WorldWideScience

Sample records for handling raw meat

  1. Properties of raw meat and meat curry from spent goat in relation with post-mortem handling conditions.

    Science.gov (United States)

    Narayan, Raj; Mendiratta, S K; Mane, B G

    2013-04-01

    The properties of raw meat and meat curry from spent goat meat in relation with post-mortem handling conditions were evaluated. The conditions evaluated were: cooking of meat within 1-2 h post-slaughter (condition 1); deboning meat storage at 25 ± 2 °C for 5-6 h and cooking (condition 2); post-slaughter storage of carcass at room temperature for 5-6 h, then deboning followed by storage of meat at refrigeration temperature for 5-6 h and cooking (condition 3); deboning and storage of meat at 25 ± 2 °C for 10-12 h and cooking (condition 4). Significant difference was observed in pH values in condition 1 (p meat as compared to the conditions 2, 3 and 4. However, the moisture content of cooked meat was significantly higher (p meat chunks, that is, the mean value was significantly higher (p < 0.01) for condition 2 and significantly lower for condition 1. Sensory scores were significantly higher in condition 1 and significantly lower in condition 2. However, sensory scores for condition 4 were almost similar to the condition 1.

  2. An Immunoassay for Quantification of Contamination by Raw Meat Juice on Food Contact Surfaces.

    Science.gov (United States)

    Chen, Fur-Chi; Godwin, Sandria; Chambers, Edgar

    2016-11-01

    Raw chicken products often are contaminated with Salmonella and Campylobacter , which can be transmitted from packages to contact surfaces. Raw meat juices from these packages also provide potential media for cross-contamination. There are limited quantitative data on the levels of consumer exposure to raw meat juice during shopping for and handling of chicken products. An exposure assessment is needed to quantify the levels of transmission and to assess the risk. An enzyme-linked immunosorbent assay (ELISA) was developed and validated for quantitative detection of raw meat juice on hands and various food contact surfaces. Analytical procedures were designed to maximize the recovery of raw meat juice from various surfaces: hands, plastic, wood, stainless steel, laminated countertops, glass, and ceramics. The ELISA was based on the detection of a soluble muscle protein, troponin I (TnI), in the raw meat juice. The assay can detect levels as low as 1.25 ng of TnI, which is equivalent to less than 1 μl of the raw meat juice. The concentrations of TnI in the raw meat juices from 10 retail chicken packages, as determined by ELISA, were between 0.46 and 3.56 ng/μl, with an average of 1.69 ng/μl. The analytical procedures, which include swabbing, extraction, and concentration, enable the detection of TnI from various surfaces. The recoveries of raw meat juice from surfaces of hands were 92%, and recoveries from other tested surfaces were from 55% on plastic cutting boards to 75% on laminated countertops. The ELISA developed has been used for monitoring the transfer of raw meat juice during shopping for and handling of raw chicken products in our studies. The assay also can be applied to other raw meat products, such as pork and beef.

  3. Safe meat-handling knowledge, attitudes and practices of private and government meat processing plants' workers: implications for future policy.

    Science.gov (United States)

    Adesokan, H K; Raji, A O Q

    2014-03-01

    Food-borne disease outbreaks remain a major global health challenge and cross-contamination from raw meat due to poor handling is a major cause in developing countries. Adequate knowledge of meat handlers is important in limiting these outbreaks. This study evaluated and compared the safe meat-handling knowledge, attitudes and practices (KAP) of private (PMPP) and government meat processing plants' (GMPP) workers in south-western Nigeria. This cross sectional study comprised 190 meat handlers (PMPP = 55; GMPP = 135). Data concerning their safe meat-handling knowledge, attitudes and practices as well as their socio-demographic characteristics, such as age, gender and work experience were collected. A significant association was observed between the type of meat processing plants and their knowledge (p = 0.000), attitudes (p = 0.000) and practices (p = 0.000) of safe meat-handling. Meat handlers in the GMPP were respectively, about 17 times (OR = 0.060, 95% CI: 0.018-0.203), 57 times (OR = 0.019, 95% CI: 0.007-0.054) and 111 times (OR = 0.009, 95% CI: 0.001- 0.067) less likely to obtain good knowledge, attitude and practice level of safe meat-handling than those from PMPP. Further, KAP levels were significantly associated with age group, education and work experience (p < 0.05). Study findings suggest the need for future policy in food industry in developing countries to accommodate increased involvement of private sector for improved food safety and quality delivery. Public health education on safe food handling and hygiene should be on the front burner among food handlers in general.

  4. Prevalence of Arcobacter spp. in raw milk and retail raw meats in northern Ireland

    DEFF Research Database (Denmark)

    Scullion, R.; Harrington, C.S.; Madden, R.H.

    2006-01-01

    A 1-year study was undertaken to determine the prevalence of Arcobacter spp. in raw milk and retail raw meats on sale in Northern Ireland. Retail raw poultry samples (n = 94), pork samples (n = 101), and beef samples (n = 108) were obtained from supermarkets in Northern Ireland, and raw milk samp...... from raw milk samples. Arcobacter cryaerophilus was detected less frequently, and Arcobacter skirrowii was detected only as a cocontaminant. To our knowledge, this is the first report of Arcobacter spp. prevalence in a diverse range of products of animal origin in Northern Ireland....

  5. Detection of horse meat contamination in raw and heat-processed meat products.

    Science.gov (United States)

    Hsieh, Yun-Hwa P; Ofori, Jack A

    2014-12-31

    Europe's recent problems with the adulteration of beef products with horse meat highlight the need for a reliable method for detecting horse meat in food for human consumption. The objective of this study was therefore to develop a reliable monoclonal antibody (mAb) based enzyme-linked immunosorbent assay (ELISA) for horse meat detection. Two mAbs, H3E3 (IgG2b) and H4E7 (IgG2a), were characterized as horse-selective, and competitive ELISAs (cELISAs) employing these mAbs were developed. The cELISAs were found to be capable of detecting levels as low as 1% of horse meat in raw, cooked, and autoclaved ground beef or pork, being useful analytical tools for addressing the health, economic, and ethical concerns associated with adulterating meat products with horse meat. However, due to cross-reaction with raw poultry meat, it is recommended that samples be heated (100 °C for 15 min) prior to analysis to eliminate possible false-positive results.

  6. The Formulation of Binding Agent Concentration on Raw Restructured Goat Meat Trimming Product

    Directory of Open Access Journals (Sweden)

    Rini Mastuti

    2012-02-01

    Full Text Available The utilization of raw materials and formulation method would affect the quality of the processed meat product. Therefore, a research on the processing method to produce a raw structured product should be conducted. The research was testing a single factor comprises of following parameters: control (without binding agent; 0.3%, 0.5% and 0.7% sodium alginat and 0.3%, 0.5% and 0.7% carragenan, respectively. The results showed that the goat meat trimming could be used as raw materials in the production of the best restructured meat using 0.5% carragenan. This raw restructured meat produced had a loss weight of 1.67%, pH value  7.89, WHC  48.345, and moisture content  75.20%.   Keywords : sodium alginat, carragenan, raw restructured goat meat trimming.

  7. Artificial neural network as the tool in prediction rheological features of raw minced meat

    OpenAIRE

    Edyta Balejko; Zbigniew Nowak; Jerzy A. Balejko

    2012-01-01

      Background. The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. Material and methods. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed us...

  8. Antimicrobial resistance among Campylobacter jejuni isolated from raw poultry meat at retail level in Denmark

    DEFF Research Database (Denmark)

    Andersen, S. R.; Saadbye, P.; Shukri, Naseer Mahmoud

    2006-01-01

    Campylobacter jejuni isolated from raw poultry meat collected at retail shops in Denmark in the period 1996-2003 were tested for susceptibility to seven antimicrobial agents. The food samples consisted of raw chicken meat and other raw poultry meat of domestic or imported origin. The highest levels...... for chloramphenicol, nalidixic acid and ciprofloxacin (P food animals....... Monitoring of the occurrence of antimicrobial resistance in C. jejuni isolated from raw uncooked poultry has been performed on a yearly basis since 1996, thus providing useful insight into consumer exposure to antimicrobial-resistant C. jejuni....

  9. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus

    OpenAIRE

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E.; Hanson, Blake M.; Smith, Tara C.

    2017-01-01

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n?=?3347) and contemporaneously from meat produc...

  10. Staphylococcus aureus Enterotoxin A Gene Isolated From Raw Red Meat and Poultry in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Hossein Sarrafzadeh Zargar

    2014-07-01

    Full Text Available Background: Staphylococcus aureus is the most prevalent infectious agent of food materials. Enterotoxin producing types of S. aureus cause well-known food-borne disease. Staphylococcal Enterotoxin A (SEA is the most important agent of gastroenteritis. Objectives: The present study aimed to screen the raw meat samples collected from different regions of Tehran for S. aureus infection and type of encoding enterotoxin. Materials and Methods: Hundred and eighty six meat samples were collected randomly from city dealers and transferred to laboratory within screw cap containers. The samples were first cultured according to the standard bacteriological methods and then S. aureus isolates were identified using standard bacteriological tests. The isolates were subjected to Polymerase Chain Reaction (PCR to detect gene encoding SEA. Results: Staphylococcus aureus isolated from 29 (15.6% meat samples including beef 14.8%, raw lamb 15%, raw chicken 15.7% and raw turkey 16.6%. Using special primer sets proved that the species isolated from five samples (two raw chicken, two raw beef and one raw turkey encoded enterotoxin A. Conclusions: Although staphylococcal contamination within food material is more or less a routine, but detection of enterotoxin encoding species from raw meat samples is alarming for health authorities. These data highlight the importance of periodic surveillance of raw meat distributed among ordinary consumers.

