WorldWideScience

Sample records for hard agar minimal

  1. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  2. NP-hardness of the cluster minimization problem revisited

    Science.gov (United States)

    Adib, Artur B.

    2005-10-01

    The computational complexity of the 'cluster minimization problem' is revisited (Wille and Vennik 1985 J. Phys. A: Math. Gen. 18 L419). It is argued that the original NP-hardness proof does not apply to pairwise potentials of physical interest, such as those that depend on the geometric distance between the particles. A geometric analogue of the original problem is formulated, and a new proof for such potentials is provided by polynomial time transformation from the independent set problem for unit disk graphs. Limitations of this formulation are pointed out, and new subproblems that bear more direct consequences to the numerical study of clusters are suggested.

  3. NP-hardness of the cluster minimization problem revisited

    International Nuclear Information System (INIS)

    Adib, Artur B

    2005-01-01

    The computational complexity of the 'cluster minimization problem' is revisited (Wille and Vennik 1985 J. Phys. A: Math. Gen. 18 L419). It is argued that the original NP-hardness proof does not apply to pairwise potentials of physical interest, such as those that depend on the geometric distance between the particles. A geometric analogue of the original problem is formulated, and a new proof for such potentials is provided by polynomial time transformation from the independent set problem for unit disk graphs. Limitations of this formulation are pointed out, and new subproblems that bear more direct consequences to the numerical study of clusters are suggested

  4. NP-hardness of the cluster minimization problem revisited

    Energy Technology Data Exchange (ETDEWEB)

    Adib, Artur B [Physics Department, Brown University, Providence, RI 02912 (United States)

    2005-10-07

    The computational complexity of the 'cluster minimization problem' is revisited (Wille and Vennik 1985 J. Phys. A: Math. Gen. 18 L419). It is argued that the original NP-hardness proof does not apply to pairwise potentials of physical interest, such as those that depend on the geometric distance between the particles. A geometric analogue of the original problem is formulated, and a new proof for such potentials is provided by polynomial time transformation from the independent set problem for unit disk graphs. Limitations of this formulation are pointed out, and new subproblems that bear more direct consequences to the numerical study of clusters are suggested.

  5. Minimalism

    CERN Document Server

    Obendorf, Hartmut

    2009-01-01

    The notion of Minimalism is proposed as a theoretical tool supporting a more differentiated understanding of reduction and thus forms a standpoint that allows definition of aspects of simplicity. This book traces the development of minimalism, defines the four types of minimalism in interaction design, and looks at how to apply it.

  6. Hard dental tissue minimal-invasive preparation using contemporary polymer rotating instruments and laser

    Directory of Open Access Journals (Sweden)

    Beloica Miloš

    2014-01-01

    Full Text Available Goal of contemporary dentistry is to decrease the patient’s discomfort during treatment. Dentists aim to achieve maximum with the newly developed dental materials as well as with new cavity preparation techniques in the shortest time span. Since the development of the first constructed borer (drilling machine for caries removal, the preparation techniques have considerably changed. The progress of dental materials as well as the cavity preparation techniques has led us to contemporary carbide tungsten and diamond borers that are used with obligatory water cooling. The innovation within this field represents newly developed polymer borers that can detect the difference between carious lesions and healthy tooth structure. In this way the cavity preparation may be performed without damaging dental healthy tissue. This is possible owing to their hardness which is lower than the hardness of intact dentin. Polymer borer preparation is painless with less vibration, while the increase in temperature is negligible. Lasers have been used in clinical dentistry since 1980s so it can be said that they represent a new technology. The function of lasers is based on ablation which requires water. Erbium lasers have shown the highest potential with their ability to produce effective ablation of hard dental tissues. Laser application in dentistry requires special training as well as some protective measures. Laser advantages, compared to traditional preparation techniques, involve the absence of vibration, painless preparation, possibility of preparation without anesthetic and easier patient’s adjustment to dental intervention which is of importance, especially in pediatric dentistry. [Projekat Ministarstva nauke Republike Srbije, br. 46009

  7. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  8. The Use of Wetting Agents/Fume Supressants for Minimizing the Atmospheric Emissions from Hard Chromium Electroplating Baths

    Science.gov (United States)

    2003-08-01

    Accreditation (A2LA) for compliance with ISO 9001, Quality Systems - Model for Quality Assurance in Design, Development, Production, Installation and Servicing...All samples handling and testing at Patuxent River laboratory is ISO 9001 compliant. Appendix D, Table 1, 2, and 4 outline the test methods...HCF 0.1 4 3 8583 ± 288 8257/8909 8155/9012 1 TEST (N = 44090 CYCLES) TREATED AS AN OUTLIER. EXTRA HARD CHROME WITH FUME SUPPRESSANT HCF -1 4 4

  9. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  10. Standard Practice for Minimizing Dosimetry Errors in Radiation Hardness Testing of Silicon Electronic Devices Using Co-60 Sources

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This practice covers recommended procedures for the use of dosimeters, such as thermoluminescent dosimeters (TLD's), to determine the absorbed dose in a region of interest within an electronic device irradiated using a Co-60 source. Co-60 sources are commonly used for the absorbed dose testing of silicon electronic devices. Note 1—This absorbed-dose testing is sometimes called “total dose testing” to distinguish it from “dose rate testing.” Note 2—The effects of ionizing radiation on some types of electronic devices may depend on both the absorbed dose and the absorbed dose rate; that is, the effects may be different if the device is irradiated to the same absorbed-dose level at different absorbed-dose rates. Absorbed-dose rate effects are not covered in this practice but should be considered in radiation hardness testing. 1.2 The principal potential error for the measurement of absorbed dose in electronic devices arises from non-equilibrium energy deposition effects in the vicinity o...

  11. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  12. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  13. Work Hard / Play Hard

    OpenAIRE

    Burrows, J.; Johnson, V.; Henckel, D.

    2016-01-01

    Work Hard / Play Hard was a participatory performance/workshop or CPD experience hosted by interdisciplinary arts atelier WeAreCodeX, in association with AntiUniversity.org. As a socially/economically engaged arts practice, Work Hard / Play Hard challenged employees/players to get playful, or go to work. 'The game changes you, you never change the game'. Employee PLAYER A 'The faster the better.' Employer PLAYER B

  14. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  15. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  16. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  17. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  18. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  19. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  20. Hard electronics; Hard electronics

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    Hard material technologies were surveyed to establish the hard electronic technology which offers superior characteristics under hard operational or environmental conditions as compared with conventional Si devices. The following technologies were separately surveyed: (1) The device and integration technologies of wide gap hard semiconductors such as SiC, diamond and nitride, (2) The technology of hard semiconductor devices for vacuum micro- electronics technology, and (3) The technology of hard new material devices for oxides. The formation technology of oxide thin films made remarkable progress after discovery of oxide superconductor materials, resulting in development of an atomic layer growth method and mist deposition method. This leading research is expected to solve such issues difficult to be easily realized by current Si technology as high-power, high-frequency and low-loss devices in power electronics, high temperature-proof and radiation-proof devices in ultimate electronics, and high-speed and dense- integrated devices in information electronics. 432 refs., 136 figs., 15 tabs.

  1. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  2. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  3. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  5. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  6. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  7. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  8. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  9. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  10. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  11. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  12. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  13. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  14. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  15. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  16. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  17. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  18. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  19. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  1. Minimal surfaces

    CERN Document Server

    Dierkes, Ulrich; Sauvigny, Friedrich; Jakob, Ruben; Kuster, Albrecht

    2010-01-01

    Minimal Surfaces is the first volume of a three volume treatise on minimal surfaces (Grundlehren Nr. 339-341). Each volume can be read and studied independently of the others. The central theme is boundary value problems for minimal surfaces. The treatise is a substantially revised and extended version of the monograph Minimal Surfaces I, II (Grundlehren Nr. 295 & 296). The first volume begins with an exposition of basic ideas of the theory of surfaces in three-dimensional Euclidean space, followed by an introduction of minimal surfaces as stationary points of area, or equivalently

  2. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  3. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  4. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  5. Standard hardness conversion tables for metals relationship among brinell hardness, vickers hardness, rockwell hardness, superficial hardness, knoop hardness, and scleroscope hardness

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2007-01-01

    1.1 Conversion Table 1 presents data in the Rockwell C hardness range on the relationship among Brinell hardness, Vickers hardness, Rockwell hardness, Rockwell superficial hardness, Knoop hardness, and Scleroscope hardness of non-austenitic steels including carbon, alloy, and tool steels in the as-forged, annealed, normalized, and quenched and tempered conditions provided that they are homogeneous. 1.2 Conversion Table 2 presents data in the Rockwell B hardness range on the relationship among Brinell hardness, Vickers hardness, Rockwell hardness, Rockwell superficial hardness, Knoop hardness, and Scleroscope hardness of non-austenitic steels including carbon, alloy, and tool steels in the as-forged, annealed, normalized, and quenched and tempered conditions provided that they are homogeneous. 1.3 Conversion Table 3 presents data on the relationship among Brinell hardness, Vickers hardness, Rockwell hardness, Rockwell superficial hardness, and Knoop hardness of nickel and high-nickel alloys (nickel content o...

  6. Hard coatings

    International Nuclear Information System (INIS)

    Dan, J.P.; Boving, H.J.; Hintermann, H.E.

    1993-01-01

    Hard, wear resistant and low friction coatings are presently produced on a world-wide basis, by different processes such as electrochemical or electroless methods, spray technologies, thermochemical, CVD and PVD. Some of the most advanced processes, especially those dedicated to thin film depositions, basically belong to CVD or PVD technologies, and will be looked at in more detail. The hard coatings mainly consist of oxides, nitrides, carbides, borides or carbon. Over the years, many processes have been developed which are variations and/or combinations of the basic CVD and PVD methods. The main difference between these two families of deposition techniques is that the CVD is an elevated temperature process (≥ 700 C), while the PVD on the contrary, is rather a low temperature process (≤ 500 C); this of course influences the choice of substrates and properties of the coating/substrate systems. Fundamental aspects of the vapor phase deposition techniques and some of their influences on coating properties will be discussed, as well as the very important interactions between deposit and substrate: diffusions, internal stress, etc. Advantages and limitations of CVD and PVD respectively will briefly be reviewed and examples of applications of the layers will be given. Parallel to the development and permanent updating of surface modification technologies, an effort was made to create novel characterisation methods. A close look will be given to the coating adherence control by means of the scratch test, at the coating hardness measurement by means of nanoindentation, at the coating wear resistance by means of a pin-on-disc tribometer, and at the surface quality evaluation by Atomic Force Microscopy (AFM). Finally, main important trends will be highlighted. (orig.)

  7. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  8. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  9. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  10. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  11. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  12. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  13. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  14. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  15. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  16. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  17. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  18. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  19. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  1. Taxonomic minimalism.

    Science.gov (United States)

    Beattle, A J; Oliver, I

    1994-12-01

    Biological surveys are in increasing demand while taxonomic resources continue to decline. How much formal taxonomy is required to get the job done? The answer depends on the kind of job but it is possible that taxonomic minimalism, especially (1) the use of higher taxonomic ranks, (2) the use of morphospecies rather than species (as identified by Latin binomials), and (3) the involvement of taxonomic specialists only for training and verification, may offer advantages for biodiversity assessment, environmental monitoring and ecological research. As such, formal taxonomy remains central to the process of biological inventory and survey but resources may be allocated more efficiently. For example, if formal Identification is not required, resources may be concentrated on replication and increasing sample sizes. Taxonomic minimalism may also facilitate the inclusion in these activities of important but neglected groups, especially among the invertebrates, and perhaps even microorganisms. Copyright © 1994. Published by Elsevier Ltd.

  2. Zirconium nitride hard coatings

    International Nuclear Information System (INIS)

    Roman, Daiane; Amorim, Cintia Lugnani Gomes de; Soares, Gabriel Vieira; Figueroa, Carlos Alejandro; Baumvol, Israel Jacob Rabin; Basso, Rodrigo Leonardo de Oliveira

    2010-01-01

    Zirconium nitride (ZrN) nanometric films were deposited onto different substrates, in order to study the surface crystalline microstructure and also to investigate the electrochemical behavior to obtain a better composition that minimizes corrosion reactions. The coatings were produced by physical vapor deposition (PVD). The influence of the nitrogen partial pressure, deposition time and temperature over the surface properties was studied. Rutherford backscattering spectrometry (RBS), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), scanning electron microscopy (SEM) and corrosion experiments were performed to characterize the ZrN hard coatings. The ZrN films properties and microstructure changes according to the deposition parameters. The corrosion resistance increases with temperature used in the films deposition. Corrosion tests show that ZrN coating deposited by PVD onto titanium substrate can improve the corrosion resistance. (author)

  3. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  4. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  5. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  6. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  7. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  8. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  9. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  10. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  11. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  12. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  13. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  14. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  15. Two-dimensional network formation of cardiac myocytes in agar microculture chip with 1480 nm infrared laser photo-thermal etching.

    Science.gov (United States)

    Kojima, Kensuke; Moriguchi, Hiroyuki; Hattori, Akihiro; Kaneko, Tomoyuki; Yasuda, Kenji

    2003-11-01

    We have developed a new method that enables agar microstructures to be used to cultivate cells and that allows cell network patterns to be controlled. The method makes use of non-contact three-dimensional photo-thermal etching with a 1480 nm infrared focused laser beam, which is strongly absorbed by water and agar gel, to form the shapes of agar microstructures. It allows microstructures to be easily formed in an agar layer within a few minutes, with cell-culture holes formed by the spot heating of a 100 mW laser and tunnels by the tracing of a 100 microm s(-1), 40 mW laser. We cultivated rat cardiac myocytes in adjacent microstructures and observed synchronized beating in them 90 min after they had made physical contact. Our results indicate that the system can make and use microstructures for cell-network cultivation in a minimal amount of time without any expensive microfabrication facilities or complicated procedures.

  16. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  17. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  18. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  19. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  20. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  1. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  3. The minimally tuned minimal supersymmetric standard model

    International Nuclear Information System (INIS)

    Essig, Rouven; Fortin, Jean-Francois

    2008-01-01

    The regions in the Minimal Supersymmetric Standard Model with the minimal amount of fine-tuning of electroweak symmetry breaking are presented for general messenger scale. No a priori relations among the soft supersymmetry breaking parameters are assumed and fine-tuning is minimized with respect to all the important parameters which affect electroweak symmetry breaking. The superpartner spectra in the minimally tuned region of parameter space are quite distinctive with large stop mixing at the low scale and negative squark soft masses at the high scale. The minimal amount of tuning increases enormously for a Higgs mass beyond roughly 120 GeV

  4. Comprehensive hard materials

    CERN Document Server

    2014-01-01

    Comprehensive Hard Materials deals with the production, uses and properties of the carbides, nitrides and borides of these metals and those of titanium, as well as tools of ceramics, the superhard boron nitrides and diamond and related compounds. Articles include the technologies of powder production (including their precursor materials), milling, granulation, cold and hot compaction, sintering, hot isostatic pressing, hot-pressing, injection moulding, as well as on the coating technologies for refractory metals, hard metals and hard materials. The characterization, testing, quality assurance and applications are also covered. Comprehensive Hard Materials provides meaningful insights on materials at the leading edge of technology. It aids continued research and development of these materials and as such it is a critical information resource to academics and industry professionals facing the technological challenges of the future. Hard materials operate at the leading edge of technology, and continued res...

  5. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  6. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  7. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  8. In vitro susceptibility of filamentous fungi to copper nanoparticles assessed by rapid XTT colorimetry and agar dilution method.

    Science.gov (United States)

    Ghasemian, E; Naghoni, A; Tabaraie, B; Tabaraie, T

    2012-12-01

    Metal nanoparticles and their uses in various aspects have recently drawn a great deal of attention. One of the major applications is that it can be used as an antimicrobial agent. They can be considered in approaches targeted to decrease the harms caused by microorganisms, specifically fungi, threatening the medical and industrial areas. The aim of this study was to investigate the antifungal activity of synthesized copper nanoparticles (CuNPs) against four filamentous fungi including Alternaria alternata, Aspergillus flavus, Fusarium solani, and Penicillium chrysogenum. Zerovalent copper nanoparticles of mean size 8nm were synthesized by inert gas condensation (IGC) method. The antifungal activity of these synthesized copper nanoparticles was measured against selected fungi by using two different techniques including agar dilution method and XTT reduction assay. The minimal inhibitory concentrations (MICs) for copper nanoparticles by agar dilution method were less or equal to 40mg/L for P. chrysogenum, less or equal to 60mg/L for A. alternata, less or equal to 60mg/L for F. solani, and less or equal to 80mg/L for A. flavus. And also MICs obtained by XTT reduction assay ranged from 40 to 80mg/L. Our data demonstrated that the copper nanoparticles inhibited fungal growth, but the fungal sensitivity to copper nanoparticles varies depending on the fungal species. Therefore, it is advisable that the minimal inhibitory concentrations (MICs) be examined before using these compounds. It is hoped that, in future, copper nanoparticles could replace some antifungal agents, making them applicable to many different medical devices and antimicrobial control system. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. The minimal non-minimal standard model

    International Nuclear Information System (INIS)

    Bij, J.J. van der

    2006-01-01

    In this Letter I discuss a class of extensions of the standard model that have a minimal number of possible parameters, but can in principle explain dark matter and inflation. It is pointed out that the so-called new minimal standard model contains a large number of parameters that can be put to zero, without affecting the renormalizability of the model. With the extra restrictions one might call it the minimal (new) non-minimal standard model (MNMSM). A few hidden discrete variables are present. It is argued that the inflaton should be higher-dimensional. Experimental consequences for the LHC and the ILC are discussed

  10. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  11. Induced spherococcoid hard wheat

    International Nuclear Information System (INIS)

    Yanev, Sh.

    1981-01-01

    A mutant has been obtained - a spheroccocoid line -through irradiation of hard wheat seed with fast neutrons. It is distinguished by semispherical glumes and smaller grain; the plants have low stem with erect leaves but with shorter spikes and with lesser number of spikelets than those of the initial cultivar. Good productive tillering and resistance to lodging contributed to 23.5% higher yield. The line was superior to the standard and the initial cultivars by 14.2% as regards protein content, and by up to 22.8% - as to flour gluten. It has been successfully used in hybridization producing high-yielding hard wheat lines resistant to lodging, with good technological and other indicators. The possibility stated is of obtaining a spherococcoid mutant in tetraploid (hard) wheat out of the D-genome as well as its being suited to hard wheat breeding to enhance protein content, resistance to lodging, etc. (author)

  12. Hard probes 2006 Asilomar

    CERN Multimedia

    2006-01-01

    "The second international conference on hard and electromagnetic probes of high-energy nuclear collisions was held June 9 to 16, 2006 at the Asilomar Conference grounds in Pacific Grove, California" (photo and 1/2 page)

  13. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  14. Hard coal; Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Loo, Kai van de; Sitte, Andreas-Peter [Gesamtverband Steinkohle e.V., Herne (Germany)

    2013-04-01

    The year 2012 benefited from a growth of the consumption of hard coal at the national level as well as at the international level. Worldwide, the hard coal still is the number one energy source for power generation. This leads to an increasing demand for power plant coal. In this year, the conversion of hard coal into electricity also increases in this year. In contrast to this, the demand for coking coal as well as for coke of the steel industry is still declining depending on the market conditions. The enhanced utilization of coal for the domestic power generation is due to the reduction of the nuclear power from a relatively bad year for wind power as well as reduced import prices and low CO{sub 2} prices. Both justify a significant price advantage for coal in comparison to the utilisation of natural gas in power plants. This was mainly due to the price erosion of the inexpensive US coal which partly was replaced by the expansion of shale gas on the domestic market. As a result of this, the inexpensive US coal looked for an outlet for sales in Europe. The domestic hard coal has continued the process of adaptation and phase-out as scheduled. Two further hard coal mines were decommissioned in the year 2012. RAG Aktiengesellschaft (Herne, Federal Republic of Germany) running the hard coal mining in this country begins with the preparations for the activities after the time of mining.

  15. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  16. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  17. Hard Spheres on the Primitive Surface

    Science.gov (United States)

    Dotera, Tomonari; Takahashi, Yusuke

    2015-03-01

    Recently hierarchical structures associated with the gyroid in several soft-matter systems have been reported. One of fundamental questions is regular arrangement or tiling on minimal surfaces. We have found certain numbers of hard spheres per unit cell on the gyroid surface are entropically self-organized. Here, new results for the primitive surface are presented. 56/64/72 per unit cell on the primitive minimal surface are entropically self-organized. Numerical evidences for the fluid-solid transition as a function of hard sphere radius are obtained in terms of the acceptance ratio of Monte Carlo moves and order parameters. These arrangements, which are the extensions of the hexagonal arrangement on a flat surface, can be viewed as hyperbolic tiling on the Poincaré disk with a negative Gaussian curvature.

  18. Minimally processed vegetable salads: microbial quality evaluation.

    Science.gov (United States)

    Fröder, Hans; Martins, Cecília Geraldes; De Souza, Katia Leani Oliveira; Landgraf, Mariza; Franco, Bernadette D G M; Destro, Maria Teresa

    2007-05-01

    The increasing demand for fresh fruits and vegetables and for convenience foods is causing an expansion of the market share for minimally processed vegetables. Among the more common pathogenic microorganisms that can be transmitted to humans by these products are Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella. The aim of this study was to evaluate the microbial quality of a selection of minimally processed vegetables. A total of 181 samples of minimally processed leafy salads were collected from retailers in the city of Sao Paulo, Brazil. Counts of total coliforms, fecal coliforms, Enterobacteriaceae, psychrotrophic microorganisms, and Salmonella were conducted for 133 samples. L. monocytogenes was assessed in 181 samples using the BAX System and by plating the enrichment broth onto Palcam and Oxford agars. Suspected Listeria colonies were submitted to classical biochemical tests. Populations of psychrotrophic microorganisms >10(6) CFU/g were found in 51% of the 133 samples, and Enterobacteriaceae populations between 10(5) and 106 CFU/g were found in 42% of the samples. Fecal coliform concentrations higher than 10(2) CFU/g (Brazilian standard) were found in 97 (73%) of the samples, and Salmonella was detected in 4 (3%) of the samples. Two of the Salmonella-positive samples had minimally processed vegetables had poor microbiological quality, and these products could be a vehicle for pathogens such as Salmonella and L. monocytogenes.

  19. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  20. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  1. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  2. Soft and hard pomerons

    International Nuclear Information System (INIS)

    Maor, Uri; Tel Aviv Univ.

    1995-09-01

    The role of s-channel unitarity screening corrections, calculated in the eikonal approximation, is investigated for soft Pomeron exchange responsible for elastic and diffractive hadron scattering in the high energy limit. We examine the differences between our results and those obtained from the supercritical Pomeron-Regge model with no such corrections. It is shown that screening saturation is attained at different scales for different channels. We then proceed to discuss the new HERA data on hard (PQCD) Pomeron diffractive channels and discuss the relationship between the soft and hard Pomerons and the relevance of our analysis to this problem. (author). 18 refs, 9 figs, 1 tab

  3. Hard exclusive QCD processes

    Energy Technology Data Exchange (ETDEWEB)

    Kugler, W.

    2007-01-15

    Hard exclusive processes in high energy electron proton scattering offer the opportunity to get access to a new generation of parton distributions, the so-called generalized parton distributions (GPDs). This functions provide more detailed informations about the structure of the nucleon than the usual PDFs obtained from DIS. In this work we present a detailed analysis of exclusive processes, especially of hard exclusive meson production. We investigated the influence of exclusive produced mesons on the semi-inclusive production of mesons at fixed target experiments like HERMES. Further we give a detailed analysis of higher order corrections (NLO) for the exclusive production of mesons in a very broad range of kinematics. (orig.)

  4. Hard-hat day

    CERN Multimedia

    2003-01-01

    CERN will be organizing a special information day on Friday, 27th June, designed to promote the wearing of hard hats and ensure that they are worn correctly. A new prevention campaign will also be launched.The event will take place in the hall of the Main Building from 11.30 a.m. to 2.00 p.m., when you will be able to come and try on various models of hard hat, including some of the very latest innovative designs, ask questions and pass on any comments and suggestions.

  5. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  6. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  9. Hard times; Schwere Zeiten

    Energy Technology Data Exchange (ETDEWEB)

    Grunwald, Markus

    2012-10-02

    The prices of silicon and solar wafers keep dropping. According to market research specialist IMS research, this is the result of weak traditional solar markets and global overcapacities. While many manufacturers are facing hard times, big producers of silicon are continuing to expand.

  10. Hardness of Clustering

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Hardness of Clustering. Both k-means and k-medians intractable (when n and d are both inputs even for k =2). The best known deterministic algorithms. are based on Voronoi partitioning that. takes about time. Need for approximation – “close” to optimal.

  11. Rock-hard coatings

    OpenAIRE

    Muller, M.

    2007-01-01

    Aircraft jet engines have to be able to withstand infernal conditions. Extreme heat and bitter cold tax coatings to the limit. Materials expert Dr Ir. Wim Sloof fits atoms together to develop rock-hard coatings. The latest invention in this field is known as ceramic matrix composites. Sloof has signed an agreement with a number of parties to investigate this material further.

  12. Rock-hard coatings

    NARCIS (Netherlands)

    Muller, M.

    2007-01-01

    Aircraft jet engines have to be able to withstand infernal conditions. Extreme heat and bitter cold tax coatings to the limit. Materials expert Dr Ir. Wim Sloof fits atoms together to develop rock-hard coatings. The latest invention in this field is known as ceramic matrix composites. Sloof has

  13. Hardness and excitation energy

    Indian Academy of Sciences (India)

    It is shown that the first excitation energy can be given by the Kohn-Sham hardness (i.e. the energy difference of the ground-state lowest unoccupied and highest occupied levels) plus an extra term coming from the partial derivative of the ensemble exchange-correlation energy with respect to the weighting factor in the ...

  14. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  15. Regularity of Minimal Surfaces

    CERN Document Server

    Dierkes, Ulrich; Tromba, Anthony J; Kuster, Albrecht

    2010-01-01

    "Regularity of Minimal Surfaces" begins with a survey of minimal surfaces with free boundaries. Following this, the basic results concerning the boundary behaviour of minimal surfaces and H-surfaces with fixed or free boundaries are studied. In particular, the asymptotic expansions at interior and boundary branch points are derived, leading to general Gauss-Bonnet formulas. Furthermore, gradient estimates and asymptotic expansions for minimal surfaces with only piecewise smooth boundaries are obtained. One of the main features of free boundary value problems for minimal surfaces is t

  16. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  17. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  18. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  19. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  20. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  1. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  2. Hard Copy Market Overview

    Science.gov (United States)

    Testan, Peter R.

    1987-04-01

    A number of Color Hard Copy (CHC) market drivers are currently indicating strong growth in the use of CHC technologies for the business graphics marketplace. These market drivers relate to product, software, color monitors and color copiers. The use of color in business graphics allows more information to be relayed than is normally the case in a monochrome format. The communicative powers of full-color computer generated output in the business graphics application area will continue to induce end users to desire and require color in their future applications. A number of color hard copy technologies will be utilized in the presentation graphics arena. Thermal transfer, ink jet, photographic and electrophotographic technologies are all expected to be utilized in the business graphics presentation application area in the future. Since the end of 1984, the availability of color application software packages has grown significantly. Sales revenue generated by business graphics software is expected to grow at a compound annual growth rate of just over 40 percent to 1990. Increased availability of packages to allow the integration of text and graphics is expected. Currently, the latest versions of page description languages such as Postscript, Interpress and DDL all support color output. The use of color monitors will also drive the demand for color hard copy in the business graphics market place. The availability of higher resolution screens is allowing color monitors to be easily used for both text and graphics applications in the office environment. During 1987, the sales of color monitors are expected to surpass the sales of monochrome monitors. Another major color hard copy market driver will be the color copier. In order to take advantage of the communications power of computer generated color output, multiple copies are required for distribution. Product introductions of a new generation of color copiers is now underway with additional introductions expected

  3. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  4. Hard Electromagnetic Processes

    International Nuclear Information System (INIS)

    Richard, F.

