin),其中包含41个氨基酸残基的N末端信号肽,27个氨基酸残基的成熟肽及66个氨基酸残基的C末端肽.序列同源性比较显示驯鹿ghrelincDNA与山羊、绵羊和牛的同源性分别是92.0%、90.8%和89.5%;与猪和人的同源性分别是69.5%和65.2%;与鸡的同源性仅为33.8%.表明ghrelin的结构具有明显的种属特异性.驯鹿Ghrelin cDNA全序列的获得为进一步研究其生理作用奠定了基础.

  20. Foxf genes integrate tbx5 and hedgehog pathways in the second heart field for cardiac septation.

    Andrew D Hoffmann

    2014-10-01

    Full Text Available The Second Heart Field (SHF has been implicated in several forms of congenital heart disease (CHD, including atrioventricular septal defects (AVSDs. Identifying the SHF gene regulatory networks required for atrioventricular septation is therefore an essential goal for understanding the molecular basis of AVSDs. We defined a SHF Hedgehog-dependent gene regulatory network using whole genome transcriptional profiling and GLI-chromatin interaction studies. The Forkhead box transcription factors Foxf1a and Foxf2 were identified as SHF Hedgehog targets. Compound haploinsufficiency for Foxf1a and Foxf2 caused atrioventricular septal defects, demonstrating the biological relevance of this regulatory network. We identified a Foxf1a cis-regulatory element that bound the Hedgehog transcriptional regulators GLI1 and GLI3 and the T-box transcription factor TBX5 in vivo. GLI1 and TBX5 synergistically activated transcription from this cis-regulatory element in vitro. This enhancer drove reproducible expression in vivo in the posterior SHF, the only region where Gli1 and Tbx5 expression overlaps. Our findings implicate Foxf genes in atrioventricular septation, describe the molecular underpinnings of the genetic interaction between Hedgehog signaling and Tbx5, and establish a molecular model for the selection of the SHF gene regulatory network for cardiac septation.

  1. Exon 3-deleted/full-length growth hormone receptor polymorphism genotype frequencies in Spanish short small-for-gestational-age (SGA) children and adolescents (n = 247) and in an adult control population (n = 289) show increased fl/fl in short SGA.

    Audí, Laura; Esteban, Cristina; Carrascosa, Antonio; Espadero, Rosa; Pérez-Arroyo, Annalisa; Arjona, Rosa; Clemente, María; Wollmann, Hartmut; Fryklund, Linda; Parodi, Luis A

    2006-12-01

    A polymorphism in the human GH receptor gene (d3/fl-GHR) resulting in genomic deletion of exon 3 has been associated with the degree of height increase in response to GH therapy. The objective of the study was to evaluate the frequencies of d3/fl-GHR polymorphism genotypes in control and short small-for-gestational-age (SGA) populations. An adult control population with heights normally distributed (ACPNH) between -2 and +2 sd score (SDS) and a short non-GH-deficient SGA child population were selected. Thirty Spanish hospitals participated in the selection of the short non-GH-deficient SGA children in the setting of a controlled, randomized trial, and one of these hospitals selected the ACPNH. CONTROLS AND PATIENTS: Two hundred eighty-nine adult subjects of both sexes constituted the ACPNH and 247 children and adolescents of both sexes the short SGA patients. Heights and weights were recorded in the ACPNH, and auxologic and biochemical data were recorded at each hospital for the SGA patients; d3/fl-GHR genotypes were determined and data analyzed in a single hospital. In short SGA patients, d3/fl-GHR genotype frequencies were significantly different from those in ACPNH, with a higher frequency of fl/fl genotype (P or=-2 SDS, n = 60). Our data showed significant differences in the frequency distribution of the d3/fl-GHR genotypes between a normally distributed adult height population and short SGA children, with the biologically less active fl/fl genotype being almost twice as frequent in SGA patients. These data suggest that the d3/fl-GHR polymorphism might be considered among the factors that contribute to the phenotypic expression of growth.

  2. Cloning and analysis of the full-length cDNA of reindeer β-defensin caBD-1%驯鹿β-防御素reBD-1全长cDNA的克隆及序列分析

    杨银凤; 郝永峰; 赵艳芳; 余兴帮; 都格尔斯仁

    2008-01-01

    为了获得驯鹿β-防御素reBD-1全长cDNA序列,根据已获得的reBD-1 cDNA的已知序列设计1条序列特异性引物作为上游引物,反转录引物中的部分序列即3′接舍器引物作为下游引物,克隆reBD-1 cDNA的3′末端序列.另外,采用反向嵌套PCR RACE法,根据reBD-1 cDNA的已知序列,设计1条5′末端磷酸化的特异性反转录引物和2对特异性反向嵌套PCR引物,首先进行反转录(RT),然后将mRNA反转录成的cDNA进行环化,最后进行反向嵌套巢式PCR,克隆reBD-1 cDNA的5′末端序列.结果成功的克隆出了reBD-1 cDNA的3′和5′末端序列,从而得到372 bp的reBD-1 cDNA全序列,其中包含44 bp 5′非翻译区(UTR)、192 bp的开放读码框(ORF)、终止密码子TAA、118 bp的3′UTR和poly(A)15.reBD-1 cDNA全序列的获得为进一步研究其基因结构、基因表达和基因功能奠定了基础.

  3. AcEST: DK947950 [AcEST

    Full Text Available 10071|GLI3_HUMAN Zinc finger protein GLI3 OS=Homo sapiens GN... 31 4.9 sp|Q8WXX7|AUTS2_HUMAN Autism suscepti...FSPPHPYINPYMDYIRSLHSSPSLSMI 216 >sp|Q8WXX7|AUTS2_HUMAN Autism susceptibility gene 2 protein OS=Homo sapiens

  4. Journal of Genetics | Indian Academy of Sciences

    ... without cleft palate identified risk variants of the GLI3 gene in a Chinese population ... association analysis with NSCL/P in 504 cases and 455 healthy controls. ... Tsinghua University School of Medicine, Beijing 100084, People's Republic of ...

  5. The association study of nonsyndromic cleft lip with or without cleft ...

    Yirui Wang

    2017-09-07

    Sep 7, 2017 ... identified risk variants of the GLI3 gene in a Chinese population ... Engineering, Medical Systems Biology Research Center, Tsinghua University School of .... gene and performed case–control-based association anal- ysis in a ...