  11. IMPROVING THE SYSTEM OF RAW MATERIAL SUPPLY OF THE MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. M. Bukreev

    2013-01-01

    Full Text Available The article describes the characteristics of the process of improving the system raw materials supply of meat industry and presents the main factors, criteria, principles and algorithm rational distribution of the meat industry. The relevance of the research topic, in a globalized economy and Russia's accession to the WTO, caused by necessity to improve the system of raw material supply domestic enterprises and enhancing food security.

  12. OFFGEL electrophoresis and tandem mass spectrometry approach compared with DNA-based PCR method for authentication of meat species from raw and cooked ground meat mixtures containing cattle meat, water buffalo meat and sheep meat.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Jagadeesh Babu, A; Madhava Rao, T; Kamuni, Veeranna; Vaithiyanathan, S; Kulkarni, Vinayak V; Rapole, Srikanth

    2017-10-15

    The present study compared the accuracy of an OFFGEL electrophoresis and tandem mass spectrometry-based proteomic approach with a DNA-based method for meat species identification from raw and cooked ground meat mixes containing cattle, water buffalo and sheep meat. The proteomic approach involved the separation of myofibrillar proteins using OFFGEL electrophoresis, SDS-PAGE and protein identification by MALDI-TOF MS. Species-specific peptides derived from myosin light chain-1 and 2 were identified for authenticating buffalo meat spiked at a minimum 0.5% level in sheep meat with high confidence. Relative quantification of buffalo meat mixed with sheep meat was done by quantitative label-free mass spectrometry using UPLC-QTOF and PLGS search engine to substantiate the confidence level of the data. In the DNA-based method, PCR amplification of mitochondrial D loop gene using species specific primers found 226bp and 126bp product amplicons for buffalo and cattle meat, respectively. The method was efficient in detecting a minimum of 0.5% and 1.0% when buffalo meat was spiked with cattle meat in raw and cooked meat mixes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    OpenAIRE

    Claudiu-Dan Salagean; Dorin Tibulca; Radu Marin

    2013-01-01

    Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste) in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon) and mix of natural spices - fine grinding variant (1) and coarse grinding variant (3) - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon) + vegetable protein supplements (textured soy protein) + binder (protein + fiber) + add...

  14. Volatiles in raw and cooked meat from lambs fed olive cake and linseed.

    Science.gov (United States)

    Gravador, R S; Serra, A; Luciano, G; Pennisi, P; Vasta, V; Mele, M; Pauselli, M; Priolo, A

    2015-04-01

    This study was conducted to determine the effects of feeding olive cake and linseed to lambs on the volatile organic compounds (VOCs) in raw and cooked meat. Four groups of eight male Appenninica lambs each were fed: conventional cereal-based concentrates (diet C), concentrates containing 20% on a dry matter (DM) basis of rolled linseed (diet L), concentrates containing 35% DM of stoned olive cake (diet OC), or concentrates containing both rolled linseed (10% DM) and stoned olive cake (17% DM; diet OCL). The longissimus dorsi muscle of each lamb was sampled at slaughter and was subjected to VOC profiling through the use of SPME-GC-MS. In the raw meat, the concentration of 3-methylpentanoic acid was higher in treatment C as compared with treatments L, OC and OCL (Pcooked meat the amount of 1-pentanol was higher in treatment C than in treatment OC (Plamb meat.

  15. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Dietary vitamin E affects lipid oxidation and total volatiles of irradiated raw turkey meat

    International Nuclear Information System (INIS)

    Ahn, D.U.; Sell, J.L.; Jeffery, M.; Jo, C.; Chen, X.; Lee, J.I.

    1997-01-01

    Breast and leg meat patties, prepared from turkeys fed diets containing 25, 200, 400 or 600 IU of dl-alpha-tocopheryl acetate (TA) per kg diet, were irradiated at 0 or 2.5 kGy with vacuum or loose packaging. The effects of dietary TA on storage stability and production of volatiles in irradiated raw turkey meat were determined. Dietary TA at 200 IU/kg decreased lipid oxidation and reduced total volatiles of raw turkey patties after 7-days of storage. However, the antioxidant effects of dietary TA were more notable when the patties were loosely packaged than when vacuum-packaged. Irradiation increased lipid oxidation of raw turkey meats only when loosely packaged but had limited effects on formation of total volatiles after storage at 4 degrees C for 7 days or longer

  17. Listeria monocytogenes in retailed raw chicken meat in Turkey.

    Science.gov (United States)

    Siriken, Belgin; Ayaz, Naim Deniz; Erol, Irfan

    2014-01-01

    The objectives of this study were, to find the prevalence and antimicrobial resistance of L. monocytogenes from a total of 116 chicken meat samples including 50 carcasses and 66 meat parts marketed in Turkey between 2008 and 2009 using immunomagnetic separation (IMS) based cultivation technique, to detect the hlyA gene for the verification of the isolates by PCR, and to identify the genoserotypes of the L. monocytogenes isolates by multiplex PCR assay. In the study, 51 L. monocytogenes colonies were isolated from 34 (29.3%) chicken meat samples (eleven [22.0%] carcasses and 23 [34.8%] pieces of meat) by IMS based cultivation technique and confirmed by PCR. According to the multiplex PCR results, all the 51 isolates were identified as genoserotype IIa (1/2a or 3a). L. monocytogenes isolates were also tested for their susceptibility to eight antibiotic (gentamicin, vancomycin, chloramphenicol, streptomycin, tetracycline, ampicillin, penicillin G, erythromycin) agents using the disk diffusion method. 14 isolates (27.45%) were susceptible to all eight antimicrobials drugs tested and the remaining 37 isolates (72.54%) were resistant to gentamicin (one isolate, 1.96%), vancomycin (four isolates, 7.84%), penicillin G (six isolates, 11.76%), streptomycin (nine isolates, 17.64%; resistant or intermediate), tetracycline (seven isolates, 13.72%) and ampicillin (six isolates, 11.76%). This study showed that antimicrobial resistance is not highly prevalent in L. monocytogenes isolated from chicken carcasses and pieces of meat. The presence of L. monocytogenes in chicken samples suggests an importance of this pathogen in chicken.

  18. Artificial neural network as the tool in prediction rheological features of raw minced meat.

    Science.gov (United States)

    Balejko, Jerzy A; Nowak, Zbigniew; Balejko, Edyta

    2012-01-01

    The aim of the study was to elaborate a method of modelling and forecasting rheological features which could be applied to raw minced meat at the stage of mixture preparation with a given ingredient composition. The investigated material contained pork and beef meat, pork fat, fat substitutes, ice and curing mixture in various proportions. Seven texture parameters were measured for each sample of raw minced meat. The data obtained were processed using the artificial neural network module in Statistica 9.0 software. The model that reached the lowest training error was a multi-layer perceptron MLP with three neural layers and architecture 7:7-11-7:7. Correlation coefficients between the experimental and calculated values in training, verification and testing subsets were similar and rather high (around 0.65) which indicated good network performance. High percentage of the total variance explained in PCA analysis (73.5%) indicated that the percentage composition of raw minced meat can be successfully used in the prediction of its rheological features. Statistical analysis of the results revealed, that artificial neural network model is able to predict rheological parameters and thus a complete texture profile of raw minced meat.

  19. The Influence of Stunning Method, Refrigeration and Freezing Time on the Rheological and Textural Properties of Raw Meat

    Directory of Open Access Journals (Sweden)

    Liliana Tudoreanu

    2013-11-01

    Full Text Available The present research was conducted to provide information on the influence of stunning methods in conjunction with refrigeration and freezing time on the textural and rheological properties of raw meat. Pork raw meat, commercially available, was analyzed for textural properties such as hardness, cohesiveness, adhesiveness and fracture force. Sample were analyzed fresh, after 3 days of refrigeration, and 15 days, 30days and 60 days freezing time in commercially available refrigerators mimicking the storing conditions used by consumers. For pork raw meat, hardness increased sharply after 3 days of refrigeration and showed no significant differences after 15days of freezing compared to 3days refrigeration time. After 30 days of freezing the raw pork meat samples’ hardness decreased significantly compared to the hardness of the samples freeze for15 days. Hardness of gas stunning raw pork meat samples compared to electrical stunning raw pork meat samples was 2.57 times higher indicating a better firmness of the gas stunning raw pork meat. The cohesiveness of the raw pork meat from gas stunned animals maintained its levels after 60 days of freezing while the meat from electrically stunned animals showed significant modificatio

  20. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  1. Assessing the potential for raw meat to influence human colonization with Staphylococcus aureus.

    Science.gov (United States)

    Carrel, Margaret; Zhao, Chang; Thapaliya, Dipendra; Bitterman, Patrick; Kates, Ashley E; Hanson, Blake M; Smith, Tara C

    2017-09-07

    The role of household meat handling and consumption in the transfer of Staphylococcus aureus (S. aureus) from livestock to consumers is not well understood. Examining the similarity of S. aureus colonizing humans and S. aureus in meat from the stores in which those individuals shop can provide insight into the role of meat in human S. aureus colonization. S. aureus isolates were collected from individuals in rural and urban communities in Iowa (n = 3347) and contemporaneously from meat products in stores where participants report purchasing meat (n = 913). The staphylococcal protein A (spa) gene was sequenced for all isolates to determine a spa type. Morisita indices and Permutational Multivariate Analysis of Variance Using Distance Matrices (PERMANOVA) were used to determine the relationship between spa type composition among human samples and meat samples. spa type composition was significantly different between households and meat sampled from their associated grocery stores. spa types found in meat were not significantly different regardless of the store or county in which they were sampled. spa types in people also exhibit high similarity regardless of residential location in urban or rural counties. Such findings suggest meat is not an important source of S. aureus colonization in shoppers.

