WorldWideScience

Sample records for handwritten chinese signatures

  1. Cryptographic key generation using handwritten signature

    OpenAIRE

    Freire, Manuel R.; Fiérrez, Julián; Ortega-García, Javier

    2006-01-01

    M. Freire-Santos ; J. Fierrez-Aguilar ; J. Ortega-Garcia; "Cryptographic key generation using handwritten signature", Biometric Technology for Human Identification III, Proc. SPIE 6202 (April 17, 2006); doi:10.1117/12.665875. Copyright 2006 Society of Photo‑Optical Instrumentation Engineers. One print or electronic copy may be made for personal use only. Systematic reproduction and distribution, duplication of any material in this paper for a fee or for commercial purposes, or modification of...

  2. Font generation of personal handwritten Chinese characters

    Science.gov (United States)

    Lin, Jeng-Wei; Wang, Chih-Yin; Ting, Chao-Lung; Chang, Ray-I.

    2014-01-01

    Today, digital multimedia messages have drawn more and more attention due to the great achievement of computer and network techniques. Nevertheless, text is still the most popular media for people to communicate with others. Many fonts have been developed so that product designers can choose unique fonts to demonstrate their idea gracefully. It is commonly believed that handwritings can reflect one's personality, emotion, feeling, education level, and so on. This is especially true in Chinese calligraphy. However, it is not easy for ordinary users to customize a font of their personal handwritings. In this study, we performed a process reengineering in font generation. We present a new method to create font in a batch mode. Rather than to create glyphs of characters one by one according to their codepoints, people create glyphs incrementally in an on-demand manner. A Java Implementation is developed to read a document image of user handwritten Chinese characters, and make a vector font of these handwritten Chinese characters. Preliminary experiment result shows that the proposed method can help ordinary users create their personal handwritten fonts easily and quickly.

  3. Modeling the lexical morphology of Western handwritten signatures.

    Directory of Open Access Journals (Sweden)

    Moises Diaz-Cabrera

    Full Text Available A handwritten signature is the final response to a complex cognitive and neuromuscular process which is the result of the learning process. Because of the many factors involved in signing, it is possible to study the signature from many points of view: graphologists, forensic experts, neurologists and computer vision experts have all examined them. Researchers study written signatures for psychiatric, penal, health and automatic verification purposes. As a potentially useful, multi-purpose study, this paper is focused on the lexical morphology of handwritten signatures. This we understand to mean the identification, analysis, and description of the signature structures of a given signer. In this work we analyze different public datasets involving 1533 signers from different Western geographical areas. Some relevant characteristics of signature lexical morphology have been selected, examined in terms of their probability distribution functions and modeled through a General Extreme Value distribution. This study suggests some useful models for multi-disciplinary sciences which depend on handwriting signatures.

  4. The Proximate Unit in Chinese Handwritten Character Production

    Directory of Open Access Journals (Sweden)

    Jenn-Yeu eChen

    2013-08-01

    Full Text Available In spoken word production, a proximate unit is the first phonological unit at the sublexical level that is selectable for production (O’Seaghdha, Chen, & Chen, 2010. The present study investigated whether the proximate unit in Chinese handwritten word production is the stroke, the radical, or something in between. A written version of the form preparation task was adopted. Chinese participants learned sets of two-character words, later were cued with the first character of each word, and had to write down the second character (the target. Response times were measured from the onset of a cue character to the onset of a written response. In Experiment 1, the target characters within a block shared (homogeneous or did not share (heterogeneous the first stroke. In Experiment 2, the first two strokes were shared in the homogeneous blocks. Response times in the homogeneous blocks and in the heterogeneous blocks were comparable in both experiments (Exp. 1: 687 ms vs. 684 ms, Exp. 2: 717 vs. 716. In Experiment 3 and 4, the target characters within a block shared or did not share the first radical. Response times in the homogeneous blocks were significantly faster than those in the heterogeneous blocks (Exp. 3: 685 vs. 704, Exp. 4: 594 vs. 650. In Experiment 5 and 6, the shared component was a Gestalt-like form that is more than a stroke, constitutes a portion of the target character, can be a stand-alone character itself, can be a radical of another character but is not a radical of the target character (e.g., 士in聲, 鼓, 穀, 款; called a logographeme. Response times in the homogeneous blocks were significantly faster than those in the heterogeneous blocks (Exp. 5: 576 vs. 625, Exp. 6: 586 vs. 620. These results suggest a model of Chinese handwritten character production in which the stroke is not a functional unit, the radical plays the role of a morpheme, and the logographeme is the proximate unit.

  5. Segmentation of Handwritten Chinese Character Strings Based on improved Algorithm Liu

    Directory of Open Access Journals (Sweden)

    Zhihua Cai

    2014-09-01

    Full Text Available Algorithm Liu attracts high attention because of its high accuracy in segmentation of Japanese postal address. But the disadvantages, such as complexity and difficult implementation of algorithm, etc. have an adverse effect on its popularization and application. In this paper, the author applies the principles of algorithm Liu to handwritten Chinese character segmentation according to the characteristics of the handwritten Chinese characters, based on deeply study on algorithm Liu.In the same time, the author put forward the judgment criterion of Segmentation block classification and adhering mode of the handwritten Chinese characters.In the process of segmentation, text images are seen as the sequence made up of Connected Components (CCs, while the connected components are made up of several horizontal itinerary set of black pixels in image. The author determines whether these parts will be merged into segmentation through analyzing connected components. And then the author does image segmentation through adhering mode based on the analysis of outline edges. Finally cut the text images into character segmentation. Experimental results show that the improved Algorithm Liu obtains high segmentation accuracy and produces a satisfactory segmentation result.

  6. [About da tai - abortion in old Chinese folk medicine handwritten manuscripts].

    Science.gov (United States)

    Zheng, Jinsheng

    2013-01-01

    Of 881 Chinese handwritten volumes with medical texts of the 17th through mid-20th century held by Staatsbibliothek zu Berlin and Ethnologisches Museum Berlin-Dahlem, 48 volumes include prescriptions for induced abortion. A comparison shows that these records are significantly different from references to abortion in Chinese printed medical texts of pre-modern times. For example, the percentage of recipes recommended for artificial abortions in handwritten texts is significantly higher than those in printed medical books. Authors of handwritten texts used 25 terms to designate artificial abortion, with the term da tai [see text], lit.: "to strike the fetus", occurring most frequently. Its meaning is well defined, in contrast to other terms used, such as duo tai [see text], lit: "to make a fetus fall", xia tai [see text], lit. "to bring a fetus down", und duan chan [see text], lit., to interrupt birthing", which is mostly used to indicate a temporary or permanent sterilization. Pre-modern Chinese medicine has not generally abstained from inducing abortions; physicians showed a differentiating attitude. While abortions were descibed as "things a [physician with an attitude of] humaneness will not do", in case a pregnancy was seen as too risky for a woman she was offered medication to terminate this pregnancy. The commercial application of abortifacients has been recorded in China since ancient times. A request for such services has continued over time for various reasons, including so-called illegitimate pregnancies, and those by nuns, widows and prostitutes. In general, recipes to induce abortions documented in printed medical literature have mild effects and are to be ingested orally. In comparison, those recommended in handwritten texts are rather toxic. Possibly to minimize the negative side-effects of such medication, practitioners of folk medicine developed mechanical devices to perform "external", i.e., vaginal approaches.

  7. Methods of Generating Key Sequences Based on Parameters of Handwritten Passwords and Signatures

    Directory of Open Access Journals (Sweden)

    Pavel Lozhnikov

    2016-10-01

    Full Text Available The modern encryption methods are reliable if strong keys (passwords are used, but the human factor issue cannot be solved by cryptographic methods. The best variant is binding all authenticators (passwords, encryption keys, and others to the identities. When a user is authenticated by biometrical characteristics, the problem of protecting a biometrical template stored on a remote server becomes a concern. The paper proposes several methods of generating keys (passwords by means of the fuzzy extractors method based on signature parameters without storing templates in an open way.

  8. The temporal courses of phonological and orthographic encoding in handwritten production in Chinese: An ERP study

    Directory of Open Access Journals (Sweden)

    Qingfang Zhang

    2016-08-01

    Full Text Available A central issue in written production concerns how phonological codes influence the output of orthographic codes. We used a picture-word interference paradigm combined with the event-related potential technique to investigate the temporal courses of phonological and orthographic activation and their interplay in Chinese writing. Distractors were orthographically related, phonologically related, orthographically plus phonologically related, or unrelated to picture names. The behavioral results replicated the classic facilitation effect for all three types of relatedness. The ERP results indicated an orthographic effect in the time window of 370 to 500 ms (onset latency: 370 ms, a phonological effect in the time window of 460 to 500 ms (onset latency: 464 ms, and an additive pattern of both effects in both time windows, thus indicating that orthographic codes were accessed earlier than, and independent of, phonological codes in written production. The orthographic activation originates from the semantic system, whereas the phonological effect results from the activation spreading from the orthographic lexicon to the phonological lexicon. These findings substantially strengthen the existing evidence that shows that access to orthographic codes is not mediated by phonological information, and they provide important support for the orthographic autonomy hypothesis.

  9. Optimal Weight Assignment for a Chinese Signature File.

    Science.gov (United States)

    Liang, Tyne; And Others

    1996-01-01

    Investigates the performance of a character-based Chinese text retrieval scheme in which monogram keys and bigram keys are encoded into document signatures. Tests and verifies the theoretical predictions of the optimal weight assignments and the minimal false hit rate in experiments using a real Chinese corpus for disyllabic queries of different…

  10. Neural signatures of phonological deficits in Chinese developmental dyslexia.

    Science.gov (United States)

    Cao, Fan; Yan, Xin; Wang, Zhao; Liu, Yanni; Wang, Jin; Spray, Gregory J; Deng, Yuan

    2017-02-01

    There has been debate on whether phonological deficits explain reading difficulty in Chinese, since Chinese is a logographic language which does not employ grapheme-phoneme-correspondence rules and remote memorization seems to be the main method to acquire reading. In the current study, we present neuroimaging evidence that the phonological deficit is also a signature of Chinese dyslexia. Specifically, we found that Chinese children with dyslexia (DD) showed reduced brain activation in the left dorsal inferior frontal gyrus (dIFG) when compared to both age-matched controls (AC) and reading-matched controls (RC) during an auditory rhyming judgment task. This suggests that the phonological processing deficit in this region may be a signature of dyslexia in Chinese, rather than a difference due to task performance or reading ability, which was matched on DD and RC. At exactly the same region of the left dIFG, we found a positive correlation between brain activation and reading skill in DD, suggesting that the phonological deficit is associated with the severity of dyslexia. We also found increased brain activation in the right precentral gyrus in DD than both AC and RC, suggesting a compensation of reliance on articulation. Functional connectivity analyses revealed that DD had a weaker connection between the left superior temporal gyrus (STG) and fusiform gyrus (FG) than the two control groups, suggesting that the reduced connection between phonology and orthography is another neural signature of dyslexia. In contrast, DD showed greater connectivity between the left dIFG and the left inferior parietal lobule (IPL) than both control groups, suggesting a reduced segregation between the language network and default mode network in dyslexic children. We also found that connectivity between the left STG and the left dIFG was sensitive to task performance and/or reading skill rather than being dyslexic or not, because AC was greater than both RC and DD, while the

  11. A small set of succinct signature patterns distinguishes Chinese and non-Chinese HIV-1 genomes.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The epidemiology of HIV-1 in China has unique features that may have led to unique viral strains. We therefore tested the hypothesis that it is possible to find distinctive patterns in HIV-1 genomes sampled in China. Using a rule inference algorithm we could indeed extract from sequences of the third variable loop (V3 of HIV-1 gp120 a set of 14 signature patterns that with 89% accuracy distinguished Chinese from non-Chinese sequences. These patterns were found to be specific to HIV-1 subtype, i.e. sequences complying with pattern 1 were of subtype B, pattern 2 almost exclusively covered sequences of subtype 01_AE, etc. We then analyzed the first of these signature patterns in depth, namely that L and W at two V3 positions are specifically occurring in Chinese sequences of subtype B/B' (3% false positives. This pattern was found to be in agreement with the phylogeny of HIV-1 of subtype B inside and outside of China. We could neither reject nor convincingly confirm that the pattern is stabilized by immune escape. For further interpretation of the signature pattern we used the recently developed measure of Direct Information, and in this way discovered evidence for physical interactions between V2 and V3. We conclude by a discussion of limitations of signature patterns, and the applicability of the approach to other genomic regions and other countries.

  12. Signature-based User Authentication

    OpenAIRE

    Hámorník, Juraj

    2015-01-01

    This work aims on missing handwritten signature authentication in Windows. Result of this work is standalone software that allow users to log into Windows by writing signature. We focus on security of signature authentification and best overall user experience. We implemented signature authentification service that accept signature and return user access token if signature is genuine. Signature authentification is done by comparing given signature to signature patterns by their similarity. Si...

  13. Sunspot drawings handwritten character recognition method based on deep learning

    Science.gov (United States)

    Zheng, Sheng; Zeng, Xiangyun; Lin, Ganghua; Zhao, Cui; Feng, Yongli; Tao, Jinping; Zhu, Daoyuan; Xiong, Li

    2016-05-01

    High accuracy scanned sunspot drawings handwritten characters recognition is an issue of critical importance to analyze sunspots movement and store them in the database. This paper presents a robust deep learning method for scanned sunspot drawings handwritten characters recognition. The convolution neural network (CNN) is one algorithm of deep learning which is truly successful in training of multi-layer network structure. CNN is used to train recognition model of handwritten character images which are extracted from the original sunspot drawings. We demonstrate the advantages of the proposed method on sunspot drawings provided by Chinese Academy Yunnan Observatory and obtain the daily full-disc sunspot numbers and sunspot areas from the sunspot drawings. The experimental results show that the proposed method achieves a high recognition accurate rate.

  14. Use of Splines in Handwritten Character Recognition

    OpenAIRE

    Sunil Kumar; Gopinath S,; Satish Kumar; Rajesh Chhikara

    2010-01-01

    Handwritten Character Recognition is software used to identify the handwritten characters and receive and interpret intelligible andwritten input from sources such as manuscript documents. The recent past several years has seen the development of many systems which are able to simulate the human brain actions. Among the many, the neural networks and the artificial intelligence are the most two important paradigms used. In this paper we propose a new algorithm for recognition of handwritten t...

  15. Exploring the molecular mechanisms of Traditional Chinese Medicine components using gene expression signatures and connectivity map.

    Science.gov (United States)

    Yoo, Minjae; Shin, Jimin; Kim, Hyunmin; Kim, Jihye; Kang, Jaewoo; Tan, Aik Choon

    2018-04-04

    Traditional Chinese Medicine (TCM) has been practiced over thousands of years in China and other Asian countries for treating various symptoms and diseases. However, the underlying molecular mechanisms of TCM are poorly understood, partly due to the "multi-component, multi-target" nature of TCM. To uncover the molecular mechanisms of TCM, we perform comprehensive gene expression analysis using connectivity map. We interrogated gene expression signatures obtained 102 TCM components using the next generation Connectivity Map (CMap) resource. We performed systematic data mining and analysis on the mechanism of action (MoA) of these TCM components based on the CMap results. We clustered the 102 TCM components into four groups based on their MoAs using next generation CMap resource. We performed gene set enrichment analysis on these components to provide additional supports for explaining these molecular mechanisms. We also provided literature evidence to validate the MoAs identified through this bioinformatics analysis. Finally, we developed the Traditional Chinese Medicine Drug Repurposing Hub (TCM Hub) - a connectivity map resource to facilitate the elucidation of TCM MoA for drug repurposing research. TCMHub is freely available in http://tanlab.ucdenver.edu/TCMHub. Molecular mechanisms of TCM could be uncovered by using gene expression signatures and connectivity map. Through this analysis, we identified many of the TCM components possess diverse MoAs, this may explain the applications of TCM in treating various symptoms and diseases. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  16. Online handwritten mathematical expression recognition

    Science.gov (United States)

    Büyükbayrak, Hakan; Yanikoglu, Berrin; Erçil, Aytül

    2007-01-01

    We describe a system for recognizing online, handwritten mathematical expressions. The system is designed with a user-interface for writing scientific articles, supporting the recognition of basic mathematical expressions as well as integrals, summations, matrices etc. A feed-forward neural network recognizes symbols which are assumed to be single-stroke and a recursive algorithm parses the expression by combining neural network output and the structure of the expression. Preliminary results show that writer-dependent recognition rates are very high (99.8%) while writer-independent symbol recognition rates are lower (75%). The interface associated with the proposed system integrates the built-in recognition capabilities of the Microsoft's Tablet PC API for recognizing textual input and supports conversion of hand-drawn figures into PNG format. This enables the user to enter text, mathematics and draw figures in a single interface. After recognition, all output is combined into one LATEX code and compiled into a PDF file.

  17. 21 CFR 11.70 - Signature/record linking.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Signature/record linking. 11.70 Section 11.70 Food... RECORDS; ELECTRONIC SIGNATURES Electronic Records § 11.70 Signature/record linking. Electronic signatures and handwritten signatures executed to electronic records shall be linked to their respective...

  18. Un système de vérification de signature manuscrite en ligne basé ...

    African Journals Online (AJOL)

    Administrateur

    online handwritten signature verification system. We model the handwritten signature by an analytical approach based on the Empirical Mode Decomposition (EMD). The organized system is provided with a training module and a base of signatures. The implemented evaluation protocol points out the interest of the adopted ...

  19. Script-independent text line segmentation in freestyle handwritten documents.

    Science.gov (United States)

    Li, Yi; Zheng, Yefeng; Doermann, David; Jaeger, Stefan; Li, Yi

    2008-08-01

    Text line segmentation in freestyle handwritten documents remains an open document analysis problem. Curvilinear text lines and small gaps between neighboring text lines present a challenge to algorithms developed for machine printed or hand-printed documents. In this paper, we propose a novel approach based on density estimation and a state-of-the-art image segmentation technique, the level set method. From an input document image, we estimate a probability map, where each element represents the probability that the underlying pixel belongs to a text line. The level set method is then exploited to determine the boundary of neighboring text lines by evolving an initial estimate. Unlike connected component based methods ( [1], [2] for example), the proposed algorithm does not use any script-specific knowledge. Extensive quantitative experiments on freestyle handwritten documents with diverse scripts, such as Arabic, Chinese, Korean, and Hindi, demonstrate that our algorithm consistently outperforms previous methods [1]-[3]. Further experiments show the proposed algorithm is robust to scale change, rotation, and noise.

  20. DATABASES FOR RECOGNITION OF HANDWRITTEN ARABIC CHEQUES

    NARCIS (Netherlands)

    Alohali, Y.; Cheriet, M.; Suen, C.Y.

    2004-01-01

    This paper describes an effort toward building Arabic cheque databases for research in recognition of handwritten Arabic cheques. Databases of Arabic legal amounts, Arabic sub­ words, courtesy amounts, Indian digits, and Arabic cheques are provided. This paper highlights the characteristics of the

  1. Beyond OCR: Handwritten manuscript attribute understanding

    NARCIS (Netherlands)

    He, Sheng

    2017-01-01

    Knowing the author, date and location of handwritten historical documents is very important for historians to completely understand and reveal the valuable information they contain. In this thesis, three attributes, such as writer, date and geographical location, are studied by analyzing the

  2. RECOGNITION AND VERIFICATION OF TOUCHING HANDWRITTEN NUMERALS

    NARCIS (Netherlands)

    Zhou, J.; Kryzak, A.; Suen, C.Y.

    2004-01-01

    In the field of financial document processing, recognition of touching handwritten numerals has been limited by lack of good benchmarking databases and low reliability of algorithms. This paper addresses the efforts toward solving the two problems. Two databases IRIS-Bell\\\\\\'98 and TNIST are

  3. A NEW APPROACH TO SEGMENT HANDWRITTEN DIGITS

    NARCIS (Netherlands)

    Oliveira, L.S.; Lethelier, E.; Bortolozzi, F.; Sabourin, R.

    2004-01-01

    This article presents a new segmentation approach applied to unconstrained handwritten digits. The novelty of the proposed algorithm is based on the combination of two types of structural features in order to provide the best segmentation path between connected entities. In this article, we first

  4. Do handwritten words magnify lexical effects in visual word recognition?

    Science.gov (United States)

    Perea, Manuel; Gil-López, Cristina; Beléndez, Victoria; Carreiras, Manuel

    2016-01-01

    An examination of how the word recognition system is able to process handwritten words is fundamental to formulate a comprehensive model of visual word recognition. Previous research has revealed that the magnitude of lexical effects (e.g., the word-frequency effect) is greater with handwritten words than with printed words. In the present lexical decision experiments, we examined whether the quality of handwritten words moderates the recruitment of top-down feedback, as reflected in word-frequency effects. Results showed a reading cost for difficult-to-read and easy-to-read handwritten words relative to printed words. But the critical finding was that difficult-to-read handwritten words, but not easy-to-read handwritten words, showed a greater word-frequency effect than printed words. Therefore, the inherent physical variability of handwritten words does not necessarily boost the magnitude of lexical effects.

  5. Handwritten Digits Recognition Using Neural Computing

    Directory of Open Access Journals (Sweden)

    Călin Enăchescu

    2009-12-01

    Full Text Available In this paper we present a method for the recognition of handwritten digits and a practical implementation of this method for real-time recognition. A theoretical framework for the neural networks used to classify the handwritten digits is also presented.The classification task is performed using a Convolutional Neural Network (CNN. CNN is a special type of multy-layer neural network, being trained with an optimized version of the back-propagation learning algorithm.CNN is designed to recognize visual patterns directly from pixel images with minimal preprocessing, being capable to recognize patterns with extreme variability (such as handwritten characters, and with robustness to distortions and simple geometric transformations.The main contributions of this paper are related to theoriginal methods for increasing the efficiency of the learning algorithm by preprocessing the images before the learning process and a method for increasing the precision and performance for real-time applications, by removing the non useful information from the background.By combining these strategies we have obtained an accuracy of 96.76%, using as training set the NIST (National Institute of Standards and Technology database.

  6. Assessment of legibility and completeness of handwritten and electronic prescriptions.

    Science.gov (United States)

    Albarrak, Ahmed I; Al Rashidi, Eman Abdulrahman; Fatani, Rwaa Kamil; Al Ageel, Shoog Ibrahim; Mohammed, Rafiuddin

    2014-12-01

    To assess the legibility and completeness of handwritten prescriptions and compare with electronic prescription system for medication errors. Prospective study. King Khalid University Hospital (KKUH), Riyadh, Saudi Arabia. Handwritten prescriptions were received from clinical units of Medicine Outpatient Department (MOPD), Primary Care Clinic (PCC) and Surgery Outpatient Department (SOPD) whereas electronic prescriptions were collected from the pediatric ward. The handwritten prescription was assessed for completeness by the checklist designed according to the hospital prescription and evaluated for legibility by two pharmacists. The comparison between handwritten and electronic prescription errors was evaluated based on the validated checklist adopted from previous studies. Legibility and completeness of prescriptions. 398 prescriptions (199 handwritten and 199 e-prescriptions) were assessed. About 71 (35.7%) of handwritten and 5 (2.5%) of electronic prescription errors were identified. A significant statistical difference (P prescriptions in omitted dose and omitted route of administration category of error distribution. The rate of completeness in patient identification in handwritten prescriptions was 80.97% in MOPD, 76.36% in PCC and 85.93% in SOPD clinic units. Assessment of medication prescription completeness was 91.48% in MOPD, 88.48% in PCC, and 89.28% in SOPD. This study revealed a high incidence of prescribing errors in handwritten prescriptions. The use of e-prescription system showed a significant decline in the incidence of errors. The legibility of handwritten prescriptions was relatively good whereas the level of completeness was very low.

  7. Multi-digit handwritten sindhi numerals recognition using som neural network

    International Nuclear Information System (INIS)

    Chandio, A.A.; Jalbani, A.H.; Awan, S.A.

    2017-01-01

    In this research paper a multi-digit Sindhi handwritten numerals recognition system using SOM Neural Network is presented. Handwritten digits recognition is one of the challenging tasks and a lot of research is being carried out since many years. A remarkable work has been done for recognition of isolated handwritten characters as well as digits in many languages like English, Arabic, Devanagari, Chinese, Urdu and Pashto. However, the literature reviewed does not show any remarkable work done for Sindhi numerals recognition. The recognition of Sindhi digits is a difficult task due to the various writing styles and different font sizes. Therefore, SOM (Self-Organizing Map), a NN (Neural Network) method is used which can recognize digits with various writing styles and different font sizes. Only one sample is required to train the network for each pair of multi-digit numerals. A database consisting of 4000 samples of multi-digits consisting only two digits from 10-50 and other matching numerals have been collected by 50 users and the experimental results of proposed method show that an accuracy of 86.89% is achieved. (author)

  8. Eye movements when reading sentences with handwritten words.

    Science.gov (United States)

    Perea, Manuel; Marcet, Ana; Uixera, Beatriz; Vergara-Martínez, Marta

    2016-10-17

    The examination of how we read handwritten words (i.e., the original form of writing) has typically been disregarded in the literature on reading. Previous research using word recognition tasks has shown that lexical effects (e.g., the word-frequency effect) are magnified when reading difficult handwritten words. To examine this issue in a more ecological scenario, we registered the participants' eye movements when reading handwritten sentences that varied in the degree of legibility (i.e., sentences composed of words in easy vs. difficult handwritten style). For comparison purposes, we included a condition with printed sentences. Results showed a larger reading cost for sentences with difficult handwritten words than for sentences with easy handwritten words, which in turn showed a reading cost relative to the sentences with printed words. Critically, the effect of word frequency was greater for difficult handwritten words than for easy handwritten words or printed words in the total times on a target word, but not on first-fixation durations or gaze durations. We examine the implications of these findings for models of eye movement control in reading.

  9. Slant correction for handwritten English documents

    Science.gov (United States)

    Shridhar, Malayappan; Kimura, Fumitaka; Ding, Yimei; Miller, John W. V.

    2004-12-01

    Optical character recognition of machine-printed documents is an effective means for extracting textural material. While the level of effectiveness for handwritten documents is much poorer, progress is being made in more constrained applications such as personal checks and postal addresses. In these applications a series of steps is performed for recognition beginning with removal of skew and slant. Slant is a characteristic unique to the writer and varies from writer to writer in which characters are tilted some amount from vertical. The second attribute is the skew that arises from the inability of the writer to write on a horizontal line. Several methods have been proposed and discussed for average slant estimation and correction in the earlier papers. However, analysis of many handwritten documents reveals that slant is a local property and slant varies even within a word. The use of an average slant for the entire word often results in overestimation or underestimation of the local slant. This paper describes three methods for local slant estimation, namely the simple iterative method, high-speed iterative method, and the 8-directional chain code method. The experimental results show that the proposed methods can estimate and correct local slant more effectively than the average slant correction.

  10. A Proposed Arabic Handwritten Text Normalization Method

    Directory of Open Access Journals (Sweden)

    Tarik Abu-Ain

    2014-11-01

    Full Text Available Text normalization is an important technique in document image analysis and recognition. It consists of many preprocessing stages, which include slope correction, text padding, skew correction, and straight the writing line. In this side, text normalization has an important role in many procedures such as text segmentation, feature extraction and characters recognition. In the present article, a new method for text baseline detection, straightening, and slant correction for Arabic handwritten texts is proposed. The method comprises a set of sequential steps: first components segmentation is done followed by components text thinning; then, the direction features of the skeletons are extracted, and the candidate baseline regions are determined. After that, selection of the correct baseline region is done, and finally, the baselines of all components are aligned with the writing line.  The experiments are conducted on IFN/ENIT benchmark Arabic dataset. The results show that the proposed method has a promising and encouraging performance.

  11. Ensemble methods for handwritten digit recognition

    DEFF Research Database (Denmark)

    Hansen, Lars Kai; Liisberg, Christian; Salamon, P.

    1992-01-01

    Neural network ensembles are applied to handwritten digit recognition. The individual networks of the ensemble are combinations of sparse look-up tables (LUTs) with random receptive fields. It is shown that the consensus of a group of networks outperforms the best individual of the ensemble....... It is further shown that it is possible to estimate the ensemble performance as well as the learning curve on a medium-size database. In addition the authors present preliminary analysis of experiments on a large database and show that state-of-the-art performance can be obtained using the ensemble approach...... by optimizing the receptive fields. It is concluded that it is possible to improve performance significantly by introducing moderate-size ensembles; in particular, a 20-25% improvement has been found. The ensemble random LUTs, when trained on a medium-size database, reach a performance (without rejects) of 94...

  12. A novel handwritten character recognition system using gradient ...

    Indian Academy of Sciences (India)

    The issues faced by the handwritten character recognition systems are the similarity. ∗ ... tical/structural features have also been successfully used in character ..... The coordinates (xc, yc) of centroid are calculated by equations (4) and (5). xc =.

  13. 37 CFR 1.4 - Nature of correspondence and signature requirements.

    Science.gov (United States)

    2010-07-01

    ... signature requirements. 1.4 Section 1.4 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... General Information and Correspondence § 1.4 Nature of correspondence and signature requirements. (a...) Handwritten signature. Each piece of correspondence, except as provided in paragraphs (d)(2), (d)(3), (e) and...

  14. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  15. Behavioral and subcortical signatures of musical expertise in Mandarin Chinese speakers.

    Directory of Open Access Journals (Sweden)

    Caitlin Dawson

    Full Text Available Both musical training and native language have been shown to have experience-based plastic effects on auditory processing. However, the combined effects within individuals are unclear. Recent research suggests that musical training and tone language speaking are not clearly additive in their effects on processing of auditory features and that there may be a disconnect between perceptual and neural signatures of auditory feature processing. The literature has only recently begun to investigate the effects of musical expertise on basic auditory processing for different linguistic groups. This work provides a profile of primary auditory feature discrimination for Mandarin speaking musicians and nonmusicians. The musicians showed enhanced perceptual discrimination for both frequency and duration as well as enhanced duration discrimination in a multifeature discrimination task, compared to nonmusicians. However, there were no differences between the groups in duration processing of nonspeech sounds at a subcortical level or in subcortical frequency representation of a nonnative tone contour, for fo or for the first or second formant region. The results indicate that musical expertise provides a cognitive, but not subcortical, advantage in a population of Mandarin speakers.

  16. Features fusion based approach for handwritten Gujarati character recognition

    Directory of Open Access Journals (Sweden)

    Ankit Sharma

    2017-02-01

    Full Text Available Handwritten character recognition is a challenging area of research. Lots of research activities in the area of character recognition are already done for Indian languages such as Hindi, Bangla, Kannada, Tamil and Telugu. Literature review on handwritten character recognition indicates that in comparison with other Indian scripts research activities on Gujarati handwritten character recognition are very less.  This paper aims to bring Gujarati character recognition in attention. Recognition of isolated Gujarati handwritten characters is proposed using three different kinds of features and their fusion. Chain code based, zone based and projection profiles based features are utilized as individual features. One of the significant contribution of proposed work is towards the generation of large and representative dataset of 88,000 handwritten Gujarati characters. Experiments are carried out on this developed dataset. Artificial Neural Network (ANN, Support Vector Machine (SVM and Naive Bayes (NB classifier based methods are implemented for handwritten Gujarati character recognition. Experimental results show substantial enhancement over state-of-the-art and authenticate our proposals.

  17. Handwritten Sindhi Character Recognition Using Neural Networks

    Directory of Open Access Journals (Sweden)

    Shafique Ahmed Awan

    2018-01-01

    Full Text Available OCR (OpticalCharacter Recognition is a technology in which text image is used to understand and write text by machines. The work on languages containing isolated characters such as German, English, French and others is at its peak. The OCR and ICR (Intelligent Character Recognition research in Sindhi script is currently at in starting stages and not sufficient work have been cited in this area even though Sindhi language is rich in culture and history. This paper presents one of the initial steps in recognizing Sindhi handwritten characters. The isolated characters of Sindhi script written by thesubjects have been recognized. The various subjects were asked to write Sindhi characters in unconstrained form and then the written samples were collected and scanned through a flatbed scanner. The scanned documents were preprocessedwith the help of binary conversion, removing noise by pepper noise and the lines were segmented with the help of horizontal profile technique. The segmented lines were used to extract characters from scanned pages.This character segmentation was done by vertical projection. The extracted characters have been used to extract features so that the characters can be classified easily. Zoning was used for the feature extraction technique. For the classification, neural network has been used. The recognized characters converted into editable text with an average accuracy of 85%.

  18. Handwritten recognition of Tamil vowels using deep learning

    Science.gov (United States)

    Ram Prashanth, N.; Siddarth, B.; Ganesh, Anirudh; Naveen Kumar, Vaegae

    2017-11-01

    We come across a large volume of handwritten texts in our daily lives and handwritten character recognition has long been an important area of research in pattern recognition. The complexity of the task varies among different languages and it so happens largely due to the similarity between characters, distinct shapes and number of characters which are all language-specific properties. There have been numerous works on character recognition of English alphabets and with laudable success, but regional languages have not been dealt with very frequently and with similar accuracies. In this paper, we explored the performance of Deep Belief Networks in the classification of Handwritten Tamil vowels, and conclusively compared the results obtained. The proposed method has shown satisfactory recognition accuracy in light of difficulties faced with regional languages such as similarity between characters and minute nuances that differentiate them. We can further extend this to all the Tamil characters.

  19. Un système de vérification de signature manuscrite en ligne basé ...

    African Journals Online (AJOL)

    Administrateur

    systems. The problem of cursive handwritten signatures verification can be approached on two main approaches one probabilistic. (analytical) and another structural. So, two methodologies ... do the classification is presented in [11].The online signature ..... Automatic on-line signature verification based on multiple models ...

  20. Handwritten Word Recognition Using Multi-view Analysis

    Science.gov (United States)

    de Oliveira, J. J.; de A. Freitas, C. O.; de Carvalho, J. M.; Sabourin, R.

    This paper brings a contribution to the problem of efficiently recognizing handwritten words from a limited size lexicon. For that, a multiple classifier system has been developed that analyzes the words from three different approximation levels, in order to get a computational approach inspired on the human reading process. For each approximation level a three-module architecture composed of a zoning mechanism (pseudo-segmenter), a feature extractor and a classifier is defined. The proposed application is the recognition of the Portuguese handwritten names of the months, for which a best recognition rate of 97.7% was obtained, using classifier combination.

  1. Handwritten document age classification based on handwriting styles

    Science.gov (United States)

    Ramaiah, Chetan; Kumar, Gaurav; Govindaraju, Venu

    2012-01-01

    Handwriting styles are constantly changing over time. We approach the novel problem of estimating the approximate age of Historical Handwritten Documents using Handwriting styles. This system will have many applications in handwritten document processing engines where specialized processing techniques can be applied based on the estimated age of the document. We propose to learn a distribution over styles across centuries using Topic Models and to apply a classifier over weights learned in order to estimate the approximate age of the documents. We present a comparison of different distance metrics such as Euclidean Distance and Hellinger Distance within this application.

  2. WORD LEVEL DISCRIMINATIVE TRAINING FOR HANDWRITTEN WORD RECOGNITION

    NARCIS (Netherlands)

    Chen, W.; Gader, P.

    2004-01-01

    Word level training refers to the process of learning the parameters of a word recognition system based on word level criteria functions. Previously, researchers trained lexicon­driven handwritten word recognition systems at the character level individually. These systems generally use statistical

  3. Interpreting Chicken-Scratch: Lexical Access for Handwritten Words

    Science.gov (United States)

    Barnhart, Anthony S.; Goldinger, Stephen D.

    2010-01-01

    Handwritten word recognition is a field of study that has largely been neglected in the psychological literature, despite its prevalence in society. Whereas studies of spoken word recognition almost exclusively employ natural, human voices as stimuli, studies of visual word recognition use synthetic typefaces, thus simplifying the process of word…

  4. Beyond OCR : Multi-faceted understanding of handwritten document characteristics

    NARCIS (Netherlands)

    He, Sheng; Schomaker, Lambert

    Handwritten document understanding is a fundamental research problem in pattern recognition and it relies on the effective features. In this paper, we propose a joint feature distribution (JFD) principle to design novel discriminative features which could be the joint distribution of features on

  5. ADAPTIVE CONTEXT PROCESSING IN ON-LINE HANDWRITTEN CHARACTER RECOGNITION

    NARCIS (Netherlands)

    Iwayama, N.; Ishigaki, K.

    2004-01-01

    We propose a new approach to context processing in on-line handwritten character recognition (OLCR). Based on the observation that writers often repeat the strings that they input, we take the approach of adaptive context processing. (ACP). In ACP, the strings input by a writer are automatically

  6. Handwritten-word spotting using biologically inspired features

    NARCIS (Netherlands)

    van der Zant, Tijn; Schomaker, Lambert; Haak, Koen

    For quick access to new handwritten collections, current handwriting recognition methods are too cumbersome. They cannot deal with the lack of labeled data and would require extensive laboratory training for each individual script, style, language, and collection. We propose a biologically inspired

  7. Recognition of handwritten characters using local gradient feature descriptors

    NARCIS (Netherlands)

    Surinta, Olarik; Karaaba, Mahir F.; Schomaker, Lambert R.B.; Wiering, Marco A.

    2015-01-01

    Abstract In this paper we propose to use local gradient feature descriptors, namely the scale invariant feature transform keypoint descriptor and the histogram of oriented gradients, for handwritten character recognition. The local gradient feature descriptors are used to extract feature vectors

  8. Where are the Search Engines for Handwritten Documents?

    NARCIS (Netherlands)

    van der Zant, Tijn; Schomaker, Lambert; Zinger, Svitlana; van Schie, Henny

    Although the problems of optical character recognition for contemporary printed text have been resolved, for historical printed and handwritten connected cursive text (i.e. western style writing), they have not. This does not mean that scanning historical documents is not useful. This article

  9. Where are the search engines for handwritten documents?

    NARCIS (Netherlands)

    Zant, T.; Schomaker, L.; Zinger, S.; Schie, H.

    2009-01-01

    Although the problems of optical character recognition for contemporary printed text have been resolved, for historical printed and handwritten connected cursive text (i.e. western style writing), they have not. This does not mean that scanning historical documents is not useful. This article

  10. Neural Signatures of the Reading-Writing Connection: Greater Involvement of Writing in Chinese Reading than English Reading.

    Directory of Open Access Journals (Sweden)

    Fan Cao

    Full Text Available Research on cross-linguistic comparisons of the neural correlates of reading has consistently found that the left middle frontal gyrus (MFG is more involved in Chinese than in English. However, there is a lack of consensus on the interpretation of the language difference. Because this region has been found to be involved in writing, we hypothesize that reading Chinese characters involves this writing region to a greater degree because Chinese speakers learn to read by repeatedly writing the characters. To test this hypothesis, we recruited English L1 learners of Chinese, who performed a reading task and a writing task in each language. The English L1 sample had learned some Chinese characters through character-writing and others through phonological learning, allowing a test of writing-on-reading effect. We found that the left MFG was more activated in Chinese than English regardless of task, and more activated in writing than in reading regardless of language. Furthermore, we found that this region was more activated for reading Chinese characters learned by character-writing than those learned by phonological learning. A major conclusion is that writing regions are also activated in reading, and that this reading-writing connection is modulated by the learning experience. We replicated the main findings in a group of native Chinese speakers, which excluded the possibility that the language differences observed in the English L1 participants were due to different language proficiency level.

  11. Neural Signatures of the Reading-Writing Connection: Greater Involvement of Writing in Chinese Reading than English Reading.

    Science.gov (United States)

    Cao, Fan; Perfetti, Charles A

    2016-01-01

    Research on cross-linguistic comparisons of the neural correlates of reading has consistently found that the left middle frontal gyrus (MFG) is more involved in Chinese than in English. However, there is a lack of consensus on the interpretation of the language difference. Because this region has been found to be involved in writing, we hypothesize that reading Chinese characters involves this writing region to a greater degree because Chinese speakers learn to read by repeatedly writing the characters. To test this hypothesis, we recruited English L1 learners of Chinese, who performed a reading task and a writing task in each language. The English L1 sample had learned some Chinese characters through character-writing and others through phonological learning, allowing a test of writing-on-reading effect. We found that the left MFG was more activated in Chinese than English regardless of task, and more activated in writing than in reading regardless of language. Furthermore, we found that this region was more activated for reading Chinese characters learned by character-writing than those learned by phonological learning. A major conclusion is that writing regions are also activated in reading, and that this reading-writing connection is modulated by the learning experience. We replicated the main findings in a group of native Chinese speakers, which excluded the possibility that the language differences observed in the English L1 participants were due to different language proficiency level.

  12. Research on Signature Verification Method Based on Discrete Fréchet Distance

    Science.gov (United States)

    Fang, J. L.; Wu, W.

    2018-05-01

    This paper proposes a multi-feature signature template based on discrete Fréchet distance, which breaks through the limitation of traditional signature authentication using a single signature feature. It solves the online handwritten signature authentication signature global feature template extraction calculation workload, signature feature selection unreasonable problem. In this experiment, the false recognition rate (FAR) and false rejection rate (FRR) of the statistical signature are calculated and the average equal error rate (AEER) is calculated. The feasibility of the combined template scheme is verified by comparing the average equal error rate of the combination template and the original template.

  13. A Study of Moment Based Features on Handwritten Digit Recognition

    Directory of Open Access Journals (Sweden)

    Pawan Kumar Singh

    2016-01-01

    Full Text Available Handwritten digit recognition plays a significant role in many user authentication applications in the modern world. As the handwritten digits are not of the same size, thickness, style, and orientation, therefore, these challenges are to be faced to resolve this problem. A lot of work has been done for various non-Indic scripts particularly, in case of Roman, but, in case of Indic scripts, the research is limited. This paper presents a script invariant handwritten digit recognition system for identifying digits written in five popular scripts of Indian subcontinent, namely, Indo-Arabic, Bangla, Devanagari, Roman, and Telugu. A 130-element feature set which is basically a combination of six different types of moments, namely, geometric moment, moment invariant, affine moment invariant, Legendre moment, Zernike moment, and complex moment, has been estimated for each digit sample. Finally, the technique is evaluated on CMATER and MNIST databases using multiple classifiers and, after performing statistical significance tests, it is observed that Multilayer Perceptron (MLP classifier outperforms the others. Satisfactory recognition accuracies are attained for all the five mentioned scripts.

  14. Image Processing Based Signature Verification Technique to Reduce Fraud in Financial Institutions

    Directory of Open Access Journals (Sweden)

    Hussein Walid

    2016-01-01

    Full Text Available Handwritten signature is broadly utilized as personal verification in financial institutions ensures the necessity for a robust automatic signature verification tool. This tool aims to reduce fraud in all related financial transactions’ sectors. This paper proposes an online, robust, and automatic signature verification technique using the recent advances in image processing and machine learning. Once the image of a handwritten signature for a customer is captured, several pre-processing steps are performed on it including filtration and detection of the signature edges. Afterwards, a feature extraction process is applied on the image to extract Speeded up Robust Features (SURF and Scale-Invariant Feature Transform (SIFT features. Finally, a verification process is developed and applied to compare the extracted image features with those stored in the database for the specified customer. Results indicate high accuracy, simplicity, and rapidity of the developed technique, which are the main criteria to judge a signature verification tool in banking and other financial institutions.

  15. The influence of physical and biomechanical processes on the ink trace. Methodological foundations for the forensic analysis of signatures

    NARCIS (Netherlands)

    Franke, Katrin

    2005-01-01

    Handwritten signatures play an important role in daily life. They are widely accepted and frequently used to verify the claimed identity of a person. Consequently, there is a strong need for objective and automatic signature evaluation. The dissertation at hand aims (i) to provide a scientific basis

  16. Incremental Tensor Principal Component Analysis for Handwritten Digit Recognition

    Directory of Open Access Journals (Sweden)

    Chang Liu

    2014-01-01

    Full Text Available To overcome the shortcomings of traditional dimensionality reduction algorithms, incremental tensor principal component analysis (ITPCA based on updated-SVD technique algorithm is proposed in this paper. This paper proves the relationship between PCA, 2DPCA, MPCA, and the graph embedding framework theoretically and derives the incremental learning procedure to add single sample and multiple samples in detail. The experiments on handwritten digit recognition have demonstrated that ITPCA has achieved better recognition performance than that of vector-based principal component analysis (PCA, incremental principal component analysis (IPCA, and multilinear principal component analysis (MPCA algorithms. At the same time, ITPCA also has lower time and space complexity.

  17. Multi-script handwritten character recognition : Using feature descriptors and machine learning

    NARCIS (Netherlands)

    Surinta, Olarik

    2016-01-01

    Handwritten character recognition plays an important role in transforming raw visual image data obtained from handwritten documents using for example scanners to a format which is understandable by a computer. It is an important application in the field of pattern recognition, machine learning and

  18. IMPROVEMENT IN HANDWRITTEN NUMERAL STRING RECOGNITION BY SLANT NORMALIZATION AND CONTEXTUAL INFORMATION

    NARCIS (Netherlands)

    Britto jr., A. de S.; Sabourin, R.; Lethelier, E.; Bortolozzi, F.; Suen, C.Y.

    2004-01-01

    This work describes a way of enhancing handwritten numeral string recognition by considering slant normalization and contextual information to train an implicit segmentation­based system. A word slant normalization method is modified in order to improve the results for handwritten numeral strings.

  19. Boosting bonsai trees for handwritten/printed text discrimination

    Science.gov (United States)

    Ricquebourg, Yann; Raymond, Christian; Poirriez, Baptiste; Lemaitre, Aurélie; Coüasnon, Bertrand

    2013-12-01

    Boosting over decision-stumps proved its efficiency in Natural Language Processing essentially with symbolic features, and its good properties (fast, few and not critical parameters, not sensitive to over-fitting) could be of great interest in the numeric world of pixel images. In this article we investigated the use of boosting over small decision trees, in image classification processing, for the discrimination of handwritten/printed text. Then, we conducted experiments to compare it to usual SVM-based classification revealing convincing results with very close performance, but with faster predictions and behaving far less as a black-box. Those promising results tend to make use of this classifier in more complex recognition tasks like multiclass problems.

  20. A Novel Handwritten Letter Recognizer Using Enhanced Evolutionary Neural Network

    Science.gov (United States)

    Mahmoudi, Fariborz; Mirzashaeri, Mohsen; Shahamatnia, Ehsan; Faridnia, Saed

    This paper introduces a novel design for handwritten letter recognition by employing a hybrid back-propagation neural network with an enhanced evolutionary algorithm. Feeding the neural network consists of a new approach which is invariant to translation, rotation, and scaling of input letters. Evolutionary algorithm is used for the global search of the search space and the back-propagation algorithm is used for the local search. The results have been computed by implementing this approach for recognizing 26 English capital letters in the handwritings of different people. The computational results show that the neural network reaches very satisfying results with relatively scarce input data and a promising performance improvement in convergence of the hybrid evolutionary back-propagation algorithms is exhibited.

  1. Ancient administrative handwritten documents: X-ray analysis and imaging

    International Nuclear Information System (INIS)

    Albertin, F.; Astolfo, A.; Stampanoni, M.; Peccenini, Eva; Hwu, Y.; Kaplan, F.; Margaritondo, G.

    2015-01-01

    The heavy-element content of ink in ancient administrative documents makes it possible to detect the characters with different synchrotron imaging techniques, based on attenuation or refraction. This is the first step in the direction of non-interactive virtual X-ray reading. Handwritten characters in administrative antique documents from three centuries have been detected using different synchrotron X-ray imaging techniques. Heavy elements in ancient inks, present even for everyday administrative manuscripts as shown by X-ray fluorescence spectra, produce attenuation contrast. In most cases the image quality is good enough for tomography reconstruction in view of future applications to virtual page-by-page ‘reading’. When attenuation is too low, differential phase contrast imaging can reveal the characters from refractive index effects. The results are potentially important for new information harvesting strategies, for example from the huge Archivio di Stato collection, objective of the Venice Time Machine project

  2. Ancient administrative handwritten documents: X-ray analysis and imaging

    Energy Technology Data Exchange (ETDEWEB)

    Albertin, F., E-mail: fauzia.albertin@epfl.ch [Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Astolfo, A. [Paul Scherrer Institut (PSI), Villigen (Switzerland); Stampanoni, M. [Paul Scherrer Institut (PSI), Villigen (Switzerland); ETHZ, Zürich (Switzerland); Peccenini, Eva [University of Ferrara (Italy); Technopole of Ferrara (Italy); Hwu, Y. [Academia Sinica, Taipei, Taiwan (China); Kaplan, F. [Ecole Polytechnique Fédérale de Lausanne (EPFL) (Switzerland); Margaritondo, G. [Ecole Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2015-01-30

    The heavy-element content of ink in ancient administrative documents makes it possible to detect the characters with different synchrotron imaging techniques, based on attenuation or refraction. This is the first step in the direction of non-interactive virtual X-ray reading. Handwritten characters in administrative antique documents from three centuries have been detected using different synchrotron X-ray imaging techniques. Heavy elements in ancient inks, present even for everyday administrative manuscripts as shown by X-ray fluorescence spectra, produce attenuation contrast. In most cases the image quality is good enough for tomography reconstruction in view of future applications to virtual page-by-page ‘reading’. When attenuation is too low, differential phase contrast imaging can reveal the characters from refractive index effects. The results are potentially important for new information harvesting strategies, for example from the huge Archivio di Stato collection, objective of the Venice Time Machine project.