  6. Complementary Gli activity mediates early patterning of the mouse visual system.

    Furimsky, Marosh; Wallace, Valerie A

    2006-03-01

    The Sonic hedgehog (Shh) signaling pathway plays a key role in the development of the vertebrate central nervous system, including the eye. This pathway is mediated by the Gli transcription factors (Gli1, Gli2, and Gli3) that differentially activate and repress the expression of specific downstream target genes. In this study, we investigated the roles of the three vertebrate Glis in mediating midline Shh signaling in early ocular development. We examined the ocular phenotypes of Shh and Gli combination mutant mouse embryos and monitored proximodistal and dorsoventral patterning by the expression of specific eye development regulatory genes using in situ hybridization. We show that midline Shh signaling relieves the repressor activity of Gli3 adjacent to the midline and then promotes eye pattern formation through the nonredundant activities of all three Gli proteins. Gli3, in particular, is required to specify the dorsal optic stalk and to define the boundary between the optic stalk and the optic cup.

  7. The Association study of nonsyndromic cleft lip with or without cleft ...

    Navya

    2016-11-25

    Nov 25, 2016 ... 12 Maternal and Children Metabolic-Genetic Key Laboratory, ... performed association analysis with NSCL/P in 504 cases and 455 healthy controls. Our ... GLI3 morphopathies have distinct clinical characteristics, the ..... Wehby G. L., Cassell C. H. 2010 The impact of orofacial clefts on quality of life and.

  8. The Gli2 transcriptional activator is a crucial effector for Ihh signaling in osteoblast development and cartilage vascularization.

    Joeng, Kyu Sang; Long, Fanxin

    2009-12-01

    Indian hedgehog (Ihh) critically regulates multiple aspects of endochondral bone development. Although it is generally believed that all Ihh functions are mediated by the Gli family of transcription activators and repressors, formal genetic proof for this notion has not been provided. Moreover, the extent to which different Gli proteins contribute to Ihh functions is not fully understood. Previous work has shown that de-repression of the Gli3 repressor is the predominant mode through which Ihh controls chondrocyte proliferation and maturation, but that osteoblast differentiation and hypertrophic cartilage vascularization require additional mechanisms. To test the involvement of Gli2 activation in these processes, we have generated a mouse strain that expresses a constitutive Gli2 activator in a Cre-dependent manner, and have attempted to rescue the Ihh-null mouse with the Gli2 activator, either alone or in combination with Gli3 removal. Here, we report that the Gli2 activator alone is sufficient to induce vascularization of the hypertrophic cartilage in the absence of Ihh but requires simultaneous removal of Gli3 to restore osteoblast differentiation. These results therefore provide direct genetic evidence that Gli2 and Gli3 collectively mediate all major aspects of Ihh function during endochondral skeletal development.

  9. TMFunction data: 1704 [TMFunction[Archive

    Full Text Available ... Wild yes drug transport; inter-domain communication ... Multidrug transporter, P-gly...3) Helix ... inter-domain communication; drug transport; substrate translocation; ATPase activity ...hemistry. 2007 Sep 4;46(35):9899-910 Calorimetric assay 2.4 fold stimulation Vinblastine ... MDR1_HUMAN (P0818

  10. TMFunction data: 1689 [TMFunction[Archive

    Full Text Available ... Wild yes drug transport; inter-domain communication ... Multidrug transporter, P-gly...3) Helix ... inter-domain communication; drug transport; substrate translocation; ATPase activity ...hemistry. 2007 Sep 4;46(35):9899-910 Calorimetric assay 3.4 fold stimulation Nicardipine ... MDR1_HUMAN (P0818

  11. Journal of Genetics | Indian Academy of Sciences

    Home; Journals; Journal of Genetics. YONGQING HUANG. Articles written in Journal of Genetics. Volume 96 Issue 4 September 2017 pp 687-693 RESEARCH NOTE. The association study of nonsyndromic cleft lip with or without cleft palate identified risk variants of the GLI3 gene in a Chinese population · YIRUI WANG ...

  12. aihua yin

    Home; Journals; Journal of Genetics. AIHUA YIN. Articles written in Journal of Genetics. Volume 96 Issue 4 September 2017 pp 687-693 RESEARCH NOTE. The association study of nonsyndromic cleft lip with or without cleft palate identified risk variants of the GLI3 gene in a Chinese population · YIRUI WANG YIMIN SUN ...

  13. Journal of Genetics | Indian Academy of Sciences

    Conditional QTL mapping of protein content in wheat with respect to grain yield and its components · Lin Wang Fa Cui Jinping Wang Li Jun ... The association study of nonsyndromic cleft lip with or without cleft palate identified risk variants of the GLI3 gene in a Chinese population · YIRUI WANG YIMIN SUN YONGQING ...

  14. Frequent alterations in cytoskeleton remodelling genes in primary and metastatic lung adenocarcinomas

    Wu, Kui; Zhang, Xin; Li, Fuqiang

    2015-01-01

    significantly mutated genes are identified, including the most commonly mutated gene TP53 and novel mutation targets such as RHPN2, GLI3 and MRC2. TP53 mutations are furthermore significantly enriched in tumours from patients harbouring metastases. Genes regulating cytoskeleton remodelling processes are also...

  15. yimin sun

    Home; Journals; Journal of Genetics. YIMIN SUN. Articles written in Journal of Genetics. Volume 96 Issue 4 September 2017 pp 687-693 RESEARCH NOTE. The association study of nonsyndromic cleft lip with or without cleft palate identified risk variants of the GLI3 gene in a Chinese population · YIRUI WANG YIMIN SUN ...

  16. One Family's Struggle with Chickenpox

    Full Text Available ... MP3 :60-second unbranded MP3 Video PSAs for Web :30-second branded FLV | MP4/QuickTime | WMV :30- ... MPEG-2 Full-Length Videos Full-length branded, web FLV | MP4/QuickTime | WMV Full-length unbranded, web ...

  17. One Family's Struggles with Rotavirus

    Full Text Available ... MP3 :60-second unbranded MP3 Video PSAs for Web :30-second branded FLV | MP4/QuickTime | WMV :30- ... MPEG-2 Full-Length Videos Full-length branded, web FLV | MP4/QuickTime | WMV Full-length unbranded, web ...

  18. One Family's Struggles with HPV (Human Papillomavirus)

    Full Text Available ... MP3 :60-second unbranded MP3 Video PSAs for Web :30-second branded FLV | MP4/QuickTime | WMV :30- ... MPEG-2 Full-Length Videos Full-length branded, web FLV | MP4/QuickTime | WMV Full-length unbranded, web ...

  19. One Family's Struggles with Hepatitis B

    Full Text Available ... MP3 :60-second unbranded MP3 Video PSAs for Web :30-second branded FLV | MP4/QuickTime | WMV :30- ... MPEG-2 Full-Length Videos Full-length branded, web FLV | MP4/QuickTime | WMV Full-length unbranded, web ...