  2. Survival of Salmonella Copenhagen in food bowls following contamination with experimentally inoculated raw meat: Effects of time, cleaning, and disinfection

    OpenAIRE

    Weese, J Scott; Rousseau, J.

    2006-01-01

    There are concerns regarding the safety of feeding raw meat to household pets. This study demonstrated that Salmonella persists in food bowls that are inoculated with Salmonella-containing raw meat. Standard methods of cleaning and disinfection were minimally effective at eliminating Salmonella contamination.

  3. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    NARCIS (Netherlands)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-01

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and

  4. 76 FR 44855 - Common or Usual Name for Raw Meat and Poultry Products Containing Added Solutions

    Science.gov (United States)

    2011-07-27

    ...'s experience in reviewing labels of meat and poultry products with added solution, the Agency has... or prior to consumption. Therefore, to ensure that labels adequately inform consumers that raw... of identity and that are sold for retail sale, institutional use, or further processing. If retail...

  5. Freezing of meat raw materials affects tyramine and diamine accumulation in spontaneously fermented sausages.

    Science.gov (United States)

    Bover-Cid, Sara; Miguelez-Arrizado, M Jesús; Luz Latorre Moratalla, L; Vidal Carou, M Carmen

    2006-01-01

    Biogenic amine accumulation was studied in spontaneously fermented sausages (Fuet) manufactured from unfrozen-fresh meat (U-sausages) and frozen-thawed meat (F-sausages). The aim was to investigate whether the frozen storage of raw materials affects the microbial composition and its aminogenic activity during sausage fermentation. Tyramine was the major amine in all sausages. Although the final levels were similar, tyramine accumulated more rapidly in F-sausages, which contained putrescine as the second amine. By contrast, U-sausages accumulated much more cadaverine than putrescine. F-sausages showed a slightly lower pH and free amino acid content as well as higher counts of technological flora (lactic acid and gram positive catalase positive bacteria) and lower counts of enterobacteria. Therefore, to freeze the meat raw materials for few days before sausage manufacture could be a useful practice, especially for the artisan fermented sausages (without starter), because it helps to reduce enterobacteria development and cadaverine production.

  6. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Jalali, Mohammad; Weese, J Scott

    2014-02-05

    Clostridium difficile has been shown to be a nosocomial pathogen associated with diarrhoea and pseudomembranous colitis in hospitalised patients and the infection is believed to be acquired nosocomially. Recent studies have shown the occurrence of C. difficile in food animals which may act as a source of infection to humans.The aim of this study was to determine the occurrence of C. difficile in retail raw beef, cow, sheep, goat, camel and buffalo meat in Iran. From April to October 2012, a total of 660 raw meat samples from beef, cow, sheep, goat, camel and buffalo were purchased from 49 butcheries in Isfahan and Khuzestan provinces, Iran, and were evaluated for the presence of C. difficile using a method including selective enrichment in C. difficile broth, subsequent alcohol shock-treatment and plating onto C. difficile selective medium. C. difficile isolates were tested for the presence of toxin genes and were typed using PCR ribotyping. In this study, 13 of 660 meat samples (2%) were contaminated with C. difficile. The highest prevalence of C. difficile was found in buffalo meat (9%), followed by goat meat (3.3%), beef meat (1.7%), cow (0.94%) and sheep meat (0.9%). Seven of the 13C. difficile strains (53.9%) were positive for tcdA, tcdB and cdtB toxin genes and were classified as ribotype 078. Four strains (30.8%) were positive tcdA, and tcdB, and one strain (7.7%) was possessed only tcdB. The remaining isolate was non-toxigenic. Susceptibilities of 13C. difficile isolates were determined for 11 antimicrobial drugs using the disk diffusion assay. Resistance to clindamycin, gentamycin, and nalidixic acid was the most common finding. To our knowledge, the present study is the first report of the isolation of C. difficile from raw buffalo meat. This study indicates the potential importance of food, including buffalo meat, as a source of transmission of C. difficile to humans.

  7. Risk factors for antibiotic resistance in Campylobacter spp. isolated from raw poultry meat in Switzerland

    Directory of Open Access Journals (Sweden)

    Danuser Jürg

    2003-12-01

    Full Text Available Abstract Background The world-wide increase of foodborne infections with antibiotic resistant pathogens is of growing concern and is designated by the World Health Organization as an emerging public health problem. Thermophilic Campylobacter have been recognised as a major cause of foodborne bacterial gastrointestinal human infections in Switzerland and in many other countries throughout the world. Poultry meat is the most common source for foodborne cases caused by Campylobacter. Because all classes of antibiotics recommended for treatment of human campylobacteriosis are also used in veterinary medicine, in view of food safety, the resistance status of Campylobacter isolated from poultry meat is of special interest. Methods Raw poultry meat samples were collected throughout Switzerland and Liechtenstein at retail level and examined for Campylobacter spp. One strain from each Campylobacter-positive sample was selected for susceptibility testing with the disc diffusion and the E-test method. Risk factors associated with resistance to the tested antibiotics were analysed by multiple logistic regression. Results In total, 91 Campylobacter spp. strains were isolated from 415 raw poultry meat samples. Fifty-one strains (59% were sensitive to all tested antibiotics. Nineteen strains (22% were resistant to a single, nine strains to two antibiotics, and eight strains showed at least three antibiotic resistances. Resistance was observed most frequently to ciprofloxacin (28.7%, tetracycline (12.6%, sulphonamide (11.8%, and ampicillin (10.3%. One multiple resistant strain exhibited resistance to five antibiotics including ciprofloxacin, tetracycline, and erythromycin. These are the most important antibiotics for treatment of human campylobacteriosis. A significant risk factor associated with multiple resistance in Campylobacter was foreign meat production compared to Swiss meat production (odds ratio = 5.7. Conclusion Compared to the situation in other

  8. Fate of gamma-irradiated Listeria monocytogenes during refrigerated storage on raw or cooked turkey breast meat

    International Nuclear Information System (INIS)

    Thayer, D.W.; Boyd, G.; Kim, A.; Fox, J.B. Jr.; Farrell, H.M. Jr.

    1998-01-01

    The radiation resistance and ability of Listeria monocytogenes ATCC 7644, 15313, 43256, and 49594 to multiply on irradiated, air-packed, refrigerated raw or cooked turkey breast meat nuggets (ca. 25 g) and ground turkey breast meat was investigated. Gamma-radiation D values for L. monocytogenes were significantly different on raw and cooked nuggets, 0.56 +/- 0.03 kGy and 0.69 +/- 0.03 kGy, respectively; but they were not significantly different (P less than or equal to 0.05) on raw and cooked ground turkey meat. High populations (approximately 10(9) CFU/g) of L. monocytogenes declined during 14 days of storage at 4 degrees C in both irradiated and nonirradiated samples of raw but not of cooked ground turkey breast meat. A moderate inoculum (approximately 10(3) CFU/g) did not survive a radiation dose of 3 kGy. The population increased in cooked but not in raw samples of irradiated ground turkey meat stored at either 2 or 7 degrees C for 21 days. The D value changed significantly from 0.70 +/- 0.04 to 0.60 +/- 0.02 kGy when the product was cooked to an internal temperature of 80 degrees C before irradiation. Growth on either raw or cooked turkey meat did not alter the radiation resistance of L. monocytogenes. Analyses were performed for pH, a(w), moisture, and reducing potential of raw and cooked turkey meat and for pH, amino acid profile, thiamine, and riboflavin contents of aqueous extracts of raw and cooked turkey meats without identifying the factor or factors involved in differences in the survival and multiplication of L. monocytogenes on raw and cooked meat

  9. Occurrence and characterization of Shiga toxin-producing Escherichia coli in raw meat, raw milk, and street vended juices in Bangladesh.

    Science.gov (United States)

    Islam, Mohammad A; Mondol, Abdus S; Azmi, Ishrat J; de Boer, Enne; Beumer, Rijkelt R; Zwietering, Marcel H; Heuvelink, Annet E; Talukder, Kaisar A

    2010-11-01

    The major objective of this study was to investigate the prevalence of Shiga toxin (Stx)-producing Escherichia coli (STEC) in different types of food samples and to compare their genetic relatedness with STEC strains previously isolated from animal sources in Bangladesh. We investigated a total of 213 food samples, including 90 raw meat samples collected from retail butcher shops, 20 raw milk samples from domestic cattle, and 103 fresh juice samples from street vendors in Dhaka city. We found that more than 68% (n = 62) of the raw meat samples were positive for the stx gene(s); 34% (n = 21) of buffalo meats and 66% (n = 41) of beef. Approximately 10% (n = 2) of the raw milk and 8% (n = 8) of the fresh juice samples were positive for stx. We isolated STEC O157 from seven meat samples (7.8%), of which two were from buffalo meats and five from beef; and no other STEC serotypes could be isolated. We could not isolate STEC from any of the stx-positive raw milk and juice samples. The STEC O157 isolates from raw meats were positive for the stx(2), eae, katP, etpD, and enterohemorrhagic E. coli hly virulence genes, and they belonged to three different phage types: 8 (14.3%), 31 (42.8%), and 32 (42.8%). Pulsed-field gel electrophoresis (PFGE) typing revealed six distinct patterns among seven isolates of STEC O157, suggesting a heterogeneous clonal diversity. Of the six PFGE patterns, one was identical and the other two were ≥90% related to PFGE patterns of STEC O157 strains previously isolated from animal feces, indicating that raw meats are readily contaminated with fecal materials. This study represents the first survey of STEC in the food chain in Bangladesh.