    1987-09-01

    Among hard electromagnetic processes, I will use the most recent data and focus on quantitative test of QCD. More specifically, I will retain two items: - hadroproduction of direct photons, - Drell-Yan. In addition, I will briefly discuss a recent analysis of ISR data obtained with AFS (Axial Field Spectrometer) which sheds a new light on the e/π puzzle at low P T

  5. Minimally invasive orthognathic surgery.

    Science.gov (United States)

    Resnick, Cory M; Kaban, Leonard B; Troulis, Maria J

    2009-02-01

    Minimally invasive surgery is defined as the discipline in which operative procedures are performed in novel ways to diminish the sequelae of standard surgical dissections. The goals of minimally invasive surgery are to reduce tissue trauma and to minimize bleeding, edema, and injury, thereby improving the rate and quality of healing. In orthognathic surgery, there are two minimally invasive techniques that can be used separately or in combination: (1) endoscopic exposure and (2) distraction osteogenesis. This article describes the historical developments of the fields of orthognathic surgery and minimally invasive surgery, as well as the integration of the two disciplines. Indications, techniques, and the most current outcome data for specific minimally invasive orthognathic surgical procedures are presented.

  6. Correlates of minimal dating.

    Science.gov (United States)

    Leck, Kira

    2006-10-01

    Researchers have associated minimal dating with numerous factors. The present author tested shyness, introversion, physical attractiveness, performance evaluation, anxiety, social skill, social self-esteem, and loneliness to determine the nature of their relationships with 2 measures of self-reported minimal dating in a sample of 175 college students. For women, shyness, introversion, physical attractiveness, self-rated anxiety, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. For men, physical attractiveness, observer-rated social skill, social self-esteem, and loneliness correlated with 1 or both measures of minimal dating. The patterns of relationships were not identical for the 2 indicators of minimal dating, indicating the possibility that minimal dating is not a single construct as researchers previously believed. The present author discussed implications and suggestions for future researchers.

  7. Hexavalent Chromium Minimization Strategy

    Science.gov (United States)

    2011-05-01

    Logistics 4 Initiative - DoD Hexavalent Chromium Minimization Non- Chrome Primer IIEXAVAJ ENT CHRO:M I~UMI CHROMIUM (VII Oil CrfVli.J CANCEfl HAnRD CD...Management Office of the Secretary of Defense Hexavalent Chromium Minimization Strategy Report Documentation Page Form ApprovedOMB No. 0704-0188...00-2011 4. TITLE AND SUBTITLE Hexavalent Chromium Minimization Strategy 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6

  8. Minimal Super Technicolor

    DEFF Research Database (Denmark)

    Antola, M.; Di Chiara, S.; Sannino, F.

    2011-01-01

    We introduce novel extensions of the Standard Model featuring a supersymmetric technicolor sector (supertechnicolor). As the first minimal conformal supertechnicolor model we consider N=4 Super Yang-Mills which breaks to N=1 via the electroweak interactions. This is a well defined, economical......, between unparticle physics and Minimal Walking Technicolor. We consider also other N =1 extensions of the Minimal Walking Technicolor model. The new models allow all the standard model matter fields to acquire a mass....

  9. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  10. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  11. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  13. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  14. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  15. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  16. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  17. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  18. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  19. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  20. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  1. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  2. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  3. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  4. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  5. Isotropic-nematic transition in a mixture of hard spheres and hard spherocylinders: scaled particle theory description

    Directory of Open Access Journals (Sweden)

    M.F. Holovko

    2017-12-01

    Full Text Available The scaled particle theory is developed for the description of thermodynamical properties of a mixture of hard spheres and hard spherocylinders. Analytical expressions for free energy, pressure and chemical potentials are derived. From the minimization of free energy, a nonlinear integral equation for the orientational singlet distribution function is formulated. An isotropic-nematic phase transition in this mixture is investigated from the bifurcation analysis of this equation. It is shown that with an increase of concentration of hard spheres, the total packing fraction of a mixture on phase boundaries slightly increases. The obtained results are compared with computer simulations data.

  6. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  7. Minimizing Mutual Couping

    DEFF Research Database (Denmark)

    2010-01-01

    Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna.......Disclosed herein are techniques, systems, and methods relating to minimizing mutual coupling between a first antenna and a second antenna....

  8. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail; Pottmann, Helmut; Grohs, Philipp

    2011-01-01

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ

  9. Non-minimally coupled tachyon and inflation

    International Nuclear Information System (INIS)

    Piao Yunsong; Huang Qingguo; Zhang Xinmin; Zhang Yuanzhong

    2003-01-01

    In this Letter, we consider a model of tachyon with a non-minimal coupling to gravity and study its cosmological effects. Regarding inflation, we show that only for a specific coupling of tachyon to gravity this model satisfies observations and solves various problems which exist in the single and multi tachyon inflation models. But noting in the string theory the coupling coefficient of tachyon to gravity is of order g s , which in general is very small, we can hardly expect that the non-minimally coupling of tachyon to gravity could provide a reasonable tachyon inflation scenario. Our work may be a meaningful try for the cosmological effect of tachyon non-minimally coupled to gravity

  10. Microanalysis of Organic Pigments in Ancient Textiles by Surface-Enhanced Raman Scattering on Agar Gel Matrices

    Directory of Open Access Journals (Sweden)

    Marilena Ricci

    2016-01-01

    Full Text Available We review some new methods based on surface-enhanced Raman scattering (SERS for the nondestructive/minimally invasive identification of organic colorants in objects whose value or function precludes sampling, such as historic and archeological textiles, paintings, and drawing. We discuss in detail the methodology we developed for the selective extraction and identification of anthraquinones and indigoids in the typical concentration used in textiles by means of an ecocompatible homogeneous nanostructured agar matrix. The extraction system was modulated according to the chemical properties of the target analyte by choosing appropriate reagents for the extraction and optimizing the extraction time. The system has been found to be extremely stable, easy to use and produce, easy to store, and at the same time able to be analyzed even after long time intervals, maintaining its enhancement properties unaltered, without the detriment of the extracted compound. Highly structured SERS band intensities have been obtained from the extracted dyes adopting laser light excitations at 514.5 and 785 nm of a micro-Raman setup. This analytical method has been found to be extremely safe for the analyzed substrates, thus being a promising procedure for the selective analysis and detection of molecules at low concentration in the field of artworks conservation.

  11. Hardness and Approximation for Network Flow Interdiction

    OpenAIRE

    Chestnut, Stephen R.; Zenklusen, Rico

    2015-01-01

    In the Network Flow Interdiction problem an adversary attacks a network in order to minimize the maximum s-t-flow. Very little is known about the approximatibility of this problem despite decades of interest in it. We present the first approximation hardness, showing that Network Flow Interdiction and several of its variants cannot be much easier to approximate than Densest k-Subgraph. In particular, any $n^{o(1)}$-approximation algorithm for Network Flow Interdiction would imply an $n^{o(1)}...

  12. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  13. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  14. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  16. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  17. Revisiting the definition of local hardness and hardness kernel.

    Science.gov (United States)

    Polanco-Ramírez, Carlos A; Franco-Pérez, Marco; Carmona-Espíndola, Javier; Gázquez, José L; Ayers, Paul W

    2017-05-17

    An analysis of the hardness kernel and local hardness is performed to propose new definitions for these quantities that follow a similar pattern to the one that characterizes the quantities associated with softness, that is, we have derived new definitions for which the integral of the hardness kernel over the whole space of one of the variables leads to local hardness, and the integral of local hardness over the whole space leads to global hardness. A basic aspect of the present approach is that global hardness keeps its identity as the second derivative of energy with respect to the number of electrons. Local hardness thus obtained depends on the first and second derivatives of energy and electron density with respect to the number of electrons. When these derivatives are approximated by a smooth quadratic interpolation of energy, the expression for local hardness reduces to the one intuitively proposed by Meneses, Tiznado, Contreras and Fuentealba. However, when one combines the first directional derivatives with smooth second derivatives one finds additional terms that allow one to differentiate local hardness for electrophilic attack from the one for nucleophilic attack. Numerical results related to electrophilic attacks on substituted pyridines, substituted benzenes and substituted ethenes are presented to show the overall performance of the new definition.

  18. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  19. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  20. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  1. Minimizing Exposure at Work

    Science.gov (United States)

    ; Environment Human Health Animal Health Safe Use Practices Food Safety Environment Air Water Soil Wildlife Home Page Pesticide Health and Safety Information Safe Use Practices Minimizing Exposure at Work Pesticides - Pennsylvania State University Cooperative Extension Personal Protective Equipment for Working

  2. Minimalism. Clip and Save.

    Science.gov (United States)

    Hubbard, Guy

    2002-01-01

    Provides background information on the art movement called "Minimalism" discussing why it started and its characteristics. Includes learning activities and information on the artist, Donald Judd. Includes a reproduction of one of his art works and discusses its content. (CMK)

  3. Ruled Laguerre minimal surfaces

    KAUST Repository

    Skopenkov, Mikhail

    2011-10-30

    A Laguerre minimal surface is an immersed surface in ℝ 3 being an extremal of the functional ∫ (H 2/K-1)dA. In the present paper, we prove that the only ruled Laguerre minimal surfaces are up to isometry the surfaces ℝ (φλ) = (Aφ, Bφ, Cφ + D cos 2φ) + λ(sin φ, cos φ, 0), where A,B,C,D ε ℝ are fixed. To achieve invariance under Laguerre transformations, we also derive all Laguerre minimal surfaces that are enveloped by a family of cones. The methodology is based on the isotropic model of Laguerre geometry. In this model a Laguerre minimal surface enveloped by a family of cones corresponds to a graph of a biharmonic function carrying a family of isotropic circles. We classify such functions by showing that the top view of the family of circles is a pencil. © 2011 Springer-Verlag.

  4. Minimal and careful processing

    OpenAIRE

    Nielsen, Thorkild

    2004-01-01

    In several standards, guidelines and publications, organic food processing is strongly associated with "minimal processing" and "careful processing". The term "minimal processing" is nowadays often used in the general food processing industry and described in literature. The term "careful processing" is used more specifically within organic food processing but is not yet clearly defined. The concept of carefulness seems to fit very well with the processing of organic foods, especially if it i...

  5. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  6. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  7. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  8. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  9. Hard and Soft Governance

    DEFF Research Database (Denmark)

    Moos, Lejf

    2009-01-01

    of Denmark, and finally the third layer: the leadership used in Danish schools. The use of 'soft governance' is shifting the focus of governance and leadership from decisions towards influence and power and thus shifting the focus of the processes from the decision-making itself towards more focus......The governance and leadership at transnational, national and school level seem to be converging into a number of isomorphic forms as we see a tendency towards substituting 'hard' forms of governance, that are legally binding, with 'soft' forms based on persuasion and advice. This article analyses...... and discusses governance forms at several levels. The first layer is the global: the methods of 'soft governance' that are being utilised by transnational agencies. The second layer is the national and local: the shift in national and local governance seen in many countries, but here demonstrated in the case...

  10. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  11. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  12. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  13. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  14. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  15. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  16. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  17. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  18. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  19. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  20. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  1. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  2. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  3. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  4. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  5. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  6. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  7. Janka hardness using nonstandard specimens

    Science.gov (United States)

    David W. Green; Marshall Begel; William Nelson

    2006-01-01

    Janka hardness determined on 1.5- by 3.5-in. specimens (2×4s) was found to be equivalent to that determined using the 2- by 2-in. specimen specified in ASTM D 143. Data are presented on the relationship between Janka hardness and the strength of clear wood. Analysis of historical data determined using standard specimens indicated no difference between side hardness...

  8. Waste minimization assessment procedure

    International Nuclear Information System (INIS)

    Kellythorne, L.L.

    1993-01-01

    Perry Nuclear Power Plant began developing a waste minimization plan early in 1991. In March of 1991 the plan was documented following a similar format to that described in the EPA Waste Minimization Opportunity Assessment Manual. Initial implementation involved obtaining management's commitment to support a waste minimization effort. The primary assessment goal was to identify all hazardous waste streams and to evaluate those streams for minimization opportunities. As implementation of the plan proceeded, non-hazardous waste streams routinely generated in large volumes were also evaluated for minimization opportunities. The next step included collection of process and facility data which would be useful in helping the facility accomplish its assessment goals. This paper describes the resources that were used and which were most valuable in identifying both the hazardous and non-hazardous waste streams that existed on site. For each material identified as a waste stream, additional information regarding the materials use, manufacturer, EPA hazardous waste number and DOT hazard class was also gathered. Once waste streams were evaluated for potential source reduction, recycling, re-use, re-sale, or burning for heat recovery, with disposal as the last viable alternative

  9. 2TB hard disk drive

    CERN Multimedia

    This particular object was used up until 2012 in the Data Centre. It slots into one of the Disk Server trays. Hard disks were invented in the 1950s. They started as large disks up to 20 inches in diameter holding just a few megabytes (link is external). They were originally called "fixed disks" or "Winchesters" (a code name used for a popular IBM product). They later became known as "hard disks" to distinguish them from "floppy disks (link is external)." Hard disks have a hard platter that holds the magnetic medium, as opposed to the flexible plastic film found in tapes and floppies.

  10. Cover layer technology and a new hard coat for cartridge-free Blu-ray disc

    Science.gov (United States)

    Kang, Tae-Sik; Han, Mi Young; Lee, Seong-Keun; Jang, Sung Hoon; Hong, Young Jun; Seo, Hun; Lee, Chang-Ho

    2004-09-01

    Spin coating method for cover layer of Blu-ray Disc (BD) has been studied and a new hard coat resin including antifouling property has been developed. A vacuum chuck was newly designed to minimize the ski-jump effect. 3 mm hard coat layer was stacked onto the 97 mm cover layer by spin coating method.

  11. Minimal quantization and confinement

    International Nuclear Information System (INIS)

    Ilieva, N.P.; Kalinowskij, Yu.L.; Nguyen Suan Han; Pervushin, V.N.

    1987-01-01

    A ''minimal'' version of the Hamiltonian quantization based on the explicit solution of the Gauss equation and on the gauge-invariance principle is considered. By the example of the one-particle Green function we show that the requirement for gauge invariance leads to relativistic covariance of the theory and to more proper definition of the Faddeev - Popov integral that does not depend on the gauge choice. The ''minimal'' quantization is applied to consider the gauge-ambiguity problem and a new topological mechanism of confinement

  12. Minimal Composite Inflation

    DEFF Research Database (Denmark)

    Channuie, Phongpichit; Jark Joergensen, Jakob; Sannino, Francesco

    2011-01-01

    We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity, and that the u......We investigate models in which the inflaton emerges as a composite field of a four dimensional, strongly interacting and nonsupersymmetric gauge theory featuring purely fermionic matter. We show that it is possible to obtain successful inflation via non-minimal coupling to gravity...

  13. Minimalism and Speakers’ Intuitions

    Directory of Open Access Journals (Sweden)

    Matías Gariazzo

    2011-08-01

    Full Text Available Minimalism proposes a semantics that does not account for speakers’ intuitions about the truth conditions of a range of sentences or utterances. Thus, a challenge for this view is to offer an explanation of how its assignment of semantic contents to these sentences is grounded in their use. Such an account was mainly offered by Soames, but also suggested by Cappelen and Lepore. The article criticizes this explanation by presenting four kinds of counterexamples to it, and arrives at the conclusion that minimalism has not successfully answered the above-mentioned challenge.

  14. Minimal open strings

    International Nuclear Information System (INIS)

    Hosomichi, Kazuo

    2008-01-01

    We study FZZT-branes and open string amplitudes in (p, q) minimal string theory. We focus on the simplest boundary changing operators in two-matrix models, and identify the corresponding operators in worldsheet theory through the comparison of amplitudes. Along the way, we find a novel linear relation among FZZT boundary states in minimal string theory. We also show that the boundary ground ring is realized on physical open string operators in a very simple manner, and discuss its use for perturbative computation of higher open string amplitudes.

  15. Hard processes. Vol. 1

    International Nuclear Information System (INIS)

    Ioffe, B.L.; Khoze, V.A.; Lipatov, L.N.

    1984-01-01

    Deep inelastic (hard) processes are now at the epicenter of modern high-energy physics. These processes are governed by short-distance dynamics, which reveals the intrinsic structure of elementary particles. The theory of deep inelastic processes is now sufficiently well settled. The authors' aim was to give an effective tool to theoreticians and experimentalists who are engaged in high-energy physics. This book is intended primarily for physicists who are only beginning to study the field. To read the book, one should be acquainted with the Feynman diagram technique and with some particular topics from elementary particle theory (symmetries, dispersion relations, Regge pole theory, etc.). Theoretical consideration of deep inelastic processes is now based on quantum chromodynamics (QCD). At the same time, analysis of relevant physical phenomena demands a synthesis of QCD notions (quarks, gluons) with certain empirical characteristics. Therefore, the phenomenological approaches presented are a necessary stage in a study of this range of phenomena which should undoubtedly be followed by a detailed description based on QCD and electroweak theory. The authors were naturally unable to dwell on experimental data accumulated during the past decade of intensive investigations. Priority was given to results which allow a direct comparison with theoretical predictions. (Auth.)

  16. Hard coal; Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Loo, Kai van de; Sitte, Andreas-Peter [Gesamtverband Steinkohle e.V. (GVSt), Herne (Germany)

    2015-07-01

    International the coal market in 2014 was the first time in a long time in a period of stagnation. In Germany, the coal consumption decreased even significantly, mainly due to the decrease in power generation. Here the national energy transition has now been noticable affected negative for coal use. The political guidances can expect a further significant downward movement for the future. In the present phase-out process of the German hard coal industry with still three active mines there was in 2014 no decommissioning. But the next is at the end of 2015, and the plans for the time after mining have been continued. [German] International war der Markt fuer Steinkohle 2014 erstmals seit langem wieder von einer Stagnation gekennzeichnet. In Deutschland ging der Steinkohlenverbrauch sogar deutlich zurueck, vor allem wegen des Rueckgangs in der Stromerzeugung. Hier hat sich die nationale Energiewende nun spuerbar und fuer die Steinkohlennutzung negativ ausgewirkt. Die politischen Weichenstellungen lassen fuer die Zukunft eine weitere erhebliche Abwaertsbewegung erwarten. Bei dem im Auslaufprozess befindlichen deutschen Steinkohlenbergbau mit noch drei aktiven Bergwerken gab es 2014 keine Stilllegung. Doch die naechste steht zum Jahresende 2015 an, und die Planungen fuer die Zeit nach dem Bergbau sind fortgefuehrt worden.

  17. Minimal model holography

    International Nuclear Information System (INIS)

    Gaberdiel, Matthias R; Gopakumar, Rajesh

    2013-01-01

    We review the duality relating 2D W N minimal model conformal field theories, in a large-N ’t Hooft like limit, to higher spin gravitational theories on AdS 3 . This article is part of a special issue of Journal of Physics A: Mathematical and Theoretical devoted to ‘Higher spin theories and holography’. (review)

  18. Minimal constrained supergravity

    Energy Technology Data Exchange (ETDEWEB)

    Cribiori, N. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Dall' Agata, G., E-mail: dallagat@pd.infn.it [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Farakos, F. [Dipartimento di Fisica e Astronomia “Galileo Galilei”, Università di Padova, Via Marzolo 8, 35131 Padova (Italy); INFN, Sezione di Padova, Via Marzolo 8, 35131 Padova (Italy); Porrati, M. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States)

    2017-01-10

    We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  19. Hazardous waste minimization

    International Nuclear Information System (INIS)

    Freeman, H.

    1990-01-01

    This book presents an overview of waste minimization. Covers applications of technology to waste reduction, techniques for implementing programs, incorporation of programs into R and D, strategies for private industry and the public sector, and case studies of programs already in effect

  20. Minimally invasive distal pancreatectomy

    NARCIS (Netherlands)

    Røsok, Bård I.; de Rooij, Thijs; van Hilst, Jony; Diener, Markus K.; Allen, Peter J.; Vollmer, Charles M.; Kooby, David A.; Shrikhande, Shailesh V.; Asbun, Horacio J.; Barkun, Jeffrey; Besselink, Marc G.; Boggi, Ugo; Conlon, Kevin; Han, Ho Seong; Hansen, Paul; Kendrick, Michael L.; Kooby, David; Montagnini, Andre L.; Palanivelu, Chinnasamy; Wakabayashi, Go; Zeh, Herbert J.

    2017-01-01

    The first International conference on Minimally Invasive Pancreas Resection was arranged in conjunction with the annual meeting of the International Hepato-Pancreato-Biliary Association (IHPBA), in Sao Paulo, Brazil on April 19th 2016. The presented evidence and outcomes resulting from the session

  1. Minimal DBM Substraction

    DEFF Research Database (Denmark)

    David, Alexandre; Håkansson, John; G. Larsen, Kim

    In this paper we present an algorithm to compute DBM substractions with a guaranteed minimal number of splits and disjoint DBMs to avoid any redundance. The substraction is one of the few operations that result in a non-convex zone, and thus, requires splitting. It is of prime importance to reduce...

  2. Minimal constrained supergravity

    Directory of Open Access Journals (Sweden)

    N. Cribiori

    2017-01-01

    Full Text Available We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  3. Minimal constrained supergravity

    International Nuclear Information System (INIS)

    Cribiori, N.; Dall'Agata, G.; Farakos, F.; Porrati, M.

    2017-01-01

    We describe minimal supergravity models where supersymmetry is non-linearly realized via constrained superfields. We show that the resulting actions differ from the so called “de Sitter” supergravities because we consider constraints eliminating directly the auxiliary fields of the gravity multiplet.

  4. Minimizing System Modification in an Incremental Design Approach

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Pop, Traian

    2001-01-01

    In this paper we present an approach to mapping and scheduling of distributed embedded systems for hard real-time applications, aiming at minimizing the system modification cost. We consider an incremental design process that starts from an already existing sys-tem running a set of applications. We...

  5. Advanced nuclear power plant design with minimized use of cables

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    The objective of this report is to present a nuclear power plant design with a minimum utilization of cables. The report describes the types of software and hardware that will be needed to minimize hard-wired control and instrumentation circuits and to reduce the quantity of low voltage power cables while maintaining a high availability and reliability of the plant control systems

  6. Discrete Curvatures and Discrete Minimal Surfaces

    KAUST Repository

    Sun, Xiang

    2012-06-01

    This thesis presents an overview of some approaches to compute Gaussian and mean curvature on discrete surfaces and discusses discrete minimal surfaces. The variety of applications of differential geometry in visualization and shape design leads to great interest in studying discrete surfaces. With the rich smooth surface theory in hand, one would hope that this elegant theory can still be applied to the discrete counter part. Such a generalization, however, is not always successful. While discrete surfaces have the advantage of being finite dimensional, thus easier to treat, their geometric properties such as curvatures are not well defined in the classical sense. Furthermore, the powerful calculus tool can hardly be applied. The methods in this thesis, including angular defect formula, cotangent formula, parallel meshes, relative geometry etc. are approaches based on offset meshes or generalized offset meshes. As an important application, we discuss discrete minimal surfaces and discrete Koenigs meshes.

  7. Melting of polydisperse hard disks

    NARCIS (Netherlands)

    Pronk, S.; Frenkel, D.

    2004-01-01

    The melting of a polydisperse hard-disk system is investigated by Monte Carlo simulations in the semigrand canonical ensemble. This is done in the context of possible continuous melting by a dislocation-unbinding mechanism, as an extension of the two-dimensional hard-disk melting problem. We find

  8. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  9. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  10. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  11. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  12. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  13. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  14. Minimal abdominal incisions

    Directory of Open Access Journals (Sweden)

    João Carlos Magi

    2017-04-01

    Full Text Available Minimally invasive procedures aim to resolve the disease with minimal trauma to the body, resulting in a rapid return to activities and in reductions of infection, complications, costs and pain. Minimally incised laparotomy, sometimes referred to as minilaparotomy, is an example of such minimally invasive procedures. The aim of this study is to demonstrate the feasibility and utility of laparotomy with minimal incision based on the literature and exemplifying with a case. The case in question describes reconstruction of the intestinal transit with the use of this incision. Male, young, HIV-positive patient in a late postoperative of ileotiflectomy, terminal ileostomy and closing of the ascending colon by an acute perforating abdomen, due to ileocolonic tuberculosis. The barium enema showed a proximal stump of the right colon near the ileostomy. The access to the cavity was made through the orifice resulting from the release of the stoma, with a lateral-lateral ileo-colonic anastomosis with a 25 mm circular stapler and manual closure of the ileal stump. These surgeries require their own tactics, such as rigor in the lysis of adhesions, tissue traction, and hemostasis, in addition to requiring surgeon dexterity – but without the need for investments in technology; moreover, the learning curve is reported as being lower than that for videolaparoscopy. Laparotomy with minimal incision should be considered as a valid and viable option in the treatment of surgical conditions. Resumo: Procedimentos minimamente invasivos visam resolver a doença com o mínimo de trauma ao organismo, resultando em retorno rápido às atividades, reduções nas infecções, complicações, custos e na dor. A laparotomia com incisão mínima, algumas vezes referida como minilaparotomia, é um exemplo desses procedimentos minimamente invasivos. O objetivo deste trabalho é demonstrar a viabilidade e utilidade das laparotomias com incisão mínima com base na literatura e

  15. Minimal Walking Technicolor

    DEFF Research Database (Denmark)

    Foadi, Roshan; Frandsen, Mads Toudal; A. Ryttov, T.

    2007-01-01

    Different theoretical and phenomenological aspects of the Minimal and Nonminimal Walking Technicolor theories have recently been studied. The goal here is to make the models ready for collider phenomenology. We do this by constructing the low energy effective theory containing scalars......, pseudoscalars, vector mesons and other fields predicted by the minimal walking theory. We construct their self-interactions and interactions with standard model fields. Using the Weinberg sum rules, opportunely modified to take into account the walking behavior of the underlying gauge theory, we find...... interesting relations for the spin-one spectrum. We derive the electroweak parameters using the newly constructed effective theory and compare the results with the underlying gauge theory. Our analysis is sufficiently general such that the resulting model can be used to represent a generic walking technicolor...

  16. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  17. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  18. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  19. Hardness variability in commercial technologies

    International Nuclear Information System (INIS)

    Shaneyfelt, M.R.; Winokur, P.S.; Meisenheimer, T.L.; Sexton, F.W.; Roeske, S.B.; Knoll, M.G.

    1994-01-01

    The radiation hardness of commercial Floating Gate 256K E 2 PROMs from a single diffusion lot was observed to vary between 5 to 25 krad(Si) when irradiated at a low dose rate of 64 mrad(Si)/s. Additional variations in E 2 PROM hardness were found to depend on bias condition and failure mode (i.e., inability to read or write the memory), as well as the foundry at which the part was manufactured. This variability is related to system requirements, and it is shown that hardness level and variability affect the allowable mode of operation for E 2 PROMs in space applications. The radiation hardness of commercial 1-Mbit CMOS SRAMs from Micron, Hitachi, and Sony irradiated at 147 rad(Si)/s was approximately 12, 13, and 19 krad(Si), respectively. These failure levels appear to be related to increases in leakage current during irradiation. Hardness of SRAMs from each manufacturer varied by less than 20%, but differences between manufacturers are significant. The Qualified Manufacturer's List approach to radiation hardness assurance is suggested as a way to reduce variability and to improve the hardness level of commercial technologies

  20. On scale dependence of hardness

    International Nuclear Information System (INIS)

    Shorshorov, M.Kh.; Alekhin, V.P.; Bulychev, S.I.