  20. One Family's Struggles with Pertussis (Whooping Cough)

    Full Text Available ... MP3 :60-second unbranded MP3 Video PSAs for Web :30-second branded FLV | MP4/QuickTime | WMV :30- ... MPEG-2 Full-Length Videos Full-length branded, web FLV | MP4/QuickTime | WMV Full-length unbranded, web ...

  1. Measurement of conformational constraints in an elastin-mimetic protein by residue-pair selected solid-state NMR

    Hong, Mei [Iowa State University, Department of Chemistry (United States)], E-mail: mhong@iastate.edu; McMillan, R. Andrew; Conticello, Vincent P. [Emory University, Department of Chemistry (United States)

    2002-02-15

    We introduce a solid-state NMR technique for selective detection of a residue pair in multiply labeled proteins to obtain site-specific structural constraints. The method exploits the frequency-offset dependence of cross polarization to achieve {sup 13}CO{sub i} {sup {yields}} {sup 15}N{sub i} {sup {yields}} {sup 13}C{alpha}{sub i} transfer between two residues. A {sup 13}C, {sup 15}N-labeled elastin mimetic protein (VPGVG){sub n} is used to demonstrate the method. The technique selected the Gly3 C{alpha} signal while suppressing the Gly5 C{alpha} signal, and allowed the measurement of the Gly3 C{alpha} chemical shift anisotropy to derive information on the protein conformation. This residue-pair selection technique should simplify the study of protein structure at specific residues.

  2. Measurement of conformational constraints in an elastin-mimetic protein by residue-pair selected solid-state NMR

    Hong, Mei; McMillan, R. Andrew; Conticello, Vincent P.

    2002-01-01

    We introduce a solid-state NMR technique for selective detection of a residue pair in multiply labeled proteins to obtain site-specific structural constraints. The method exploits the frequency-offset dependence of cross polarization to achieve 13 CO i → 15 N i → 13 Cα i transfer between two residues. A 13 C, 15 N-labeled elastin mimetic protein (VPGVG) n is used to demonstrate the method. The technique selected the Gly3 Cα signal while suppressing the Gly5 Cα signal, and allowed the measurement of the Gly3 Cα chemical shift anisotropy to derive information on the protein conformation. This residue-pair selection technique should simplify the study of protein structure at specific residues

  3. Genetic Analysis of Hedgehog Signaling in Ventral Body Wall Development and the Onset of Omphalocele Formation

    Matsumaru, Daisuke; Haraguchi, Ryuma; Miyagawa, Shinichi; Motoyama, Jun; Nakagata, Naomi; Meijlink, Frits; Yamada, Gen

    2011-01-01

    Background An omphalocele is one of the major ventral body wall malformations and is characterized by abnormally herniated viscera from the body trunk. It has been frequently found to be associated with other structural malformations, such as genitourinary malformations and digit abnormalities. In spite of its clinical importance, the etiology of omphalocele formation is still controversial. Hedgehog (Hh) signaling is one of the essential growth factor signaling pathways involved in the formation of the limbs and urogenital system. However, the relationship between Hh signaling and ventral body wall formation remains unclear. Methodology/Principal Findings To gain insight into the roles of Hh signaling in ventral body wall formation and its malformation, we analyzed phenotypes of mouse mutants of Sonic hedgehog (Shh), GLI-Kruppel family member 3 (Gli3) and Aristaless-like homeobox 4 (Alx4). Introduction of additional Alx4Lst mutations into the Gli3Xt/Xt background resulted in various degrees of severe omphalocele and pubic diastasis. In addition, loss of a single Shh allele restored the omphalocele and pubic symphysis of Gli3Xt/+; Alx4Lst/Lst embryos. We also observed ectopic Hh activity in the ventral body wall region of Gli3Xt/Xt embryos. Moreover, tamoxifen-inducible gain-of-function experiments to induce ectopic Hh signaling revealed Hh signal dose-dependent formation of omphaloceles. Conclusions/Significance We suggest that one of the possible causes of omphalocele and pubic diastasis is ectopically-induced Hh signaling. To our knowledge, this would be the first demonstration of the involvement of Hh signaling in ventral body wall malformation and the genetic rescue of omphalocele phenotypes. PMID:21283718

  4. Genetic analysis of Hedgehog signaling in ventral body wall development and the onset of omphalocele formation.

    Daisuke Matsumaru

    2011-01-01

    Full Text Available An omphalocele is one of the major ventral body wall malformations and is characterized by abnormally herniated viscera from the body trunk. It has been frequently found to be associated with other structural malformations, such as genitourinary malformations and digit abnormalities. In spite of its clinical importance, the etiology of omphalocele formation is still controversial. Hedgehog (Hh signaling is one of the essential growth factor signaling pathways involved in the formation of the limbs and urogenital system. However, the relationship between Hh signaling and ventral body wall formation remains unclear.To gain insight into the roles of Hh signaling in ventral body wall formation and its malformation, we analyzed phenotypes of mouse mutants of Sonic hedgehog (Shh, GLI-Kruppel family member 3 (Gli3 and Aristaless-like homeobox 4 (Alx4. Introduction of additional Alx4(Lst mutations into the Gli3(Xt/Xt background resulted in various degrees of severe omphalocele and pubic diastasis. In addition, loss of a single Shh allele restored the omphalocele and pubic symphysis of Gli3(Xt/+; Alx4(Lst/Lst embryos. We also observed ectopic Hh activity in the ventral body wall region of Gli3(Xt/Xt embryos. Moreover, tamoxifen-inducible gain-of-function experiments to induce ectopic Hh signaling revealed Hh signal dose-dependent formation of omphaloceles.We suggest that one of the possible causes of omphalocele and pubic diastasis is ectopically-induced Hh signaling. To our knowledge, this would be the first demonstration of the involvement of Hh signaling in ventral body wall malformation and the genetic rescue of omphalocele phenotypes.

  5. Dicty_cDB: VSH706 [Dicty_cDB

    Full Text Available AGAGTTCAAACAACAAAGTAGACGAATTAGATTGACGGAATTTTTCAGAGGAAA ACATCTCTATCAAATAGATTTCTTAAAAAATAATAAGTTAGTAAAATCAATAAAGCTTAC TCATANA...AAGTAGACGAATTAGATTGACGGAATTTTTCAGAGGAAAACATCTCTATCAAATAG ATTTCTTAAAAAATAATAAGTTAGTAAAATCAATAAAGCTTACTCATANAT...AATTTTTCAGAGGAAAA CATCTCTATCAAATAGATTTCTTAAAAAATAATAAGTTAGTAAAATCAATAAAGCTTACT CATANA...TAGATTGACGGAATTTTTCAGAGGAAA ACATCTCTATCAAATAGATTTCTTAAAAAATAATAAGTTAGTAAAATCAATAAAGCTTAC TCATANATAGACACA Length of full length seq. 615 ...