  3. Transcription of Spanish Historical Handwritten Documents with Deep Neural Networks

    Directory of Open Access Journals (Sweden)

    Emilio Granell

    2018-01-01

    Full Text Available The digitization of historical handwritten document images is important for the preservation of cultural heritage. Moreover, the transcription of text images obtained from digitization is necessary to provide efficient information access to the content of these documents. Handwritten Text Recognition (HTR has become an important research topic in the areas of image and computational language processing that allows us to obtain transcriptions from text images. State-of-the-art HTR systems are, however, far from perfect. One difficulty is that they have to cope with image noise and handwriting variability. Another difficulty is the presence of a large amount of Out-Of-Vocabulary (OOV words in ancient historical texts. A solution to this problem is to use external lexical resources, but such resources might be scarce or unavailable given the nature and the age of such documents. This work proposes a solution to avoid this limitation. It consists of associating a powerful optical recognition system that will cope with image noise and variability, with a language model based on sub-lexical units that will model OOV words. Such a language modeling approach reduces the size of the lexicon while increasing the lexicon coverage. Experiments are first conducted on the publicly available Rodrigo dataset, which contains the digitization of an ancient Spanish manuscript, with a recognizer based on Hidden Markov Models (HMMs. They show that sub-lexical units outperform word units in terms of Word Error Rate (WER, Character Error Rate (CER and OOV word accuracy rate. This approach is then applied to deep net classifiers, namely Bi-directional Long-Short Term Memory (BLSTMs and Convolutional Recurrent Neural Nets (CRNNs. Results show that CRNNs outperform HMMs and BLSTMs, reaching the lowest WER and CER for this image dataset and significantly improving OOV recognition.

  4. A GRU-based Encoder-Decoder Approach with Attention for Online Handwritten Mathematical Expression Recognition

    OpenAIRE

    Zhang, Jianshu; Du, Jun; Dai, Lirong

    2017-01-01

    In this study, we present a novel end-to-end approach based on the encoder-decoder framework with the attention mechanism for online handwritten mathematical expression recognition (OHMER). First, the input two-dimensional ink trajectory information of handwritten expression is encoded via the gated recurrent unit based recurrent neural network (GRU-RNN). Then the decoder is also implemented by the GRU-RNN with a coverage-based attention model. The proposed approach can simultaneously accompl...

  5. On writing legibly: Processing fluency systematically biases evaluations of handwritten material

    OpenAIRE

    Greifeneder, Rainer; Alt, Alexander; Bottenberg, Konstantin; Seele, Tim; Zelt, Sarah; Wagener, Dietrich

    2010-01-01

    Evaluations of handwritten essays or exams are often suspected of being biased, such as by mood states or individual predilections. Although most of these influences are unsystematic, at least one bias is problematic because it systematically affects evaluations of handwritten materials. Three experiments revealed that essays in legible as compared to less legible handwriting were evaluated more positively. This robust finding was related to a basic judgmental mechanism that builds on the flu...

  6. Segmentation-Based And Segmentation-Free Methods for Spotting Handwritten Arabic Words

    OpenAIRE

    Ball , Gregory R.; Srihari , Sargur N.; Srinivasan , Harish

    2006-01-01

    http://www.suvisoft.com; Given a set of handwritten documents, a common goal is to search for a relevant subset. Attempting to find a query word or image in such a set of documents is called word spotting. Spotting handwritten words in documents written in the Latin alphabet, and more recently in Arabic, has received considerable attention. One issue is generating candidate word regions on a page. Attempting to definitely segment the document into such regions (automatic segmentation) can mee...

  7. ASM Based Synthesis of Handwritten Arabic Text Pages

    Directory of Open Access Journals (Sweden)

    Laslo Dinges

    2015-01-01

    Full Text Available Document analysis tasks, as text recognition, word spotting, or segmentation, are highly dependent on comprehensive and suitable databases for training and validation. However their generation is expensive in sense of labor and time. As a matter of fact, there is a lack of such databases, which complicates research and development. This is especially true for the case of Arabic handwriting recognition, that involves different preprocessing, segmentation, and recognition methods, which have individual demands on samples and ground truth. To bypass this problem, we present an efficient system that automatically turns Arabic Unicode text into synthetic images of handwritten documents and detailed ground truth. Active Shape Models (ASMs based on 28046 online samples were used for character synthesis and statistical properties were extracted from the IESK-arDB database to simulate baselines and word slant or skew. In the synthesis step ASM based representations are composed to words and text pages, smoothed by B-Spline interpolation and rendered considering writing speed and pen characteristics. Finally, we use the synthetic data to validate a segmentation method. An experimental comparison with the IESK-arDB database encourages to train and test document analysis related methods on synthetic samples, whenever no sufficient natural ground truthed data is available.

  8. ASM Based Synthesis of Handwritten Arabic Text Pages.

    Science.gov (United States)

    Dinges, Laslo; Al-Hamadi, Ayoub; Elzobi, Moftah; El-Etriby, Sherif; Ghoneim, Ahmed

    2015-01-01

    Document analysis tasks, as text recognition, word spotting, or segmentation, are highly dependent on comprehensive and suitable databases for training and validation. However their generation is expensive in sense of labor and time. As a matter of fact, there is a lack of such databases, which complicates research and development. This is especially true for the case of Arabic handwriting recognition, that involves different preprocessing, segmentation, and recognition methods, which have individual demands on samples and ground truth. To bypass this problem, we present an efficient system that automatically turns Arabic Unicode text into synthetic images of handwritten documents and detailed ground truth. Active Shape Models (ASMs) based on 28046 online samples were used for character synthesis and statistical properties were extracted from the IESK-arDB database to simulate baselines and word slant or skew. In the synthesis step ASM based representations are composed to words and text pages, smoothed by B-Spline interpolation and rendered considering writing speed and pen characteristics. Finally, we use the synthetic data to validate a segmentation method. An experimental comparison with the IESK-arDB database encourages to train and test document analysis related methods on synthetic samples, whenever no sufficient natural ground truthed data is available.

  9. Optical character recognition of handwritten Arabic using hidden Markov models

    Science.gov (United States)

    Aulama, Mohannad M.; Natsheh, Asem M.; Abandah, Gheith A.; Olama, Mohammed M.

    2011-04-01

    The problem of optical character recognition (OCR) of handwritten Arabic has not received a satisfactory solution yet. In this paper, an Arabic OCR algorithm is developed based on Hidden Markov Models (HMMs) combined with the Viterbi algorithm, which results in an improved and more robust recognition of characters at the sub-word level. Integrating the HMMs represents another step of the overall OCR trends being currently researched in the literature. The proposed approach exploits the structure of characters in the Arabic language in addition to their extracted features to achieve improved recognition rates. Useful statistical information of the Arabic language is initially extracted and then used to estimate the probabilistic parameters of the mathematical HMM. A new custom implementation of the HMM is developed in this study, where the transition matrix is built based on the collected large corpus, and the emission matrix is built based on the results obtained via the extracted character features. The recognition process is triggered using the Viterbi algorithm which employs the most probable sequence of sub-words. The model was implemented to recognize the sub-word unit of Arabic text raising the recognition rate from being linked to the worst recognition rate for any character to the overall structure of the Arabic language. Numerical results show that there is a potentially large recognition improvement by using the proposed algorithms.

  10. WATERSHED ALGORITHM BASED SEGMENTATION FOR HANDWRITTEN TEXT IDENTIFICATION

    Directory of Open Access Journals (Sweden)

    P. Mathivanan

    2014-02-01

    Full Text Available In this paper we develop a system for writer identification which involves four processing steps like preprocessing, segmentation, feature extraction and writer identification using neural network. In the preprocessing phase the handwritten text is subjected to slant removal process for segmentation and feature extraction. After this step the text image enters into the process of noise removal and gray level conversion. The preprocessed image is further segmented by using morphological watershed algorithm, where the text lines are segmented into single words and then into single letters. The segmented image is feature extracted by Daubechies’5/3 integer wavelet transform to reduce training complexity [1, 6]. This process is lossless and reversible [10], [14]. These extracted features are given as input to our neural network for writer identification process and a target image is selected for each training process in the 2-layer neural network. With the several trained output data obtained from different target help in text identification. It is a multilingual text analysis which provides simple and efficient text segmentation.

  11. Handwritten Javanese Character Recognition Using Several Artificial Neural Network Methods

    Directory of Open Access Journals (Sweden)

    Gregorius Satia Budhi

    2015-07-01

    Full Text Available Javanese characters are traditional characters that are used to write the Javanese language. The Javanese language is a language used by many people on the island of Java, Indonesia. The use of Javanese characters is diminishing more and more because of the difficulty of studying the Javanese characters themselves. The Javanese character set consists of basic characters, numbers, complementary characters, and so on. In this research we have developed a system to recognize Javanese characters. Input for the system is a digital image containing several handwritten Javanese characters. Preprocessing and segmentation are performed on the input image to get each character. For each character, feature extraction is done using the ICZ-ZCZ method. The output from feature extraction will become input for an artificial neural network. We used several artificial neural networks, namely a bidirectional associative memory network, a counterpropagation network, an evolutionary network, a backpropagation network, and a backpropagation network combined with chi2. From the experimental results it can be seen that the combination of chi2 and backpropagation achieved better recognition accuracy than the other methods.

  12. Signature Balancing

    NARCIS (Netherlands)

    Noordkamp, H.W.; Brink, M. van den

    2006-01-01

    Signatures are an important part of the design of a ship. In an ideal situation, signatures must be as low as possible. However, due to budget constraints it is most unlikely to reach this ideal situation. The arising question is which levels of signatures are optimal given the different scenarios

  13. Comparison of crisp and fuzzy character networks in handwritten word recognition

    Science.gov (United States)

    Gader, Paul; Mohamed, Magdi; Chiang, Jung-Hsien

    1992-01-01

    Experiments involving handwritten word recognition on words taken from images of handwritten address blocks from the United States Postal Service mailstream are described. The word recognition algorithm relies on the use of neural networks at the character level. The neural networks are trained using crisp and fuzzy desired outputs. The fuzzy outputs were defined using a fuzzy k-nearest neighbor algorithm. The crisp networks slightly outperformed the fuzzy networks at the character level but the fuzzy networks outperformed the crisp networks at the word level.

  14. Detection of Text Lines of Handwritten Arabic Manuscripts using Markov Decision Processes

    Directory of Open Access Journals (Sweden)

    Youssef Boulid

    2016-09-01

    Full Text Available In a character recognition systems, the segmentation phase is critical since the accuracy of the recognition depend strongly on it. In this paper we present an approach based on Markov Decision Processes to extract text lines from binary images of Arabic handwritten documents. The proposed approach detects the connected components belonging to the same line by making use of knowledge about features and arrangement of those components. The initial results show that the system is promising for extracting Arabic handwritten lines.

  15. Influence of the signer's psychophysiological state on the results of his identification using handwritten pattern by natural and artificial intelligence

    Directory of Open Access Journals (Sweden)

    Alexey E. Sulavko

    2017-11-01

    Full Text Available At present, while various mechanisms to ensure information security are actively being improved, particular attention is paid to prevent unauthorized access to information resources.  The human factor and process of identification still remain the most problematic, as well as user authentication. A progress in the technology of information resources protection from internal security threats paves its way towards biometric systems of hidden identification of computer users and their psychophysiological state. A change in psychophysiological state results in the person's handwriting. The influence of the signer’s state of fatigue and excitation on the results of its identification both by a person and by pattern recognition methods on reproduced signatures are studied. Capabilities of human and artificial intelligence are compared in equal conditions. When the state of the signer changes, the probability of erroneous recognition by artificial intelligence increases by factor 3.3 to 3.7. A person identifies a handwritten image with fewer errors in case when the signer is agitated, and with higher error rate if the signer is tired.

  16. Device of Definition of Hand-Written Documents Belonging to One Executor

    Directory of Open Access Journals (Sweden)

    S. D. Kulik

    2012-03-01

    Full Text Available Results of working out of the device of definition of hand-written documents belonging to the executor of the text in Russian are presented. The device is intended for automation of work of experts and allows to solve problems of information security and search of criminals.

  17. Students' Perceived Preference for Visual and Auditory Assessment with E-Handwritten Feedback

    Science.gov (United States)

    Crews, Tena B.; Wilkinson, Kelly

    2010-01-01

    Undergraduate business communication students were surveyed to determine their perceived most effective method of assessment on writing assignments. The results indicated students' preference for a process that incorporates visual, auditory, and e-handwritten presentation via a tablet PC. Students also identified this assessment process would…

  18. Comparing Postsecondary Marketing Student Performance on Computer-Based and Handwritten Essay Tests

    Science.gov (United States)

    Truell, Allen D.; Alexander, Melody W.; Davis, Rodney E.

    2004-01-01

    The purpose of this study was to determine if there were differences in postsecondary marketing student performance on essay tests based on test format (i.e., computer-based or handwritten). Specifically, the variables of performance, test completion time, and gender were explored for differences based on essay test format. Results of the study…

  19. An adaptive deep Q-learning strategy for handwritten digit recognition.

    Science.gov (United States)

    Qiao, Junfei; Wang, Gongming; Li, Wenjing; Chen, Min

    2018-02-22

    Handwritten digits recognition is a challenging problem in recent years. Although many deep learning-based classification algorithms are studied for handwritten digits recognition, the recognition accuracy and running time still need to be further improved. In this paper, an adaptive deep Q-learning strategy is proposed to improve accuracy and shorten running time for handwritten digit recognition. The adaptive deep Q-learning strategy combines the feature-extracting capability of deep learning and the decision-making of reinforcement learning to form an adaptive Q-learning deep belief network (Q-ADBN). First, Q-ADBN extracts the features of original images using an adaptive deep auto-encoder (ADAE), and the extracted features are considered as the current states of Q-learning algorithm. Second, Q-ADBN receives Q-function (reward signal) during recognition of the current states, and the final handwritten digits recognition is implemented by maximizing the Q-function using Q-learning algorithm. Finally, experimental results from the well-known MNIST dataset show that the proposed Q-ADBN has a superiority to other similar methods in terms of accuracy and running time. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Signature detection and matching for document image retrieval.

    Science.gov (United States)

    Zhu, Guangyu; Zheng, Yefeng; Doermann, David; Jaeger, Stefan

    2009-11-01

    As one of the most pervasive methods of individual identification and document authentication, signatures present convincing evidence and provide an important form of indexing for effective document image processing and retrieval in a broad range of applications. However, detection and segmentation of free-form objects such as signatures from clustered background is currently an open document analysis problem. In this paper, we focus on two fundamental problems in signature-based document image retrieval. First, we propose a novel multiscale approach to jointly detecting and segmenting signatures from document images. Rather than focusing on local features that typically have large variations, our approach captures the structural saliency using a signature production model and computes the dynamic curvature of 2D contour fragments over multiple scales. This detection framework is general and computationally tractable. Second, we treat the problem of signature retrieval in the unconstrained setting of translation, scale, and rotation invariant nonrigid shape matching. We propose two novel measures of shape dissimilarity based on anisotropic scaling and registration residual error and present a supervised learning framework for combining complementary shape information from different dissimilarity metrics using LDA. We quantitatively study state-of-the-art shape representations, shape matching algorithms, measures of dissimilarity, and the use of multiple instances as query in document image retrieval. We further demonstrate our matching techniques in offline signature verification. Extensive experiments using large real-world collections of English and Arabic machine-printed and handwritten documents demonstrate the excellent performance of our approaches.

  1. The Effects of Handwritten Feedback on Paper and Tablet PC in Learning Japanese Writing

    Directory of Open Access Journals (Sweden)

    Kai LI

    2007-12-01

    Full Text Available This paper compares the effect of paper-basedhandwritten feedback (PBHF and that of Tablet PC-basedhandwritten feedback (TBHF in learning Japanese writing.The study contributes to the research on motivation,usability and presence when learners are given differentmedia-based handwritten error feedback. The resultsindicated that there was little difference in the effect of thetwo media on motivation and usability factors. However,PBHF showed a positive effect on presence factor thanTBHF. Also, there was little difference in proficiencyimprovement after the students reviewed different mediabased handwritten feedback. The results of this studysuggest that language teachers should not use ICT withtraditional strategies, but in an innovative way to improvetheir writing instruction and enhance learners’ writingproficiency.

  2. Segmentation of Arabic Handwritten Documents into Text Lines using Watershed Transform

    Directory of Open Access Journals (Sweden)

    Abdelghani Souhar

    2017-12-01

    Full Text Available A crucial task in character recognition systems is the segmentation of the document into text lines and especially if it is handwritten. When dealing with non-Latin document such as Arabic, the challenge becomes greater since in addition to the variability of writing, the presence of diacritical points and the high number of ascender and descender characters complicates more the process of the segmentation. To remedy with this complexity and even to make this difficulty an advantage since the focus is on the Arabic language which is semi-cursive in nature, a method based on the Watershed Transform technique is proposed. Tested on «Handwritten Arabic Proximity Datasets» a segmentation rate of 93% for a 95% of matching score is achieved.

  3. Marker Registration Technique for Handwritten Text Marker in Augmented Reality Applications

    Science.gov (United States)

    Thanaborvornwiwat, N.; Patanukhom, K.

    2018-04-01

    Marker registration is a fundamental process to estimate camera poses in marker-based Augmented Reality (AR) systems. We developed AR system that creates correspondence virtual objects on handwritten text markers. This paper presents a new method for registration that is robust for low-content text markers, variation of camera poses, and variation of handwritten styles. The proposed method uses Maximally Stable Extremal Regions (MSER) and polygon simplification for a feature point extraction. The experiment shows that we need to extract only five feature points per image which can provide the best registration results. An exhaustive search is used to find the best matching pattern of the feature points in two images. We also compared performance of the proposed method to some existing registration methods and found that the proposed method can provide better accuracy and time efficiency.

  4. Recognition of Handwritten Arabic words using a neuro-fuzzy network

    International Nuclear Information System (INIS)

    Boukharouba, Abdelhak; Bennia, Abdelhak

    2008-01-01

    We present a new method for the recognition of handwritten Arabic words based on neuro-fuzzy hybrid network. As a first step, connected components (CCs) of black pixels are detected. Then the system determines which CCs are sub-words and which are stress marks. The stress marks are then isolated and identified separately and the sub-words are segmented into graphemes. Each grapheme is described by topological and statistical features. Fuzzy rules are extracted from training examples by a hybrid learning scheme comprised of two phases: rule generation phase from data using a fuzzy c-means, and rule parameter tuning phase using gradient descent learning. After learning, the network encodes in its topology the essential design parameters of a fuzzy inference system.The contribution of this technique is shown through the significant tests performed on a handwritten Arabic words database

  5. Handwritten dynamics assessment through convolutional neural networks: An application to Parkinson's disease identification.

    Science.gov (United States)

    Pereira, Clayton R; Pereira, Danilo R; Rosa, Gustavo H; Albuquerque, Victor H C; Weber, Silke A T; Hook, Christian; Papa, João P

    2018-04-16

    Parkinson's disease (PD) is considered a degenerative disorder that affects the motor system, which may cause tremors, micrography, and the freezing of gait. Although PD is related to the lack of dopamine, the triggering process of its development is not fully understood yet. In this work, we introduce convolutional neural networks to learn features from images produced by handwritten dynamics, which capture different information during the individual's assessment. Additionally, we make available a dataset composed of images and signal-based data to foster the research related to computer-aided PD diagnosis. The proposed approach was compared against raw data and texture-based descriptors, showing suitable results, mainly in the context of early stage detection, with results nearly to 95%. The analysis of handwritten dynamics using deep learning techniques showed to be useful for automatic Parkinson's disease identification, as well as it can outperform handcrafted features. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. BanglaLekha-Isolated: A multi-purpose comprehensive dataset of Handwritten Bangla Isolated characters

    Directory of Open Access Journals (Sweden)

    Mithun Biswas

    2017-06-01

    Full Text Available BanglaLekha-Isolated, a Bangla handwritten isolated character dataset is presented in this article. This dataset contains 84 different characters comprising of 50 Bangla basic characters, 10 Bangla numerals and 24 selected compound characters. 2000 handwriting samples for each of the 84 characters were collected, digitized and pre-processed. After discarding mistakes and scribbles, 1,66,105 handwritten character images were included in the final dataset. The dataset also includes labels indicating the age and the gender of the subjects from whom the samples were collected. This dataset could be used not only for optical handwriting recognition research but also to explore the influence of gender and age on handwriting. The dataset is publicly available at https://data.mendeley.com/datasets/hf6sf8zrkc/2.

  7. Handwritten Character Recognition Based on the Specificity and the Singularity of the Arabic Language

    Directory of Open Access Journals (Sweden)

    Youssef Boulid

    2017-08-01

    Full Text Available A good Arabic handwritten recognition system must consider the characteristics of Arabic letters which can be explicit such as the presence of diacritics or implicit such as the baseline information (a virtual line on which cursive text are aligned and/join. In order to find an adequate method of features extraction, we have taken into consideration the nature of the Arabic characters. The paper investigate two methods based on two different visions: one describes the image in terms of the distribution of pixels, and the other describes it in terms of local patterns. Spatial Distribution of Pixels (SDP is used according to the first vision; whereas Local Binary Patterns (LBP are used for the second one. Tested on the Arabic portion of the Isolated Farsi Handwritten Character Database (IFHCDB and using neural networks as a classifier, SDP achieve a recognition rate around 94% while LBP achieve a recognition rate of about 96%.

  8. Contribution to automatic handwritten characters recognition. Application to optical moving characters recognition

    International Nuclear Information System (INIS)

    Gokana, Denis

    1986-01-01

    This paper describes a research work on computer aided vision relating to the design of a vision system which can recognize isolated handwritten characters written on a mobile support. We use a technique which consists in analyzing information contained in the contours of the polygon circumscribed to the character's shape. These contours are segmented and labelled to give a new set of features constituted by: - right and left 'profiles', - topological and algebraic unvarying properties. A new method of character's recognition induced from this representation based on a multilevel hierarchical technique is then described. In the primary level, we use a fuzzy classification with dynamic programming technique using 'profiles'. The other levels adjust the recognition by using topological and algebraic unvarying properties. Several results are presented and an accuracy of 99 pc was reached for handwritten numeral characters, thereby attesting the robustness of our algorithm. (author) [fr

  9. A study of symbol segmentation method for handwritten mathematical formula recognition using mathematical structure information

    OpenAIRE

    Toyozumi, Kenichi; Yamada, Naoya; Kitasaka, Takayuki; Mori, Kensaku; Suenaga, Yasuhito; Mase, Kenji; Takahashi, Tomoichi

    2004-01-01

    Symbol segmentation is very important in handwritten mathematical formula recognition, since it is the very first portion of the recognition, since it is the very first portion of the recognition process. This paper proposes a new symbol segmentation method using mathematical structure information. The base technique of symbol segmentation employed in theexisting methods is dynamic programming which optimizes the overall results of individual symbol recognition. The new method we propose here...

  10. HWNet v2: An Efficient Word Image Representation for Handwritten Documents

    OpenAIRE

    Krishnan, Praveen; Jawahar, C. V.

    2018-01-01

    We present a framework for learning efficient holistic representation for handwritten word images. The proposed method uses a deep convolutional neural network with traditional classification loss. The major strengths of our work lie in: (i) the efficient usage of synthetic data to pre-train a deep network, (ii) an adapted version of ResNet-34 architecture with region of interest pooling (referred as HWNet v2) which learns discriminative features with variable sized word images, and (iii) rea...

  11. Spotting handwritten words and REGEX using a two stage BLSTM-HMM architecture

    Science.gov (United States)

    Bideault, Gautier; Mioulet, Luc; Chatelain, Clément; Paquet, Thierry

    2015-01-01

    In this article, we propose a hybrid model for spotting words and regular expressions (REGEX) in handwritten documents. The model is made of the state-of-the-art BLSTM (Bidirectional Long Short Time Memory) neural network for recognizing and segmenting characters, coupled with a HMM to build line models able to spot the desired sequences. Experiments on the Rimes database show very promising results.

  12. Development of an optical character recognition pipeline for handwritten form fields from an electronic health record.

    Science.gov (United States)

    Rasmussen, Luke V; Peissig, Peggy L; McCarty, Catherine A; Starren, Justin

    2012-06-01

    Although the penetration of electronic health records is increasing rapidly, much of the historical medical record is only available in handwritten notes and forms, which require labor-intensive, human chart abstraction for some clinical research. The few previous studies on automated extraction of data from these handwritten notes have focused on monolithic, custom-developed recognition systems or third-party systems that require proprietary forms. We present an optical character recognition processing pipeline, which leverages the capabilities of existing third-party optical character recognition engines, and provides the flexibility offered by a modular custom-developed system. The system was configured and run on a selected set of form fields extracted from a corpus of handwritten ophthalmology forms. The processing pipeline allowed multiple configurations to be run, with the optimal configuration consisting of the Nuance and LEADTOOLS engines running in parallel with a positive predictive value of 94.6% and a sensitivity of 13.5%. While limitations exist, preliminary experience from this project yielded insights on the generalizability and applicability of integrating multiple, inexpensive general-purpose third-party optical character recognition engines in a modular pipeline.

  13. Radiation signatures

    International Nuclear Information System (INIS)

    McGlynn, S.P.; Varma, M.N.

    1992-01-01

    A new concept for modelling radiation risk is proposed. This concept is based on the proposal that the spectrum of molecular lesions, which we dub ''the radiation signature'', can be used to identify the quality of the causal radiation. If the proposal concerning radiation signatures can be established then, in principle, both prospective and retrospective risk determination can be assessed on an individual basis. A major goal of biophysical modelling is to relate physical events such as ionization, excitation, etc. to the production of radiation carcinogenesis. A description of the physical events is provided by track structure. The track structure is determined by radiation quality, and it can be considered to be the ''physical signature'' of the radiation. Unfortunately, the uniqueness characteristics of this signature are dissipated in biological systems in ∼10 -9 s. Nonetheless, it is our contention that this physical disturbance of the biological system eventuates later, at ∼10 0 s, in molecular lesion spectra which also characterize the causal radiation. (author)

  14. Did an extensive forest ever develop on the Chinese Loess Plateau during the past 130 ka?: a test using soil carbon isotopic signatures

    International Nuclear Information System (INIS)

    Liu Weiguo; Yang Hong; Cao Yunning; Ning Youfeng; Li Li; Zhou Jie; An Zhisheng

    2005-01-01

    Pleistocene vegetation history on the Chinese Loess Plateau has been traditionally investigated using palynological methods, and questions remain regarding whether an extensive broadleaf deciduous forest ever developed on the loess table under favorable climatic conditions. The authors have employed a C isotope approach to address this question by comparing δ 13 C values in soil organic matter from different loess ecological domains with known source vegetation to the C isotope values obtained from a paleosol section that can be dated back to 130 ka. The C isotopic compositions of modern soils from the loess table and the loess-desert transition gave δ 13 C values of -24.5 per mille to -18.2 per mille and -25.7 per mille to -20.7 per mille, respectively. These C isotopic ratios are consistent with the standing modern vegetation that is dominated by a mixture of C 3 and C 4 plants and can be distinguished from that in the patchy forest areas where exclusive C 3 trees yield a narrow δ 13 C value range from -26.9 per mille to -25 per mille (average -26.1 per mille). Obtained δ 13 C compositions from paleosols and loess sediments in the Lantian and the Luochuan profiles vary from -24 per mille to -16.9 per mille, indicating a grass-dominated steppe with shifting C 3 and C 4 contributions controlled mainly by paleoclimatic changes during the late Pleistocene. The present results suggest no extensive forest coverage on the loess table during the past 130 ka even under the most suitable conditions for forest development. This conclusion supports the explanation of natural causes for the development of only patchy forests on the modern loess table and provides critical historical information toward the vegetation restoration project that is currently underway on the Chinese Loess Plateau

  15. A New Approach for High Pressure Pixel Polar Distribution on Off-line Signature Verification

    Directory of Open Access Journals (Sweden)

    Jesús F. Vargas

    2010-06-01

    Full Text Available Features representing information of High Pressure Points froma static image of a handwritten signature are analyzed for an offline verification system. From grayscale images, a new approach for High Pressure threshold estimation is proposed. Two images, one containingthe High Pressure Points extracted and other with a binary version ofthe original signature, are transformed to polar coordinates where a pixel density ratio between them is calculated. Polar space had been divided into angular and radial segments, which permit a local analysis of the high pressure distribution. Finally two vectors containing the density distribution ratio are calculated for nearest and farthest points from geometric center of the original signature image. Experiments were carried out using a database containing signature from 160 individual. The robustness of the analyzed system for simple forgeries is tested out with Support Vector Machines models. For the sake of completeness, a comparison of the results obtained by the proposed approach with similar works published is presented.

  16. A Novel Data Encryption Technique by Genetic Crossover of Robust Finger Print Based Key and Handwritten Signature Key

    OpenAIRE

    Tanmay Bhattacharya; Sirshendu Hore; S. R. Bhadra Chaudhuri

    2011-01-01

    Unimodal biometric systems have to contend with a variety of problems such as noisy data, intra-class variations, restricted degrees of freedom, non-universality; phishing attacks spoof attacks, and high false acceptance rates. In order for the biometrics to be ultra-secure and to provide more-than-average accuracy, more then one form of biometric identification is required. Hence some of these limitations can be addressed by a combination of different biometric recognition technologies that ...

  17. The Comparison of Typed and Handwritten Essays of Iranian EFL Students in terms of Length, Spelling, and Grammar

    Directory of Open Access Journals (Sweden)

    Behrouz Sarbakhshian

    2016-11-01

    Full Text Available This study attempted to compare typed and handwritten essays of Iranian EFL students in terms of length, spelling, and grammar. To administer the study, the researchers utilized Alice Touch Typing Tutor software to select 15 upper intermediate students with higher ability to write two essays: one typed and the other handwritten. The students were both males and females between the ages of 22 to 35. The analyses of the students’ scores in the three mentioned criteria through three paired samples t-tests indicate that typed essays are significantly better than handwritten ones in terms of length of texts and grammatical mistakes, but not significantly different in spelling mistakes. Positive effects of typing can provide a logical reason for students, especially TOEFL applicants, to spend more time on acquiring typing skill and also for teachers to encourage their students with higher typing ability to choose typed format in their essays.

  18. Structural analysis of online handwritten mathematical symbols based on support vector machines

    Science.gov (United States)

    Simistira, Foteini; Papavassiliou, Vassilis; Katsouros, Vassilis; Carayannis, George

    2013-01-01

    Mathematical expression recognition is still a very challenging task for the research community mainly because of the two-dimensional (2d) structure of mathematical expressions (MEs). In this paper, we present a novel approach for the structural analysis between two on-line handwritten mathematical symbols of a ME, based on spatial features of the symbols. We introduce six features to represent the spatial affinity of the symbols and compare two multi-class classification methods that employ support vector machines (SVMs): one based on the "one-against-one" technique and one based on the "one-against-all", in identifying the relation between a pair of symbols (i.e. subscript, numerator, etc). A dataset containing 1906 spatial relations derived from the Competition on Recognition of Online Handwritten Mathematical Expressions (CROHME) 2012 training dataset is constructed to evaluate the classifiers and compare them with the rule-based classifier of the ILSP-1 system participated in the contest. The experimental results give an overall mean error rate of 2.61% for the "one-against-one" SVM approach, 6.57% for the "one-against-all" SVM technique and 12.31% error rate for the ILSP-1 classifier.

  19. Evaluating structural pattern recognition for handwritten math via primitive label graphs

    Science.gov (United States)

    Zanibbi, Richard; Mouchère, Harold; Viard-Gaudin, Christian

    2013-01-01

    Currently, structural pattern recognizer evaluations compare graphs of detected structure to target structures (i.e. ground truth) using recognition rates, recall and precision for object segmentation, classification and relationships. In document recognition, these target objects (e.g. symbols) are frequently comprised of multiple primitives (e.g. connected components, or strokes for online handwritten data), but current metrics do not characterize errors at the primitive level, from which object-level structure is obtained. Primitive label graphs are directed graphs defined over primitives and primitive pairs. We define new metrics obtained by Hamming distances over label graphs, which allow classification, segmentation and parsing errors to be characterized separately, or using a single measure. Recall and precision for detected objects may also be computed directly from label graphs. We illustrate the new metrics by comparing a new primitive-level evaluation to the symbol-level evaluation performed for the CROHME 2012 handwritten math recognition competition. A Python-based set of utilities for evaluating, visualizing and translating label graphs is publicly available.

  20. Corticospinal excitability during the processing of handwritten and typed words and non-words.

    Science.gov (United States)

    Gordon, Chelsea L; Spivey, Michael J; Balasubramaniam, Ramesh

    2017-06-09

    A number of studies have suggested that perception of actions is accompanied by motor simulation of those actions. To further explore this proposal, we applied Transcranial magnetic stimulation (TMS) to the left primary motor cortex during the observation of handwritten and typed language stimuli, including words and non-word consonant clusters. We recorded motor-evoked potentials (MEPs) from the right first dorsal interosseous (FDI) muscle to measure cortico-spinal excitability during written text perception. We observed a facilitation in MEPs for handwritten stimuli, regardless of whether the stimuli were words or non-words, suggesting potential motor simulation during observation. We did not observe a similar facilitation for the typed stimuli, suggesting that motor simulation was not occurring during observation of typed text. By demonstrating potential simulation of written language text during observation, these findings add to a growing literature suggesting that the motor system plays a strong role in the perception of written language. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Quantum Digital Signatures for Unconditional Safe Authenticity Protection of Medical Documentation

    Directory of Open Access Journals (Sweden)

    Arkadiusz Liber

    2015-12-01

    Full Text Available Modern medical documentation appears most often in an online form which requires some digital methods to ensure its confidentiality, integrity and authenticity. The document authenticity may be secured with the use of a signature. A classical handwritten signature is directly related to its owner by his/her psychomotor character traits. Such a signature is also connected with the material it is written on, and a writing tool. Because of these properties, a handwritten signature reflects certain close material bonds between the owner and the document. In case of modern digital signatures, the document authentication has a mathematical nature. The verification of the authenticity becomes the verification of a key instead of a human. Since 1994 it has been known that classical digital signature algorithms may not be safe because of the Shor’s factorization algorithm. To implement the modern authenticity protection of medical data, some new types of algorithms should be used. One of the groups of such algorithms is based on the quantum computations. In this paper, the analysis of the current knowledge status of Quantum Digital Signature protocols, with its basic principles, phases and common elements such as transmission, comparison and encryption, was outlined. Some of the most promising protocols for signing digital medical documentation, that fulfill the requirements for QDS, were also briefly described. We showed that, a QDS protocol with QKD components requires the equipment similar to the equipment used for a QKD, for its implementation, which is already commercially available. If it is properly implemented, it provides the shortest lifetime of qubits in comparison to other protocols. It can be used not only to sign classical messages but probably it could be well adopted to implement unconditionally safe protection of medical documentation in the nearest future, as well.

  2. Hardware Acceleration on Cloud Services: The use of Restricted Boltzmann Machines on Handwritten Digits Recognition

    Directory of Open Access Journals (Sweden)

    Eleni Bougioukou

    2018-02-01

    Full Text Available Cloud computing allows users and enterprises to process their data in high performance servers, thus reducing the need for advanced hardware at the client side. Although local processing is viable in many cases, collecting data from multiple clients and processing them in a server gives the best possible performance in terms of processing rate. In this work, the implementation of a high performance cloud computing engine for recognizing handwritten digits is presented. The engine exploits the benefits of cloud and uses a powerful hardware accelerator in order to classify the images received concurrently from multiple clients. The accelerator implements a number of neural networks, operating in parallel, resulting to a processing rate of more than 10 MImages/sec.

  3. A comparison of 1D and 2D LSTM architectures for the recognition of handwritten Arabic

    Science.gov (United States)

    Yousefi, Mohammad Reza; Soheili, Mohammad Reza; Breuel, Thomas M.; Stricker, Didier

    2015-01-01

    In this paper, we present an Arabic handwriting recognition method based on recurrent neural network. We use the Long Short Term Memory (LSTM) architecture, that have proven successful in different printed and handwritten OCR tasks. Applications of LSTM for handwriting recognition employ the two-dimensional architecture to deal with the variations in both vertical and horizontal axis. However, we show that using a simple pre-processing step that normalizes the position and baseline of letters, we can make use of 1D LSTM, which is faster in learning and convergence, and yet achieve superior performance. In a series of experiments on IFN/ENIT database for Arabic handwriting recognition, we demonstrate that our proposed pipeline can outperform 2D LSTM networks. Furthermore, we provide comparisons with 1D LSTM networks trained with manually crafted features to show that the automatically learned features in a globally trained 1D LSTM network with our normalization step can even outperform such systems.

  4. Comparative implementation of Handwritten and Machine written Gurmukhi text utilizing appropriate parameters

    Science.gov (United States)

    Kaur, Jaswinder; Jagdev, Gagandeep, Dr.

    2018-01-01

    Optical character recognition is concerned with the recognition of optically processed characters. The recognition is done offline after the writing or printing has been completed, unlike online recognition where the computer has to recognize the characters instantly as they are drawn. The performance of character recognition depends upon the quality of scanned documents. The preprocessing steps are used for removing low-frequency background noise and normalizing the intensity of individual scanned documents. Several filters are used for reducing certain image details and enabling an easier or faster evaluation. The primary aim of the research work is to recognize handwritten and machine written characters and differentiate them. The language opted for the research work is Punjabi Gurmukhi and tool utilized is Matlab.

  5. Handwritten Devanagari Character Recognition Using Layer-Wise Training of Deep Convolutional Neural Networks and Adaptive Gradient Methods

    Directory of Open Access Journals (Sweden)

    Mahesh Jangid

    2018-02-01

    Full Text Available Handwritten character recognition is currently getting the attention of researchers because of possible applications in assisting technology for blind and visually impaired users, human–robot interaction, automatic data entry for business documents, etc. In this work, we propose a technique to recognize handwritten Devanagari characters using deep convolutional neural networks (DCNN which are one of the recent techniques adopted from the deep learning community. We experimented the ISIDCHAR database provided by (Information Sharing Index ISI, Kolkata and V2DMDCHAR database with six different architectures of DCNN to evaluate the performance and also investigate the use of six recently developed adaptive gradient methods. A layer-wise technique of DCNN has been employed that helped to achieve the highest recognition accuracy and also get a faster convergence rate. The results of layer-wise-trained DCNN are favorable in comparison with those achieved by a shallow technique of handcrafted features and standard DCNN.

  6. A Record Book of Open Heart Surgical Cases between 1959 and 1982, Hand-Written by a Cardiac Surgeon.

    Science.gov (United States)

    Kim, Won-Gon

    2016-08-01

    A book of brief records of open heart surgery underwent between 1959 and 1982 at Seoul National University Hospital was recently found. The book was hand-written by the late professor and cardiac surgeon Yung Kyoon Lee (1921-1994). This book contains valuable information about cardiac patients and surgery at the early stages of the establishment of open heart surgery in Korea, and at Seoul National University Hospital. This report is intended to analyze the content of the book.

  7. A comparative study of different feature sets for recognition of handwritten Arabic numerals using a Multi Layer Perceptron

    OpenAIRE

    Das, Nibaran; Mollah, Ayatullah Faruk; Sarkar, Ram; Basu, Subhadip

    2010-01-01

    The work presents a comparative assessment of seven different feature sets for recognition of handwritten Arabic numerals using a Multi Layer Perceptron (MLP) based classifier. The seven feature sets employed here consist of shadow features, octant centroids, longest runs, angular distances, effective spans, dynamic centers of gravity, and some of their combinations. On experimentation with a database of 3000 samples, the maximum recognition rate of 95.80% is observed with both of two separat...

  8. HMM-based lexicon-driven and lexicon-free word recognition for online handwritten Indic scripts.

    Science.gov (United States)

    Bharath, A; Madhvanath, Sriganesh

    2012-04-01

    Research for recognizing online handwritten words in Indic scripts is at its early stages when compared to Latin and Oriental scripts. In this paper, we address this problem specifically for two major Indic scripts--Devanagari and Tamil. In contrast to previous approaches, the techniques we propose are largely data driven and script independent. We propose two different techniques for word recognition based on Hidden Markov Models (HMM): lexicon driven and lexicon free. The lexicon-driven technique models each word in the lexicon as a sequence of symbol HMMs according to a standard symbol writing order derived from the phonetic representation. The lexicon-free technique uses a novel Bag-of-Symbols representation of the handwritten word that is independent of symbol order and allows rapid pruning of the lexicon. On handwritten Devanagari word samples featuring both standard and nonstandard symbol writing orders, a combination of lexicon-driven and lexicon-free recognizers significantly outperforms either of them used in isolation. In contrast, most Tamil word samples feature the standard symbol order, and the lexicon-driven recognizer outperforms the lexicon free one as well as their combination. The best recognition accuracies obtained for 20,000 word lexicons are 87.13 percent for Devanagari when the two recognizers are combined, and 91.8 percent for Tamil using the lexicon-driven technique.

  9. Drawing and Recognizing Chinese Characters with Recurrent Neural Network.

    Science.gov (United States)

    Zhang, Xu-Yao; Yin, Fei; Zhang, Yan-Ming; Liu, Cheng-Lin; Bengio, Yoshua

    2018-04-01

    Recent deep learning based approaches have achieved great success on handwriting recognition. Chinese characters are among the most widely adopted writing systems in the world. Previous research has mainly focused on recognizing handwritten Chinese characters. However, recognition is only one aspect for understanding a language, another challenging and interesting task is to teach a machine to automatically write (pictographic) Chinese characters. In this paper, we propose a framework by using the recurrent neural network (RNN) as both a discriminative model for recognizing Chinese characters and a generative model for drawing (generating) Chinese characters. To recognize Chinese characters, previous methods usually adopt the convolutional neural network (CNN) models which require transforming the online handwriting trajectory into image-like representations. Instead, our RNN based approach is an end-to-end system which directly deals with the sequential structure and does not require any domain-specific knowledge. With the RNN system (combining an LSTM and GRU), state-of-the-art performance can be achieved on the ICDAR-2013 competition database. Furthermore, under the RNN framework, a conditional generative model with character embedding is proposed for automatically drawing recognizable Chinese characters. The generated characters (in vector format) are human-readable and also can be recognized by the discriminative RNN model with high accuracy. Experimental results verify the effectiveness of using RNNs as both generative and discriminative models for the tasks of drawing and recognizing Chinese characters.

  10. Electronic Signature Policy

    Science.gov (United States)

    Establishes the United States Environmental Protection Agency's approach to adopting electronic signature technology and best practices to ensure electronic signatures applied to official Agency documents are legally valid and enforceable

  11. Lesson 6: Signature Validation

    Science.gov (United States)

    Checklist items 13 through 17 are grouped under the Signature Validation Process, and represent CROMERR requirements that the system must satisfy as part of ensuring that electronic signatures it receives are valid.

  12. Exotic signatures from supersymmetry

    International Nuclear Information System (INIS)

    Hall, L.J.

    1989-08-01

    Minor changes to the standard supersymmetric model, such as soft flavor violation and R parity violation, cause large changes in the signatures. The origin of these changes and the resulting signatures are discussed. 15 refs., 7 figs., 2 tabs

  13. Spiking neural networks for handwritten digit recognition-Supervised learning and network optimization.

    Science.gov (United States)

    Kulkarni, Shruti R; Rajendran, Bipin

    2018-07-01

    We demonstrate supervised learning in Spiking Neural Networks (SNNs) for the problem of handwritten digit recognition using the spike triggered Normalized Approximate Descent (NormAD) algorithm. Our network that employs neurons operating at sparse biological spike rates below 300Hz achieves a classification accuracy of 98.17% on the MNIST test database with four times fewer parameters compared to the state-of-the-art. We present several insights from extensive numerical experiments regarding optimization of learning parameters and network configuration to improve its accuracy. We also describe a number of strategies to optimize the SNN for implementation in memory and energy constrained hardware, including approximations in computing the neuronal dynamics and reduced precision in storing the synaptic weights. Experiments reveal that even with 3-bit synaptic weights, the classification accuracy of the designed SNN does not degrade beyond 1% as compared to the floating-point baseline. Further, the proposed SNN, which is trained based on the precise spike timing information outperforms an equivalent non-spiking artificial neural network (ANN) trained using back propagation, especially at low bit precision. Thus, our study shows the potential for realizing efficient neuromorphic systems that use spike based information encoding and learning for real-world applications. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Blinding for unanticipated signatures

    NARCIS (Netherlands)

    D. Chaum (David)

    1987-01-01

    textabstractPreviously known blind signature systems require an amount of computation at least proportional to the number of signature types, and also that the number of such types be fixed in advance. These requirements are not practical in some applications. Here, a new blind signature technique

  15. Fair quantum blind signatures

    International Nuclear Information System (INIS)

    Tian-Yin, Wang; Qiao-Yan, Wen

    2010-01-01

    We present a new fair blind signature scheme based on the fundamental properties of quantum mechanics. In addition, we analyse the security of this scheme, and show that it is not possible to forge valid blind signatures. Moreover, comparisons between this scheme and public key blind signature schemes are also discussed. (general)

  16. Real Traceable Signatures

    Science.gov (United States)

    Chow, Sherman S. M.

    Traceable signature scheme extends a group signature scheme with an enhanced anonymity management mechanism. The group manager can compute a tracing trapdoor which enables anyone to test if a signature is signed by a given misbehaving user, while the only way to do so for group signatures requires revealing the signer of all signatures. Nevertheless, it is not tracing in a strict sense. For all existing schemes, T tracing agents need to recollect all N' signatures ever produced and perform RN' “checks” for R revoked users. This involves a high volume of transfer and computations. Increasing T increases the degree of parallelism for tracing but also the probability of “missing” some signatures in case some of the agents are dishonest.

  17. Unconditionally Secure Quantum Signatures

    Directory of Open Access Journals (Sweden)

    Ryan Amiri

    2015-08-01

    Full Text Available Signature schemes, proposed in 1976 by Diffie and Hellman, have become ubiquitous across modern communications. They allow for the exchange of messages from one sender to multiple recipients, with the guarantees that messages cannot be forged or tampered with and that messages also can be forwarded from one recipient to another without compromising their validity. Signatures are different from, but no less important than encryption, which ensures the privacy of a message. Commonly used signature protocols—signatures based on the Rivest–Adleman–Shamir (RSA algorithm, the digital signature algorithm (DSA, and the elliptic curve digital signature algorithm (ECDSA—are only computationally secure, similar to public key encryption methods. In fact, since these rely on the difficulty of finding discrete logarithms or factoring large primes, it is known that they will become completely insecure with the emergence of quantum computers. We may therefore see a shift towards signature protocols that will remain secure even in a post-quantum world. Ideally, such schemes would provide unconditional or information-theoretic security. In this paper, we aim to provide an accessible and comprehensive review of existing unconditionally securesecure signature schemes for signing classical messages, with a focus on unconditionally secure quantum signature schemes.

  18. Radar Signature Calculation Facility

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: The calculation, analysis, and visualization of the spatially extended radar signatures of complex objects such as ships in a sea multipath environment and...

  19. New Approach of Feature Extraction Method Based on the Raw Form and his Skeleton for Gujarati Handwritten Digits using Neural Networks Classifier

    Directory of Open Access Journals (Sweden)

    K. Moro

    2014-12-01

    Full Text Available This paper presents an optical character recognition (OCR system for Gujarati handwritten digits. One may find so much of work for latin writing, arabic, chines, etc. but Gujarati is a language for which hardly any work is traceable especially for handwritten characters. Here in this work we have proposed a method of feature extraction based on the raw form of the character and his skeleton and we have shown the advantage of using this method over other approaches mentioned in this article.

  20. Threshold Signature Schemes Application

    Directory of Open Access Journals (Sweden)

    Anastasiya Victorovna Beresneva

    2015-10-01

    Full Text Available This work is devoted to an investigation of threshold signature schemes. The systematization of the threshold signature schemes was done, cryptographic constructions based on interpolation Lagrange polynomial, elliptic curves and bilinear pairings were examined. Different methods of generation and verification of threshold signatures were explored, the availability of practical usage of threshold schemes in mobile agents, Internet banking and e-currency was shown. The topics of further investigation were given and it could reduce a level of counterfeit electronic documents signed by a group of users.

  1. Advanced Missile Signature Center

    Data.gov (United States)

    Federal Laboratory Consortium — The Advanced Missile Signature Center (AMSC) is a national facility supporting the Missile Defense Agency (MDA) and other DoD programs and customers with analysis,...

  2. THE ELECTRONIC SIGNATURE

    Directory of Open Access Journals (Sweden)

    Voiculescu Madalina Irena

    2009-05-01

    Full Text Available Article refers to significance and the digital signature in electronic commerce. Internet and electronic commerce open up many new opportunities for the consumer, yet, the security (or perceived lack of security of exchanging personal and financial data

  3. Digital signature feasibility study

    Science.gov (United States)

    2008-06-01

    The purpose of this study was to assess the advantages and disadvantages of using digital signatures to assist the Arizona Department of Transportation in conducting business. The Department is evaluating the potential of performing more electronic t...