    1977-01-01

    The concept of hardness as a structure-sensitive characteristic of a material is considered. It is shown that in conditions of a decreasing stress field under the inventor the hardness function is determined by the average distance, Lsub(a), between the stops (fixed and sessile dislocations, segregation particles, etc.). In the general case, Lsub(a) depends on the size of the impression and explains the great diversity of hardness functions. The concept of average true deformation rate on depression is introduced

  1. Photon technology. Hard photon technology; Photon technology. Hard photon gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    Research results of hard photon technology have been summarized as a part of novel technology development highly utilizing the quantum nature of photon. Hard photon technology refers to photon beam technologies which use photon in the 0.1 to 200 nm wavelength region. Hard photon has not been used in industry due to the lack of suitable photon sources and optical devices. However, hard photon in this wavelength region is expected to bring about innovations in such areas as ultrafine processing and material synthesis due to its atom selective reaction, inner shell excitation reaction, and spatially high resolution. Then, technological themes and possibility have been surveyed. Although there are principle proposes and their verification of individual technologies for the technologies of hard photon generation, regulation and utilization, they are still far from the practical applications. For the photon source technology, the laser diode pumped driver laser technology, laser plasma photon source technology, synchrotron radiation photon source technology, and vacuum ultraviolet photon source technology are presented. For the optical device technology, the multi-layer film technology for beam mirrors and the non-spherical lens processing technology are introduced. Also are described the reduction lithography technology, hard photon excitation process, and methods of analysis and measurement. 430 refs., 165 figs., 23 tabs.

  2. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  4. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  6. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  7. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  8. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  11. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  12. The effects of high-Ca hardness water treatment for secondary cooling water in HANARO

    International Nuclear Information System (INIS)

    Kang, T. J.; Park, Y. C.; Hwang, S. R.; Lim, I. C.; Choi, H. Y.

    2003-01-01

    Water-quality control of the second cooling system in HANARO has been altered from low Ca-hardness treatment to high Ca-hardness treatment since March, 2001. High Ca-hardness water treatment in HANARO is to maintain the calcium hardness around 12 by minimizing the blowdown of secondary cooling water. This paper describes the effect of cost reduction after change of water-quility treatment method. The result shows that the cost of the water could be reduced by 25% using the pond water in KAERI. The amount and cost for the chemical agent could be reduced by 40% and 10% respectively

  13. Two NP-hardness results for preemptive minsum scheduling of unrelated parallel machines

    NARCIS (Netherlands)

    Sitters, R.A.; Aardal, K.; Gerards, B.

    2001-01-01

    We show that the problems of minimizing total completion time and of minimizing the number of late jobs on unrelated parallel machines, when preemption is allowed, are both NP-hard in the strong sense. The former result settles a long-standing open question.

  14. Legal incentives for minimizing waste

    International Nuclear Information System (INIS)

    Clearwater, S.W.; Scanlon, J.M.

    1991-01-01

    Waste minimization, or pollution prevention, has become an integral component of federal and state environmental regulation. Minimizing waste offers many economic and public relations benefits. In addition, waste minimization efforts can also dramatically reduce potential criminal requirements. This paper addresses the legal incentives for minimizing waste under current and proposed environmental laws and regulations

  15. The ZOOM minimization package

    International Nuclear Information System (INIS)

    Fischler, Mark S.; Sachs, D.

    2004-01-01

    A new object-oriented Minimization package is available for distribution in the same manner as CLHEP. This package, designed for use in HEP applications, has all the capabilities of Minuit, but is a re-write from scratch, adhering to modern C++ design principles. A primary goal of this package is extensibility in several directions, so that its capabilities can be kept fresh with as little maintenance effort as possible. This package is distinguished by the priority that was assigned to C++ design issues, and the focus on producing an extensible system that will resist becoming obsolete

  16. Minimizing the Pacman effect

    International Nuclear Information System (INIS)

    Ritson, D.; Chou, W.

    1997-10-01

    The Pacman bunches will experience two deleterious effects: tune shift and orbit displacement. It is known that the tune shift can be compensated by arranging crossing planes 900 relative to each other at successive interaction points (lPs). This paper gives an analytical estimate of the Pacman orbit displacement for a single as well as for two crossings. For the latter, it can be minimized by using equal phase advances from one IP to another. In the LHC, this displacement is in any event small and can be neglected

  17. Minimally Invasive Parathyroidectomy

    Directory of Open Access Journals (Sweden)

    Lee F. Starker

    2011-01-01

    Full Text Available Minimally invasive parathyroidectomy (MIP is an operative approach for the treatment of primary hyperparathyroidism (pHPT. Currently, routine use of improved preoperative localization studies, cervical block anesthesia in the conscious patient, and intraoperative parathyroid hormone analyses aid in guiding surgical therapy. MIP requires less surgical dissection causing decreased trauma to tissues, can be performed safely in the ambulatory setting, and is at least as effective as standard cervical exploration. This paper reviews advances in preoperative localization, anesthetic techniques, and intraoperative management of patients undergoing MIP for the treatment of pHPT.

  18. CO2 laser milling of hard tissue

    Science.gov (United States)

    Werner, Martin; Ivanenko, Mikhail; Harbecke, Daniela; Klasing, Manfred; Steigerwald, Hendrik; Hering, Peter

    2007-02-01

    Drilling of bone and tooth tissue belongs to recurrent medical procedures (screw- and pin-bores, bores for implant inserting, trepanation etc.). Small round bores can be in general quickly produced with mechanical drills. Problems arise however by angled drilling, by the necessity to fulfill the drilling without damaging of sensitive soft tissue beneath the bone, or by the attempt to mill precisely noncircular small cavities. We present investigations on laser hard tissue "milling", which can be advantageous for solving these problems. The "milling" is done with a CO2 laser (10.6 μm) with pulse duration of 50 - 100 μs, combined with a PC-controlled galvanic beam scanner and with a fine water-spray, which helps to avoid thermal side-effects. The damaging of underlying soft tissue can be prevented through control of the optical or acoustical ablation signal. The ablation of hard tissue is accompanied with a strong glowing, which is absent during the laser beam action on soft tissue. The acoustic signals from the diverse tissue types exhibit distinct differences in the spectral composition. Also computer image analysis could be a useful tool to control the operation. Laser "milling" of noncircular cavities with 1 - 4 mm width and about 10 mm depth is particularly interesting for dental implantology. In ex-vivo investigations we found conditions for fast laser "milling" of the cavities without thermal damage and with minimal tapering. It included exploration of different filling patterns (concentric rings, crosshatch, parallel lines and their combinations), definition of maximal pulse duration, repetition rate and laser power, optimal position of the spray. The optimized results give evidences for the applicability of the CO2 laser for biologically tolerable "milling" of deep cavities in the hard tissue.

  19. Statistical physics of hard optimization problems

    International Nuclear Information System (INIS)

    Zdeborova, L.

    2009-01-01

    Optimization is fundamental in many areas of science, from computer science and information theory to engineering and statistical physics, as well as to biology or social sciences. It typically involves a large number of variables and a cost function depending on these variables. Optimization problems in the non-deterministic polynomial (NP)-complete class are particularly difficult, it is believed that the number of operations required to minimize the cost function is in the most difficult cases exponential in the system size. However, even in an NP-complete problem the practically arising instances might, in fact, be easy to solve. The principal question we address in this article is: How to recognize if an NP-complete constraint satisfaction problem is typically hard and what are the main reasons for this? We adopt approaches from the statistical physics of disordered systems, in particular the cavity method developed originally to describe glassy systems. We describe new properties of the space of solutions in two of the most studied constraint satisfaction problems - random satisfy ability and random graph coloring. We suggest a relation between the existence of the so-called frozen variables and the algorithmic hardness of a problem. Based on these insights, we introduce a new class of problems which we named ”locked” constraint satisfaction, where the statistical description is easily solvable, but from the algorithmic point of view they are even more challenging than the canonical satisfy ability.

  20. Statistical physics of hard optimization problems

    International Nuclear Information System (INIS)

    Zdeborova, L.

    2009-01-01

    Optimization is fundamental in many areas of science, from computer science and information theory to engineering and statistical physics, as well as to biology or social sciences. It typically involves a large number of variables and a cost function depending on these variables. Optimization problems in the non-deterministic polynomial-complete class are particularly difficult, it is believed that the number of operations required to minimize the cost function is in the most difficult cases exponential in the system size. However, even in an non-deterministic polynomial-complete problem the practically arising instances might, in fact, be easy to solve. The principal the question we address in the article is: How to recognize if an non-deterministic polynomial-complete constraint satisfaction problem is typically hard and what are the main reasons for this? We adopt approaches from the statistical physics of disordered systems, in particular the cavity method developed originally to describe glassy systems. We describe new properties of the space of solutions in two of the most studied constraint satisfaction problems - random satisfiability and random graph coloring. We suggest a relation between the existence of the so-called frozen variables and the algorithmic hardness of a problem. Based on these insights, we introduce a new class of problems which we named 'locked' constraint satisfaction, where the statistical description is easily solvable, but from the algorithmic point of view they are even more challenging than the canonical satisfiability (Authors)

  1. Statistical physics of hard optimization problems

    Science.gov (United States)

    Zdeborová, Lenka

    2009-06-01

    Optimization is fundamental in many areas of science, from computer science and information theory to engineering and statistical physics, as well as to biology or social sciences. It typically involves a large number of variables and a cost function depending on these variables. Optimization problems in the non-deterministic polynomial (NP)-complete class are particularly difficult, it is believed that the number of operations required to minimize the cost function is in the most difficult cases exponential in the system size. However, even in an NP-complete problem the practically arising instances might, in fact, be easy to solve. The principal question we address in this article is: How to recognize if an NP-complete constraint satisfaction problem is typically hard and what are the main reasons for this? We adopt approaches from the statistical physics of disordered systems, in particular the cavity method developed originally to describe glassy systems. We describe new properties of the space of solutions in two of the most studied constraint satisfaction problems - random satisfiability and random graph coloring. We suggest a relation between the existence of the so-called frozen variables and the algorithmic hardness of a problem. Based on these insights, we introduce a new class of problems which we named "locked" constraint satisfaction, where the statistical description is easily solvable, but from the algorithmic point of view they are even more challenging than the canonical satisfiability.

  2. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  3. Robust design of head interconnect for hard disk drive

    Science.gov (United States)

    Gao, X. K.; Liu, Q. H.; Liu, Z. J.

    2005-05-01

    Design of head interconnect is one of the important issues for hard disk drives with higher data rate and storage capacity. The impedance of interconnect and electromagnetic coupling influence the quality level of data communication. Thus an insightful study on how the trace configuration affects the impedance and crosstalk is necessary. An effective design approach based on Taguchi's robust design method is employed therefore in an attempt to realize impedance matching and crosstalk minimization with the effects of uncontrollable sources taken into consideration.

  4. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  5. Minimal conformal model

    Energy Technology Data Exchange (ETDEWEB)

    Helmboldt, Alexander; Humbert, Pascal; Lindner, Manfred; Smirnov, Juri [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany)

    2016-07-01

    The gauge hierarchy problem is one of the crucial drawbacks of the standard model of particle physics (SM) and thus has triggered model building over the last decades. Its most famous solution is the introduction of low-scale supersymmetry. However, without any significant signs of supersymmetric particles at the LHC to date, it makes sense to devise alternative mechanisms to remedy the hierarchy problem. One such mechanism is based on classically scale-invariant extensions of the SM, in which both the electroweak symmetry and the (anomalous) scale symmetry are broken radiatively via the Coleman-Weinberg mechanism. Apart from giving an introduction to classically scale-invariant models, the talk presents our results on obtaining a theoretically consistent minimal extension of the SM, which reproduces the correct low-scale phenomenology.

  6. Minimal Reducts with Grasp

    Directory of Open Access Journals (Sweden)

    Iris Iddaly Mendez Gurrola

    2011-03-01

    Full Text Available The proper detection of patient level of dementia is important to offer the suitable treatment. The diagnosis is based on certain criteria, reflected in the clinical examinations. From these examinations emerge the limitations and the degree in which each patient is in. In order to reduce the total of limitations to be evaluated, we used the rough set theory, this theory has been applied in areas of the artificial intelligence such as decision analysis, expert systems, knowledge discovery, classification with multiple attributes. In our case this theory is applied to find the minimal limitations set or reduct that generate the same classification that considering all the limitations, to fulfill this purpose we development an algorithm GRASP (Greedy Randomized Adaptive Search Procedure.

  7. Minimally extended SILH

    International Nuclear Information System (INIS)

    Chala, Mikael; Grojean, Christophe; Humboldt-Univ. Berlin; Lima, Leonardo de; Univ. Estadual Paulista, Sao Paulo

    2017-03-01

    Higgs boson compositeness is a phenomenologically viable scenario addressing the hierarchy problem. In minimal models, the Higgs boson is the only degree of freedom of the strong sector below the strong interaction scale. We present here the simplest extension of such a framework with an additional composite spin-zero singlet. To this end, we adopt an effective field theory approach and develop a set of rules to estimate the size of the various operator coefficients, relating them to the parameters of the strong sector and its structural features. As a result, we obtain the patterns of new interactions affecting both the new singlet and the Higgs boson's physics. We identify the characteristics of the singlet field which cause its effects on Higgs physics to dominate over the ones inherited from the composite nature of the Higgs boson. Our effective field theory construction is supported by comparisons with explicit UV models.

  8. Minimally extended SILH

    Energy Technology Data Exchange (ETDEWEB)

    Chala, Mikael [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Valencia Univ. (Spain). Dept. de Fisica Teorica y IFIC; Durieux, Gauthier; Matsedonskyi, Oleksii [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Grojean, Christophe [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Humboldt-Univ. Berlin (Germany). Inst. fuer Physik; Lima, Leonardo de [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Univ. Estadual Paulista, Sao Paulo (Brazil). Inst. de Fisica Teorica

    2017-03-15

    Higgs boson compositeness is a phenomenologically viable scenario addressing the hierarchy problem. In minimal models, the Higgs boson is the only degree of freedom of the strong sector below the strong interaction scale. We present here the simplest extension of such a framework with an additional composite spin-zero singlet. To this end, we adopt an effective field theory approach and develop a set of rules to estimate the size of the various operator coefficients, relating them to the parameters of the strong sector and its structural features. As a result, we obtain the patterns of new interactions affecting both the new singlet and the Higgs boson's physics. We identify the characteristics of the singlet field which cause its effects on Higgs physics to dominate over the ones inherited from the composite nature of the Higgs boson. Our effective field theory construction is supported by comparisons with explicit UV models.

  9. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  10. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  11. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  12. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  14. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  15. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  16. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  17. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  18. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  19. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  20. Hard diffraction and rapidity gaps

    International Nuclear Information System (INIS)

    Brandt, A.

    1995-09-01

    The field of hard diffraction, which studies events with a rapidity gap and a hard scattering, has expanded dramatically recently. A review of new results from CDF, D OE, H1 and ZEUS will be given. These results include diffractive jet production, deep-inelastic scattering in large rapidity gap events, rapidity gaps between high transverse energy jets, and a search for diffractive W-boson production. The combination of these results gives new insight into the exchanged object, believed to be the pomeron. The results axe consistent with factorization and with a hard pomeron that contains both quarks and gluons. There is also evidence for the exchange of a strongly interacting color singlet in high momentum transfer (36 2 ) events

  1. Initiative hard coal; Initiative Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Leonhardt, J.

    2007-08-02

    In order to decrease the import dependence of hard coal in the European Union, the author has submitted suggestions to the director of conventional sources of energy (directorate general for energy and transport) of the European community, which found a positive resonance. These suggestions are summarized in an elaboration 'Initiative Hard Coal'. After clarifying the starting situation and defining the target the presupposition for a better use of hard coal deposits as raw material in the European Union are pointed out. On that basis concrete suggestions for measures are made. Apart from the conditions of the deposits it concerns thereby also new mining techniques and mining-economical developments, connected with tasks for the mining-machine industry. (orig.)

  2. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  3. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  4. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  5. Photon technology. Hard photon technology; Photon technology. Hard photon gijutsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-03-01

    For the application of photon to industrial technologies, in particular, a hard photon technology was surveyed which uses photon beams of 0.1-200nm in wavelength. Its features such as selective atom reaction, dense inner shell excitation and spacial high resolution by quantum energy are expected to provide innovative techniques for various field such as fine machining, material synthesis and advanced inspection technology. This wavelength region has been hardly utilized for industrial fields because of poor development of suitable photon sources and optical devices. The developmental meaning, usable time and issue of a hard photon reduction lithography were surveyed as lithography in ultra-fine region below 0.1{mu}m. On hard photon analysis/evaluation technology, the industrial use of analysis, measurement and evaluation technologies by micro-beam was viewed, and optimum photon sources and optical systems were surveyed. Prediction of surface and surface layer modification by inner shell excitation, the future trend of this process and development of a vacuum ultraviolet light source were also surveyed. 383 refs., 153 figs., 17 tabs.

  6. Evaluation of hard fossil fuel

    International Nuclear Information System (INIS)

    Zivkovic, S.; Nuic, J.

    1999-01-01

    Because of its inexhaustible supplies hard fossil fuel will represent the pillar of the power systems of the 21st century. Only high-calorie fossil fuels have the market value and participate in the world trade. Low-calorie fossil fuels ((brown coal and lignite) are fuels spent on the spot and their value is indirectly expressed through manufactured kWh. For the purpose of determining the real value of a tonne of low-calorie coal, the criteria that help in establishing the value of a tonne of hard coal have to be corrected and thus evaluated and assessed at the market. (author)

  7. Calorimeter triggers for hard collisions

    International Nuclear Information System (INIS)

    Landshoff, P.V.; Polkinghorne, J.C.

    1978-01-01

    We discuss the use of a forward calorimeter to trigger on hard hadron-hadron collisions. We give a derivation in the covariant parton model of the Ochs-Stodolsky scaling law for single-hard-scattering processes, and investigate the conditions when instead a multiple- scattering mechanism might dominate. With a proton beam, this mechanism results in six transverse jets, with a total average multiplicity about twice that seen in ordinary events. We estimate that its cross section is likely to be experimentally accessible at avalues of the beam energy in the region of 100 GeV/c

  8. Hardness of ion implanted ceramics

    International Nuclear Information System (INIS)

    Oliver, W.C.; McHargue, C.J.; Farlow, G.C.; White, C.W.

    1985-01-01

    It has been established that the wear behavior of ceramic materials can be modified through ion implantation. Studies have been done to characterize the effect of implantation on the structure and composition of ceramic surfaces. To understand how these changes affect the wear properties of the ceramic, other mechanical properties must be measured. To accomplish this, a commercially available ultra low load hardness tester has been used to characterize Al 2 O 3 with different implanted species and doses. The hardness of the base material is compared with the highly damaged crystalline state as well as the amorphous material

  9. Minimal Marking: A Success Story

    Science.gov (United States)

    McNeilly, Anne

    2014-01-01

    The minimal-marking project conducted in Ryerson's School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The "minimal-marking" concept (Haswell, 1983), which requires…

  10. Swarm robotics and minimalism

    Science.gov (United States)

    Sharkey, Amanda J. C.

    2007-09-01

    Swarm Robotics (SR) is closely related to Swarm Intelligence, and both were initially inspired by studies of social insects. Their guiding principles are based on their biological inspiration and take the form of an emphasis on decentralized local control and communication. Earlier studies went a step further in emphasizing the use of simple reactive robots that only communicate indirectly through the environment. More recently SR studies have moved beyond these constraints to explore the use of non-reactive robots that communicate directly, and that can learn and represent their environment. There is no clear agreement in the literature about how far such extensions of the original principles could go. Should there be any limitations on the individual abilities of the robots used in SR studies? Should knowledge of the capabilities of social insects lead to constraints on the capabilities of individual robots in SR studies? There is a lack of explicit discussion of such questions, and researchers have adopted a variety of constraints for a variety of reasons. A simple taxonomy of swarm robotics is presented here with the aim of addressing and clarifying these questions. The taxonomy distinguishes subareas of SR based on the emphases and justifications for minimalism and individual simplicity.

  11. Minimal dilaton model

    Directory of Open Access Journals (Sweden)

    Oda Kin-ya

    2013-05-01

    Full Text Available Both the ATLAS and CMS experiments at the LHC have reported the observation of the particle of mass around 125 GeV which is consistent to the Standard Model (SM Higgs boson, but with an excess of events beyond the SM expectation in the diphoton decay channel at each of them. There still remains room for a logical possibility that we are not seeing the SM Higgs but something else. Here we introduce the minimal dilaton model in which the LHC signals are explained by an extra singlet scalar of the mass around 125 GeV that slightly mixes with the SM Higgs heavier than 600 GeV. When this scalar has a vacuum expectation value well beyond the electroweak scale, it can be identified as a linearly realized version of a dilaton field. Though the current experimental constraints from the Higgs search disfavors such a region, the singlet scalar model itself still provides a viable alternative to the SM Higgs in interpreting its search results.

  12. Minimal mirror twin Higgs

    Energy Technology Data Exchange (ETDEWEB)

    Barbieri, Riccardo [Institute of Theoretical Studies, ETH Zurich,CH-8092 Zurich (Switzerland); Scuola Normale Superiore,Piazza dei Cavalieri 7, 56126 Pisa (Italy); Hall, Lawrence J.; Harigaya, Keisuke [Department of Physics, University of California,Berkeley, California 94720 (United States); Theoretical Physics Group, Lawrence Berkeley National Laboratory,Berkeley, California 94720 (United States)

    2016-11-29

    In a Mirror Twin World with a maximally symmetric Higgs sector the little hierarchy of the Standard Model can be significantly mitigated, perhaps displacing the cutoff scale above the LHC reach. We show that consistency with observations requires that the Z{sub 2} parity exchanging the Standard Model with its mirror be broken in the Yukawa couplings. A minimal such effective field theory, with this sole Z{sub 2} breaking, can generate the Z{sub 2} breaking in the Higgs sector necessary for the Twin Higgs mechanism. The theory has constrained and correlated signals in Higgs decays, direct Dark Matter Detection and Dark Radiation, all within reach of foreseen experiments, over a region of parameter space where the fine-tuning for the electroweak scale is 10-50%. For dark matter, both mirror neutrons and a variety of self-interacting mirror atoms are considered. Neutrino mass signals and the effects of a possible additional Z{sub 2} breaking from the vacuum expectation values of B−L breaking fields are also discussed.

  13. Chemical hardness and density functional theory

    Indian Academy of Sciences (India)

    Unknown

    RALPH G PEARSON. Chemistry Department, University of California, Santa Barbara, CA 93106, USA. Abstract. The concept of chemical hardness is reviewed from a personal point of view. Keywords. Hardness; softness; hard & soft acids bases (HSAB); principle of maximum hardness. (PMH) density functional theory (DFT) ...

  14. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  15. Injectable biomaterials for minimally invasive orthopedic treatments.

    Science.gov (United States)

    Jayabalan, M; Shalumon, K T; Mitha, M K

    2009-06-01

    Biodegradable and injectable hydroxy terminated-poly propylene fumarate (HT-PPF) bone cement was developed. The injectable formulation consisting HT-PPF and comonomer, n-vinyl pyrrolidone, calcium phosphate filler, free radical catalyst, accelerator and radiopaque agent sets rapidly to hard mass with low exothermic temperature. The candidate bone cement attains mechanical strength more than the required compressive strength of 5 MPa and compressive modulus 50 MPa. The candidate bone cement resin elicits cell adhesion and cytoplasmic spreading of osteoblast cells. The cured bone cement does not induce intracutaneous irritation and skin sensitization. The candidate bone cement is tissue compatible without eliciting any adverse tissue reactions. The candidate bone cement is osteoconductive and inductive and allow osteointegration and bone remodeling. HT-PPF bone cement is candidate bone cement for minimally invasive radiological procedures for the treatment of bone diseases and spinal compression fractures.

  16. Design Mixers to Minimize Effects of Erosion and Corrosion Erosion

    Directory of Open Access Journals (Sweden)

    Julian Fasano

    2012-01-01

    Full Text Available A thorough review of the major parameters that affect solid-liquid slurry wear on impellers and techniques for minimizing wear is presented. These major parameters include (i chemical environment, (ii hardness of solids, (iii density of solids, (iv percent solids, (v shape of solids, (vi fluid regime (turbulent, transitional, or laminar, (vii hardness of the mixer's wetted parts, (viii hydraulic efficiency of the impeller (kinetic energy dissipation rates near the impeller blades, (ix impact velocity, and (x impact frequency. Techniques for minimizing the wear on impellers cover the choice of impeller, size and speed of the impeller, alloy selection, and surface coating or coverings. An example is provided as well as an assessment of the approximate life improvement.

  17. Proton decay in non-minimal SU(5) GUTs

    International Nuclear Information System (INIS)

    Rudaz, S.

    1984-01-01

    We first give an overview of the minimal SU(5) GUT, outlining its successes and failures: we argue that in view of the failure of this theory to reproduce correctly light quark and lepton mass ratios, the lack of experimental evidence for the decay mode p → e + π 0 is hardly surprising. We then consider non-minimal extensions of the basic SU(5) model, with or without supersymmetry, which give rise to quite different hierarchies of nucleon decay modes. These considerations serve to emphasize the importance of ''broad band'' searches for proton decay in all possible modes in the next generation of experiments. 31 refs

  18. Minimizing secondary coolant blowdown in HANARO

    International Nuclear Information System (INIS)

    Park, Y. C.; Woo, J. S.; Ryu, J. S.; Cho, Y. G.; Lim, N. Y.

    2000-01-01

    There is about 80m 3 /h loss of the secondary cooling water by evaporation, windage and blowdown during the operation of HANARO, 30MW research reactor. The evaporation and the windage is necessary loss to maintain the performance of cooling tower, but the blowdown is artificial lose to get rid of the foreign material and to maintain the quality of the secondary cooling water. Therefore, minimizing the blowdown loss was studied. It was confirmed, through the relation of the number of cycle and the loss rate of secondary coolant, that the number of cycle is saturated to 12 without blowdown because of the windage loss. When the secondary coolant is treated by high Ca-hardness treatment program (the number of cycle > 10) to maintain the number of cycle around 12 without blowdown, only the turbidity exceeds the limit. By adding filtering system it was confirmed, through the relation of turbidity and filtering rate of secondary cooling water, that the turbidity is reduced below the limit (5 deg.) by 2% of filtering rate without blowdown. And it was verified, through the performance test of back-flow filtering unit, that this unit gets rid of foreign material up to 95% of the back-flow and that the water can be reused as coolant. Therefore, the secondary cooling water can be treated by the high Ca-hardness program and filter system without blowdown

  19. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  20. Seismic signals hard clipping overcoming

    Science.gov (United States)

    Olszowa, Paula; Sokolowski, Jakub

    2018-01-01

    In signal processing the clipping is understand as the phenomenon of limiting the signal beyond certain threshold. It is often related to overloading of a sensor. Two particular types of clipping are being recognized: soft and hard. Beyond the limiting value soft clipping reduces the signal real gain while the hard clipping stiffly sets the signal values at the limit. In both cases certain amount of signal information is lost. Obviously if one possess the model which describes the considered signal and the threshold value (which might be slightly more difficult to obtain in the soft clipping case), the attempt of restoring the signal can be made. Commonly it is assumed that the seismic signals take form of an impulse response of some specific system. This may lead to belief that the sine wave may be the most appropriate to fit in the clipping period. However, this should be tested. In this paper the possibility of overcoming the hard clipping in seismic signals originating from a geoseismic station belonging to an underground mine is considered. A set of raw signals will be hard-clipped manually and then couple different functions will be fitted and compared in terms of least squares. The results will be then analysed.

  1. Hard equality constrained integer knapsacks

    NARCIS (Netherlands)

    Aardal, K.I.; Lenstra, A.K.; Cook, W.J.; Schulz, A.S.

    2002-01-01

    We consider the following integer feasibility problem: "Given positive integer numbers a 0, a 1,..., a n, with gcd(a 1,..., a n) = 1 and a = (a 1,..., a n), does there exist a nonnegative integer vector x satisfying ax = a 0?" Some instances of this type have been found to be extremely hard to solve

  2. Stress in hard metal films

    NARCIS (Netherlands)

    Janssen, G.C.A.M.; Kamminga, J.D.

    2004-01-01

    In the absence of thermal stress, tensile stress in hard metal films is caused by grain boundary shrinkage and compressive stress is caused by ion peening. It is shown that the two contributions are additive. Moreover tensile stress generated at the grain boundaries does not relax by ion

  3. Hard processes in hadronic interactions

    International Nuclear Information System (INIS)

    Satz, H.; Wang, X.N.