  10. Flavour development in pork. Influence of flavour precursor concentrations in longissimus dorsi from pigs with different raw meat qualities

    DEFF Research Database (Denmark)

    Meinert, Lene; Tikk, Kaja; Tikk, Meelis

    2009-01-01

    Flavour development and overall eating quality of pan-fried pork chops of longissimus dorsi from eight different raw meat qualities aged for 4 and IS days were assessed by a trained sensory panel. The raw meat qualities were obtained through combinations of strategic feeding/fasting (control vs...... the differences in sensory perception of the pan-fried pork chops. Overall, the differences were small....

  11. Physico-chemical and microbiological properties of raw fermented sausages are not influenced by color differences of turkey breast meat.

    Science.gov (United States)

    Popp, J; Krischek, C; Janisch, S; Wicke, M; Klein, G

    2013-05-01

    It has been suggested that the color of turkey breast meat influences both physico-chemical and microbiological properties of raw fermented sausages. In this study, raw fermented sausages were produced with turkey breast meat in 3 different colors (pale, normal, or dark), which were obtained from 2 fast-growing-genetic-line toms at 2 slaughterhouses. Prior to the sausage production, the breast muscles were sorted into color groups according to the lightness values determined at 24 h postmortem. This meat was subsequently processed to raw fermented sausages using 1.5 or 2.5% curing salt (CS). The pale meat had higher lightness, electrical conductivity, and drip loss, whereas the dark meat showed a darker color only. The physico-chemical (pH, water activity), visual (lightness, redness), and microbial (total plate count) properties of the sausages were not influenced by the color of the turkey breast meat. The sausage made with 2.5% CS had lower aw and higher ash and hardness values than the sausages produced with 1.5% CS. In conclusion, processing of differently colored turkey meat to raw fermented sausages does not influence the quality characteristics of the products. Based on these findings, there is no reason for the sausage producer to separate turkey breast muscles by color before producing raw fermented sausages.

  12. The effect of changing the pre-slaughter handling on bovine cattle DFD meat

    Directory of Open Access Journals (Sweden)

    Cristina Pérez-Linares

    2015-09-01

    Full Text Available Objective. To evaluate the effect that a series of changes in the handling techniques used throughout the pre and post slaughter periods and during the handling of cooled carcass have on the presence of DFD (Dark, firm and dry meat. Materials and methods. Odds ratios (OR and confidence intervals were estimated applying logistic regression models. Data from 18 visits to the slaughterhouse regarding: animal handling on arrival, slaughter period, and carcass storage was obtained through the use of a questionnaire. A total of 572 carcasses were analyzed to determine DFD meat using pH and color (L*, a*, b* and C* measurements done on the Longissimus dorsi muscle. Results. Even after of the changes were made, the lairage period to slaughter continued to be a factor (p<0.05 associated to the presence of DFD meat (OR=1.13. Of the complementary variables, the amount of time that cattle spent on the resting pens was associated (p<0.05 to the presence of DFD meat (OR=1.003. Conclusions. Regardless of the changes made in the ante mortem handling, a high frequency of DFD was found (39%, suggesting a permanent audit program to detect other critical points in the supply chain.

  13. Fluoroquinolone residues in raw meat from open markets in Ibadan, Southwest, Nigeria

    Directory of Open Access Journals (Sweden)

    Adekunbi Bridget Omotoso

    2015-07-01

    Full Text Available Misuse of fluoroquinolones in livestock production may lead to the presence of their residues in tissues of meat animals after slaughter, constituting health hazards to consumers. The present study was designed to screen for residues of three fluoroquinolones (ciprofloxacin, norfloxacin and ofloxacin in raw meat. Microbiological assay, followed by High Performance Liquid Chromatography (HPLC was used to screen three hundred and twenty samples of beef, chicken, pork and chevon purchased from open markets. Initial screening by microbiological assay revealed that 50%, 55%, 40% and 40% of beef, chicken, pork and chevon, respectively were positive for residues of antibiotics. Further analysis by HPLC with UV detection revealed the presence of ciprofloxacin, norfloxacin and ofloxacin at varying concentrations in the meat samples. Ofloxacin was the least in frequency and abundance in all meat types. Results obtained in this study have implications for public health and will lead to steps that will further enhance the safety of animal foods in order to protect consumers and the animal production industry

  14. In vitro antimicrobial effect of Satureja wiedemanniana against Bacillus species isolated from raw meat samples.

    Science.gov (United States)

    Yucel, Nihal; Aslim, Belma; Ozdoğan, Hakan

    2009-08-01

    In this study a total of 30 raw meat samples obtained from Ankara, Turkey were screened for the presence of Bacillus species. Among the meat samples analyzed, the predominant species isolated was Bacillus circulans; other Bacillus species were identified as Bacillus firmus, Bacillus lentus, Bacillus megaterium, Bacillus licheniformis, Bacillus mycoides, Bacillus sphaericus, and Bacillus cereus. Minced meat samples were more contaminated with Bacillus species than sliced beef sample. From these samples, 242 Bacillus species isolates were obtained, which were investigated for proteolytic and lipolytic activity, associated with meat spoilage. Interestingly, some Bacillus strains produced the highest values of proteolytic/lipolytic activities. Nineteen Bacillus strains were selected among the 242 isolates according to their proteolytic/lipolytic activity with a clear zone diameter of > or =6 mm. The essential oil of Satureja wiedemanniana (Lalem) Velen was also tested against these 19 Bacillus species that had proteolytic and lipolytic activity. The essential oil yield obtained from the aerial parts of the plant was 0.35% (vol/wt). The inhibition zones of the essential oil obtained against all the Bacillus species were in the range of 5.0-12.0 mm. The oil showed high antimicrobial activities against B. licheniformis M 6(26), M 11(16), and M 12(1) strains. B. licheniformis 12(1) showed high lipolytic activity (18.0 mm). Also, B. licheniformis M 6(26) and M 11(16) showed high proteolytic activity (16.0 and 14.0 mm). These results may suggest that an essential oil of S. wiedemanniana can be used as a natural preservative in meat against spoilage bacteria.

  15. Campylobacter fetus meningitis associated with eating habits of raw meat and raw liver in a healthy patient: A case report and literature review.

    Science.gov (United States)

    Ishihara, Ayaka; Hashimoto, Etaro; Ishioka, Haruhiko; Kobayashi, Hiroyuki; Gomi, Harumi

    2018-01-01

    Meningitis caused by the zoonotic pathogen Campylobacter fetus in immunocompetent adults is rare. We report a 48-year-old Japanese woman with no underlying disease who was found to have meningitis caused by C. fetus . Both C. fetus subsp. fetus and C. fetus subsp. venerealis were isolated from the cerebrospinal fluid culture. The mode of infection in our patient was considered to be associated with the consumption of raw beef and raw cattle liver on a regular basis. Public awareness and education to avoid the consumption of raw or undercooked meat might help prevent C. fetus meningitis.

  16. Equipment for RAW handling, packaging, transport and storage from ZTS VVU KOSICE a.s

    International Nuclear Information System (INIS)

    Vargovcik, L.

    2004-01-01

    Since 1988, the company ZTS VVU KOSICE has devoted a great part of its activities to the development of equipment for RAW handling, packaging, transport and storage, mainly for application in the decommissioning of NPP A1 at Jaslovske Bohunice in Slovakia. This is a HWGCR NPP shut down following a breakdown in 1977. This incident was caused by disruption of the technological channel serving as a barrier between heavy water moderator and fuel assembly. Damage of this barrier enabled heavy water leakage into the primary circuit with partial fuel elements cladding damage and subsequent additional contamination of the primary circuit. During two consecutive years after the incident main effort was focused on activities related to personnel and environment protection, moderator draining, reactor defuelling, dry cleaning of the primary circuit, repair and maintenance of equipment. The next step was the preparation of the concept of NPP A-1 introduction into dry safe state. The order of importance of RAW liquidation was as follows: 1. Spent fuel - spent fuel assemblies from NPP A-1 were, after short cooling, stored temporarily in storage pipe containers filled at the beginning of NPP operation with ''chrompik'' (an aqueous solution of K 2 Cr 2 O 7 with concentration of 3-5%), later with ''dowtherm'' (mixture of bi-phenyl oxide and bi-phenyl). The containers were placed in a storage pond filled with water. 2. Liquid RAW - combustible (dowtherm, oils) and non-combustible (chrompik, Demi water, decontaminating solutions, sludge, sorbents, etc.) 3. Solid RAW - metallic and non-metallic For this purpose, it was necessary to build RAW processing lines, intermediate storage facilities and systems for manipulation and transport of RAW

  17. Antioxidant Effect of Extracts from the Coffee Residue in Raw and Cooked Meat

    Directory of Open Access Journals (Sweden)

    Ji-Hee Kim

    2016-07-01

    Full Text Available The residue of ground coffee obtained after the brewing process (spent coffee still contains various functional components with high antioxidant capacity and health benefits, but no attempts have been made to use it as a resource to produce value-added food ingredients. This study evaluates the antioxidant activity of ethanol or hot water extracts from the residues of coffee after brewing. An extraction experiment was carried out using the conventional solid–liquid methods, including ethanol and water as the extraction media at different temperatures and liquid/solid ratios. The antioxidant activity of extracts was tested for total phenolic compound (TPC, 2,2-diphenyl-1-picrylhydrazyl (DPPH, and 2-thiobarbituric acid reactive substances (TBARS using oil emulsion and raw/cooked meat systems. The DPPH radical scavenging activity of the ethanol extracts with heating (HEE and without heating (CEE were higher than that of the hot water extracts (WE. The highest DPPH value of HEE and CEE at 1000 ppm was 91.22% and 90.21%, respectively. In oil emulsion and raw/cooked systems, both the water and ethanol extracts had similar antioxidant effects to the positive control (BHA, but HEE and CEE extracts showed stronger antioxidant activities than WE extract. These results indicated that the ethanol extracts of coffee residue have a strong antioxidant activity and have the potential to be used as a natural antioxidant in meat.