  4. Physics Signatures at CLIC

    CERN Document Server

    Battaglia, Marco

    2001-01-01

    A set of signatures for physics processes of potential interests for the CLIC programme at = 1 - 5 TeV are discussed. These signatures, that may correspond to the manifestation of different scenarios of new physics as well as to Standard Model precision tests, are proposed as benchmarks for the optimisation of the CLIC accelerator parameters and for a first definition of the required detector response.

  5. Molecular Signatures in the Prevention of Radiation Damage by the Synergistic Effect of N-Acetyl Cysteine and Qingre Liyan Decoction, a Traditional Chinese Medicine, Using a 3-Dimensional Cell Culture Model of Oral Mucositis

    Directory of Open Access Journals (Sweden)

    Maria P. Lambros

    2015-01-01

    Full Text Available Qingre Liyan decoction (QYD, a Traditional Chinese medicine, and N-acetyl cysteine (NAC have been used to prevent radiation induced mucositis. This work evaluates the protective mechanisms of QYD, NAC, and their combination (NAC-QYD at the cellular and transcriptional level. A validated organotypic model of oral mucosal consisting of a three-dimensional (3D cell tissue-culture of primary human keratinocytes exposed to X-ray irradiation was used. Six hours after the irradiation, the tissues were evaluated by hematoxylin and eosin (H and E and a TUNEL assay to assess histopathology and apoptosis, respectively. Total RNA was extracted and used for microarray gene expression profiling. The tissue-cultures treated with NAC-QYD preserved their integrity and showed no apoptosis. Microarray results revealed that the NAC-QYD caused the upregulation of genes encoding metallothioneins, HMOX1, and other components of the Nrf2 pathway, which protects against oxidative stress. DNA repair genes (XCP, GADD45G, RAD9, and XRCC1, protective genes (EGFR and PPARD, and genes of the NFκB pathway were upregulated. Finally, tissue-cultures treated prophylactically with NAC-QYD showed significant downregulation of apoptosis, cytokines and chemokines genes, and constrained damage-associated molecular patterns (DAMPs. NAC-QYD treatment involves the protective effect of Nrf2, NFκB, and DNA repair factors.

  6. Uncertainty in hydrological signatures

    Science.gov (United States)

    McMillan, Hilary; Westerberg, Ida

    2015-04-01

    Information that summarises the hydrological behaviour or flow regime of a catchment is essential for comparing responses of different catchments to understand catchment organisation and similarity, and for many other modelling and water-management applications. Such information types derived as an index value from observed data are known as hydrological signatures, and can include descriptors of high flows (e.g. mean annual flood), low flows (e.g. mean annual low flow, recession shape), the flow variability, flow duration curve, and runoff ratio. Because the hydrological signatures are calculated from observed data such as rainfall and flow records, they are affected by uncertainty in those data. Subjective choices in the method used to calculate the signatures create a further source of uncertainty. Uncertainties in the signatures may affect our ability to compare different locations, to detect changes, or to compare future water resource management scenarios. The aim of this study was to contribute to the hydrological community's awareness and knowledge of data uncertainty in hydrological signatures, including typical sources, magnitude and methods for its assessment. We proposed a generally applicable method to calculate these uncertainties based on Monte Carlo sampling and demonstrated it for a variety of commonly used signatures. The study was made for two data rich catchments, the 50 km2 Mahurangi catchment in New Zealand and the 135 km2 Brue catchment in the UK. For rainfall data the uncertainty sources included point measurement uncertainty, the number of gauges used in calculation of the catchment spatial average, and uncertainties relating to lack of quality control. For flow data the uncertainty sources included uncertainties in stage/discharge measurement and in the approximation of the true stage-discharge relation by a rating curve. The resulting uncertainties were compared across the different signatures and catchments, to quantify uncertainty

  7. Practical quantum digital signature

    Science.gov (United States)

    Yin, Hua-Lei; Fu, Yao; Chen, Zeng-Bing

    2016-03-01

    Guaranteeing nonrepudiation, unforgeability as well as transferability of a signature is one of the most vital safeguards in today's e-commerce era. Based on fundamental laws of quantum physics, quantum digital signature (QDS) aims to provide information-theoretic security for this cryptographic task. However, up to date, the previously proposed QDS protocols are impractical due to various challenging problems and most importantly, the requirement of authenticated (secure) quantum channels between participants. Here, we present the first quantum digital signature protocol that removes the assumption of authenticated quantum channels while remaining secure against the collective attacks. Besides, our QDS protocol can be practically implemented over more than 100 km under current mature technology as used in quantum key distribution.

  8. Signatures of the Invisible

    CERN Multimedia

    Strom, D

    2003-01-01

    On the Net it is possible to take a look at art from afar via Virtual Museums. One such exhibition was recently in the New York Museum of Modern Art's branch, PS1. Entitled 'Signatures of the Invisible' it was a collaborative effort between artists and physicists (1/2 page).

  9. Construction of Graduation Certificate Issuing System Based on Digital Signature Technique

    Directory of Open Access Journals (Sweden)

    Mohammed Issam Younis

    2015-06-01

    Full Text Available With the development of computer architecture and its technologies in recent years, applications like e-commerce, e-government, e-governance and e-finance are widely used, and they act as active research areas. In addition, in order to increase the quality and quantity of the ordinary everyday transactions, it is desired to migrate from the paper-based environment to a digital-based computerized environment. Such migration increases efficiency, saves time, eliminates paperwork, increases safety and reduces the cost in an organization. Digital signatures are playing an essential role in many electronic and automatic based systems and facilitate this migration. The digital signatures are used to provide many services and solutions that would not have been possible by the conventional hand-written signature. In the educational environment, the process of issuing the graduation certificates can no longer be restricted to the traditional methods. Hence, a computerized system for issuing certificates of graduation in an electronic form is needed and desired. This paper proposes a Graduation Certificates Issuing System (GCIS based on digital signature technology. In doing so, this research highlights the state-of-the-art and the art-of-the-practice for some existing digital signature-based systems in the literatures. In addition, eight intertwined elected services are identified, namely: message authentication, entity authentication, integrity, non-repudiation, time stamping, distinguished signing authorities, delegating signing capability and supporting workflow systems. Moreover, this research examines nine existing systems, showing their merits and demerits in terms of these elected services. Furthermore, the research describes the architectural design using the Unified Modeling Language (UML and provides the concrete implementation of the proposed GCIS. The GCIS is implemented using Visual Basic.Net programming language and SQL Server database

  10. A Directed Signature Scheme and its Applications

    OpenAIRE

    Lal, Sunder; Kumar, Manoj

    2004-01-01

    This paper presents a directed signature scheme with the property that the signature can be verified only with the help of signer or signature receiver. We also propose its applications to share verification of signatures and to threshold cryptosystems.

  11. Signatures of topological superconductivity

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Yang

    2017-07-19

    The prediction and experimental discovery of topological insulators brought the importance of topology in condensed matter physics into the limelight. Topology hence acts as a new dimension along which more and more new states of matter start to emerge. One of these topological states of matter, namely topological superconductors, comes into the focus because of their gapless excitations. These gapless excitations, especially in one dimensional topological superconductors, are Majorana zero modes localized at the ends of the superconductor and exhibit exotic nonabelian statistics, which can be potentially applied to fault-tolerant quantum computation. Given their highly interesting physical properties and potential applications to quantum computation, both theorists and experimentalists spend great efforts to realize topological supercondoctors and to detect Majoranas. In two projects within this thesis, we investigate the properties of Majorana zero modes in realistic materials which are absent in simple theoretical models. We find that the superconducting proximity effect, an essential ingredient in all existing platforms for topological superconductors, plays a significant role in determining the localization property of the Majoranas. Strong proximity coupling between the normal system and the superconducting substrate can lead to strongly localized Majoranas, which can explain the observation in a recent experiment. Motivated by experiments in Molenkamp's group, we also look at realistic quantum spin Hall Josephson junctions, in which charge puddles acting as magnetic impurities are coupled to the helical edge states. We find that with this setup, the junction generically realizes an exotic 8π periodic Josephson effect, which is absent in a pristine Josephson junction. In another two projects, we propose more pronounced signatures of Majoranas that are accessible with current experimental techniques. The first one is a transport measurement, which uses

  12. Modem Signature Analysis.

    Science.gov (United States)

    1982-10-01

    AD-A127 993 MODEM SIGNATURE ANALISIS (U) PAR TECHNOLOGY CORP NEW / HARTFORD NY V EDWARDS ET AL. OCT 82 RADC-TR-82-269 F30602-80-C-0264 NCLASSIFIED F/G...as an indication of the class clustering and separation between different classes in the modem data base. It is apparent from the projection that the...that as the clusters disperse, the likelihood of a sample crossing the boundary into an adjacent region and causing a symbol decision error increases. As

  13. Fast, Simple and Accurate Handwritten Digit Classification by Training Shallow Neural Network Classifiers with the 'Extreme Learning Machine' Algorithm.

    Directory of Open Access Journals (Sweden)

    Mark D McDonnell

    Full Text Available Recent advances in training deep (multi-layer architectures have inspired a renaissance in neural network use. For example, deep convolutional networks are becoming the default option for difficult tasks on large datasets, such as image and speech recognition. However, here we show that error rates below 1% on the MNIST handwritten digit benchmark can be replicated with shallow non-convolutional neural networks. This is achieved by training such networks using the 'Extreme Learning Machine' (ELM approach, which also enables a very rapid training time (∼ 10 minutes. Adding distortions, as is common practise for MNIST, reduces error rates even further. Our methods are also shown to be capable of achieving less than 5.5% error rates on the NORB image database. To achieve these results, we introduce several enhancements to the standard ELM algorithm, which individually and in combination can significantly improve performance. The main innovation is to ensure each hidden-unit operates only on a randomly sized and positioned patch of each image. This form of random 'receptive field' sampling of the input ensures the input weight matrix is sparse, with about 90% of weights equal to zero. Furthermore, combining our methods with a small number of iterations of a single-batch backpropagation method can significantly reduce the number of hidden-units required to achieve a particular performance. Our close to state-of-the-art results for MNIST and NORB suggest that the ease of use and accuracy of the ELM algorithm for designing a single-hidden-layer neural network classifier should cause it to be given greater consideration either as a standalone method for simpler problems, or as the final classification stage in deep neural networks applied to more difficult problems.

  14. Electronic Signature (eSig)

    Data.gov (United States)

    Department of Veterans Affairs — Beginning with the Government Paperwork Elimination Act of 1998 (GPEA), the Federal government has encouraged the use of electronic / digital signatures to enable...

  15. Expressiveness considerations of XML signatures

    DEFF Research Database (Denmark)

    Jensen, Meiko; Meyer, Christopher

    2011-01-01

    XML Signatures are used to protect XML-based Web Service communication against a broad range of attacks related to man-in-the-middle scenarios. However, due to the complexity of the Web Services specification landscape, the task of applying XML Signatures in a robust and reliable manner becomes...... more and more challenging. In this paper, we investigate this issue, describing how an attacker can still interfere with Web Services communication even in the presence of XML Signatures. Additionally, we discuss the interrelation of XML Signatures and XML Encryption, focussing on their security...

  16. Electronic Warfare Signature Measurement Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Electronic Warfare Signature Measurement Facility contains specialized mobile spectral, radiometric, and imaging measurement systems to characterize ultraviolet,...

  17. Signatures of Mechanosensitive Gating.

    Science.gov (United States)

    Morris, Richard G

    2017-01-10

    The question of how mechanically gated membrane channels open and close is notoriously difficult to address, especially if the protein structure is not available. This perspective highlights the relevance of micropipette-aspirated single-particle tracking-used to obtain a channel's diffusion coefficient, D, as a function of applied membrane tension, σ-as an indirect assay for determining functional behavior in mechanosensitive channels. While ensuring that the protein remains integral to the membrane, such methods can be used to identify not only the gating mechanism of a protein, but also associated physical moduli, such as torsional and dilational rigidity, which correspond to the protein's effective shape change. As an example, three distinct D-versus-σ "signatures" are calculated, corresponding to gating by dilation, gating by tilt, and gating by a combination of both dilation and tilt. Both advantages and disadvantages of the approach are discussed. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  18. Framatome Contribution to Chinese NPP Development and Standardization

    International Nuclear Information System (INIS)

    Charbonneau, S.

    1996-01-01

    First discussions in 1978 between Framatome and Chinese authorities about the supply of an NPP were successfully concluded in 1986 by the signature of the supply contracts (nuclear islands, conventional islands, nuclear fuel assemblies, and project management assistance) for the Daya Bay NPP. Since then teams of engineers and technicians from Framatome and other French companies, and from relevant Chinese institutes and agencies have gotten to know each other better and have deepened their relationships

  19. Signatures de l'invisible

    CERN Multimedia

    CERN Press Office. Geneva

    2000-01-01

    "Signatures of the Invisible" is an unique collaboration between contemporary artists and contemporary physicists which has the potential to help redefine the relationship between science and art. "Signatures of the Invisible" is jointly organised by the London Institute - the world's largest college of art and design and CERN*, the world's leading particle physics laboratory. 12 leading visual artists:

  20. An interpretation of signature inversion

    International Nuclear Information System (INIS)

    Onishi, Naoki; Tajima, Naoki

    1988-01-01

    An interpretation in terms of the cranking model is presented to explain why signature inversion occurs for positive γ of the axially asymmetric deformation parameter and emerges into specific orbitals. By introducing a continuous variable, the eigenvalue equation can be reduced to a one dimensional Schroedinger equation by means of which one can easily understand the cause of signature inversion. (author)

  1. Cell short circuit, preshort signature

    Science.gov (United States)

    Lurie, C.

    1980-01-01

    Short-circuit events observed in ground test simulations of DSCS-3 battery in-orbit operations are analyzed. Voltage signatures appearing in the data preceding the short-circuit event are evaluated. The ground test simulation is briefly described along with performance during reconditioning discharges. Results suggest that a characteristic signature develops prior to a shorting event.

  2. Ship Signature Management System : Functionality

    NARCIS (Netherlands)

    Arciszewski, H.F.R.; Lier, L. van; Meijer, Y.G.S.; Noordkamp, H.W.; Wassenaar, A.S.

    2010-01-01

    A signature of a platform is the manner in which the platform manifests itself to a certain type of sensor and how observable it is when such a sensor is used to detect the platform. Because many military platforms use sensors in different media, it is the total of its different signatures that

  3. Chinese Geography through Chinese Cuisine

    Science.gov (United States)

    Lipman, Jonathan

    2010-01-01

    China has the world's largest population, now over 1.3 billion, but its land area (much of it high mountains or desert) is about the same as that of the United States, which has less than one-fourth as many people. So Chinese farmers have learned to use every inch of their fertile land intensively. Pressure on the land has required extremely…

  4. Initial Semantics for Strengthened Signatures

    Directory of Open Access Journals (Sweden)

    André Hirschowitz

    2012-02-01

    Full Text Available We give a new general definition of arity, yielding the companion notions of signature and associated syntax. This setting is modular in the sense requested by Ghani and Uustalu: merging two extensions of syntax corresponds to building an amalgamated sum. These signatures are too general in the sense that we are not able to prove the existence of an associated syntax in this general context. So we have to select arities and signatures for which there exists the desired initial monad. For this, we follow a track opened by Matthes and Uustalu: we introduce a notion of strengthened arity and prove that the corresponding signatures have initial semantics (i.e. associated syntax. Our strengthened arities admit colimits, which allows the treatment of the λ-calculus with explicit substitution.

  5. Retail applications of signature verification

    Science.gov (United States)

    Zimmerman, Thomas G.; Russell, Gregory F.; Heilper, Andre; Smith, Barton A.; Hu, Jianying; Markman, Dmitry; Graham, Jon E.; Drews, Clemens

    2004-08-01

    The dramatic rise in identity theft, the ever pressing need to provide convenience in checkout services to attract and retain loyal customers, and the growing use of multi-function signature captures devices in the retail sector provides favorable conditions for the deployment of dynamic signature verification (DSV) in retail settings. We report on the development of a DSV system to meet the needs of the retail sector. We currently have a database of approximately 10,000 signatures collected from 600 subjects and forgers. Previous work at IBM on DSV has been merged and extended to achieve robust performance on pen position data available from commercial point of sale hardware, achieving equal error rates on skilled forgeries and authentic signatures of 1.5% to 4%.

  6. Magnetic Signature Analysis & Validation System

    National Research Council Canada - National Science Library

    Vliet, Scott

    2001-01-01

    The Magnetic Signature Analysis and Validation (MAGSAV) System is a mobile platform that is used to measure, record, and analyze the perturbations to the earth's ambient magnetic field caused by object such as armored vehicles...

  7. Chinese restaurant syndrome

    Science.gov (United States)

    Chinese restaurant syndrome is a set of symptoms that some people have after eating Chinese food. A food additive ... Chinese restaurant syndrome is most often diagnosed based on the symptoms. The health care provider may ask the following ...

  8. 21 CFR 11.50 - Signature manifestations.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Signature manifestations. 11.50 Section 11.50 Food... RECORDS; ELECTRONIC SIGNATURES Electronic Records § 11.50 Signature manifestations. (a) Signed electronic...: (1) The printed name of the signer; (2) The date and time when the signature was executed; and (3...

  9. 76 FR 30542 - Adult Signature Services

    Science.gov (United States)

    2011-05-26

    ... POSTAL SERVICE 39 CFR Part 111 Adult Signature Services AGENCY: Postal Service\\TM\\. ACTION: Final..., Domestic Mail Manual (DMM[supreg]) 503.8, to add a new extra service called Adult Signature. This new service has two available options: Adult Signature Required and Adult Signature Restricted Delivery. DATES...

  10. 1 CFR 18.7 - Signature.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Signature. 18.7 Section 18.7 General Provisions... PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.7 Signature. The original and each duplicate original... stamped beneath the signature. Initialed or impressed signatures will not be accepted. Documents submitted...

  11. Attribute-Based Digital Signature System

    NARCIS (Netherlands)

    Ibraimi, L.; Asim, Muhammad; Petkovic, M.

    2011-01-01

    An attribute-based digital signature system comprises a signature generation unit (1) for signing a message (m) by generating a signature (s) based on a user secret key (SK) associated with a set of user attributes, wherein the signature generation unit (1) is arranged for combining the user secret

  12. Quantum messages with signatures forgeable in arbitrated quantum signature schemes

    International Nuclear Information System (INIS)

    Kim, Taewan; Choi, Jeong Woon; Jho, Nam-Su; Lee, Soojoon

    2015-01-01

    Even though a method to perfectly sign quantum messages has not been known, the arbitrated quantum signature scheme has been considered as one of the good candidates. However, its forgery problem has been an obstacle to the scheme becoming a successful method. In this paper, we consider one situation, which is slightly different from the forgery problem, that we use to check whether at least one quantum message with signature can be forged in a given scheme, although all the messages cannot be forged. If there are only a finite number of forgeable quantum messages in the scheme, then the scheme can be secured against the forgery attack by not sending forgeable quantum messages, and so our situation does not directly imply that we check whether the scheme is secure against the attack. However, if users run a given scheme without any consideration of forgeable quantum messages, then a sender might transmit such forgeable messages to a receiver and in such a case an attacker can forge the messages if the attacker knows them. Thus it is important and necessary to look into forgeable quantum messages. We show here that there always exists such a forgeable quantum message-signature pair for every known scheme with quantum encryption and rotation, and numerically show that there are no forgeable quantum message-signature pairs that exist in an arbitrated quantum signature scheme. (paper)

  13. SIGNATURE: A workbench for gene expression signature analysis

    Directory of Open Access Journals (Sweden)

    Chang Jeffrey T

    2011-11-01

    Full Text Available Abstract Background The biological phenotype of a cell, such as a characteristic visual image or behavior, reflects activities derived from the expression of collections of genes. As such, an ability to measure the expression of these genes provides an opportunity to develop more precise and varied sets of phenotypes. However, to use this approach requires computational methods that are difficult to implement and apply, and thus there is a critical need for intelligent software tools that can reduce the technical burden of the analysis. Tools for gene expression analyses are unusually difficult to implement in a user-friendly way because their application requires a combination of biological data curation, statistical computational methods, and database expertise. Results We have developed SIGNATURE, a web-based resource that simplifies gene expression signature analysis by providing software, data, and protocols to perform the analysis successfully. This resource uses Bayesian methods for processing gene expression data coupled with a curated database of gene expression signatures, all carried out within a GenePattern web interface for easy use and access. Conclusions SIGNATURE is available for public use at http://genepattern.genome.duke.edu/signature/.

  14. Signature molecular descriptor : advanced applications.

    Energy Technology Data Exchange (ETDEWEB)

    Visco, Donald Patrick, Jr. (Tennessee Technological University, Cookeville, TN)

    2010-04-01

    In this work we report on the development of the Signature Molecular Descriptor (or Signature) for use in the solution of inverse design problems as well as in highthroughput screening applications. The ultimate goal of using Signature is to identify novel and non-intuitive chemical structures with optimal predicted properties for a given application. We demonstrate this in three studies: green solvent design, glucocorticoid receptor ligand design and the design of inhibitors for Factor XIa. In many areas of engineering, compounds are designed and/or modified in incremental ways which rely upon heuristics or institutional knowledge. Often multiple experiments are performed and the optimal compound is identified in this brute-force fashion. Perhaps a traditional chemical scaffold is identified and movement of a substituent group around a ring constitutes the whole of the design process. Also notably, a chemical being evaluated in one area might demonstrate properties very attractive in another area and serendipity was the mechanism for solution. In contrast to such approaches, computer-aided molecular design (CAMD) looks to encompass both experimental and heuristic-based knowledge into a strategy that will design a molecule on a computer to meet a given target. Depending on the algorithm employed, the molecule which is designed might be quite novel (re: no CAS registration number) and/or non-intuitive relative to what is known about the problem at hand. While CAMD is a fairly recent strategy (dating to the early 1980s), it contains a variety of bottlenecks and limitations which have prevented the technique from garnering more attention in the academic, governmental and industrial institutions. A main reason for this is how the molecules are described in the computer. This step can control how models are developed for the properties of interest on a given problem as well as how to go from an output of the algorithm to an actual chemical structure. This report

  15. Chinese letterkunde. Een inleiding

    NARCIS (Netherlands)

    Idema, Wilt; Haft, Lloyd

    2005-01-01

    De Chinese cultuur mag zich verheugen in een groeiende belangstelling. Chinese films bereiken in Nederland een steeds omvangrijker publiek en ook de moderne Chinese literatuur, die sinds de jaren tachtig een grote bloei doormaakt, wordt door veel liefhebbers op de voet gevolgd. Chinese Letterkunde

  16. Medieval Chinese syntax

    OpenAIRE

    Anderl, Christoph

    2017-01-01

    “Medieval Chinese Syntax” aims to provide a sketch of the development of function words and syntactic structures during the Chinese Medieval period, including Early Medieval Chinese (ca. 0-700 A.D.) and Late Medieval Chinese (ca. 700-1100).

  17. Five Guidelines for Selecting Hydrological Signatures

    Science.gov (United States)

    McMillan, H. K.; Westerberg, I.; Branger, F.

    2017-12-01

    Hydrological signatures are index values derived from observed or modeled series of hydrological data such as rainfall, flow or soil moisture. They are designed to extract relevant information about hydrological behavior, such as to identify dominant processes, and to determine the strength, speed and spatiotemporal variability of the rainfall-runoff response. Hydrological signatures play an important role in model evaluation. They allow us to test whether particular model structures or parameter sets accurately reproduce the runoff generation processes within the watershed of interest. Most modeling studies use a selection of different signatures to capture different aspects of the catchment response, for example evaluating overall flow distribution as well as high and low flow extremes and flow timing. Such studies often choose their own set of signatures, or may borrow subsets of signatures used in multiple other works. The link between signature values and hydrological processes is not always straightforward, leading to uncertainty and variability in hydrologists' signature choices. In this presentation, we aim to encourage a more rigorous approach to hydrological signature selection, which considers the ability of signatures to represent hydrological behavior and underlying processes for the catchment and application in question. To this end, we propose a set of guidelines for selecting hydrological signatures. We describe five criteria that any hydrological signature should conform to: Identifiability, Robustness, Consistency, Representativeness, and Discriminatory Power. We describe an example of the design process for a signature, assessing possible signature designs against the guidelines above. Due to their ubiquity, we chose a signature related to the Flow Duration Curve, selecting the FDC mid-section slope as a proposed signature to quantify catchment overall behavior and flashiness. We demonstrate how assessment against each guideline could be used to

  18. Management of Chinese restaurant

    OpenAIRE

    Cui , Longbo

    2009-01-01

    With Chinese economy developing rapidly, the Chinese restaurant is under the spotlight, but the management of Chinese restaurant is weak at the moment, especially on the service management, which is an important part of service management in the Chinese restaurant. On the other hand, the managers of Chinese restaurant should pay more attention on the service management for instance brand, service innovation. Service management is core and essential concept for every service company recently, ...

  19. Digital Signature Schemes with Complementary Functionality and Applications

    OpenAIRE

    S. N. Kyazhin

    2012-01-01

    Digital signature schemes with additional functionality (an undeniable signature, a signature of the designated confirmee, a signature blind, a group signature, a signature of the additional protection) and examples of their application are considered. These schemes are more practical, effective and useful than schemes of ordinary digital signature.

  20. Signature Pedagogy in Theatre Arts

    Science.gov (United States)

    Kornetsky, Lisa

    2017-01-01

    Critique in undergraduate theatre programs is at the heart of training actors at all levels. It is accepted as the signature pedagogy and is practiced in multiple ways. This essay defines critique and presents the case for why it is used as the single most important way that performers come to understand the language, values, and discourse of the…

  1. Motif signatures of transcribed enhancers

    KAUST Repository

    Kleftogiannis, Dimitrios

    2017-09-14

    In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.

  2. Quark-Gluon Plasma Signatures

    CERN Document Server

    Vogt, Ramona

    1998-01-01

    Aspects of quark-gluon plasma signatures that can be measured by CMS are discussed. First the initial conditions of the system from minijet production are introduced, including shadowing effects. Color screening of the Upsilon family is then presented, followed by energy loss effects on charm and bottom hadrons, high Pt jets and global observables.

  3. Galaxy interactions : The HI signature

    NARCIS (Netherlands)

    Sancisi, R; Barnes, JE; Sanders, DB

    1999-01-01

    HI observations are an excellent tool for investigating tidal interactions. Ongoing major and minor interactions which can lead to traumatic mergers or to accretion and the triggering of star formation, show distinct HI signatures. Interactions and mergers in the recent past can also be recognized

  4. Online Signature Verification on MOBISIG Finger-Drawn Signature Corpus

    Directory of Open Access Journals (Sweden)

    Margit Antal

    2018-01-01

    Full Text Available We present MOBISIG, a pseudosignature dataset containing finger-drawn signatures from 83 users captured with a capacitive touchscreen-based mobile device. The database was captured in three sessions resulting in 45 genuine signatures and 20 skilled forgeries for each user. The database was evaluated by two state-of-the-art methods: a function-based system using local features and a feature-based system using global features. Two types of equal error rate computations are performed: one using a global threshold and the other using user-specific thresholds. The lowest equal error rate was 0.01% against random forgeries and 5.81% against skilled forgeries using user-specific thresholds that were computed a posteriori. However, these equal error rates were significantly raised to 1.68% (random forgeries case and 14.31% (skilled forgeries case using global thresholds. The same evaluation protocol was performed on the DooDB publicly available dataset. Besides verification performance evaluations conducted on the two finger-drawn datasets, we evaluated the quality of the samples and the users of the two datasets using basic quality measures. The results show that finger-drawn signatures can be used by biometric systems with reasonable accuracy.

  5. Unsupervised signature extraction from forensic logs

    NARCIS (Netherlands)

    Thaler, S.M.; Menkovski, V.; Petkovic, M.; Altun, Y.; Das, K.; Mielikäinen, T.; Malerba, D.; Stefanowski, J.; Read, J.; Žitnik, M.; Ceci, M.

    2017-01-01

    Signature extraction is a key part of forensic log analysis. It involves recognizing patterns in log lines such that log lines that originated from the same line of code are grouped together. A log signature consists of immutable parts and mutable parts. The immutable parts define the signature, and

  6. 7 CFR 718.9 - Signature requirements.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Signature requirements. 718.9 Section 718.9... MULTIPLE PROGRAMS General Provisions § 718.9 Signature requirements. (a) When a program authorized by this chapter or Chapter XIV of this title requires the signature of a producer; landowner; landlord; or tenant...

  7. 42 CFR 424.36 - Signature requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Signature requirements. 424.36 Section 424.36... (CONTINUED) MEDICARE PROGRAM CONDITIONS FOR MEDICARE PAYMENT Claims for Payment § 424.36 Signature requirements. (a) General rule. The beneficiary's own signature is required on the claim unless the beneficiary...

  8. 17 CFR 12.12 - Signature.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Signature. 12.12 Section 12.12... General Information and Preliminary Consideration of Pleadings § 12.12 Signature. (a) By whom. All... document on behalf of another person. (b) Effect. The signature on any document of any person acting either...

  9. 25 CFR 213.10 - Lessor's signature.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Lessor's signature. 213.10 Section 213.10 Indians BUREAU... MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.10 Lessor's signature... thumbprint which shall be designated as “right” or “left” thumbmark. Such signatures must be witnessed by two...

  10. Signature effects in 2-qp rotational bands

    International Nuclear Information System (INIS)

    Jain, A.K.; Goel, A.

    1992-01-01

    The authors briefly review the progress in understanding the 2-qp rotational bands in odd-odd nuclei. Signature effects and the phenomenon of signature inversion are discussed. The Coriolis coupling appears to have all the ingredients to explain the inversion. Some recent work on signature dependence in 2-qp bands of even-even nuclei is also discussed; interesting features are pointed out

  11. 27 CFR 17.6 - Signature authority.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Signature authority. 17.6... PRODUCTS General Provisions § 17.6 Signature authority. No claim, bond, tax return, or other required... other proper notification of signature authority has been filed with the TTB office where the required...

  12. High-speed high-security signatures

    NARCIS (Netherlands)

    Bernstein, D.J.; Duif, N.; Lange, T.; Schwabe, P.; Yang, B.Y.

    2011-01-01

    This paper shows that a $390 mass-market quad-core 2.4GHz Intel Westmere (Xeon E5620) CPU can create 108000 signatures per second and verify 71000 signatures per second on an elliptic curve at a 2128 security level. Public keys are 32 bytes, and signatures are 64 bytes. These performance figures

  13. Some Proxy Signature and Designated verifier Signature Schemes over Braid Groups

    OpenAIRE

    Lal, Sunder; Verma, Vandani

    2009-01-01

    Braids groups provide an alternative to number theoretic public cryptography and can be implemented quite efficiently. The paper proposes five signature schemes: Proxy Signature, Designated Verifier, Bi-Designated Verifier, Designated Verifier Proxy Signature And Bi-Designated Verifier Proxy Signature scheme based on braid groups. We also discuss the security aspects of each of the proposed schemes.

  14. Nonlinear control of magnetic signatures

    Science.gov (United States)

    Niemoczynski, Bogdan

    Magnetic properties of ferrite structures are known to cause fluctuations in Earth's magnetic field around the object. These fluctuations are known as the object's magnetic signature and are unique based on the object's geometry and material. It is a common practice to neutralize magnetic signatures periodically after certain time intervals, however there is a growing interest to develop real time degaussing systems for various applications. Development of real time degaussing system is a challenging problem because of magnetic hysteresis and difficulties in measurement or estimation of near-field flux data. The goal of this research is to develop a real time feedback control system that can be used to minimize magnetic signatures for ferrite structures. Experimental work on controlling the magnetic signature of a cylindrical steel shell structure with a magnetic disturbance provided evidence that the control process substantially increased the interior magnetic flux. This means near field estimation using interior sensor data is likely to be inaccurate. Follow up numerical work for rectangular and cylindrical cross sections investigated variations in shell wall flux density under a variety of ambient excitation and applied disturbances. Results showed magnetic disturbances could corrupt interior sensor data and magnetic shielding due to the shell walls makes the interior very sensitive to noise. The magnetic flux inside the shell wall showed little variation due to inner disturbances and its high base value makes it less susceptible to noise. This research proceeds to describe a nonlinear controller to use the shell wall data as an input. A nonlinear plant model of magnetics is developed using a constant tau to represent domain rotation lag and a gain function k to describe the magnetic hysteresis curve for the shell wall. The model is justified by producing hysteresis curves for multiple materials, matching experimental data using a particle swarm algorithm, and

  15. Nonlinear analysis of dynamic signature

    Science.gov (United States)

    Rashidi, S.; Fallah, A.; Towhidkhah, F.

    2013-12-01

    Signature is a long trained motor skill resulting in well combination of segments like strokes and loops. It is a physical manifestation of complex motor processes. The problem, generally stated, is that how relative simplicity in behavior emerges from considerable complexity of perception-action system that produces behavior within an infinitely variable biomechanical and environmental context. To solve this problem, we present evidences which indicate that motor control dynamic in signing process is a chaotic process. This chaotic dynamic may explain a richer array of time series behavior in motor skill of signature. Nonlinear analysis is a powerful approach and suitable tool which seeks for characterizing dynamical systems through concepts such as fractal dimension and Lyapunov exponent. As a result, they can be analyzed in both horizontal and vertical for time series of position and velocity. We observed from the results that noninteger values for the correlation dimension indicates low dimensional deterministic dynamics. This result could be confirmed by using surrogate data tests. We have also used time series to calculate the largest Lyapunov exponent and obtain a positive value. These results constitute significant evidence that signature data are outcome of chaos in a nonlinear dynamical system of motor control.

  16. Spectral signature selection for mapping unvegetated soils

    Science.gov (United States)

    May, G. A.; Petersen, G. W.

    1975-01-01

    Airborne multispectral scanner data covering the wavelength interval from 0.40-2.60 microns were collected at an altitude of 1000 m above the terrain in southeastern Pennsylvania. Uniform training areas were selected within three sites from this flightline. Soil samples were collected from each site and a procedure developed to allow assignment of scan line and element number from the multispectral scanner data to each sampling location. These soil samples were analyzed on a spectrophotometer and laboratory spectral signatures were derived. After correcting for solar radiation and atmospheric attenuation, the laboratory signatures were compared to the spectral signatures derived from these same soils using multispectral scanner data. Both signatures were used in supervised and unsupervised classification routines. Computer-generated maps using the laboratory and multispectral scanner derived signatures resulted in maps that were similar to maps resulting from field surveys. Approximately 90% agreement was obtained between classification maps produced using multispectral scanner derived signatures and laboratory derived signatures.

  17. Time Series Based for Online Signature Verification

    Directory of Open Access Journals (Sweden)

    I Ketut Gede Darma Putra

    2013-11-01

    Full Text Available Signature verification system is to match the tested signature with a claimed signature. This paper proposes time series based for feature extraction method and dynamic time warping for match method. The system made by process of testing 900 signatures belong to 50 participants, 3 signatures for reference and 5 signatures from original user, simple imposters and trained imposters for signatures test. The final result system was tested with 50 participants with 3 references. This test obtained that system accuracy without imposters is 90,44897959% at threshold 44 with rejection errors (FNMR is 5,2% and acceptance errors (FMR is 4,35102%, when with imposters system accuracy is 80,1361% at threshold 27 with error rejection (FNMR is 15,6% and acceptance errors (average FMR is 4,263946%, with details as follows: acceptance errors is 0,391837%, acceptance errors simple imposters is 3,2% and acceptance errors trained imposters is 9,2%.

  18. MANDARIN CHINESE DICTIONARY.

    Science.gov (United States)

    WANG, FRED FANGYU

    IN RESPONSE TO THE NEEDS OF THE GROWING NUMBER OF AMERICAN HIGH SCHOOL AND COLLEGE STUDENTS LEARNING CHINESE, SETON HALL UNIVERSITY UNDERTOOK A CONTRACT WITH THE U.S. OFFICE OF EDUCATION TO COMPILE A BILINGUAL POCKET-SIZE DICTIONARY FOR BEGINNING STUDENTS OF SPOKEN MANDARIN CHINESE. THE PRESENT WORK IS THE CHINESE TO ENGLISH SECTION IN PRELIMINARY…

  19. TRADITIONAL CHINESE HERBAL MEDICINE

    NARCIS (Netherlands)

    ZHU, YP; WOERDENBAG, HJ

    1995-01-01

    Herbal medicine, acupuncture and moxibustion, and massage and the three major constituent parts of traditional Chinese medicine. Although acupuncture is well known in many Western countries, Chinese herbal medicine, the mos important part of traditional Chinese medicine, is less well known in the

  20. Chinese restaurant syndrome

    OpenAIRE

    Balachandran C; Srinivas C; Shenoy S

    1991-01-01

    A 24-year-old Chinese student with history of recurrent attacks of flushing with burning and dryness of face of 4 years duration showed exacerbation of the symptoms after oral provocation with 1 mg of Chinese salt. Patient was treated with 50 mg pyridoxine daily and restriction of the Chinese salt in diet with moderate improvement.

  1. Chinese restaurant syndrome

    Directory of Open Access Journals (Sweden)

    Balachandran C

    1991-01-01

    Full Text Available A 24-year-old Chinese student with history of recurrent attacks of flushing with burning and dryness of face of 4 years duration showed exacerbation of the symptoms after oral provocation with 1 mg of Chinese salt. Patient was treated with 50 mg pyridoxine daily and restriction of the Chinese salt in diet with moderate improvement.

  2. Infrared signatures for remote sensing

    International Nuclear Information System (INIS)

    McDowell, R.S.; Sharpe, S.W.; Kelly, J.F.

    1994-04-01

    PNL's capabilities for infrared and near-infrared spectroscopy include tunable-diode-laser (TDL) systems covering 300--3,000 cm -1 at 2 laser. PNL also has a beam expansion source with a 12-cm slit, which provides a 3-m effective path for gases at ∼10 K, giving a Doppler width of typically 10 MHz; and long-path static gas cells (to 100 m). In applying this equipment to signatures work, the authors emphasize the importance of high spectral resolution for detecting and identifying atmospheric interferences; for identifying the optimum analytical frequencies; for deriving, by spectroscopic analysis, the molecular parameters needed for modeling; and for obtaining data on species and/or bands that are not in existing databases. As an example of such spectroscopy, the authors have assigned and analyzed the C-Cl stretching region of CCl 4 at 770--800 cm -1 . This is an important potential signature species whose IR absorption has remained puzzling because of the natural isotopic mix, extensive hot-band structure, and a Fermi resonance involving a nearby combination band. Instrument development projects include the IR sniffer, a small high-sensitivity, high-discrimination (Doppler-limited) device for fence-line or downwind monitoring that is effective even in regions of atmospheric absorption; preliminary work has achieved sensitivities at the low-ppb level. Other work covers trace species detection with TDLs, and FM-modulated CO 2 laser LIDAR. The authors are planning a field experiment to interrogate the Hanford tank farm for signature species from Rattlesnake Mountain, a standoff of ca. 15 km, to be accompanied by simultaneous ground-truthing at the tanks

  3. Isotopic source signatures: Impact of regional variability on the δ13CH4 trend and spatial distribution

    Science.gov (United States)

    Feinberg, Aryeh I.; Coulon, Ancelin; Stenke, Andrea; Schwietzke, Stefan; Peter, Thomas

    2018-02-01

    The atmospheric methane growth rate has fluctuated over the past three decades, signifying variations in methane sources and sinks. Methane isotopic ratios (δ13CH4) differ between emission categories, and can therefore be used to distinguish which methane sources have changed. However, isotopic modelling studies have mainly focused on uncertainties in methane emissions rather than uncertainties in isotopic source signatures. We simulated atmospheric δ13CH4 for the period 1990-2010 using the global chemistry-climate model SOCOL. Empirically-derived regional variability in the isotopic signatures was introduced in a suite of sensitivity simulations. These simulations were compared to a baseline simulation with commonly used global mean isotopic signatures. We investigated coal, natural gas/oil, wetland, livestock, and biomass burning source signatures to determine whether regional variations impact the observed isotopic trend and spatial distribution. Based on recently published source signature datasets, our calculated global mean isotopic signatures are in general lighter than the commonly used values. Trends in several isotopic signatures were also apparent during the period 1990-2010. Tropical livestock emissions grew during the 2000s, introducing isotopically heavier livestock emissions since tropical livestock consume more C4 vegetation than midlatitude livestock. Chinese coal emissions, which are isotopically heavy compared to other coals, increase during the 2000s leading to higher global values of δ13CH4 for coal emissions. EDGAR v4.2 emissions disagree with the observed atmospheric isotopic trend for almost all simulations, confirming past doubts about this emissions inventory. The agreement between the modelled and observed δ13CH4 interhemispheric differences improves when regional source signatures are used. Even though the simulated results are highly dependent on the choice of methane emission inventories, they emphasize that the commonly used

  4. Signature Curves Statistics of DNA Supercoils

    OpenAIRE

    Shakiban, Cheri; Lloyd, Peter

    2004-01-01

    In this paper we describe the Euclidean signature curves for two dimensional closed curves in the plane and their generalization to closed space curves. The focus will be on discrete numerical methods for approximating such curves. Further we will apply these numerical methods to plot the signature curves related to three-dimensional simulated DNA supercoils. Our primary focus will be on statistical analysis of the data generated for the signature curves of the supercoils. We will try to esta...

  5. Institute of Geophysics, Planetary Physics, and Signatures

    Data.gov (United States)

    Federal Laboratory Consortium — The Institute of Geophysics, Planetary Physics, and Signatures at Los Alamos National Laboratory is committed to promoting and supporting high quality, cutting-edge...

  6. On reliable discovery of molecular signatures

    Directory of Open Access Journals (Sweden)

    Björkegren Johan

    2009-01-01

    Full Text Available Abstract Background Molecular signatures are sets of genes, proteins, genetic variants or other variables that can be used as markers for a particular phenotype. Reliable signature discovery methods could yield valuable insight into cell biology and mechanisms of human disease. However, it is currently not clear how to control error rates such as the false discovery rate (FDR in signature discovery. Moreover, signatures for cancer gene expression have been shown to be unstable, that is, difficult to replicate in independent studies, casting doubts on their reliability. Results We demonstrate that with modern prediction methods, signatures that yield accurate predictions may still have a high FDR. Further, we show that even signatures with low FDR may fail to replicate in independent studies due to limited statistical power. Thus, neither stability nor predictive accuracy are relevant when FDR control is the primary goal. We therefore develop a general statistical hypothesis testing framework that for the first time provides FDR control for signature discovery. Our method is demonstrated to be correct in simulation studies. When applied to five cancer data sets, the method was able to discover molecular signatures with 5% FDR in three cases, while two data sets yielded no significant findings. Conclusion Our approach enables reliable discovery of molecular signatures from genome-wide data with current sample sizes. The statistical framework developed herein is potentially applicable to a wide range of prediction problems in bioinformatics.

  7. Modeling the Thermal Signature of Natural Backgrounds

    National Research Council Canada - National Science Library

    Gamborg, Marius

    2002-01-01

    Two measuring stations have been established the purpose being to collect comprehensive databases of thermal signatures of background elements in addition to the prevailing meteorological conditions...

  8. An Arbitrated Quantum Signature Scheme without Entanglement*

    International Nuclear Information System (INIS)

    Li Hui-Ran; Luo Ming-Xing; Peng Dai-Yuan; Wang Xiao-Jun

    2017-01-01

    Several quantum signature schemes are recently proposed to realize secure signatures of quantum or classical messages. Arbitrated quantum signature as one nontrivial scheme has attracted great interests because of its usefulness and efficiency. Unfortunately, previous schemes cannot against Trojan horse attack and DoS attack and lack of the unforgeability and the non-repudiation. In this paper, we propose an improved arbitrated quantum signature to address these secure issues with the honesty arbitrator. Our scheme takes use of qubit states not entanglements. More importantly, the qubit scheme can achieve the unforgeability and the non-repudiation. Our scheme is also secure for other known quantum attacks . (paper)

  9. Is handwriting constrained by phonology? Evidence from Stroop tasks with written responses and Chinese characters

    Directory of Open Access Journals (Sweden)

    Markus eDamian

    2013-10-01

    Full Text Available To what extent is handwritten word production based on phonological codes? A few studies conducted in Western languages have recently provided evidence showing that phonology contributes to the retrieval of graphemic properties in written output tasks. Less is known about how orthographic production works in languages with non-alphabetic scripts such as written Chinese. We report a Stroop study in which Chinese participants wrote the colour of characters on a digital graphic tablet; characters were either neutral, or homophonic to the target (congruent, or homophonic to an alternative (incongruent. Facilitation was found from congruent homophonic distractors, but only when the homophone shared the same tone with the target. This finding suggests a contribution of phonology to written word production. A second experiment served as a control experiment to exclude the possibility that the effect in Experiment 1 had an exclusively semantic locus. Overall, the findings offer new insight into the relative contribution of phonology to handwriting, particularly in non-Western languages.

  10. Evaluation of Chinese Calligraphy by Using DBSC Vectorization and ICP Algorithm

    Directory of Open Access Journals (Sweden)

    Mengdi Wang

    2016-01-01

    Full Text Available Chinese calligraphy is a charismatic ancient art form with high artistic value in Chinese culture. Virtual calligraphy learning system is a research hotspot in recent years. In such system, a judging mechanism for user’s practice result is quite important. Sometimes, user’s handwritten character is not that standard, the size and position are not fixed, and the whole character may be even askew, which brings difficulty for its evaluation. In this paper, we propose an approach by using DBSCs (disk B-spline curves vectorization and ICP (iterative closest point algorithm, which cannot only evaluate a calligraphic character without knowing what it is, but also deal with the above problems commendably. Firstly we find the promising candidate characters from the database according to the angular difference relations as quickly as possible. Then we check these vectorized candidates by using ICP algorithm based upon the skeleton, hence finding out the best matching character. Finally a comprehensive evaluation involving global (the whole character and local (strokes similarities is implemented, and a final composited evaluation score can be worked out.

  11. Elektronisk signatur : Hur säkra är elektroniska signaturer ur avtalsrättslig synpunkt?

    OpenAIRE

    Levén, Malin

    2005-01-01

    Communication between parties in an important process in their relationship can be based on a contract. This communication can for exemple be composed by a handwritten contract or an electronic contract. Contract law makes no difference between these two forms. to create more favourable requirements for commencing a contract or an ongoing contract there are possibilities to use standard agreements. Therefore a contract can be based on the will of the parties or on a standard agreement. An ele...

  12. 15 CFR 908.16 - Signature.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Signature. 908.16 Section 908.16 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) NATIONAL OCEANIC... SUBMITTING REPORTS ON WEATHER MODIFICATION ACTIVITIES § 908.16 Signature. All reports filed with the National...

  13. 12 CFR 269b.731 - Signature.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Signature. 269b.731 Section 269b.731 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CHARGES OF UNFAIR LABOR PRACTICES General Rules § 269b.731 Signature. The original of each document filed shall be...

  14. The Pedagogic Signature of the Teaching Profession

    Science.gov (United States)

    Kiel, Ewald; Lerche, Thomas; Kollmannsberger, Markus; Oubaid, Viktor; Weiss, Sabine

    2016-01-01

    Lee S. Shulman deplores that the field of education as a profession does not have a pedagogic signature, which he characterizes as a synthesis of cognitive, practical and moral apprenticeship. In this context, the following study has three goals: 1) In the first theoretical part, the basic problems of constructing a pedagogic signature are…

  15. Infrared ship signature analysis and optimisation

    NARCIS (Netherlands)

    Neele, F.P.

    2005-01-01

    The last decade has seen an increase in the awareness of the infrared signature of naval ships. New ship designs show that infrared signature reduction measures are being incorporated, such as exhaust gas cooling systems, relocation of the exhausts and surface cooling systems. Hull and

  16. Does Social Work Have a Signature Pedagogy?

    Science.gov (United States)

    Earls Larrison, Tara; Korr, Wynne S.

    2013-01-01

    This article contributes to discourse on signature pedagogy by reconceptualizing how our pedagogies are understood and defined for social work education. We critique the view that field education is social work's signature pedagogy and consider what pedagogies are distinct about the teaching and learning of social work. Using Shulman's…

  17. Quantum signature scheme for known quantum messages

    International Nuclear Information System (INIS)

    Kim, Taewan; Lee, Hyang-Sook

    2015-01-01

    When we want to sign a quantum message that we create, we can use arbitrated quantum signature schemes which are possible to sign for not only known quantum messages but also unknown quantum messages. However, since the arbitrated quantum signature schemes need the help of a trusted arbitrator in each verification of the signature, it is known that the schemes are not convenient in practical use. If we consider only known quantum messages such as the above situation, there can exist a quantum signature scheme with more efficient structure. In this paper, we present a new quantum signature scheme for known quantum messages without the help of an arbitrator. Differing from arbitrated quantum signature schemes based on the quantum one-time pad with the symmetric key, since our scheme is based on quantum public-key cryptosystems, the validity of the signature can be verified by a receiver without the help of an arbitrator. Moreover, we show that our scheme provides the functions of quantum message integrity, user authentication and non-repudiation of the origin as in digital signature schemes. (paper)

  18. Analysis of signature wrapping attacks and countermeasures

    DEFF Research Database (Denmark)

    Gajek, Sebastian; Jensen, Meiko; Liao, Lijun

    2009-01-01

    In recent research it turned out that Boolean verification, of digital signatures in the context of WSSecurity, is likely to fail: If parts of a SOAP message, are signed and the signature verification applied to, the whole document returns true, then nevertheless the, document may have been...