    1995-01-01

    Quantum chromodynamics is today accepted as the fundamental theory of strong interactions, even though most hadronic collisions lead to final states for which quantitative QCD predictions are still lacking. It therefore seems worthwhile to take stock of where we stand today and to what extent the presently available data on hard processes in hadronic collisions can be accounted for in terms of QCD. This is one reason for this work. The second reason - and in fact its original trigger - is the search for the quark-gluon plasma in high energy nuclear collisions. The hard processes to be considered here are the production of prompt photons, Drell-Yan dileptons, open charm, quarkonium states, and hard jets. For each of these, we discuss the present theoretical understanding, compare the resulting predictions to available data, and then show what behaviour it leads to at RHIC and LHC energies. All of these processes have the structure mentioned above: they contain a hard partonic interaction, calculable perturbatively, but also the non-perturbative parton distribution within a hadron. These parton distributions, however, can be studied theoretically in terms of counting rule arguments, and they can be checked independently by measurements of the parton structure functions in deep inelastic lepton-hadron scattering. The present volume is the work of Hard Probe Collaboration, a group of theorists who are interested in the problem and were willing to dedicate a considerable amount of their time and work on it. The necessary preparation, planning and coordination of the project were carried out in two workshops of two weeks' duration each, in February 1994 at CERn in Geneva andin July 1994 at LBL in Berkeley

  4. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  5. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  6. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  7. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  9. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  11. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  12. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  14. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  15. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  16. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  17. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  18. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  19. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  1. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  2. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  3. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  4. ASSOCIATION BETWEEN RETINAL HARD EXUDATES AND DYSLIPIDEMIA IN TYPE 2 DIABETIC PATIENTS IN RURAL KARNATAKA

    Directory of Open Access Journals (Sweden)

    Arun Kumar B.

    2015-10-01

    Full Text Available AIM: To evaluate the association of elevated serum lipids with retinal hard exudates in type 2 diabetic patients in rural Karnataka. MATERIAL AND METHODS : Hospital based cross sectional study which included 60 (n=60 type 2 diabetic patients (60 eyes fulfilling the inclusion criteria. Patients were subjected to detailed ocular examination, fundus examination done under full dilatation using indirect ophth almoscope with 20D lens and slit lamp biomicroscope with 90D lens. Fundus photographs were obtained using fundus camera. Grading of retinal hard exudates performed by utilizing modified Airlie House classification. The modified Airlie House Classification used is as follows: Grade 0 - No evidence of hard exudates; Grade 1 : Questionable hard exudates present; Grade 2 : Hard exudates less than standard photograph 3; Grade 3 : Hard exudates greater than or equal to standard photograph 3, but less than standard p hotograph 5; Grade 4 : Hard exudates greater than or equal to standard photograph 5, but less than standard photograph 4 and Grade 5 : Hard exudates greater than or equal to standard photograph 4. These grades were further divided into three groups of patie nt severity as follows: Group 1 (absent or minimal hard exudates included patients with Grade 0, 1 or 2 hard exudates; Group 2 (hard exudates present included patients with Grade 3 or 4 hard exudates and Group 3 (prominent hard exudates included patient s with Grade 5 hard exudates. Fasting lipid profile including serum total cholesterol, low density lipoproteins, very low density lipoproteins, high density lipoproteins and triglycerides was obtained. Association of dyslipidemia with retinal hard exudates was analysed using one way ANOVA test. RESULTS: On statistical analysis with ANOVA test retinal hard exudates were significantly associated with elevated total cholesterol (p= .0001, triglycerides (p= .0001, serum LDL (p=.008, serum VLDL (p=.012, and negative correlation was found

  5. Global Analysis of Minimal Surfaces

    CERN Document Server

    Dierkes, Ulrich; Tromba, Anthony J

    2010-01-01

    Many properties of minimal surfaces are of a global nature, and this is already true for the results treated in the first two volumes of the treatise. Part I of the present book can be viewed as an extension of these results. For instance, the first two chapters deal with existence, regularity and uniqueness theorems for minimal surfaces with partially free boundaries. Here one of the main features is the possibility of 'edge-crawling' along free parts of the boundary. The third chapter deals with a priori estimates for minimal surfaces in higher dimensions and for minimizers of singular integ

  6. Minimal Surfaces for Hitchin Representations

    DEFF Research Database (Denmark)

    Li, Qiongling; Dai, Song

    2018-01-01

    . In this paper, we investigate the properties of immersed minimal surfaces inside symmetric space associated to a subloci of Hitchin component: $q_n$ and $q_{n-1}$ case. First, we show that the pullback metric of the minimal surface dominates a constant multiple of the hyperbolic metric in the same conformal...... class and has a strong rigidity property. Secondly, we show that the immersed minimal surface is never tangential to any flat inside the symmetric space. As a direct corollary, the pullback metric of the minimal surface is always strictly negatively curved. In the end, we find a fully decoupled system...

  7. Hard-to-fill vacancies.

    Science.gov (United States)

    Williams, Ruth

    2010-09-29

    Skills for Health has launched a set of resources to help healthcare employers tackle hard-to-fill entry-level vacancies and provide sustainable employment for local unemployed people. The Sector Employability Toolkit aims to reduce recruitment and retention costs for entry-level posts and repare people for employment through pre-job training programmes, and support employers to develop local partnerships to gain access to wider pools of candidates and funding streams.

  8. Pushing hard on the accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1987-09-15

    The quest for new techniques to drive future generations of particle accelerators has been pushed hard in recent years, efforts having been highlighted by workshops in Europe, organized by the European Committee for Future Accelerators, and in the US. The latest ECFA Workshop on New Developments in Particle Acceleration Techniques, held at Orsay from 29 June to 4 July, showed how the initial frantic search for innovation is now maturing.

  9. CMS results on hard diffraction

    CERN Document Server

    INSPIRE-00107098

    2013-01-01

    In these proceedings we present CMS results on hard diffraction. Diffractive dijet production in pp collisions at $\\sqrt{s}$=7 TeV is discussed. The cross section for dijet production is presented as a function of $\\tilde{\\xi}$, representing the fractional momentum loss of the scattered proton in single-diffractive events. The observation of W and Z boson production in events with a large pseudo-rapidity gap is also presented.

  10. Close encounter with the hard-discounter : A multiple-store shopping perspective on the impact of local hard-discounter entry

    NARCIS (Netherlands)

    Vroegrijk, M.J.J.; Gijsbrechts, E.; Campo, K.

    2013-01-01

    Hard discounters” (HDs) have become a considerable force in grocery retailing. With rock-bottom prices and minimal assortments, they differ greatly from “large discounters” such as Wal-Mart, constituting complements to, rather than substitutes for, more traditional supermarkets. Therefore, the

  11. Playing Moderately Hard to Get

    Directory of Open Access Journals (Sweden)

    Stephen Reysen

    2013-12-01

    Full Text Available In two studies, we examined the effect of different degrees of attraction reciprocation on ratings of attraction toward a potential romantic partner. Undergraduate college student participants imagined a potential romantic partner who reciprocated a low (reciprocating attraction one day a week, moderate (reciprocating attraction three days a week, high (reciprocating attraction five days a week, or unspecified degree of attraction (no mention of reciprocation. Participants then rated their degree of attraction toward the potential partner. The results of Study 1 provided only partial support for Brehm’s emotion intensity theory. However, after revising the high reciprocation condition vignette in Study 2, supporting Brehm’s emotion intensity theory, results show that a potential partners’ display of reciprocation of attraction acted as a deterrent to participants’ intensity of experienced attraction to the potential partner. The results support the notion that playing moderately hard to get elicits more intense feelings of attraction from potential suitors than playing too easy or too hard to get. Discussion of previous research examining playing hard to get is also re-examined through an emotion intensity theory theoretical lens.

  12. CMOS optimization for radiation hardness

    International Nuclear Information System (INIS)

    Derbenwick, G.F.; Fossum, J.G.

    1975-01-01

    Several approaches to the attainment of radiation-hardened MOS circuits have been investigated in the last few years. These have included implanting the SiO 2 gate insulator with aluminum, using chrome-aluminum layered gate metallization, using Al 2 O 3 as the gate insulator, and optimizing the MOS fabrication process. Earlier process optimization studies were restricted primarily to p-channel devices operating with negative gate biases. Since knowledge of the hardness dependence upon processing and design parameters is essential in producing hardened integrated circuits, a comprehensive investigation of the effects of both process and design optimization on radiation-hardened CMOS integrated circuits was undertaken. The goals are to define and establish a radiation-hardened processing sequence for CMOS integrated circuits and to formulate quantitative relationships between process and design parameters and the radiation hardness. Using these equations, the basic CMOS design can then be optimized for radiation hardness and some understanding of the basic physics responsible for the radiation damage can be gained. Results are presented

  13. Effect of Antioxidant Mixtures on Growth and Ochratoxin A Production of Aspergillus Section Nigri Species under Different Water Activity Conditions on Peanut Meal Extract Agar

    Directory of Open Access Journals (Sweden)

    Carla Barberis

    2010-06-01

    Full Text Available The effect of mixtures of antioxidants butylated hydroxyanisol (BHA and propyl paraben (PP on lag phase, growth rate and ochratoxin A (OTA production by four Aspergillus section Nigri strains was evaluated on peanut meal extract agar (PMEA under different water activities (aw. The antioxidant mixtures used were: BHA + PP (mM, M1 (0.5 + 0.5, M2 (1.0 + 0.5, M3 (2.5 + 0.5, M4 (0.5 + 1.0, M5 (1.0 + 1.0, M6 (2.5 + 1.0, M7 (5.0 + 2.5 and M8 (10 + 2.5. The mixture M8 completely suppressed mycelial growth for all strains. A significant stimulation in OTA production was observed with mixtures M1 to M5 mainly at the highest aw; whereas M6, M7 and M8 completely inhibited OTA production in all strains assayed; except M6 in A. carbonarius strain (RCP G. These results could enable a future intervention strategy to minimize OTA contamination.

  14. INFLUENCE OF ANNEALING ON HARDNESS OF Cr-Mn-Ni CAST IRONS

    Directory of Open Access Journals (Sweden)

    V. V. Netrebko

    2015-01-01

    Full Text Available The necessary level of material’s hardness is determined by the exploitation conditions and presence of technological operations during manufacturing of articles. Mechanical edge cutting machining of wear resistant materials is impeded because of their high hardness. It is recommended to apply annealing in order to decrease hardness and improve machinability. The purpose of the work consisted in obtaining of regression dependences of cast iron’s macrohardness on its chemical content after annealing at 730 °С. With the use of mathematical experimental design the regression dependences of cast iron’s macrohardness and structural components’ microhardness on С, Cr, Mn, Ni content have been established. The minimal hardness of 27,6 HRC after annealing at 730 °С is obtained in the cast iron containing: 3,9% С; 11,4% Cr; 0,6% Mn; 0,2% Ni. The maximal hardness of 70,4 HRC is obtained when the content is as follows: 1,1% С; 25,6% Cr; 5,4% Mn; 3,0% Ni. Annealing at 730 °С decreases the cast irons’ hardness containing the minimal amount of Cr, Mn and Ni. Annealing at 730 °С is recommended for cast irons alloyed by Mn and Ni for increasing of hardness.

  15. Probabilistic Properties of Rectilinear Steiner Minimal Trees

    Directory of Open Access Journals (Sweden)

    V. N. Salnikov

    2015-01-01

    Full Text Available This work concerns the properties of Steiner minimal trees for the manhattan plane in the context of introducing a probability measure. This problem is important because exact algorithms to solve the Steiner problem are computationally expensive (NP-hard and the solution (especially in the case of big number of points to be connected has a diversity of practical applications. That is why the work considers a possibility to rank the possible topologies of the minimal trees with respect to a probability of their usage. For this, the known facts about the structural properties of minimal trees for selected metrics have been analyzed to see their usefulness for the problem in question. For the small amount of boundary (fixed vertices, the paper offers a way to introduce a probability measure as a corollary of proved theorem about some structural properties of the minimal trees.This work is considered to further the previous similar activity concerning a problem of searching for minimal fillings, and it is a door opener to the more general (complicated task. The stated method demonstrates the possibility to reach the final result analytically, which gives a chance of its applicability to the case of the bigger number of boundary vertices (probably, with the use of computer engineering.The introducing definition of an essential Steiner point allowed a considerable restriction of the ambiguity of initial problem solution and, at the same time, comparison of such an approach with more classical works in the field concerned. The paper also lists main barriers of classical approaches, preventing their use for the task of introducing a probability measure.In prospect, application areas of the described method are expected to be wider both in terms of system enlargement (the number of boundary vertices and in terms of other metric spaces (the Euclidean case is of especial interest. The main interest is to find the classes of topologies with significantly

  16. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  17. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  18. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  19. Impact of aging on radiation hardness

    International Nuclear Information System (INIS)

    Shaneyfelt, M.R.; Winokur, P.S.; Fleetwood, D.M.

    1997-01-01

    Burn-in effects are used to demonstrate the potential impact of thermally activated aging effects on functional and parametric radiation hardness. These results have implications on hardness assurance testing. Techniques for characterizing aging effects are proposed

  20. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... Quitting drugs is hard because addiction is a brain disease. Your brain is like a control tower that sends out ... and choices. Addiction changes the signals in your brain and makes it hard to feel OK without ...

  1. Guidelines for mixed waste minimization

    International Nuclear Information System (INIS)

    Owens, C.

    1992-02-01

    Currently, there is no commercial mixed waste disposal available in the United States. Storage and treatment for commercial mixed waste is limited. Host States and compacts region officials are encouraging their mixed waste generators to minimize their mixed wastes because of management limitations. This document provides a guide to mixed waste minimization

  2. Minimal changes in health status questionnaires: distinction between minimally detectable change and minimally important change

    Directory of Open Access Journals (Sweden)

    Knol Dirk L

    2006-08-01

    Full Text Available Abstract Changes in scores on health status questionnaires are difficult to interpret. Several methods to determine minimally important changes (MICs have been proposed which can broadly be divided in distribution-based and anchor-based methods. Comparisons of these methods have led to insight into essential differences between these approaches. Some authors have tried to come to a uniform measure for the MIC, such as 0.5 standard deviation and the value of one standard error of measurement (SEM. Others have emphasized the diversity of MIC values, depending on the type of anchor, the definition of minimal importance on the anchor, and characteristics of the disease under study. A closer look makes clear that some distribution-based methods have been merely focused on minimally detectable changes. For assessing minimally important changes, anchor-based methods are preferred, as they include a definition of what is minimally important. Acknowledging the distinction between minimally detectable and minimally important changes is useful, not only to avoid confusion among MIC methods, but also to gain information on two important benchmarks on the scale of a health status measurement instrument. Appreciating the distinction, it becomes possible to judge whether the minimally detectable change of a measurement instrument is sufficiently small to detect minimally important changes.

  3. Hard dental tissue minimal-invasive preparation using contemporary polymer rotating instruments and laser

    OpenAIRE

    Beloica Miloš; Vulićević Zoran R.; Mandinić Zoran; Radović Ivana; Jovičić Olivera; Carević Momir; Tekić Jasmina

    2014-01-01

    Goal of contemporary dentistry is to decrease the patient’s discomfort during treatment. Dentists aim to achieve maximum with the newly developed dental materials as well as with new cavity preparation techniques in the shortest time span. Since the development of the first constructed borer (drilling machine) for caries removal, the preparation techniques have considerably changed. The progress of dental materials as well as the cavity preparation techniqu...

  4. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  5. Waste minimization handbook, Volume 1

    International Nuclear Information System (INIS)

    Boing, L.E.; Coffey, M.J.

    1995-12-01

    This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility's life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996

  6. Waste minimization handbook, Volume 1

    Energy Technology Data Exchange (ETDEWEB)

    Boing, L.E.; Coffey, M.J.

    1995-12-01

    This technical guide presents various methods used by industry to minimize low-level radioactive waste (LLW) generated during decommissioning and decontamination (D and D) activities. Such activities generate significant amounts of LLW during their operations. Waste minimization refers to any measure, procedure, or technique that reduces the amount of waste generated during a specific operation or project. Preventive waste minimization techniques implemented when a project is initiated can significantly reduce waste. Techniques implemented during decontamination activities reduce the cost of decommissioning. The application of waste minimization techniques is not limited to D and D activities; it is also useful during any phase of a facility`s life cycle. This compendium will be supplemented with a second volume of abstracts of hundreds of papers related to minimizing low-level nuclear waste. This second volume is expected to be released in late 1996.

  7. Minimal Webs in Riemannian Manifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen

    2008-01-01

    For a given combinatorial graph $G$ a {\\it geometrization} $(G, g)$ of the graph is obtained by considering each edge of the graph as a $1-$dimensional manifold with an associated metric $g$. In this paper we are concerned with {\\it minimal isometric immersions} of geometrized graphs $(G, g......)$ into Riemannian manifolds $(N^{n}, h)$. Such immersions we call {\\em{minimal webs}}. They admit a natural 'geometric' extension of the intrinsic combinatorial discrete Laplacian. The geometric Laplacian on minimal webs enjoys standard properties such as the maximum principle and the divergence theorems, which...... are of instrumental importance for the applications. We apply these properties to show that minimal webs in ambient Riemannian spaces share several analytic and geometric properties with their smooth (minimal submanifold) counterparts in such spaces. In particular we use appropriate versions of the divergence...

  8. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  9. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  10. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  12. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  13. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  14. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  15. Approaches for enhancing in situ detection of enterocin genes in thermized milk, and selective isolation of enterocin-producing Enterococcus faecium from Baird-Parker agar.

    Science.gov (United States)

    Vandera, Elpiniki; Tsirka, Georgia; Kakouri, Athanasia; Koukkou, Anna-Irini; Samelis, John

    2018-05-21

    Enterococci are naturally selected for growth in thermized ewes'/goats' milk mixtures used for traditional cooked hard cheese processing in Greece. A culture-independent PCR-based approach was applied to detect the presence of enterocin-encoding genes in naturally culture-enriched thermized milk (TM). Portions of TM (63 °C, 30 s) collected from a commercial cheese plant before addition of starters were fermented at 37 °C for 48 h to facilitate growth of indigenous enterococci. The multiple enterocin-producing (m-Ent+) Enterococcus faecium KE82 and the nisin A-producing Lactococcus lactis subsp. cremoris M104 served as bacteriocin-positive inocula in separate TM treatments. The PCR results revealed a constant presence of the enterocin A, B and P genes in TM fermented naturally at 37 °C. Eleven out of 42 (26.2%) lactic isolates from the enriched TM cultures without inoculation were Ent+ E. faecium assigned to three biotypes. Biotype I (4 isolates) included single entA possessors, whereas biotype II (5 isolates) and biotype III (2 isolates) were m-Ent+ variants profiling entA-entB-entP and entA-entB genes, respectively. Biotype II displayed the strongest antilisterial activity in vitro. Surprisingly, 85.7% (6/7) of the m-Ent+ E. faecium were selectively isolated from Baird-Parker agar, reflecting their natural resistance to 0.01% tellurite contained in the egg yolk supplement. No cytolysin-positive E. faecalis or other Ent+ Enterococcus spp. were isolated. In conclusion, commercially thermized Greek milk is a natural pool or 'reservoir' of antagonistic Ent+ or m-Ent+ E. faecium strains that can be easily detected and recovered by applying this PCR-based approach to naturally fermented milks or cheese products. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Minimal Poems Written in 1979 Minimal Poems Written in 1979

    Directory of Open Access Journals (Sweden)

    Sandra Sirangelo Maggio

    2008-04-01

    Full Text Available The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism. The reading of M. van der Slice's Minimal Poems Written in 1979 (the work, actually, has no title reminded me of a book I have seen a long time ago. called Truth, which had not even a single word printed inside. In either case we have a sample of how often excentricities can prove efficient means of artistic creativity, in this new literary trend known as Minimalism.

  17. The hard problem of cooperation.

    Directory of Open Access Journals (Sweden)

    Kimmo Eriksson

    Full Text Available Based on individual variation in cooperative inclinations, we define the "hard problem of cooperation" as that of achieving high levels of cooperation in a group of non-cooperative types. Can the hard problem be solved by institutions with monitoring and sanctions? In a laboratory experiment we find that the answer is affirmative if the institution is imposed on the group but negative if development of the institution is left to the group to vote on. In the experiment, participants were divided into groups of either cooperative types or non-cooperative types depending on their behavior in a public goods game. In these homogeneous groups they repeatedly played a public goods game regulated by an institution that incorporated several of the key properties identified by Ostrom: operational rules, monitoring, rewards, punishments, and (in one condition change of rules. When change of rules was not possible and punishments were set to be high, groups of both types generally abided by operational rules demanding high contributions to the common good, and thereby achieved high levels of payoffs. Under less severe rules, both types of groups did worse but non-cooperative types did worst. Thus, non-cooperative groups profited the most from being governed by an institution demanding high contributions and employing high punishments. Nevertheless, in a condition where change of rules through voting was made possible, development of the institution in this direction was more often voted down in groups of non-cooperative types. We discuss the relevance of the hard problem and fit our results into a bigger picture of institutional and individual determinants of cooperative behavior.

  18. The hard problem of cooperation.

    Science.gov (United States)

    Eriksson, Kimmo; Strimling, Pontus

    2012-01-01

    Based on individual variation in cooperative inclinations, we define the "hard problem of cooperation" as that of achieving high levels of cooperation in a group of non-cooperative types. Can the hard problem be solved by institutions with monitoring and sanctions? In a laboratory experiment we find that the answer is affirmative if the institution is imposed on the group but negative if development of the institution is left to the group to vote on. In the experiment, participants were divided into groups of either cooperative types or non-cooperative types depending on their behavior in a public goods game. In these homogeneous groups they repeatedly played a public goods game regulated by an institution that incorporated several of the key properties identified by Ostrom: operational rules, monitoring, rewards, punishments, and (in one condition) change of rules. When change of rules was not possible and punishments were set to be high, groups of both types generally abided by operational rules demanding high contributions to the common good, and thereby achieved high levels of payoffs. Under less severe rules, both types of groups did worse but non-cooperative types did worst. Thus, non-cooperative groups profited the most from being governed by an institution demanding high contributions and employing high punishments. Nevertheless, in a condition where change of rules through voting was made possible, development of the institution in this direction was more often voted down in groups of non-cooperative types. We discuss the relevance of the hard problem and fit our results into a bigger picture of institutional and individual determinants of cooperative behavior.

  19. Hard electroproduction of hybrid mesons

    International Nuclear Information System (INIS)

    Anikin, I.V.; LPT Universite Paris-Sud, Orsay; Szymanowski, L.; Teryaev, O.V.; ); Wallon, S.

    2005-01-01

    We estimate the sizeable cross section for deep exclusive electroproduction of an exotic J PC = 1 -+ hybrid meson in the Bjorken regime. The production amplitude scales like the one for usual meson electroproduction, i.e. as 1/Q 2 . This is due to the non-vanishing leading twist distribution amplitude for the hybrid meson, which may be normalized thanks to its relation to the energy momentum tensor and to the QCD sum rules technique. The hard amplitude is considered up to next-to-leading order in as and we explore the consequences of fixing the renormalization scale ambiguity through the BLM procedure. (author)

  20. Hard Identity and Soft Identity

    Directory of Open Access Journals (Sweden)

    Hassan Rachik

    2006-04-01

    Full Text Available Often collective identities are classified depending on their contents and rarely depending on their forms. Differentiation between soft identity and hard identity is applied to diverse collective identities: religious, political, national, tribal ones, etc. This classification is made following the principal dimensions of collective identities: type of classification (univocal and exclusive or relative and contextual, the absence or presence of conflictsof loyalty, selective or totalitarian, objective or subjective conception, among others. The different characteristics analysed contribute to outlining an increasingly frequent type of identity: the authoritarian identity.

  1. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  2. Minimal Flavour Violation and Beyond

    CERN Document Server

    Isidori, Gino

    2012-01-01

    We review the formulation of the Minimal Flavour Violation (MFV) hypothesis in the quark sector, as well as some "variations on a theme" based on smaller flavour symmetry groups and/or less minimal breaking terms. We also review how these hypotheses can be tested in B decays and by means of other flavour-physics observables. The phenomenological consequences of MFV are discussed both in general terms, employing a general effective theory approach, and in the specific context of the Minimal Supersymmetric extension of the SM.

  3. Minimizing waste in environmental restoration

    International Nuclear Information System (INIS)

    Thuot, J.R.; Moos, L.

    1996-01-01

    Environmental restoration, decontamination and decommissioning, and facility dismantlement projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized; however, there are significant areas where waste and cost can be reduced by careful planning and execution. Waste reduction can occur in three ways: beneficial reuse or recycling, segregation of waste types, and reducing generation of secondary waste

  4. Minimizing waste in environmental restoration

    International Nuclear Information System (INIS)

    Moos, L.; Thuot, J.R.

    1996-01-01

    Environmental restoration, decontamination and decommissioning and facility dismantelment projects are not typically known for their waste minimization and pollution prevention efforts. Typical projects are driven by schedules and milestones with little attention given to cost or waste minimization. Conventional wisdom in these projects is that the waste already exists and cannot be reduced or minimized. In fact, however, there are three significant areas where waste and cost can be reduced. Waste reduction can occur in three ways: beneficial reuse or recycling; segregation of waste types; and reducing generation of secondary waste. This paper will discuss several examples of reuse, recycle, segregation, and secondary waste reduction at ANL restoration programs

  5. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  6. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  7. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  8. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  9. Driven self-assembly of hard nanoplates on soft elastic shells

    International Nuclear Information System (INIS)

    Zhang Yao-Yang; Hua Yun-Feng; Deng Zhen-Yu

    2015-01-01

    The driven self-assembly behaviors of hard nanoplates on soft elastic shells are investigated by using molecular dynamics (MD) simulation method, and the driven self-assembly structures of adsorbed hard nanoplates depend on the shape of hard nanoplates and the bending energy of soft elastic shells. Three main structures for adsorbed hard nanoplates, including the ordered aggregation structures of hard nanoplates for elastic shells with a moderate bending energy, the collapsed structures for elastic shells with a low bending energy, and the disordered aggregation structures for hard shells, are observed. The self-assembly process of adsorbed hard nanoplates is driven by the surface tension of the elastic shell, and the shape of driven self-assembly structures is determined on the basis of the minimization of the second moment of mass distribution. Meanwhile, the deformations of elastic shells can be controlled by the number of adsorbed rods as well as the length of adsorbed rods. This investigation can help us understand the complexity of the driven self-assembly of hard nanoplates on elastic shells. (paper)

  10. Relative hardness measurement of soft objects by a new fiber optic sensor

    Science.gov (United States)

    Ahmadi, Roozbeh; Ashtaputre, Pranav; Abou Ziki, Jana; Dargahi, Javad; Packirisamy, Muthukumaran

    2010-06-01

    The measurement of relative hardness of soft objects enables replication of human finger tactile perception capabilities. This ability has many applications not only in automation and robotics industry but also in many other areas such as aerospace and robotic surgery where a robotic tool interacts with a soft contact object. One of the practical examples of interaction between a solid robotic instrument and a soft contact object occurs during robotically-assisted minimally invasive surgery. Measuring the relative hardness of bio-tissue, while contacting the robotic instrument, helps the surgeons to perform this type of surgery more reliably. In the present work, a new optical sensor is proposed to measure the relative hardness of contact objects. In order to measure the hardness of a contact object, like a human finger, it is required to apply a small force/deformation to the object by a tactile sensor. Then, the applied force and resulting deformation should be recorded at certain points to enable the relative hardness measurement. In this work, force/deformation data for a contact object is recorded at certain points by the proposed optical sensor. Recorded data is used to measure the relative hardness of soft objects. Based on the proposed design, an experimental setup was developed and experimental tests were performed to measure the relative hardness of elastomeric materials. Experimental results verify the ability of the proposed optical sensor to measure the relative hardness of elastomeric samples.