  18. Prevalence and antimicrobial resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Ameri, Mehrdad; Kazemeini, Hamid Reza

    2010-04-01

    Campylobacter spp. are one of the most common causes of acute bacterial gastroenteritis in human beings which are transmitted mostly via food originating from animals. This study was conducted to determine the prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail raw meats in Iran. From June 2008 to June 2009, a total of 722 raw meat samples from camel (n = 107), beef (n = 190), lamb (n = 225), and goat (n = 180) were purchased from randomly selected retail outlets in Isfahan and Yazd, Iran, and were evaluated for the presence of Campylobacter spp. In this study, 50 of the 722 meat samples (6.9%) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in lamb meat (12.0%), followed by goat meat (9.4%), beef meat (2.4%), and camel meat (0.9%). The most prevalent Campylobacter spp. isolated from the meat samples was Campylobacter jejuni (84.0%); the remaining isolates were Campylobacter coli (16.0%). Susceptibilities of 50 Campylobacter isolates were determined for 10 antimicrobial drugs using the disk-diffusion assay. Resistance to tetracycline was the most common finding (68.0%), followed by resistance to ciprofloxacin (46.0%) and nalidixic acid (40.0%). All of the isolates were susceptible to erythromycin, gentamicin, and chloramphenicol. Significantly higher prevalence rates of Campylobacter spp. (p meat samples taken in spring (20.0%) and summer (18.9%). To our knowledge, this study is the first report of the isolation of Campylobacter spp. from raw camel, lamb, and goat meat in Iran.

  19. Efficient halal bleeding, animal handling, and welfare: A holistic approach for meat quality.

    Science.gov (United States)

    Aghwan, Z A; Bello, A U; Abubakar, A A; Imlan, J C; Sazili, A Q

    2016-11-01

    Traditional halal slaughter and other forms of religious slaughter are still an issue of debate. Opposing arguments related to pre-slaughter handling, stress and pain associated with restraint, whether the incision is painful or not, and the onset of unconsciousness have been put forward, but no consensus has been achieved. There is a need to strike a balance between halal bleeding in the light of science and animal welfare. There is a paucity of scientific data with respect to animal welfare, particularly the use of restraining devices, animal handling, and efficient halal bleeding. However, this review found that competent handling of animals, proper use of restraining devices, and the efficient bleeding process that follows halal slaughter maintains meat eating quality. In conclusion, halal bleeding, when carried out in accordance with recommended animal welfare procedures, will not only maintain the quality and wholesomeness of meat but could also potentially reduce suffering and pain. Maintained meat quality increases consumer satisfaction and food safety. Copyright © 2016. Published by Elsevier Ltd.

  20. Occurrence of Thermotolerant Campylobacter in Raw Poultry Meat, Environmental and Pigeon Stools Collected in Open-Air Markets.

    Science.gov (United States)

    Bellio, Alberto; Traversa, Amaranta; Adriano, Daniela; Bianchi, Daniela Manila; Colzani, Alberto; Gili, Stefano; Dondo, Alessandro; Gallina, Silvia; Grattarola, Carla; Maurella, Cristiana; Zoppi, Simona; Zuccon, Fabio; Decastelli, Lucia

    2014-08-28

    Campylobacteriosis was the most commonly reported zoonosis for confirmed human cases in European Union during 2011. Poultry meat was very often implicated in Campylobacter infections in humans. In Italy commerce of raw poultry meat is common in open-air markets: these areas can be considered at high risk of bacterial contamination due to the high presence birds like pigeons. The aim of this study was to collect data about the contamination by thermotolerant Campylobacter of raw poultry meat commercialised in open-air markets, of work-surfaces in contact with poultry meat and of pigeon stools sampled in the market areas in Turin, Northern Italy. Between September 2011 and December 2012, 86 raw poultry meat samples, 86 environmental swabs and 108 animal samples were collected in 38 open-air markets. Analysis were carried out according to ISO10272-1:2006 standard. C.coli was detected in 2.3% (2/86) of raw poultry meat samples, whereas no swab (0/86) resulted positive. Of pigeon stool 28% (30/107) was positive for C.jejuni (83.3% C.jejuni subsp . jejuni and 16.7% C.jejuni subsp . doylei ). C.jejuni subsp. jejuni was isolated from 1 dead pigeon . Our results showed lower rates of contamination than those reported at retail in Europe. Although samples were collected in areas at high risk of contamination, raw poultry meat and work surfaces reported a low level of presence of thermotolerant Campylobacter . The high percentage of C.jejuni isolated from pigeon stools showed the importance of a continuous application of preventive measures by the food business operators and the surveillance activity by the Competent Authority.

  1. Development of a Rapid Immunodiagnostic Test for Pork Components in Raw Beef and Chicken Meats: a Preliminary Study

    Directory of Open Access Journals (Sweden)

    S. N. Depamede

    2011-08-01

    Full Text Available A rapid immunodiagnostic test that provides visual evidence of the presence of pork components in raw beef and chicken meats was developed. Colloidal gold was prepared and conjugated with anti-Swine IgG polyclonal antibody. Immunochromatographic test strips were produced, and then were used to test laboratory adulterated raw meat samples. The samples consisted adulteration meat, immunodiagnostic, pork, rapid test of pork-in-beef, or pork-in-chicken at 1/0; 1/100; 1/1,000; 1/5,000; 1/10,000 (w/w adulteration levels that were extracted in phosphate-buffered saline. Raw beef and chicken meats without pork were included as controls. Analysis was completed in 10 min. Detection limit was 1/5,000 (w/w, although 1/10,000 was also observed. This immunodiagnostic tests can be conveniently applied to detect low levels of pork components in raw beef and chicken meat products. For the commercial purposes, further studies need to be carried out.

  2. Sheep pre-slaughter handling practices and their effect on meat quality

    Directory of Open Access Journals (Sweden)

    Francisco Gerardo Ríos-Rincón

    2013-06-01

    Full Text Available Aspects related to ovine production systems in Mexico were revisited, as well as the relationship between the transport and the ante-mortem handling with ovine welfare and pre slaughter operations. Animals stress evaluation is fundamental importance for this process, where the observation of animal behavior is basic to determinate and understands the scope of this biological phenomenon. Finally, we make reference to two of the main meat quality attributes that can be affected as consequence of non-appropriated handling practice and operations that implies the un-knowledge of animal conduct. The conclusion is that the handling practices previous to slaughter of ovine specie had a considerable influence on carcass quality. In Mexico is important to focus the cattle research on the productive systems improvement in consideration to animal welfare in the different productive process steps.

  3. Zoonotic bacteria and parasites found in raw meat-based diets for cats and dogs.

    Science.gov (United States)

    van Bree, Freek P J; Bokken, Gertie C A M; Mineur, Robin; Franssen, Frits; Opsteegh, Marieke; van der Giessen, Joke W B; Lipman, Len J A; Overgaauw, Paul A M

    2018-01-13

    Feeding raw meat-based diets (RMBDs) to companion animals has become increasingly popular. Since these diets may be contaminated with bacteria and parasites, they may pose a risk to both animal and human health. The purpose of this study was to test for the presence of zoonotic bacterial and parasitic pathogens in Dutch commercial RMBDs. We analysed 35 commercial frozen RMBDs from eight different brands. Escherichia coli serotype O157:H7 was isolated from eight products (23 per cent) and extended-spectrum beta-lactamases-producing E coli was found in 28 products (80 per cent). Listeria monocytogenes was present in 19 products (54 per cent), other Listeria species in 15 products (43 per cent) and Salmonella species in seven products (20 per cent). Concerning parasites, four products (11 per cent) contained Sarcocystis cruzi and another four (11 per cent) S tenella In two products (6 per cent) Toxoplasma gondii was found. The results of this study demonstrate the presence of potential zoonotic pathogens in frozen RMBDs that may be a possible source of bacterial infections in pet animals and if transmitted pose a risk for human beings. If non-frozen meat is fed, parasitic infections are also possible. Pet owners should therefore be informed about the risks associated with feeding their animals RMBDs. © British Veterinary Association (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  4. Comparison of the amounts of taste-related compounds in raw and cooked meats from broilers and Korean native chickens.

    Science.gov (United States)

    Jayasena, Dinesh D; Kim, Sun Hyo; Lee, Hyun Jung; Jung, Samooel; Lee, Jun Heon; Park, Hee Bok; Jo, Cheorun

    2014-12-01

    This study was aimed at comparing the taste-related compound content in the breast and leg meat from 100-d-old Korean native chickens (KNC-100) and 32-d-old commercial broilers (CB-32) and determining the changes in these compounds during cooking. Cocks from certified meat-type commercial broiler (Ross) and Korean native chicken (Woorimatdag) strains were raised under similar standard commercial conditions, and a total of 10 birds from each breed were slaughtered at 32 and 100 d of age, which represents their market ages, respectively. Raw and cooked meat samples were prepared separately from the breast and leg and analyzed. The KNC-100 showed significantly higher concentrations of inosine 5'-monophosphate, reducing sugars, glutamic acid, linoleic acid, arachidonic acid, and docosahexaenoic acid than CB-32 did. Additionally, significantly higher inosine 5'-monophosphate, cysteine, arachidonic acid, and docosahexaenoic acid concentrations were observed in the breast meat, whereas the leg meat had higher concentration of glutamic acid, oleic acid, and linoleic acid (P cooking process, except oleic and linoleic acids. We suggest that the higher levels of taste-related compounds present in KNC-100 meat compared with CB-32 meat may result in the unique taste of the former meat, as has been previously reported. In addition, the results of this study may provide useful information for selection and breeding programs. ©2014 Poultry Science Association Inc.