  19. 48 CFR 4.102 - Contractor's signature.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contractor's signature. 4.102 Section 4.102 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL ADMINISTRATIVE MATTERS Contract Execution 4.102 Contractor's signature. (a) Individuals. A contract with an...

  20. Real time gamma-ray signature identifier

    Science.gov (United States)

    Rowland, Mark [Alamo, CA; Gosnell, Tom B [Moraga, CA; Ham, Cheryl [Livermore, CA; Perkins, Dwight [Livermore, CA; Wong, James [Dublin, CA

    2012-05-15

    A real time gamma-ray signature/source identification method and system using principal components analysis (PCA) for transforming and substantially reducing one or more comprehensive spectral libraries of nuclear materials types and configurations into a corresponding concise representation/signature(s) representing and indexing each individual predetermined spectrum in principal component (PC) space, wherein an unknown gamma-ray signature may be compared against the representative signature to find a match or at least characterize the unknown signature from among all the entries in the library with a single regression or simple projection into the PC space, so as to substantially reduce processing time and computing resources and enable real-time characterization and/or identification.

  1. DIGITAL SIGNATURE IN THE WAY OF LAW

    Directory of Open Access Journals (Sweden)

    Ruya Samlı

    2013-01-01

    Full Text Available Signature can be defined as a person’s name or special signs that he/she writes when he/she wants to indicate he/she wrote or confirm that writing. A person signs many times in his/her life. A person’s signature that is used for thousands of times for many things from formal documents to exams has importance for that person. Especially, signing in legal operations is an operation that can build important results. If a person’s signature is imitated by another person, he/she can become beholden, donate his/her whole wealth, commits offences or do some judicial operations. Today, because many operations can be done with digital environments and internet, signature operation that provides identity validation must also be carried to digital environment. In this paper digital signature concept that is approved for this reason and its situation in international areas and Turkish laws are investigated.

  2. 48 CFR 804.101 - Contracting officer's signature.

    Science.gov (United States)

    2010-10-01

    ... signature. 804.101 Section 804.101 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS GENERAL ADMINISTRATIVE MATTERS Contract Execution 804.101 Contracting officer's signature. (a) If a... signature. ...

  3. SecurePhone: a mobile phone with biometric authentication and e-signature support for dealing secure transactions on the fly

    Science.gov (United States)

    Ricci, R.; Chollet, G.; Crispino, M. V.; Jassim, S.; Koreman, J.; Olivar-Dimas, M.; Garcia-Salicetti, S.; Soria-Rodriguez, P.

    2006-05-01

    This article presents an overview of the SecurePhone project, with an account of the first results obtained. SecurePhone's primary aim is to realise a mobile phone prototype - the 'SecurePhone' - in which biometrical authentication enables users to deal secure, dependable transactions over a mobile network. The SecurePhone is based on a commercial PDA-phone, supplemented with specific software modules and a customised SIM card. It integrates in a single environment a number of advanced features: access to cryptographic keys through strong multimodal biometric authentication; appending and verification of digital signatures; real-time exchange and interactive modification of (esigned) documents and voice recordings. SecurePhone's 'biometric recogniser' is based on original research. A fused combination of three different biometric methods - speaker, face and handwritten signature verification - is exploited, with no need for dedicated hardware components. The adoption of non-intrusive, psychologically neutral biometric techniques is expected to mitigate rejection problems that often inhibit the social use of biometrics, and speed up the spread of e-signature technology. Successful biometric authentication grants access to SecurePhone's built-in esignature services through a user-friendly interface. Special emphasis is accorded to the definition of a trustworthy security chain model covering all aspects of system operation. The SecurePhone is expected to boost m-commerce and open new scenarios for m-business and m-work, by changing the way people interact and by improving trust and confidence in information technologies, often considered intimidating and difficult to use. Exploitation plans will also explore other application domains (physical and logical access control, securised mobile communications).

  4. Maximizing biomarker discovery by minimizing gene signatures

    Directory of Open Access Journals (Sweden)

    Chang Chang

    2011-12-01

    Full Text Available Abstract Background The use of gene signatures can potentially be of considerable value in the field of clinical diagnosis. However, gene signatures defined with different methods can be quite various even when applied the same disease and the same endpoint. Previous studies have shown that the correct selection of subsets of genes from microarray data is key for the accurate classification of disease phenotypes, and a number of methods have been proposed for the purpose. However, these methods refine the subsets by only considering each single feature, and they do not confirm the association between the genes identified in each gene signature and the phenotype of the disease. We proposed an innovative new method termed Minimize Feature's Size (MFS based on multiple level similarity analyses and association between the genes and disease for breast cancer endpoints by comparing classifier models generated from the second phase of MicroArray Quality Control (MAQC-II, trying to develop effective meta-analysis strategies to transform the MAQC-II signatures into a robust and reliable set of biomarker for clinical applications. Results We analyzed the similarity of the multiple gene signatures in an endpoint and between the two endpoints of breast cancer at probe and gene levels, the results indicate that disease-related genes can be preferably selected as the components of gene signature, and that the gene signatures for the two endpoints could be interchangeable. The minimized signatures were built at probe level by using MFS for each endpoint. By applying the approach, we generated a much smaller set of gene signature with the similar predictive power compared with those gene signatures from MAQC-II. Conclusions Our results indicate that gene signatures of both large and small sizes could perform equally well in clinical applications. Besides, consistency and biological significances can be detected among different gene signatures, reflecting the

  5. Chinese Foods; Teacher's Handbook.

    Science.gov (United States)

    Huang, Joe, Ed.

    Different styles of Chinese cooking, traditional food items, cooking utensils, serving techniques, and the nutritional value of Chinese cooking are described in this teaching guide. Lesson plans for the preparation of simple dishes are presented. Recipes, a shopping guide to San Francisco's Chinatown, a guide to sources of supplies, and a…

  6. Chinese Companies in Switzerland

    Directory of Open Access Journals (Sweden)

    Esther Kessler

    2014-10-01

    Full Text Available In recent years, some of China’s leading firms have made headlines with their European expansion, by either opening new facilities or by acquiring or merging with significant enterprises in Europe. The goal of this paper is to contribute to the existing literature by examining Chinese enterprises expanding into Switzerland. The study also allows some conclusions for Chinese companies entering Central and Eastern Europe. We analyze via interviews the motivations of Chinese companies to expand into Switzerland as well as their behavior and the impediments in their internationalization process. Our findings show that Chinese companies fail to take advantage of certain benefits of western economies (such as open information and stable rule of law. To move forward efficiently, they should develop competence in dealing systematically with readily available market information, building professional networks that recognize a separation between business life and personal life, and managing their Chinese and foreign employees in the foreign cultural environment.

  7. Translation: an example from ancient Chinese to modern Chinese

    NARCIS (Netherlands)

    Liu, X; Hoede, C.

    2002-01-01

    In this paper, we gave an idea of translation by means of knowledge graph theory from ancient Chinese to modern Chinese, by using an example story. Actually, we give the details of the method of translation from ancient Chinese to modern Chinese step by step as carried out by hand. From the example,

  8. Genomic Signatures of Sexual Conflict.

    Science.gov (United States)

    Kasimatis, Katja R; Nelson, Thomas C; Phillips, Patrick C

    2017-10-30

    Sexual conflict is a specific class of intergenomic conflict that describes the reciprocal sex-specific fitness costs generated by antagonistic reproductive interactions. The potential for sexual conflict is an inherent property of having a shared genome between the sexes and, therefore, is an extreme form of an environment-dependent fitness effect. In this way, many of the predictions from environment-dependent selection can be used to formulate expected patterns of genome evolution under sexual conflict. However, the pleiotropic and transmission constraints inherent to having alleles move across sex-specific backgrounds from generation to generation further modulate the anticipated signatures of selection. We outline methods for detecting candidate sexual conflict loci both across and within populations. Additionally, we consider the ability of genome scans to identify sexually antagonistic loci by modeling allele frequency changes within males and females due to a single generation of selection. In particular, we highlight the need to integrate genotype, phenotype, and functional information to truly distinguish sexual conflict from other forms of sexual differentiation. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Transcriptomic signatures in cartilage ageing

    Science.gov (United States)

    2013-01-01

    Introduction Age is an important factor in the development of osteoarthritis. Microarray studies provide insight into cartilage aging but do not reveal the full transcriptomic phenotype of chondrocytes such as small noncoding RNAs, pseudogenes, and microRNAs. RNA-Seq is a powerful technique for the interrogation of large numbers of transcripts including nonprotein coding RNAs. The aim of the study was to characterise molecular mechanisms associated with age-related changes in gene signatures. Methods RNA for gene expression analysis using RNA-Seq and real-time PCR analysis was isolated from macroscopically normal cartilage of the metacarpophalangeal joints of eight horses; four young donors (4 years old) and four old donors (>15 years old). RNA sequence libraries were prepared following ribosomal RNA depletion and sequencing was undertaken using the Illumina HiSeq 2000 platform. Differentially expressed genes were defined using Benjamini-Hochberg false discovery rate correction with a generalised linear model likelihood ratio test (P ageing cartilage. Conclusion There was an age-related dysregulation of matrix, anabolic and catabolic cartilage factors. This study has increased our knowledge of transcriptional networks in cartilage ageing by providing a global view of the transcriptome. PMID:23971731

  10. Reduction of a Ship's Magnetic Field Signatures

    CERN Document Server

    Holmes, John

    2008-01-01

    Decreasing the magnetic field signature of a naval vessel will reduce its susceptibility to detonating naval influence mines and the probability of a submarine being detected by underwater barriers and maritime patrol aircraft. Both passive and active techniques for reducing the magnetic signatures produced by a vessel's ferromagnetism, roll-induced eddy currents, corrosion-related sources, and stray fields are presented. Mathematical models of simple hull shapes are used to predict the levels of signature reduction that might be achieved through the use of alternate construction materials. Al

  11. Molecular signatures of thyroid follicular neoplasia

    DEFF Research Database (Denmark)

    Borup, R.; Rossing, M.; Henao, Ricardo

    2010-01-01

    The molecular pathways leading to thyroid follicular neoplasia are incompletely understood, and the diagnosis of follicular tumors is a clinical challenge. To provide leads to the pathogenesis and diagnosis of the tumors, we examined the global transcriptome signatures of follicular thyroid...... a mechanism for cancer progression, which is why we exploited the results in order to generate a molecular classifier that could identify 95% of all carcinomas. Validation employing public domain and cross-platform data demonstrated that the signature was robust and could diagnose follicular nodules...... and robust genetic signature for the diagnosis of FA and FC. Endocrine-Related Cancer (2010) 17 691-708...

  12. DIGITAL SIGNATURE IN THE WAY OF LAW

    OpenAIRE

    Ruya Samlı

    2013-01-01

    Signature can be defined as a person’s name or special signs that he/she writes when he/she wants to indicate he/she wrote or confirm that writing. A person signs many times in his/her life. A person’s signature that is used for thousands of times for many things from formal documents to exams has importance for that person. Especially, signing in legal operations is an operation that can build important results. If a person’s signature is imitated by another person, he/she can be...

  13. Chinese nuclear insurance and Chinese nuclear insurance pool

    International Nuclear Information System (INIS)

    Gong Zhiqi

    2000-01-01

    Chinese Nuclear Insurance Started with Daya Bay Nuclear Power Station, PICC issued the insurance policy. Nuclear insurance cooperation between Chinese and international pool's organizations was set up in 1989. In 1996, the Chinese Nuclear Insurance Pool was prepared. The Chinese Nuclear Insurance Pool was approved by The Chinese Insurance Regulatory Committee in May of 1999. The principal aim is to centralize maximum the insurance capacity for nuclear insurance from local individual insurers and to strengthen the reinsurance relations with international insurance pools so as to provide the high quality insurance service for Chinese nuclear industry. The Member Company of Chinese Nuclear Pool and its roles are introduced in this article

  14. The Danger of Chinese Exceptionalism

    DEFF Research Database (Denmark)

    Li, Xin

    2016-01-01

    In the movement of Chinese indigenous management research, a sort of ‘Chinese exceptionalism’ (as critiqued by Peng, 2005: 133) seems to have been emerging, namely, some Chinese scholars see Chinese culture, philosophy, and way of thinking are unique and cannot be accounted for by some...

  15. Aging of immune system: Immune signature from peripheral blood lymphocyte subsets in 1068 healthy adults.

    Science.gov (United States)

    Qin, Ling; Jing, Xie; Qiu, Zhifeng; Cao, Wei; Jiao, Yang; Routy, Jean-Pierre; Li, Taisheng

    2016-05-01

    Aging is a major risk factor for several conditions including neurodegenerative, cardiovascular diseases and cancer. Functional impairments in cellular pathways controlling genomic stability, and immune control have been identified. Biomarker of immune senescence is needed to improve vaccine response and to develop therapy to improve immune control. To identify phenotypic signature of circulating immune cells with aging, we enrolled 1068 Chinese healthy volunteers ranging from 18 to 80 years old. The decreased naïve CD4+ and CD8+ T cells, increased memory CD4+ or CD8+ T cells, loss of CD28 expression on T cells and reverse trend of CD38 and HLA-DR, were significant for aging of immune system. Conversely, the absolute counts and percentage of NK cells and CD19+B cells maintained stable in aging individuals. The Chinese reference ranges of absolute counts and percentage of peripheral lymphocyte in this study might be useful for future clinical evaluation.

  16. Application of Toxic Chinese Medicine in Chinese Pharmacopoeia

    Science.gov (United States)

    Zhao, Hui; Feng, Yu; Mao, Mingsan

    2018-01-01

    Objective: Explore the application characteristics of proprietary Chinese medicine prescriptions containing toxic herbs in pharmacopoeia. Methods: In this paper, according to the clinical application of pharmacopoeia proprietary Chinese medicine is divided into table agent, Qushu agent, diarrhea agent, heat agent, Wen Li agent, cough and asthma agents, resuscitation agent, Gutian agent, Fuzheng agent, Anshen agent, hemostatic agent, The traditional Chinese medicine prescription and the clinical application of the Chinese herbal medicine containing the toxic Chinese medicine were analyzed and sorted out., Summed up the compatibility of toxic herbs and application characteristics. Results: Toxic Chinese herbal medicine in the cure of traditional Chinese medicine to play a long-standing role, through the overall thinking, dialectical thinking, and thinking of toxic Chinese medicine in the analysis of Chinese medicine that [2], toxic Chinese medicine in the application of proprietary Chinese medicine can not lack. Conclusion: Pharmacopoeia included proprietary Chinese medicine not only in the clinical treatment of good, but also the application of its toxic traditional Chinese medicine and its understanding of the enrichment of the toxic characteristics of traditional Chinese medicine and treatment-related disease pathology between the points of contact for patients with clinical applications Based on and theoretical guidance of Chinese medicine [3].

  17. Performing "Chinese-ness" in Singkawang

    NARCIS (Netherlands)

    Ong, C.E.; Ormond, M.E.; Sulianti, Dian

    2017-01-01

    Through an examination of two festivals – Qing Ming and Cap Go Meh – in the town of Singkawang in Indonesian Borneo (Kalimantan), we show how Singkawang-bound Chinese Indonesian tourists and their Singkawang-based relatives produce a diasporic heritage network through ‘moorings’ generated by both

  18. Magnetic Signature of Brushless Electric Motors

    National Research Council Canada - National Science Library

    Clarke, David

    2006-01-01

    Brushless electric motors are used in a number of underwater vehicles. When these underwater vehicles are used for mine clearance operations the magnetic signature of the brushless motors is important...

  19. Magnetic signature surveillance of nuclear fuel

    International Nuclear Information System (INIS)

    Bernatowicz, H.; Schoenig, F.C.

    1981-01-01

    Typical nuclear fuel material contains tramp ferromagnetic particles of random size and distribution. Also, selected amounts of paramagnetic or ferromagnetic material can be added at random or at known positions in the fuel material. The fuel material in its non-magnetic container is scanned along its length by magnetic susceptibility detecting apparatus whereby susceptibility changes along its length are obtained and provide a unique signal waveform of the container of fuel material as a signature thereof. The output signature is stored. At subsequent times in its life the container is again scanned and respective signatures obtained which are compared with the initially obtained signature, any differences indicating alteration or tampering with the fuel material. If the fuel material includes a paramagnetic additive by taking two measurements along the container the effects thereof can be cancelled out. (author)

  20. Blind Quantum Signature with Blind Quantum Computation

    Science.gov (United States)

    Li, Wei; Shi, Ronghua; Guo, Ying

    2017-04-01

    Blind quantum computation allows a client without quantum abilities to interact with a quantum server to perform a unconditional secure computing protocol, while protecting client's privacy. Motivated by confidentiality of blind quantum computation, a blind quantum signature scheme is designed with laconic structure. Different from the traditional signature schemes, the signing and verifying operations are performed through measurement-based quantum computation. Inputs of blind quantum computation are securely controlled with multi-qubit entangled states. The unique signature of the transmitted message is generated by the signer without leaking information in imperfect channels. Whereas, the receiver can verify the validity of the signature using the quantum matching algorithm. The security is guaranteed by entanglement of quantum system for blind quantum computation. It provides a potential practical application for e-commerce in the cloud computing and first-generation quantum computation.

  1. Signature scheme based on bilinear pairs

    Science.gov (United States)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  2. Signature for the shape of the universe

    International Nuclear Information System (INIS)

    Gomero, G.I.; Reboucas, M.J.; Teixeira, A.F.F.

    2001-03-01

    If the universe has a nontrival shape (topology) the sky may show multiple correlated images of cosmic objects. These correlations can be counched in terms of distance correlations. We propose a statistical quantity which can be used to reveal the topological signature of any Roberston-Walker (RW) spacetime with nontrivial topology. We also show through computer-aided simulations how one can extract the topological signatures of flat elliptic and hyperbolic RW universes with nontrivial topology. (author)

  3. Signature-based store checking buffer

    Science.gov (United States)

    Sridharan, Vilas; Gurumurthi, Sudhanva

    2015-06-02

    A system and method for optimizing redundant output verification, are provided. A hardware-based store fingerprint buffer receives multiple instances of output from multiple instances of computation. The store fingerprint buffer generates a signature from the content included in the multiple instances of output. When a barrier is reached, the store fingerprint buffer uses the signature to verify the content is error-free.

  4. Neutral signature Walker-VSI metrics

    International Nuclear Information System (INIS)

    Coley, A; McNutt, D; Musoke, N; Brooks, D; Hervik, S

    2014-01-01

    We will construct explicit examples of four-dimensional neutral signature Walker (but not necessarily degenerate Kundt) spaces for which all of the polynomial scalar curvature invariants vanish. We then investigate the properties of some particular subclasses of Ricci flat spaces. We also briefly describe some four-dimensional neutral signature Einstein spaces for which all of the polynomial scalar curvature invariants are constant. (paper)

  5. Tightly Secure Signatures From Lossy Identification Schemes

    OpenAIRE

    Abdalla , Michel; Fouque , Pierre-Alain; Lyubashevsky , Vadim; Tibouchi , Mehdi

    2015-01-01

    International audience; In this paper, we present three digital signature schemes with tight security reductions in the random oracle model. Our first signature scheme is a particularly efficient version of the short exponent discrete log-based scheme of Girault et al. (J Cryptol 19(4):463–487, 2006). Our scheme has a tight reduction to the decisional short discrete logarithm problem, while still maintaining the non-tight reduction to the computational version of the problem upon which the or...

  6. Chemical and isotopic fingerprinting of ancient Chinese porcelains

    International Nuclear Information System (INIS)

    Zhao, J.-X.; Li, B.-P.; Greig, A.; Collerson, K.D.; Feng, Y.-X.

    2005-01-01

    We have obtained unequivocal fingerprinting for many Chinese porcelains of utmost significance, based on high-precision multi-element and isotopic analysis by inductively-coupled mass spectrometry (ICP-MS) and thermal ionization mass spectrometry (TIMS) in our laboratory. As most ancient Chinese kilns used raw materials mined from local areas, differences in the geochemistry and mineralogy of these raw materials are expected to be preserved as distinctive geochemical and isotopic signatures in finished products and this may be useful for identifying their sources. Production techniques, such as purifying and mixing of different raw materials, may also vary from kiln to kiln, or may even change over time. All of that could also potentially leave a characteristic chemical and isotopic signature in a kiln's finished products. Using a tiny amount (often a few tens milligrams) of porcelain material, more than 40 element concentrations and Sr-Nd isotopic compositions can be rapidly and precisely determined on the ICP-MS and TIMS, respectively. The analytical results show that visibly similar Chinese porcelains made in different places and/or dynasties are strikingly distinctive. The data also allow modern fakes to be readily distinguished from antique porcelains. (author). 4 refs., 7 figs

  7. Traditional Chinese Biotechnology

    Science.gov (United States)

    Xu, Yan; Wang, Dong; Fan, Wen Lai; Mu, Xiao Qing; Chen, Jian

    The earliest industrial biotechnology originated in ancient China and developed into a vibrant industry in traditional Chinese liquor, rice wine, soy sauce, and vinegar. It is now a significant component of the Chinese economy valued annually at about 150 billion RMB. Although the production methods had existed and remained basically unchanged for centuries, modern developments in biotechnology and related fields in the last decades have greatly impacted on these industries and led to numerous technological innovations. In this chapter, the main biochemical processes and related technological innovations in traditional Chinese biotechnology are illustrated with recent advances in functional microbiology, microbial ecology, solid-state fermentation, enzymology, chemistry of impact flavor compounds, and improvements made to relevant traditional industrial facilities. Recent biotechnological advances in making Chinese liquor, rice wine, soy sauce, and vinegar are reviewed.

  8. Chinese implicit leadership theory.

    Science.gov (United States)

    Ling, W; Chia, R C; Fang, L

    2000-12-01

    In a 1st attempt to identify an implicit theory of leadership among Chinese people, the authors developed the Chinese Implicit Leadership Scale (CILS) in Study 1. In Study 2, they administered the CILS to 622 Chinese participants from 5 occupation groups, to explore differences in perceptions of leadership. Factor analysis yielded 4 factors of leadership: Personal Morality, Goal Efficiency, Interpersonal Competence, and Versatility. Social groups differing in age, gender, education level, and occupation rated these factors. Results showed no significant gender differences, and the underlying cause for social group differences was education level. All groups gave the highest ratings to Interpersonal Competence, reflecting the enormous importance of this factor, which is consistent with Chinese collectivist values.

  9. Danish-accented Chinese

    DEFF Research Database (Denmark)

    Wang, Lei; Sloos, Marjoleine 莱娜; Zhang, Chun

    In search for a linguistic basis for the education of Chinese as a foreign language CFL in Denmark, we set up a new line of investigation into CFL. This research focuses on the phonetics and phonology of Mandarin Chinese as compared to Danish. Considering the sound systems of both languages, we......-ba /pha pa/ ta-da /tha ta/ ka-ga / kha-ka/ For L2 acquisition it is held that same and new phonemes are (relatively) easy acquired, whereas similar but not identical sounds are difficult to learn. New sounds are initially mapped onto the L1 phoneme inventory (Kuhl 1991). For Danish, this would predict...... instruction, which pitch contours do the Danish learners of Chinese use on neutral tones and to what extent does their production match that of native speakers? Future research may include Norwegian and Swedish-accented Chinese and a comparison between the different Germanic accents of CFL. Reference Kuhl, P...

  10. A Black Hole Spectral Signature

    Science.gov (United States)

    Titarchuk, Lev; Laurent, Philippe

    2000-03-01

    An accreting black hole is, by definition, characterized by the drain. Namely, the matter falls into a black hole much the same way as water disappears down a drain matter goes in and nothing comes out. As this can only happen in a black hole, it provides a way to see ``a black hole'', an unique observational signature. The accretion proceeds almost in a free-fall manner close to the black hole horizon, where the strong gravitational field dominates the pressure forces. In this paper we present analytical calculations and Monte-Carlo simulations of the specific features of X-ray spectra formed as a result of upscattering of the soft (disk) photons in the converging inflow (CI) into the black hole. The full relativistic treatment has been implemented to reproduce these spectra. We show that spectra in the soft state of black hole systems (BHS) can be described as the sum of a thermal (disk) component and the convolution of some fraction of this component with the CI upscattering spread (Greens) function. The latter boosted photon component is seen as an extended power-law at energies much higher than the characteristic energy of the soft photons. We demonstrate the stability of the power spectral index over a wide range of the plasma temperature 0 - 10 keV and mass accretion rates (higher than 2 in Eddington units). We also demonstrate that the sharp high energy cutoff occurs at energies of 200-400 keV which are related to the average energy of electrons mec2 impinging upon the event horizon. The spectrum is practically identical to the standard thermal Comptonization spectrum when the CI plasma temperature is getting of order of 50 keV (the typical ones for the hard state of BHS). In this case one can see the effect of the bulk motion only at high energies where there is an excess in the CI spectrum with respect to the pure thermal one. Furthermore we demonstrate that the change of spectral shapes from the soft X-ray state to the hard X-ray state is clearly to be

  11. The Chinese nuclear program

    International Nuclear Information System (INIS)

    Prenez, J.C.; Bettoun, G.

    2009-01-01

    This series of slides presents the organization of the Chinese nuclear industry and its perspectives for the 2 next decades. The presentation is divided into 5 parts. Part one: the energy sector in China. Due to the economic development of the country this sector is flourishing and reaches an average growth rate of 9% per year. More than fifty per cent of the power plants being built in the world, are located in China. The electricity production stems by far from fossil energies (>80%) but this part is expected to decrease to reach 70% in 2020. Part 2: the Chinese nuclear program. This program is dual: the massive deployment of chinese improved reactors of second generation (the construction of 6 CPR1000 reactors will be launched each year) and the import and assimilation of reactors of the third generation: 4 AP1000 and 2 EPR are being built. Part 3: the organization of the Chinese nuclear sector. The main actors are CNNC (China National Nuclear Corporation), CGNPC (China Guangdong Nuclear Power Corporation), CPI (China Power Investment Corporation), SNPTC (State Nuclear Power Technology Corporation). The main 5 Chinese suppliers are also presented. Part 4: The role of EDF. Today's EDF role is multiple: to be active in the Chinese nuclear program, to go beyond technical assistance to reach partnership, to invest in Chinese power plants, to promote cooperation between French and Chinese actors of the nuclear industry. A lot of joint ventures have been created. Part 5: the Taishan project. Taishan is a coastal site near Macao in the Guangdong province in which 2 EPR are being built, the first concrete was cast in october 2009, 52 months of construction are scheduled and the first unit will be commissioned in end 2013 while the second commissioning is planned for end 2014. (A.C.)

  12. Chinese students' great expectations

    DEFF Research Database (Denmark)

    Thøgersen, Stig

    2013-01-01

    The article focuses on Chinese students' hopes and expectations before leaving to study abroad. The national political environment for their decision to go abroad is shaped by an official narrative of China's transition to a more creative and innovative economy. Students draw on this narrative to...... system, they think of themselves as having a role in the transformation of Chinese attitudes to education and parent-child relations....

  13. Chinese Typography Transfer

    OpenAIRE

    Chang, Jie; Gu, Yujun

    2017-01-01

    In this paper, we propose a new network architecture for Chinese typography transformation based on deep learning. The architecture consists of two sub-networks: (1)a fully convolutional network(FCN) aiming at transferring specified typography style to another in condition of preserving structure information; (2)an adversarial network aiming at generating more realistic strokes in some details. Unlike models proposed before 2012 relying on the complex segmentation of Chinese components or str...

  14. Does Twitter trigger bursts in signature collections?

    Directory of Open Access Journals (Sweden)

    Rui Yamaguchi

    Full Text Available INTRODUCTION: The quantification of social media impacts on societal and political events is a difficult undertaking. The Japanese Society of Oriental Medicine started a signature-collecting campaign to oppose a medical policy of the Government Revitalization Unit to exclude a traditional Japanese medicine, "Kampo," from the public insurance system. The signature count showed a series of aberrant bursts from November 26 to 29, 2009. In the same interval, the number of messages on Twitter including the keywords "Signature" and "Kampo," increased abruptly. Moreover, the number of messages on an Internet forum that discussed the policy and called for signatures showed a train of spikes. METHODS AND FINDINGS: In order to estimate the contributions of social media, we developed a statistical model with state-space modeling framework that distinguishes the contributions of multiple social media in time-series of collected public opinions. We applied the model to the time-series of signature counts of the campaign and quantified contributions of two social media, i.e., Twitter and an Internet forum, by the estimation. We found that a considerable portion (78% of the signatures was affected from either of the social media throughout the campaign and the Twitter effect (26% was smaller than the Forum effect (52% in total, although Twitter probably triggered the initial two bursts of signatures. Comparisons of the estimated profiles of the both effects suggested distinctions between the social media in terms of sustainable impact of messages or tweets. Twitter shows messages on various topics on a time-line; newer messages push out older ones. Twitter may diminish the impact of messages that are tweeted intermittently. CONCLUSIONS: The quantification of social media impacts is beneficial to better understand people's tendency and may promote developing strategies to engage public opinions effectively. Our proposed method is a promising tool to explore

  15. Does Twitter trigger bursts in signature collections?

    Science.gov (United States)

    Yamaguchi, Rui; Imoto, Seiya; Kami, Masahiro; Watanabe, Kenji; Miyano, Satoru; Yuji, Koichiro

    2013-01-01

    The quantification of social media impacts on societal and political events is a difficult undertaking. The Japanese Society of Oriental Medicine started a signature-collecting campaign to oppose a medical policy of the Government Revitalization Unit to exclude a traditional Japanese medicine, "Kampo," from the public insurance system. The signature count showed a series of aberrant bursts from November 26 to 29, 2009. In the same interval, the number of messages on Twitter including the keywords "Signature" and "Kampo," increased abruptly. Moreover, the number of messages on an Internet forum that discussed the policy and called for signatures showed a train of spikes. In order to estimate the contributions of social media, we developed a statistical model with state-space modeling framework that distinguishes the contributions of multiple social media in time-series of collected public opinions. We applied the model to the time-series of signature counts of the campaign and quantified contributions of two social media, i.e., Twitter and an Internet forum, by the estimation. We found that a considerable portion (78%) of the signatures was affected from either of the social media throughout the campaign and the Twitter effect (26%) was smaller than the Forum effect (52%) in total, although Twitter probably triggered the initial two bursts of signatures. Comparisons of the estimated profiles of the both effects suggested distinctions between the social media in terms of sustainable impact of messages or tweets. Twitter shows messages on various topics on a time-line; newer messages push out older ones. Twitter may diminish the impact of messages that are tweeted intermittently. The quantification of social media impacts is beneficial to better understand people's tendency and may promote developing strategies to engage public opinions effectively. Our proposed method is a promising tool to explore information hidden in social phenomena.

  16. Research on a New Signature Scheme on Blockchain

    Directory of Open Access Journals (Sweden)

    Chao Yuan

    2017-01-01

    Full Text Available With the rise of Bitcoin, blockchain which is the core technology of Bitcoin has received increasing attention. Privacy preserving and performance on blockchain are two research points in academia and business, but there are still some unresolved issues in both respects. An aggregate signature scheme is a digital signature that supports making signatures on many different messages generated by many different users. Using aggregate signature, the size of the signature could be shortened by compressing multiple signatures into a single signature. In this paper, a new signature scheme for transactions on blockchain based on the aggregate signature was proposed. It was worth noting that elliptic curve discrete logarithm problem and bilinear maps played major roles in our signature scheme. And the security properties of our signature scheme were proved. In our signature scheme, the amount will be hidden especially in the transactions which contain multiple inputs and outputs. Additionally, the size of the signature on transaction is constant regardless of the number of inputs and outputs that the transaction contains, which can improve the performance of signature. Finally, we gave an application scenario for our signature scheme which aims to achieve the transactions of big data on blockchain.

  17. Lattice-Based Revocable Certificateless Signature

    Directory of Open Access Journals (Sweden)

    Ying-Hao Hung

    2017-10-01

    Full Text Available Certificateless signatures (CLS are noticeable because they may resolve the key escrow problem in ID-based signatures and break away the management problem regarding certificate in conventional signatures. However, the security of the mostly previous CLS schemes relies on the difficulty of solving discrete logarithm or large integer factorization problems. These two problems would be solved by quantum computers in the future so that the signature schemes based on them will also become insecure. For post-quantum cryptography, lattice-based cryptography is significant due to its efficiency and security. However, no study on addressing the revocation problem in the existing lattice-based CLS schemes is presented. In this paper, we focus on the revocation issue and present the first revocable CLS (RCLS scheme over lattices. Based on the short integer solution (SIS assumption over lattices, the proposed lattice-based RCLS scheme is shown to be existential unforgeability against adaptive chosen message attacks. By performance analysis and comparisons, the proposed lattice-based RCLS scheme is better than the previously proposed lattice-based CLS scheme, in terms of private key size, signature length and the revocation mechanism.

  18. Calculated NWIS signatures for enriched uranium metal

    International Nuclear Information System (INIS)

    Valentine, T.E.; Mihalczo, J.T.; Koehler, P.E.

    1995-01-01

    Nuclear Weapons Identification System (NWIS) signatures have been calculated using a Monte Carlo transport code for measurement configurations of a 252 Cf source, detectors, and a uranium metal casting. NWIS signatures consist of a wide variety of time-and frequency-analysis signatures such as the time distribution of neutrons after californium fission, the time distribution of counts in a detector after a previous count, the number of times n pulses occur in a time interval, and various frequency-analysis signatures, such as auto-power and cross-power spectral densities, coherences, and a ratio of spectral densities. This ratio is independent of detection efficiency. The analysis presented here, using the MCNP-DSP code, evaluates the applicability of this method for measurement of the 235 U content of 19-kg castings of depleted uranium and uranium with enrichments of 20, 40, 60, 80, 90, and 93.2 wt % 235 U. The dependence of the wide variety of NWIS signatures on 235 U content and possible configurations of a measurement system are presented. These preliminary calculations indicate short measurement times. Additional calculations are being performed to optimize the source-detector-moderator-casting configuration for the shortest measurement time. Although the NWIS method was developed for nuclear weapons identification, the development of a small processor now allows it to be also applied in a practical way to subcriticality measurements, nuclear fuel process monitoring and qualitative nondestructive assay of special nuclear material

  19. A Neuroanatomical Signature for Schizophrenia Across Different Ethnic Groups.

    Science.gov (United States)

    Gong, Qiyong; Dazzan, Paola; Scarpazza, Cristina; Kasai, Kyioto; Hu, Xinyu; Marques, Tiago R; Iwashiro, Norichika; Huang, Xiaoqi; Murray, Robin M; Koike, Shinsuke; David, Anthony S; Yamasue, Hidenori; Lui, Su; Mechelli, Andrea

    2015-11-01

    Schizophrenia is a disabling clinical syndrome found across the world. While the incidence and clinical expression of this illness are strongly influenced by ethnic factors, it is unclear whether patients from different ethnicities show distinct brain deficits. In this multicentre study, we used structural Magnetic Resonance Imaging to investigate neuroanatomy in 126 patients with first episode schizophrenia who came from 4 ethnically distinct cohorts (White Caucasians, African-Caribbeans, Japanese, and Chinese). Each patient was individually matched with a healthy control of the same ethnicity, gender, and age (±1 year). We report a reduction in the gray matter volume of the right anterior insula in patients relative to controls (P ethnic groups despite differences in psychopathology, exposure to antipsychotic medication and image acquisition sequence. This finding provides evidence for a neuroanatomical signature of schizophrenia expressed above and beyond ethnic variations in incidence and clinical expression. In light of the existing literature, implicating the right anterior insula in bipolar disorder, depression, addiction, obsessive-compulsive disorder, and anxiety, we speculate that the neuroanatomical deficit reported here may represent a transdiagnostic feature of Axis I disorders. © The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center.

  20. Trace element ink spiking for signature authentication

    International Nuclear Information System (INIS)

    Hatzistavros, V.S.; Kallithrakas-Kontos, N.G.

    2008-01-01

    Signature authentication is a critical question in forensic document examination. Last years the evolution of personal computers made signature copying a quite easy task, so the development of new ways for signature authentication is crucial. In the present work a commercial ink was spiked with many trace elements in various concentrations. Inorganic and organometallic ink soluble compounds were used as spiking agents, whilst ink retained its initial properties. The spiked inks were used for paper writing and the documents were analyzed by a non destructive method, the energy dispersive X-ray fluorescence. The thin target model was proved right for quantitative analysis and a very good linear relationship of the intensity (X-ray signal) against concentration was estimated for all used elements. Intensity ratios between different elements in the same ink gave very stable results, independent on the writing alterations. The impact of time both to written document and prepared inks was also investigated. (author)

  1. A Methodology for Calculating Radiation Signatures

    Energy Technology Data Exchange (ETDEWEB)

    Klasky, Marc Louis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wilcox, Trevor [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Bathke, Charles G. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); James, Michael R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-05-01

    A rigorous formalism is presented for calculating radiation signatures from both Special Nuclear Material (SNM) as well as radiological sources. The use of MCNP6 in conjunction with CINDER/ORIGEN is described to allow for the determination of both neutron and photon leakages from objects of interest. In addition, a description of the use of MCNP6 to properly model the background neutron and photon sources is also presented. Examinations of the physics issues encountered in the modeling are investigated so as to allow for guidance in the user discerning the relevant physics to incorporate into general radiation signature calculations. Furthermore, examples are provided to assist in delineating the pertinent physics that must be accounted for. Finally, examples of detector modeling utilizing MCNP are provided along with a discussion on the generation of Receiver Operating Curves, which are the suggested means by which to determine detectability radiation signatures emanating from objects.

  2. Cryptanalysis of the arbitrated quantum signature protocols

    International Nuclear Information System (INIS)

    Gao Fei; Qin Sujuan; Guo Fenzhuo; Wen Qiaoyan

    2011-01-01

    As a new model for signing quantum messages, arbitrated quantum signature (AQS) has recently received a lot of attention. In this paper we study the cryptanalysis of previous AQS protocols from the aspects of forgery and disavowal. We show that in these protocols the receiver, Bob, can realize existential forgery of the sender's signature under known message attack. Bob can even achieve universal forgery when the protocols are used to sign a classical message. Furthermore, the sender, Alice, can successfully disavow any of her signatures by simple attack. The attack strategies are described in detail and some discussions about the potential improvements of the protocols are given. Finally we also present several interesting topics on AQS protocols that can be studied in future.

  3. Molecular Signature in HCV-Positive Lymphomas

    Directory of Open Access Journals (Sweden)

    Valli De Re

    2012-01-01

    Full Text Available Hepatitis C virus (HCV is a positive, single-stranded RNA virus, which has been associated to different subtypes of B-cell non-Hodgkin lymphoma (B-NHL. Cumulative evidence suggests an HCV-related antigen driven process in the B-NHL development. The underlying molecular signature associated to HCV-related B-NHL has to date remained obscure. In this review, we discuss the recent developments in this field with a special mention to different sets of genes whose expression is associated with BCR coupled to Blys signaling which in turn was found to be linked to B-cell maturation stages and NF-κb transcription factor. Even if recent progress on HCV-B-NHL signature has been made, the precise relationship between HCV and lymphoma development and phenotype signature remain to be clarified.

  4. Selection signatures in worldwide sheep populations.

    Science.gov (United States)

    Fariello, Maria-Ines; Servin, Bertrand; Tosser-Klopp, Gwenola; Rupp, Rachel; Moreno, Carole; San Cristobal, Magali; Boitard, Simon

    2014-01-01

    The diversity of populations in domestic species offers great opportunities to study genome response to selection. The recently published Sheep HapMap dataset is a great example of characterization of the world wide genetic diversity in sheep. In this study, we re-analyzed the Sheep HapMap dataset to identify selection signatures in worldwide sheep populations. Compared to previous analyses, we made use of statistical methods that (i) take account of the hierarchical structure of sheep populations, (ii) make use of linkage disequilibrium information and (iii) focus specifically on either recent or older selection signatures. We show that this allows pinpointing several new selection signatures in the sheep genome and distinguishing those related to modern breeding objectives and to earlier post-domestication constraints. The newly identified regions, together with the ones previously identified, reveal the extensive genome response to selection on morphology, color and adaptation to new environments.

  5. Biomarker Gene Signature Discovery Integrating Network Knowledge

    Directory of Open Access Journals (Sweden)

    Holger Fröhlich

    2012-02-01

    Full Text Available Discovery of prognostic and diagnostic biomarker gene signatures for diseases, such as cancer, is seen as a major step towards a better personalized medicine. During the last decade various methods, mainly coming from the machine learning or statistical domain, have been proposed for that purpose. However, one important obstacle for making gene signatures a standard tool in clinical diagnosis is the typical low reproducibility of these signatures combined with the difficulty to achieve a clear biological interpretation. For that purpose in the last years there has been a growing interest in approaches that try to integrate information from molecular interaction networks. Here we review the current state of research in this field by giving an overview about so-far proposed approaches.

  6. Estimating physiological skin parameters from hyperspectral signatures

    Science.gov (United States)

    Vyas, Saurabh; Banerjee, Amit; Burlina, Philippe

    2013-05-01

    We describe an approach for estimating human skin parameters, such as melanosome concentration, collagen concentration, oxygen saturation, and blood volume, using hyperspectral radiometric measurements (signatures) obtained from in vivo skin. We use a computational model based on Kubelka-Munk theory and the Fresnel equations. This model forward maps the skin parameters to a corresponding multiband reflectance spectra. Machine-learning-based regression is used to generate the inverse map, and hence estimate skin parameters from hyperspectral signatures. We test our methods using synthetic and in vivo skin signatures obtained in the visible through the short wave infrared domains from 24 patients of both genders and Caucasian, Asian, and African American ethnicities. Performance validation shows promising results: good agreement with the ground truth and well-established physiological precepts. These methods have potential use in the characterization of skin abnormalities and in minimally-invasive prescreening of malignant skin cancers.

  7. Older Chinese-Australian and Chinese community music engagement

    OpenAIRE

    Li, Sicong

    2017-01-01

    This research study will investigate community music engagement by both Chinese-Australians and Chinese older people at two different older people’s organizations with the aim of exploring the affects of music engagement on older people. The study seeks to explore cultural differences between Chinese-Australian older people and Chinese older people as they relate to their music engagement. The research contentions were that (1) active music engagement can enhance the quality of the life of ol...

  8. Peripheral blood signatures of lead exposure.

    Directory of Open Access Journals (Sweden)

    Heather G LaBreche

    Full Text Available BACKGROUND: Current evidence indicates that even low-level lead (Pb exposure can have detrimental effects, especially in children. We tested the hypothesis that Pb exposure alters gene expression patterns in peripheral blood cells and that these changes reflect dose-specific alterations in the activity of particular pathways. METHODOLOGY/PRINCIPAL FINDING: Using Affymetrix Mouse Genome 430 2.0 arrays, we examined gene expression changes in the peripheral blood of female Balb/c mice following exposure to per os lead acetate trihydrate or plain drinking water for two weeks and after a two-week recovery period. Data sets were RMA-normalized and dose-specific signatures were generated using established methods of supervised classification and binary regression. Pathway activity was analyzed using the ScoreSignatures module from GenePattern. CONCLUSIONS/SIGNIFICANCE: The low-level Pb signature was 93% sensitive and 100% specific in classifying samples a leave-one-out crossvalidation. The high-level Pb signature demonstrated 100% sensitivity and specificity in the leave-one-out crossvalidation. These two signatures exhibited dose-specificity in their ability to predict Pb exposure and had little overlap in terms of constituent genes. The signatures also seemed to reflect current levels of Pb exposure rather than past exposure. Finally, the two doses showed differential activation of cellular pathways. Low-level Pb exposure increased activity of the interferon-gamma pathway, whereas high-level Pb exposure increased activity of the E2F1 pathway.

  9. Doppler Velocity Signatures of Idealized Elliptical Vortices

    Directory of Open Access Journals (Sweden)

    Wen-Chau Lee

    2006-01-01

    Full Text Available Doppler radar observations have revealed a class of atmospheric vortices (tropical cyclones, tornadoes, dust devils that possess elliptical radar reflectivity signatures. One famous example is Typhoon Herb (1996 that maintained its elliptical reflectivity structure over a 40-hour period. Theoretical work and dual-Doppler analyses of observed tropical cyclones have suggested two physical mechanisms that can explain the formation of two types of elliptical vortices observed in nature, namely, the combination of a circular vortex with either a wavenumber two vortex Rossby wave or a deformation field. The characteristics of these two types of elliptical vortices and their corresponding Doppler velocity signatures have not been previously examined.

  10. KEA-71 Smart Current Signature Sensor (SCSS)

    Science.gov (United States)

    Perotti, Jose M.

    2010-01-01

    This slide presentation reviews the development and uses of the Smart Current Signature Sensor (SCSS), also known as the Valve Health Monitor (VHM) system. SCSS provides a way to not only monitor real-time the valve's operation in a non invasive manner, but also to monitor its health (Fault Detection and Isolation) and identify potential faults and/or degradation in the near future (Prediction/Prognosis). This technology approach is not only applicable for solenoid valves, and it could be extrapolated to other electrical components with repeatable electrical current signatures such as motors.

  11. Security problem on arbitrated quantum signature schemes

    International Nuclear Information System (INIS)

    Choi, Jeong Woon; Chang, Ku-Young; Hong, Dowon

    2011-01-01

    Many arbitrated quantum signature schemes implemented with the help of a trusted third party have been developed up to now. In order to guarantee unconditional security, most of them take advantage of the optimal quantum one-time encryption based on Pauli operators. However, in this paper we point out that the previous schemes provide security only against a total break attack and show in fact that there exists an existential forgery attack that can validly modify the transmitted pair of message and signature. In addition, we also provide a simple method to recover security against the proposed attack.

  12. Plasma Signatures of Radial Field Power Dropouts

    International Nuclear Information System (INIS)

    Lucek, E.A.; Horbury, T.S.; Balogh, A.; McComas, D.J.

    1998-01-01

    A class of small scale structures, with a near-radial magnetic field and a drop in magnetic field fluctuation power, have recently been identified in the polar solar wind. An earlier study of 24 events, each lasting for 6 hours or more, identified no clear plasma signature. In an extension of that work, radial intervals lasting for 4 hours or more (89 in total), have been used to search for a statistically significant plasma signature. It was found that, despite considerable variations between intervals, there was a small but significant drop, on average, in plasma temperature, density and β during these events

  13. Transient thermal camouflage and heat signature control

    Science.gov (United States)

    Yang, Tian-Zhi; Su, Yishu; Xu, Weikai; Yang, Xiao-Dong

    2016-09-01

    Thermal metamaterials have been proposed to manipulate heat flux as a new way to cloak or camouflage objects in the infrared world. To date, however, thermal metamaterials only operate in the steady-state and exhibit detectable, transient heat signatures. In this letter, the theoretical basis for a thermal camouflaging technique with controlled transient diffusion is presented. This technique renders an object invisible in real time. More importantly, the thermal camouflaging device instantaneously generates a pre-designed heat signature and behaves as a perfect thermal illusion device. A metamaterial coating with homogeneous and isotropic thermal conductivity, density, and volumetric heat capacity was fabricated and very good camouflaging performance was achieved.

  14. Security problem on arbitrated quantum signature schemes

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jeong Woon [Emerging Technology R and D Center, SK Telecom, Kyunggi 463-784 (Korea, Republic of); Chang, Ku-Young; Hong, Dowon [Cryptography Research Team, Electronics and Telecommunications Research Institute, Daejeon 305-700 (Korea, Republic of)

    2011-12-15

    Many arbitrated quantum signature schemes implemented with the help of a trusted third party have been developed up to now. In order to guarantee unconditional security, most of them take advantage of the optimal quantum one-time encryption based on Pauli operators. However, in this paper we point out that the previous schemes provide security only against a total break attack and show in fact that there exists an existential forgery attack that can validly modify the transmitted pair of message and signature. In addition, we also provide a simple method to recover security against the proposed attack.

  15. COMPUTER-IMPLEMENTED METHOD OF PERFORMING A SEARCH USING SIGNATURES

    DEFF Research Database (Denmark)

    2017-01-01

    A computer-implemented method of processing a query vector and a data vector), comprising: generating a set of masks and a first set of multiple signatures and a second set of multiple signatures by applying the set of masks to the query vector and the data vector, respectively, and generating...... candidate pairs, of a first signature and a second signature, by identifying matches of a first signature and a second signature. The set of masks comprises a configuration of the elements that is a Hadamard code; a permutation of a Hadamard code; or a code that deviates from a Hadamard code...

  16. Quantum multi-signature protocol based on teleportation

    International Nuclear Information System (INIS)

    Wen Xiao-jun; Liu Yun; Sun Yu

    2007-01-01

    In this paper, a protocol which can be used in multi-user quantum signature is proposed. The scheme of signature and verification is based on the correlation of Greenberger-Horne-Zeilinger (GHZ) states and the controlled quantum teleportation. Different from the digital signatures, which are based on computational complexity, the proposed protocol has perfect security in the noiseless quantum channels. Compared to previous quantum signature schemes, this protocol can verify the signature independent of an arbitrator as well as realize multi-user signature together. (orig.)