  11. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  12. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  13. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  14. Aespoe hard rock laboratory Sweden

    International Nuclear Information System (INIS)

    1992-01-01

    The aim of the new Aespoe hard rock laboratory is to demonstrate state of the art of technology and evaluation methods before the start of actual construction work on the planned deep repository for spent nuclear fuel. The nine country OECD/NEA project in the Stripa mine in Sweden has been an excellent example of high quality international research co-operation. In Sweden the new Aespoe hard rock laboratory will gradually take over and finalize this work. SKB very much appreciates the continued international participation in Aespoe which is of great value for the quality efficiency, and confidence in this kind of work. We have invited a number of leading experts to this first international seminar to summarize the current state of a number of key questions. The contributions show the great progress that has taken place during the years. The results show that there is a solid scientific basis for using this knowledge on site specific preparation and work on actual repositories. (au)

  15. Sludge minimization technologies - an overview

    Energy Technology Data Exchange (ETDEWEB)

    Oedegaard, Hallvard

    2003-07-01

    The management of wastewater sludge from wastewater treatment plants represents one of the major challenges in wastewater treatment today. The cost of the sludge treatment amounts to more that the cost of the liquid in many cases. Therefore the focus on and interest in sludge minimization is steadily increasing. In the paper an overview is given for sludge minimization (sludge mass reduction) options. It is demonstrated that sludge minimization may be a result of reduced production of sludge and/or disintegration processes that may take place both in the wastewater treatment stage and in the sludge stage. Various sludge disintegration technologies for sludge minimization are discussed, including mechanical methods (focusing on stirred ball-mill, high-pressure homogenizer, ultrasonic disintegrator), chemical methods (focusing on the use of ozone), physical methods (focusing on thermal and thermal/chemical hydrolysis) and biological methods (focusing on enzymatic processes). (author)

  16. Wilson loops in minimal surfaces

    International Nuclear Information System (INIS)

    Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

    1999-01-01

    The AdS/CFT correspondence suggests that the Wilson loop of the large N gauge theory with N = 4 supersymmetry in 4 dimensions is described by a minimal surface in AdS 5 x S 5 . The authors examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which the authors call BPS loops, whose expectation values are free from ultra-violet divergence. They formulate the loop equation for such loops. To the extent that they have checked, the minimal surface in AdS 5 x S 5 gives a solution of the equation. The authors also discuss the zig-zag symmetry of the loop operator. In the N = 4 gauge theory, they expect the zig-zag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. They will show how this is realized for the minimal surface

  17. Classical strings and minimal surfaces

    International Nuclear Information System (INIS)

    Urbantke, H.

    1986-01-01

    Real Lorentzian forms of some complex or complexified Euclidean minimal surfaces are obtained as an application of H.A. Schwarz' solution to the initial value problem or a search for surfaces admitting a group of Poincare transformations. (Author)

  18. Minimal Gromov-Witten rings

    International Nuclear Information System (INIS)

    Przyjalkowski, V V

    2008-01-01

    We construct an abstract theory of Gromov-Witten invariants of genus 0 for quantum minimal Fano varieties (a minimal class of varieties which is natural from the quantum cohomological viewpoint). Namely, we consider the minimal Gromov-Witten ring: a commutative algebra whose generators and relations are of the form used in the Gromov-Witten theory of Fano varieties (of unspecified dimension). The Gromov-Witten theory of any quantum minimal variety is a homomorphism from this ring to C. We prove an abstract reconstruction theorem which says that this ring is isomorphic to the free commutative ring generated by 'prime two-pointed invariants'. We also find solutions of the differential equation of type DN for a Fano variety of dimension N in terms of the generating series of one-pointed Gromov-Witten invariants

  19. Wilson loops and minimal surfaces

    International Nuclear Information System (INIS)

    Drukker, Nadav; Gross, David J.; Ooguri, Hirosi

    1999-01-01

    The AdS-CFT correspondence suggests that the Wilson loop of the large N gauge theory with N=4 supersymmetry in four dimensions is described by a minimal surface in AdS 5 xS 5 . We examine various aspects of this proposal, comparing gauge theory expectations with computations of minimal surfaces. There is a distinguished class of loops, which we call BPS loops, whose expectation values are free from ultraviolet divergence. We formulate the loop equation for such loops. To the extent that we have checked, the minimal surface in AdS 5 xS 5 gives a solution of the equation. We also discuss the zigzag symmetry of the loop operator. In the N=4 gauge theory, we expect the zigzag symmetry to hold when the loop does not couple the scalar fields in the supermultiplet. We will show how this is realized for the minimal surface. (c) 1999 The American Physical Society

  20. Minimal string theory is logarithmic

    International Nuclear Information System (INIS)

    Ishimoto, Yukitaka; Yamaguchi, Shun-ichi

    2005-01-01

    We study the simplest examples of minimal string theory whose worldsheet description is the unitary (p,q) minimal model coupled to two-dimensional gravity ( Liouville field theory). In the Liouville sector, we show that four-point correlation functions of 'tachyons' exhibit logarithmic singularities, and that the theory turns out to be logarithmic. The relation with Zamolodchikov's logarithmic degenerate fields is also discussed. Our result holds for generic values of (p,q)

  1. Annual Waste Minimization Summary Report

    International Nuclear Information System (INIS)

    Haworth, D.M.

    2011-01-01

    This report summarizes the waste minimization efforts undertaken by National Security TechnoIogies, LLC, for the U. S. Department of Energy, National Nuclear Security Administration Nevada Site Office (NNSA/NSO), during calendar year 2010. The NNSA/NSO Pollution Prevention Program establishes a process to reduce the volume and toxicity of waste generated by NNSA/NSO activities and ensures that proposed methods of treatment, storage, and/or disposal of waste minimize potential threats to human health and the environment.

  2. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. d/Deaf and Hard of Hearing Multilingual Learners: The Development of Communication and Language

    Science.gov (United States)

    Pizzo, Lianna

    2016-01-01

    The author examines the theory and research relevant to educating d/Deaf and Hard of Hearing Multilingual Learners (DMLs). There is minimal research on this population, yet a synthesis of related theory, research, and practice on spoken-language bilinguals can be used to add to the body of knowledge on these learners. Specifically, the author…

  4. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  5. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  6. Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

    Science.gov (United States)

    Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

    2017-07-01

    To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  7. Development of radiation hard scintillators

    International Nuclear Information System (INIS)

    Markley, F.; Woods, D.; Pla-Dalmau, A.; Foster, G.; Blackburn, R.

    1992-05-01

    Substantial improvements have been made in the radiation hardness of plastic scintillators. Cylinders of scintillating materials 2.2 cm in diameter and 1 cm thick have been exposed to 10 Mrads of gamma rays at a dose rate of 1 Mrad/h in a nitrogen atmosphere. One of the formulations tested showed an immediate decrease in pulse height of only 4% and has remained stable for 12 days while annealing in air. By comparison a commercial PVT scintillator showed an immediate decrease of 58% and after 43 days of annealing in air it improved to a 14% loss. The formulated sample consisted of 70 parts by weight of Dow polystyrene, 30 pbw of pentaphenyltrimethyltrisiloxane (Dow Corning DC 705 oil), 2 pbw of p-terphenyl, 0.2 pbw of tetraphenylbutadiene, and 0.5 pbw of UVASIL299LM from Ferro

  8. Phyto-bioconversion of hard coal in the Cynodon dactylon/coal rhizosphere.

    Science.gov (United States)

    Igbinigie, Eric E; Mutambanengwe, Cecil C Z; Rose, Peter D

    2010-03-01

    Fundamental processes involved in the microbial degradation of coal and its derivatives have been well documented. A mutualistic interaction between plant roots and certain microorganisms to aid growth of plants such as Cynodon dactylon (Bermuda grass) on hard coal dumps has recently been suggested. In the present study coal bioconversion activity of nonmycorrhizal fungi was investigated in the C. dactylon/coal rhizosphere. Fungal growth on 2% Duff-agar, gutation formation on nitric acid treated coal and submerged culture activity in nitrogen-rich and -deficient broth formed part of the screening and selection of the fungi. The selected fungal isolates were confirmed to be found in pristine C. dactylon/coal rhizosphere. To simulate bioconversion, a fungal aliquot of this rhizosphere was used as inoculum for a Perfusate fixed bed bioreactor, packed with coal. The results demonstrate an enhanced coal bioconversion facilitated by low molecular weight organics and the bioconversion of coal may be initiated by an introduction of nitrogen moieties to the coal substrate. These findings suggest a phyto-bioconversion of hard coal involving plant and microbes occurring in the rhizosphere to promote the growth of C. dactylon. An understanding of this relationship can serve as a benchmark for coal dumps rehabilitation as well as for the industrial scale bioprocessing of hard coal.

  9. Minimal but non-minimal inflation and electroweak symmetry breaking

    Energy Technology Data Exchange (ETDEWEB)

    Marzola, Luca [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia); Institute of Physics, University of Tartu,Ravila 14c, 50411 Tartu (Estonia); Racioppi, Antonio [National Institute of Chemical Physics and Biophysics,Rävala 10, 10143 Tallinn (Estonia)

    2016-10-07

    We consider the most minimal scale invariant extension of the standard model that allows for successful radiative electroweak symmetry breaking and inflation. The framework involves an extra scalar singlet, that plays the rôle of the inflaton, and is compatibile with current experimental bounds owing to the non-minimal coupling of the latter to gravity. This inflationary scenario predicts a very low tensor-to-scalar ratio r≈10{sup −3}, typical of Higgs-inflation models, but in contrast yields a scalar spectral index n{sub s}≃0.97 which departs from the Starobinsky limit. We briefly discuss the collider phenomenology of the framework.

  10. It must be hard to stay so close

    CERN Multimedia

    Rossi, L

    The ATLAS pixel detector should operate for many years at a few centimeters from the LHC collision region. Every part of the detector should then be radiation hard to levels exceeding 500 KGy. This requirement is particularly difficult to meet for the active parts of the detectors, namely the sensors and the electronics. While the pixel sensors have already proven to be rad-hard, the electronics, being more complex, have required a longer development period. It is then with understandable excitement that the pixel collaboration begun to test the first samples of rad-hard electronics developed in Deep Sub Micron (DSM), a technology where the very pure and thin oxides minimize the transistor voltage threshold variation with irradiation. The first DSM 8" wafers have been delivered in January 2002, after a long and intense design activity lead by Kevin Einsweiler. Several laboratories did contribute to the design of the electronics: the Front End chip has been developed by Bonn, CPPM and LBNL, the Module Contro...

  11. Minimal modification to tribimaximal mixing

    International Nuclear Information System (INIS)

    He Xiaogang; Zee, A.

    2011-01-01

    We explore some ways of minimally modifying the neutrino mixing matrix from tribimaximal, characterized by introducing at most one mixing angle and a CP violating phase thus extending our earlier work. One minimal modification, motivated to some extent by group theoretic considerations, is a simple case with the elements V α2 of the second column in the mixing matrix equal to 1/√(3). Modifications by keeping one of the columns or one of the rows unchanged from tribimaximal mixing all belong to the class of minimal modification. Some of the cases have interesting experimentally testable consequences. In particular, the T2K and MINOS collaborations have recently reported indications of a nonzero θ 13 . For the cases we consider, the new data sharply constrain the CP violating phase angle δ, with δ close to 0 (in some cases) and π disfavored.

  12. Topological gravity with minimal matter

    International Nuclear Information System (INIS)

    Li Keke

    1991-01-01

    Topological minimal matter, obtained by twisting the minimal N = 2 supeconformal field theory, is coupled to two-dimensional topological gravity. The free field formulation of the coupled system allows explicit representations of BRST charge, physical operators and their correlation functions. The contact terms of the physical operators may be evaluated by extending the argument used in a recent solution of topological gravity without matter. The consistency of the contact terms in correlation functions implies recursion relations which coincide with the Virasoro constraints derived from the multi-matrix models. Topological gravity with minimal matter thus provides the field theoretic description for the multi-matrix models of two-dimensional quantum gravity. (orig.)

  13. Minimal Marking: A Success Story

    Directory of Open Access Journals (Sweden)

    Anne McNeilly

    2014-11-01

    Full Text Available The minimal-marking project conducted in Ryerson’s School of Journalism throughout 2012 and early 2013 resulted in significantly higher grammar scores in two first-year classes of minimally marked university students when compared to two traditionally marked classes. The “minimal-marking” concept (Haswell, 1983, which requires dramatically more student engagement, resulted in more successful learning outcomes for surface-level knowledge acquisition than the more traditional approach of “teacher-corrects-all.” Results suggest it would be effective, not just for grammar, punctuation, and word usage, the objective here, but for any material that requires rote-memory learning, such as the Associated Press or Canadian Press style rules used by news publications across North America.

  14. Soft And Hard Skills of Social Worker

    OpenAIRE

    HANTOVÁ, Libuše

    2011-01-01

    The work deals with soft and hard skills relevant to the profession of social worker. The theoretical part at first evaluates and analyzes important soft and hard skills necessary for people working in the field of social work. Then these skills are compared. The practical part illustrates the use of soft and hard skills in practice by means of model scenes and deals with the preferences in three groups of people ? students of social work, social workers and people outside the sphere, namely ...

  15. Theory of hard diffraction and rapidity gaps

    International Nuclear Information System (INIS)

    Del Duca, V.

    1995-06-01

    In this talk we review the models describing the hard diffractive production of jets or more generally high-mass states in presence of rapidity gaps in hadron-hadron and lepton-hadron collisions. By rapidity gaps we mean regions on the lego plot in (pseudo)-rapidity and azimuthal angle where no hadrons are produced, between the jet(s) and an elastically scattered hadron (single hard diffraction) or between two jets (double hard diffraction). (orig.)

  16. Theory of hard diffraction and rapidity gaps

    International Nuclear Information System (INIS)

    Del Duca, V.

    1996-01-01

    In this talk we review the models describing the hard diffractive production of jets or more generally high-mass states in presence of rapidity gaps in hadron-hadron and lepton-hadron collisions. By rapidity gaps we mean regions on the lego plot in (pseudo)-rapidity and azimuthal angle where no hadrons are produced, between the jet(s) and an elastically scattered hadron (single hard diffraction) or between two jets (double hard diffraction). copyright 1996 American Institute of Physics

  17. Advances in hard nucleus cataract surgery

    Directory of Open Access Journals (Sweden)

    Wei Cui

    2013-11-01

    Full Text Available Security and perfect vision and fewer complications are our goals in cataract surgery, and hard-nucleus cataract surgery is always a difficulty one. Many new studies indicate that micro-incision phacoemulsification in treating hard nucleus cataract is obviously effective. This article reviews the evolution process of hard nuclear cataract surgery, the new progress in the research of artificial intraocular lens for microincision, and analyse advantages and disadvantages of various surgical methods.

  18. Non-minimal inflation revisited

    International Nuclear Information System (INIS)

    Nozari, Kourosh; Shafizadeh, Somayeh

    2010-01-01

    We reconsider an inflationary model that inflaton field is non-minimally coupled to gravity. We study the parameter space of the model up to the second (and in some cases third) order of the slow-roll parameters. We calculate inflation parameters in both Jordan and Einstein frames, and the results are compared in these two frames and also with observations. Using the recent observational data from combined WMAP5+SDSS+SNIa datasets, we study constraints imposed on our model parameters, especially the non-minimal coupling ξ.

  19. Minimal Flavor Constraints for Technicolor

    DEFF Research Database (Denmark)

    Sakuma, Hidenori; Sannino, Francesco

    2010-01-01

    We analyze the constraints on the the vacuum polarization of the standard model gauge bosons from a minimal set of flavor observables valid for a general class of models of dynamical electroweak symmetry breaking. We will show that the constraints have a strong impact on the self-coupling and mas......We analyze the constraints on the the vacuum polarization of the standard model gauge bosons from a minimal set of flavor observables valid for a general class of models of dynamical electroweak symmetry breaking. We will show that the constraints have a strong impact on the self...

  20. Harm minimization among teenage drinkers

    DEFF Research Database (Denmark)

    Jørgensen, Morten Hulvej; Curtis, Tine; Christensen, Pia Haudrup

    2007-01-01

    AIM: To examine strategies of harm minimization employed by teenage drinkers. DESIGN, SETTING AND PARTICIPANTS: Two periods of ethnographic fieldwork were conducted in a rural Danish community of approximately 2000 inhabitants. The fieldwork included 50 days of participant observation among 13....... In regulating the social context of drinking they relied on their personal experiences more than on formalized knowledge about alcohol and harm, which they had learned from prevention campaigns and educational programmes. CONCLUSIONS: In this study we found that teenagers may help each other to minimize alcohol...

  1. A cooled water-irrigated intraesophageal balloon to prevent thermal injury during cardiac ablation: experimental study based on an agar phantom

    International Nuclear Information System (INIS)

    Lequerica, Juan L; Berjano, Enrique J; Herrero, Maria; Melecio, Lemuel; Hornero, Fernando

    2008-01-01

    A great deal of current research is directed to finding a way to minimize thermal injury in the esophagus during radiofrequency catheter ablation of the atrium. A recent clinical study employing a cooling intraesophageal balloon reported a reduction of the temperature in the esophageal lumen. However, it could not be determined whether the deeper muscular layer of the esophagus was cooled enough to prevent injury. We built a model based on an agar phantom in order to experimentally study the thermal behavior of this balloon by measuring the temperature not only on the balloon, but also at a hypothetical point between the esophageal lumen and myocardium (2 mm distant). Controlled temperature (55 0 C) ablations were conducted for 120 s. The results showed that (1) the cooling balloon provides a reduction in the final temperature reached, both on the balloon surface and at a distance of 2 mm; (2) coolant temperature has a significant effect on the temperature measured at 2 mm from the esophageal lumen (it has a less effect on the temperature measured on the balloon surface) and (3) the pre-cooling period has a significant effect on the temperature measured on the balloon surface (the effect on the temperature measured 2 mm away is small). The results were in good agreement with those obtained in a previous clinical study. The study suggests that the cooling balloon gives thermal protection to the esophagus when a minimum pre-cooling period of 2 min is programmed at a coolant temperature of 5 deg. C or less. (note)

  2. MEKANISME PENGAWASAN YANG SINERGIS IMPLEMENTASI STANDAR PELAYANAN MINIMAL PENDIDIKAN DASAR DAN MENENGAH

    Directory of Open Access Journals (Sweden)

    Moerdiyanto *

    2005-01-01

    ment index, Indonesia hanya berada di peringkat 111 dari 177 negara di dunia yang disurvei. Salah satu upaya pemerintah untuk meningkatkan mutu layanan pendidikan dituangkan dalam Keputusan Mendiknas nomor 0971U/2002, tentang pengawasan penyelenggaraan pendidikan, termasuk pemenuhan standar pelayanan minimal (SPM. Pada tataran praktis justru yang harus menjadi perhatian adalah bagaimana mekanisme dan prosedur monitoring dan kontrol dilakukan, agar pelaksanaan SPM di setiap lembaga pendidikan berjalan sebagaimana mestinya. Model monitoring dan pengawasan yang intensif adalah bentuk kolaborasi yang sinergis dan produktif antara inspektorat jenderal, Bawasda Provinsi, Bawasda KabupatenlKota dan Pengawas Sekolah, dan masyarakat. Oi dalam pelaksanaan pengawasan perlu dilakukan koordinasi dan sinkronisasi melalui pembagian kekuasaan dan kewenangan pengawasan yang diatur dalam Buku Pedoman Pengawasan Standar Pelayanan Minimal. Pelaksanaan pemeriksaan kolaboratif hendaknya dilandasi oleh prinsip-prinsip sebagai berikut: (1 prinsip manajemen yaitu fungsi kontrol, (2 prinsip pengendalian yaitu memberikan bimbingan, (3 prinsip integritas yang dilandasi integritas pribadi dan profesional, (4 prinsip pemberdayaan atas kemampuan dan kinerja kelembagaan, dan (5 prinsip efektivitas dan efisiensi agar pengawasan hemat biaya, tenaga, dan waktu. Selain itu, pengawasan harus ditempuh secara prosedural, yaitu: (1 dilaksanakan secara berkala dan terpadu, (2 melakukan penilaian atas manfaat dan keberhasilan pelaksanaan program kegiatan, (3 memberikan informasi adanya kotupsi, kolusi dan nepotisme, dan penyampaian saran perbaikan, (4 dilakukan oleh pengawas yang memadai, dan (5 adanya semangat saling memberi dan menerima secara profesional, obyektif dan akuntabel yang bernuansa pemberdayaan.

  3. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  4. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  5. Isoperimetric inequalities for minimal graphs

    International Nuclear Information System (INIS)

    Pacelli Bessa, G.; Montenegro, J.F.

    2007-09-01

    Based on Markvorsen and Palmer's work on mean time exit and isoperimetric inequalities we establish slightly better isoperimetric inequalities and mean time exit estimates for minimal graphs in N x R. We also prove isoperimetric inequalities for submanifolds of Hadamard spaces with tamed second fundamental form. (author)

  6. A Defense of Semantic Minimalism

    Science.gov (United States)

    Kim, Su

    2012-01-01

    Semantic Minimalism is a position about the semantic content of declarative sentences, i.e., the content that is determined entirely by syntax. It is defined by the following two points: "Point 1": The semantic content is a complete/truth-conditional proposition. "Point 2": The semantic content is useful to a theory of…

  7. Torsional Rigidity of Minimal Submanifolds

    DEFF Research Database (Denmark)

    Markvorsen, Steen; Palmer, Vicente

    2006-01-01

    We prove explicit upper bounds for the torsional rigidity of extrinsic domains of minimal submanifolds $P^m$ in ambient Riemannian manifolds $N^n$ with a pole $p$. The upper bounds are given in terms of the torsional rigidities of corresponding Schwarz symmetrizations of the domains in warped...

  8. The debate on minimal deterrence

    International Nuclear Information System (INIS)

    Arbatov, A.; Karp, R.C.; Toth, T.

    1993-01-01

    Revitalization of debates on minimal nuclear deterrence at the present time is induced by the end of the Cold War and a number of unilateral and bilateral actions by the great powers to curtail nuclear arms race and reduce nuclear weapons arsenals

  9. LLNL Waste Minimization Program Plan

    International Nuclear Information System (INIS)

    1990-01-01

    This document is the February 14, 1990 version of the LLNL Waste Minimization Program Plan (WMPP). The Waste Minimization Policy field has undergone continuous changes since its formal inception in the 1984 HSWA legislation. The first LLNL WMPP, Revision A, is dated March 1985. A series of informal revision were made on approximately a semi-annual basis. This Revision 2 is the third formal issuance of the WMPP document. EPA has issued a proposed new policy statement on source reduction and recycling. This policy reflects a preventative strategy to reduce or eliminate the generation of environmentally-harmful pollutants which may be released to the air, land surface, water, or ground water. In accordance with this new policy new guidance to hazardous waste generators on the elements of a Waste Minimization Program was issued. In response to these policies, DOE has revised and issued implementation guidance for DOE Order 5400.1, Waste Minimization Plan and Waste Reduction reporting of DOE Hazardous, Radioactive, and Radioactive Mixed Wastes, final draft January 1990. This WMPP is formatted to meet the current DOE guidance outlines. The current WMPP will be revised to reflect all of these proposed changes when guidelines are established. Updates, changes and revisions to the overall LLNL WMPP will be made as appropriate to reflect ever-changing regulatory requirements. 3 figs., 4 tabs

  10. Minimizing TLD-DRD differences

    International Nuclear Information System (INIS)

    Riley, D.L.; McCoy, R.A.; Connell, W.D.

    1987-01-01

    When substantial differences exist in exposures recorded by TLD's and DRD's, it is often necessary to perform an exposure investigation to reconcile the difference. In working with several operating plants, the authors have observed a number of causes for these differences. This paper outlines these observations and discusses procedures that can be used to minimize them

  11. Acquiring minimally invasive surgical skills

    NARCIS (Netherlands)

    Hiemstra, Ellen

    2012-01-01

    Many topics in surgical skills education have been implemented without a solid scientific basis. For that reason we have tried to find this scientific basis. We have focused on training and evaluation of minimally invasive surgical skills in a training setting and in practice in the operating room.

  12. 30 CFR 75.1720-1 - Distinctively colored hard hats, or hard caps; identification for newly employed, inexperienced...

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Distinctively colored hard hats, or hard caps... STANDARDS-UNDERGROUND COAL MINES Miscellaneous § 75.1720-1 Distinctively colored hard hats, or hard caps; identification for newly employed, inexperienced miners. Hard hats or hard caps distinctively different in color...

  13. 30 CFR 77.1710-1 - Distinctively colored hard hats or hard caps; identification for newly employed, inexperienced...

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Distinctively colored hard hats or hard caps... Distinctively colored hard hats or hard caps; identification for newly employed, inexperienced miners. Hard hats or hard caps distinctively different in color from those worn by experienced miners shall be worn at...

  14. Hard disks with SCSI interface

    CERN Document Server

    Denisov, O Yu

    1999-01-01

    The testing of 20 models of hard SCSI-disks is carried out: the Fujitsu MAE3091LP; the IBM DDRS-39130, DGHS-318220, DNES-318350, DRHS-36V and DRVS-18V; the Quantum Atlas VI 18.2; the Viking 11 9.1; the Seagate ST118202LW, ST118273LW, ST118273W, ST318203LW, ST318275LW, ST34520W, ST39140LW and ST39173W; and the Western Digital WDE9100-0007, WDE9100-AV0016, WDE9100-AV0030 and WDE9180-0048. All tests ran under the Windows NT 4.0 workstation operating system with Service Pack 4, under video mode with 1024*768 pixel resolution, 32- bit colour depth and V-frequency equal to 85 Hz. The detailed description and characteristics of SCSI stores are presented. Test results (ZD Winstone 99 and ZD WinBench 99 tests) are given in both table and diagram (disk transfer rate) forms. (0 refs).

  15. Development of a hard microcontroller

    International Nuclear Information System (INIS)

    Measel, P.R.; Sivo, L.L.; Quilitz, W.E.; Davidson, T.K.

    1976-01-01

    The applicability of commercially available microprocessors to certain systems requiring radiation survival was assessed. A microcontroller was designed and built to perform a monitor and control function of military operational ground equipment, and demonstrated to exceed the radiation hardness goal. The preparation of the microcontroller module required hardware and software design, selection of LSI and other piece part types, development of piece part and module electrical and radiation test techniques, and the performance of radiation tests on the LSI piece parts and the completed module. The microcontroller has a 16-bit central processor unit, a 4096 word read only memory, and a 256 word read-write memory. The module has circumvention circuitry, including a PIN diode radiation detector. The processor device used was the MMI 6701 T 2 L Schottky bipolar 4-bit slice. Electrical exerciser circuits were developed for in-situ electrical testing of microprocessors and memories during irradiation. A test program was developed for a Terradyne J283 microcircuit tester for more complete electrical characterization of the MMI 6701 microprocessor. A simple self-test algorithm was used in the microcontroller for performance testing during irradiation. For the operational demonstration of the microcontroller a TI 960A minicomputer was used to provide the required complex inputs to the module and verify the module outputs

  16. 'Triune' Protection and its Implications for the Minimal State

    Directory of Open Access Journals (Sweden)

    Jinglei Hu

    2009-04-01

    Full Text Available Characterizing the libertarian ideal, Robert Nozick’s Minimal State has been a classic model wherein individual rights are taken for granted, from which state power is derivative, and legitimate only if it protects and reinforces individual rights. However, the “protection” is not so limited as it appears to be and the feedback from the state to individuals is not always positive. A microscopic analysis of the “protection” proffered by minimal state reveals three constituents (retribution, preemption and prevention or preventive restraints, with “preventive restraints” being the most controversial and extensive, and conflicting with the rights as “side-constraints”. By rejecting “utilitarianism of rights”, Nozick sets out to optimally secure rights, yet in so doing, he could hardly reconcile the clash between “constraints” and “restraints”, the inviolable rights supposed to be protected and the protective measures supposed to limit rights

  17. Hazardous waste minimization tracking system

    International Nuclear Information System (INIS)

    Railan, R.