  6. Degradation of morpholine by Mycobacterium sp. isolated from ...

    Jane

    2011-08-08

    Aug 8, 2011 ... Full Length Research Paper. Degradation ... The heterocyclic xenobiotic compound morpholine (1- ... Culture of morpholine degrading microorganisms ..... Biodegradation and toxicity of selected amines on aquatic organisms.

  7. The Films of Oscar Micheaux: America's First Fabulous Black Filmmaker.

    Peterson, Bernard L., Jr.

    1979-01-01

    Although Oscar Micheaux was not the first Black American filmmaker, he was undoubtedly the most prolific Black American movie producer. He is credited with making the first full-length, all-Black silent film produced by a Black company, as well as the first full-length, all-Black sound film. (Author/MC)

  8. Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

    The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

  9. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  10. Journal of Biosciences | Indian Academy of Sciences

    Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot mannose-binding lectins, the full-length cDNA of Z. officinale agglutinin (ZOA) was cloned by rapid amplification of cDNA ends (RACE). The full-length cDNA of zoa was 746 bp and contained a ...

  11. Ranking factors involved in diabetes remission after bariatric surgery using machine-learning integrating clinical and genomic biomarkers

    Pedersen, Helle Krogh; Gudmundsdottir, Valborg; Pedersen, Mette Krogh

    2016-01-01

    , use of insulin-sensitising agents and baseline serum insulin levels, as the most informative variables with a decent internal validation performance (74% accuracy, area under the curve (AUC) 0.81). Adding information for the eight top-ranked single nucleotide polymorphisms (SNPs) significantly boosted...... classification performance to 84% accuracy (AUC 0.92). The eight SNPs mapped to eight genes — ABCA1, ARHGEF12, CTNNBL1, GLI3, PROK2, RYBP, SMUG1 and STXBP5 — three of which are known to have a role in insulin secretion, insulin sensitivity or obesity, but have not been indicated for diabetes remission after...

  12. Theoretical conformational analysis of the bovine adrenal medulla 12 residue peptide molecule

    Akhmedov, N. A.; Tagiyev, Z. H.; Hasanov, E. M.; Akverdieva, G. A.

    2003-02-01

    The spatial structure and conformational properties of the bovine adrenal medulla 12 residue peptide Tyr1-Gly2-Gly3-Phe4-Met5-Arg6-Arg7-Val8-Gly9-Arg10-Pro11-Glu12 (BAM-12P) molecule were studied by theoretical conformational analysis. It is revealed that this molecule can exist in several stable states. The energy and geometrical parameters for the low-energy conformations are obtained. The conformationally rigid and labile segments of this molecule were revealed.

  13. Characterization of a beta-glycosidase highly active on disaccharides and of a beta-galactosidase from Tenebrio molitor midgut lumen.

    Ferreira, Alexandre H P; Terra, Walter R; Ferreira, Clélia

    2003-02-01

    The midgut of the yellow mealworm, Tenebrio molitor L. (Coleoptera: Tenebrionidae) larvae has four beta-glycosidases. The properties of two of these enzymes (betaGly1 and betaGly2) have been described elsewhere. In this paper, the characterization of the other two glycosidases (betaGly3 and betaGly4) is described. BetaGly3 has one active site, hydrolyzes disaccharides, cellodextrins, synthetic substrates and beta-glucosides produced by plants. The enzyme is inhibited by amygdalin, cellotriose, cellotetraose and cellopentaose in high concentrations, probably due to transglycosylation. betaGly3 hydrolyzes beta 1,4-glycosidic linkages with a catalytic rate independent of the substrate polymerization degree (k(int)) of 11.9 s(-1). Its active site is formed by four subsites, where subsites +1 and -1 bind glucose residues with higher affinity than subsite +2. The main role of betaGly3 seems to be disaccharide hydrolysis. BetaGly4 is a beta-galactosidase, since it has highest activity against beta-galactosides. It can also hydrolyze fucosides, but not glucosides, and has Triton X-100 as a non-essential activator (K(a)=15 microM, pH 4.5). betaGly4 has two active sites that can hydrolyze p-nitrophenyl beta-galactoside (NPbetaGal). The one hydrolyzing NPbetaGal with more efficiency is also active against methylumbellipheryl beta-D-galactoside and lactose. The other active site hydrolyzes NPbetaFucoside and binds NPbetaGal weakly. BetaGly4 hydrolyzes hydrophobic substrates with high catalytical efficiency and is able to bind octyl-beta-thiogalactoside in its active site with high affinity. The betaGly4 physiological role is supposed to be the hydrolysis of galactolipids that are found in membranes from vegetal tissues. As the enzyme has a hydrophobic site where Triton X-100 can bind, it might be activated by membrane lipids, thus becoming fully active only at the surface of cell membranes.

  14. Identification and Characterization of KCASH2 and KCASH3, 2 Novel Cullin3 Adaptors Suppressing Histone Deacetylase and Hedgehog Activity in Medulloblastoma

    Enrico De Smaele

    2011-04-01

    Full Text Available Medulloblastoma is the most common pediatric malignant brain tumor, arising from aberrant cerebellar precursors' development, a process mainly controlled by Hedgehog (Hh signaling pathway. Histone deacetylase HDAC1 has been recently shown to modulate Hh signaling, deacetylating its effectors Gli1/2 and enhancing their transcriptional activity. Therefore, HDAC may represent a potential therapeutic target for Hh-dependent tumors, but still little information is available on the physiological mechanisms of HDAC regulation. The putative tumor suppressor RENKCTD11 acts through ubiquitination-dependent degradation of HDAC1, thereby affecting Hh activity and medulloblastoma growth. We identify and characterize here two RENKCTD11 homologues, defining a new family of proteins named KCASH, as “KCTD containing, Cullin3 adaptor, suppressor of Hedgehog.” Indeed, the novel genes (KCASH2KCTD21 and KCASH3KCTD6 share with RENKCTD11 a number of features, such as a BTB domain required for the formation of a Cullin3 ubiquitin ligase complex and HDAC1 ubiquitination and degradation capability, suppressing the acetylation-dependent Hh/Gli signaling. Expression of KCASH2 and -3 is observed in cerebellum, whereas epigenetic silencing and allelic deletion are observed in human medulloblastoma. Rescuing KCASHs expression reduces the Hedgehog-dependent medulloblastoma growth, suggesting that loss of members of this novel family of native HDAC inhibitors is crucial in sustaining Hh pathway-mediated tumorigenesis. Accordingly, they might represent a promising class of endogenous “agents” through which this pathway may be targeted.