  17. A group signature scheme based on quantum teleportation

    International Nuclear Information System (INIS)

    Wen Xiaojun; Tian Yuan; Ji Liping; Niu Xiamu

    2010-01-01

    In this paper, we present a group signature scheme using quantum teleportation. Different from classical group signature and current quantum signature schemes, which could only deliver either group signature or unconditional security, our scheme guarantees both by adopting quantum key preparation, quantum encryption algorithm and quantum teleportation. Security analysis proved that our scheme has the characteristics of group signature, non-counterfeit, non-disavowal, blindness and traceability. Our quantum group signature scheme has a foreseeable application in the e-payment system, e-government, e-business, etc.

  18. A group signature scheme based on quantum teleportation

    Energy Technology Data Exchange (ETDEWEB)

    Wen Xiaojun; Tian Yuan; Ji Liping; Niu Xiamu, E-mail: wxjun36@gmail.co [Information Countermeasure Technique Research Institute, Harbin Institute of Technology, Harbin 150001 (China)

    2010-05-01

    In this paper, we present a group signature scheme using quantum teleportation. Different from classical group signature and current quantum signature schemes, which could only deliver either group signature or unconditional security, our scheme guarantees both by adopting quantum key preparation, quantum encryption algorithm and quantum teleportation. Security analysis proved that our scheme has the characteristics of group signature, non-counterfeit, non-disavowal, blindness and traceability. Our quantum group signature scheme has a foreseeable application in the e-payment system, e-government, e-business, etc.

  19. On Chinese Culture Curriculum Planning

    Science.gov (United States)

    Wang, Catherine

    2006-01-01

    The importance of cultural elements in foreign language teaching has been widely accepted in recent years. This applies particularly to the teaching of Chinese as a foreign language (TCFL) to non-native Chinese speakers at tertiary level in mainland China. However, there is no commonly accepted blueprint that defines the parts of Chinese culture…

  20. Concepts of Chinese Folk Happiness

    Science.gov (United States)

    Ip, Po Keung

    2011-01-01

    Discourses on Chinese folk happiness are often based on anecdotal narratives or qualitative analysis. Two traditional concepts of happiness popular in Chinese culture are introduced. The paper constructs a concept of Chinese folk happiness on basis of the findings of a scientific survey on the Taiwanese people regarding their concepts of…

  1. Traditional Chinese Masks Reveal Customs

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    CHINESE masks are undoubtedly an important component in the worldwide mask culture. Minority nationality masks are a major component of China’s mask culture. Traditional Chinese masks, or nuo, represent a cultural component which originated from religious rites in prehistoric times. Various types of nuo are highly valuable for studies of Chinese customs.

  2. The Chinese in the Netherlands

    NARCIS (Netherlands)

    Mérove Gijsberts; Willem Huijnk; Ria Vogels

    2011-01-01

    Original title: Chinese Nederlanders This report presents the first national picture of the position of the Chinese community in the Netherlands. A large-scale survey was conducted among persons of Chinese origin living in the Netherlands, with the aim of answering questions on a wide range of

  3. Chinese Counterspace Intentions

    Science.gov (United States)

    2008-12-01

    overly prideful country with “no ethical principles”151 seeking to “rule the world”152 while “spiritually polluting”153 China. The Chinese believe that...long term relationships through less direct means. The U.S. directness could also be seen as selfish and proud rather than as self-assertive, thereby...into a “ benign competition.”420 Lieutenant Colonel Troy L. Dixon described a U.S. approach to achieving increased cooperation with the Chinese.421

  4. Distribution of Chinese names

    Science.gov (United States)

    Huang, Ding-wei

    2013-03-01

    We present a statistical model for the distribution of Chinese names. Both family names and given names are studied on the same basis. With naive expectation, the distribution of family names can be very different from that of given names. One is affected mostly by genealogy, while the other can be dominated by cultural effects. However, we find that both distributions can be well described by the same model. Various scaling behaviors can be understood as a result of stochastic processes. The exponents of different power-law distributions are controlled by a single parameter. We also comment on the significance of full-name repetition in Chinese population.

  5. Lorentz violations and Euclidean signature metrics

    International Nuclear Information System (INIS)

    Barbero G, J. Fernando; Villasenor, Eduardo J.S.

    2003-01-01

    We show that the families of effective actions considered by Jacobson et al. to study Lorentz invariance violations contain a class of models that represent pure general relativity with a Euclidean signature. We also point out that some members of this family of actions preserve Lorentz invariance in a generalized sense

  6. Mechanical System Simulations for Seismic Signature Modeling

    National Research Council Canada - National Science Library

    Lacombe, J

    2001-01-01

    .... Results for an M1A1 and T72 are discussed. By analyzing the simulated seismic signature data in conjunction with the spectral features associated with the vibrations of specific vehicle sprung and un-sprung components we are able to make...

  7. Exploring Signature Pedagogies in Undergraduate Leadership Education

    Science.gov (United States)

    Jenkins, Daniel M.

    2012-01-01

    This research explores the instructional strategies most frequently used by leadership educators who teach academic credit-bearing undergraduate leadership studies courses through a national survey and identifies signature pedagogies within the leadership discipline. Findings from this study suggest that class discussion--whether in the form of…

  8. The Pedagogic Signature of Special Needs Education

    Science.gov (United States)

    Weiß, Sabine; Kollmannsberger, Markus; Lerche, Thomas; Oubaid, Viktor; Kiel, Ewald

    2014-01-01

    The goal of the following study is to identify a pedagogic signature, according to LS Shulman, for working with students who have special educational needs. Special educational needs are defined as significant limitations in personal development and learning which require particular educational measures beyond regular education. The development of…

  9. Arbitrated quantum signature scheme with message recovery

    International Nuclear Information System (INIS)

    Lee, Hwayean; Hong, Changho; Kim, Hyunsang; Lim, Jongin; Yang, Hyung Jin

    2004-01-01

    Two quantum signature schemes with message recovery relying on the availability of an arbitrator are proposed. One scheme uses a public board and the other does not. However both schemes provide confidentiality of the message and a higher efficiency in transmission

  10. Hyperspectral signature analysis of skin parameters

    Science.gov (United States)

    Vyas, Saurabh; Banerjee, Amit; Garza, Luis; Kang, Sewon; Burlina, Philippe

    2013-02-01

    The temporal analysis of changes in biological skin parameters, including melanosome concentration, collagen concentration and blood oxygenation, may serve as a valuable tool in diagnosing the progression of malignant skin cancers and in understanding the pathophysiology of cancerous tumors. Quantitative knowledge of these parameters can also be useful in applications such as wound assessment, and point-of-care diagnostics, amongst others. We propose an approach to estimate in vivo skin parameters using a forward computational model based on Kubelka-Munk theory and the Fresnel Equations. We use this model to map the skin parameters to their corresponding hyperspectral signature. We then use machine learning based regression to develop an inverse map from hyperspectral signatures to skin parameters. In particular, we employ support vector machine based regression to estimate the in vivo skin parameters given their corresponding hyperspectral signature. We build on our work from SPIE 2012, and validate our methodology on an in vivo dataset. This dataset consists of 241 signatures collected from in vivo hyperspectral imaging of patients of both genders and Caucasian, Asian and African American ethnicities. In addition, we also extend our methodology past the visible region and through the short-wave infrared region of the electromagnetic spectrum. We find promising results when comparing the estimated skin parameters to the ground truth, demonstrating good agreement with well-established physiological precepts. This methodology can have potential use in non-invasive skin anomaly detection and for developing minimally invasive pre-screening tools.

  11. Dictionary of Large Hadron Collider signatures

    Indian Academy of Sciences (India)

    We report on a plan to establish a `Dictionary of LHC Signatures', an initiative that started at the WHEPP-X workshop in Chennai, January 2008. This study aims at the strategy of distinguishing 3 classes of dark matter motivated scenarios such as -parity conserved supersymmetry, little Higgs models with -parity ...

  12. Signatures of mutational processes in human cancer

    NARCIS (Netherlands)

    Alexandrov, L.B.; Nik-Zainal, S.; Wedge, D.C.; Aparicio, S.A.; Behjati, S.; Biankin, A.V.; Bignell, G.R.; Bolli, N.; Borg, A.; Borresen-Dale, A.L.; Boyault, S.; Burkhardt, B.; Butler, A.P.; Caldas, C.; Davies, H.R.; Desmedt, C.; Eils, R.; Eyfjord, J.E.; Foekens, J.A.; Greaves, M.; Hosoda, F.; Hutter, B.; Ilicic, T.; Imbeaud, S.; Imielinsk, M.; Jager, N.; Jones, D.T.; Knappskog, S.; Kool, M.; Lakhani, S.R.; Lopez-Otin, C.; Martin, S.; Munshi, N.C.; Nakamura, H.; Northcott, P.A.; Pajic, M.; Papaemmanuil, E.; Paradiso, A.; Pearson, J.V.; Puente, X.S.; Raine, K.; Ramakrishna, M.; Richardson, A.L.; Richter, J.; Rosenstiel, P.; Schlesner, M.; Schumacher, T.N.; Span, P.N.; Teague, J.W.; Totoki, Y.; Tutt, A.N.; Valdes-Mas, R.; Buuren, M.M. van; Veer, L. van 't; Vincent-Salomon, A.; Waddell, N.; Yates, L.R.; Zucman-Rossi, J.; Futreal, P.A.; McDermott, U.; Lichter, P.; Meyerson, M.; Grimmond, S.M.; Siebert, R.; Campo, E.; Shibata, T.; Pfister, S.M.; Campbell, P.J.; Stratton, M.R.; Schlooz-Vries, M.S.; Tol, J.J. van; Laarhoven, H.W. van; Sweep, F.C.; Bult, P.; et al.,

    2013-01-01

    All cancers are caused by somatic mutations; however, understanding of the biological processes generating these mutations is limited. The catalogue of somatic mutations from a cancer genome bears the signatures of the mutational processes that have been operative. Here we analysed 4,938,362

  13. Ankle and Other Signatures in Uhecr

    Science.gov (United States)

    Berezinsky, Veniamin

    2015-03-01

    The interaction signatures of UHE protons propagating through CMB are discussed. Much attention is given to ankle, which starting from 1963 is usually interpreted as a feature of transition from galactic to extragalactic cosmic rays. We argue here that this interpretation is now excluded. It gives more credit to alternative explanation of the ankle as an intrinsic part of the pair-production dip.

  14. Detection of proteolytic signatures for Parkinson's disease

    DEFF Research Database (Denmark)

    Jordal, Peter Lüttge; Dyrlund, Thomas F.; Winge, Kristian

    2016-01-01

    Aim: To investigate if idiopathic Parkinson's disease (IPD) is associated with distinct proteolytic signatures relative to non-neurodegenerative controls (NND) and patients with multiple system atrophy (MSA). Materials & methods: A subtiligase-based N-terminomics screening method was exploited...

  15. Limits on efficient human mindreading: convergence across Chinese adults and Semai children.

    Science.gov (United States)

    Wang, Bo; Hadi, Nur Shafiqah Abdul; Low, Jason

    2015-11-01

    We tested Apperly and Butterfill's (2009, Psychological Review, 116, 753) theory that humans have two mindreading systems whereby the efficient-system guiding anticipatory glances displays signature limits that do not apply to the flexible system guiding verbal predictions. Experiments 1 and 2 tested urban Mainland-Chinese adults (n = 64) and Experiment 3 tested Semai children living in the rainforests of Peninsular Malaysia (3- to 4-year-olds, n = 60). Participants - across different ages, groups and methods - anticipated others' false-beliefs about object-location but not object-identity. Convergence in signature limits signalled that the early-developing efficient system involved minimal theory-of-mind. Chinese adults and older Semai children showed flexibility in their direct predictions. The flexible mindreading system in ascribing others' beliefs as such was task-sensitive and implicated maturational and cultural contributions. © 2015 The British Psychological Society.

  16. Perancangan Aplikasi Undeniable Digital Signature Dengan Algoritma Chaum’s Blind Signature

    OpenAIRE

    Simanjuntak, Martin Dennain

    2012-01-01

    Desperaty need a securiry system in the exchange of information via computer media, so that information can not be accessed by unauthorized parties. One of the security system is to use a system of digital signatures as a means of authenticating the authenticity of digital document that are exchanged. By using a digital a digital signature system is undeniable, the security system can be generated digital document exchange, where the system is free from the from of rejection...

  17. The effects of extrinsic motivation on signature authorship opinions in forensic signature blind trials.

    Science.gov (United States)

    Dewhurst, Tahnee N; Found, Bryan; Ballantyne, Kaye N; Rogers, Doug

    2014-03-01

    Expertise studies in forensic handwriting examination involve comparisons of Forensic Handwriting Examiners' (FHEs) opinions with lay-persons on blind tests. All published studies of this type have reported real and demonstrable skill differences between the specialist and lay groups. However, critics have proposed that any difference shown may be indicative of a lack of motivation on the part of lay participants, rather than a real difference in skill. It has been suggested that qualified FHEs would be inherently more motivated to succeed in blinded validation trials, as their professional reputations could be at risk, should they perform poorly on the task provided. Furthermore, critics suggest that lay-persons would be unlikely to be highly motivated to succeed, as they would have no fear of negative consequences should they perform badly. In an effort to investigate this concern, a blind signature trial was designed and administered to forty lay-persons. Participants were required to compare known (exemplar) signatures of an individual to questioned signatures and asked to express an opinion regarding whether the writer of the known signatures wrote each of the questioned signatures. The questioned signatures comprised a mixture of genuine, disguised and simulated signatures. The forty participants were divided into two separate groupings. Group 'A' were requested to complete the trial as directed and were advised that for each correct answer they would be financially rewarded, for each incorrect answer they would be financially penalized, and for each inconclusive opinion they would receive neither penalty nor reward. Group 'B' was requested to complete the trial as directed, with no mention of financial recompense or penalty. The results of this study do not support the proposition that motivation rather than skill difference is the source of the statistical difference in opinions between individuals' results in blinded signature proficiency trials. Crown

  18. Optical/Infrared Signatures for Space-Based Remote Sensing

    National Research Council Canada - National Science Library

    Picard, R. H; Dewan, E. M; Winick, J. R; O'Neil, R. R

    2007-01-01

    This report describes work carried out under the Air Force Research Laboratory's basic research task in optical remote-sensing signatures, entitled Optical / Infrared Signatures for Space-Based Remote Sensing...

  19. Methods and apparatus for multi-parameter acoustic signature inspection

    Energy Technology Data Exchange (ETDEWEB)

    Diaz, Aaron A [Richland, WA; Samuel, Todd J [Pasco, WA; Valencia, Juan D [Kennewick, WA; Gervais, Kevin L [Richland, WA; Tucker, Brian J [Pasco, WA; Kirihara, Leslie J [Richland, WA; Skorpik, James R [Kennewick, WA; Reid, Larry D [Benton City, WA; Munley, John T [Benton City, WA; Pappas, Richard A [Richland, WA; Wright, Bob W [West Richland, WA; Panetta, Paul D [Richland, WA; Thompson, Jason S [Richland, WA

    2007-07-24

    A multiparameter acoustic signature inspection device and method are described for non-invasive inspection of containers. Dual acoustic signatures discriminate between various fluids and materials for identification of the same.

  20. Passive Infrared Signature Augmentation of Full-Scale Plastic Targets

    National Research Council Canada - National Science Library

    Gebus, Lisa M; Sanders, Jeffrey S

    2002-01-01

    ... (IR), and radar signatures of threat systems. To address this need, a program was initiated by TMO to augment an existing full-scale, vacuum-formed plastic target with sufficient signature fidelity to adequately stress U.S...

  1. How does auditors’ work stress affect audit quality? Empirical evidence from the Chinese stock market

    OpenAIRE

    Huanmin Yan; Shengwen Xie

    2016-01-01

    With reference to the Job Demands–Control Model, we empirically examine the effect of auditors’ work stress on audit quality using a sample of Chinese A-share listed companies and their signature auditors from 2009 to 2013. The results show that (1) there is generally no pervasive deterioration in audit quality resulting from auditors’ work stress; (2) there is a significant negative association between work stress and audit quality in the initial audits of new clients; and (3) the perception...

  2. Milestone for Chinese physicists

    CERN Multimedia

    2003-01-01

    Chinese scientists have discovered a new particle predicted decades ago but never observed before. It could be what was once called the "multi-quark state," tiny elementary particles with a strong interaction or force that serves as the source of nuclear energy (1/2 page).

  3. SWOT ANALYSIS - CHINESE PETROLEUM

    Directory of Open Access Journals (Sweden)

    Chunlan Wang

    2014-01-01

    Full Text Available This article was written in early December 2013,combined with the historical development andthe latest data on the Chinese Petroleum carried SWOT- analysis. This paper discusses corporate resources, cost, management and external factorssuch as the political environment and the marketsupply and demand, conducted a comprehensiveand profound analysis.

  4. SWOT ANALYSIS - CHINESE PETROLEUM

    OpenAIRE

    Chunlan Wang; Lei Zhang; Qi Zhong

    2014-01-01

    This article was written in early December 2013, combined with the historical development and the latest data on the Chinese Petroleum carried SWOTanalysis. This paper discusses corporate resources, cost, management and external factors such as the political environment and the market supply and demand, conducted a comprehensive and profound analysis.

  5. Modelling Chinese Smart Grid

    DEFF Research Database (Denmark)

    Yuksel, Ender; Nielson, Hanne Riis; Nielson, Flemming

    In this document, we consider a specific Chinese Smart Grid implementation and try to address the verification problem for certain quantitative properties including performance and battery consumption. We employ stochastic model checking approach and present our modelling and analysis study using...

  6. The Imperative in Chinese.

    Science.gov (United States)

    Hashimoto, Anne Yue

    A preliminary study of the syntactic characteristics of the imperative construction in modern Chinese is presented. The term "imperative" is used to refer to the type of syntactic construction which is marked by an implicit or explicit second person subject, and which expresses a direct command. Indirect or implied commands expressed by a…

  7. Chinese court case fiction

    DEFF Research Database (Denmark)

    Hansen, Kim Toft

    2011-01-01

    established as early as the 6th Century AD, whereas the first substantial evidence of the tradition is from 13th Century and the first Chinese crime fiction novels were written during the 17th Century. This article is, then, a corrective for the international history of crime fiction based on numerous...

  8. Chinese New Year Dragons.

    Science.gov (United States)

    Balgemann, Linda

    2000-01-01

    Presents an art project, used in a culturally diverse curriculum, in which second grade students create Chinese New Year dragons. Describes the process of creating the dragons, from the two-week construction of the head to the accordion-folded bodies. (CMK)

  9. The Chinese House Game.

    Science.gov (United States)

    Lee, James R.

    1989-01-01

    Discussion of the use of simulations to teach international relations (IR) highlights the Chinese House Game, a computer-based decision-making game based on Inter Nation Simulation (INS). Topics discussed include the increasing role of artificial intelligence in IR simulations, multi-disciplinary approaches, and the direction of IR as a…

  10. Chinese Entrepreneurs Go Global

    Directory of Open Access Journals (Sweden)

    Daniel Zhou

    2012-02-01

    Full Text Available China may be on the tipping point of explosive global growth. In response to changes in the global economy and an economic slowdown domestically, hundreds of thousands of Chinese SMEs are being encouraged to “go global” by their central and local governments. To a Chinese company, going global requires the expansion of its existing business in other countries or the development of new ventures with partners operating in other countries. Explosive growth in China may be possible, but it will depend on an appropriate strategy for going global. For a country that has firmly established itself as an international manufacturing hub, going global requires a shift in its entrepreneurial capacity, which is the focus of this article. We first assess the current situation in China to understand its current entrepreneurial focus and capacity, as well as the impetus for change. Next, we contrast the Kirznerian and Schumpeterian views of entrepreneurship to illustrate that – to go global – Chinese entrepreneurs must shift from an emphasis on exploiting pricing inefficiencies (i.e., Kirznerian entrepreneurship to an emphasis on innovation (i.e., Schumpeterian entrepreneurship. Finally, we examine unique characteristics of the business environment and culture in China, which are likely to impact the ability of Chinese entrepreneurs to go global.

  11. Signatures of natural selection at the FTO (fat mass and obesity associated locus in human populations.

    Directory of Open Access Journals (Sweden)

    Xuanshi Liu

    Full Text Available Polymorphisms in the first intron of FTO have been robustly replicated for associations with obesity. In the Sorbs, a Slavic population resident in Germany, the strongest effect on body mass index (BMI was found for a variant in the third intron of FTO (rs17818902. Since this may indicate population specific effects of FTO variants, we initiated studies testing FTO for signatures of selection in vertebrate species and human populations.First, we analyzed the coding region of 35 vertebrate FTO orthologs with Phylogenetic Analysis by Maximum Likelihood (PAML, ω = dN/dS to screen for signatures of selection among species. Second, we investigated human population (Europeans/CEU, Yoruba/YRI, Chinese/CHB, Japanese/JPT, Sorbs SNP data for footprints of selection using DnaSP version 4.5 and the Haplotter/PhaseII. Finally, using ConSite we compared transcription factor (TF binding sites at sequences harbouring FTO SNPs in intron three.PAML analyses revealed strong conservation in coding region of FTO (ω<1. Sliding-window results from population genetic analyses provided highly significant (p<0.001 signatures for balancing selection specifically in the third intron (e.g. Tajima's D in Sorbs = 2.77. We observed several alterations in TF binding sites, e.g. TCF3 binding site introduced by the rs17818902 minor allele.Population genetic analysis revealed signatures of balancing selection at the FTO locus with a prominent signal in intron three, a genomic region with strong association with BMI in the Sorbs. Our data support the hypothesis that genes associated with obesity may have been under evolutionary selective pressure.

  12. Re-examining the security of blind quantum signature protocols

    International Nuclear Information System (INIS)

    Wang Mingming; Chen Xiubo; Niu Xinxin; Yang Yixian

    2012-01-01

    Recently, blind quantum signature (BQS) protocols have been proposed with the help of a third-party verifier. However, our research shows that some of the BQS protocols are unable to complete the blind signature task fairly if the verifier is dishonest. Indeed, these protocols can be viewed as variants of the classical digital signature scheme of symmetric-key cryptography. If nobody is trusted in such protocols, digital signature cannot be implemented since disagreements cannot be solved fairly.

  13. Quantum signature scheme based on a quantum search algorithm

    International Nuclear Information System (INIS)

    Yoon, Chun Seok; Kang, Min Sung; Lim, Jong In; Yang, Hyung Jin

    2015-01-01

    We present a quantum signature scheme based on a two-qubit quantum search algorithm. For secure transmission of signatures, we use a quantum search algorithm that has not been used in previous quantum signature schemes. A two-step protocol secures the quantum channel, and a trusted center guarantees non-repudiation that is similar to other quantum signature schemes. We discuss the security of our protocol. (paper)

  14. A Signature Comparing Android Mobile Application Utilizing Feature Extracting Algorithms

    Directory of Open Access Journals (Sweden)

    Paul Grafilon

    2017-08-01

    Full Text Available The paper presented one of the application that can be done using smartphones camera. Nowadays forgery is one of the most undetected crimes. With the forensic technology used today it is still difficult for authorities to compare and define what a real signature is and what a forged signature is. A signature is a legal representation of a person. All transactions are based on a signature. Forgers may use a signature to sign illegal contracts and withdraw from bank accounts undetected. A signature can also be forged during election periods for repeated voting. Addressing the issues a signature should always be secure. Signature verification is a reduced problem that still poses a real challenge for researchers. The literature on signature verification is quite extensive and shows two main areas of research off-line and on-line systems. Off-line systems deal with a static image of the signature i.e. the result of the action of signing while on-line systems work on the dynamic process of generating the signature i.e. the action of signing itself. The researchers have found a way to resolve the concerns. A mobile application that integrates the camera to take a picture of a signature analyzes it and compares it to other signatures for verification. It will exist to help citizens to be more cautious and aware with issues regarding the signatures. This might also be relevant to help organizations and institutions such as banks and insurance companies in verifying signatures that may avoid unwanted transactions and identity theft. Furthermore this might help the authorities in the never ending battle against crime especially against forgers and thieves. The project aimed to design and develop a mobile application that integrates the smartphone camera for verifying and comparing signatures for security using the best algorithm possible. As the result of the development the said smartphone camera application is functional and reliable.

  15. Bubble signatures revealed in antique artefacts

    Science.gov (United States)

    Wallace, Stephen C.; Kenney-Wallace, Geraldine

    2016-01-01

    Antique Chinese porcelain can fetch thousands of dollars on the art market. Stephen C Wallace and Geraldine Kenney-Wallace explain how their physics-based technique could help collectors and connoisseurs to tell a real antique object from a fake.

  16. Can specific transcriptional regulators assemble a universal cancer signature?

    Science.gov (United States)

    Roy, Janine; Isik, Zerrin; Pilarsky, Christian; Schroeder, Michael

    2013-10-01

    Recently, there is a lot of interest in using biomarker signatures derived from gene expression data to predict cancer progression. We assembled signatures of 25 published datasets covering 13 types of cancers. How do these signatures compare with each other? On one hand signatures answering the same biological question should overlap, whereas signatures predicting different cancer types should differ. On the other hand, there could also be a Universal Cancer Signature that is predictive independently of the cancer type. Initially, we generate signatures for all datasets using classical approaches such as t-test and fold change and then, we explore signatures resulting from a network-based method, that applies the random surfer model of Google's PageRank algorithm. We show that the signatures as published by the authors and the signatures generated with classical methods do not overlap - not even for the same cancer type - whereas the network-based signatures strongly overlap. Selecting 10 out of 37 universal cancer genes gives the optimal prediction for all cancers thus taking a first step towards a Universal Cancer Signature. We furthermore analyze and discuss the involved genes in terms of the Hallmarks of cancer and in particular single out SP1, JUN/FOS and NFKB1 and examine their specific role in cancer progression.

  17. Radar micro-doppler signatures processing and applications

    CERN Document Server

    Chen, Victor C; Miceli, William J

    2014-01-01

    Radar Micro-Doppler Signatures: Processing and applications concentrates on the processing and application of radar micro-Doppler signatures in real world situations, providing readers with a good working knowledge on a variety of applications of radar micro-Doppler signatures.

  18. Acoustic Signature Monitoring and Management of Naval Platforms

    NARCIS (Netherlands)

    Basten, T.G.H.; Jong, C.A.F. de; Graafland, F.; Hof, J. van 't

    2015-01-01

    Acoustic signatures make naval platforms susceptible to detection by threat sensors. The variable operational conditions and lifespan of a platform cause variations in the acoustic signature. To deal with these variations, a real time signature monitoring capability is being developed, with advisory

  19. 22 CFR 92.28 - Signature of affiant on affidavit.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Signature of affiant on affidavit. 92.28 Section 92.28 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Specific Notarial Acts § 92.28 Signature of affiant on affidavit. The signature of the affiant is...

  20. 45 CFR 81.32 - Signature of documents.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Signature of documents. 81.32 Section 81.32 Public... UNDER PART 80 OF THIS TITLE Form, Execution, Service and Filing of Documents § 81.32 Signature of documents. The signature of a party, authorized officer, employee or attorney constitutes a certificate that...

  1. 21 CFR 1309.32 - Application forms; contents; signature.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Application forms; contents; signature. 1309.32... Application forms; contents; signature. (a) Any person who is required to be registered pursuant to § 1309.21... this paragraph and shall contain the signature of the individual being authorized to sign the...

  2. 17 CFR 201.65 - Identity and signature.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Identity and signature. 201.65... of 1934 § 201.65 Identity and signature. Applications pursuant to this subpart may omit the identity, mailing address, and signature of the applicant; provided, that such identity, mailing address and...

  3. Signature Pedagogies in Support of Teachers' Professional Learning

    Science.gov (United States)

    Parker, Melissa; Patton, Kevin; O'Sullivan, Mary

    2016-01-01

    Signature pedagogies [Shulman, L. 2005. "Signature pedagogies in the professions." "Daedalus" 134 (3): 52--59.] are a focus of teacher educators seeking to improve teaching and teacher education. The purpose of this paper is to present a preliminary common language of signature pedagogies for teacher professional development…

  4. 34 CFR 101.32 - Signature of documents.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Signature of documents. 101.32 Section 101.32 Education Regulations of the Offices of the Department of Education OFFICE FOR CIVIL RIGHTS, DEPARTMENT OF EDUCATION... Documents § 101.32 Signature of documents. The signature of a party, authorized officer, employee or...

  5. 36 CFR 1150.22 - Signature of documents.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Signature of documents. 1150.22 Section 1150.22 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS... Documents for Proceedings on Citations § 1150.22 Signature of documents. The signature of a party...

  6. 29 CFR 102.116 - Signature of orders.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 2 2010-07-01 2010-07-01 false Signature of orders. 102.116 Section 102.116 Labor Regulations Relating to Labor NATIONAL LABOR RELATIONS BOARD RULES AND REGULATIONS, SERIES 8 Certification and Signature of Documents § 102.116 Signature of orders. The executive secretary or the associate executive...

  7. 48 CFR 204.101 - Contracting officer's signature.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Contracting officer's signature. 204.101 Section 204.101 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS... officer's signature. Follow the procedures at PGI 204.101 for signature of contract documents. [71 FR 9268...

  8. 32 CFR 842.6 - Signature on the claim form.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Signature on the claim form. 842.6 Section 842.6... ADMINISTRATIVE CLAIMS General Information § 842.6 Signature on the claim form. The claimant or authorized agent... authorized agent signing for a claimant shows, after the signature, the title or capacity and attaches...

  9. 38 CFR 18b.21 - Signature of documents.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Signature of documents. 18b.21 Section 18b.21 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Documents § 18b.21 Signature of documents. The signature of a party, authorized officer, employee, or...

  10. 37 CFR 2.74 - Form and signature of amendment.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and signature of... signature of amendment. (a) Form of Amendment. Amendments should be set forth clearly and completely... record. (b) Signature. A request for amendment of an application must be signed by the applicant, someone...

  11. 21 CFR 11.200 - Electronic signature components and controls.

    Science.gov (United States)

    2010-04-01

    ... signature components and controls. (a) Electronic signatures that are not based upon biometrics shall: (1) Employ at least two distinct identification components such as an identification code and password. (i... signatures based upon biometrics shall be designed to ensure that they cannot be used by anyone other than...

  12. Dilatonic imprints on exact gravitational wave signatures

    Science.gov (United States)

    McCarthy, Fiona; KubizÅák, David; Mann, Robert B.

    2018-05-01

    By employing the moduli space approximation, we analytically calculate the gravitational wave signatures emitted upon the merger of two extremally charged dilatonic black holes. We probe several values of the dilatonic coupling constant a , and find significant departures from the Einstein-Maxwell (a =0 ) counterpart studied in [Phys. Rev. D 96, 061501 (2017), 10.1103/PhysRevD.96.061501]. For (low-energy) string theory black holes (a =1 ) there are no coalescence orbits and only a memory effect is observed, whereas for an intermediate value of the coupling (a =1 /√{3 } ) the late-time merger signature becomes exponentially suppressed, compared to the polynomial decay in the a =0 case without a dilaton. Such an imprint shows a clear difference between the case with and without a scalar field (as, for example, predicted by string theory) in black hole mergers.

  13. Chameleon dark energy models with characteristic signatures

    International Nuclear Information System (INIS)

    Gannouji, Radouane; Moraes, Bruno; Polarski, David; Mota, David F.; Winther, Hans A.; Tsujikawa, Shinji

    2010-01-01

    In chameleon dark energy models, local gravity constraints tend to rule out parameters in which observable cosmological signatures can be found. We study viable chameleon potentials consistent with a number of recent observational and experimental bounds. A novel chameleon field potential, motivated by f(R) gravity, is constructed where observable cosmological signatures are present both at the background evolution and in the growth rate of the perturbations. We study the evolution of matter density perturbations on low redshifts for this potential and show that the growth index today γ 0 can have significant dispersion on scales relevant for large scale structures. The values of γ 0 can be even smaller than 0.2 with large variations of γ on very low redshifts for the model parameters constrained by local gravity tests. This gives a possibility to clearly distinguish these chameleon models from the Λ-cold-dark-matter (ΛCDM) model in future high-precision observations.

  14. Entanglement as a signature of quantum chaos.

    Science.gov (United States)

    Wang, Xiaoguang; Ghose, Shohini; Sanders, Barry C; Hu, Bambi

    2004-01-01

    We explore the dynamics of entanglement in classically chaotic systems by considering a multiqubit system that behaves collectively as a spin system obeying the dynamics of the quantum kicked top. In the classical limit, the kicked top exhibits both regular and chaotic dynamics depending on the strength of the chaoticity parameter kappa in the Hamiltonian. We show that the entanglement of the multiqubit system, considered for both the bipartite and the pairwise entanglement, yields a signature of quantum chaos. Whereas bipartite entanglement is enhanced in the chaotic region, pairwise entanglement is suppressed. Furthermore, we define a time-averaged entangling power and show that this entangling power changes markedly as kappa moves the system from being predominantly regular to being predominantly chaotic, thus sharply identifying the edge of chaos. When this entangling power is averaged over all states, it yields a signature of global chaos. The qualitative behavior of this global entangling power is similar to that of the classical Lyapunov exponent.

  15. Quark-gluon plasma: experimental signatures

    International Nuclear Information System (INIS)

    Drapier, O.

    1995-01-01

    The existence of a deconfining phase transition of nuclear matter is a clear prediction of lattice quantum chromodynamics calculations. The signatures of this quark-gluon plasma (QGP) have been searched for, since the first high energy ion beams became available at BNL and CERN in 1986, and gold and lead beams are now accelerated at 11 and 160 GeV per nucleon by the AGS and SPS. An overview of the main signatures expected in case of QGP formation is presented here. Although some recent results have been found in agreement with the predictions of the QGP scenario, no clear evidence for its formation has been observed at present. Nevertheless, new high statistics results are expected from CERN lead beams. In addition, future experiments are being prepared at RHIC and LHCC, providing an increase by two orders of magnitude of the c.m.s. energy within a few years. (author). 66 refs., 28 figs

  16. Supernova signatures of neutrino mass ordering

    Science.gov (United States)

    Scholberg, Kate

    2018-01-01

    A suite of detectors around the world is poised to measure the flavor-energy-time evolution of the ten-second burst of neutrinos from a core-collapse supernova occurring in the Milky Way or nearby. Next-generation detectors to be built in the next decade will have enhanced flavor sensitivity and statistics. Not only will the observation of this burst allow us to peer inside the dense matter of the extreme event and learn about the collapse processes and the birth of the remnant, but the neutrinos will bring information about neutrino properties themselves. This review surveys some of the physical signatures that the currently-unknown neutrino mass pattern will imprint on the observed neutrino events at Earth, emphasizing the most robust and least model-dependent signatures of mass ordering.

  17. Limits and signatures of relativistic spaceflight

    Science.gov (United States)

    Yurtsever, Ulvi; Wilkinson, Steven

    2018-01-01

    While special relativity imposes an absolute speed limit at the speed of light, our Universe is not empty Minkowski spacetime. The constituents that fill the interstellar/intergalactic vacuum, including the cosmic microwave background photons, impose a lower speed limit on any object travelling at relativistic velocities. Scattering of cosmic microwave photons from an ultra-relativistic object may create radiation with a characteristic signature allowing the detection of such objects at large distances.

  18. Signatures of quark-gluon plasma production

    International Nuclear Information System (INIS)

    Gyulassy, M.

    1985-01-01

    A critical analysis of a variety of proposed signatures for quark-gluon formation in ultrarelativistic nuclear collisions is given. The authors emphasize that longitudinal growth rather than the nuclear radius controls the time scales for expansion. The author pointed out the qualitative difference of the evolution of the plasma produced in the stopping regime E approx. 10 GeV/nucleon and the scaling regime E > 1 TeV/nucleon. This difference reflects itself in the the rmal profile function

  19. Selection signatures in worldwide sheep populations.

    OpenAIRE

    Fariello, Maria-Ines; Servin, Bertrand; Tosser-Klopp, Gwenola; Rupp, Rachel; Moreno, Carole; San Cristobal, Magali; Boitard, Simon; Drögemüller, Cord; The International Sheep Genomics Consortium, ISGC

    2014-01-01

    The diversity of populations in domestic species offers great opportunities to study genome response to selection. The recently published Sheep HapMap dataset is a great example of characterization of the world wide genetic diversity in sheep. In this study, we re-analyzed the Sheep HapMap dataset to identify selection signatures in worldwide sheep populations. Compared to previous analyses, we made use of statistical methods that (i) take account of the hierarchical structure of sheep popula...

  20. Selection Signatures in Worldwide Sheep Populations

    OpenAIRE

    Fariello, Maria-Ines; Servin, Bertrand; Tosser-Klopp, Gwenola; Rupp, Rachel; Moreno, Carole; Cristobal, Magali San; Boitard, Simon

    2014-01-01

    The diversity of populations in domestic species offers great opportunities to study genome response to selection. The recently published Sheep HapMap dataset is a great example of characterization of the world wide genetic diversity in sheep. In this study, we re-analyzed the Sheep HapMap dataset to identify selection signatures in worldwide sheep populations. Compared to previous analyses, we made use of statistical methods that (i) take account of the hierarchical structure of sheep popula...

  1. ALPs effective field theory and collider signatures

    DEFF Research Database (Denmark)

    Brivio, I.; Gavela, M. B.; Merlo, L.

    2017-01-01

    We study the leading effective interactions between the Standard Model fields and a generic singlet CP-odd (pseudo-) Goldstone boson. Two possible frameworks for electroweak symmetry breaking are considered: linear and non-linear. For the latter case, the basis of leading effective operators is d...... final states are most promising signals expected in both frameworks. In addition, non-standard Higgs decays and mono-Higgs signatures are especially prominent and expected to be dominant in non-linear realisations....

  2. Staggering in signature partners of A∼190 mass region of superdeformed rotational bands

    International Nuclear Information System (INIS)

    Uma, V.S.; Goel, Alpana; Yadav, Archana

    2014-01-01

    This paper discuss about ΔI=1 signature splitting in signature partner pairs of A∼190 mass region. Around twenty signature partner pairs (usually called as two bands, each with a fixed signature) have been reported in this mass region. For these signature pairs, band head moment of inertia (J 0 ) and intrinsic structure of each pair of signature partners have been found as almost identical. Also, these signature partner pairs showed large amplitude signature splitting. As each of the two signature partner forms a regular spin sequence and signature bands are not equivalent in terms of energies. This difference in energies results in signature splitting

  3. On signature change in p-adic space-times

    International Nuclear Information System (INIS)

    Dragovic, B.G.

    1991-01-01

    Change of signature by linear coordinate transformations in p-adic space-times is considered. In this paper it is shown that there exists arbitrary change of trivial signature in Q p n for all n ≥ 1 if p ≡ 1 (mod 4). In other cases it is possible to change only even number of the signs of the signature. The authors suggest new concept of signature with respect to distinct quadratic extensions, of Q p . If space-time dimension is restricted to four there is no signature change

  4. A Digital Signature Scheme Based on MST3 Cryptosystems

    Directory of Open Access Journals (Sweden)

    Haibo Hong

    2014-01-01

    Full Text Available As special types of factorization of finite groups, logarithmic signature and cover have been used as the main components of cryptographic keys for secret key cryptosystems such as PGM and public key cryptosystems like MST1, MST2, and MST3. Recently, Svaba et. al proposed a revised MST3 encryption scheme with greater security. Meanwhile, they put forward an idea of constructing signature schemes on the basis of logarithmic signatures and random covers. In this paper, we firstly design a secure digital signature scheme based on logarithmic signatures and random covers. In order to complete the task, we devise a new encryption scheme based on MST3 cryptosystems.

  5. New particles and their experimental signatures

    International Nuclear Information System (INIS)

    Ellis, J.; Gelmini, G.; Kowalski, H.

    1984-08-01

    This report summarizes work done by our theoretical working group on exotic particles before, during and since the Lausanne meeting. We discuss the motivations, rates and experimental signatures for new physics and new particles in the 1 TeV mass range. Section 2 reviews some of the motivations for expecting new physics in this range. Of particular interest is the physics of gauge symmetry breaking. In section 3 we discuss the rates and experimental signatures of new particles predicted by theoretical models of gauge symmetry breaking, notably the Higgs boson supersymmetry and technicolour. Among the signatures we discuss are multiple Wsup(+-) and/or Z 0 events (for the Higgs), missing transverse energy (for supersymmetry) and multiple anti tt events (for the Higgs and technicolour). We provide many examples of final state differential distributions in rapidity and Psub(T), particularly for Higgses and for supersymmetry. We also analyse some physics backgrounds to the new particle production processes which interest us. Examples include W + W - , Z 0 Z 0 , W(anti tt) and (anti tt) production as backgrounds to Higgs production. However, we do not consider in detail non-physics backgrounds such as the jet fluctuation background to missing energy signals for supersymmetry production. Section 4 summarizes our preliminary conclusions on the observability at a high energy hadron collider of the new particles studied in this report. (orig./HSI)

  6. Mirage: a visible signature evaluation tool

    Science.gov (United States)

    Culpepper, Joanne B.; Meehan, Alaster J.; Shao, Q. T.; Richards, Noel

    2017-10-01

    This paper presents the Mirage visible signature evaluation tool, designed to provide a visible signature evaluation capability that will appropriately reflect the effect of scene content on the detectability of targets, providing a capability to assess visible signatures in the context of the environment. Mirage is based on a parametric evaluation of input images, assessing the value of a range of image metrics and combining them using the boosted decision tree machine learning method to produce target detectability estimates. It has been developed using experimental data from photosimulation experiments, where human observers search for vehicle targets in a variety of digital images. The images used for tool development are synthetic (computer generated) images, showing vehicles in many different scenes and exhibiting a wide variation in scene content. A preliminary validation has been performed using k-fold cross validation, where 90% of the image data set was used for training and 10% of the image data set was used for testing. The results of the k-fold validation from 200 independent tests show a prediction accuracy between Mirage predictions of detection probability and observed probability of detection of r(262) = 0:63, p Pearson correlation) and a MAE = 0:21 (mean absolute error).

  7. SIGNATURES OF LONG-LIVED SPIRAL PATTERNS

    International Nuclear Information System (INIS)

    Martínez-García, Eric E.; González-Lópezlira, Rosa A.

    2013-01-01

    Azimuthal age/color gradients across spiral arms are a signature of long-lived spirals. From a sample of 19 normal (or weakly barred) spirals where we have previously found azimuthal age/color gradient candidates, 13 objects were further selected if a two-armed grand-design pattern survived in a surface density stellar mass map. Mass maps were obtained from optical and near-infrared imaging, by comparison with a Monte Carlo library of stellar population synthesis models that allowed us to obtain the mass-to-light ratio in the J band, (M/L) J , as a function of (g – i) versus (i – J) color. The selected spirals were analyzed with Fourier methods in search of other signatures of long-lived modes related to the gradients, such as the gradient divergence toward corotation, and the behavior of the phase angle of the two-armed spiral in different wavebands, as expected from theory. The results show additional signatures of long-lived spirals in at least 50% of the objects.

  8. On psychoanalytic supervision as signature pedagogy.

    Science.gov (United States)

    Watkins, C Edward

    2014-04-01

    What is signature pedagogy in psychoanalytic education? This paper examines that question, considering why psychoanalytic supervision best deserves that designation. In focusing on supervision as signature pedagogy, I accentuate its role in building psychoanalytic habits of mind, habits of hand, and habits of heart, and transforming theory and self-knowledge into practical product. Other facets of supervision as signature pedagogy addressed in this paper include its features of engagement, uncertainty, formation, and pervasiveness, as well as levels of surface, deep, and implicit structure. Epistemological, ontological, and axiological in nature, psychoanalytic supervision engages trainees in learning to do, think, and value what psychoanalytic practitioners in the field do, think, and value: It is, most fundamentally, professional preparation for competent, "good work." In this paper, effort is made to shine a light on and celebrate the pivotal role of supervision in "making" or developing budding psychoanalysts and psychoanalytic psychotherapists. Now over a century old, psychoanalytic supervision remains unparalleled in (1) connecting and integrating conceptualization and practice, (2) transforming psychoanalytic theory and self-knowledge into an informed analyzing instrument, and (3) teaching, transmitting, and perpetuating the traditions, practice, and culture of psychoanalytic treatment.

  9. Enhanced vibration diagnostics using vibration signature analysis

    International Nuclear Information System (INIS)

    Ahmed, S.; Shehzad, K.; Zahoor, Y.; Mahmood, A.; Bibi, A.

    2001-01-01

    Symptoms will appear in equipment, as well as in human beings. when 'suffering from sickness. Symptoms of abnormality in equipment are vibration, noise, deformation, temperature, pressure, electric current, crack, wearing, leakage etc. these are called modes of failure. If the mode of failure is vibration then the vibration signature analysis can be effectively used in order to diagnose the machinery problems. Much valuable information is contained within these vibration 'Spectra' or 'Signatures' but is only of use if the analyst can unlock its 'Secrets'. This paper documents a vibration problem in the motor of a centrifugal pump (Type ETA). It focuses mainly on the roll of modern vibration monitoring system in problem analysis. The problem experienced was the motor unstability and noise due to high vibration. Using enhanced vibration signature data, the problem was analyzed. which suggested that the rotor eccentricity was the cause of excessive noise and vibration in the motor. In conclusion, advanced electronic monitoring and diagnostic systems provide powerful information for machine's condition assessment and problem analysis. Appropriate interpretation and use of this information is important for accurate and effective vibration analysis. (author)

  10. Measurement-device-independent quantum digital signatures

    Science.gov (United States)

    Puthoor, Ittoop Vergheese; Amiri, Ryan; Wallden, Petros; Curty, Marcos; Andersson, Erika

    2016-08-01

    Digital signatures play an important role in software distribution, modern communication, and financial transactions, where it is important to detect forgery and tampering. Signatures are a cryptographic technique for validating the authenticity and integrity of messages, software, or digital documents. The security of currently used classical schemes relies on computational assumptions. Quantum digital signatures (QDS), on the other hand, provide information-theoretic security based on the laws of quantum physics. Recent work on QDS Amiri et al., Phys. Rev. A 93, 032325 (2016);, 10.1103/PhysRevA.93.032325 Yin, Fu, and Zeng-Bing, Phys. Rev. A 93, 032316 (2016), 10.1103/PhysRevA.93.032316 shows that such schemes do not require trusted quantum channels and are unconditionally secure against general coherent attacks. However, in practical QDS, just as in quantum key distribution (QKD), the detectors can be subjected to side-channel attacks, which can make the actual implementations insecure. Motivated by the idea of measurement-device-independent quantum key distribution (MDI-QKD), we present a measurement-device-independent QDS (MDI-QDS) scheme, which is secure against all detector side-channel attacks. Based on the rapid development of practical MDI-QKD, our MDI-QDS protocol could also be experimentally implemented, since it requires a similar experimental setup.

  11. Chinese Studies and Beyond

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    2013-01-01

    Many different conceptual approaches and models have been used to analyze contemporary Chinese history and politics. Some of the more commonly used include "totalitarianism", "two-line struggle", "clientelism", "tendency analysis", "political culture", "interest group politics", "bureaucratic...... politics", "corporatism", "civil society", "fragmented authoritarianism", etc. (Brødsgaard, 1989; Guo 2013). This paper will survey these approaches in order to place the analysis of the contemporary Chinese politics and history in a comparative perspective. A survey of the field will remind us...... that contemporary China studies have increasingly developed into a collective effort and that no scholar conducts his/her research in a vacuum devoid of dept to other contributions in the field. The paper will focus on the period since the Cultural Revolution. Consequently, we will not attempt a discussion...

  12. The electronic identification, signature and security of information systems

    Directory of Open Access Journals (Sweden)

    Horovèák Pavel

    2002-12-01

    Full Text Available The contribution deals with the actual methods and technologies of information and communication systems security. It introduces the overview of electronic identification elements such as static password, dynamic password and single sign-on. Into this category belong also biometric and dynamic characteristics of verified person. Widespread is authentication based on identification elements ownership, such as various cards and authentication calculators. In the next part is specified a definition and characterization of electronic signature, its basic functions and certificate categories. Practical utilization of electronic signature consists of electronic signature acquirement, signature of outgoing email message, receiving of electronic signature and verification of electronic signature. The use of electronic signature is continuously growing and in connection with legislation development it exercises in all resorts.

  13. Chinese Spacesuit Analysis

    Science.gov (United States)

    Croog, Lewis

    2010-01-01

    In 2008, China became only the 3rd nation to perform an Extravehicular Activity (EVA) from a spacecraft. An overview of the Chinese spacesuit and life support system were assessed from video downlinks during their EVA; from those assessments, spacesuit characteristics were identified. The spacesuits were compared against the Russian Orlan Spacesuit and the U.S. Extravehicular Mobility Unit (EMU). China's plans for future missions also were presented.

  14. Multivariable Chinese Remainder Theorem

    Indian Academy of Sciences (India)

    IAS Admin

    to sleep. The 3rd thief wakes up and finds the rest of the coins make 7 equal piles excepting a coin which he pockets. If the total number of coins they stole is not more than 200, what is the exact number? With a bit of hit and miss, one can find that 157 is a possible number. The Chinese remainder theorem gives a systematic ...