  5. Implications of white striping and wooden breast abnormalities on quality traits of raw and marinated chicken meat.

    Science.gov (United States)

    Mudalal, S; Lorenzi, M; Soglia, F; Cavani, C; Petracci, M

    2015-04-01

    One of the consequences of intense genetic selection for growth of poultry is the recent appearance of abnormalities in chicken breast muscles, such as white striping (characterised by superficial white striations) and wooden breast (characterised by pale and bulged areas with substantial hardness). The aim of this study was to evaluate the quality traits of chicken fillets affected by white striping and wooden breast abnormalities. In two replications, 192 fillets were divided into the following four classes: normal (n=48; absence of any visual defects), white striping (n=48, presence of white striations), wooden breast (n=48; diffusely presence of hardened areas) and white striping/wooden breast (n=48; fillets affected by both abnormalities). Morphology, raw meat texture and technological properties were assessed in both unprocessed (pH, colour, drip loss, cooking loss and cooked meat shear force) and marinated meat (marinade uptake, purge loss, cooking loss and cooked meat shear force). Fillets affected by white striping, wooden breast or both abnormalities exhibited higher breast weights compared with normal fillets (305.5, 298.7, 318.3 and 244.7 g, respectively; Pcooking losses than white-striped fillets for both unprocessed and marinated meats. On the other hand, white-striped fillets showed a moderate decline in marinade and cooking yield. Fillets affected by both abnormalities had the highest (Pcooked meat, drip loss, purge loss and cooked meat shear force were negligible or relatively low and of little practical importance. Thus, the presence of white striping and wooden breast abnormalities impair not only breast meat appearance but also the quality of both raw and marinated meats mainly by reducing water holding/binding abilities.

  6. Antioxidant Enzyme Activity, Iron Content and Lipid Oxidation of Raw and Cooked Meat of Korean Native Chickens and Other Poultry

    Directory of Open Access Journals (Sweden)

    Muhlisin

    2016-05-01

    Full Text Available This study was conducted to observe antioxidant enzyme activity, iron content and lipid oxidation of Korean native chickens and other poultry. The breast and thigh meat of three Korean native chicken breeds including Woorimatdak, Hyunin black and Yeonsan ogye, and three commercial poultry breeds including the broiler, White Leghorn and Pekin duck (Anasplatyrhyncos domesticus were studied. The analyses of the antioxidant enzymes activity, iron content and lipid oxidation were performed in raw and cooked samples. The activity of catalase (CAT in the thigh meat was higher than that of the breast meat of three Korean native chickens and the broiler, respectively. The activity of glutathione peroxidase (GPx in the uncooked thigh meat of three Korean native chickens was higher than that of the breasts. The breast meat of Woorimatdak and Pekin duck had higher superoxide dismutase (SOD activity than the others, while only the thigh meat of Pekin duck had the highest activity. Cooking inactivated CAT and decreased the activity of GPx and SOD. The thigh meat of Woorimatdak, White Leghorn, Yeonsan ogye and Hyunin black contained more total iron than the breast meat of those breeds. The heme-iron lost during cooking ranged from 3.2% to 14.8%. It is noted that the thigh meat had higher thiobarbituric acid reactive substances values than the breast in all chicken breeds. Though Woorimatdak showed higher antioxidant enzyme activity and lower released-iron percentage among Korean native chickens, no differences were found on lipid oxidation. We confirm that the dark meat of poultry exhibited higher antioxidant enzyme activity and contained more iron than the white meat.

  7. Isolation of Yersinia from raw meat (pork and chicken) and precooked meat (porcine tongues and sausages) collected from commercial establishments in Mexico City.

    Science.gov (United States)

    Ramírez, E I; Vázquez-Salinas, C; Rodas-Suárez, O R; Pedroche, F F

    2000-04-01

    A total of 160 meat product samples were collected from commercial outlets in Mexico City to investigate the presence of different species of Yersinia by the 4 degrees C enrichment method after 1, 3, 5, and 7 days of incubation using alkaline treatment and isolating in cefsulodin-Irgasan-novobiocin and MacConkey agars with Tween 80. Overall, Yersinia spp. were isolated from 27% of the samples analyzed, whereas 40% of the raw and only 13% of the precooked samples were contaminated. Although 2,970 colonies showed Yersinia characteristics, only 706 (24%) actually corresponded to this genus: 49% were Yersinia enterocolitica, 25% Yersinia kristensenii, 15% Yersinia intermedia, 9% Yersinia frederiksenii, and 2% Yersinia aldovae; 10% corresponded to biotype 2, 2% to biotype 3, and 4% to biotype 4. The presence of Yersinia in raw and cooked meat products represents a health risk for consumers in Mexico, where further clinical studies are needed to assess the epidemiological importance of this pathogen.

  8. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  9. Enzyme immunoassay and proteomic characterization of troponin I as a marker of mammalian muscle compounds in raw meat and some meat products.

    Science.gov (United States)

    Zvereva, Elena A; Kovalev, Leonid I; Ivanov, Alexei V; Kovaleva, Marina A; Zherdev, Anatoly V; Shishkin, Sergey S; Lisitsyn, Andrey B; Chernukha, Irina M; Dzantiev, Boris B

    2015-07-01

    The skeletal muscle protein troponin I (TnI) has been characterized as a potential thermally stable and species-specific biomarker of mammalian muscle tissues in raw meat and meat products. This study proposed a technique for the quantification of TnI comprising protein extraction and sandwich enzyme-linked immunosorbent assay (ELISA). The technique is characterized by a TnI detection limit of 4.8 ng/ml with quantifiable concentrations ranging from 8.7 to 52 ng/ml. The method was shown to be suitable for detection of TnI in mammalian (beef, pork, lamb, and horse) meat but not in poultry (chicken, turkey, and duck) meat. In particular, the TnI content in beef was 0.40 3 ± 0.058 mg/g of wet tissue. The TnI estimations obtained for the pork and beef samples using ELISA were comparable to the proteomic analysis results. Thus, the quantitative study of TnI can be a convenient way to assess the mammalian muscle tissue content of various meat products. Copyright © 2015. Published by Elsevier Ltd.

  10. Effect of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat during refrigerated storage.

    Science.gov (United States)

    Devatkal, Suresh K; Naveena, B M

    2010-06-01

    Effects of salt, kinnow and pomegranate fruit by-product powders on color and oxidative stability of raw ground goat meat stored at 4+/-1 degrees C was evaluated. Five treatments evaluated include: control (only meat), MS (meat+2% salt), KRP (meat+2% salt+2% kinnow rind powder), PRP (meat+2% salt+2% pomegranate rind powder) and PSP (meat+2% salt+2% pomegranate seed powder). Addition of salt resulted in reduction of redness scores. Lightness increased in control and unchanged in others during storage. Redness scores declined and yellowness showed inconsistent changes during storage. Thiobarbituric acid reactive substances (TBARS) values were higher (PPRP>KRP>control>MS. Therefore, these powders have potential to be used as natural antioxidants to minimize the auto-oxidation and salt induced lipid oxidation in raw ground goat meat. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

  11. Effects of Tannic Acid on Lipid and Protein Oxidation, Color, and Volatiles of Raw and Cooked Chicken Breast Meat during Storage

    Directory of Open Access Journals (Sweden)

    Marwan Al-Hijazeen

    2016-06-01

    Full Text Available The objective of this study was to determine the effect of tannic acid (TA on the oxidative stability and the quality characteristics of ground chicken breast meat. Five treatments including (1 control (none added, (2 2.5 ppm TA, (3 5 ppm TA, (4 10 ppm TA, and (5 5 ppm butylated hydroxyanisole (BHA were added to boneless, skinless ground chicken breast meat, and used for both raw and cooked meat studies. For the raw meat study, the ground chicken breast meat was packaged in oxygen-permeable bags and stored at 4 °C for 7 days. For the cooked study, raw ground meat samples were vacuum-packaged in oxygen-impermeable vacuum bags, cooked in-bag to the internal temperature of 75 °C, re-packaged in oxygen-permeable bags, and then stored. Both raw and cooked meats were analyzed for lipid and protein oxidation, color, and volatiles (cooked meat only at 0, 3, and 7 days of storage. Raw meats with 10 ppm of TA added had significantly (p ≤ 0.05 lower lipid and protein oxidation than other treatments during storage. In addition, TA at 10 ppm level maintained the highest color a*- and L*-values during storage. Cooked chicken breast meat with 5 and 10 ppm TA added produced significantly (p ≤ 0.05 lower amounts of off-odor volatiles than other treatments. Among the volatile compounds, the amount of hexanal increased rapidly during storage for cooked meat. However, meats with 5 and 10 ppm TA added showed the lowest amount of hexanal and other aldehydes related to lipid oxidation, indicating a strong antioxidant effect of TA in cooked chicken breast meat. Furthermore, the differences in aldehydes among the treatments were bigger in cooked than in raw meat, indicating that the antioxidant effect of TA in cooked meat was greater than that in raw meat. Therefore, TA at >5 ppm can be used as a good natural preservative in cooked chicken meat to maintain its quality during storage.