  15. Ihh signaling regulates mandibular symphysis development and growth.

    Sugito, H; Shibukawa, Y; Kinumatsu, T; Yasuda, T; Nagayama, M; Yamada, S; Minugh-Purvis, N; Pacifici, M; Koyama, E

    2011-05-01

    Symphyseal secondary cartilage is important for mandibular development, but the molecular mechanisms underlying its formation remain largely unknown. Here we asked whether Indian hedgehog (Ihh) regulates symphyseal cartilage development and growth. By embryonic days 16.5 to 18.5, Sox9-expressing chondrocytes formed within condensed Tgfβ-1/Runx2-expressing mesenchymal cells at the prospective symphyseal joint site, and established a growth-plate-like structure with distinct Ihh, collagen X, and osteopontin expression patterns. In post-natal life, mesenchymal cells expressing the Ihh receptor Patched1 were present anterior to the Ihh-expressing secondary cartilage, proliferated, differentiated into chondrocytes, and contributed to anterior growth of alveolar bone. In Ihh-null mice, however, symphyseal development was defective, mainly because of enhanced chondrocyte maturation and reduced proliferation of chondroprogenitor cells. Proliferation was partially restored in dual Ihh;Gli3 mutants, suggesting that Gli3 is normally a negative regulator of symphyseal development. Thus, Ihh signaling is essential for symphyseal cartilage development and anterior mandibular growth.

  16. Evc is a positive mediator of Ihh-regulated bone growth that localises at the base of chondrocyte cilia.

    Ruiz-Perez, Victor L; Blair, Helen J; Rodriguez-Andres, M Elena; Blanco, Maria Jose; Wilson, Amy; Liu, Yu-Ning; Miles, Colin; Peters, Heiko; Goodship, Judith A

    2007-08-01

    EVC is a novel protein mutated in the human chondroectodermal dysplasia Ellis-van Creveld syndrome (EvC; OMIM: 225500). We have inactivated Evc in the mouse and show that Evc(-/-) mice develop an EvC-like syndrome, including short ribs, short limbs and dental abnormalities. lacZ driven by the Evc promoter revealed that Evc is expressed in the developing bones and the orofacial region. Antibodies developed against Evc locate the protein at the base of the primary cilium. The growth plate of Evc(-/-) mice shows delayed bone collar formation and advanced maturation of chondrocytes. Indian hedgehog (Ihh) is expressed normally in the growth plates of Evc(-/-) mice, but expression of the Ihh downstream genes Ptch1 and Gli1 was markedly decreased. Recent studies have shown that Smo localises to primary cilia and that Gli3 processing is defective in intraflagellar transport mutants. In vitro studies using Evc(-/-) cells demonstrate that the defect lies downstream of Smo. Chondrocyte cilia are present in Evc(-/-) mice and Gli3 processing appears normal by western blot analysis. We conclude that Evc is an intracellular component of the hedgehog signal transduction pathway that is required for normal transcriptional activation of Ihh target genes.

  17. The Orphan G Protein-coupled Receptor Gpr175 (Tpra40) Enhances Hedgehog Signaling by Modulating cAMP Levels.

    Singh, Jaskirat; Wen, Xiaohui; Scales, Suzie J

    2015-12-04

    The Hedgehog (Hh) signaling pathway plays an essential role in vertebrate embryonic tissue patterning of many developing organs. Signaling occurs predominantly in primary cilia and is initiated by the entry of the G protein-coupled receptor (GPCR)-like protein Smoothened into cilia and culminates in gene transcription via the Gli family of transcription factors upon their nuclear entry. Here we identify an orphan GPCR, Gpr175 (also known as Tpra1 or Tpra40: transmembrane protein, adipocyte associated 1 or of 40 kDa), which also localizes to primary cilia upon Hh stimulation and positively regulates Hh signaling. Interaction experiments place Gpr175 at the level of PKA and upstream of the Gαi component of heterotrimeric G proteins, which itself localizes to cilia and can modulate Hh signaling. Gpr175 or Gαi1 depletion leads to increases in cellular cAMP levels and in Gli3 processing into its repressor form. Thus we propose that Gpr175 coupled to Gαi1 normally functions to inhibit the production of cAMP by adenylyl cyclase upon Hh stimulation, thus maximizing signaling by turning off PKA activity and hence Gli3 repressor formation. Taken together our data suggest that Gpr175 is a novel positive regulator of the Hh signaling pathway. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Congenital Hypothalamic "Hamartoblastoma" Versus "Hamartoma": Suggestions for Neuropathologic Terminology Emanating From a Mid-gestational Autopsy Case of Pallister-Hall Syndrome.

    Dunham, C; McFadden, D; Dahlgren, L; Butler, B; Hamilton, S; McKinnon, M

    2018-01-01

    Pallister-Hall syndrome (PHS) is a rare malformative disorder that is due to truncating functional repressor mutations in GLI3. Since the seminal publication in 1980, hypothalamic tumors have been recognized to be a cardinal feature of PHS. In their original description of the neuropathologic features of PHS, Clarren et al. coined the term "hamartoblastoma" to characterize what they deemed to be a dual malformative and neoplastic mass of the hypothalamus. In subsequent published cases/series of PHS, the term "hamartoma" was often substituted for hamartoblastoma given what appeared to be a benign natural history of this lesion. Additional confusion in the literature has ensued since most hypothalamic hamartomas (HH) encountered on the clinical neuropathology service are "isolated" in nature (ie, no other congenital malformations) and present in a very different and stereotypical fashion with gelastic seizures and/or precocious puberty. While genomic investigations of isolated HH have begun to uncover a mutational profile of these cases, GLI3 mutations have only been recognized in a small subset of isolated HH. Herein, we describe the autopsy findings from a 21-week gestational age fetus with features of PHS. Moreover, we provide a detailed description of the hypothalamic tumor affecting this fetus and propose a novel subclassification of HH, distinguishing syndromic from isolated forms based upon the presence or absence of neocortical-like areas.

  19. Familial Pallister-Hall in adulthood.

    Talsania, Mitali; Sharma, Rohan; Sughrue, Michael E; Scofield, R Hal; Lim, Jonea

    2017-10-01

    Pallister Hall syndrome is autosomal dominant disorder usually diagnosed in infants and children. Current diagnostic criteria include presence of hypothalamic hamartoma, post axial polydactyly and positive family history, but the disease has variable manifestations. Herein we report Pallister Hall syndrome diagnosed in a family where both patients were adults. A 59 year old man developed seizures 4 years prior to our evaluation of him, at which time imaging showed a hypothalamic hamartoma. The seizures were controlled medically. He did well until he had visual changes after a traumatic head injury. Repeat MRI showed slight expansion of the mass with formal visual field testing demonstrating bitemporal hemianopsia. There was no evidence of pituitary dysfunction except for large urine volume. He underwent surgery to debulk the hamartoma and the visual field defects improved. There was no hypopituitarism post-operatively, and the polydyspia resolved. His 29 year old daughter also had seizures and hypothalamic hamartoma. Both patients had had polydactyly with prior surgical correction in childhood. The daughter underwent genetic testing, which revealed a previously undescribed heterozygous single base pair deletion in exon 13 of the GLI3 gene causing a frameshift mutation. Further investigation into family history revealed multiple members in previous generations with polydactyly and/or seizures. Pallister-Hall syndrome is caused by an inherited autosomal dominant or de novo mutation in GLI3 gene. This rare syndrome has not had prevalence defined, however. Generally, diagnoses are made in the pediatric population. Our report adds to the few cases detected in adulthood.