  15. Chinese Journalism Students

    DEFF Research Database (Denmark)

    Dombernowsky, Laura Møller

    2014-01-01

    As important providers of information, analysis of current events and debates, journalists are subject to high expectations regarding their professional values. Journalism is considered to be more than merely a career; it is construed as a profession that builds on personal commitment to serve...... 2012 with 41 students studying journalism at People's University, Tsinghua University, China Youth University for Political Sciences, Central University for Nationalities, Beijing Foreign Languages University and Chinese Academy of Social Sciences in Beijing and at Fudan University in Shanghai....

  16. FROM THE CHINESE PRESS

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    Discoverer of the Origin of Life The origin of life on earth has long been a subject explored by scientists around the world. At the 11th International Conference on the Origin of Life held at Orleans University in France on July 9th, 1996, Chinese scientist Zhao Yufen and her partner Cao Peisheng announced the contents of the origin of the seed of life.

  17. INTERNATIONALIZATION OF CHINESE EXECUTIVES

    OpenAIRE

    Lingfang Fayol-Song

    2012-01-01

    Over the last two decades, Chinese nationals have increasingly been employed by multinational companies (MNCs) operating in China taking positions previously occupied by foreign expatriates from investor countries. The development of local managers has therefore become crucial in the field of human resource management because the success of these companies depends greatly upon the ability and competence of their executive management class. The present paper addresses the issue of how to devel...

  18. [Verruca planae Chinese medicine treatment].

    Science.gov (United States)

    Chen, Hai-Ming

    2008-08-01

    Flat wart on the effectiveness of TCM treatment. Outpatients will be by the "People's Republic of China Chinese medicine industry standards, TCM diagnosis of dermatological diseases efficacy standards, Chen Hou State Administration of Traditional Chinese Medicine 1994-06-28 approved, 1995-01-01 implementation". Randomly divided into two groups. Treatment and control groups. Treatment groups treated with Chinese herbs. The control group were treated with WM. Since the preparation of the unification formula ointment, cuboiling method. Chinese herbal medicine preparation by my hospital room Producer. 5 g pre pack, after treatment for 30 days, clinical observation. The group of Chinese medicine is better than western medicine (86.7% vs 71.7% , P < 0.05). Chinese medicine has some effect flat wart.

  19. Buddhist Activism and Chinese Modernity

    Directory of Open Access Journals (Sweden)

    Hung-yok Ip

    2015-02-01

    Full Text Available The history of modern Chinese Buddhism has begun to attract attention in recent years. Some scholars have done inspiring research as they unravel the integration of Buddhism into the highly secularized process of Chinese modernity by drawing on the repository of knowledge on modern China. While this special issue joins this exciting endeavor, it also uses Buddhism as a window to reflect on scholarship on Chinese modernity. Conceptually, this special issue presses scholars in the field of modern China to rethink the place of tradition in the course of modernity. Thematically we show the expansionist impulse of Chinese Buddhism: In addition to envisioning the geographical expansion of their religion, Chinese Buddhists have endeavored to enhance the significance of Buddhism in various dimensions of Chinese society in particular and human life in general.

  20. Knowing Chinese character grammar.

    Science.gov (United States)

    Myers, James

    2016-02-01

    Chinese character structure has often been described as representing a kind of grammar, but the notion of character grammar has hardly been explored. Patterns in character element reduplication are particularly grammar-like, displaying discrete combinatoriality, binarity, phonology-like final prominence, and potentially the need for symbolic rules (X→XX). To test knowledge of these patterns, Chinese readers were asked to judge the acceptability of fake characters varying both in grammaticality (obeying or violating reduplication constraints) and in lexicality (of the reduplicative configurations). While lexical knowledge was important (lexicality improved acceptability and grammatical configurations were accepted more quickly when also lexical), grammatical knowledge was important as well, with grammaticality improving acceptability equally for lexical and nonlexical configurations. Acceptability was also higher for more frequent reduplicative elements, suggesting that the reduplicative configurations were decomposed. Chinese characters present an as-yet untapped resource for exploring fundamental questions about the nature of the human capacity for grammar. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. A classification of chinese culture

    OpenAIRE

    Fan, Y

    2000-01-01

    This paper presents a classification of Chinese Cultural Values (CCVs). Although there exist great differences between the Mainland China, Hong Kong and Taiwan, it is still possible to identify certain core cultural values that are shared by the Chinese people no matter where they live. Based on the original list by the Chinese Cultural Connection (1987), the paper creates a new list that contains 71 core values against 40 in the old. The implications and limitations of the classification are...

  2. Chinese values, health and nursing.

    Science.gov (United States)

    Chen, Y C

    2001-10-01

    To describe the roots of Chinese values, beliefs and the concept of health, and to illustrate how these ways have influenced the development of health care and nursing among Chinese in the Republic of China (ROC) and the People's Republic of China (PRC). Scope. Based on the literature and direct observation in the PRC and ROC, this is an introduction to Chinese philosophies, religion, basic beliefs, and values with a special meaning for health and nursing. Chinese philosophies and religion include Confucian principles, Taoism, theory of "Yin" and "Yang", and Buddhism. Beliefs and values include the way of education, practice of acupuncture, herbal treatments and diet therapy. How people value traditional Chinese medicine in combination with western science, and the future direction of nursing and nursing inquiry are also briefly addressed. Chinese philosophies and religions strongly influence the Chinese way of living and thinking about health and health care. Nurses must combine information about culture with clinical assessment of the patient to provide cultural sensitive care. A better way may be to combine both western and Chinese values into the Chinese health care system by negotiating between the traditional values while at the same time, respecting an individual's choice. The foundation of China's philosophical and aesthetic tradition, in combination with western science is important to the future advancement of nursing research that will be beneficial to the Republics, Asia, and the world.

  3. Neural signatures of lexical tone reading.

    Science.gov (United States)

    Kwok, Veronica P Y; Wang, Tianfu; Chen, Siping; Yakpo, Kofi; Zhu, Linlin; Fox, Peter T; Tan, Li Hai

    2015-01-01

    Research on how lexical tone is neuroanatomically represented in the human brain is central to our understanding of cortical regions subserving language. Past studies have exclusively focused on tone perception of the spoken language, and little is known as to the lexical tone processing in reading visual words and its associated brain mechanisms. In this study, we performed two experiments to identify neural substrates in Chinese tone reading. First, we used a tone judgment paradigm to investigate tone processing of visually presented Chinese characters. We found that, relative to baseline, tone perception of printed Chinese characters were mediated by strong brain activation in bilateral frontal regions, left inferior parietal lobule, left posterior middle/medial temporal gyrus, left inferior temporal region, bilateral visual systems, and cerebellum. Surprisingly, no activation was found in superior temporal regions, brain sites well known for speech tone processing. In activation likelihood estimation (ALE) meta-analysis to combine results of relevant published studies, we attempted to elucidate whether the left temporal cortex activities identified in Experiment one is consistent with those found in previous studies of auditory lexical tone perception. ALE results showed that only the left superior temporal gyrus and putamen were critical in auditory lexical tone processing. These findings suggest that activation in the superior temporal cortex associated with lexical tone perception is modality-dependent. © 2014 Wiley Periodicals, Inc.

  4. Universal brain signature of proficient reading: Evidence from four contrasting languages.

    Science.gov (United States)

    Rueckl, Jay G; Paz-Alonso, Pedro M; Molfese, Peter J; Kuo, Wen-Jui; Bick, Atira; Frost, Stephen J; Hancock, Roeland; Wu, Denise H; Mencl, William Einar; Duñabeitia, Jon Andoni; Lee, Jun-Ren; Oliver, Myriam; Zevin, Jason D; Hoeft, Fumiko; Carreiras, Manuel; Tzeng, Ovid J L; Pugh, Kenneth R; Frost, Ram

    2015-12-15

    We propose and test a theoretical perspective in which a universal hallmark of successful literacy acquisition is the convergence of the speech and orthographic processing systems onto a common network of neural structures, regardless of how spoken words are represented orthographically in a writing system. During functional MRI, skilled adult readers of four distinct and highly contrasting languages, Spanish, English, Hebrew, and Chinese, performed an identical semantic categorization task to spoken and written words. Results from three complementary analytic approaches demonstrate limited language variation, with speech-print convergence emerging as a common brain signature of reading proficiency across the wide spectrum of selected languages, whether their writing system is alphabetic or logographic, whether it is opaque or transparent, and regardless of the phonological and morphological structure it represents.

  5. The Solar-flux Third Granulation Signature

    Science.gov (United States)

    Gray, David F.; Oostra, Benjamin

    2018-01-01

    The velocity shifts of spectral lines as a function of line strength, so-called the third signature of granulation, are investigated using three published solar-flux atlases. We use flux atlases because we wish to treat the Sun as a star, against which stellar observations can be compared and judged. The atlases are critiqued and compared to the lower-resolution observations taken with the Elginfield stellar spectrograph. Third-signature plots are constructed for the 6020–6340 Å region. No dependence on excitation potential or wavelength is found over this wavelength span. The shape of the plots from the three solar atlases is essentially the same, with rms line-core velocity differences of 30–35 m s‑1. High-resolution atlas data are degraded to the level of the Elginfield spectrograph and compared to direct observations taken with that spectrograph. The line-core velocities show good agreement, with rms differences of 38 m s‑1. A new standard curve is derived and compared with the previously published one. Only small differences in shape are found, but a significant (+97 m s‑1) change in the zero point is indicated. The bisector of the Fe I 6253 line is mapped onto the third-signature plots and flux deficits are derived, which measure the granule/lane flux imbalance. The lower spectral resolution lowers the flux deficit area slightly and moves the peak of the deficit 0.3–0.5 km s‑1 toward higher velocities. These differences, while significant, are not large compared to measurement errors for stellar data.

  6. Identification of host response signatures of infection.

    Energy Technology Data Exchange (ETDEWEB)

    Branda, Steven S.; Sinha, Anupama; Bent, Zachary

    2013-02-01

    Biological weapons of mass destruction and emerging infectious diseases represent a serious and growing threat to our national security. Effective response to a bioattack or disease outbreak critically depends upon efficient and reliable distinguishing between infected vs healthy individuals, to enable rational use of scarce, invasive, and/or costly countermeasures (diagnostics, therapies, quarantine). Screening based on direct detection of the causative pathogen can be problematic, because culture- and probe-based assays are confounded by unanticipated pathogens (e.g., deeply diverged, engineered), and readily-accessible specimens (e.g., blood) often contain little or no pathogen, particularly at pre-symptomatic stages of disease. Thus, in addition to the pathogen itself, one would like to detect infection-specific host response signatures in the specimen, preferably ones comprised of nucleic acids (NA), which can be recovered and amplified from tiny specimens (e.g., fingerstick draws). Proof-of-concept studies have not been definitive, however, largely due to use of sub-optimal sample preparation and detection technologies. For purposes of pathogen detection, Sandia has developed novel molecular biology methods that enable selective isolation of NA unique to, or shared between, complex samples, followed by identification and quantitation via Second Generation Sequencing (SGS). The central hypothesis of the current study is that variations on this approach will support efficient identification and verification of NA-based host response signatures of infectious disease. To test this hypothesis, we re-engineered Sandia's sophisticated sample preparation pipelines, and developed new SGS data analysis tools and strategies, in order to pioneer use of SGS for identification of host NA correlating with infection. Proof-of-concept studies were carried out using specimens drawn from pathogen-infected non-human primates (NHP). This work provides a strong foundation for

  7. Signatures for quark clustering in nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, C.E. [College of William and Mary, Williamsburg, VA (United States); Lassila, K.E. [Iowa State Univ., Ames, IA (United States)

    1994-04-01

    As a signature for the presence of quark clusters in nuclei, the authors suggest studying backward protons produced by electron scattering off deuterons and suggest a ratio that cancels out much of the detailed properties of deuterons or 6-quark clusters. The test may be viewed as a test that the short range part of the deuteron is still a 2-nucleon system. They make estimates to show how it fails in characteristic and significant ways if the two nucleons at short range coalesce into a kneaded 6-quark cluster.

  8. Study on the signatures for a magazine

    International Nuclear Information System (INIS)

    Chai, Jan Bom; Kim, Tae Hwan; Park, Sung Keun

    2004-01-01

    In this paper, diagnostic algorithms are developed to be utilized to monitor the condition of and to diagnose defects in the magazine of a fuelling machine installed in CANDU plants. The magazine plays a role in storing fuels, plugs and tools. Since the magazine operates in the high radiation area, it is impossible to give direct access to it for measuring the signals. Therefore, inlet and outlet pressures of a hydraulic motor, which can be acquired remotely, were selected as the measuring variables. The measured signals are further processed to extract the diagnostic signatures. They were examined and validated in the various experiments with the magazine mock-up

  9. Signatures for quark clustering in nuclei

    International Nuclear Information System (INIS)

    Carlson, C.E.; Lassila, K.E.

    1994-01-01

    As a signature for the presence of quark clusters in nuclei, the authors suggest studying backward protons produced by electron scattering off deuterons and suggest a ratio that cancels out much of the detailed properties of deuterons or 6-quark clusters. The test may be viewed as a test that the short range part of the deuteron is still a 2-nucleon system. They make estimates to show how it fails in characteristic and significant ways if the two nucleons at short range coalesce into a kneaded 6-quark cluster

  10. Strong signatures of right-handed compositeness

    Energy Technology Data Exchange (ETDEWEB)

    Redi, Michele [INFN, Sesto Fiorentino, Firenze (Italy); Sanz, Veronica [York Univ., Toronto, ON (Canada). Dept. of Physics and Astronomy; Sussex Univ., Brighton (United Kingdom). Dept. of Physics and Astronomy; Vries, Maikel de; Weiler, Andreas [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2013-05-15

    Right-handed light quarks could be significantly composite, yet compatible with experimental searches at the LHC and precision tests on Standard Model couplings. In these scenarios, that are motivated by flavor physics, one expects large cross sections for the production of new resonances coupled to light quarks. We study experimental strong signatures of right-handed compositeness at the LHC, and constrain the parameter space of these models with recent results by ATLAS and CMS. We show that the LHC sensitivity could be significantly improved if dedicated searches were performed, in particular in multi-jet signals.

  11. Ulysses and the Signature of Things

    OpenAIRE

    Dukes, Hunter

    2017-01-01

    James Joyce’s depiction of autographic signatures resembles the “doctrine of signatures” — a pre-modern system of correspondence between medicinal plants and parts of the body. Certain aspects of this episteme reappear in the late nineteenth century. This recurrence is due, in large part, to developments in the technology of writing that threaten what Friedrich Kittler calls the “surrogate sensuality of handwriting.” Reading the “Nausicaa” episode of Ulysses against fin-de-siècle ideas about ...

  12. Characterizing Resident Space Object Earthshine Signature Variability

    Science.gov (United States)

    Van Cor, Jared D.

    There are three major sources of illumination on objects in the near Earth space environment: Sunshine, Moonshine, and Earthshine. For objects in this environment (satellites, orbital debris, etc.) known as Resident Space Objects (RSOs), the sun and the moon have consistently small illuminating solid angles and can be treated as point sources; this makes their incident illumination easily modeled. The Earth on the other hand has a large illuminating solid angle, is heterogeneous, and is in a constant state of change. The objective of this thesis was to characterize the impact and variability of observed RSO Earthshine on apparent magnitude signatures in the visible optical spectral region. A key component of this research was creating Earth object models incorporating the reflectance properties of the Earth. Two Earth objects were created: a homogeneous diffuse Earth object and a time sensitive heterogeneous Earth object. The homogeneous diffuse Earth object has a reflectance equal to the average global albedo, a standard model used when modeling Earthshine. The time sensitive heterogeneous Earth object was created with two material maps representative of the dynamic reflectance of the surface of the earth, and a shell representative of the atmosphere. NASA's Moderate-resolution Imaging Spectroradiometer (MODIS) Earth observing satellite product libraries, MCD43C1 global surface BRDF map and MOD06 global fractional cloud map, were utilized to create the material maps, and a hybridized version of the Empirical Line Method (ELM) was used to create the atmosphere. This dynamic Earth object was validated by comparing simulated color imagery of the Earth to that taken by: NASAs Earth Polychromatic Imaging Camera (EPIC) located on the Deep Space Climate Observatory (DSCOVR), and by MODIS located on the Terra satellite. The time sensitive heterogeneous Earth object deviated from MODIS imagery by a spectral radiance root mean square error (RMSE) of +/-14.86 [watts/m. 2sr

  13. Criminaliteit en traditionele Chinese medicijnen

    NARCIS (Netherlands)

    van Uhm, Daan

    2014-01-01

    Traditional Chinese medicine (TCM) is deeply rooted in the Chinese culture. Although thousands of animal and plant species are used for medicines legally, some medications contain more sinister elements; illegal animal or plant ingredients of protected species. What is the origin of this demand for

  14. Internationalization of Chinese Higher Education

    Science.gov (United States)

    Chen, Linhan; Huang, Danyan

    2013-01-01

    This paper probes into the development of internationalization of higher education in China from ancient times to modern times, including the emergence of international connections in Chinese higher education and the subsequent development of such connections, the further development of internationalization of Chinese higher education, and the…

  15. The chinese health care system

    DEFF Research Database (Denmark)

    Hougaard, Jens Leth; Østerdal, Lars Peter Raahave; Yu, Yi

    2011-01-01

    We describe the structure and present situation of the Chinese healthcare system and discuss its primary problems and challenges. We discuss problems with inefficient burden sharing, adverse provider incentives and huge inequities, and seek explanations in the structural features of the Chinese...

  16. Chinese Companies in the Netherlands

    NARCIS (Netherlands)

    Hong, T.M.; Pieke, F.N.; Stam, T.

    2017-01-01

    The rapid growth of Chinese investment in the Netherlands has been cause for both excitement and anxiety. Many of the companies and other investors are still unknown and the background and objectives of their investment often remain unclear. This research takes a close look at fourteen Chinese

  17. Mechanical removal of Chinese privet

    Science.gov (United States)

    John Klepac; Robert B. Rummer; James L. Hanula; Scott Horn

    2007-01-01

    Chinese privet (Ligustrum sinense Lour.), a highly invasive nonnative plant, is prevalent in the Southern United States. Chinese privet infestations can hinder regeneration of desirable species, reduce stand productivity, and have other undesirable consequences. A combined mechanical (mulching) and chemical (triclopyr) treatment was applied to...

  18. Transnational Learning and Chinese Sayings

    Science.gov (United States)

    Liu, Haedy

    2017-01-01

    Chinese sayings within the context of transnational education have not been extensively explored within higher education. In this qualitative study, which utilized semi-structured interviews, data were collected from 24 participants to explore their transnational study experience. Chinese sayings, framed within a rich Confucian history, provide a…

  19. Chinese Food Heats Up

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ Earlier this year,the vice chairman of industry body the China Cuisine Association,Yang Liu,expressed his bewilderment at the absence of a truly successful Chinese restaurant chain."In this ancient nation with a restaurant culture thousands of years old,home to the most delicious food in the world,it is a pity that you can find world-famous traditional dishes and delicious snacks,but a globally competitive restaurant chain is nowhere to be found,"he told Sanlian Life Weekly.

  20. The Chinese Tiger Mother

    OpenAIRE

    Jacek Hołówka

    2011-01-01

    In 2010 a book by Amy Chua: Battle Hymn of the Tiger Mother was published and it sparked a broad discussion among pedagogues and the open society about the factors determining educational success. Chua forms a simple and provocative thesis – the Chinese mothers are the best in the world because they don’t spoil their children, quickly introduce them into the adult culture, have high expectations of them, they are brusque and cold but they teach their children how to survive and be competitive...

  1. [Common household traditional Chinese medicines].

    Science.gov (United States)

    Zhang, Shu-Yuan; Li, Mei; Fu, Dan; Liu, Yang; Wang, Hui; Tan, Wei

    2016-02-01

    With the enhancement in the awareness of self-diagnosis among residents, it's very common for each family to prepare common medicines for unexpected needs. Meanwhile, with the popularization of the traditional Chinese medicine knowledge, the proportion of common traditional Chinese medicines prepared at residents' families is increasingly higher than western medicines year by year. To make it clear, both pre-research and closed questionnaire research were adopted for residents in Chaoyang District, Beijing, excluding residents with a medical background. Based on the results of data, a analysis was made to define the role and influence on the quality of life of residents and give suggestions for relevant departments to improve the traditional Chinese medicine popularization and promote the traditional Chinese medicine market. Copyright© by the Chinese Pharmaceutical Association.

  2. Signatures of unstable semiclassical trajectories in tunneling

    International Nuclear Information System (INIS)

    Levkov, D G; Panin, A G; Sibiryakov, S M

    2009-01-01

    It was found recently that processes of multidimensional tunneling are generally described at high energies by unstable semiclassical trajectories. We study two observational signatures related to the instability of trajectories. First, we find an additional power-law dependence of the tunneling probability on the semiclassical parameter as compared to the standard case of potential tunneling. The second signature is a substantial widening of the probability distribution over final-state quantum numbers. These effects are studied using a modified semiclassical technique which incorporates stabilization of the tunneling trajectories. The technique is derived from first principles. We obtain expressions for the inclusive and exclusive tunneling probabilities in the case of unstable semiclassical trajectories. We also investigate the 'phase transition' between the cases of stable and unstable trajectories across certain 'critical' values of energy. Finally, we derive the relation between the semiclassical probabilities of tunneling from the low-lying and highly excited initial states. This puts on firm ground a conjecture made previously in the semiclassical description of collision-induced tunneling in field theory

  3. Theoretical Characterizaiton of Visual Signatures (Muzzle Flash)

    Science.gov (United States)

    Kashinski, D. O.; Scales, A. N.; Vanderley, D. L.; Chase, G. M.; di Nallo, O. E.; Byrd, E. F. C.

    2014-05-01

    We are investigating the accuracy of theoretical models used to predict the visible, ultraviolet and infrared spectra of product materials ejected from the muzzle of currently fielded systems. Recent advances in solid propellants has made the management of muzzle signature (flash) a principle issue in weapons development across the calibers. A priori prediction of the electromagnetic spectra of formulations will allow researchers to tailor blends that yield desired signatures and determine spectrographic detection ranges. We are currently employing quantum chemistry methods at various levels of sophistication to optimize molecular geometries, compute vibrational frequencies, and determine the optical spectra of specific gas-phase molecules and radicals of interest. Electronic excitations are being computed using Time Dependent Density Functional Theory (TD-DFT). A comparison of computational results to experimental values found in the literature is used to assess the affect of basis set and functional choice on calculation accuracy. The current status of this work will be presented at the conference. Work supported by the ARL, and USMA.

  4. Signature inversion in doubly odd 124La

    International Nuclear Information System (INIS)

    Chantler, H.J.; Paul, E.S.; Boston, A.J.; Choy, P.T.W.; Nolan, P.J.; Carpenter, M.P.; Davids, C.N.; Seweryniak, D.; Charity, R.; Devlin, M.; Sarantites, D.G.; Chiara, C.J.; Fossan, D.B.; Koike, T.; LaFosse, D.R.; Starosta, K.; Fletcher, A.M.; Smith, J.F.; Jenkins, D.G.; Kelsall, N.S.

    2002-01-01

    High-spin states have been studied in neutron-deficient 57 124 La 67 , populated through the 64 Zn( 64 Zn,3pn) reaction at 260 MeV. The Gammasphere γ-ray spectrometer has been used in conjunction with the Microball charged-particle detector, the Neutron Shell, and the Argonne Fragment Mass Analyzer, in order to select evaporation residues of interest. The known band structures have been extended and new bands found. Most of the bands are linked together, allowing more consistent spin and parity assignments. Comparison of band properties to cranking calculations has allowed configuration assignments to be made and includes the first identification of the g 9/2 proton-hole in an odd-odd lanthanum isotope. Two bands have been assigned a πh 11/2 xνh 11/2 structure; the yrast one exhibits a signature inversion in its level energies below I=18.5(ℎ/2π), while the excited one exhibits a signature inversion above I=18.5(ℎ/2π)

  5. Persistence of social signatures in human communication.

    Science.gov (United States)

    Saramäki, Jari; Leicht, E A; López, Eduardo; Roberts, Sam G B; Reed-Tsochas, Felix; Dunbar, Robin I M

    2014-01-21

    The social network maintained by a focal individual, or ego, is intrinsically dynamic and typically exhibits some turnover in membership over time as personal circumstances change. However, the consequences of such changes on the distribution of an ego's network ties are not well understood. Here we use a unique 18-mo dataset that combines mobile phone calls and survey data to track changes in the ego networks and communication patterns of students making the transition from school to university or work. Our analysis reveals that individuals display a distinctive and robust social signature, captured by how interactions are distributed across different alters. Notably, for a given ego, these social signatures tend to persist over time, despite considerable turnover in the identity of alters in the ego network. Thus, as new network members are added, some old network members either are replaced or receive fewer calls, preserving the overall distribution of calls across network members. This is likely to reflect the consequences of finite resources such as the time available for communication, the cognitive and emotional effort required to sustain close relationships, and the ability to make emotional investments.

  6. Corticosteroid receptors adopt distinct cyclical transcriptional signatures.

    Science.gov (United States)

    Le Billan, Florian; Amazit, Larbi; Bleakley, Kevin; Xue, Qiong-Yao; Pussard, Eric; Lhadj, Christophe; Kolkhof, Peter; Viengchareun, Say; Fagart, Jérôme; Lombès, Marc

    2018-05-07

    Mineralocorticoid receptors (MRs) and glucocorticoid receptors (GRs) are two closely related hormone-activated transcription factors that regulate major pathophysiologic functions. High homology between these receptors accounts for the crossbinding of their corresponding ligands, MR being activated by both aldosterone and cortisol and GR essentially activated by cortisol. Their coexpression and ability to bind similar DNA motifs highlight the need to investigate their respective contributions to overall corticosteroid signaling. Here, we decipher the transcriptional regulatory mechanisms that underlie selective effects of MRs and GRs on shared genomic targets in a human renal cellular model. Kinetic, serial, and sequential chromatin immunoprecipitation approaches were performed on the period circadian protein 1 ( PER1) target gene, providing evidence that both receptors dynamically and cyclically interact at the same target promoter in a specific and distinct transcriptional signature. During this process, both receptors regulate PER1 gene by binding as homo- or heterodimers to the same promoter region. Our results suggest a novel level of MR-GR target gene regulation, which should be considered for a better and integrated understanding of corticosteroid-related pathophysiology.-Le Billan, F., Amazit, L., Bleakley, K., Xue, Q.-Y., Pussard, E., Lhadj, C., Kolkhof, P., Viengchareun, S., Fagart, J., Lombès, M. Corticosteroid receptors adopt distinct cyclical transcriptional signatures.

  7. Monotop signature from a fermionic top partner

    Science.gov (United States)

    Gonçalves, Dorival; Kong, Kyoungchul; Sakurai, Kazuki; Takeuchi, Michihisa

    2018-01-01

    We investigate monotop signatures arising from phenomenological models of fermionic top partners, which are degenerate in mass and decay into a bosonic dark matter candidate, either spin 0 or spin 1. Such a model provides a monotop signature as a smoking gun, while conventional searches with t t ¯ + missing transverse momentum are limited. Two such scenarios, (i) a phenomenological third generation extradimensional model with excited top and electroweak sectors, and (ii) a model where only a top partner and a dark matter particle are added to the standard model, are studied in the degenerate mass regime. We find that in the case of extra dimension a number of different processes give rise to effectively the same monotop final state, and a great gain can be obtained in the sensitivity for this channel. We show that the monotop search can explore top-partner masses up to 630 and 300 GeV for the third generation extradimensional model and the minimal fermionic top-partner model, respectively, at the high luminosity LHC.

  8. Automated defect spatial signature analysis for semiconductor manufacturing process

    Science.gov (United States)

    Tobin, Jr., Kenneth W.; Gleason, Shaun S.; Karnowski, Thomas P.; Sari-Sarraf, Hamed

    1999-01-01

    An apparatus and method for performing automated defect spatial signature alysis on a data set representing defect coordinates and wafer processing information includes categorizing data from the data set into a plurality of high level categories, classifying the categorized data contained in each high level category into user-labeled signature events, and correlating the categorized, classified signature events to a present or incipient anomalous process condition.

  9. Provably Secure and Subliminal-Free Variant of Schnorr Signature

    OpenAIRE

    Zhang , Yinghui; Li , Hui; Li , Xiaoqing; Zhu , Hui

    2013-01-01

    Part 2: Asian Conference on Availability, Reliability and Security (AsiaARES); International audience; Subliminal channels present a severe challenge to information security. Currently, subliminal channels still exist in Schnorr signature. In this paper, we propose a subliminal-free variant of Schnorr signature. In the proposed scheme, an honest-but-curious warden is introduced to help the signer to generate a signature on a given message, but it is disallowed to sign messages independently. ...

  10. Invariance Signatures: Characterizing contours by their departures from invariance

    OpenAIRE

    Squire, David; Caelli, Terry M.

    1997-01-01

    In this paper, a new invariant feature of two-dimensional contours is reported: the Invariance Signature. The Invariance Signature is a measure of the degree to which a contour is invariant under a variety of transformations, derived from the theory of Lie transformation groups. It is shown that the Invariance Signature is itself invariant under shift, rotation and scaling of the contour. Since it is derived from local properties of the contour, it is well-suited to a neural network implement...

  11. Analysis of Non-contact Acousto Thermal Signature Data (Postprint)

    Science.gov (United States)

    2016-02-01

    AFRL-RX-WP-JA-2016-0321 ANALYSIS OF NON-CONTACT ACOUSTO-THERMAL SIGNATURE DATA (POSTPRINT) Amanda K. Criner AFRL/RX...October 2014 – 16 September 2015 4. TITLE AND SUBTITLE ANALYSIS OF NON-CONTACT ACOUSTO-THERMAL SIGNATURE DATA (POSTPRINT) 5a. CONTRACT NUMBER...words) The non-contact acousto-thermal signature (NCATS) is a nondestructive evaluation technique with potential to detect fatigue in materials such as

  12. General Conversion for Obtaining Strongly Existentially Unforgeable Signatures

    Science.gov (United States)

    Teranishi, Isamu; Oyama, Takuro; Ogata, Wakaha

    We say that a signature scheme is strongly existentially unforgeable (SEU) if no adversary, given message/signature pairs adaptively, can generate a signature on a new message or a new signature on a previously signed message. We propose a general and efficient conversion in the standard model that transforms a secure signature scheme to SEU signature scheme. In order to construct that conversion, we use a chameleon commitment scheme. Here a chameleon commitment scheme is a variant of commitment scheme such that one can change the committed value after publishing the commitment if one knows the secret key. We define the chosen message security notion for the chameleon commitment scheme, and show that the signature scheme transformed by our proposed conversion satisfies the SEU property if the chameleon commitment scheme is chosen message secure. By modifying the proposed conversion, we also give a general and efficient conversion in the random oracle model, that transforms a secure signature scheme into a SEU signature scheme. This second conversion also uses a chameleon commitment scheme but only requires the key only attack security for it.

  13. Enhanced arbitrated quantum signature scheme using Bell states

    International Nuclear Information System (INIS)

    Wang Chao; Liu Jian-Wei; Shang Tao

    2014-01-01

    We investigate the existing arbitrated quantum signature schemes as well as their cryptanalysis, including intercept-resend attack and denial-of-service attack. By exploring the loopholes of these schemes, a malicious signatory may successfully disavow signed messages, or the receiver may actively negate the signature from the signatory without being detected. By modifying the existing schemes, we develop counter-measures to these attacks using Bell states. The newly proposed scheme puts forward the security of arbitrated quantum signature. Furthermore, several valuable topics are also presented for further research of the quantum signature scheme

  14. FIR signature verification system characterizing dynamics of handwriting features

    Science.gov (United States)

    Thumwarin, Pitak; Pernwong, Jitawat; Matsuura, Takenobu

    2013-12-01

    This paper proposes an online signature verification method based on the finite impulse response (FIR) system characterizing time-frequency characteristics of dynamic handwriting features. First, the barycenter determined from both the center point of signature and two adjacent pen-point positions in the signing process, instead of one pen-point position, is used to reduce the fluctuation of handwriting motion. In this paper, among the available dynamic handwriting features, motion pressure and area pressure are employed to investigate handwriting behavior. Thus, the stable dynamic handwriting features can be described by the relation of the time-frequency characteristics of the dynamic handwriting features. In this study, the aforesaid relation can be represented by the FIR system with the wavelet coefficients of the dynamic handwriting features as both input and output of the system. The impulse response of the FIR system is used as the individual feature for a particular signature. In short, the signature can be verified by evaluating the difference between the impulse responses of the FIR systems for a reference signature and the signature to be verified. The signature verification experiments in this paper were conducted using the SUBCORPUS MCYT-100 signature database consisting of 5,000 signatures from 100 signers. The proposed method yielded equal error rate (EER) of 3.21% on skilled forgeries.

  15. Chinese outward foreign direct investments to Europe

    NARCIS (Netherlands)

    Blomkvist, Katarina; Drogendijk, Rian

    This paper addresses Chinese outward foreign direct investments (OFDI) in Europe. We aim to provide more knowledge on the ongoing research discussion about Chinese OFDI, more specifically, we answer questions about what is driving Chinese firms to invest in Europe, and whether Chinese investment

  16. Social Anxiety among Chinese People

    Science.gov (United States)

    Fan, Qianqian; Chang, Weining C.

    2015-01-01

    The experience of social anxiety has largely been investigated among Western populations; much less is known about social anxiety in other cultures. Unlike the Western culture, the Chinese emphasize interdependence and harmony with social others. In addition, it is unclear if Western constructed instruments adequately capture culturally conditioned conceptualizations and manifestations of social anxiety that might be specific to the Chinese. The present study employed a sequence of qualitative and quantitative approaches to examine the assessment of social anxiety among the Chinese people. Interviews and focus group discussions with Chinese participants revealed that some items containing the experience of social anxiety among the Chinese are not present in existing Western measures. Factor analysis was employed to examine the factor structure of the more comprehensive scale. This approach revealed an “other concerned anxiety” factor that appears to be specific to the Chinese. Subsequent analysis found that the new factor—other concerned anxiety—functioned the same as other social anxiety factors in their association with risk factors of social anxiety, such as attachment, parenting, behavioral inhibition/activation, and attitude toward group. The implications of these findings for a more culturally sensitive assessment tool of social anxiety among the Chinese were discussed. PMID:26380367

  17. Social Anxiety among Chinese People.

    Science.gov (United States)

    Fan, Qianqian; Chang, Weining C

    2015-01-01

    The experience of social anxiety has largely been investigated among Western populations; much less is known about social anxiety in other cultures. Unlike the Western culture, the Chinese emphasize interdependence and harmony with social others. In addition, it is unclear if Western constructed instruments adequately capture culturally conditioned conceptualizations and manifestations of social anxiety that might be specific to the Chinese. The present study employed a sequence of qualitative and quantitative approaches to examine the assessment of social anxiety among the Chinese people. Interviews and focus group discussions with Chinese participants revealed that some items containing the experience of social anxiety among the Chinese are not present in existing Western measures. Factor analysis was employed to examine the factor structure of the more comprehensive scale. This approach revealed an "other concerned anxiety" factor that appears to be specific to the Chinese. Subsequent analysis found that the new factor-other concerned anxiety-functioned the same as other social anxiety factors in their association with risk factors of social anxiety, such as attachment, parenting, behavioral inhibition/activation, and attitude toward group. The implications of these findings for a more culturally sensitive assessment tool of social anxiety among the Chinese were discussed.

  18. Social Anxiety among Chinese People

    Directory of Open Access Journals (Sweden)

    Qianqian Fan

    2015-01-01

    Full Text Available The experience of social anxiety has largely been investigated among Western populations; much less is known about social anxiety in other cultures. Unlike the Western culture, the Chinese emphasize interdependence and harmony with social others. In addition, it is unclear if Western constructed instruments adequately capture culturally conditioned conceptualizations and manifestations of social anxiety that might be specific to the Chinese. The present study employed a sequence of qualitative and quantitative approaches to examine the assessment of social anxiety among the Chinese people. Interviews and focus group discussions with Chinese participants revealed that some items containing the experience of social anxiety among the Chinese are not present in existing Western measures. Factor analysis was employed to examine the factor structure of the more comprehensive scale. This approach revealed an “other concerned anxiety” factor that appears to be specific to the Chinese. Subsequent analysis found that the new factor—other concerned anxiety—functioned the same as other social anxiety factors in their association with risk factors of social anxiety, such as attachment, parenting, behavioral inhibition/activation, and attitude toward group. The implications of these findings for a more culturally sensitive assessment tool of social anxiety among the Chinese were discussed.

  19. Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures

    Directory of Open Access Journals (Sweden)

    Pride David T

    2008-09-01

    Full Text Available Abstract Background Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC, where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. Results From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of

  20. Genome signature analysis of thermal virus metagenomes reveals Archaea and thermophilic signatures.

    Science.gov (United States)

    Pride, David T; Schoenfeld, Thomas

    2008-09-17

    Metagenomic analysis provides a rich source of biological information for otherwise intractable viral communities. However, study of viral metagenomes has been hampered by its nearly complete reliance on BLAST algorithms for identification of DNA sequences. We sought to develop algorithms for examination of viral metagenomes to identify the origin of sequences independent of BLAST algorithms. We chose viral metagenomes obtained from two hot springs, Bear Paw and Octopus, in Yellowstone National Park, as they represent simple microbial populations where comparatively large contigs were obtained. Thermal spring metagenomes have high proportions of sequences without significant Genbank homology, which has hampered identification of viruses and their linkage with hosts. To analyze each metagenome, we developed a method to classify DNA fragments using genome signature-based phylogenetic classification (GSPC), where metagenomic fragments are compared to a database of oligonucleotide signatures for all previously sequenced Bacteria, Archaea, and viruses. From both Bear Paw and Octopus hot springs, each assembled contig had more similarity to other metagenome contigs than to any sequenced microbial genome based on GSPC analysis, suggesting a genome signature common to each of these extreme environments. While viral metagenomes from Bear Paw and Octopus share some similarity, the genome signatures from each locale are largely unique. GSPC using a microbial database predicts most of the Octopus metagenome has archaeal signatures, while bacterial signatures predominate in Bear Paw; a finding consistent with those of Genbank BLAST. When using a viral database, the majority of the Octopus metagenome is predicted to belong to archaeal virus Families Globuloviridae and Fuselloviridae, while none of the Bear Paw metagenome is predicted to belong to archaeal viruses. As expected, when microbial and viral databases are combined, each of the Octopus and Bear Paw metagenomic contigs

  1. Quantum liquid signatures in dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Gabadadze, Gregory; Pirtskhalava, David, E-mail: gg32@nyu.edu, E-mail: dmp371@nyu.edu [Center for Cosmology and Particle Physics, Department of Physics, New York University, New York, NY 10003 (United States)

    2009-05-15

    We develop further the proposal of arXiv:0806.3692 that a new state of matter - charged condensate of spin-0 nuclei - may exist in helium-core dwarf stars. The charged condensate and its fluctuations are described by an effective field theory Lagrangian. The spectrum of bosonic fluctuations is gapped, while electrons, at temperatures of interest, give rise to gapless excitations near the Fermi surface. These properties determine the evolution of the dwarfs with condensed cores. In particular, we show that such dwarf stars would cool significantly faster than their crystallized counterparts. As a result, the luminosity function for the helium-core dwarfs will have a sharp drop-off after the condensation. It is tempting to interpret the recently discovered abrupt termination of a sequence of 24 helium-core dwarf candidates in NGC 6397 as a signature of the charged condensation.

  2. SSC physics signatures and trigger requirements

    International Nuclear Information System (INIS)

    1985-01-01

    Strategies are considered for triggering on new physics processes on the environment of the SSC, where interaction rates will be very high and most new physics processes quite rare. The quantities available for use in the trigger at various levels are related to the signatures of possible new physics. Two examples were investigated in some detail using the ISAJET Monte Carlo program: Higgs decays to W pairs and a missing energy trigger applied to gluino pair production. In both of the examples studied in detail, it was found that workable strategies for reducing the trigger rate were obtainable which also produced acceptable efficiency for the processes of interest. In future work, it will be necessary to carry out such a program for the full spectrum of suggested new physics

  3. Signatures of massive sgoldstinos at hadron colliders

    International Nuclear Information System (INIS)

    Perazzi, Elena; Ridolfi, Giovanni; Zwirner, Fabio

    2000-01-01

    In supersymmetric extensions of the Standard Model with a very light gravitino, the effective theory at the weak scale should contain not only the goldstino G-tilde, but also its supersymmetric partners, the sgoldstinos. In the simplest case, the goldstino is a gauge-singlet and its superpartners are two neutral spin-0 particles, S and P. We study possible signals of massive sgoldstinos at hadron colliders, focusing on those that are most relevant for the Tevatron. We show that inclusive production of sgoldstinos, followed by their decay into two photons, can lead to observable signals or to stringent combined bounds on the gravitino and sgoldstino masses. Sgoldstino decays into two gluon jets may provide a useful complementary signature

  4. Signatures of chromodynamics in hadron collisions

    International Nuclear Information System (INIS)

    Halzen, F.

    1979-01-01

    The quantum chromodynamics (QCD) describes the interaction of the parton constituents of hadrons (quarks and gluons) via eight colored photons (gluons) interacting with the quarks, and unlike the photons, with each other. The simple picture of Drell-Yan model has made surprising success. The marriage of the old fashion Drell-Yan parton model with QCD has not only made its phenomenological success in the study of lepton pair production, but has allowed to study quantitatively the gluon correction to the model. Information from beam dump and emulsion experiments on charm production is compared with the typical QCD diagram. The results indicate some possible non-perturbative contribution to the photon- and hadron-production of heavy quarks. The definite features of dilepton as well as large transverse momentum data are direct signature of gluons. (Kato, T.)

  5. Collider signatures of flavorful Higgs bosons

    International Nuclear Information System (INIS)

    Altmannshofer, Wolfgang; Eby, Joshua; Gori, Stefania; Lotito, Matteo

    2016-01-01

    Motivated by our limited knowledge of the Higgs couplings to the first two generation fermions, we analyze the collider phenomenology of a class of two Higgs doublet models (2HDMs) with a nonstandard Yukawa sector. One Higgs doublet is mainly responsible for the masses of the weak gauge bosons and the third-generation fermions, while the second Higgs doublet provides mass for the lighter fermion generations. The characteristic collider signatures of this setup differ significantly from well-studied 2HDMs with natural flavor conservation, flavor alignment, or minimal flavor violation. New production mechanisms for the heavy scalar, pseudoscalar, and charged Higgs involving second-generation quarks can become dominant. The most interesting decay modes include H/A → cc,tc,μμ,τμ and H"± → cb,cs,μν. As a result, searches for low-mass dimuon resonances are currently among the best probes of the heavy Higgs bosons in this setup.

  6. ALPs effective field theory and collider signatures

    Energy Technology Data Exchange (ETDEWEB)

    Brivio, I. [Universidad Autonoma de Madrid, Departamento de Fisica Teorica y Instituto de Fisica Teorica, IFT-UAM/CSIC, Madrid (Spain); University of Copenhagen, Niels Bohr International Academy, Copenhagen (Denmark); Gavela, M.B.; Merlo, L.; Rey, R. del [Universidad Autonoma de Madrid, Departamento de Fisica Teorica y Instituto de Fisica Teorica, IFT-UAM/CSIC, Madrid (Spain); Mimasu, K. [University of Sussex, Department of Physics and Astronomy, Brighton (United Kingdom); Universite Catholique de Louvain, Centre for Cosmology, Particle Physics and Phenomenology (CP3), Louvain-la-Neuve (Belgium); No, J.M. [University of Sussex, Department of Physics and Astronomy, Brighton (United Kingdom); King' s College London, Department of Physics, London (United Kingdom); Sanz, V. [University of Sussex, Department of Physics and Astronomy, Brighton (United Kingdom)

    2017-08-15

    We study the leading effective interactions between the Standard Model fields and a generic singlet CP-odd (pseudo-) Goldstone boson. Two possible frameworks for electroweak symmetry breaking are considered: linear and non-linear. For the latter case, the basis of leading effective operators is determined and compared with that for the linear expansion. Associated phenomenological signals at colliders are explored for both scenarios, deriving new bounds and analyzing future prospects, including LHC and High Luminosity LHC sensitivities. Mono-Z, mono-W, W-photon plus missing energy and on-shell top final states are most promising signals expected in both frameworks. In addition, non-standard Higgs decays and mono-Higgs signatures are especially prominent and expected to be dominant in non-linear realisations. (orig.)

  7. Signatures of Beam - and Anisotropy Driven Oscillitons

    Science.gov (United States)

    Sauer, K.; Dubinin, E.; McKenzie, J. F.

    Oscillitons represent a new class of stationary nonlinear waves, first found in bi-ion plasmas (Sauer et al., 1991) where mode splitting of the `individual' wave modes leads to conditions for phase- and group-standing waves near the `crossing points'. The corresponding structures have signatures of the usual solitons, superimposed by spatial oscillations. Oscillitons may also occur in single-ion plasmas, e.g. in the elec- tron whistler branch. The characteristic features of different types of oscillitons under realistic conditions in space plasmas including damping, beams and anisotropies are analyzed. Relevant mechanisms of coherent waves observed in different frequency ranges (Lion Roars at Earth, ion cyclotron waves near Io and Mars) are discussed.

  8. Thermal Signature Identification System (TheSIS)

    Science.gov (United States)

    Merritt, Scott; Bean, Brian

    2015-01-01

    We characterize both nonlinear and high order linear responses of fiber-optic and optoelectronic components using spread spectrum temperature cycling methods. This Thermal Signature Identification System (TheSIS) provides much more detail than conventional narrowband or quasi-static temperature profiling methods. This detail allows us to match components more thoroughly, detect subtle reversible shifts in performance, and investigate the cause of instabilities or irreversible changes. In particular, we create parameterized models of athermal fiber Bragg gratings (FBGs), delay line interferometers (DLIs), and distributed feedback (DFB) lasers, then subject the alternative models to selection via the Akaike Information Criterion (AIC). Detailed pairing of components, e.g. FBGs, is accomplished by means of weighted distance metrics or norms, rather than on the basis of a single parameter, such as center wavelength.

  9. Spin-3/2 Pentaquark Resonance Signature

    International Nuclear Information System (INIS)

    Ben Lasscock; John Hedditch; Derek Leinweber; Anthony Williams; Waseem Kamleh; Wolodymyr Melnitchouk; Anthony Thomas; Ross Young; James Zanotti

    2005-01-01

    We search for the standard lattice resonance signature of attraction between the resonance constituents which leads to a bound state at quark masses near the physical regime. We study a variety of spin-1/2 interpolators and for the first time, interpolators providing access to spin-3/2 pentaquark states. In looking for evidence of binding, a precise determination of the mass splitting between the pentaquark state and its lowest-lying decay channel is performed by constructing the effective mass splitting from the various two-point correlation functions. While the binding of the pentaquark state is not a requirement, the observation of such binding would provide compelling evidence for the existence of the theta+ pentaquark resonance. Evidence of binding is observed in the isoscalar spin-3/2 positive parity channel, making it an interesting state for further research

  10. Signature of Microbial Dysbiosis in Periodontitis.

    Science.gov (United States)

    Meuric, Vincent; Le Gall-David, Sandrine; Boyer, Emile; Acuña-Amador, Luis; Martin, Bénédicte; Fong, Shao Bing; Barloy-Hubler, Frederique; Bonnaure-Mallet, Martine

    2017-07-15

    Periodontitis is driven by disproportionate host inflammatory immune responses induced by an imbalance in the composition of oral bacteria; this instigates microbial dysbiosis, along with failed resolution of the chronic destructive inflammation. The objectives of this study were to identify microbial signatures for health and chronic periodontitis at the genus level and to propose a model of dysbiosis, including the calculation of bacterial ratios. Published sequencing data obtained from several different studies (196 subgingival samples from patients with chronic periodontitis and 422 subgingival samples from healthy subjects) were pooled and subjected to a new microbiota analysis using the same Visualization and Analysis of Microbial Population Structures (VAMPS) pipeline, to identify microbiota specific to health and disease. Microbiota were visualized using CoNet and Cytoscape. Dysbiosis ratios, defined as the percentage of genera associated with disease relative to the percentage of genera associated with health, were calculated to distinguish disease from health. Correlations between the proposed dysbiosis ratio and the periodontal pocket depth were tested with a different set of data obtained from a recent study, to confirm the relevance of the ratio as a potential indicator of dysbiosis. Beta diversity showed significant clustering of periodontitis-associated microbiota, at the genus level, according to the clinical status and independent of the methods used. Specific genera ( Veillonella , Neisseria , Rothia , Corynebacterium , and Actinomyces ) were highly prevalent (>95%) in health, while other genera ( Eubacterium , Campylobacter , Treponema , and Tannerella ) were associated with chronic periodontitis. The calculation of dysbiosis ratios based on the relative abundance of the genera found in health versus periodontitis was tested. Nonperiodontitis samples were significantly identifiable by low ratios, compared to chronic periodontitis samples. When

  11. Experimental signatures of gravitational wave bursters

    International Nuclear Information System (INIS)

    Dubath, Florian; Foffa, Stefano; Gasparini, Maria Alice; Maggiore, Michele; Sturani, Riccardo

    2005-01-01

    Gravitational wave bursters are sources which emit repeatedly bursts of gravitational waves, and have been recently suggested as potentially interesting candidates for gravitational wave (GW) detectors. Mechanisms that could give rise to a GW burster can be found for instance in highly magnetized neutron stars (the 'magnetars' which explain the phenomenon of soft gamma repeaters), in accreting neutron stars and in hybrid stars with a quark core. We point out that these sources have very distinctive experimental signatures. In particular, as already observed in the γ-ray bursts from soft gamma repeaters, the energy spectrum of the events is a power-law, dN∼E -γ dE with γ≅1.6, and they have a distribution of waiting times (the times between one outburst and the next) significantly different from the distribution of uncorrelated events. We discuss possible detection strategies that could be used to search for these events in existing gravitational wave detectors

  12. Continuous-variable quantum homomorphic signature

    Science.gov (United States)

    Li, Ke; Shang, Tao; Liu, Jian-wei

    2017-10-01

    Quantum cryptography is believed to be unconditionally secure because its security is ensured by physical laws rather than computational complexity. According to spectrum characteristic, quantum information can be classified into two categories, namely discrete variables and continuous variables. Continuous-variable quantum protocols have gained much attention for their ability to transmit more information with lower cost. To verify the identities of different data sources in a quantum network, we propose a continuous-variable quantum homomorphic signature scheme. It is based on continuous-variable entanglement swapping and provides additive and subtractive homomorphism. Security analysis shows the proposed scheme is secure against replay, forgery and repudiation. Even under nonideal conditions, it supports effective verification within a certain verification threshold.