    1994-01-01

    Under RCRA section 3002 9(b) and 3005f(h), hazardous waste generators and owners/operators of treatment, storage, and disposal facilities (TSDFs) are required to certify that they have a program in place to reduce the volume or quantity and toxicity of hazardous waste to the degree determined to be economically practicable. In many cases, there are environmental, as well as, economic benefits, for agencies that pursue pollution prevention options. Several state governments have already enacted waste minimization legislation (e.g., Massachusetts Toxic Use Reduction Act of 1989, and Oregon Toxic Use Reduction Act and Hazardous Waste Reduction Act, July 2, 1989). About twenty six other states have established legislation that will mandate some type of waste minimization program and/or facility planning. The need to address the HAZMIN (Hazardous Waste Minimization) Program at government agencies and private industries has prompted us to identify the importance of managing The HAZMIN Program, and tracking various aspects of the program, as well as the progress made in this area. The open-quotes WASTEclose quotes is a tracking system, which can be used and modified in maintaining the information related to Hazardous Waste Minimization Program, in a manageable fashion. This program maintains, modifies, and retrieves information related to hazardous waste minimization and recycling, and provides automated report generating capabilities. It has a built-in menu, which can be printed either in part or in full. There are instructions on preparing The Annual Waste Report, and The Annual Recycling Report. The program is very user friendly. This program is available in 3.5 inch or 5 1/4 inch floppy disks. A computer with 640K memory is required

  18. Complex technique for materials hardness measurement

    Energy Technology Data Exchange (ETDEWEB)

    Krashchenko, V P; Oksametnaya, O B

    1984-01-01

    A review of existing methods of measurement of material hardness in national and foreign practice has been made. A necessity of improving the technique of material hardness measurement in a wide temperature range and insuring load change with indenting, continuity of imprint application, smooth changing of temperatures along a sample length, and deformation rate control has been noted.

  19. Hard scattering and a diffractive trigger

    International Nuclear Information System (INIS)

    Berger, E.L.; Collins, J.C.; Soper, D.E.; Sterman, G.

    1986-02-01

    Conclusions concerning the properties of hard scattering in diffractively produced systems are summarized. One motivation for studying diffractive hard scattering is to investigate the interface between Regge theory and perturbative QCD. Another is to see whether diffractive triggering can result in an improvement in the signal-to-background ratio of measurements of production of very heavy quarks. 5 refs

  20. ERRATUM: Work smart, wear your hard hat

    CERN Multimedia

    2003-01-01

    An error appeared in the article «Work smart, wear your hard hat» published in Weekly Bulletin 27/2003, page 5. The impact which pierced a hole in the hard hat worn by Gerd Fetchenhauer was the equivalent of a box weighing 5 kg and not 50 kg.

  1. 7 CFR 201.57 - Hard seeds.

    Science.gov (United States)

    2010-01-01

    ... REGULATIONS Germination Tests in the Administration of the Act § 201.57 Hard seeds. Seeds which remain hard at the end of the prescribed test because they have not absorbed water, due to an impermeable seed coat... percentage of germination. For flatpea, continue the swollen seed in test for 14 days when germinating at 15...

  2. Thermal spray coatings replace hard chrome

    International Nuclear Information System (INIS)

    Schroeder, M.; Unger, R.

    1997-01-01

    Hard chrome plating provides good wear and erosion resistance, as well as good corrosion protection and fine surface finishes. Until a few years ago, it could also be applied at a reasonable cost. However, because of the many environmental and financial sanctions that have been imposed on the process over the past several years, cost has been on a consistent upward trend, and is projected to continue to escalate. Therefore, it is very important to find a coating or a process that offers the same characteristics as hard chrome plating, but without the consequent risks. This article lists the benefits and limitations of hard chrome plating, and describes the performance of two thermal spray coatings (tungsten carbide and chromium carbide) that compared favorably with hard chrome plating in a series of tests. It also lists three criteria to determine whether plasma spray or hard chrome plating should be selected

  3. Correlating particle hardness with powder compaction performance.

    Science.gov (United States)

    Cao, Xiaoping; Morganti, Mikayla; Hancock, Bruno C; Masterson, Victoria M

    2010-10-01

    Assessing particle mechanical properties of pharmaceutical materials quickly and with little material can be very important to early stages of pharmaceutical research. In this study, a wide range of pharmaceutical materials were studied using atomic force microscopy (AFM) nanoindentation. A significant amount of particle hardness and elastic modulus data were provided. Moreover, powder compact mechanical properties of these materials were investigated in order to build correlation between the particle hardness and powder compaction performance. It was found that the materials with very low or high particle hardness most likely exhibit poor compaction performance while the materials with medium particle hardness usually have good compaction behavior. Additionally, the results from this study enriched Hiestand's special case concept on particle hardness and powder compaction performance. This study suggests that the use of AFM nanoindentation can help to screen mechanical properties of pharmaceutical materials at early development stages of pharmaceutical research.

  4. Implications of water hardness in ecotoxicological assessments for water quality regulatory purposes: a case study with the aquatic snail Biomphalaria glabrata (Say, 1818

    Directory of Open Access Journals (Sweden)

    EC Oliveira-Filho

    Full Text Available Water hardness is a property depending on the presence of alkaline earth metals, mainly calcium and magnesium. Among the strategies for water quality monitoring, ecotoxicological assays are performed to minimize impacts and classify water bodies. For these laboratory evaluations parameters are previously defined in the guidelines, including water hardness for both cultivation and testing medium. The present work was performed to evaluate the effects of different levels of water hardness on the survival and reproduction of the freshwater snail Biomphalaria glabrata and discuss the influence of natural water hardness on the results of ecotoxicological tests with these environmental samples. Comparing the groups it was possible to observe that those maintained in waters with least hardness had lower reproductive success, while the groups maintained in highest hardness showed better reproduction. These data show that waters with low hardness make the reproduction of the snail B. glabrata unfeasible, and this reveal a problem for ecotoxicity assays using natural water samples.

  5. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  6. In vitro fermentation and prebiotic potential of novel low molecular weight polysaccharides derived from agar and alginate seaweeds.

    Science.gov (United States)

    Ramnani, Priya; Chitarrari, Roberto; Tuohy, Kieran; Grant, John; Hotchkiss, Sarah; Philp, Kevin; Campbell, Ross; Gill, Chris; Rowland, Ian

    2012-02-01

    Fermentation properties and prebiotic potential of novel low molecular weight polysaccharides (LMWPs) derived from agar and alginate bearing seaweeds was investigated. Ten LMWPs were supplemented to pH, temperature controlled anaerobic batch cultures inoculated with human feces from three donors, in triplicate. Microbiota changes were monitored using Fluorescent in-situ hybridization and short chain fatty acids, the fermentation end products were analysed using gas chromatography. Of the ten LMWPs tested, Gelidium seaweed CC2253 of molecular weight 64.64 KDa showed a significant increase in bifidobacterial populations from log(10) 8.06 at 0 h to log(10) 8.55 at 24 h (p = 0.018). For total bacterial populations, alginate powder CC2238 produced a significant increase from log(10) 9.01 at 0 h to log(10) 9.58 at 24 h (p = 0.032). No changes were observed in the other bacterial groups tested viz. Bacteroides, Lactobacilli/Enterococci, Eubacterium rectale/Clostridium coccoides and Clostridium histolyticum. The polysaccharides also showed significant increases in total SCFA production, particularly acetic and propionic acids, indicating that they were readily fermented. In conclusion, some LMWPs derived from agar and alginate bearing seaweeds were fermented by gut bacteria and exhibited potential to be used a novel source of prebiotics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Determination of in vitro synergy for dual antimicrobial therapy against resistant Neisseria gonorrhoeae using Etest and agar dilution.

    Science.gov (United States)

    Wind, Carolien M; de Vries, Henry J C; van Dam, Alje P

    2015-03-01

    In response to antimicrobial resistance of Neisseria gonorrhoeae to last-resort extended-spectrum cephalosporins, combination therapy of azithromycin+ceftriaxone is now recommended. Dual therapy can be effective to treat monoresistant strains as well as multidrug-resistant strains, preferably employing the effect of in vitro synergy. As reports on in vitro synergy of azithromycin+ceftriaxone in N. gonorrhoeae are conflicting, in this study an evaluation of this combination was performed using a cross-wise Etest method and agar dilution. Synergy was defined as a fractional inhibitory concentration index (FICI) of ≤0.5. To identify other dual treatment options for gonorrhoea, in vitro synergy was evaluated for 65 dual antimicrobial combinations using Etest. Azithromycin, cefixime, ceftriaxone, colistin, ertapenem, fosfomycin, gentamicin, minocycline, moxifloxacin, rifampicin, spectinomycin and tigecycline were screened for synergy in all possible combinations. No synergy or antagonism was found for any of the 65 combinations. The geometric mean FICI ranged from 0.82 to 2.00. The mean FICI of azithromycin+ceftriaxone was 1.18 (Etest) and 0.55 (agar dilution). The difference between both methods did not result in a difference in interpretation of synergy. Ceftriaxone-resistant strain F89 was tested in all combinations and no synergy was found for any of them. Most importantly, the ceftriaxone minimum inhibitory concentration of F89 was not decreased below the breakpoint with any concentration of azithromycin. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  8. Gamma radiation in the reduction of Salmonella spp. inoculated on minimally processed watercress (Nasturtium officinalis)

    International Nuclear Information System (INIS)

    Martins, C.G.; Behrens, J.H.; Destro, M.T.; Franco, B.D.G.M.; Vizeu, D.M.; Hutzler, B.; Landgraf, M.

    2004-01-01

    Consumer attitudes towards foods have changed in the last two decades increasing requirements for freshlike products. Consequently, less extreme treatments or additives are being required. Minimally processed foods have freshlike characteristics and satisfy this new consumer demand. Besides freshness, the minimally processing also provide convenience required by the market. Salad vegetables can be source of pathogen such as Salmonella, Escherichia coli O157:H7, Shigella spp. The minimal processing does not reduce the levels of pathogenic microorganisms to safe levels. Therefore, this study was carried out in order to improve the microbiological safety and the shelf-life of minimally processed vegetables using gamma radiation. Minimally processed watercress inoculated with a cocktail of Salmonella spp was exposed to 0.0, 0.2, 0.5, 0.7, 1.0, 1.2 and 1.5 kGy. Irradiated samples were diluted 1:10 in saline peptone water and plated onto tryptic soy agar that were incubated at 37 deg. C/24 h. D 10 values for Salmonella spp. inoculated in watercress varied from 0.29 to 0.43 kGy. Therefore, a dose of 1.7 kGy will reduce Salmonella population in watercress by 4 log 10 . The shelf-life was increased by 1 1/2 day when the product was exposed to 1 kGy

  9. Gamma radiation in the reduction of S almonella spp. inoculated on minimally processed watercress ( Nasturtium officinalis)

    Science.gov (United States)

    Martins, C. G.; Behrens, J. H.; Destro, M. T.; Franco, B. D. G. M.; Vizeu, D. M.; Hutzler, B.; Landgraf, M.

    2004-09-01

    Consumer attitudes towards foods have changed in the last two decades increasing requirements for freshlike products. Consequently, less extreme treatments or additives are being required. Minimally processed foods have freshlike characteristics and satisfy this new consumer demand. Besides freshness, the minimally processing also provide convenience required by the market. Salad vegetables can be source of pathogen such as Salmonella, Escherichia coli O157:H7, Shigella spp. The minimal processing does not reduce the levels of pathogenic microorganisms to safe levels. Therefore, this study was carried out in order to improve the microbiological safety and the shelf-life of minimally processed vegetables using gamma radiation. Minimally processed watercress inoculated with a cocktail of Salmonella spp was exposed to 0.0, 0.2, 0.5, 0.7, 1.0, 1.2 and 1.5 kGy. Irradiated samples were diluted 1:10 in saline peptone water and plated onto tryptic soy agar that were incubated at 37°C/24 h. D 10 values for Salmonella spp. inoculated in watercress varied from 0.29 to 0.43 kGy. Therefore, a dose of 1.7 kGy will reduce Salmonella population in watercress by 4 log 10. The shelf-life was increased by 1 {1}/{2} day when the product was exposed to 1 kGy.

  10. Gamma radiation in the reduction of Salmonella spp. inoculated on minimally processed watercress (Nasturtium officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Martins, C.G.; Behrens, J.H.; Destro, M.T.; Franco, B.D.G.M.; Vizeu, D.M.; Hutzler, B.; Landgraf, M. E-mail: landgraf@usp.br

    2004-10-01

    Consumer attitudes towards foods have changed in the last two decades increasing requirements for freshlike products. Consequently, less extreme treatments or additives are being required. Minimally processed foods have freshlike characteristics and satisfy this new consumer demand. Besides freshness, the minimally processing also provide convenience required by the market. Salad vegetables can be source of pathogen such as Salmonella, Escherichia coli O157:H7, Shigella spp. The minimal processing does not reduce the levels of pathogenic microorganisms to safe levels. Therefore, this study was carried out in order to improve the microbiological safety and the shelf-life of minimally processed vegetables using gamma radiation. Minimally processed watercress inoculated with a cocktail of Salmonella spp was exposed to 0.0, 0.2, 0.5, 0.7, 1.0, 1.2 and 1.5 kGy. Irradiated samples were diluted 1:10 in saline peptone water and plated onto tryptic soy agar that were incubated at 37 deg. C/24 h. D{sub 10} values for Salmonella spp. inoculated in watercress varied from 0.29 to 0.43 kGy. Therefore, a dose of 1.7 kGy will reduce Salmonella population in watercress by 4 log{sub 10}. The shelf-life was increased by 1 1/2 day when the product was exposed to 1 kGy.

  11. Minimizing communication cost among distributed controllers in software defined networks

    Science.gov (United States)

    Arlimatti, Shivaleela; Elbreiki, Walid; Hassan, Suhaidi; Habbal, Adib; Elshaikh, Mohamed

    2016-08-01

    Software Defined Networking (SDN) is a new paradigm to increase the flexibility of today's network by promising for a programmable network. The fundamental idea behind this new architecture is to simplify network complexity by decoupling control plane and data plane of the network devices, and by making the control plane centralized. Recently controllers have distributed to solve the problem of single point of failure, and to increase scalability and flexibility during workload distribution. Even though, controllers are flexible and scalable to accommodate more number of network switches, yet the problem of intercommunication cost between distributed controllers is still challenging issue in the Software Defined Network environment. This paper, aims to fill the gap by proposing a new mechanism, which minimizes intercommunication cost with graph partitioning algorithm, an NP hard problem. The methodology proposed in this paper is, swapping of network elements between controller domains to minimize communication cost by calculating communication gain. The swapping of elements minimizes inter and intra communication cost among network domains. We validate our work with the OMNeT++ simulation environment tool. Simulation results show that the proposed mechanism minimizes the inter domain communication cost among controllers compared to traditional distributed controllers.

  12. Minimalism and the Pragmatic Frame

    Directory of Open Access Journals (Sweden)

    Ana Falcato

    2016-02-01

    Full Text Available In the debate between literalism and contextualism in semantics, Kent Bach’s project is often taken to stand on the latter side of the divide. In this paper I argue this is a misleading assumption and justify it by contrasting Bach’s assessment of the theoretical eliminability of minimal propositions arguably expressed by well-formed sentences with standard minimalist views, and by further contrasting his account of the division of interpretative processes ascribable to the semantics and pragmatics of a language with a parallel analysis carried out by the most radical opponent to semantic minimalism, i.e., by occasionalism. If my analysis proves right, the sum of its conclusions amounts to a refusal of Bach’s main dichotomies.

  13. Principle of minimal work fluctuations.

    Science.gov (United States)

    Xiao, Gaoyang; Gong, Jiangbin

    2015-08-01

    Understanding and manipulating work fluctuations in microscale and nanoscale systems are of both fundamental and practical interest. For example, in considering the Jarzynski equality 〈e-βW〉=e-βΔF, a change in the fluctuations of e-βW may impact how rapidly the statistical average of e-βW converges towards the theoretical value e-βΔF, where W is the work, β is the inverse temperature, and ΔF is the free energy difference between two equilibrium states. Motivated by our previous study aiming at the suppression of work fluctuations, here we obtain a principle of minimal work fluctuations. In brief, adiabatic processes as treated in quantum and classical adiabatic theorems yield the minimal fluctuations in e-βW. In the quantum domain, if a system initially prepared at thermal equilibrium is subjected to a work protocol but isolated from a bath during the time evolution, then a quantum adiabatic process without energy level crossing (or an assisted adiabatic process reaching the same final states as in a conventional adiabatic process) yields the minimal fluctuations in e-βW, where W is the quantum work defined by two energy measurements at the beginning and at the end of the process. In the classical domain where the classical work protocol is realizable by an adiabatic process, then the classical adiabatic process also yields the minimal fluctuations in e-βW. Numerical experiments based on a Landau-Zener process confirm our theory in the quantum domain, and our theory in the classical domain explains our previous numerical findings regarding the suppression of classical work fluctuations [G. Y. Xiao and J. B. Gong, Phys. Rev. E 90, 052132 (2014)].

  14. Optimizing Processes to Minimize Risk

    Science.gov (United States)

    Loyd, David

    2017-01-01

    NASA, like the other hazardous industries, has suffered very catastrophic losses. Human error will likely never be completely eliminated as a factor in our failures. When you can't eliminate risk, focus on mitigating the worst consequences and recovering operations. Bolstering processes to emphasize the role of integration and problem solving is key to success. Building an effective Safety Culture bolsters skill-based performance that minimizes risk and encourages successful engagement.

  15. Minimal Length, Measurability and Gravity

    Directory of Open Access Journals (Sweden)

    Alexander Shalyt-Margolin

    2016-03-01

    Full Text Available The present work is a continuation of the previous papers written by the author on the subject. In terms of the measurability (or measurable quantities notion introduced in a minimal length theory, first the consideration is given to a quantum theory in the momentum representation. The same terms are used to consider the Markov gravity model that here illustrates the general approach to studies of gravity in terms of measurable quantities.

  16. [Minimally invasive coronary artery surgery].

    Science.gov (United States)

    Zalaquett, R; Howard, M; Irarrázaval, M J; Morán, S; Maturana, G; Becker, P; Medel, J; Sacco, C; Lema, G; Canessa, R; Cruz, F

    1999-01-01

    There is a growing interest to perform a left internal mammary artery (LIMA) graft to the left anterior descending coronary artery (LAD) on a beating heart through a minimally invasive access to the chest cavity. To report the experience with minimally invasive coronary artery surgery. Analysis of 11 patients aged 48 to 79 years old with single vessel disease that, between 1996 and 1997, had a LIMA graft to the LAD performed through a minimally invasive left anterior mediastinotomy, without cardiopulmonary bypass. A 6 to 10 cm left parasternal incision was done. The LIMA to the LAD anastomosis was done after pharmacological heart rate and blood pressure control and a period of ischemic pre conditioning. Graft patency was confirmed intraoperatively by standard Doppler techniques. Patients were followed for a mean of 11.6 months (7-15 months). All patients were extubated in the operating room and transferred out of the intensive care unit on the next morning. Seven patients were discharged on the third postoperative day. Duplex scanning confirmed graft patency in all patients before discharge; in two patients, it was confirmed additionally by arteriography. There was no hospital mortality, no perioperative myocardial infarction and no bleeding problems. After follow up, ten patients were free of angina, in functional class I and pleased with the surgical and cosmetic results. One patient developed atypical angina on the seventh postoperative month and a selective arteriography confirmed stenosis of the anastomosis. A successful angioplasty of the original LAD lesion was carried out. A minimally invasive left anterior mediastinotomy is a good surgical access to perform a successful LIMA to LAD graft without cardiopulmonary bypass, allowing a shorter hospital stay and earlier postoperative recovery. However, a larger experience and a longer follow up is required to define its role in the treatment of coronary artery disease.

  17. Minimal massive 3D gravity

    International Nuclear Information System (INIS)

    Bergshoeff, Eric; Merbis, Wout; Hohm, Olaf; Routh, Alasdair J; Townsend, Paul K

    2014-01-01

    We present an alternative to topologically massive gravity (TMG) with the same ‘minimal’ bulk properties; i.e. a single local degree of freedom that is realized as a massive graviton in linearization about an anti-de Sitter (AdS) vacuum. However, in contrast to TMG, the new ‘minimal massive gravity’ has both a positive energy graviton and positive central charges for the asymptotic AdS-boundary conformal algebra. (paper)

  18. Construction schedules slack time minimizing

    Science.gov (United States)

    Krzemiński, Michał

    2017-07-01

    The article presents two copyright models for minimizing downtime working brigades. Models have been developed for construction schedules performed using the method of work uniform. Application of flow shop models is possible and useful for the implementation of large objects, which can be divided into plots. The article also presents a condition describing gives which model should be used, as well as a brief example of optimization schedule. The optimization results confirm the legitimacy of the work on the newly-developed models.

  19. Acquiring minimally invasive surgical skills

    OpenAIRE

    Hiemstra, Ellen

    2012-01-01

    Many topics in surgical skills education have been implemented without a solid scientific basis. For that reason we have tried to find this scientific basis. We have focused on training and evaluation of minimally invasive surgical skills in a training setting and in practice in the operating room. This thesis has led to an enlarged insight in the organization of surgical skills training during residency training of surgical medical specialists.

  20. PENGARUH KONSENTRASI KITOSAN TERHADAP AKTIVITAS ANTIBAKTERI DENGAN METODE DIFUSI AGAR (SUMUR

    Directory of Open Access Journals (Sweden)

    Fibra Nurainy

    2012-12-01

    Full Text Available The aim of this work was to obtain the minimal concentration of chitosan which possess antibacterial characteristic. The concentrations of chitosan that used were 0%; 0,2%; 0,4%; 0,6%; and 0,8% (w/v, whereas bacteria cultures used to examine antibacterial activity of chitosan were Escherichia coli, Bacillus subtilis and Staphylococcus aureus. Well method (gel diffusion was utilized to test the chitosan antibacterial activity.  The result was analyzed using descriptive method and presented in the graphic form.  The result showed the activity of chitosan restraint as antibacterial.  The test of chitosan antibacterial activity utilizes gel diffusion (well method. The data analyzed descriptively and presented in the graphic form.  The result  showed the activity of chitosan restraint as anti bacteria against Staphylococcus aureus, Bacillus subtilis or Escherichia coli with the highest restraint diameter was noticed at the addition of 0,2% chitosan, which were 20,27 mm/mg chitosan, 24,50 mm/mg chitosan and 31,53 mg chitosan, respectively.  The lowest restraint diameter was found at the addition of 0,8% chitosan, which were 6,82 mm/mg chitosan, 12,14 mm/mg chitosan and 14,23 mm/mg chitosan, respectively. Keywords:  Antibacterial activity, chitosan, gel diffusion method

  1. Stowage Planning in Multiple Ports with Shifting Fee Minimization

    Directory of Open Access Journals (Sweden)

    E. Zhang

    2018-01-01

    Full Text Available This paper studies the problem of stowage planning within a vessel bay in a multiple port transportation route, aiming at minimizing the total container shifting fee. Since the access to containers is in the top-to-bottom order for each stack, reshuffle operations occur when a target container to be unloaded at its destination port is not stowed on the top of a stack at the time. Each container shift via a quay crane induces one unit of shifting fee that depends on the charge policy of the local container port. Previous studies assume that each container shift consumes a uniform cost in all ports and thus focus on minimizing the total number of shifts or the turnaround time of the vessel. Motivated by the observation that different ports are of nonuniform fee for each container shift, we propose a mixed integer programming (MIP model for the problem to produce an optimal stowage planning with minimum total shifting fee in this work. Moreover, as the considered problem is NP-hard due to the NP-hardness of its counterpart with uniform unit shifting fee, we propose an improved genetic algorithm to solve the problem. The efficiency of the proposed algorithm is demonstrated via numerical experiments.

  2. High-density fluid-perturbation theory based on an inverse 12th-power hard-sphere reference system

    International Nuclear Information System (INIS)

    Ross, M.

    1979-01-01

    A variational theory is developed that is accurate at normal liquid densities and densities up to 4 times that of the argon triple point. This theory uses the inverse 12th-power potential as a reference system. The properties of this reference system are expressed in terms of hard-sphere packing fractions by using a modified form of hard-space variational theory. As a result of this ''bootstrapping,'' a variational procedure may be followed that employs the inverse 12th-power system as a reference but uses the hard-sphere packing fraction as the scaling parameter with which to minimize the Helmholtz free energy

  3. Analysis of Hard Thin Film Coating

    Science.gov (United States)

    Shen, Dashen

    1998-01-01

    MSFC is interested in developing hard thin film coating for bearings. The wearing of the bearing is an important problem for space flight engine. Hard thin film coating can drastically improve the surface of the bearing and improve the wear-endurance of the bearing. However, many fundamental problems in surface physics, plasma deposition, etc, need further research. The approach is using electron cyclotron resonance chemical vapor deposition (ECRCVD) to deposit hard thin film an stainless steel bearing. The thin films in consideration include SiC, SiN and other materials. An ECRCVD deposition system is being assembled at MSFC.

  4. Changes in Vickers hardness during the decomposition of bone: Possibilities for forensic anthropology.

    Science.gov (United States)

    Walden, Steven J; Evans, Sam L; Mulville, Jacqui

    2017-01-01

    The purpose of this study was to determine how the Vickers hardness (HV) of bone varies during soft tissue putrefaction. This has possible forensic applications, notably for determining the postmortem interval. Experimental porcine bone samples were decomposed in surface and burial deposition scenarios over a period of 6 months. Although the Vickers hardness varied widely, it was found that when transverse axial hardness was subtracted from longitudinal axial hardness, the difference showed correlations with three distinct phases of soft tissue putrefaction. The ratio of transverse axial hardness to longitudinal axial hardness showed a similar correlation. A difference of 10 or greater in HV with soft tissue present and signs of minimal decomposition, was associated with a decomposition period of 250 cumulative cooling degree days or less. A difference of 10 (+/- standard error of mean at a 95% confidence interval) or greater in HV associated with marked decomposition indicated a decomposition period of 1450 cumulative cooling degree days or more. A difference of -7 to +8 (+/- standard error of mean at a 95% confidence interval) was thus associated with 250 to 1450 cumulative cooling degree days' decomposition. The ratio of transverse axial HV to longitudinal HV, ranging from 2.42 to 1.54, is a more reliable indicator in this context and is preferable to using negative integers These differences may have potential as an indicator of postmortem interval and thus the time of body deposition in the forensic context. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  5. Minimal families of curves on surfaces

    KAUST Repository

    Lubbes, Niels

    2014-01-01

    A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal

  6. Minimal families of curves on surfaces

    KAUST Repository

    Lubbes, Niels

    2014-11-01

    A minimal family of curves on an embedded surface is defined as a 1-dimensional family of rational curves of minimal degree, which cover the surface. We classify such minimal families using constructive methods. This allows us to compute the minimal families of a given surface.The classification of minimal families of curves can be reduced to the classification of minimal families which cover weak Del Pezzo surfaces. We classify the minimal families of weak Del Pezzo surfaces and present a table with the number of minimal families of each weak Del Pezzo surface up to Weyl equivalence.As an application of this classification we generalize some results of Schicho. We classify algebraic surfaces that carry a family of conics. We determine the minimal lexicographic degree for the parametrization of a surface that carries at least 2 minimal families. © 2014 Elsevier B.V.

  7. Inactivation of pathogenic bacteria inoculated onto a Bacto™ agar model surface using TiO2-UVC photocatalysis, UVC and chlorine treatments.

    Science.gov (United States)

    Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J

    2015-09-01

    The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.

  8. Double hard scattering without double counting

    Energy Technology Data Exchange (ETDEWEB)

    Diehl, Markus [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Gaunt, Jonathan R. [VU Univ. Amsterdam (Netherlands). NIKHEF Theory Group; Schoenwald, Kay [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany)

    2017-02-15

    Double parton scattering in proton-proton collisions includes kinematic regions in which two partons inside a proton originate from the perturbative splitting of a single parton. This leads to a double counting problem between single and double hard scattering. We present a solution to this problem, which allows for the definition of double parton distributions as operator matrix elements in a proton, and which can be used at higher orders in perturbation theory. We show how the evaluation of double hard scattering in this framework can provide a rough estimate for the size of the higher-order contributions to single hard scattering that are affected by double counting. In a numeric study, we identify situations in which these higher-order contributions must be explicitly calculated and included if one wants to attain an accuracy at which double hard scattering becomes relevant, and other situations where such contributions may be neglected.