  20. Regeneration and propagation of reed grass for large-scale ...

    전서범

    2012-01-26

    Jan 26, 2012 ... Full Length Research Paper ... cultivated without fertilizer, irrigation or pesticides ... magenta vessels containing MS medium without any growth ... Effect of 2,4 D and 4-FA on callus formation from nodal stem tissue of P.

  1. and spider plant (Cleome gynandra)

    User

    2016-02-17

    Feb 17, 2016 ... Full Length Research Paper. Ascorbic acid ... By recognizing the impact of leaf age and importance of providing ... antioxidant, maintains the flexibility of blood vessels ... The experimental plots had drip irrigation installed to.

  2. Gendered childcare norms — evidence from rural Swaziland to ...

    and support female caregivers (emotionally and financially through social support .... the community researchers through participatory mapping. The accuracy of the ... These capabilities are: full length life; bodily health; bodily integrity; senses.

  3. Over-expressing Salicornia europaea (SeNHX1) gene in tobacco ...

    use

    2011-11-21

    Nov 21, 2011 ... 1School of Chemical Engineering and Technology, Tianjin University, Tianjin, P. R. 300072, ... stronger salt-tolerance than their wild-type counterparts. .... CTAGC-3' (reverse), which amplified an about 1700 bp full-length.

  4. MICGLOGM APLICADA INTERNATIONAL, 15(2), 2003, pp

    Bj

    2012-06-07

    Jun 7, 2012 ... Full Length Research Paper ... Quercus sawdust, 10% corn-cobs, 10% maize stubble, 7% wheat bran and 3% rice meal. The highest yield was ... 70% carbohydrates (cellulose and hemicellulose) and. 27% lignin. Overall ...

  5. Evaluating the production of Ganoderma mushroom on corn cobs

    SAM

    2014-05-28

    May 28, 2014 ... Full Length Research Paper. Evaluating the production ... Key words: Ganoderma, corn cobs, substrate, mushrooms, sawdust, basidiocarp. INTRODUCTION .... those which have high lignin and low cellulose. This is because ...

  6. Degrading capability and activity of extracellular xylanase secreted ...

    DR. NJ TONUKARI

    2012-04-26

    Apr 26, 2012 ... Full Length Research Paper ... Peptone cellulose solution (PCS) medium was beneficial to the ... crude enzyme, and the weight loss of hemicellulose of corn stalk core and ... making the fiber more permeable to lignin removal.

  7. Fenthion induced toxicity and histopathological changes in gill ...

    Tersoo

    2015-06-23

    Jun 23, 2015 ... African Journal of Biotechnology. Full Length ... The present study investigated the toxic effect of fenthion and the ... Studies have demonstrated that exposure of fish to ..... mere stress response of fish to toxicant exposures.

  8. Download this PDF file

    STORAGESEVER

    2008-07-18

    Jul 18, 2008 ... Full Length Research Paper .... The fermenter used was a 10 L mechanically stirred tank bioreactor. (B. Braun ... Comparison of enzyme activities of Aspergillus sp. ... optimize the medium compositions in shake flask cultures.

  9. Screening of thermophilic neutral lipase-producing Pseudomonas ...

    akpobome uruemuesiri

    2013-02-27

    Feb 27, 2013 ... Full Length Research Paper ... The main objective of this research was to isolate and ... liquid-state fermentation in shake flask. ..... lues generated signals, which were large in comparison .... production in a bioreactor. Proc.

  10. Analysis of the Water Resources Potential and Useful Life of the ...

    Full Length R ... Keywords: Shiroro dam reservoir, water resources potential, useful life, hydropower, ... Water balance analysis is a highly effective tool that .... from operation each time the reservoir capacity ..... validity of this research work. iii.

  11. Abordagem toxicológica da C

    Muller

    Full Length Research Paper ... estrogenic activity by increasing the relative weight (%) of the uterus of rats treated at doses of 125, 250 ... assessment of toxicity in pregnancy, the animals were divided into two groups and treated daily with.

  12. Socioeconomic constraints to sustainable cocoyam production in the ...

    AGHOGHO A

    Full Length Research Paper ... 4Makerere University, Department of Crop Science, P. O. Box 7062, ... Cocoyam production, social and economic constraints, Lake Victoria region. .... available throughout the year and is also a stable source.

  13. Optimisation of wheat-sprouted soybean flour bread using response ...

    STORAGESEVER

    2009-11-16

    Nov 16, 2009 ... Full Length Research Paper. Optimisation of ... Victoria A. Jideani1* and Felix C. Onwubali2. 1Department of Food Technology, Cape Peninsula University of Technology, P. O. Box 652, Cape Town 8000, South. Africa.

  14. Molecular characters and recombinant expression of the ...

    user

    2011-03-07

    Mar 7, 2011 ... Full Length Research Paper. Molecular characters ... 1State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of .... Characterization and model building of the 3-D.

  15. Aflatoxin status of some commercial dry dog foods in Ibadan, Nigeria

    Ifeoluwa

    2012-06-28

    Jun 28, 2012 ... ISSN 1684-5315 ©2012 Academic Journals. Full Length Research ... commonly found in corn, peanuts, cottonseed, milk and tree nuts which are ..... Critical Control Point (HACCP) plan for each commodity; genetic breeding of ...

  16. QTL analysis for early yield in a pseudo F2 population of cassava

    SERVER

    2008-01-18

    Jan 18, 2008 ... Full Length Research Paper ... sive and labour intensive, genetic analysis with simple ..... Individual QTL loci are named by trait (abbreviation indicated in titles) and linkage groups. .... Past research in quantitative genetics.

  17. Potential probiotic of Lactobacillus johnsonii LT171 for chicken ...

    STORAGESEVER

    2009-11-02

    Nov 2, 2009 ... ISSN 1684–5315 © 2009 Academic Journals. Full Length Research Paper ... ability to the mucus and antibacterial effects against pathogens is the major .... medium consisting of skim milk (1%) and agar (1.5%). Clear zones.