  13. Greenland and Chinese outbound investments

    DEFF Research Database (Denmark)

    Mouyal, Lone Wandahl; Mortensen, Bent Ole Gram; Su, Jingjing

    2017-01-01

    -Government seeks to develop new business sectors and to attract foreign investment, including investments from China, to develop especially its mineral resources. China now is the second largest economy in the world and the outbound investments by Chinese companies presents unprecedented opportunities for both...... Chinese companies and their global partners. However, Chinese outbound investment faces many hurdles both at home and outside. This article analyzes some of the main aspects in relation to regulatory hurdles, political obstacles as well as environmental, labor and financial challenges primarily focusing...... on investments in the mining industry....

  14. Machine monitoring via current signature analysis techniques

    International Nuclear Information System (INIS)

    Smith, S.F.; Castleberry, K.N.; Nowlin, C.H.

    1992-01-01

    A significant need in the effort to provide increased production quality is to provide improved plant equipment monitoring capabilities. Unfortunately, in today's tight economy, even such monitoring instrumentation must be implemented in a recognizably cost effective manner. By analyzing the electric current drawn by motors, actuator, and other line-powered industrial equipment, significant insights into the operations of the movers, driven equipment, and even the power source can be obtained. The generic term 'current signature analysis' (CSA) has been coined to describe several techniques for extracting useful equipment or process monitoring information from the electrical power feed system. A patented method developed at Oak Ridge National Laboratory is described which recognizes the presence of line-current modulation produced by motors and actuators driving varying loads. The in-situ application of applicable linear demodulation techniques to the analysis of numerous motor-driven systems is also discussed. The use of high-quality amplitude and angle-demodulation circuitry has permitted remote status monitoring of several types of medium and high-power gas compressors in (US DOE facilities) driven by 3-phase induction motors rated from 100 to 3,500 hp, both with and without intervening speed increasers. Flow characteristics of the compressors, including various forms of abnormal behavior such as surging and rotating stall, produce at the output of the specialized detectors specific time and frequency signatures which can be easily identified for monitoring, control, and fault-prevention purposes. The resultant data are similar in form to information obtained via standard vibration-sensing techniques and can be analyzed using essentially identical methods. In addition, other machinery such as refrigeration compressors, brine pumps, vacuum pumps, fans, and electric motors have been characterized

  15. Extracellular Signatures as Indicators of Processing Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wahl, Karen L.

    2012-01-09

    As described in other chapters within this volume, many aspects of microbial cells vary with culture conditions and therefore can potentially be analyzed as forensic signatures of growth conditions. In addition to changes or variations in components of the microbes themselves, extracellular materials indicative of production processes may remain associated with the final bacterial product. It is well recognized that even with considerable effort to make pure products such as fine chemicals or pharmaceuticals, trace impurities from components or synthesis steps associated with production processes can be detected in the final product. These impurities can be used as indicators of production source or methods, such as to help connect drugs of abuse to supply chains. Extracellular residue associated with microbial cells could similarly help to characterize production processes. For successful growth of microorganisms on culture media there must be an available source of carbon, nitrogen, inorganic phosphate and sulfur, trace metals, water and vitamins. The pH, temperature, and a supply of oxygen or other gases must also be appropriate for a given organism for successful culture. The sources of these components and the range in temperature, pH and other variables has adapted over the years with currently a wide range of possible combinations of media components, recipes and parameters to choose from for a given organism. Because of this wide variability in components, mixtures of components, and other parameters, there is the potential for differentiation of cultured organisms based on changes in culture conditions. The challenge remains how to narrow the field of potential combinations and be able to attribute variations in the final bacterial product and extracellular signatures associated with the final product to information about the culture conditions or recipe used in the production of that product.

  16. Acoustic signature of thunder from seismic records

    Science.gov (United States)

    Kappus, Mary E.; Vernon, Frank L.

    1991-06-01

    Thunder, the sound wave through the air associated with lightning, transfers sufficient energy to the ground to trigger seismometers set to record regional earthquakes. The acoustic signature recorded on seismometers, in the form of ground velocity as a function of time, contains the same type features as pressure variations recorded with microphones in air. At a seismic station in Kislovodsk, USSR, a nearly direct lightning strike caused electronic failure of borehole instruments while leaving a brief impulsive acoustic signature on the surface instruments. The peak frequency of 25-55 Hz is consistent with previously published values for cloud-to-ground lightning strikes, but spectra from this station are contaminated by very strong wind noise in this band. A thunderstorm near a similar station in Karasu triggered more than a dozen records of individual lightning strikes during a 2-hour period. The spectra for these events are fairly broadband, with peaks at low frequencies, varying from 6 to 13 Hz. The spectra were all computed by multitaper analysis, which deals appropriately with the nonstationary thunder signal. These independent measurements of low-frequency peaks corroborate the occasional occurrences in traditional microphone records, but a theory concerning the physical mechanism to account for them is still in question. Examined separately, the individual claps in each record have similar frequency distributions, discounting a need for multiple mechanisms to explain different phases of the thunder sequence. Particle motion, determined from polarization analysis of the three-component records, is predominantly vertical downward, with smaller horizontal components indicative of the direction to the lightning bolt. In three of the records the azimuth to the lightning bolt changes with time, confirming a significant horizontal component to the lightning channel itself.

  17. Thermal-Signature-Based Sleep Analysis Sensor

    Directory of Open Access Journals (Sweden)

    Ali Seba

    2017-10-01

    Full Text Available This paper addresses the development of a new technique in the sleep analysis domain. Sleep is defined as a periodic physiological state during which vigilance is suspended and reactivity to external stimulations diminished. We sleep on average between six and nine hours per night and our sleep is composed of four to six cycles of about 90 min each. Each of these cycles is composed of a succession of several stages of sleep that vary in depth. Analysis of sleep is usually done via polysomnography. This examination consists of recording, among other things, electrical cerebral activity by electroencephalography (EEG, ocular movements by electrooculography (EOG, and chin muscle tone by electromyography (EMG. Recordings are made mostly in a hospital, more specifically in a service for monitoring the pathologies related to sleep. The readings are then interpreted manually by an expert to generate a hypnogram, a curve showing the succession of sleep stages during the night in 30s epochs. The proposed method is based on the follow-up of the thermal signature that makes it possible to classify the activity into three classes: “awakening,” “calm sleep,” and “restless sleep”. The contribution of this non-invasive method is part of the screening of sleep disorders, to be validated by a more complete analysis of the sleep. The measure provided by this new system, based on temperature monitoring (patient and ambient, aims to be integrated into the tele-medicine platform developed within the framework of the Smart-EEG project by the SYEL–SYstèmes ELectroniques team. Analysis of the data collected during the first surveys carried out with this method showed a correlation between thermal signature and activity during sleep. The advantage of this method lies in its simplicity and the possibility of carrying out measurements of activity during sleep and without direct contact with the patient at home or hospitals.

  18. Predicting cellular growth from gene expression signatures.

    Directory of Open Access Journals (Sweden)

    Edoardo M Airoldi

    2009-01-01

    Full Text Available Maintaining balanced growth in a changing environment is a fundamental systems-level challenge for cellular physiology, particularly in microorganisms. While the complete set of regulatory and functional pathways supporting growth and cellular proliferation are not yet known, portions of them are well understood. In particular, cellular proliferation is governed by mechanisms that are highly conserved from unicellular to multicellular organisms, and the disruption of these processes in metazoans is a major factor in the development of cancer. In this paper, we develop statistical methodology to identify quantitative aspects of the regulatory mechanisms underlying cellular proliferation in Saccharomyces cerevisiae. We find that the expression levels of a small set of genes can be exploited to predict the instantaneous growth rate of any cellular culture with high accuracy. The predictions obtained in this fashion are robust to changing biological conditions, experimental methods, and technological platforms. The proposed model is also effective in predicting growth rates for the related yeast Saccharomyces bayanus and the highly diverged yeast Schizosaccharomyces pombe, suggesting that the underlying regulatory signature is conserved across a wide range of unicellular evolution. We investigate the biological significance of the gene expression signature that the predictions are based upon from multiple perspectives: by perturbing the regulatory network through the Ras/PKA pathway, observing strong upregulation of growth rate even in the absence of appropriate nutrients, and discovering putative transcription factor binding sites, observing enrichment in growth-correlated genes. More broadly, the proposed methodology enables biological insights about growth at an instantaneous time scale, inaccessible by direct experimental methods. Data and tools enabling others to apply our methods are available at http://function.princeton.edu/growthrate.

  19. A Chinese sky trust?

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Mark [Political Economy Research Institute, University of Massachusetts, Amherst (United States)]. E-mail: brenner@econs.umass.edu; Riddle, Matthew [Department of Economics, University of Massachusetts, Amherst (United States)]. E-mail: mriddle@econs.umass.edu; Boyce, James K. [Political Economy Research Institute and Department of Economics, University of Massachusetts, Amherst (United States)]. E-mail: boyce@econs.umass.edu

    2007-03-15

    The introduction of carbon charges on the use of fossil fuels in China would have a progressive impact on income distribution. This outcome, which contrasts to the regressive distributional impact found in most studies of carbon charges in industrialized countries, is driven primarily by differences between urban and rural expenditure patterns. If carbon revenues were recycled on an equal per capita basis via a 'sky trust,' the progressive impact would be further enhanced: low-income (mainly rural) households would receive more in sky-trust dividends than they pay in carbon charges, and high-income (mainly urban) households would pay more than they receive in dividends. Thus a Chinese sky trust would contribute to both lower fossil fuel consumption and greater income equality.

  20. Nitrogen in Chinese coals

    Science.gov (United States)

    Wu, D.; Lei, J.; Zheng, B.; Tang, X.; Wang, M.; Hu, Jiawen; Li, S.; Wang, B.; Finkelman, R.B.

    2011-01-01

    Three hundred and six coal samples were taken from main coal mines of twenty-six provinces, autonomous regions, and municipalities in China, according to the resource distribution and coal-forming periods as well as the coal ranks and coal yields. Nitrogen was determined by using the Kjeldahl method at U. S. Geological Survey (USGS), which exhibit a normal frequency distribution. The nitrogen contents of over 90% Chinese coal vary from 0.52% to 1.41% and the average nitrogen content is recommended to be 0.98%. Nitrogen in coal exists primarily in organic form. There is a slight positive relationship between nitrogen content and coal ranking. ?? 2011 Science Press, Institute of Geochemistry, CAS and Springer Berlin Heidelberg.

  1. A Chinese sky trust?

    International Nuclear Information System (INIS)

    Brenner, Mark; Riddle, Matthew; Boyce, James K.

    2007-01-01

    The introduction of carbon charges on the use of fossil fuels in China would have a progressive impact on income distribution. This outcome, which contrasts to the regressive distributional impact found in most studies of carbon charges in industrialized countries, is driven primarily by differences between urban and rural expenditure patterns. If carbon revenues were recycled on an equal per capita basis via a 'sky trust,' the progressive impact would be further enhanced: low-income (mainly rural) households would receive more in sky-trust dividends than they pay in carbon charges, and high-income (mainly urban) households would pay more than they receive in dividends. Thus a Chinese sky trust would contribute to both lower fossil fuel consumption and greater income equality

  2. Ancient DNA provides new insight into the maternal lineages and domestication of Chinese donkeys.

    Science.gov (United States)

    Han, Lu; Zhu, Songbiao; Ning, Chao; Cai, Dawei; Wang, Kai; Chen, Quanjia; Hu, Songmei; Yang, Junkai; Shao, Jing; Zhu, Hong; Zhou, Hui

    2014-11-30

    The donkey (Equus asinus) is an important domestic animal that provides a reliable source of protein and method of transportation for many human populations. However, the process of domestication and the dispersal routes of the Chinese donkey are still unclear, as donkey remains are sparse in the archaeological record and often confused with horse remains. To explore the maternal origins and dispersal route of Chinese donkeys, both mitochondrial DNA D-loop and cytochrome b gene fragments of 21 suspected donkey remains from four archaeological sites in China were amplified and sequenced. Molecular methods of species identification show that 17 specimens were donkeys and three samples had the maternal genetic signature of horses. One sample that dates to about 20,000 years before present failed to amplify. In this study, the phylogenetic analysis reveals that ancient Chinese donkeys have high mitochondrial DNA diversity and two distinct mitochondrial maternal lineages, known as the Somali and Nubian lineages. These results indicate that the maternal origin of Chinese domestic donkeys was probably related to the African wild ass, which includes the Nubian wild ass (Equus africanus africanus) and the Somali wild ass (Equus africanus somaliensis). Combined with historical records, the results of this study implied that domestic donkeys spread into west and north China before the emergence of the Han dynasty. The number of Chinese domestic donkeys had increased primarily to meet demand for the expansion of trade, and they were likely used as commodities or for shipping goods along the Silk Road during the Tang Dynasty, when the Silk Road reached its golden age. This study is the first to provide valuable ancient animal DNA evidence for early trade between African and Asian populations. The ancient DNA analysis of Chinese donkeys also sheds light on the dynamic process of the maternal origin, domestication, and dispersal route of ancient Chinese donkeys.

  3. Searches with long-lived or unusual signatures

    CERN Document Server

    Haug, S; The ATLAS collaboration

    2013-01-01

    We present recent ATLAS and CMS results from searches with long-lived and unusual signatures. They are based on analysis of LHC proton-proton collisions at center of mass energies at 7 and 8 TeV. Long-lived and heavy particles may cause peculiar signatures in the detectors, but are in several Standard Model extensions well motivated.

  4. 27 CFR 70.52 - Signature presumed authentic.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Signature presumed authentic. 70.52 Section 70.52 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Collection of Excise and Special (Occupational) Tax Collection-General Provisions § 70.52 Signature presumed...

  5. 25 CFR 117.33 - Signature of illiterates.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Signature of illiterates. 117.33 Section 117.33 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FINANCIAL ACTIVITIES DEPOSIT AND EXPENDITURE OF... Signature of illiterates. An Indian who cannot write shall be required to endorse checks payable to his...

  6. 26 CFR 301.6064-1 - Signature presumed authentic.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Signature presumed authentic. 301.6064-1 Section 301.6064-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED....6064-1 Signature presumed authentic. An individual's name signed to a return, statement, or other...

  7. Field Education as the Signature Pedagogy of Social Work Education

    Science.gov (United States)

    Wayne, Julianne; Bogo, Marion; Raskin, Miriam

    2010-01-01

    In its EPAS, CSWE (2008) identifies field education as the signature pedagogy (Shulman, 2005b) of social work education. This article analyzes the field education-signature pedagogy fit. It finds congruence in selected organizational arrangements that are pervasive and routine, and disparities with respect to expectations about public student…

  8. 12 CFR 18.6 - Signature and attestation.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Signature and attestation. 18.6 Section 18.6 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY DISCLOSURE OF FINANCIAL AND OTHER INFORMATION BY NATIONAL BANKS § 18.6 Signature and attestation. A duly authorized officer of the...

  9. 12 CFR 350.6 - Signature and attestation.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Signature and attestation. 350.6 Section 350.6 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY DISCLOSURE OF FINANCIAL AND OTHER INFORMATION BY FDIC-INSURED STATE NONMEMBER BANKS § 350.6 Signature and...

  10. 13 CFR 134.209 - Requirement of signature.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement of signature. 134.209 Section 134.209 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION RULES OF PROCEDURE GOVERNING... of signature. Every written submission to OHA, other than evidence, must be signed by the party...

  11. 48 CFR 4.101 - Contracting officer's signature.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contracting officer's signature. 4.101 Section 4.101 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL ADMINISTRATIVE MATTERS Contract Execution 4.101 Contracting officer's signature. Only contracting officers shall...

  12. Selective forgery of RSA signatures with fixed-pattern padding

    NARCIS (Netherlands)

    Lenstra, A.K.; Shparlinski, I.E.; Naccache, D.; Paillier, P.

    2002-01-01

    We present a practical selective forgery attack against RSA signatures with fixed-pattern padding shorter than two thirds of the modulus length. Our result extends the practical existential forgery of such RSA signatures that was presented at Crypto 2001. For an n-bit modulus the heuristic

  13. Subsurface signatures and timing of extreme wave events along the ...

    Indian Academy of Sciences (India)

    The diagnostic event signatures include the extent and elevation of the deposits, as well as morphologic similarity ... Historical archives of the origin, timing, and impact of tsunamis, storms, and floods along the mar- gins of ... High-resolution GPR studies (by the IIT Madras group) of erosional signatures from the beach ridge.

  14. Restrictive partially blind signature for resource-constrained information systems

    NARCIS (Netherlands)

    Qiu, Weidong; Gong, Zheng; Liu, Bozhong; Long, Yu; Chen, Kefei

    2010-01-01

    Restrictive partially blind signature, which is designed for privacy oriented information systems, allows a user to obtain a blind signature from a signer whilst the blind message must obey some certain rules. In order to reduce storage and communication costs, several public-key cryptosystems are

  15. Electronic Signatures in Global and National Commerce Act. Public Law.

    Science.gov (United States)

    Congress of the U.S., Washington, DC.

    This document presents the text of Public Law 106-229, the "Electronic Signatures in Global and National Commerce Act." The act states that, with respect to any transaction in or affecting interstate or foreign commerce: a signature, contract, or other record relating to such transaction may not be denied legal effect, validity, or…

  16. Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation

    Science.gov (United States)

    2009-09-01

    Introduction This presentation summarizes recent activity in monitoring spacecraft health status using passive remote optical nonimaging ...Approved for public release; distribution is unlimited. Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation...It is beneficial to the observer/analyst to understand the fundamental optical signature variability associated with these detection and

  17. Detection of chemical explosives using multiple photon signatures

    International Nuclear Information System (INIS)

    Loschke, K.W.; Dunn, W.L.

    2008-01-01

    Full text: A template-matching procedure to aid in rapid detection of improvised explosive devices (IEDs) is being investigated. Multiple photon-scattered and photon-induced positron annihilation radiation responses are being used as part of a photon-neutron signature-based radiation scanning (SBRS) approach (see companion reference for description of the neutron component), in an attempt to detect chemical explosives at safe standoff distances. Many past and present photon interrogation methods are based on imaging. Imaging techniques seek to determine at high special resolution the internal structure of a target of interest. Our technique simply seeks to determine if an unknown target contains a detectable amount of chemical explosives by comparing multiple responses (signatures) that depend on both density and composition of portions of a target. In the photon component, beams of photons are used to create back-streaming signatures, which are dependent on the density and composition of part of the target being interrogated. These signatures are compared to templates, which are collections of the same signatures if the interrogated volume contained a significant amount of explosives. The signature analysis produces a figure-of-merit and a standard deviation of the figure-of-merit. These two metrics are used to filter safe from dangerous targets. Experiments have been conducted that show that explosive surrogates (fertilizers) can be distinguished from several inert materials using these photon signatures, demonstrating that these signatures can be used effectively to help IEDs

  18. Online Signature Verification using Recurrent Neural Network and Length-normalized Path Signature

    OpenAIRE

    Lai, Songxuan; Jin, Lianwen; Yang, Weixin

    2017-01-01

    Inspired by the great success of recurrent neural networks (RNNs) in sequential modeling, we introduce a novel RNN system to improve the performance of online signature verification. The training objective is to directly minimize intra-class variations and to push the distances between skilled forgeries and genuine samples above a given threshold. By back-propagating the training signals, our RNN network produced discriminative features with desired metrics. Additionally, we propose a novel d...

  19. A semi-classical approach to signature splitting and signature inversion in odd–odd nuclei

    International Nuclear Information System (INIS)

    Kumar, Vinod; Kumar, Suresh; Kumar, Sushil; Hasan, Zafrul; Koranga, B.S.; Kumar, Deepak; Negi, D.; Angus, Lee

    2011-01-01

    The signature inversion observed in rotational bands belonging to high-j configurations of odd–odd deformed nuclei has been analyzed within the framework of an axially symmetric rotor plus two-particle model. The Coriolis and n–p interaction are considered the main cause of energy staggering. However, γ-triaxial deformation and the numbers of valence protons, N p , and neutrons, N n also contribute to the energy staggering between odd- and even-spin states. (author)

  20. Time-dependent delayed signatures from energetic photon interrogations

    International Nuclear Information System (INIS)

    Norman, Daren R.; Jones, James L.; Blackburn, Brandon W.; Haskell, Kevin J.; Johnson, James T.; Watson, Scott M.; Hunt, Alan W.; Spaulding, Randy; Harmon, Frank

    2007-01-01

    Pulsed photonuclear interrogation environments generated by 8-24 MeV electron linac are rich with time-dependent, material-specific, radiation signatures. Nitrogen-based explosives and nuclear materials can be detected by exploiting these signatures in different delayed-time regions. Numerical and experimental results presented in this paper show the unique time and energy dependence of these signatures. It is shown that appropriate delayed-time windows are essential to acquire material-specific signatures in pulsed photonuclear assessment environments. These developments demonstrate that pulsed, high-energy, photon-inspection environments can be exploited for time-dependent, material-specific signatures through the proper operation of specialized detectors and detection methods

  1. Signature scheme for the microscopic description of nuclear collective excitations

    International Nuclear Information System (INIS)

    Ogawa, K.

    1980-04-01

    The symmetries between the proton and neutron systems in a nucleus are described in terms of the signatures. Three kinds of signatures (i.e. the pn-, p anti n- and p anti p- (or n anti n-) signatures) are introduced and they are related to the appearance of various collective motions such as rotations or vibrations. It is shown that the pn-signature scheme provides a band-like structure of deformed nuclei, while the features associated with the quadrupole vibration are obtained in the p anti n- and p anti p-signature scheme. From the detail investigation of the p anti n-symmetric wave functions, it is concluded that the reguralities provided by the present shell model are more analogous to those of the γ-unstable surface vibration model (Wilets-Jean model) than to those of harmonic phonon model. (author)

  2. An Efficient Homomorphic Aggregate Signature Scheme Based on Lattice

    Directory of Open Access Journals (Sweden)

    Zhengjun Jing

    2014-01-01

    Full Text Available Homomorphic aggregate signature (HAS is a linearly homomorphic signature (LHS for multiple users, which can be applied for a variety of purposes, such as multi-source network coding and sensor data aggregation. In order to design an efficient postquantum secure HAS scheme, we borrow the idea of the lattice-based LHS scheme over binary field in the single-user case, and develop it into a new lattice-based HAS scheme in this paper. The security of the proposed scheme is proved by showing a reduction to the single-user case and the signature length remains invariant. Compared with the existing lattice-based homomorphic aggregate signature scheme, our new scheme enjoys shorter signature length and high efficiency.

  3. Chinese student mobility, local engagement and transformation of Chinese communities in England: an empirical study

    OpenAIRE

    Wu, Bin

    2016-01-01

    Unprecedented growth and circulation of Chinese international students cannot be fully understood unless the roles of host societies including diaspora Chinese communities are taken into account. This chapter draws attention to a phenomenon of local engagement, a process of interconnections and interactions between Chinese students and local communities, leading to a co-development of both Chinese students and diaspora Chinese communities in host countries. The links and impacts of Chinese st...

  4. Culture, ethnicity, and children's facial expressions: a study of European American, Mainland Chinese, Chinese American, and adopted Chinese girls.

    Science.gov (United States)

    Camras, Linda A; Bakeman, Roger; Chen, Yinghe; Norris, Katherine; Cain, Thomas R

    2006-02-01

    This investigation extends previous research documenting differences in Chinese and European American infants' facial expressivity. Chinese girls adopted by European American families, nonadopted Mainland Chinese girls, nonadopted Chinese American girls, and nonadopted European American girls responded to emotionally evocative slides and an odor stimulus. European American girls smiled more than Mainland Chinese and Chinese American girls and scored higher than Mainland Chinese girls for disgust-related expressions and overall expressivity. Adopted Chinese girls produced more disgust-related expressions than Mainland Chinese girls. Self-reported maternal strictness, aggravation, positive expressiveness, and cultural identification correlated with children's facial responses, as did number of siblings and adults in the home. Results suggest that culture and family environment influences facial expressivity, creating differences among children of the same ethnicity.

  5. Ancient Chinese Precedents in China

    National Research Council Canada - National Science Library

    Geddis, Robert

    1999-01-01

    ... classics from ancient china. The assumption is that since China's political and military leaders state openly that their strategy is based on traditional Chinese strategic concepts, a study of ancient classics on strategy...

  6. Chinese culture approached through touch

    DEFF Research Database (Denmark)

    Wang, Li; Champion, Erik

    2012-01-01

    Can recent technology help bridge cultures through playful interaction appropriate to traditional tacit means of acquiring knowledge? In order to help answer this question, we designed four Adobe Flash-based based game prototypes and evaluated them via a touch-screen PC. The goal was to offer non......, fun, and cultural authenticity. While this form of tangible computing proved engaging, it raises technical issues of how to convey appropriately the interactive elements without the help of the evaluator, and how to evaluate user satisfaction. We also briefly discuss more embodied and spatial......Chinese participants a playful way of experiencing aspects of traditional Chinese culture. The four single-player games were based on the four arts of China (music, calligraphy, painting and the game of Go!). In the evaluation we asked non-Chinese and the Chinese participants to evaluate the games in terms of learning...

  7. Chinese culture and fertility decline.

    Science.gov (United States)

    Wu, C; Jia, S

    1992-01-01

    Coale has suggested that cultural factors exert a significant influence on fertility reduction; countries in the "Chinese cultural circle" would be the first to show fertility decline. In China, the view was that traditional Chinese culture contributed to increased population. This paper examines the nature of the relationship between Chinese culture and fertility. Attention was directed to a comparison of fertility rates of developing countries with strong Chinese cultural influence and of fertility within different regions of China. Discussion was followed by an explanation of the theoretical impact of Chinese culture on fertility and direct and indirect beliefs and practices that might either enhance or hinder fertility decline. Emigration to neighboring countries occurred after the Qing dynasty. Fertility after the 1950s declined markedly in Japan, Singapore, Hong Kong, South Korea, Taiwan, and mainland China: all countries within the Chinese cultural circle. Other countries within the Chinese circle which have higher fertility, yet lower fertility than other non-Chinese cultural countries, are Malaysia, Thailand, and Indonesia. Within China, regions with similar fertility patterns are identified as coastal regions, central plains, and mountainous and plateau regions. The Han ethnic group has lower fertility than that of ethnic minorities; regions with large Han populations have lower fertility. Overseas Chinese in East Asian countries also tend to have lower fertility than their host populations. Chinese culture consisted of the assimilation of other cultures over 5000 years. Fertility decline was dependent on the population's desire to limit reproduction, favorable social mechanisms, and availability of contraception: all factors related to economic development. Chinese culture affects fertility reduction by affecting reproductive views and social mechanisms directly, and indirectly through economics. Confucianism emphasizes collectivism, self

  8. Chinese herbal medicines for hyperthyroidism.

    Science.gov (United States)

    Zen, X X; Yuan, Y; Liu, Y; Wu, T X; Han, S

    2007-04-18

    Hyperthyroidism is a disease in which excessive amounts of thyroid hormones circulate in the blood. Patients, among other things suffer from tachycardia, warm moist skin and raised body temperature. The treatment of hyperthyroidism includes symptom relief and therapy with antithyroid medications, radioiodine and thyroidectomy. Medicinal herbs are used alone or in combination with antithyroid agents to treat hyperthyroidism in China and some other countries. To assess the effects of Chinese herbal medicines for treating hyperthyroidism. Studies were obtained from computerised searches of MEDLINE, EMBASE, The Cochrane Library, the Chinese Biomedical Database. Randomised controlled trials comparing the effects of Chinese herbal medicines alone with Chinese herbal medicines combined with antithyroid drugs, radioiodine or both. Three authors interviewed authors of all potentially relevant studies by telephone to verify randomisation procedures. One author entered data into a data extraction form and another author verified the results of this procedure. Thirteen relevant trials with 1770 participants were included. All of them were of low quality. Fifty-two studies still need to be assessed because the original authors could not be interviewed. None of these trials analysed mortality, health related quality of life, economic outcomes or compliance. Compared to antithyroid drugs alone the results showed that Chinese herbal medicines combined with antithyroid drugs may offer benefits in lowering relapse rates, reducing the incidence of adverse effects, relieving symptoms, improving thyroid antibody status and thyroid function. Two trials investigated Chinese herbal medicine versus radioiodine and reported improvements in anxiety, tachycardia and heat intolerance. However, thyroid function - with the exception of restored thyroid stimulating hormone (TSH) - was not significantly altered. The results suggest that traditional Chinese herbal medicines added to other routine

  9. Criminaliteit en traditionele Chinese medicijnen

    OpenAIRE

    van Uhm, Daan

    2014-01-01

    Traditional Chinese medicine (TCM) is deeply rooted in the Chinese culture. Although thousands of animal and plant species are used for medicines legally, some medications contain more sinister elements; illegal animal or plant ingredients of protected species. What is the origin of this demand for rare species as medicine, who are involved in the trade and why is law enforcement complicated? This article will show that the illicit trade in TCM is a form of crime that transcends the borders o...

  10. Social Anxiety among Chinese People

    OpenAIRE

    Fan, Qianqian; Chang, Weining C.

    2015-01-01

    The experience of social anxiety has largely been investigated among Western populations; much less is known about social anxiety in other cultures. Unlike the Western culture, the Chinese emphasize interdependence and harmony with social others. In addition, it is unclear if Western constructed instruments adequately capture culturally conditioned conceptualizations and manifestations of social anxiety that might be specific to the Chinese. The present study employed a sequence of qualitativ...

  11. Chinese investments in the EU

    Directory of Open Access Journals (Sweden)

    Haico EBBERS

    2010-12-01

    Full Text Available China’s investments in the European Union are much lower than what you may expect given the economic size of both entities. These relatively low investments in Europe are a combination of priority and obstacles. The priority for investments is clearly in Asia, Africa and Latin America. This regional pattern is heavily influenced by the need to solve the resource shortage in the medium and long term. The investments in Europe and the United States are mostly market seeking investments. Research specifically focused on Chinese M&A abroad comes to the same conclusion. The success rate of Chinese M&A abroad is much lower than what we see with respect to American or European investments abroad. In this paper, we examine why Chinese firms are facing more difficulties in the European Union than in other regions. The paper focuses on Chinese M&A as proxy for total foreign direct investments abroad. By looking at the factors that have been documented as influencing the level of M&A abroad, it becomes clear that Chinese firms in Europe are hindered by many factors. For example, the trade between China and the EU is relatively low, the institutional quality is lower compared to the United States, there is less experience with respect to Europe and relatively many deals relate to State Owned Enterprises (SOE which makes the deal sensitive. So it is logical that Chinese investments are not very high in Europe. However, the research makes clear that the obstacles for Chinese investments in Europe are disappearing step by step. In that sense, we expect a strong increase of Chinese investments in Europe in the future.

  12. Mystery behind Chinese liquor fermentation

    OpenAIRE

    Jin, Guangyuan; Zhu, Yang; Xu, Yan

    2017-01-01

    Background Chinese liquor, a very popular fermented alcoholic beverage with thousands of years’ history in China, though its flavour formation and microbial process have only been partly explored, is facing the industrial challenge of modernisation and standardisation for food quality and safety as well as sustainability. Meanwhile, the hidden knowledge behind the complicated and somehow empirical solid-state fermentation process of Chinese liquor can enrich the food sector to improve our qua...

  13. Analysis of Chinese Communist Power

    Science.gov (United States)

    1966-04-08

    Confucianism, Legalism, Taoism and ancestral beliefs have been superseded by the dialectical materialism of the Commu- nists’ doctrine; and the mutual...developing individualism or independence. Chinese cosmology existed long before Christianity or Confu- cianism; it survived as a principal religious belief ...harmonious. With these beliefs , the Chinese nature religion included both ancestral and nonances- tral worship. These forces and the Lord on High

  14. Creation of Indian–Chinese cuisine: Chinese food in an Indian city

    Directory of Open Access Journals (Sweden)

    Amal Sankar

    2017-12-01

    Full Text Available This paper discusses two aspects of Chinese food served in India, based on data collected from fieldwork in Dharavi, Mumbai along with the data gathered from online restaurant reviews, food ordering portals, and blogs. First it discusses different forms of Indianizations in Chinese food served in India. Second part discusses how Chineseness is created through exhibits in and out of the restaurants, and how it communicates ‘Chinese’ in the menu through these symbols. One Major observation was that Indian Chinese restaurants mostly use Indian spices, flavors, and materials to make Chinese food, in which the main flavors are spicy, and pungent. The cooked food is served in a bowl, and eaten with spoon, and fork. Some symbolic elements are frequently exhibited in Chinese restaurants. Predominant use of red color, random Chinese scripts, images of Chinese temples, paintings or statues of Buddha, symbols of wok, picture of fat Chinese chef, picture of dragon, symbols of bowl and chopsticks are such representations. The study concludes that the Chinese food served in India is intrinsically Indianized Chinese food, and there are certain Indian expectations of what Chinese foods are, and a Chineseness is created in Chinese restaurants to give Chinese feel during the eat out. The author argues that the Indian imagination of Chinese food creates a new cuisine category Indian-Chinese cuisine which is neither Indian, nor Chinese.

  15. Implementing Signature Neural Networks with Spiking Neurons.

    Science.gov (United States)

    Carrillo-Medina, José Luis; Latorre, Roberto

    2016-01-01

    Spiking Neural Networks constitute the most promising approach to develop realistic Artificial Neural Networks (ANNs). Unlike traditional firing rate-based paradigms, information coding in spiking models is based on the precise timing of individual spikes. It has been demonstrated that spiking ANNs can be successfully and efficiently applied to multiple realistic problems solvable with traditional strategies (e.g., data classification or pattern recognition). In recent years, major breakthroughs in neuroscience research have discovered new relevant computational principles in different living neural systems. Could ANNs benefit from some of these recent findings providing novel elements of inspiration? This is an intriguing question for the research community and the development of spiking ANNs including novel bio-inspired information coding and processing strategies is gaining attention. From this perspective, in this work, we adapt the core concepts of the recently proposed Signature Neural Network paradigm-i.e., neural signatures to identify each unit in the network, local information contextualization during the processing, and multicoding strategies for information propagation regarding the origin and the content of the data-to be employed in a spiking neural network. To the best of our knowledge, none of these mechanisms have been used yet in the context of ANNs of spiking neurons. This paper provides a proof-of-concept for their applicability in such networks. Computer simulations show that a simple network model like the discussed here exhibits complex self-organizing properties. The combination of multiple simultaneous encoding schemes allows the network to generate coexisting spatio-temporal patterns of activity encoding information in different spatio-temporal spaces. As a function of the network and/or intra-unit parameters shaping the corresponding encoding modality, different forms of competition among the evoked patterns can emerge even in the absence

  16. Noble Gas signatures of Enhanced Oil Recovery

    Science.gov (United States)

    Barry, P. H.; Kulongoski, J. T.; Tyne, R. L.; Hillegonds, D.; Byrne, D. J.; Landon, M. K.; Ballentine, C. J.

    2017-12-01

    Noble gases are powerful tracers of fluids from various oil and gas production activities in hydrocarbon reservoirs and nearby groundwater. Non-radiogenic noble gases are introduced into undisturbed oil and natural gas reservoirs through exchange with formation waters [1-3]. Reservoirs with extensive hydraulic fracturing, injection for enhanced oil recovery (EOR), and/or waste disposal also show evidence for a component of noble gases introduced from air [4]. Isotopic and elemental ratios of noble gases can be used to 1) assess the migration history of the injected and formation fluids, and 2) determine the extent of exchange between multiphase fluids in different reservoirs. We present noble gas isotope and abundance data from casing, separator and injectate gases of the Lost Hills and Fruitvale oil fields in the San Joaquin basin, California. Samples were collected as part of the California State Water Resource Control Board's Oil and Gas Regional Groundwater Monitoring Program. Lost Hills (n=7) and Fruitvale (n=2) gases are geochemically distinct and duplicate samples are highly reproducible. Lost Hills casing gas samples were collected from areas where EOR and hydraulic fracturing has occurred in the past several years, and from areas where EOR is absent. The Fruitvale samples were collected from a re-injection port. All samples are radiogenic in their He isotopes, typical of a crustal environment, and show enrichments in heavy noble gases, resulting from preferential adsorption on sediments. Fruitvale samples reflect air-like surface conditions, with higher air-derived noble gas concentrations. Lost Hills gases show a gradation from pristine crustal signatures - indicative of closed-system exchange with formation fluids - to strongly air-contaminated signatures in the EOR region. Pristine samples can be used to determine the extent of hydrocarbon exchange with fluids, whereas samples with excess air can be used to quantify the extent of EOR. Determining noble

  17. Signature change events: a challenge for quantum gravity?

    International Nuclear Information System (INIS)

    White, Angela; Weinfurtner, Silke; Visser, Matt

    2010-01-01

    Within the framework of either Euclidean (functional integral) quantum gravity or canonical general relativity the signature of the manifold is a priori unconstrained. Furthermore, recent developments in the emergent spacetime programme have led to a physically feasible implementation of (analogue) signature change events. This suggests that it is time to revisit the sometimes controversial topic of signature change in general relativity. Specifically, we shall focus on the behaviour of a quantum field defined on a manifold containing regions of different signature. We emphasize that regardless of the underlying classical theory, there are severe problems associated with any quantum field theory residing on a signature-changing background. (Such as the production of what is naively an infinite number of particles, with an infinite energy density.) We show how the problem of quantum fields exposed to finite regions of Euclidean-signature (Riemannian) geometry has similarities with the quantum barrier penetration problem. Finally we raise the question as to whether signature change transitions could be fully understood and dynamically generated within (modified) classical general relativity, or whether they require the knowledge of a theory of quantum gravity.

  18. Forged Signature Distinction Using Convolutional Neural Network for Feature Extraction

    Directory of Open Access Journals (Sweden)

    Seungsoo Nam

    2018-01-01

    Full Text Available This paper proposes a dynamic verification scheme for finger-drawn signatures in smartphones. As a dynamic feature, the movement of a smartphone is recorded with accelerometer sensors in the smartphone, in addition to the moving coordinates of the signature. To extract high-level longitudinal and topological features, the proposed scheme uses a convolution neural network (CNN for feature extraction, and not as a conventional classifier. We assume that a CNN trained with forged signatures can extract effective features (called S-vector, which are common in forging activities such as hesitation and delay before drawing the complicated part. The proposed scheme also exploits an autoencoder (AE as a classifier, and the S-vector is used as the input vector to the AE. An AE has high accuracy for the one-class distinction problem such as signature verification, and is also greatly dependent on the accuracy of input data. S-vector is valuable as the input of AE, and, consequently, could lead to improved verification accuracy especially for distinguishing forged signatures. Compared to the previous work, i.e., the MLP-based finger-drawn signature verification scheme, the proposed scheme decreases the equal error rate by 13.7%, specifically, from 18.1% to 4.4%, for discriminating forged signatures.

  19. Server-Aided Verification Signature with Privacy for Mobile Computing

    Directory of Open Access Journals (Sweden)

    Lingling Xu

    2015-01-01

    Full Text Available With the development of wireless technology, much data communication and processing has been conducted in mobile devices with wireless connection. As we know that the mobile devices will always be resource-poor relative to static ones though they will improve in absolute ability, therefore, they cannot process some expensive computational tasks due to the constrained computational resources. According to this problem, server-aided computing has been studied in which the power-constrained mobile devices can outsource some expensive computation to a server with powerful resources in order to reduce their computational load. However, in existing server-aided verification signature schemes, the server can learn some information about the message-signature pair to be verified, which is undesirable especially when the message includes some secret information. In this paper, we mainly study the server-aided verification signatures with privacy in which the message-signature pair to be verified can be protected from the server. Two definitions of privacy for server-aided verification signatures are presented under collusion attacks between the server and the signer. Then based on existing signatures, two concrete server-aided verification signature schemes with privacy are proposed which are both proved secure.

  20. Starry messages: Searching for signatures of interstellar archaeology

    Energy Technology Data Exchange (ETDEWEB)

    Carrigan, Richard A., Jr.; /Fermilab

    2009-12-01

    Searching for signatures of cosmic-scale archaeological artifacts such as Dyson spheres or Kardashev civilizations is an interesting alternative to conventional SETI. Uncovering such an artifact does not require the intentional transmission of a signal on the part of the original civilization. This type of search is called interstellar archaeology or sometimes cosmic archaeology. The detection of intelligence elsewhere in the Universe with interstellar archaeology or SETI would have broad implications for science. For example, the constraints of the anthropic principle would have to be loosened if a different type of intelligence was discovered elsewhere. A variety of interstellar archaeology signatures are discussed including non-natural planetary atmospheric constituents, stellar doping with isotopes of nuclear wastes, Dyson spheres, as well as signatures of stellar and galactic-scale engineering. The concept of a Fermi bubble due to interstellar migration is introduced in the discussion of galactic signatures. These potential interstellar archaeological signatures are classified using the Kardashev scale. A modified Drake equation is used to evaluate the relative challenges of finding various sources. With few exceptions interstellar archaeological signatures are clouded and beyond current technological capabilities. However SETI for so-called cultural transmissions and planetary atmosphere signatures are within reach.

  1. Modeling ground vehicle acoustic signatures for analysis and synthesis

    International Nuclear Information System (INIS)

    Haschke, G.; Stanfield, R.

    1995-01-01

    Security and weapon systems use acoustic sensor signals to classify and identify moving ground vehicles. Developing robust signal processing algorithms for this is expensive, particularly in presence of acoustic clutter or countermeasures. This paper proposes a parametric ground vehicle acoustic signature model to aid the system designer in understanding which signature features are important, developing corresponding feature extraction algorithms and generating low-cost, high-fidelity synthetic signatures for testing. The authors have proposed computer-generated acoustic signatures of armored, tracked ground vehicles to deceive acoustic-sensored smart munitions. They have developed quantitative measures of how accurately a synthetic acoustic signature matches those produced by actual vehicles. This paper describes parameters of the model used to generate these synthetic signatures and suggests methods for extracting these parameters from signatures of valid vehicle encounters. The model incorporates wide-bandwidth and narrow- bandwidth components that are modulated in a pseudo-random fashion to mimic the time dynamics of valid vehicle signatures. Narrow- bandwidth feature extraction techniques estimate frequency, amplitude and phase information contained in a single set of narrow frequency- band harmonics. Wide-bandwidth feature extraction techniques estimate parameters of a correlated-noise-floor model. Finally, the authors propose a method of modeling the time dynamics of the harmonic amplitudes as a means adding necessary time-varying features to the narrow-bandwidth signal components. The authors present results of applying this modeling technique to acoustic signatures recorded during encounters with one armored, tracked vehicle. Similar modeling techniques can be applied to security systems

  2. Photon signature analysis using template matching

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, D.A., E-mail: d.a.bradley@surrey.ac.uk [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Hashim, S., E-mail: suhairul@utm.my [Department of Physics, Universiti Teknologi Malaysia, 81310 Skudai, Johor (Malaysia); Saripan, M.I. [Faculty of Engineering, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Wells, K. [Centre for Vision, Speech and Signal Processing, University of Surrey, Guildford GU2 7XH (United Kingdom); Dunn, W.L. [Department of Mechanical and Nuclear Engineering, Kansas State University, 3002 Rathbone Hall, Manhattan, KS 66506 (United States)

    2011-10-01

    We describe an approach to detect improvised explosive devices (IEDs) by using a template matching procedure. This approach relies on the signature due to backstreaming {gamma} photons from various targets. In this work we have simulated cylindrical targets of aluminum, iron, copper, water and ammonium nitrate (nitrogen-rich fertilizer). We simulate 3.5 MeV source photons distributed on a plane inside a shielded area using Monte Carlo N-Particle (MCNP{sup TM}) code version 5 (V5). The 3.5 MeV source gamma rays yield 511 keV peaks due to pair production and scattered gamma rays. In this work, we simulate capture of those photons that backstream, after impinging on the target element, toward a NaI detector. The captured backstreamed photons are expected to produce a unique spectrum that will become part of a simple signal processing recognition system based on the template matching method. Different elements were simulated using different sets of random numbers in the Monte Carlo simulation. To date, the sum of absolute differences (SAD) method has been used to match the template. In the examples investigated, template matching was found to detect all elements correctly.

  3. Discrete Neural Signatures of Basic Emotions.

    Science.gov (United States)

    Saarimäki, Heini; Gotsopoulos, Athanasios; Jääskeläinen, Iiro P; Lampinen, Jouko; Vuilleumier, Patrik; Hari, Riitta; Sams, Mikko; Nummenmaa, Lauri

    2016-06-01

    Categorical models of emotions posit neurally and physiologically distinct human basic emotions. We tested this assumption by using multivariate pattern analysis (MVPA) to classify brain activity patterns of 6 basic emotions (disgust, fear, happiness, sadness, anger, and surprise) in 3 experiments. Emotions were induced with short movies or mental imagery during functional magnetic resonance imaging. MVPA accurately classified emotions induced by both methods, and the classification generalized from one induction condition to another and across individuals. Brain regions contributing most to the classification accuracy included medial and inferior lateral prefrontal cortices, frontal pole, precentral and postcentral gyri, precuneus, and posterior cingulate cortex. Thus, specific neural signatures across these regions hold representations of different emotional states in multimodal fashion, independently of how the emotions are induced. Similarity of subjective experiences between emotions was associated with similarity of neural patterns for the same emotions, suggesting a direct link between activity in these brain regions and the subjective emotional experience. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Geochemical signature of radioactive waste: oil NORM

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Gilberto T. de Paula; Costa-de-Moura, Jorge; Gomes, Carlos de Almeida; Sampaio, Emidio A. Lopes, E-mail: gilberto.costa@cnen.gov.br, E-mail: jcmoura@cnen.gov.br, E-mail: cgomes@cnen.gov.br [Comissao Nacional de Energia Nuclear (CNEN), Rio de Janeiro, RJ (Brazil). Div. de Controle de Rejeitos e Transporte de Materiais Radioativos

    2017-07-01

    The Brazilian Nuclear Agency (CNEN) rules all nuclear activity in Brazil as demanded by the Federal Constitution, articles 21, XXIII, and 177, V, and by the Federal Acts 4.118/62 and 10.308/2001. Therefore, the CNEN is responsible for any radioactive waste disposal in the country. Oil Naturally Occurring Radioactive Materials (Oil NORM) in this paper refers to waste coming from oil exploration. Oil NORM has called much attention during the last decades, mostly because it is not possible to determine its primary source due to the actual absence of regulatory control mechanism. There is no efficient regulatory tool which allows determining the origin of such NORM wastes even among those facilities under regulatory control. This fact may encourage non-authorized radioactive material transportation, smuggling and terrorism. The aim of this project is to provide a geochemical signature for each oil NORM waste using its naturally occurring isotopic composition to identify its origin. The here proposed method is a specific geochemical modeling of oil sludge NORM samples which are analyzed for radioisotopes normally present in oil pipes, such as {sup 228}Ac, {sup 214}Bi and {sup 214}Pb. The activity ratios are plotted in scatter diagrams. This method was successfully tested with data of different sources obtained from analysis reports from the Campos Basin/Brazil and from literature. (author)

  5. DNA methylation signatures of educational attainment

    Science.gov (United States)

    van Dongen, Jenny; Bonder, Marc Jan; Dekkers, Koen F.; Nivard, Michel G.; van Iterson, Maarten; Willemsen, Gonneke; Beekman, Marian; van der Spek, Ashley; van Meurs, Joyce B. J.; Franke, Lude; Heijmans, Bastiaan T.; van Duijn, Cornelia M.; Slagboom, P. Eline; Boomsma, Dorret I.; BIOS consortium

    2018-03-01

    Educational attainment is a key behavioural measure in studies of cognitive and physical health, and socioeconomic status. We measured DNA methylation at 410,746 CpGs (N = 4152) and identified 58 CpGs associated with educational attainment at loci characterized by pleiotropic functions shared with neuronal, immune and developmental processes. Associations overlapped with those for smoking behaviour, but remained after accounting for smoking at many CpGs: Effect sizes were on average 28% smaller and genome-wide significant at 11 CpGs after adjusting for smoking and were 62% smaller in never smokers. We examined sources and biological implications of education-related methylation differences, demonstrating correlations with maternal prenatal folate, smoking and air pollution signatures, and associations with gene expression in cis, dynamic methylation in foetal brain, and correlations between blood and brain. Our findings show that the methylome of lower-educated people resembles that of smokers beyond effects of their own smoking behaviour and shows traces of various other exposures.