  12. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia.

    Science.gov (United States)

    Thung, T Y; Mahyudin, N A; Basri, D F; Wan Mohamed Radzi, C W J; Nakaguchi, Y; Nishibuchi, M; Radu, S

    2016-08-01

    Salmonellosis is one of the major food-borne diseases in many countries. This study was carried out to determine the occurrence of Salmonella spp., Salmonella Enteritidis, and Salmonella Typhimurium in raw chicken meat from wet markets and hypermarkets in Selangor, as well as to determine the antibiotic susceptibility profile of S. Enteritidis and S. Typhimurium. The most probable number (MPN) in combination with multiplex polymerase chain reaction (mPCR) method was used to quantify the Salmonella spp., S. Enteritidis, and S. Typhimurium in the samples. The occurrence of Salmonella spp., S. Enteritidis, and S. Typhimurium in 120 chicken meat samples were 20.80%, 6.70%, and 2.50%, respectively with estimated quantity varying from retail chicken meat could be a source of multiple antimicrobial-resistance Salmonella and may constitute a public health concern in Malaysia. © 2016 Poultry Science Association Inc.

  13. Valorization of functional properties of extract and powder of olive leaves in raw and cooked minced beef meat.

    Science.gov (United States)

    Aouidi, Fathia; Okba, Aicha; Hamdi, Moktar

    2017-08-01

    Olive leaves (OL), available in huge amounts from pruning, are known to be a useful source of biologically active compounds. This study investigated the potential application of OL as a supplement to minced beef meat in order to develop a functional product. The effect of OL extract or powder (100 and 150 µg phenols g -1 meat) on the quality and stability of raw and cooked meat during refrigerated storage was examined. Microwave drying at 600 W gave OL with the highest antioxidant quality (evaluated by TEAC/[phenols] (mg mg -1 ) and DPPH/[phenols] (mg mg -1 )) compared with other methods. OL showed an ability to inhibit (P production was 43-65% in control samples and 14-35% in treated samples). OL also improved the technological quality of the meat, decreasing (P functional meat products of good technological quality that remain stable during storage. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  14. The physicochemical properties and antioxidative potential of raw thigh meat from broilers fed a dietary medicinal herb extract mixture

    Directory of Open Access Journals (Sweden)

    K. Shirzadegan

    2014-07-01

    Full Text Available A 6-wk feeding study was conducted to evaluate the antioxidative potential, indices such as quality of the thigh meat and liver of broiler chickens fed with a dietary medicinal herb extract mixture (HEM, consisting: Iranian green tea, cinnamon, garlic and chicory at a ratio of 25:15:45:15. A total of 320, one-d-old Ross (male broiler chickens were used to investigate the effects of 0.0, 2.5, 5.0 and 7.5 g/kg HEM in the diet, on aforementioned factors. The HEM supplementation did not influence the composition of raw thigh meat except for the total phenols and crude ash (P<0.05. Furthermore, pH, water-holding capacity (WHC and acceptability of thigh meat were affecting by administration of HEM in diets (P<0.05. Meat flavor increased in the supplemented groups (P<0.05. According to our data, HEM supplementation decreased the amount of thiobarbituric acid reactive substance (TBARS in various times of storage and improved the liver lipid peroxides and superoxide dismutase (SOD activities at week 6 (P<0.05, but did not influence the catalase activity. Our results reveal that the addition of 7.5 g/kg or higher HEM in diet could be sufficient to increase the antioxidative activity and 2.5 g/kg for meat taste of broilers in maximum levels.

  15. Omega-3 fatty acids, nutrient retention values, and sensory meat eating quality in cooked and raw Australian lamb.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    This study evaluated omega-3 intramuscular fatty acids in the longissimus thoracis et lumborum of commercially prepared Australian lamb loin chops. Meats, denuded of external fats were cooked by means of conductive dry-heat using a fry grilling hot plate, to a core temperature of 70°C. An untrained consumer panel assessed meat appearance, aroma, tenderness, juiciness, taste and overall liking. Results showed no compositional alterations (P>0.05) to omega-3 fatty acids due to cooking treatment, whereas on absolute terms (mg/100g muscle) omega-3 fatty acids significantly (Pcooked meat at 32.8±2.3mg/100g muscle exceeded the minimum 30mg/100g per edible portion required for the defined Australian classification as 'source' long-chain (≥C 20 ) omega-3 for cooked lamb. A 3.4% intramuscular fat content in the initial raw meat was sufficient to maintain acceptable overall sensory eating quality. Results endorse the application of this cooking method to enable delivery of health beneficial long-chain omega-3 fatty acids of commercially prepared Australian lamb loin chops to consumers without impediments to sensory eating properties. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Quantification of meat proportions by measuring DNA contents in raw and boiled sausages using matrix-adapted calibrators and multiplex real-time PCR.

    Science.gov (United States)

    Köppel, René; Eugster, Albert; Ruf, Jürg; Rentsch, Jürg

    2012-01-01

    The quantification of meat proportions in raw and boiled sausage according to the recipe was evaluated using three different calibrators. To measure the DNA contents from beef, pork, sheep (mutton), and horse, a tetraplex real-time PCR method was applied. Nineteen laboratories analyzed four meat products each made of different proportions of beef, pork, sheep, and horse meat. Three kinds of calibrators were used: raw and boiled sausages of known proportions ranging from 1 to 55% of meat, and a dilution series of DNA from muscle tissue. In general, results generated using calibration sausages were more accurate than those resulting from the use of DNA from muscle tissue, and exhibited smaller measurement uncertainties. Although differences between uses of raw and boiled calibration sausages were small, the most precise and accurate results were obtained by calibration with fine-textured boiled reference sausages.

  17. Evaluation of hygiene practices and microbiological quality of cooked meat products during slicing and handling at retail.

    Science.gov (United States)

    Pérez-Rodríguez, F; Castro, R; Posada-Izquierdo, G D; Valero, A; Carrasco, E; García-Gimeno, R M; Zurera, G

    2010-10-01

    Cooked meat ready-to-eat products are recognized to be contaminated during slicing which, in the last years, has been associated with several outbreaks. This work aimed to find out possible relation between the hygiene practice taking place at retail point during slicing of cooked meat products in small and medium-sized establishments (SMEs) and large-sized establishments (LEs) and the microbiological quality of sliced cooked meat products. For that, a checklist was drawn up and filled in based on scoring handling practice during slicing in different establishments in Cordoba (Southern Spain). In addition, sliced cooked meats were analyzed for different microbiological indicators and investigated for the presence of Listeria spp. and Listeria monocytogenes. Results indicated that SMEs showed a more deficient handling practices compared to LEs. In spite of these differences, microbiological counts indicated similar microbiological quality in cooked meat samples for both types of establishments. On the other hand, Listeria monocytogenes and Listeria inocua were isolated from 7.35% (5/68) and 8.82% (6/68) of analyzed samples, respectively. Positive samples for Listeria spp. were found in establishments which showed acceptable hygiene levels, though contamination could be associated to the lack of exclusiveness of slicers at retail points. Moreover, Listeria spp presence could not be statistically linked to any microbiological parameters; however, it was observed that seasonality influenced significantly (Phygiene practices, focused specially on SMEs. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  18. Designing a time-effective TaqMan probe-based real-time polymerase chain reaction protocol for the identification of Yersinia enterocolitica in raw pork meat

    Directory of Open Access Journals (Sweden)

    Milena Alicja Stachelska

    2017-01-01

    Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.

  19. Effect of chosen lactic acid bacteria strains on Staphylococcus aureus in vitro as well as in meat and raw sausages.

    Science.gov (United States)

    Gomółka-Pawlicka, M; Uradziński, J; Wiszniewska, A

    2004-01-01

    The present study was aimed at determining the influence of 15 strains of lactic acid bacteria on the growth of 2 Staphylococcus aureus strains in vitro as well as in meat and raw sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus sp. strains and, partly, methodological approach. The study also considered water activity (a(w)) and pH of the products investigated. The results obtained are demonstrated in 5 diagrams. It was found that among 15 strains of Lactobacillus aureus investigated only one strain, Lactobacillus helveticus T 78, showed antagonistic effect on studied strains of Staphylococcus aureus both in vitro as well as in meat and raw sausages. Five other strains of Lactobacillus spp. displayed the antagonistic effect in vitro only. The temperature and incubation time of sausages, but also the type of sausage stuffing were found to have a distinct or slight influence, respectively, on the antagonistic interaction between the bacteria. However, this phenomenon was affected by neither a(w) nor pH.

  20. Prevalence and antibiotic resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

    Science.gov (United States)

    Pesavento, G; Calonico, C; Ducci, B; Magnanini, A; Lo Nostro, A

    2014-08-01

    Food specimens were analyzed in order to research Enterococcus spp.: 636 samples of raw meat (227 beef, 238 poultry, and 171 pork), 278 samples of cheese (110 fresh soft cheese and 168 mozzarella cheese), 214 samples of ready-to-eat salads, and 187 samples of ham. 312 strains of Enterococcus spp samples were isolated, then identified and submitted to susceptibility tests against 11 antimicrobial agents. The predominant species were Enterococcus faecalis in raw meat and Enterococcus faecium in retail products. Low percentages of microorganisms were resistant to vancomycin (3.53%), teicoplanin (2.24%), linezolid (0.32%), and amoxicillin in combination with clavulanic acid (0.32%). A high percentage of resistance was noted in E. faecalis at high level gentamicin (21.9%) and tetracycline (60.6%). In general, strains of E. faecalis were more resistant than E. faecium. Enterococci should be considered not only potential pathogens, but also a reservoir of genes encoding antibiotic resistance which can be transferred to other microorganisms. Continuous monitoring of their incidence and emerging resistance is important in order to identify foods which potentially represent a real risk to the population, and to ensure effective treatment of human enterococcal infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Consumer knowledge, storage, and handling practices regarding Listeria in frankfurters and deli meats: results of a Web-based survey.