  9. Hard X-ray Photoelectric Polarimeter

    Data.gov (United States)

    National Aeronautics and Space Administration — Our objective is to determine the gas mixtures and pressures that would enable a sensitive, hard X-ray polarimeter using existing flight components with the goal of...

  10. Methane in German hard coal mining

    International Nuclear Information System (INIS)

    Martens, P.N.; Den Drijver, J.

    1995-01-01

    Worldwide, hard coal mining is being carried out at ever increasing depth, and has, therefore, to cope with correspondingly increasing methane emissions are caused by coal mining. Beside carbon dioxide, chloro-fluoro-carbons (CFCs) and nitrogen oxides, methane is one of the most significant 'greenhouse' gases. It is mainly through the release of such trace gases that the greenhouse effect is brought about. Reducing methane emissions is therefore an important problem to be solved by the coal mining industry. This paper begins by highlighting some of the fundamental principles of methane in hard coal mining. The methane problem in German hard coal mining and the industry's efforts to reduce methane emissions are presented. The future development in German hard coal mining is illustrated by an example which shows how large methane volumes can be managed, while still maintaining high outputs at increasing depth. (author). 7 tabs., 10 figs., 20 refs

  11. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... it free Find out why Close Why Are Drugs So Hard to Quit? National Institute on Drug Abuse (NIDA/NIH) Loading... Unsubscribe from National Institute on Drug Abuse (NIDA/NIH)? Cancel Unsubscribe Working... Subscribe Subscribed ...

  12. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... YouTube Red. Working... Not now Try it free Find out why Close Why Are Drugs So Hard ... hotline to help you or a loved one find treatment. For more information, visit http://www.easyread. ...

  13. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... So Hard to Quit? National Institute on Drug Abuse (NIDA/NIH) Loading... Unsubscribe from National Institute on Drug Abuse (NIDA/NIH)? Cancel Unsubscribe Working... Subscribe Subscribed Unsubscribe ...

  14. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... Feb 7, 2012 Quitting drugs is hard because addiction is a brain disease. Your brain is like ... out signals to direct your actions and choices. Addiction changes the signals in your brain and makes ...

  15. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... Drugs So Hard to Quit? National Institute on Drug Abuse (NIDA/NIH) Loading... Unsubscribe from National Institute on Drug Abuse (NIDA/NIH)? Cancel Unsubscribe Working... Subscribe Subscribed Unsubscribe ...

  16. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... in your brain and makes it hard to feel OK without the drug. This video from NIDA ... Advertise Developers +YouTube Terms Privacy Policy & Safety Send feedback Test new features Loading... Working... Sign in to ...

  17. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... has been rented. This feature is not available right now. Please try again later. Published on Feb 7, 2012 Quitting drugs is hard because addiction is a brain disease. Your brain is like a control tower ...

  18. A theoretical overview on single hard diffraction

    International Nuclear Information System (INIS)

    Wuesthoff, M.

    1996-01-01

    The concept of the Pomeron structure function and its application in Single Hard Diffraction at hadron colliders and in diffractive Deep Inelastic Scattering is critically reviewed. Some alternative approaches are briefly surveyed with a focus on QCD inspired models

  19. Double hard scattering without double counting

    International Nuclear Information System (INIS)

    Diehl, Markus; Gaunt, Jonathan R.

    2017-02-01

    Double parton scattering in proton-proton collisions includes kinematic regions in which two partons inside a proton originate from the perturbative splitting of a single parton. This leads to a double counting problem between single and double hard scattering. We present a solution to this problem, which allows for the definition of double parton distributions as operator matrix elements in a proton, and which can be used at higher orders in perturbation theory. We show how the evaluation of double hard scattering in this framework can provide a rough estimate for the size of the higher-order contributions to single hard scattering that are affected by double counting. In a numeric study, we identify situations in which these higher-order contributions must be explicitly calculated and included if one wants to attain an accuracy at which double hard scattering becomes relevant, and other situations where such contributions may be neglected.

  20. Biomimetic synthesis of hollow calcium carbonate with the existence of the agar matrix and bovine serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Jianhua, E-mail: fjh2008@126.com; Wu, Gang; Qing, Chengsong

    2016-01-01

    Proteins play important roles in the process of biomineralization. Vaterite and calcite have been synthesized by the reaction of Na{sub 2}CO{sub 3} and CaCl{sub 2} in the bovine serum albumin (BSA) and agar system. The samples have been characterized by Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). The shape of CaCO{sub 3} crystal has been analyzed by scanning electronic microscopy (SEM). The results show that calcite is a single product in the absence of BSA, but the product is a mixture of calcite and vaterite in the presence of BSA. The spheral shell of CaCO{sub 3} crystal was obtained when the concentration of BSA increased to 9.0 mg/mL. - Highlights: • Biomimetic synthesis of hollow calcium carbonate • Calcification mechanisms in the presence of both protein and polysaccharides • Biomineralization under the action of protein and polysaccharides.

  1. LLNL Waste Minimization Program Plan

    International Nuclear Information System (INIS)

    1990-05-01

    This document is the February 14, 1990 version of the LLNL Waste Minimization Program Plan (WMPP). Now legislation at the federal level is being introduced. Passage will result in new EPA regulations and also DOE orders. At the state level the Hazardous Waste Reduction and Management Review Act of 1989 was signed by the Governor. DHS is currently promulgating regulations to implement the new law. EPA has issued a proposed new policy statement on source reduction and recycling. This policy reflects a preventative strategy to reduce or eliminate the generation of environmentally-harmful pollutants which may be released to the air, land surface, water, or ground water. In accordance with this policy new guidance to hazardous waste generators on the elements of a Waste Minimization Program was issued. This WMPP is formatted to meet the current DOE guidance outlines. The current WMPP will be revised to reflect all of these proposed changes when guidelines are established. Updates, changes and revisions to the overall LLNL WMPP will be made as appropriate to reflect ever-changing regulatory requirements

  2. Symmetry breaking for drag minimization

    Science.gov (United States)

    Roper, Marcus; Squires, Todd M.; Brenner, Michael P.

    2005-11-01

    For locomotion at high Reynolds numbers drag minimization favors fore-aft asymmetric slender shapes with blunt noses and sharp trailing edges. On the other hand, in an inertialess fluid the drag experienced by a body is independent of whether it travels forward or backward through the fluid, so there is no advantage to having a single preferred swimming direction. In fact numerically determined minimum drag shapes are known to exhibit almost no fore-aft asymmetry even at moderate Re. We show that asymmetry persists, albeit extremely weakly, down to vanishingly small Re, scaling asymptotically as Re^3. The need to minimize drag to maximize speed for a given propulsive capacity gives one possible mechanism for the increasing asymmetry in the body plans seen in nature, as organisms increase in size and swimming speed from bacteria like E-Coli up to pursuit predator fish such as tuna. If it is the dominant mechanism, then this signature scaling will be observed in the shapes of motile micro-organisms.

  3. Hard scattering and gauge/string duality

    International Nuclear Information System (INIS)

    Polchinski, Joseph; Strassler, Matthew J.

    2002-01-01

    We consider high-energy fixed-angle scattering of glueballs in confining gauge theories that have supergravity duals. Although the effective description is in terms of the scattering of strings, we find that the amplitudes are hard (power law). This is a consequence of the warped geometry of the dual theory, which has the effect that in an inertial frame the string process is never in the soft regime. At small angle we find hard and Regge behaviors in different kinematic regions

  4. Soft skills, hard skills, and individual innovativeness

    DEFF Research Database (Denmark)

    Hendarman, Achmad Fajar; Cantner, Uwe

    2018-01-01

    of Indonesian firms from different industries are used from an online survey on manager and worker perceptions related to individual innovation performance on the one hand and individual skills on the other hand. The results show that soft skills and hard skills are significantly and positively associated...... with individual level innovativeness. However, no complementarity (positive interaction effect) is found between soft skills and hard skills....

  5. Hard template synthesis of metal nanowires

    OpenAIRE

    Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori

    2014-01-01

    Metal nanowires (NWs) have attracted much attention because of their high electron conductivity, optical transmittance, and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production o...

  6. Radiation-Hard Quartz Cerenkov Calorimeters

    International Nuclear Information System (INIS)

    Akgun, U.; Onel, Y.

    2006-01-01

    New generation hadron colliders are going to reach unprecedented energies and radiation levels. Quartz has been identified as a radiation-hard material that can be used for Cerenkov calorimeters of the future experiments. We report from the radiation hardness tests performed on quartz fibers, as well as the characteristics of the quartz fiber and plate Cerenkov calorimeters that have been built, designed, and proposed for the CMS experiment

  7. Radiation hard memory cell and array thereof

    International Nuclear Information System (INIS)

    Gunckel, T.L. II; Rovell, A.; Nielsen, R.L.

    1978-01-01

    A memory cell configuration that is implemented to be relatively hard to the adverse effects of a nuclear event is discussed. The presently disclosed memory cell can be interconnected with other like memory cells to form a high speed radiation hard register file. Information is selectively written into and read out of a memory cell comprising the register file, which memory cell preserves previously stored data without alteration in the event of exposure to high levels of nuclear radiation

  8. Eco-efficient and high performance hard chrome process

    Energy Technology Data Exchange (ETDEWEB)

    Negre, P. [Protection des Metaux, Montreuil (France)

    2001-07-01

    Clean manufacturing processes that can minimize effects on the environment are discussed using electrolytic hard chromium-plating as an example. The goal of the research proposal described in this paper is to develop processes from a new and non-toxic electrolytic solution that would allow for harder, thick coatings of chromium that is more resistant to corrosion than traditional coatings and without the carcinogenic effects of hexavalent chromium. The process, as envisaged, will combine the advantages of chromium plating processes based on non-toxic compounds already available, the result primarily of the chemical formulation of the solutions for chromium plating on which the microstructure and the capacity of the structural hardening of the coatings depend. The paper provides an overview of the project, estimates person year and time requirements (225 person-years and 3.5 years) and provides a list of participating partners.

  9. Equilibrium and kinetic modelling of Cd(II) biosorption by algae Gelidium and agar extraction algal waste.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2006-01-01

    In this study an industrial algal waste from agar extraction has been used as an inexpensive and effective biosorbent for cadmium (II) removal from aqueous solutions. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction. Equilibrium data follow both Langmuir and Redlich-Peterson models. The parameters of Langmuir equilibrium model are q(max)=18.0 mgg(-1), b=0.19 mgl(-1) and q(max)=9.7 mgg(-1), b=0.16 mgl(-1), respectively for Gelidium and the algal waste. Kinetic experiments were conducted at initial Cd(II) concentrations in the range 6-91 mgl(-1). Data were fitted to pseudo-first- and second-order Lagergren models. For an initial Cd(II) concentration of 91 mgl(-1) the parameters of the pseudo-first-order Lagergren model are k(1,ads)=0.17 and 0.87 min(-1); q(eq)=16.3 and 8.7 mgg(-1), respectively, for Gelidium and algal waste. Kinetic constants vary with the initial metal concentration. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model. The model successfully predicts Cd(II) concentration profiles and provides significant insights on the biosorbents performance. The homogeneous diffusivity, D(h), is in the range 0.5-2.2 x10(-8) and 2.1-10.4 x10(-8)cm(2)s(-1), respectively, for Gelidium and algal waste.

  10. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  11. Black-box modeling to estimate tissue temperature during radiofrequency catheter cardiac ablation: feasibility study on an agar phantom model

    International Nuclear Information System (INIS)

    Blasco-Gimenez, Ramón; Lequerica, Juan L; Herrero, Maria; Hornero, Fernando; Berjano, Enrique J

    2010-01-01

    The aim of this work was to study linear deterministic models to predict tissue temperature during radiofrequency cardiac ablation (RFCA) by measuring magnitudes such as electrode temperature, power and impedance between active and dispersive electrodes. The concept involves autoregressive models with exogenous input (ARX), which is a particular case of the autoregressive moving average model with exogenous input (ARMAX). The values of the mode parameters were determined from a least-squares fit of experimental data. The data were obtained from radiofrequency ablations conducted on agar models with different contact pressure conditions between electrode and agar (0 and 20 g) and different flow rates around the electrode (1, 1.5 and 2 L min −1 ). Half of all the ablations were chosen randomly to be used for identification (i.e. determination of model parameters) and the other half were used for model validation. The results suggest that (1) a linear model can be developed to predict tissue temperature at a depth of 4.5 mm during RF cardiac ablation by using the variables applied power, impedance and electrode temperature; (2) the best model provides a reasonably accurate estimate of tissue temperature with a 60% probability of achieving average errors better than 5 °C; (3) substantial errors (larger than 15 °C) were found only in 6.6% of cases and were associated with abnormal experiments (e.g. those involving the displacement of the ablation electrode) and (4) the impact of measuring impedance on the overall estimate is negligible (around 1 °C)

  12. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  13. Standard test methods for rockwell hardness of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2011-01-01

    1.1 These test methods cover the determination of the Rockwell hardness and the Rockwell superficial hardness of metallic materials by the Rockwell indentation hardness principle. This standard provides the requirements for Rockwell hardness machines and the procedures for performing Rockwell hardness tests. 1.2 This standard includes additional requirements in annexes: Verification of Rockwell Hardness Testing Machines Annex A1 Rockwell Hardness Standardizing Machines Annex A2 Standardization of Rockwell Indenters Annex A3 Standardization of Rockwell Hardness Test Blocks Annex A4 Guidelines for Determining the Minimum Thickness of a Test Piece Annex A5 Hardness Value Corrections When Testing on Convex Cylindrical Surfaces Annex A6 1.3 This standard includes nonmandatory information in appendixes which relates to the Rockwell hardness test. List of ASTM Standards Giving Hardness Values Corresponding to Tensile Strength Appendix X1 Examples of Procedures for Determining Rockwell Hardness Uncertainty Appendix X...

  14. Standard test methods for rockwell hardness of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 These test methods cover the determination of the Rockwell hardness and the Rockwell superficial hardness of metallic materials by the Rockwell indentation hardness principle. This standard provides the requirements for Rockwell hardness machines and the procedures for performing Rockwell hardness tests. 1.2 This standard includes additional requirements in annexes: Verification of Rockwell Hardness Testing Machines Annex A1 Rockwell Hardness Standardizing Machines Annex A2 Standardization of Rockwell Indenters Annex A3 Standardization of Rockwell Hardness Test Blocks Annex A4 Guidelines for Determining the Minimum Thickness of a Test Piece Annex A5 Hardness Value Corrections When Testing on Convex Cylindrical Surfaces Annex A6 1.3 This standard includes nonmandatory information in appendixes which relates to the Rockwell hardness test. List of ASTM Standards Giving Hardness Values Corresponding to Tensile Strength Appendix X1 Examples of Procedures for Determining Rockwell Hardness Uncertainty Appendix X...

  15. Laparoscopic colonic resection in inflammatory bowel disease: minimal surgery, minimal access and minimal hospital stay.

    LENUS (Irish Health Repository)

    Boyle, E

    2008-11-01

    Laparoscopic surgery for inflammatory bowel disease (IBD) is technically demanding but can offer improved short-term outcomes. The introduction of minimally invasive surgery (MIS) as the default operative approach for IBD, however, may have inherent learning curve-associated disadvantages. We hypothesise that the establishment of MIS as the standard operative approach does not increase patient morbidity as assessed in the initial period of its introduction into a specialised unit, and that it confers earlier postoperative gastrointestinal recovery and reduced hospitalisation compared with conventional open resection.

  16. Minimally invasive aortic valve replacement

    DEFF Research Database (Denmark)

    Foghsgaard, Signe; Schmidt, Thomas Andersen; Kjaergard, Henrik K

    2009-01-01

    In this descriptive prospective study, we evaluate the outcomes of surgery in 98 patients who were scheduled to undergo minimally invasive aortic valve replacement. These patients were compared with a group of 50 patients who underwent scheduled aortic valve replacement through a full sternotomy...... operations were completed as mini-sternotomies, 4 died later of noncardiac causes. The aortic cross-clamp and perfusion times were significantly different across all groups (P replacement...... is an excellent operation in selected patients, but its true advantages over conventional aortic valve replacement (other than a smaller scar) await evaluation by means of randomized clinical trial. The "extended mini-aortic valve replacement" operation, on the other hand, is a risky procedure that should...

  17. Minimization over randomly selected lines

    Directory of Open Access Journals (Sweden)

    Ismet Sahin

    2013-07-01

    Full Text Available This paper presents a population-based evolutionary optimization method for minimizing a given cost function. The mutation operator of this method selects randomly oriented lines in the cost function domain, constructs quadratic functions interpolating the cost function at three different points over each line, and uses extrema of the quadratics as mutated points. The crossover operator modifies each mutated point based on components of two points in population, instead of one point as is usually performed in other evolutionary algorithms. The stopping criterion of this method depends on the number of almost degenerate quadratics. We demonstrate that the proposed method with these mutation and crossover operations achieves faster and more robust convergence than the well-known Differential Evolution and Particle Swarm algorithms.

  18. Strategies to Minimize Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Sang Hee Lee

    2013-09-01

    Full Text Available Antibiotic resistance can be reduced by using antibiotics prudently based on guidelines of antimicrobial stewardship programs (ASPs and various data such as pharmacokinetic (PK and pharmacodynamic (PD properties of antibiotics, diagnostic testing, antimicrobial susceptibility testing (AST, clinical response, and effects on the microbiota, as well as by new antibiotic developments. The controlled use of antibiotics in food animals is another cornerstone among efforts to reduce antibiotic resistance. All major resistance-control strategies recommend education for patients, children (e.g., through schools and day care, the public, and relevant healthcare professionals (e.g., primary-care physicians, pharmacists, and medical students regarding unique features of bacterial infections and antibiotics, prudent antibiotic prescribing as a positive construct, and personal hygiene (e.g., handwashing. The problem of antibiotic resistance can be minimized only by concerted efforts of all members of society for ensuring the continued efficiency of antibiotics.

  19. A minimally invasive smile enhancement.

    Science.gov (United States)

    Peck, Fred H

    2014-01-01

    Minimally invasive dentistry refers to a wide variety of dental treatments. On the restorative aspect of dental procedures, direct resin bonding can be a very conservative treatment option for the patient. When tooth structure does not need to be removed, the patient benefits. Proper treatment planning is essential to determine how conservative the restorative treatment will be. This article describes the diagnosis, treatment options, and procedural techniques in the restoration of 4 maxillary anterior teeth with direct composite resin. The procedural steps are reviewed with regard to placing the composite and the variety of colors needed to ensure a natural result. Finishing and polishing of the composite are critical to ending with a natural looking dentition that the patient will be pleased with for many years.

  20. Waste minimization in analytical methods

    International Nuclear Information System (INIS)

    Green, D.W.; Smith, L.L.; Crain, J.S.; Boparai, A.S.; Kiely, J.T.; Yaeger, J.S. Schilling, J.B.

    1995-01-01

    The US Department of Energy (DOE) will require a large number of waste characterizations over a multi-year period to accomplish the Department's goals in environmental restoration and waste management. Estimates vary, but two million analyses annually are expected. The waste generated by the analytical procedures used for characterizations is a significant source of new DOE waste. Success in reducing the volume of secondary waste and the costs of handling this waste would significantly decrease the overall cost of this DOE program. Selection of appropriate analytical methods depends on the intended use of the resultant data. It is not always necessary to use a high-powered analytical method, typically at higher cost, to obtain data needed to make decisions about waste management. Indeed, for samples taken from some heterogeneous systems, the meaning of high accuracy becomes clouded if the data generated are intended to measure a property of this system. Among the factors to be considered in selecting the analytical method are the lower limit of detection, accuracy, turnaround time, cost, reproducibility (precision), interferences, and simplicity. Occasionally, there must be tradeoffs among these factors to achieve the multiple goals of a characterization program. The purpose of the work described here is to add waste minimization to the list of characteristics to be considered. In this paper the authors present results of modifying analytical methods for waste characterization to reduce both the cost of analysis and volume of secondary wastes. Although tradeoffs may be required to minimize waste while still generating data of acceptable quality for the decision-making process, they have data demonstrating that wastes can be reduced in some cases without sacrificing accuracy or precision

  1. A screening method for β-glucan hydrolase employing Trypan Blue-coupled β-glucan agar plate and β-glucan zymography.

    Science.gov (United States)

    Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick

    2012-06-01

    A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.

  2. Detection of group B streptococci in Lim broth by use of group B streptococcus peptide nucleic acid fluorescent in situ hybridization and selective and nonselective agars.

    Science.gov (United States)

    Montague, Naomi S; Cleary, Timothy J; Martinez, Octavio V; Procop, Gary W

    2008-10-01

    The sensitivity, specificity, and positive and negative predictive values for the detection of group B streptococci from Lim enrichment broth with sheep blood agar (SBA), with selective Streptococcus agar (SSA), and by a peptide nucleic acid fluorescent in situ hybridization (PNA FISH) assay were as follows: for culture on SBA, 68.4%, 100%, 100%, and 87.9%, respectively; for culture on SSA, 85.5%, 100%, 100%, and 94.1%, respectively; and for the PNA FISH assay, 97.4%, 98.3%, 96.1%, and 98.9%, respectively.

  3. Corrigendum to “Rheological properties of agar and carrageenan from Ghanaian red seaweeds” [Food Hydrocolloids 63 (2017) 50–58

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2018-01-01

    . G., Penninkhof, B., Rudolph, B., & De Ruiter, G. A. (1999). A novel high-performance anion-exchange chromatographic method for the analysis of carrageenans and agars containing 3,6-anhydrogalactose. Analytical Biochemistry, 268, 213-222. Table 3 Overview of seaweed type (hydrocolloid source......), hydrocolloid extraction method (direct water-extraction or after alkali treatment), hydrocolloid and monomer1 yields, and sulfate levels [data given as means ± SD]. Different roman superscript letters indicate significant differences (P agar yields, monosaccharides...

  4. Novel hard compositions and methods of preparation

    Science.gov (United States)

    Sheinberg, H.

    1983-08-23

    Novel very hard compositions of matter are prepared by using in all embodiments only a minor amount of a particular carbide (or materials which can form the carbide in situ when subjected to heat and pressure); and no strategic cobalt is needed. Under a particular range of conditions, densified compositions of matter of the invention are prepared having hardnesses on the Rockwell A test substantially equal to the hardness of pure tungsten carbide and to two of the hardest commercial cobalt-bonded tungsten carbides. Alternately, other compositions of the invention which have slightly lower hardnesses than those described above in one embodiment also possess the advantage of requiring no tungsten and in another embodiment possess the advantage of having a good fracture toughness value. Photomicrographs show that the shapes of the grains of the alloy mixture with which the minor amount of carbide (or carbide-formers) is mixed are radically altered from large, rounded to small, very angular by the addition of the carbide. Superiority of one of these hard compositions of matter over cobalt-bonded tungsten carbide for ultra-high pressure anvil applications was demonstrated. 3 figs.

  5. Cyclone Simulation via Action Minimization

    Science.gov (United States)

    Plotkin, D. A.; Weare, J.; Abbot, D. S.

    2016-12-01

    A postulated impact of climate change is an increase in intensity of tropical cyclones (TCs). This hypothesized effect results from the fact that TCs are powered subsaturated boundary layer air picking up water vapor from the surface ocean as it flows inwards towards the eye. This water vapor serves as the energy input for TCs, which can be idealized as heat engines. The inflowing air has a nearly identical temperature as the surface ocean; therefore, warming of the surface leads to a warmer atmospheric boundary layer. By the Clausius-Clapeyron relationship, warmer boundary layer air can hold more water vapor and thus results in more energetic storms. Changes in TC intensity are difficult to predict due to the presence of fine structures (e.g. convective structures and rainbands) with length scales of less than 1 km, while general circulation models (GCMs) generally have horizontal resolutions of tens of kilometers. The models are therefore unable to capture these features, which are critical to accurately simulating cyclone structure and intensity. Further, strong TCs are rare events, meaning that long multi-decadal simulations are necessary to generate meaningful statistics about intense TC activity. This adds to the computational expense, making it yet more difficult to generate accurate statistics about long-term changes in TC intensity due to global warming via direct simulation. We take an alternative approach, applying action minimization techniques developed in molecular dynamics to the WRF weather/climate model. We construct artificial model trajectories that lead from quiescent (TC-free) states to TC states, then minimize the deviation of these trajectories from true model dynamics. We can thus create Monte Carlo model ensembles that are biased towards cyclogenesis, which reduces computational expense by limiting time spent in non-TC states. This allows for: 1) selective interrogation of model states with TCs; 2) finding the likeliest paths for

  6. Structure, production and properties of high-melting compounds and systems (hard materials and hard metals)

    International Nuclear Information System (INIS)

    Holleck, H.; Thuemmler, F.

    1979-07-01

    The report contains contributions by various authors to the research project on the production, structure, and physical properties of high-melting compounds and systems (hard metals and hard materials), in particular WC-, TaC-, and MoC-base materials. (GSCH) [de

  7. Analytical Modeling of Hard-Coating Cantilever Composite Plate considering the Material Nonlinearity of Hard Coating

    Directory of Open Access Journals (Sweden)

    Wei Sun

    2015-01-01

    Full Text Available Due to the material nonlinearity of hard coating, the coated structure produces the nonlinear dynamical behaviors of variable stiffness and damping, which make the modeling of hard-coating composite structure become a challenging task. In this study, the polynomial was adopted to characterize this material nonlinearity and an analytical modeling method was developed for the hard-coating composite plate. Firstly, to relate the hard-coating material parameters obtained by test and the analytical model, the expression of equivalent strain of composite plate was derived. Then, the analytical model of hard-coating composite plate was created by energy method considering the material nonlinearity of hard coating. Next, using the Newton-Raphson method to solve the vibration response and resonant frequencies of composite plate and a specific calculation procedure was also proposed. Finally, a cantilever plate coated with MgO + Al2O3 hard coating was chosen as study case; the vibration response and resonant frequencies of composite plate were calculated using the proposed method. The calculation results were compared with the experiment and general linear calculation, and the correctness of the created model was verified. The study shows the proposed method can still maintain an acceptable precision when the material nonlinearity of hard coating is stronger.

  8. Minimalism through intraoperative functional mapping.

    Science.gov (United States)

    Berger, M S

    1996-01-01

    Intraoperative stimulation mapping may be used to avoid unnecessary risk to functional regions subserving language and sensori-motor pathways. Based on the data presented here, language localization is variable in the entire population, with only certainty existing for the inferior frontal region responsible for motor speech. Anatomical landmarks such as the anterior temporal tip for temporal lobe language sites and the posterior aspect of the lateral sphenoid wing for the frontal lobe language zones are unreliable in avoiding postoperative aphasias. Thus, individual mapping to identify essential language sites has the greatest likelihood of avoiding permanent deficits in naming, reading, and motor speech. In a similar approach, motor and sensory pathways from the cortex and underlying white matter may be reliably stimulated and mapped in both awake and asleep patients. Although these techniques require an additional operative time and equipment nominally priced, the result is often gratifying, as postoperative morbidity has been greatly reduced in the process of incorporating these surgical strategies. The patients quality of life is improved in terms of seizure control, with or without antiepileptic drugs. This avoids having to perform a second costly operative procedure, which is routinely done when extraoperative stimulation and recording is done via subdural grids. In addition, an aggressive tumor resection at the initial operation lengthens the time to tumor recurrence and often obviates the need for a subsequent reoperation. Thus, intraoperative functional mapping may be best alluded to as a surgical technique that results in "minimalism in the long term".

  9. Against explanatory minimalism in psychiatry

    Directory of Open Access Journals (Sweden)

    Tim eThornton

    2015-12-01

    Full Text Available The idea that psychiatry contains, in principle, a series of levels of explanation has been criticised both as empirically false but also, by Campbell, as unintelligible because it presupposes a discredited pre-Humean view of causation. Campbell’s criticism is based on an interventionist-inspired denial that mechanisms and rational connections underpin physical and mental causation respectively and hence underpin levels of explanation. These claims echo some superficially similar remarks in Wittgenstein’s Zettel. But attention to the context of Wittgenstein’s remarks suggests a reason to reject explanatory minimalism in psychiatry and reinstate a Wittgensteinian notion of level of explanation. Only in a context broader than the one provided by interventionism is the ascription of propositional attitudes, even in the puzzling case of delusions, justified. Such a view, informed by Wittgenstein, can reconcile the idea that the ascription mental phenomena presupposes a particular level of explanation with the rejection of an a priori claim about its connection to a neurological level of explanation.