  6. Geochemical signature of radioactive waste: oil NORM

    International Nuclear Information System (INIS)

    Costa, Gilberto T. de Paula; Costa-de-Moura, Jorge; Gomes, Carlos de Almeida; Sampaio, Emidio A. Lopes

    2017-01-01

    The Brazilian Nuclear Agency (CNEN) rules all nuclear activity in Brazil as demanded by the Federal Constitution, articles 21, XXIII, and 177, V, and by the Federal Acts 4.118/62 and 10.308/2001. Therefore, the CNEN is responsible for any radioactive waste disposal in the country. Oil Naturally Occurring Radioactive Materials (Oil NORM) in this paper refers to waste coming from oil exploration. Oil NORM has called much attention during the last decades, mostly because it is not possible to determine its primary source due to the actual absence of regulatory control mechanism. There is no efficient regulatory tool which allows determining the origin of such NORM wastes even among those facilities under regulatory control. This fact may encourage non-authorized radioactive material transportation, smuggling and terrorism. The aim of this project is to provide a geochemical signature for each oil NORM waste using its naturally occurring isotopic composition to identify its origin. The here proposed method is a specific geochemical modeling of oil sludge NORM samples which are analyzed for radioisotopes normally present in oil pipes, such as 228 Ac, 214 Bi and 214 Pb. The activity ratios are plotted in scatter diagrams. This method was successfully tested with data of different sources obtained from analysis reports from the Campos Basin/Brazil and from literature. (author)

  7. Multimodal three-dimensional dynamic signature

    Directory of Open Access Journals (Sweden)

    Yury E. Kozlov

    2017-11-01

    Full Text Available Reliable authentication in mobile applications is among the most important information security challenges. Today, we can hardly imagine a person who would not own a mobile device that connects to the Internet. Mobile devices are being used to store large amounts of confidential information, ranging from personal photos to electronic banking tools. In 2009, colleagues from Rice University together with their collaborators from Motorola, proposed an authentication through in-air gestures. This and subsequent work contributing to the development of the method are reviewed in our introduction. At the moment, there exists a version of the gesture-based authentication software available for Android mobile devices. This software has not become widespread yet. One of likely reasons for that is the insufficient reliability of the method, which involves similar to its earlier analogs the use of only one device. Here we discuss the authentication based on the multimodal three-dimensional dynamic signature (MTDS performed by two independent mobile devices. The MTDS-based authentication technique is an advanced version of in-air gesture authentication. We describe the operation of a prototype of MTDS-based authentication, including the main implemented algorithms, as well as some preliminary results of testing the software. We expect that our method can be used in any mobile application, provided a number of additional improvements discussed in the conclusion are made.

  8. Movement Pattern Analysis Based on Sequence Signatures

    Directory of Open Access Journals (Sweden)

    Seyed Hossein Chavoshi

    2015-09-01

    Full Text Available Increased affordability and deployment of advanced tracking technologies have led researchers from various domains to analyze the resulting spatio-temporal movement data sets for the purpose of knowledge discovery. Two different approaches can be considered in the analysis of moving objects: quantitative analysis and qualitative analysis. This research focuses on the latter and uses the qualitative trajectory calculus (QTC, a type of calculus that represents qualitative data on moving point objects (MPOs, and establishes a framework to analyze the relative movement of multiple MPOs. A visualization technique called sequence signature (SESI is used, which enables to map QTC patterns in a 2D indexed rasterized space in order to evaluate the similarity of relative movement patterns of multiple MPOs. The applicability of the proposed methodology is illustrated by means of two practical examples of interacting MPOs: cars on a highway and body parts of a samba dancer. The results show that the proposed method can be effectively used to analyze interactions of multiple MPOs in different domains.

  9. Brain morphological signatures for chronic pain.

    Directory of Open Access Journals (Sweden)

    Marwan N Baliki

    Full Text Available Chronic pain can be understood not only as an altered functional state, but also as a consequence of neuronal plasticity. Here we use in vivo structural MRI to compare global, local, and architectural changes in gray matter properties in patients suffering from chronic back pain (CBP, complex regional pain syndrome (CRPS and knee osteoarthritis (OA, relative to healthy controls. We find that different chronic pain types exhibit unique anatomical 'brain signatures'. Only the CBP group showed altered whole-brain gray matter volume, while regional gray matter density was distinct for each group. Voxel-wise comparison of gray matter density showed that the impact on the extent of chronicity of pain was localized to a common set of regions across all conditions. When gray matter density was examined for large regions approximating Brodmann areas, it exhibited unique large-scale distributed networks for each group. We derived a barcode, summarized by a single index of within-subject co-variation of gray matter density, which enabled classification of individual brains to their conditions with high accuracy. This index also enabled calculating time constants and asymptotic amplitudes for an exponential increase in brain re-organization with pain chronicity, and showed that brain reorganization with pain chronicity was 6 times slower and twice as large in CBP in comparison to CRPS. The results show an exuberance of brain anatomical reorganization peculiar to each condition and as such reflecting the unique maladaptive physiology of different types of chronic pain.

  10. Overloaded CDMA Systems with Displaced Binary Signatures

    Directory of Open Access Journals (Sweden)

    Vanhaverbeke Frederik

    2004-01-01

    Full Text Available We extend three types of overloaded CDMA systems, by displacing in time the binary signature sequences of these systems: (1 random spreading (PN, (2 multiple-OCDMA (MO, and (3 PN/OCDMA (PN/O. For each of these systems, we determine the time shifts that minimize the overall multiuser interference power. The achievable channel load with coded and uncoded data is evaluated for the conventional (without displacement and improved (with displacement systems, as well as for systems based on quasi-Welch-bound-equality (QWBE sequences, by means of several types of turbo detectors. For each system, the best performing turbo detector is selected in order to compare the performance of these systems. It is found that the improved systems substantially outperform their original counterparts. With uncoded data, (improved PN/O yields the highest acceptable channel load. For coded data, MO allows for the highest acceptable channel load over all considered systems, both for the conventional and the improved systems. In the latter case, channel loads of about 280% are achievable with a low degradation as compared to a single user system.

  11. Microbial Signatures of Cadaver Gravesoil During Decomposition.

    Science.gov (United States)

    Finley, Sheree J; Pechal, Jennifer L; Benbow, M Eric; Robertson, B K; Javan, Gulnaz T

    2016-04-01

    Genomic studies have estimated there are approximately 10(3)-10(6) bacterial species per gram of soil. The microbial species found in soil associated with decomposing human remains (gravesoil) have been investigated and recognized as potential molecular determinants for estimates of time since death. The nascent era of high-throughput amplicon sequencing of the conserved 16S ribosomal RNA (rRNA) gene region of gravesoil microbes is allowing research to expand beyond more subjective empirical methods used in forensic microbiology. The goal of the present study was to evaluate microbial communities and identify taxonomic signatures associated with the gravesoil human cadavers. Using 16S rRNA gene amplicon-based sequencing, soil microbial communities were surveyed from 18 cadavers placed on the surface or buried that were allowed to decompose over a range of decomposition time periods (3-303 days). Surface soil microbial communities showed a decreasing trend in taxon richness, diversity, and evenness over decomposition, while buried cadaver-soil microbial communities demonstrated increasing taxon richness, consistent diversity, and decreasing evenness. The results show that ubiquitous Proteobacteria was confirmed as the most abundant phylum in all gravesoil samples. Surface cadaver-soil communities demonstrated a decrease in Acidobacteria and an increase in Firmicutes relative abundance over decomposition, while buried soil communities were consistent in their community composition throughout decomposition. Better understanding of microbial community structure and its shifts over time may be important for advancing general knowledge of decomposition soil ecology and its potential use during forensic investigations.

  12. Raman Signatures of Polytypism in Molybdenum Disulfide.

    Science.gov (United States)

    Lee, Jae-Ung; Kim, Kangwon; Han, Songhee; Ryu, Gyeong Hee; Lee, Zonghoon; Cheong, Hyeonsik

    2016-02-23

    Since the stacking order sensitively affects various physical properties of layered materials, accurate determination of the stacking order is important for studying the basic properties of these materials as well as for device applications. Because 2H-molybdenum disulfide (MoS2) is most common in nature, most studies so far have focused on 2H-MoS2. However, we found that the 2H, 3R, and mixed stacking sequences exist in few-layer MoS2 exfoliated from natural molybdenite crystals. The crystal structures are confirmed by HR-TEM measurements. The Raman signatures of different polytypes are investigated by using three different excitation energies that are nonresonant and resonant with A and C excitons, respectively. The low-frequency breathing and shear modes show distinct differences for each polytype, whereas the high-frequency intralayer modes show little difference. For resonant excitations at 1.96 and 2.81 eV, distinct features are observed that enable determination of the stacking order.

  13. Degradation Signatures of Open Ocean Microplastic Debris

    Science.gov (United States)

    Lavender Law, K. L.; Donohue, J. L.; Collins, T.; Proskurowsi, G.; Andrady, A. L.

    2016-02-01

    Microplastics collected from the open ocean offer few clues about their origin and history. There is currently no method to determine how long ocean plastic has undergone environmental weathering, how quickly fragmentation has occurred, or how small microplastic particles will ultimately become before (or if) they are fully degraded by microbial action. In the current absence of results from laboratory and field experiments designed to address these questions, we meticulously examined physical and chemical characteristics of open ocean microplastic particles collected over a 16-year period for clues about their weathering history. More than 1000 microplastic particles collected in the western North Atlantic between 1991 and 2007 were analyzed to determine polymer type, material density, mass and particle size, and were used to create a detailed catalogue of common microscopic surface features likely related to environmental exposure and weathering. Polyethylene and polypropylene, the two buoyant resins most commonly collected at the sea surface, can typically be distinguished by visual microscopy alone, and their particular characteristics lead us to hypothesize that these two resins weaken and fragment in different ways and on different time scales. A subset of resin pellets collected at sea were also analyzed using FTIR-ATR and/or FTIR microscopy for signatures of chemical degradation (e.g., carbonyl index) that are related to physical weathering characteristics such as color, quantified by the yellowness index.

  14. Infrared Signature Masking by Air Plasma Radiation

    Science.gov (United States)

    Kruger, Charles H.; Laux, C. O.

    2001-01-01

    This report summarizes the results obtained during a research program on the infrared radiation of air plasmas conducted in the High Temperature Gasdynamics Laboratory at Stanford University under the direction of Professor Charles H. Kruger, with Dr. Christophe O. Laux as Associate Investigator. The goal of this research was to investigate the masking of infrared signatures by the air plasma formed behind the bow shock of high velocity missiles. To this end, spectral measurements and modeling were made of the radiation emitted between 2.4 and 5.5 micrometers by an atmospheric pressure air plasma in chemical and thermal equilibrium at a temperature of approximately 3000 K. The objective was to examine the spectral emission of air species including nitric oxide, atomic oxygen and nitrogen lines, molecular and atomic continua, as well as secondary species such as water vapor or carbon dioxide. The cold air stream injected in the plasma torch contained approximately 330 parts per million of CO2, which is the natural CO2 concentration in atmospheric air at room temperatures, and a small amount of water vapor with an estimated mole fraction of 3.8x10(exp -4).

  15. Robust signatures of solar neutrino oscillation solutions

    CERN Document Server

    Bahcall, J N; Peña-Garay, C; Bahcall, John N.; Peña-Garay, Carlos

    2002-01-01

    With the goal of identifying signatures that select specific neutrino oscillation parameters, we test the robustness of global oscillation solutions that fit all the available solar and reactor experimental data. We use three global analysis strategies previously applied by different authors and also determine the sensitivity of the oscillation solutions to the critical nuclear fusion cross section, S_{17}(0), for the production of 8B. The neutral current to charged current ratio for SNO is predicted to be 3.5 +- 0.6 (1 sigma) for the favored LMA, LOW, and VAC solutions, which is separated from the no-oscillation value of 1.0 by much more than the expected experimental error. The predicted range of the day-night difference in charged current rates is between 0% and 21% (3 sigma) and is to be strongly correlated with the day-night effect for neutrino-electron scattering. A measurement by SNO of either a NC to CC ratio > 3.3 or a day-night difference > 10%, would favor a small region of the currently allowed LM...

  16. Magnetic signature of surface defects at nanodiamonds

    Energy Technology Data Exchange (ETDEWEB)

    Vollmers, Nora Jenny; Gerstmann, Uwe; Schmidt, Wolf Gero [Theoretische Physik, Universitaet Paderborn (Germany)

    2011-07-01

    The n-type doping of diamond has been a long-standing issue, which recently gained attention in the context of nanodiamonds. Attempts of doping with nitrogen failed to result in the Electron paramagnetic Resonance (EPR) fingerprints expected from bulk material. Instead, the nanodiamond signals show a much larger deviation from the free-electron g-value and are believed to be related to intrinsic, carbon inherited defects. However, the absence of the bulk-like EPR spectra does not mean that nitrogen is not incorporated at all. The N atoms could be built in predominantly at or at least close to the surfaces yielding EPR spectra, very different from those measured in the bulk. In this work, we elucidate the situation by investigating the magnetic signature of paramagnetic defects in the nanodiamonds. We use the gauge-including projector augmented plane wave (GI-PAW) approach to calculate the hyperfine splittings and the elements of the electronic g-tensor. Taking the C(100) surface as a first model system, a possible contribution of nitrogen is discussed by comparing EPR parameters for different N incorporation depths: Incorporated directly at the surface, N gives rise to surface states similar to intrinsic carbon dangling bond-like states. Otherwise N is able to introduce surface conductivity as demonstrated by calculated effective mass tensors.

  17. Protein signature of lung cancer tissues.

    Directory of Open Access Journals (Sweden)

    Michael R Mehan

    Full Text Available Lung cancer remains the most common cause of cancer-related mortality. We applied a highly multiplexed proteomic technology (SOMAscan to compare protein expression signatures of non small-cell lung cancer (NSCLC tissues with healthy adjacent and distant tissues from surgical resections. In this first report of SOMAscan applied to tissues, we highlight 36 proteins that exhibit the largest expression differences between matched tumor and non-tumor tissues. The concentrations of twenty proteins increased and sixteen decreased in tumor tissue, thirteen of which are novel for NSCLC. NSCLC tissue biomarkers identified here overlap with a core set identified in a large serum-based NSCLC study with SOMAscan. We show that large-scale comparative analysis of protein expression can be used to develop novel histochemical probes. As expected, relative differences in protein expression are greater in tissues than in serum. The combined results from tissue and serum present the most extensive view to date of the complex changes in NSCLC protein expression and provide important implications for diagnosis and treatment.

  18. Electronic signatures and their specificity in national and European regulations

    Directory of Open Access Journals (Sweden)

    R. MATEFI

    2017-07-01

    Full Text Available The paper aims to emphasize the particularities of the electronic signature by reference to the national as well as to the European legislation, trying to point out its utility in the business environment as well as the controversies in this matter. The starting point of this analysis was the Directive 1999/93/EC of the European Parliament and of the Council of 13 December 1999 on a Community framework for electronic signatures, which establishes the legal framework for electronic signatures and the recognition of certification-service providers. Its main aim was to ease its use and help it become legally recognized within all EU countries.

  19. An ID-based Blind Signature Scheme from Bilinear Pairings

    OpenAIRE

    B.Umaprasada Rao; K.A.Ajmath

    2010-01-01

    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  20. Review and Analysis of Cryptographic Schemes Implementing Threshold Signature

    Directory of Open Access Journals (Sweden)

    Anastasiya Victorovna Beresneva

    2015-03-01

    Full Text Available This work is devoted to the study of threshold signature schemes. The systematization of the threshold signature schemes was done, cryptographic constructions based on interpolation Lagrange polynomial, ellipt ic curves and bilinear pairings were investigated. Different methods of generation and verification of threshold signatures were explored, e.g. used in a mobile agents, Internet banking and e-currency. The significance of the work is determined by the reduction of the level of counterfeit electronic documents, signed by certain group of users.

  1. Spectral decomposition of MR spectroscopy signatures with use of eigenanalysis

    International Nuclear Information System (INIS)

    Hearshen, D.O.; Windham, J.P.; Roebuck, J.R.; Helpern, J.A.

    1989-01-01

    Partial-volume contamination and overlapping resonances are common problems in whole-body MR spectroscopy and can affect absolute or relative intensity and chemical-shift measurements. One technique, based on solution of constrained eigenvalue problems, treats spectra as N-dimensional signatures and minimizes contributions of undesired signatures while maximizing contributions of desired signatures in compromised spectra. Computer simulations and both high-resolution (400-MHz) and whole-body (63.8-MHz) phantom studies tested accuracy and reproducibility of spectral decomposition. Results demonstrated excellent decomposition and good reproducibility within certain constraints. The authors conclude that eigenanalysis may improve quantitation of spectra without introducing operator bias

  2. Improvement of a Quantum Proxy Blind Signature Scheme

    Science.gov (United States)

    Zhang, Jia-Lei; Zhang, Jian-Zhong; Xie, Shu-Cui

    2018-06-01

    Improvement of a quantum proxy blind signature scheme is proposed in this paper. Six-qubit entangled state functions as quantum channel. In our scheme, a trust party Trent is introduced so as to avoid David's dishonest behavior. The receiver David verifies the signature with the help of Trent in our scheme. The scheme uses the physical characteristics of quantum mechanics to implement message blinding, delegation, signature and verification. Security analysis proves that our scheme has the properties of undeniability, unforgeability, anonymity and can resist some common attacks.

  3. A secure quantum group signature scheme based on Bell states

    International Nuclear Information System (INIS)

    Zhang Kejia; Song Tingting; Zuo Huijuan; Zhang Weiwei

    2013-01-01

    In this paper, we propose a new secure quantum group signature with Bell states, which may have applications in e-payment system, e-government, e-business, etc. Compared with the recent quantum group signature protocols, our scheme is focused on the most general situation in practice, i.e. only the arbitrator is trusted and no intermediate information needs to be stored in the signing phase to ensure the security. Furthermore, our scheme has achieved all the characteristics of group signature—anonymity, verifiability, traceability, unforgetability and undeniability, by using some current developed quantum and classical technologies. Finally, a feasible security analysis model for quantum group signature is presented. (paper)

  4. Secure Certificateless Signature with Revocation in the Standard Model

    Directory of Open Access Journals (Sweden)

    Tung-Tso Tsai

    2014-01-01

    previously proposed certificateless signature schemes were insecure under a considerably strong security model in the sense that they suffered from outsiders’ key replacement attacks or the attacks from the key generation center (KGC. In this paper, we propose a certificateless signature scheme without random oracles. Moreover, our scheme is secure under the strong security model and provides a public revocation mechanism, called revocable certificateless signature (RCLS. Under the standard computational Diffie-Hellman assumption, we formally demonstrate that our scheme possesses existential unforgeability against adaptive chosen-message attacks.

  5. Holistic Processing of Chinese Characters

    Directory of Open Access Journals (Sweden)

    Alan Chun-Nang Wong

    2011-05-01

    Full Text Available Enhanced holistic processing (obligatory attention to all parts of an object has been associated with different types of perceptual expertise involving faces, cars, fingerprints, musical notes, English words, etc. Curiously Chinese characters are regarded as an exception, as indicated by the lack of holistic processing found for experts (Hsiao and Cottrell, 2009. The ceiling performance of experts, however, may have caused this null effect. We revisit this issue by adopting the often-used face-composite sequential-matching task to two-part Chinese characters. Participants matched the target halves (left or right of two characters while ignoring the irrelevant halves. Both Chinese readers (experts and non-Chinese readers (novices showed holistic processing. Follow-up experiments suggested different origins of the effects for the two groups. For experts, holistic processing was sensitive to the amount of experience with the characters, as it was larger for words than non-words (formed by swapping the two parts of a valid character. Novices, however, showed similar degree of holistic processing to words and non-words, suggesting that their effects were more related to their inefficient decomposition of a complex, character-like pattern into parts. Overall these findings suggest that holistic processing may be a marker of expertise with Chinese characters, contrary to previous claims.

  6. Oscar Montelius and Chinese Archaeology

    Directory of Open Access Journals (Sweden)

    Xingcan Chen

    2014-05-01

    Full Text Available This paper demonstrates that Oscar Montelius (1843–1921, the world-famous Swedish archaeologist, had a key role in the development of modern scientific Chinese archaeology and the discovery of China’s prehistory. We know that one of his major works, Die Methode, the first volume of his Älteren kulturperioden im Orient und in Europa, translated into Chinese in the 1930s, had considerable influence on generations of Chinese archaeologists and art historians. What has previously remained unknown, is that Montelius personally promoted the research undertaken in China by Johan Gunnar Andersson (1874–1960, whose discoveries of Neolithic cultures in the 1920s constituted the breakthrough and starting point for the development of prehistoric archaeology in China. In this paper, we reproduce, translate and discuss a long forgotten memorandum written by Montelius in 1920 in support of Andersson’s research. In this Montelius indicated his belief in the potential of prehistoric Chinese archaeology as well as his predictions regarding the discoveries about to be made. It is therefore an important document for the study of the history of Chinese archaeology as a whole.

  7. Involvement in Preschools: Comparing Chinese Immigrant and Non-Chinese Parents in New Zealand

    Science.gov (United States)

    Zhang, Qilong; Keown, Louise; Farruggia, Susan

    2014-01-01

    This study compared 120 Chinese immigrant parents and 127 non-Chinese parents from New Zealand preschools on their level of involvement in preschool-based activities, as well as key predictors of parental involvement. Results showed that Chinese immigrant parents had a lower level of involvement than non-Chinese parents across three forms of…

  8. Mothers' Self-Reported Emotional Expression in Mainland Chinese, Chinese American and European American Families

    Science.gov (United States)

    Camras, Linda; Kolmodin, Karen; Chen, Yinghe

    2008-01-01

    This study compared Mainland Chinese, Chinese American and European American mothers' self-reported emotional expression within the family. Mothers of 3-year-old European American (n = 40), Chinese American (n = 39) and Mainland Chinese (n = 36) children (n = 20 girls per group) completed the Self-Expressiveness in the Family Questionnaire (SEFQ),…

  9. Is Chinese Special? Four Aspects of Chinese Literacy Acquisition That Might Distinguish Learning Chinese from Learning Alphabetic Orthographies

    Science.gov (United States)

    McBride, Catherine Alexandra

    2016-01-01

    Some aspects of Chinese literacy development do not conform to patterns of literacy development in alphabetic orthographies. Four are highlighted here. First, semantic radicals are one aspect of Chinese characters that have no analogy to alphabetic orthographies. Second, the unreliability of phonological cues in Chinese along with the fact that…

  10. Chinese Foreign Direct Investment in Indonesia

    DEFF Research Database (Denmark)

    Gammeltoft, Peter; Tarmidi, Lepi T.

    2013-01-01

    In Indonesia, no systematic study of Chinese FDI has been undertaken to date. This paper contributes to filling this research gap and analyses the current composition as well as the historical evolution of Chinese FDI in Indonesia, relying on a survey conducted in 2008 among Chinese invested...... enterprises supplemented with key informant interviews, available official statistics and secondary data. Considering the evolution of Chinese investments in Indonesia over time, investments have evolved from being individual and isolated projects to acquiring more systemic properties. Chinese companies have...... acquired a broader sectoral presence in Indonesia and Chinese invested companies in, e.g., extractive or manufacturing activities can increasingly rely on complementary Chinese investments in logistics, travel, finance, etc. Where the local development effects are concerned, a picture emerges where Chinese...

  11. Zhou Enlai and Chinese Grand Strategy

    National Research Council Canada - National Science Library

    Latham, Richard J

    1990-01-01

    ...." Contemporary Chinese writers actually write very little about modern Chinese strategy. When they do investigate the subject, they tend to begin with the late Qing dynasty and focus on events before 1949...

  12. Chinese Academic Assessment and Incentive System.

    Science.gov (United States)

    Suo, Qinghui

    2016-02-01

    The Chinese academic assessment and incentive system drew mixed responses from academia. In the essay the author tried to explain why the current assessment system is appropriate in China and an opportunistic behavior in Chinese academia is exposed.

  13. Cognitive impairment in Chinese neuromyelitis optica

    NARCIS (Netherlands)

    Zhang, N.; Li, Y.J.; Fu, Y.; Shao, J.H.; Luo, L.L.; Yang, L.; Shi, F.D.; Liu, Y.

    2015-01-01

    Background: Cognitive dysfunction is frequently seen in neuromyelitis optica (NMO). However, the features and influencing factors of cognitive impairment of Chinese NMO patients are unclear. Objective: To investigate the patterns of cognitive impairment in Chinese NMO patients, and correlate the

  14. A Primer on Chinese Music Instruments Released

    Institute of Scientific and Technical Information of China (English)

    SuSan

    2005-01-01

    Chinese traditional musical instruments, with a history of 8,000 years, are known for their diverse forms and types. The qualities, functions and materials of these instrunents reflect the unique aesthetic value of Chinese traditional music.

  15. Quantum blind dual-signature scheme without arbitrator

    International Nuclear Information System (INIS)

    Li, Wei; Shi, Ronghua; Huang, Dazu; Shi, Jinjing; Guo, Ying

    2016-01-01

    Motivated by the elegant features of a bind signature, we suggest the design of a quantum blind dual-signature scheme with three phases, i.e., initial phase, signing phase and verification phase. Different from conventional schemes, legal messages are signed not only by the blind signatory but also by the sender in the signing phase. It does not rely much on an arbitrator in the verification phase as the previous quantum signature schemes usually do. The security is guaranteed by entanglement in quantum information processing. Security analysis demonstrates that the signature can be neither forged nor disavowed by illegal participants or attacker. It provides a potential application for e-commerce or e-payment systems with the current technology. (paper)

  16. Radiation signatures from a locally energized flaring loop

    International Nuclear Information System (INIS)

    Emslie, A.G.; Vlahos, L.; and Institute for Plasma Research, Stanford University)

    1980-01-01

    We calculate the radiation signatures from a locally energized solar flare loop, at a variety of wavelengths. Our calculations depend strongly on the physical properties of the energy release mechanism which we qualitatively discuss

  17. Signature Schemes Secure against Hard-to-Invert Leakage

    DEFF Research Database (Denmark)

    Faust, Sebastian; Hazay, Carmit; Nielsen, Jesper Buus

    2012-01-01

    of the secret key. As a second contribution, we construct a signature scheme that achieves security for random messages assuming that the adversary is given a polynomial-time hard to invert function. Here, polynomial-hardness is required even when given the entire public-key – so called weak auxiliary input......-theoretically reveal the entire secret key. In this work, we propose the first constructions of digital signature schemes that are secure in the auxiliary input model. Our main contribution is a digital signature scheme that is secure against chosen message attacks when given an exponentially hard-to-invert function...... security. We show that such signature schemes readily give us auxiliary input secure identification schemes...

  18. Distinct microbiological signatures associated with triple negative breast cancer.

    Science.gov (United States)

    Banerjee, Sagarika; Wei, Zhi; Tan, Fei; Peck, Kristen N; Shih, Natalie; Feldman, Michael; Rebbeck, Timothy R; Alwine, James C; Robertson, Erle S

    2015-10-15

    Infectious agents are the third highest human cancer risk factor and may have a greater role in the origin and/or progression of cancers, and related pathogenesis. Thus, knowing the specific viruses and microbial agents associated with a cancer type may provide insights into cause, diagnosis and treatment. We utilized a pan-pathogen array technology to identify the microbial signatures associated with triple negative breast cancer (TNBC). This technology detects low copy number and fragmented genomes extracted from formalin-fixed paraffin embedded archival tissues. The results, validated by PCR and sequencing, define a microbial signature present in TNBC tissue which was underrepresented in normal tissue. Hierarchical clustering analysis displayed two broad microbial signatures, one prevalent in bacteria and parasites and one prevalent in viruses. These signatures demonstrate a new paradigm in our understanding of the link between microorganisms and cancer, as causative or commensal in the tumor microenvironment and provide new diagnostic potential.

  19. The curse of namespaces in the domain of XML signature

    DEFF Research Database (Denmark)

    Jensen, Meiko; Liao, Lijun; Schwenk, Jörg

    2009-01-01

    The XML signature wrapping attack is one of the most discussed security issues of the Web Services security community during the last years. Until now, the issue has not been solved, and all countermeasure approaches proposed so far were shown to be insufficient. In this paper, we present yet...... another way to perform signature wrapping attacks by using the XML namespace injection technique. We show that the interplay of XML Signature, XPath, and the XML namespace concept has severe flaws that can be exploited for an attack, and that XML namespaces in general pose real troubles to digital...... signatures in the XML domain. Additionally, we present and discuss some new approaches in countering the proposed attack vector....

  20. Methyl-CpG island-associated genome signature tags

    Science.gov (United States)

    Dunn, John J

    2014-05-20

    Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

  1. The 82-plex plasma protein signature that predicts increasing inflammation

    DEFF Research Database (Denmark)

    Tepel, Martin; Beck, Hans C; Tan, Qihua

    2015-01-01

    The objective of the study was to define the specific plasma protein signature that predicts the increase of the inflammation marker C-reactive protein from index day to next-day using proteome analysis and novel bioinformatics tools. We performed a prospective study of 91 incident kidney....... The prediction model selected and validated 82 plasma proteins which determined increased next-day C-reactive protein (area under receiver-operator-characteristics curve, 0.772; 95% confidence interval, 0.669 to 0.876; P signature (P ....001) was associated with observed increased next-day C-reactive protein. The 82-plex protein signature outperformed routine clinical procedures. The category-free net reclassification index improved with 82-plex plasma protein signature (total net reclassification index, 88.3%). Using the 82-plex plasma protein...

  2. Quantum blind dual-signature scheme without arbitrator

    Science.gov (United States)

    Li, Wei; Shi, Ronghua; Huang, Dazu; Shi, Jinjing; Guo, Ying

    2016-03-01

    Motivated by the elegant features of a bind signature, we suggest the design of a quantum blind dual-signature scheme with three phases, i.e., initial phase, signing phase and verification phase. Different from conventional schemes, legal messages are signed not only by the blind signatory but also by the sender in the signing phase. It does not rely much on an arbitrator in the verification phase as the previous quantum signature schemes usually do. The security is guaranteed by entanglement in quantum information processing. Security analysis demonstrates that the signature can be neither forged nor disavowed by illegal participants or attacker. It provides a potential application for e-commerce or e-payment systems with the current technology.

  3. Signature of a Collaboration agreement between Unitar & CERN.

    CERN Multimedia

    Pierre Gildemyn

    2012-01-01

    Signature of agreement with Mr Carlos Lopes (UNITAR) and Prof Rolf Heuer (CERN). From left to right : Einar Bjorgo, Francesco Pisano, Calors Lopes, Rolf Heuer, Maurizio Bona, Frédéric Hemmer, Olivier Van Damme

  4. Fault Management: Degradation Signature Detection, Modeling, and Processing, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Fault to Failure Progression (FFP) signature modeling and processing is a new method for applying condition-based signal data to detect degradation, to identify...

  5. eμ signal as heavy lepton signature at PEP

    International Nuclear Information System (INIS)

    Smith, J.

    1978-01-01

    A planned experiment to detect heavy leptons is described including the signature, cross sections, cuts to reduce the two-photon background to a tolerable level, and the computer program. The expected luminosity is also noted

  6. Fiddling with the ECT act – Electronic signatures | Eiselen ...

    African Journals Online (AJOL)

    Potchefstroom Electronic Law Journal/Potchefstroomse Elektroniese Regsblad ... is considering is an amendment of the definition of "electronic signature". ... of the UNCITRAL Model Laws on eCommerce and the 2005 UN Convention on the ...

  7. A novel quantum group signature scheme without using entangled states

    Science.gov (United States)

    Xu, Guang-Bao; Zhang, Ke-Jia

    2015-07-01

    In this paper, we propose a novel quantum group signature scheme. It can make the signer sign a message on behalf of the group without the help of group manager (the arbitrator), which is different from the previous schemes. In addition, a signature can be verified again when its signer disavows she has ever generated it. We analyze the validity and the security of the proposed signature scheme. Moreover, we discuss the advantages and the disadvantages of the new scheme and the existing ones. The results show that our scheme satisfies all the characteristics of a group signature and has more advantages than the previous ones. Like its classic counterpart, our scheme can be used in many application scenarios, such as e-government and e-business.

  8. A Secure and Efficient Certificateless Short Signature Scheme

    Directory of Open Access Journals (Sweden)

    Lin Cheng

    2013-07-01

    Full Text Available Certificateless public key cryptography combines advantage of traditional public key cryptography and identity-based public key cryptography as it avoids usage of certificates and resolves the key escrow problem. In 2007, Huang et al. classified adversaries against certificateless signatures according to their attack power into normal, strong and super adversaries (ordered by their attack power. In this paper, we propose a new certificateless short signature scheme and prove that it is secure against both of the super type I and the super type II adversaries. Our new scheme not only achieves the strongest security level but also has the shortest signature length (one group element. Compared with the other short certificateless signature schemes which have a similar security level, our new scheme has less operation cost.

  9. New signatures of flavor violating Higgs couplings

    Energy Technology Data Exchange (ETDEWEB)

    Buschmann, Malte; Kopp, Joachim; Liu, Jia; Wang, Xiao-Ping [PRISMA Cluster of Excellence and Mainz Institute for Theoretical Physics,Johannes Gutenberg University, 55099 Mainz (Germany)

    2016-06-24

    We explore several novel LHC signatures arising from quark or lepton flavor violating couplings in the Higgs sector, and we constrain such couplings using LHC data. Since the largest signals are possible in channels involving top quarks or tau leptons, we consider in particular the following flavor violating processes: (1) pp→thh (top plus di-Higgs final state) arising from a dimension six coupling of up-type quarks to three insertions of the Higgs field. We develop a search strategy for this final state and demonstrate that detection is possible at the high luminosity LHC if flavor violating top-up-Higgs couplings are not too far below the current limit. (2) pp→tH{sup 0}, where H{sup 0} is the heavy neutral CP-even Higgs boson in a two Higgs doublet model (2HDM). We consider the decay channels H{sup 0}→tu,WW,ZZ,hh and use existing LHC data to constrain the first three of them. For the fourth, we adapt our search for the thh final state, and we demonstrate that in large regions of the parameter space, it is superior to other searches, including searches for flavor violating top quark decays (t→hq). (3) H{sup 0}→τμ, again in the context of a 2HDM. This channel is particularly well motivated by the recent CMS excess in h→τμ, and we use the data from this search to constrain the properties of H{sup 0}.

  10. GRAVITATIONAL WAVE SIGNATURES OF HYPERACCRETING COLLAPSAR DISKS

    International Nuclear Information System (INIS)

    Kotake, Kei; Takiwaki, Tomoya; Harikae, Seiji

    2012-01-01

    By performing two-dimensional special relativistic (SR) magnetohydrodynamic simulations, we study possible signatures of gravitational waves (GWs) in the context of the collapsar model for long-duration gamma-ray bursts. In our SR simulations, the central black hole is treated as an absorbing boundary. By doing so, we focus on the GWs generated by asphericities in neutrino emission and matter motions in the vicinity of the hyperaccreting disks. We compute nine models by adding initial angular momenta and magnetic fields parametrically to a precollapse core of a 35 M ☉ progenitor star. As for the microphysics, a realistic equation of state is employed and the neutrino cooling is taken into account via a multi-flavor neutrino leakage scheme. To accurately estimate GWs produced by anisotropic neutrino emission, we perform a ray-tracing analysis in general relativity by a post-processing procedure. By employing a stress formula that includes contributions from both magnetic fields and SR corrections, we also study the effects of magnetic fields on the gravitational waveforms. We find that the GW amplitudes from anisotropic neutrino emission show a monotonic increase with time, whose amplitudes are much larger than those from matter motions of the accreting material. We show that the increasing trend of the neutrino GWs stems from the excess of neutrino emission in the direction near parallel to the spin axis illuminated from the hyperaccreting disks. We point out that a recently proposed future space-based interferometer like Fabry-Perot-type DECIGO would permit the detection of these GW signals within ≈100 Mpc.

  11. Modeling Profiles and Signatures of Enrichments

    Science.gov (United States)

    Ali, A.; Qualls, C.; Lucas, S. G.; Lombari, G.; Appenzeller, O.

    2014-12-01

    Anthropogenic and geochemical enrichment of soils and living matter have been well documented 1, 2, 3.Here we report on geochemical, anthropogenic and biological enrichments with heavy metals in Modern Peru and compared this to Modern and ancient data from New Mexico, USA. We established a signature derived from the quantities of 25 metals in various biological, fossil and soil materials. We also speculate that human adaptation to mercury toxicity may occur in remarkably short time spans during the Holocene. We found mercury concentrations in Modern pigeon feathers and llama wool from free foraging birds and animals in Albuquerque, NM, ranging from 0.006 to 0.019 mg/Kg of tissue. The values for Modern Peru ranged from 22.0 to 556 mg/Kg for the same tissues. We discovered, in 64 million-year-old fossilized plants from New Mexico (Paleocene Nacimiento Formation, San Juan Basin), a mercury concentration of 1.11 mg/Kg of fossil, whereas Modern plant material from the Rio Grande Basin in New Mexico contained no mercury. Profiling of metal content of these samples suggests that mercury is a proxy for anthropogenic rather than geochemical enrichment in the localities we examined. We found no overt signs of mercury toxicity in contemporaneous inhabitants of Huancavelica4, Peru; one of the ten most mercury-polluted places in the world and the mercury concentration in their hair is well below modern admissible levels. However, assessment of their annual scalp hair growth-rate showed marked reduction in growth (~ 5cm/yr) versus ~ 16cm/year for normal scalp hair from other continents4. This is consistent with a toxic effect of heavy metals on human metabolism and especially autonomic nervous system function in Huancavelica, Peru. Contemporaneous anthropogenic activities are known to increase heavy metal content in the biosphere with potentially toxic effects on humans. However, signs of human evolutionary adaptation to such toxins might already be evident in Peru4.

  12. Magnetotail processes and their ionospheric signatures

    Science.gov (United States)

    Ferdousi, B.; Raeder, J.; Zesta, E.; Murphy, K. R.; Cramer, W. D.

    2017-12-01

    In-situ observations in the magnetotail are sparse and limited to single point measurements. In the ionosphere, on the other hand, there is a broad range of observations, including magnetometers, auroral imagers, and various radars. Since the ionosphere is to some extent a mirror of plasmasheet processes it can be used as a monitor of magnetotail dynamics. Thus, it is of great importance to understand the coupling between the ionosphere and the magnetosphere in order to properly interpret the ionosphere and ground observations in terms of magnetotail dynamics. For this purpose, the global magnetohydrodynamic model OpenGGCM is used to investigate magnetosphere-ionosphere coupling. One of the key processes in magnetotail dynamics are bursty bulk flows (BBFs) which are the major means by which momentum and energy get transferred through the magnetotail and down to the ionosphere. BBFs often manifested in the ionosphere as auroral streamers. This study focuses on mapping such flow bursts from the magnetotail to the ionosphere along the magnetic field lines for three states of the magnetotail: pre-substorm onset through substorm expansion and during steady magnetospheric convection (SMC) following the substorm. We find that the orientation of streamers in the ionosphere differes for different local times, and that, for both tail and ionospheric signatures, activity increases during the SCM configutation compared to the pre-onset and quiet times. We also find that the background convection in the tail impacts the direction and deflection of the BBFs and the subsequent orientation of the auroral streamers in the ionosphere.

  13. Mapping the space of genomic signatures.

    Directory of Open Access Journals (Sweden)

    Lila Kari

    Full Text Available We propose a computational method to measure and visualize interrelationships among any number of DNA sequences allowing, for example, the examination of hundreds or thousands of complete mitochondrial genomes. An "image distance" is computed for each pair of graphical representations of DNA sequences, and the distances are visualized as a Molecular Distance Map: Each point on the map represents a DNA sequence, and the spatial proximity between any two points reflects the degree of structural similarity between the corresponding sequences. The graphical representation of DNA sequences utilized, Chaos Game Representation (CGR, is genome- and species-specific and can thus act as a genomic signature. Consequently, Molecular Distance Maps could inform species identification, taxonomic classifications and, to a certain extent, evolutionary history. The image distance employed, Structural Dissimilarity Index (DSSIM, implicitly compares the occurrences of oligomers of length up to k (herein k = 9 in DNA sequences. We computed DSSIM distances for more than 5 million pairs of complete mitochondrial genomes, and used Multi-Dimensional Scaling (MDS to obtain Molecular Distance Maps that visually display the sequence relatedness in various subsets, at different taxonomic levels. This general-purpose method does not require DNA sequence alignment and can thus be used to compare similar or vastly different DNA sequences, genomic or computer-generated, of the same or different lengths. We illustrate potential uses of this approach by applying it to several taxonomic subsets: phylum Vertebrata, (superkingdom Protista, classes Amphibia-Insecta-Mammalia, class Amphibia, and order Primates. This analysis of an extensive dataset confirms that the oligomer composition of full mtDNA sequences can be a source of taxonomic information. This method also correctly finds the mtDNA sequences most closely related to that of the anatomically modern human (the Neanderthal

  14. Integrative Metabolic Signatures for Hepatic Radiation Injury.

    Directory of Open Access Journals (Sweden)

    Irwin Jack Kurland

    Full Text Available Radiation-induced liver disease (RILD is a dose-limiting factor in curative radiation therapy (RT for liver cancers, making early detection of radiation-associated liver injury absolutely essential for medical intervention. A metabolomic approach was used to determine metabolic signatures that could serve as biomarkers for early detection of RILD in mice.Anesthetized C57BL/6 mice received 0, 10 or 50 Gy Whole Liver Irradiation (WLI and were contrasted to mice, which received 10 Gy whole body irradiation (WBI. Liver and plasma samples were collected at 24 hours after irradiation. The samples were processed using Gas Chromatography/Mass Spectrometry and Liquid Chromatography/Mass Spectrometry.Twenty four hours after WLI, 407 metabolites were detected in liver samples while 347 metabolites were detected in plasma. Plasma metabolites associated with 50 Gy WLI included several amino acids, purine and pyrimidine metabolites, microbial metabolites, and most prominently bradykinin and 3-indoxyl-sulfate. Liver metabolites associated with 50 Gy WLI included pentose phosphate, purine, and pyrimidine metabolites in liver. Plasma biomarkers in common between WLI and WBI were enriched in microbial metabolites such as 3 indoxyl sulfate, indole-3-lactic acid, phenyllactic acid, pipecolic acid, hippuric acid, and markers of DNA damage such as 2-deoxyuridine. Metabolites associated with tryptophan and indoles may reflect radiation-induced gut microbiome effects. Predominant liver biomarkers in common between WBI and WLI were amino acids, sugars, TCA metabolites (fumarate, fatty acids (lineolate, n-hexadecanoic acid and DNA damage markers (uridine.We identified a set of metabolomic markers that may prove useful as plasma biomarkers of RILD and WBI. Pathway analysis also suggested that the unique metabolic changes observed after liver irradiation was an integrative response of the intestine, liver and kidney.

  15. CHINESE INDONESIANS: CHINESE MUSLIMS AND THE COLLAPSE OF THE BUSINESS REPUBLIC JAKARTA: REPUBLIKA

    Directory of Open Access Journals (Sweden)

    Teguh Setiawan

    2013-06-01

    Full Text Available This book written by Teguh Setiawan and published by Republika is very interesting to read because from it the reader will get a lot of information about the ethnic Chinese in Indonesia, among them: the greatness of the Chinese Muslim leaders and bad luck of Chinese Muslim community during the Dutch colonial period and the heyday of the Muslim ethnic Chinese in Indonesia, and portrait of the Chinese Muslims from the past. In addition, readers will be interested in doing research on other ethnic Chinese, perhaps even you would like to know the ethnic Chinese in the rural areas recounted in the book.

  16. Littoral Assessment of Mine Burial Signatures (LAMBS) buried land mine/background spectral signature analyses

    Science.gov (United States)

    Kenton, A.C.; Geci, D.M.; Ray, K.J.; Thomas, C.M.; Salisbury, J.W.; Mars, J.C.; Crowley, J.K.; Witherspoon, N.H.; Holloway, J.H.; Harmon R.S.Broach J.T.Holloway, Jr. J.H.

    2004-01-01

    The objective of the Office of Naval Research (ONR) Rapid Overt Reconnaissance (ROR) program and the Airborne Littoral Reconnaissance Technologies (ALRT) project's LAMBS effort is to determine if electro-optical spectral discriminants exist that are useful for the detection of land mines in littoral regions. Statistically significant buried mine overburden and background signature data were collected over a wide spectral range (0.35 to 14 ??m) to identify robust spectral features that might serve as discriminants for new airborne sensor concepts. LAMBS has expanded previously collected databases to littoral areas - primarily dry and wet sandy soils - where tidal, surf, and wind conditions can severely modify spectral signatures. At AeroSense 2003, we reported completion of three buried mine collections at an inland bay, Atlantic and Gulf of Mexico beach sites.1 We now report LAMBS spectral database analyses results using metrics which characterize the detection performance of general types of spectral detection algorithms. These metrics include mean contrast, spectral signal-to-clutter, covariance, information content, and spectral matched filter analyses. Detection performance of the buried land mines was analyzed with regard to burial age, background type, and environmental conditions. These analyses considered features observed due to particle size differences, surface roughness, surface moisture, and compositional differences.

  17. Uncertainty in hydrological signatures for gauged and ungauged catchments

    Science.gov (United States)

    Westerberg, Ida K.; Wagener, Thorsten; Coxon, Gemma; McMillan, Hilary K.; Castellarin, Attilio; Montanari, Alberto; Freer, Jim

    2016-03-01

    Reliable information about hydrological behavior is needed for water-resource management and scientific investigations. Hydrological signatures quantify catchment behavior as index values, and can be predicted for ungauged catchments using a regionalization procedure. The prediction reliability is affected by data uncertainties for the gauged catchments used in prediction and by uncertainties in the regionalization procedure. We quantified signature uncertainty stemming from discharge data uncertainty for 43 UK catchments and propagated these uncertainties in signature regionalization, while accounting for regionalization uncertainty with a weighted-pooling-group approach. Discharge uncertainty was estimated using Monte Carlo sampling of multiple feasible rating curves. For each sampled rating curve, a discharge time series was calculated and used in deriving the gauged signature uncertainty distribution. We found that the gauged uncertainty varied with signature type, local measurement conditions and catchment behavior, with the highest uncertainties (median relative uncertainty ±30-40% across all catchments) for signatures measuring high- and low-flow magnitude and dynamics. Our regionalization method allowed assessing the role and relative magnitudes of the gauged and regionalized uncertainty sources in shaping the signature uncertainty distributions predicted for catchments treated as ungauged. We found that (1) if the gauged uncertainties were neglected there was a clear risk of overconditioning the regionalization inference, e.g., by attributing catchment differences resulting from gauged uncertainty to differences in catchment behavior, and (2) uncertainty in the regionalization results was lower for signatures measuring flow distribution (e.g., mean flow) than flow dynamics (e.g., autocorrelation), and for average flows (and then high flows) compared to low flows.

  18. Anogenital distance as a phenotypic signature through infancy

    DEFF Research Database (Denmark)

    Priskorn, Lærke; Petersen, Jørgen H; Jørgensen, Niels

    2018-01-01

    BACKGROUND: Anogenital distance (AGD) has been suggested to represent a phenotypic signature reflecting in utero androgen action. However, it is not known whether an individual's AGD at birth correlates to AGD later in life. We investigate correlations of AGD between 3 and 18 months and asses rep......-up through childhood and puberty will reveal whether AGD represents a phenotypic signature throughout life.Pediatric Research accepted article preview online, 20 November 2017. doi:10.1038/pr.2017.287....

  19. Signatures for isoscalar spin transitions excited in (d, d,) reactions

    International Nuclear Information System (INIS)

    Morlet, M.; Willis, A.; Van de Wiele, J.; Marty, N.; Guillot, J.; Langevin-Joliot, H.; Bimbot, L.; Rosier, L.; Djalali, C.; Duchazeaubeneix, J.C.

    1990-01-01

    Three different signatures for isoscalar spin transitions in nuclei have been tested in the 12 C(d, d , ) 12 C reaction at 400 MeV. These signatures have values of close to zero for the natural parity states, and values ranging from 0.22 to 0.50 for the ΔS=1 ΔT=0, 12.7 MeV state

  20. Epigenetic signature of birth weight discordance in adult twins

    DEFF Research Database (Denmark)

    Tan, Qihua; Nielsen, Morten Frost Munk; Heijmans, Bastiaan T

    2014-01-01

    between birth weight and adult life health while controlling for not only genetics but also postnatal rearing environment. We performed an epigenome-wide profiling on blood samples from 150 pairs of adult monozygotic twins discordant for birth weight to look for molecular evidence of epigenetic signatures...... profiling did not reveal epigenetic signatures of birth weight discordance although some sites displayed age-dependent intra-pair differential methylation in the extremely discordant twin pairs....