  18. Genetic transformation of cry1EC gene into cotton (Gossypium ...

    welcome

    2013-04-10

    Apr 10, 2013 ... Full Length Research Paper. Genetic ... This research work was carried out to transform ... were maintained on the same medium till somatic embryos matured. ... of secondary pests, as well as risk to human health and.

  19. Study of root para-nodules formation in wheat (Triticum durum ...

    djemel

    2013-08-28

    Aug 28, 2013 ... African Journal of Biotechnology. Full Length Research ... formed when wheat roots were inoculated with Frankia and the root length was enhanced. When the .... are modified lateral roots with structure enhanced by rhizobial.

  20. Don't Trust the Big Man

    Coerr, Stanton S

    2008-01-01

    .... A full-length analysis of the Democratic Republic of the Congo and its full-scale insurgencies since 1960 -- at the hands of Big Man leaders Lumumba, Mobutu, and Kabila -- provide object lessons...

  1. Cottonseed oil and yield assessment via economic heterosis and ...

    user

    2010-11-01

    Nov 1, 2010 ... ISSN 1684–5315 ©2010 Academic Journals. Full Length ... Key words: Hybrid vigor, inbreeding depression, cottonseed traits, cottonseed oil, Gossypium hirsutum. ... in yield and superior performance than well-adapted.

  2. Haematological characteristics and performance of West African ...

    STORAGESEVER

    2009-02-18

    Feb 18, 2009 ... ISSN 1684–5315 © 2009 Academic Journals. Full Length ... performance of 36 young West African Dwarf (WAD) goats was investigated in order to simulate the .... cause antibody depression, alter white blood cell counts,.

  3. Evaluation of physiological screening techniques for drought ...

    Administrator

    2011-09-26

    Sep 26, 2011 ... ISSN 1684–5315 © 2011 Academic Journals. Full Length ... Canopy temperature depression (CTD) and chlorophyll content (CHL) was used to estimate crop yield .... interested in relative performance since drought stress.

  4. Social and Abnormal Psychology Textbooks: An Objective Analysis.

    Christopher, Andrew N.; Griggs, Richard A.; Hagans, Chad L.

    2000-01-01

    Provides feature and content analyses of 14 social and 17 abnormal psychology full-length textbooks from 1995-98 that are available for undergraduate psychology courses. Provides instructors of these courses a means for more informed text selection. (CMK)

  5. Seasonal variation of meteorological factors on air parameters and ...

    user

    African Journal of Environmental Science and. Technology. Full Length ..... higher volume during dry season and lower volume during rainy .... 224 Afr. J. Environ. Sci. Technol. ..... Procedia - Social and Behavioral Sciences. 1- 5. Babatunde ...

  6. Survey of chemical manure on morphological traits in Iranian Aloe ...

    Administrator

    2011-09-21

    Sep 21, 2011 ... Full Length Research Paper ... 2National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran. ... This experiment was conducted at the Institute of National Genetic Engineering and Biotechnology in.

  7. Molecular characterization and expression of DgZFP1, a gene ...

    USER

    2010-04-12

    Apr 12, 2010 ... Full Length Research Paper. Molecular characterization and ... stem mainly done by removing the auxiliary flower buds. But cultivars as potted ... DgZFP1 by using the first strand cDNA of chrysanthemum as a template.

  8. Evaluation of antioxidant and antibacterial activities of methanolic ...

    Yomi

    2012-05-22

    May 22, 2012 ... Full Length Research Paper ... Department of Studies in Biotechnology, University of Mysore, Manasagangotri, Karnataka India- ... singly at the end of each stem. ..... of oxidizing DNA and causing strand breaks, resulting in.

  9. Dicty_cDB: VFI696 [Dicty_cDB

    Full Text Available GAAGAAAGATTAGAAGATCAACGTGCATANAATCTTTAANAGTTCAAT sequence update 2001.11.24 Translated Amino Acid sequence I...TTATGAAGATGAACAAGAAGAAGGGATTAGAAAATGAAGAAGAAAGATTAGAA GATCAACGTGCATANAATCTTTAANAG...TGAAAGATTC AGGTGAATATGAAAGTTATGAAGATGAACAAGAAGAAGGGATTAGAAAATGAAGAAGAAA GATTAGAAGATCAACGTGCATANAATCTTTAANAGT...TGAAAGTTATGAAGATGAACAAGAAGAAGGGATTAG AAAATGAAGAAGAAAGATTAGAAGATCAACGTGCATANAATCTTTAANAGTTCAAT Length of full length seq. 1196 ...

  10. Journal of Tropical Microbiology and Biotechnology: Editorial Policies

    ... Microbial Physiology, Biochemistry of micro-organisms, Microbial Genetics, Molecular Biology, Bacteriology, Virology, Mycology, and Microbial Systematics. Both full length and short papers reporting original research making a significant contribution to microbiology and Biotechnology will be considered for publication.

  11. Isolation of Genes from Chromosome Region Ip31 Involved in the Development of Breast Cancer

    Cowell, John

    2000-01-01

    .... Using gene analysis tools, we have been able to demonstrate that few full-length genes are located in this region and that the ESTs from the databases are clustered to a proximal position of the contig...

  12. Functional analyses of a flavonol synthase–like gene from Camellia ...

    ACAATCCAGGGCAAGGTC 172-190. ACAATCAGGGCATTAGGG 815-833. CLoning (JF343560). CnFLS-FL. AGGAGTGAGAAGGGGAAAAA 43-62. CAAGACAATGAAACGAGTGAGT. 1106-1127. Full Length cloing. (JF343560). CnFLS-Q. TGGAAGGCAAGAAAGGATGGG. 407-427. CCACCGGAACAACTTGTCTGC 566-585.

  13. under salinity stress

    ajl yemi

    2011-11-14

    Nov 14, 2011 ... Full Length Research Paper. The efficiency ... tiller number, root dry weight and potassium uptake in seeds and shoot significantly decreased with increasing ... or Torkashvand@iaurasht.ac.ir. ..... Country Profiles-WEB. Edition ...

  14. Detection of Bacteroides forsythus and Porphyromonas gingivalis in ...

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... African Journal of Biotechnology Vol. 8 (10), pp. ... Full Length Research Paper. Detection of ... Bacterial strains in the root canals were not easy to be identified by the traditional .... Plaque and calculus were removed from the.

  15. Browse Title Index

    Items 5201 - 5250 of 11090 ... Vol 9, No 15 (2010), Full Length Research Paper Study on the association ... Vol 15, No 34 (2016), Functional properties of milk drinks ... phenolic effluent treatment and electrochemical measurement, Abstract PDF.