  10. Against Explanatory Minimalism in Psychiatry.

    Science.gov (United States)

    Thornton, Tim

    2015-01-01

    The idea that psychiatry contains, in principle, a series of levels of explanation has been criticized not only as empirically false but also, by Campbell, as unintelligible because it presupposes a discredited pre-Humean view of causation. Campbell's criticism is based on an interventionist-inspired denial that mechanisms and rational connections underpin physical and mental causation, respectively, and hence underpin levels of explanation. These claims echo some superficially similar remarks in Wittgenstein's Zettel. But attention to the context of Wittgenstein's remarks suggests a reason to reject explanatory minimalism in psychiatry and reinstate a Wittgensteinian notion of levels of explanation. Only in a context broader than the one provided by interventionism is that the ascription of propositional attitudes, even in the puzzling case of delusions, justified. Such a view, informed by Wittgenstein, can reconcile the idea that the ascription mental phenomena presupposes a particular level of explanation with the rejection of an a priori claim about its connection to a neurological level of explanation.

  11. Robotic assisted minimally invasive surgery

    Directory of Open Access Journals (Sweden)

    Palep Jaydeep

    2009-01-01

    Full Text Available The term "robot" was coined by the Czech playright Karel Capek in 1921 in his play Rossom′s Universal Robots. The word "robot" is from the check word robota which means forced labor.The era of robots in surgery commenced in 1994 when the first AESOP (voice controlled camera holder prototype robot was used clinically in 1993 and then marketed as the first surgical robot ever in 1994 by the US FDA. Since then many robot prototypes like the Endoassist (Armstrong Healthcare Ltd., High Wycombe, Buck, UK, FIPS endoarm (Karlsruhe Research Center, Karlsruhe, Germany have been developed to add to the functions of the robot and try and increase its utility. Integrated Surgical Systems (now Intuitive Surgery, Inc. redesigned the SRI Green Telepresence Surgery system and created the daVinci Surgical System ® classified as a master-slave surgical system. It uses true 3-D visualization and EndoWrist ® . It was approved by FDA in July 2000 for general laparoscopic surgery, in November 2002 for mitral valve repair surgery. The da Vinci robot is currently being used in various fields such as urology, general surgery, gynecology, cardio-thoracic, pediatric and ENT surgery. It provides several advantages to conventional laparoscopy such as 3D vision, motion scaling, intuitive movements, visual immersion and tremor filtration. The advent of robotics has increased the use of minimally invasive surgery among laparoscopically naοve surgeons and expanded the repertoire of experienced surgeons to include more advanced and complex reconstructions.

  12. Erosion testing of hard materials and coatings

    Energy Technology Data Exchange (ETDEWEB)

    Hawk, Jeffrey A.

    2005-04-29

    Erosion is the process by which unconstrained particles, usually hard, impact a surface, creating damage that leads to material removal and component failure. These particles are usually very small and entrained in fluid of some type, typically air. The damage that occurs as a result of erosion depends on the size of the particles, their physical characteristics, the velocity of the particle/fluid stream, and their angle of impact on the surface of interest. This talk will discuss the basics of jet erosion testing of hard materials, composites and coatings. The standard test methods will be discussed as well as alternative approaches to determining the erosion rate of materials. The damage that occurs will be characterized in genera1 terms, and examples will be presented for the erosion behavior of hard materials and coatings (both thick and thin).

  13. Aespoe Hard Rock Laboratory. Annual Report 1993

    International Nuclear Information System (INIS)

    1994-06-01

    The Aespoe Hard Rock Laboratory is being constructed in preparation for the deep geological repository of spent fuel in Sweden. This Annual Report 1993 for the Aespoe Hard Rock Laboratory contains an overview of the work conducted. Present work is focused on verification of pre-investigation methods and development of the detailed investigation methodology. Construction of the facility and investigation of the bedrock are carried out in parallel. As of December 1993, 2760 m of the tunnel had been excavated to a depth of 370 m below the surface. An important and integral part of the work is further refinement of conceptual and numerical models for groundwater flow and radionuclide migration. Detailed plans have been prepared for several experiments to be conducted after the end of the construction work. Eight organizations from seven countries are now participating in the work at the Aespoe Hard Rock Laboratory and are contributing in different ways to the results being achieved

  14. Hard template synthesis of metal nanowires

    Directory of Open Access Journals (Sweden)

    Go eKawamura

    2014-11-01

    Full Text Available Metal nanowires (NWs have attracted much attention because of their high electron conductivity, optical transmittance and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production of composite devices. The resulting NWs are immobilized and spatially arranged, as dictated by the ordered porous structure of the template. This avoids the NWs from aggregating, which is common for NWs prepared with soft templates in solution. Herein, the hard template synthesis of metal NWs is reviewed, and the resulting structures, properties and potential applications are discussed.

  15. Hard template synthesis of metal nanowires

    Science.gov (United States)

    Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori

    2014-11-01

    Metal nanowires (NWs) have attracted much attention because of their high electron conductivity, optical transmittance and tunable magnetic properties. Metal NWs have been synthesized using soft templates such as surface stabilizing molecules and polymers, and hard templates such as anodic aluminum oxide, mesoporous oxide, carbon nanotubes. NWs prepared from hard templates are composites of metals and the oxide/carbon matrix. Thus, selecting appropriate elements can simplify the production of composite devices. The resulting NWs are immobilized and spatially arranged, as dictated by the ordered porous structure of the template. This avoids the NWs from aggregating, which is common for NWs prepared with soft templates in solution. Herein, the hard template synthesis of metal NWs is reviewed, and the resulting structures, properties and potential applications are discussed.

  16. Effect of Heat treatment on Hardness and Corrosion Resistance of Super Cast Iron

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Roun; Kim, Young Sik [Andong National University, Andong (Korea, Republic of)

    2014-07-15

    In fossil-fuel-fired power plants, a variety of pollutants are produced from the combustion of conventional fuels such as coal, oil and gas. Major component of such pollution are ash and corrosive chemicals, which also destroy pumps and piping; by causing erosion/corrosion, pitting, and wear. In order to over come such damage, materials with high hardness and high corrosion resistance are needed. In this work, we melted super-cast-iron with excellent corrosion resistance and high hardness. To elucidate the effect of heat treatment, microstructural analysis, hardness measurement, and corrosion tests were performed. Test results revealed that the super-cast-iron had several tens better corrosion resistance than 316 L stainless steel, and it also had a high surface hardness (> HRC45). High hardness, in spite of its low carbon content (0.74%C), could resulted from a hardening heat treatment to precipitate sufficient Cr{sub 7}C{sub 3} and Cr{sub 2}3C{sub 6}. Also, it was concluded that the excellent corrosion resistance of the super-cast-iron was due to the increase of the relative chromium content by minimizing the carbon content, and by the enhancement of passive film by the addition of Cr, Mo, Cu, and W.

  17. A novel DTI-QA tool: Automated metric extraction exploiting the sphericity of an agar filled phantom.

    Science.gov (United States)

    Chavez, Sofia; Viviano, Joseph; Zamyadi, Mojdeh; Kingsley, Peter B; Kochunov, Peter; Strother, Stephen; Voineskos, Aristotle

    2018-02-01

    To develop a quality assurance (QA) tool (acquisition guidelines and automated processing) for diffusion tensor imaging (DTI) data using a common agar-based phantom used for fMRI QA. The goal is to produce a comprehensive set of automated, sensitive and robust QA metrics. A readily available agar phantom was scanned with and without parallel imaging reconstruction. Other scanning parameters were matched to the human scans. A central slab made up of either a thick slice or an average of a few slices, was extracted and all processing was performed on that image. The proposed QA relies on the creation of two ROIs for processing: (i) a preset central circular region of interest (ccROI) and (ii) a signal mask for all images in the dataset. The ccROI enables computation of average signal for SNR calculations as well as average FA values. The production of the signal masks enables automated measurements of eddy current and B0 inhomogeneity induced distortions by exploiting the sphericity of the phantom. Also, the signal masks allow automated background localization to assess levels of Nyquist ghosting. The proposed DTI-QA was shown to produce eleven metrics which are robust yet sensitive to image quality changes within site and differences across sites. It can be performed in a reasonable amount of scan time (~15min) and the code for automated processing has been made publicly available. A novel DTI-QA tool has been proposed. It has been applied successfully on data from several scanners/platforms. The novelty lies in the exploitation of the sphericity of the phantom for distortion measurements. Other novel contributions are: the computation of an SNR value per gradient direction for the diffusion weighted images (DWIs) and an SNR value per non-DWI, an automated background detection for the Nyquist ghosting measurement and an error metric reflecting the contribution of EPI instability to the eddy current induced shape changes observed for DWIs. Copyright © 2017 Elsevier

  18. Wild-type minimal inhibitory concentration distributions in bacteria of animal origin in Argentina

    Directory of Open Access Journals (Sweden)

    Florencia L Pantozzi

    Full Text Available The aim of this study was to determine the antimicrobial resistance profiles of indicator bacteria isolated from domestic animal feces. Minimal inhibitory concentration (MIC was determined by agar dilution. Interpretative criteria on the basis of wild-type MIC distributions and epidemiological cutoff values (ECOFF or ECV were used according to the 'European Committee on Antimicrobial Susceptibility Testing' (EUCAST data. Results from 237 isolates of Escherichia coli showed reduced susceptibility for ampicillin, streptomycin and tetracycline, the antimicrobials commonly used in intensive breeding of pigs and hens. Regarding all the species of the genus Enterococcus spp., there are only ECOFF or ECV for vancomycin. Of the 173 Enterococcus spp. isolated, only one showed reduced susceptibility to vancomycin and was classified as 'non-wild-type' (NWT population. This is the first report in Argentina showing data of epidemiological cutoff values in animal bacteria.

  19. Liquid agents for dispersion of hard alloys

    International Nuclear Information System (INIS)

    Putintseva, M.N.

    2006-01-01

    Effects of dispersant properties on granulometric, chemical, and phase composition of the products of WC hard alloy electroerosion are considered. It is established that an increase of liquid dispersant permittivity results in enhanced powder dispersity, and an increase of boiling temperature and kinematic viscosity of a hydrocarbon liquid promotes a carbon loss from WC and intensifies pyrolysis of the liquid.On electroerosion of WC base hard alloy in oil a powder particle consists of b-WC+W 2 C phases, in kerosine - of a-WC+b-WC, in distilled water - of W+W 2 C. The viscosity of liquid dispersants practically has no effect on powder particle size [ru

  20. Induction surface hardening of hard coated steels

    DEFF Research Database (Denmark)

    Pantleon, Karen; Kessler, Olaf; Hoffmann, Franz

    1999-01-01

    The deposition of hard coatings with CVD-processes is commonly used to improve the wear resistance e.g. of tool steels in forming. The advantages of CVD are undisputed (high deposition rates with simple equipment, excellent coating properties). Nevertheless, the disadvantage of the CVD-process is......The deposition of hard coatings with CVD-processes is commonly used to improve the wear resistance e.g. of tool steels in forming. The advantages of CVD are undisputed (high deposition rates with simple equipment, excellent coating properties). Nevertheless, the disadvantage of the CVD...

  1. Rad Hard Active Media For Calorimeters

    CERN Document Server

    Norbeck, E; Möller, A; Onel, Y

    2006-01-01

    Zero-degree calorimeters have limited space and extreme levels of radiation. A simple, low cost, radiation hard design uses tungstenmetal as the absorber and a suitable liquid as the ˇCerenkov radiator. In other applications a PPAC (Parallel Plate Avalanche Counter) operatingwith a suitable atmosphericpressure gas is an attractive active material for a calorimeter. It can be made radiation hard and has sufficient gain in the gas that no electronic components are needed near the detector. It works well even with the highest concentration of shower particles. For this pressure range, R134A (used in auto air conditioners) has many desirable features.

  2. Hardness of basaltic glass-ceramics

    DEFF Research Database (Denmark)

    Jensen, Martin; Smedskjær, Morten Mattrup; Estrup, Maja

    2009-01-01

    The dependence of the hardness of basaltic glass-ceramics on their degree of crystallisation has been explored by means of differential scanning calorimetry, optical microscopy, x-ray diffraction, and Vickers indentation. Different degrees of crystallisation in the basaltic glasses were achieved...... by varying the temperature of heat treatment. The predominant crystalline phase in the glass was identified as augite. It was found that the hardness of the glass phase decreased slightly with an increase in the degree of crystallisation, while that of the augite phase drastically decreased....

  3. Effects of explosions in hard rocks

    International Nuclear Information System (INIS)

    Heuze, F.E.; Walton, O.R.; Maddix, D.M.; Shaffer, R.J.; Butkovich, T.R.

    1993-01-01

    This work relates to explosions in hard rocks (ex: basalt, granite, limestone...). Hard rock masses typically have a blocky structure created by the existence of geologic discontinuities such as bedding contacts, faults, and joints. At very high pressure - hundreds of kilobars and above - these discontinuities do not act separately, and the rock appears to be an equivalent continuous medium. At stress of a few tens of kilobars and below, the geologic discontinuities control the kinematics of the rock masses. Hence, the simulation of rock dynamics, anywhere but in the very-near source region, should account for those kinematics

  4. Novel Aspects of Hard Diffraction in QCD

    International Nuclear Information System (INIS)

    Brodsky, Stanley J.

    2005-01-01

    Initial- and final-state interactions from gluon-exchange, normally neglected in the parton model have a profound effect in QCD hard-scattering reactions, leading to leading-twist single-spin asymmetries, diffractive deep inelastic scattering, diffractive hard hadronic reactions, and nuclear shadowing and antishadowing--leading-twist physics not incorporated in the light-front wavefunctions of the target computed in isolation. I also discuss the use of diffraction to materialize the Fock states of a hadronic projectile and test QCD color transparency

  5. Radiation hardness of undoped BGO crystals

    International Nuclear Information System (INIS)

    Sahu, S.K.; Peng, K.C.; Huang, H.C.; Wang, C.H.; Chang, Y.H.; Hou, W.S.; Ueno, K.; Chou, F.I.; Wei, Y.Y.

    1997-01-01

    We measured the radiation hardness of undoped BGO crystals from two different manufacturers. Such crystals are proposed to be used in a small-angle calorimeter of the BELLE detector of the KEK B-factory. Transparency and scintillation light output of the crystals were monitored to see the effect of radiation damage. The crystals show considerable radiation hardness up to 10.2 Mrad equivalent dose, which is much higher than the maximum expected dosage of 500 krad per year of running at BELLE. (orig.)

  6. Hardness of carbides, nitrides, and borides

    International Nuclear Information System (INIS)

    Schroeter, W.

    1981-01-01

    Intermetallic compounds of metals with non-metals such as C, N, and B show different hardness. Wagner's interaction parameter characterizes manner and extent of the interaction between the atoms of the substance dissolved and the additional elements in metallic mixed phases. An attempt has been made to correlate the hardness of carbides, nitrides, and borides (data taken from literature) with certain interaction parameters and associated thermodynamic quantities (ΔH, ΔG). For some metals of periods 4, 5, and 6 corresponding relations were found between microhardness, interaction parameters, heat of formation, and atomic number

  7. Diffusion corrections to the hard pomeron

    CERN Document Server

    Ciafaloni, Marcello; Müller, A H; Ciafaloni, Marcello; Taiuti, Martina

    2001-01-01

    The high-energy behaviour of two-scale hard processes is investigated in the framework of small-x models with running coupling, having the Airy diffusion model as prototype. We show that, in some intermediate high-energy regime, the perturbative hard Pomeron exponent determines the energy dependence, and we prove that diffusion corrections have the form hinted at before in particular cases. We also discuss the breakdown of such regime at very large energies, and the onset of the non-perturbative Pomeron behaviour.

  8. Irradiation treatment of minimally processed carrots for ensuring microbiological safety

    Science.gov (United States)

    Ashraf Chaudry, Muhammad; Bibi, Nizakat; Khan, Misal; Khan, Maazullah; Badshah, Amal; Jamil Qureshi, Muhammad

    2004-09-01

    Minimally processed fruits and vegetables are very common in developed countries and are gaining popularity in developing countries due to their convenience and freshness. However, minimally processing may result in undesirable changes in colour, taste and appearance due to the transfer of microbes from skin to the flesh. Irradiation is a well-known technology for elimination of microbial contamination. Food irradiation has been approved by 50 countries and is being applied commercially in USA. The purpose of this study was to evaluate the effect of irradiation on the quality of minimally processed carrots. Fresh carrots were peeled, sliced and PE packaged. The samples were irradiated (0, 0.5, 1.0, 2.0, 2.5, 3.0 kGy) and stored at 5°C for 2 weeks. The samples were analyzed for hardness, organoleptic acceptance and microbial load at 0, 7th and 15th day. The mean firmness of the control and all irradiated samples remained between 4.31 and 4.42 kg of force, showing no adverse effect of radiation dose. The effect of storage (2 weeks) was significant ( P10) in all other irradiated samples(1.0, 2.0, 2.5 and 3.0 kGy) after 2 weeks storage. No coliform or E. coli were detected in any of the samples (radiated or control) immediately after irradiation and during the entire storage period in minimally processed carrots. A dose of 2.0 kGy completely controlled the fungal and bacterial counts. The irradiated samples (2.0 kGy) were also acceptable sensorially.

  9. Irradiation treatment of minimally processed carrots for ensuring microbiological safety

    Energy Technology Data Exchange (ETDEWEB)

    Ashraf Chaudry, Muhammad; Bibi, Nizakat; Khan, Misal; Khan, Maazullah; Badshah, Amal; Jamil Qureshi, Muhammad

    2004-10-01

    Minimally processed fruits and vegetables are very common in developed countries and are gaining popularity in developing countries due to their convenience and freshness. However, minimally processing may result in undesirable changes in colour, taste and appearance due to the transfer of microbes from skin to the flesh. Irradiation is a well-known technology for elimination of microbial contamination. Food irradiation has been approved by 50 countries and is being applied commercially in USA. The purpose of this study was to evaluate the effect of irradiation on the quality of minimally processed carrots. Fresh carrots were peeled, sliced and PE packaged. The samples were irradiated (0, 0.5, 1.0, 2.0, 2.5, 3.0 kGy) and stored at 5 deg. C for 2 weeks. The samples were analyzed for hardness, organoleptic acceptance and microbial load at 0, 7th and 15th day. The mean firmness of the control and all irradiated samples remained between 4.31 and 4.42 kg of force, showing no adverse effect of radiation dose. The effect of storage (2 weeks) was significant (P< 0.05) with values ranging between 4.28 and 4.39 kg of force. The total bacterial counts at 5 deg. C for non-irradiated and 0.5 kGy irradiated samples were 6.3x10{sup 5} cfu/g, 3.0x10{sup 2} and few colonies(>10) in all other irradiated samples(1.0, 2.0, 2.5 and 3.0 kGy) after 2 weeks storage. No coliform or E. coli were detected in any of the samples (radiated or control) immediately after irradiation and during the entire storage period in minimally processed carrots. A dose of 2.0 kGy completely controlled the fungal and bacterial counts. The irradiated samples (2.0 kGy) were also acceptable sensorially.

  10. Irradiation treatment of minimally processed carrots for ensuring microbiological safety

    International Nuclear Information System (INIS)

    Ashraf Chaudry, Muhammad; Bibi, Nizakat; Khan, Misal; Khan, Maazullah; Badshah, Amal; Jamil Qureshi, Muhammad

    2004-01-01

    Minimally processed fruits and vegetables are very common in developed countries and are gaining popularity in developing countries due to their convenience and freshness. However, minimally processing may result in undesirable changes in colour, taste and appearance due to the transfer of microbes from skin to the flesh. Irradiation is a well-known technology for elimination of microbial contamination. Food irradiation has been approved by 50 countries and is being applied commercially in USA. The purpose of this study was to evaluate the effect of irradiation on the quality of minimally processed carrots. Fresh carrots were peeled, sliced and PE packaged. The samples were irradiated (0, 0.5, 1.0, 2.0, 2.5, 3.0 kGy) and stored at 5 deg. C for 2 weeks. The samples were analyzed for hardness, organoleptic acceptance and microbial load at 0, 7th and 15th day. The mean firmness of the control and all irradiated samples remained between 4.31 and 4.42 kg of force, showing no adverse effect of radiation dose. The effect of storage (2 weeks) was significant (P 5 cfu/g, 3.0x10 2 and few colonies(>10) in all other irradiated samples(1.0, 2.0, 2.5 and 3.0 kGy) after 2 weeks storage. No coliform or E. coli were detected in any of the samples (radiated or control) immediately after irradiation and during the entire storage period in minimally processed carrots. A dose of 2.0 kGy completely controlled the fungal and bacterial counts. The irradiated samples (2.0 kGy) were also acceptable sensorially

  11. Identification of non-streptococcal organisms from human dental plaque grown on the Streptococcus-selective medium mitis-salivarius agar.

    Science.gov (United States)

    Kim, Yeon-Hee; Lee, Si Young

    2015-02-01

    Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. A comparison of a new centrifuge sugar flotation technique with the agar method for the extraction of immature Culicoides (Diptera: Ceratopogonidae) life stages from salt marsh soils.

    Science.gov (United States)

    Two sampling techniques, agar extraction (AE) and centrifuge sugar flotation extraction (CSFE) were compared to determine their relative efficacy to recover immature stages of Culicoides spp from salt marsh substrates. Three types of samples (seeded with known numbers of larvae, homogenized field s...

  13. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  14. Development of edible films from tapioca starch and agar, enriched with red cabbage (Brassica oleracea) as a sausage deterioration bio-indicator

    Science.gov (United States)

    Aditya Wardana, Ata; Dewanti Widyaningsih, Tri

    2017-12-01

    Sausage spoilage has been identified as a cause of some food poisoning cases. Development of a bioindicator film is one of the alternative methods to detect sausage deterioration. The objectives of this paper were to develop a bioindicator edible films (BEF) from tapioca starch (TS), agar, and red cabbage juice (RC), and to evaluate its performance on sausage deterioration detection. The experiment had a 3x3 randomized factorial experimental design (agar: 3, 5, 7% by weight of TS; RC: 10, 15, 20% v/v based on 100% of suspension). Glycerol was used as the plasticizer. The results showed that the addition of agar into the film solution increased the thickness, elongation, and tensile strength, and decreased water vapour transmission rate (WVTR). While the addition of RC increased the thickness, but decreased elongation, tensile strength, and WVTR. BEF consisting of 2% tapioca starch, 7% (w/w) agar and 10 % (v/v) RC was chosen to apply on sausage. It could detect an increase in the microbial population and in the pH variations as result of sausage deterioration at 24, 48, and 72 h shown through color changes of BEF from bright purple at 0 h to light purple, dark purple-blue, and purple-green color respectively.

  15. Development of a D-amino acids electrochemical sensor based on immobilization of thermostable D-Proline dehydrogenase within agar gel membrane

    International Nuclear Information System (INIS)

    Tani, Yuji; Tanaka, Katsuhito; Yabutani, Tomoki; Mishima, Yuji; Sakuraba, Haruhiko; Ohshima, Toshihisa; Motonaka, Junko

    2008-01-01

    A novel biosensor for determination of D-amino acids (DAAs) in biological samples by using an electrode based on immobilization of a thermostable D-Proline dehydrogenase (D-Pro DH) within an agar gel membrane was developed. The electrode was simply prepared by spin-coating the agar solution with the D-Pro DH on a glassy carbon (GC) electrode. An electrocatalytic oxidation current of 2,6-dichloroindophenol (DCIP) was observed at -100 mV vs. Ag/AgCl with the addition of 5 and 20 mmol L -1 D-proline. The current response and its relative standard deviation were 0.15 μA and 7.6% (n = 3), respectively, when it was measured in a pH 8.0 phosphate buffer solution containing 10 mmol L -1 D-proline and 0.5 mmol L -1 DCIP at 50 deg. C. The current response of D-proline increased with increase of the temperature of the sample solution up to 70 deg. C. The electrocatalytic response at the D-Pro DH/agar immobilized electrode subsequently maintained for 80 days. Finally, the D-Pro DH/agar immobilized electrode was applied to determination of DAAs in a human urine sample. The determined value of DAAs in the human urine and its R.S.D. were 1.39 ± 0.12 mmol L -1 and 8.9% (n = 3), respectively

  16. Experimenting with a Visible Copper-Aluminum Displacement Reaction in Agar Gel and Observing Copper Crystal Growth Patterns to Engage Student Interest and Inquiry

    Science.gov (United States)

    Xu, Xinhua; Wu, Meifen; Wang, Xiaogang; Yang, Yangyiwei; Shi, Xiang; Wang, Guoping

    2016-01-01

    The reaction process of copper-aluminum displacement in agar gel was observed at the microscopic level with a stereomicroscope; pine-like branches of copper crystals growing from aluminum surface into gel at a constant rate were observed. Students were asked to make hypotheses on the pattern formation and design new research approaches to prove…

  17. Characterization of a novel alkaline arylsulfatase from Marinomonas sp. FW-1 and its application in the desulfation of red seaweed agar.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Xu, Jiachao; Gao, Xin; Fu, Xiaoting

    2015-10-01

    A bacterial strain capable of hydrolyzing sulfate ester bonds of p-nitrophenyl sulfate (pNPS) and agar was isolated from the coast area of Qingdao, China. It was identified as Marinomonas based on its 16S rRNA gene sequence and named as Marinomonas sp. FW-1. An arylsulfatase with a recovery of 13 % and a fold of 12 was purified to a homogeneity using ion exchange and gel filtration chromatographies. The enzyme was composed of a single polypeptide chain with the molecular mass of 33 kDa estimated using SDS-PAGE. The optimal pH and temperature of arylsulfatase were pH 9.0 and 45, respectively. Arylsulfatase was stable over pH 8-11 and at temperature below 55 °C. The K m and V max of this enzyme for the hydrolysis of pNPS were determined to be 13.73 and 270.27 μM/min, respectively. The desulfation ratio against agar from red seaweed Gelidium amansii and Gracilaria lemaneiformis were 86.11 and 89.61 %, respectively. There was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated G. amansii agar and that of the commercial agarose. Therefore, this novel alkaline arylsulfatase might have a great potential for application in enzymatic conversion of agar to agarose.

  18. A modified MacConkey agar for selective enumeration of necrotoxigenic E. coli O55 and probiotic E. coli Nissle 1917

    Czech Academy of Sciences Publication Activity Database

    Šplíchalová, Alla; Šplíchal, Igor; Sonnenborn, U.; Rada, V.

    2014-01-01

    Roč. 103, SEP 2014 (2014), s. 82-86 ISSN 0167-7012 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : MacConkey agar * E. coil O55 * NTEC Subject RIV: CE - Biochemistry Impact factor: 2.026, year: 2014

  19. Screening of tannin acyl hydrolase (E.C.3.1.1.20) producing tannery effluent fungal isolates using simple agar plate and SmF process.

    Science.gov (United States)

    Murugan, K; Saravanababu, S; Arunachalam, M

    2007-03-01

    Industrially important tannase producing fungi were isolated from tannery effluent using simple agar plate method. The isolates were screened by submerged fermentation using auto-controlled bioreactor. The colony diameter on the solid surface media shows high correlation with quantitative production of tannase. The isolate Aspergillus niger shows maximum production of both extracellular and intracellular enzyme.

  20. Is non-minimal inflation eternal?

    International Nuclear Information System (INIS)

    Feng, Chao-Jun; Li, Xin-Zhou

    2010-01-01

    The possibility that the non-minimal coupling inflation could be eternal is investigated. We calculate the quantum fluctuation of the inflaton in a Hubble time and find that it has the same value as that in the minimal case in the slow-roll limit. Armed with this result, we have studied some concrete non-minimal inflationary models including the chaotic inflation and the natural inflation, in which the inflaton is non-minimally coupled to the gravity. We find that the non-minimal coupling inflation could be eternal in some parameter spaces.