  16. Conserved Domain Database (CDD)

    U.S. Department of Health & Human Services — CDD is a protein annotation resource that consists of a collection of well-annotated multiple sequence alignment models for ancient domains and full-length proteins.

  17. A simple and efficient procedure to enhance artemisinin content in ...

    SERVER

    2007-06-18

    Jun 18, 2007 ... Full Length Research Paper. A simple .... The leaf material after the extraction was weighed (to measure the dry ... standard control in the measurement. ..... Ro DK, Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM,.

  18. Schistosoma mansoni INFECTIONS AMONGST SCHOOL ...

    Administrator

    5.00%) of 140 examined at the secondary school category were infected. There were more infections among the secondary school students than their primary school counterparts, though the difference was not significant (p>0.05). Full Length R.

  19. as Sitophilus zeamais (Coleoptera: Curculionidae)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Full Length Research Paper ... and GC co-injections with authentic samples showed the presence of the following ... traces of water. .... y = aLn(x) + b ..... Tipping PW, Mikalajczak EL, Rudringuez JG, Poneleit CG, Legg DE.

  20. Download this PDF file

    Dr Olaleye

    Full Length Research Paper. Cholinergic ... been given much attention; hence this study investigated its role in stress induced neurobehavioral alterations in rats to further .... Ray A, Henke P G (1990): Enkaphalin-dopamine interactions.

  1. Variation in physico-chemical properties of seed of selected ...

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Full Length Research Paper. Variation in ... Key words: Industrial crop, seed physicochemical content, Vigna unduiculata. ..... Cowpea genetics a review of the world literasture. ... Development of improved cowpea varieties.

  2. The root anchorage ability of Salix alba var. tristis using a pull-out test

    user

    2011-11-21

    Nov 21, 2011 ... Full Length Research Paper. The root ... and the University of Natural Resources and applied Life. Sciences ... The design of the apparatus is ..... In The Supporting. Roots of ... Measurements in Geomechanics. Swets and ...

  3. The Biochemistry of atherosclerosis

    Scanu, Angelo M; Getz, Godfrey S; Wissler, Robert W

    1979-01-01

    In this first full-length review of the biochemical parameters and their part in the pathogenesis of atherosclerosis, the reader will discover a range of coverage concerning basic etiological factors...

  4. Butyrylcholinesterase activity in Nigerian type 2 diabetics with and ...

    USER

    2010-06-28

    Jun 28, 2010 ... Full Length Research Paper. Butyrylcholinesterase ... Type 2 diabetes mellitus is a chronic progressive disease typified by a loss of glycaemic control over time as the ..... susceptibility locus on chromosome position 3q27 but.

  5. Azadirachta indica, Vernonia amygdalina and Go

    STORAGESEVER

    2009-09-15

    Sep 15, 2009 ... Full Length Research Paper. Comparative ... tree (1-3 m high) that grows throughout tropical Africa and has ... plants that places them at advantage position over and ... ses such as diabetes mellitus (Tiwari and Rao, 2002).

  6. Acute toxicity, lipid peroxidation and ameliorative properties of ...

    OKEY

    2014-01-29

    Jan 29, 2014 ... Full Length Research Paper. Acute toxicity ... Diabetes mellitus represents a group of metabolic ... Figure 1. Pictorial view of Alstonia boonei leaves (Sidiyasa, 1998). ..... The position of hydroxyl groups and other features in the.

  7. Cadmium, lead, arsenic and selenium levels in patients with type 2 ...

    ONOS

    2010-08-09

    Aug 9, 2010 ... Full Length Research Paper. Cadmium, lead, arsenic ... Increasing rates of type 2 diabetes in the developed and developing countries ... Measurement of height was taken in standing position using a stadiometer. The height ...

  8. Development of Targeted Therapeutic Agents for Botulism

    Dolly, Oliver

    1998-01-01

    .... Therefore, an ELISA was optimised and standardised for measuring their proteolysis of immobilised, bacterially-expressed SNAP-25, using purified IgGs reactive solely with full-length or BoNT/A-truncated SNAP-25...

  9. Establishment of the callus and cell suspension culture of ...

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... Full Length Research Paper. Establishment of the callus ... study provided an efficient way for E. angustifolia cell suspension culture to produce secondary metabolite. .... was also observed that in these treatments the stem.

  10. Analysis of genetic relationships of mulberry (Morus L.) germplasm ...

    STORAGESEVER

    2009-06-03

    Jun 3, 2009 ... Full Length Research Paper. Analysis of genetic ... Key words: Mulberry, molecular marker, genetic diversity, SRAP. ... Europe, North and South America, and Africa, and it is cultivated ... Xingjiang autonomous region, China.

  11. One Family's Struggles with Hepatitis B

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  12. One Family's Struggles with HPV (Human Papillomavirus)

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  13. One Family's Struggle with Chickenpox

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  14. One Family's Struggles with Rotavirus

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  15. One Family's Struggles with Pertussis (Whooping Cough)

    Full Text Available ... kids estate planning find a doctor find health information helpful articles antibiotics colds fevers injection tips sports ... Transcripts Full-length transcript PDF Important disclaimer : The information on pkids.org is for educational purposes only ...

  16. Effect of various amino acids on shoot regeneration of sugarcane ...

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... Full Length Research Paper. Effect of various amino acids .... maize, sorghum, pineapple, rice and other monocots to enhance somatic ... without additional amino acids, making a total of 26 treatments. All culture media were ...

  17. Taxonomic studies of nodulated leguminous weeds from the flora of ...

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... African Journal of Biotechnology Vol. ... Full Length Research Paper ... species which grow in agricultural and non-agricultural fields of ..... India; Nepal; ..... National Training Course. Pak. Agric. Res. Council,. Islamabad. p. 29.

  18. Bioinformatics and phylogenetic analysis of human Tp73 gene

    Imtiaz

    2013-06-26

    Jun 26, 2013 ... Evolutionary studies are of principal importance in the field of ... assigned with pre dominant expression of anti apoptotic, .... RIKEN full-length enriched library, clone:5430439E07 product:transformation ..... accelerated aging.

  19. Transfusion transmitted malaria in three major blood banks of ...

    USER

    2010-08-16

    Aug 16, 2010 ... Full Length Research Paper ... waste products from these tissues in the body. There is ... person. In transfusion, the recipients receive whole blood or parts .... under microscope using 100x objectives with oil immersion. Slides.

  20. In vivo antiplasmodial effect of chloroform extracts of Artemisia ...

    PRECIOUS

    2009-12-01

    Dec 1, 2009 ... Full Length Research Paper. In vivo antiplasmodial effect of ... responsible for over a million deaths each year (Breman,. 2001). In tropical and ... A major breakthrough of the past decades has been the discovery by Chinese ...