    Science.gov (United States)

    Cates, Sheryl C; Morales, Roberta A; Karns, Shawn A; Jaykus, Lee-Ann; Kosa, Katherine M; Teneyck, Toby; Moore, Christina M; Cowen, Peter

    2006-07-01

    Proper storage and handling of refrigerated ready-to-eat foods can help reduce the risk of listeriosis. A national Web-based survey was conducted to measure consumer awareness and knowledge of Listeria and to estimate the prevalence of the U.S. Department of Agriculture-recommended consumer storage and handling practices for frankfurters and deli meats. The demographic characteristics of consumers who are unaware of Listeria and who do not follow the recommended storage guidelines were also assessed. In addition, predictive models were developed to determine which consumers engage in risky storage practices. Less than half of the consumers surveyed were aware of Listeria, and most of those aware were unable to identify associated food vehicles. Awareness was lower among adults 60 years of age and older, an at-risk population for listeriosis, and individuals with relatively less education and lower incomes. Most households safely stored and prepared frankfurters. Most households stored unopened packages of vacuum-packed deli meats in the refrigerator within the U.S. Department of Agriculture-recommended storage guidelines (deli meats and freshly sliced deli meats for longer than the recommended time (< or =5 days). Men, more-educated individuals, and individuals living in metropolitan areas were more likely to engage in risky storage practices. This study identified the need to develop targeted educational initiatives on listeriosis prevention.

  2. Prevalence and antimicrobial susceptibility of Salmonella isolated from a variety of raw meat sausages in Gaborone (Botswana) retail stores.

    Science.gov (United States)

    Samaxa, Ronald Gaelekolwe; Matsheka, Maitshwarelo Ignatius; Mpoloka, Sununguko Wata; Gashe, Berhanu Abegaz

    2012-04-01

    The objective of the study was to provide baseline data on the prevalence and antimicrobial susceptibility of Salmonella in different types of raw meat sausages directly accessible to the consumers in Gaborone, Botswana. A total of 300 raw sausages comprising 79 beef, 78 pork, 72 chicken, and 71 mutton samples were concurrently analyzed for the presence of Salmonella using a conventional culture method and a validated PCR method. The PCR assay results were in full concordance with those of the conventional culture method for the detection of Salmonella. Sixty-five (21.7%) of 300 samples were positive for Salmonella by both the conventional culture method and PCR assay. Even though more chicken samples contained Salmonella than did any other sausage type, the difference in the presence of Salmonella among the four sausages types was not significant. Eleven serotypes were identified, and Salmonella enterica subsp. salamae II was most prevalent in all the sausage types. Beef sausages generally had higher mesophilic bacterial counts than did the other three sausage types. However, higher microbial counts were not reflective of the presence of salmonellae. Susceptibility of the Salmonella enterica serotypes to 20 antimicrobial agents was determined, and Salmonella Muenchen was resistant to the widest array of agents and was mostly isolated from chicken sausages. Regardless of the meat of origin, all 65 Salmonella isolates were resistant to at least four antimicrobial agents: amikacin, gentamicin, cefuroxime, and tombramycin. This resistance profile group was the most common in all four sausage types, comprising 90% of all Salmonella isolates from beef, 71% from pork, 63% from mutton, and 35% from chicken. These results suggest that raw sausages pose a risk of transmitting multidrug-resistant Salmonella isolates to consumers.

  3. Compared with Raw Bovine Meat, Boiling but Not Grilling, Barbecuing, or Roasting Decreases Protein Digestibility without Any Major Consequences for Intestinal Mucosa in Rats, although the Daily Ingestion of Bovine Meat Induces Histologic Modifications in the Colon.

    Science.gov (United States)

    Oberli, Marion; Lan, Annaïg; Khodorova, Nadezda; Santé-Lhoutellier, Véronique; Walker, Francine; Piedcoq, Julien; Davila, Anne-Marie; Blachier, François; Tomé, Daniel; Fromentin, Gilles; Gaudichon, Claire

    2016-08-01

    Cooking may impair meat protein digestibility. When undigested proteins are fermented by the colon microbiota, they can generate compounds that potentially are harmful to the mucosa. This study addressed the effects of typical cooking processes and the amount of bovine meat intake on the quantity of undigested proteins entering the colon, as well as their effects on the intestinal mucosa. Male Wistar rats (n = 88) aged 8 wk were fed 11 different diets containing protein as 20% of energy. In 10 diets, bovine meat proteins represented 5% [low-meat diet (LMD)] or 15% [high-meat diet (HMD)] of energy, with the rest as total milk proteins. Meat was raw or cooked according to 4 processes (boiled, barbecued, grilled, or roasted). A meat-free diet contained only milk proteins. After 3 wk, rats ingested a (15)N-labeled meat meal and were killed 6 h later after receiving a (13)C-valine injection. Meat protein digestibility was determined from (15)N enrichments in intestinal contents. Cecal short- and branched-chain fatty acids and hydrogen sulfide were measured. Intestinal tissues were used for the assessment of protein synthesis rates, inflammation, and histopathology. Meat protein digestibility was lower in rats fed boiled meat (94.5% ± 0.281%) than in the other 4 groups (97.5% ± 0.0581%, P HMD) and on myeloperoxidase activity in the proximal colon (HMD > LMD), but not on other outcomes. The ingestion of bovine meat, whatever the cooking process and the intake amount, resulted in discrete histologic modifications of the colon (epithelium abrasion, excessive mucus secretion, and inflammation). Boiling bovine meat at a high temperature (100°C) for a long time (3 h) moderately lowered protein digestibility compared with raw meat and other cooking processes, but did not affect cecal bacterial metabolites related to protein fermentation. The daily ingestion of raw or cooked bovine meat had no marked effect on intestinal tissues, despite some slight histologic modifications

  4. Raw mechanically separated chicken meat and salmon protein hydrolysate as protein sources in extruded dog food

    DEFF Research Database (Denmark)

    Tjernsbekk, M. T.; Tauson, A. H.; Kraugerud, O. F.

    2017-01-01

    Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein...

  5. THE USAGE OF ANIMAL AND VEGETABLE ORIGIN RAW MATERIALS COMBINATORICS IN MEAT PRODUCTS OF “HALAL†CATEGORY DEVELOPMENT

    OpenAIRE

    Ivan F. Gorlov; Oksana B. Gelunova; Tatiana M. Giro; Ekaterina P. Mirzayanova

    2014-01-01

    Integrated researches aimed to develop technologies and recipes for meat products of “Halal†category using seed fat and Milk Protein-Carbohydrate Concentrate (MPCC) represent a new generation of scientific and practical interest. In this connection, the authors propose technologies and recipes for meat products of “Halal†category, designed on the basis of rational combinatorics of animal and vegetable origin raw materials, that l...

  6. 'Prevalence and antimicrobial susceptibility of Listeria monocytogenes and methicillin-resistant Staphylococcus aureus strains from raw meat and meat products in Zaria, Nigeria.

    Science.gov (United States)

    Ndahi, M D; Kwaga, J K P; Bello, M; Kabir, J; Umoh, V J; Yakubu, S E; Nok, A J

    2014-03-01

    The bacterial genera Listeria and Staphylococcus have been frequently isolated from food products and are responsible for a number of animal and human diseases. The aim of the study was to simultaneously isolate and characterize L. monocytogenes and Staphylococcus species from 300 samples of raw meat and meat products, to determine the susceptibility of the organisms to commonly used antimicrobial agents and to determine the presence of haemolysin A (hyl) virulence gene in L. monocytogenes and staphylococcal cassette chromosome mecA (SCCmec) gene in the Staph. aureus isolates using PCR. Of the 85 Listeria isolates tested, 12 L. monocytogenes were identified and tested for their sensitivity to 14 antimicrobial agents. All the 12 isolates (100%) were resistant to nine antimicrobial agents, but however sensitive to gentamicin. Only one isolate was found to harbour the hylA gene. Twenty-nine isolates were confirmed as Staph. aureus by the Microbact 12S identification system and were all presumptively identified as methicillin-resistant Staph. aureus species using oxacillin-resistant Staph. aureus basal medium (ORSAB). The 29 Staph. aureus isolates were tested for their sensitivity to 16 antimicrobial agents, and 11 were resistant to methicillin. None of the 11 Staph. aureus isolates harboured the methicillin resistance, mecA gene. Listeria monocytogenes and Staphylococcus aureus are important agents of foodborne diseases. Occurrence of these infectious agents was established in meat and meat products in Zaria, Nigeria. Majority of isolates obtained from this study, displayed multidrug resistance to commonly used antimicrobial agents, including methicillin resistance among the Staph. aureus isolates. The potential virulence of L. monocytogenes found in ready-to-eat food was documented by the carriage of hly A gene by one of the isolates. A different mechanism of methicillin resistance or different homologue of mec A gene may be circulating among Nigerian

  7. Presence of Staphylococcus aureus and Shiga Toxigenic Escherichia coli O157:H7 in Raw Meat in Ağrı, Turkey

    Directory of Open Access Journals (Sweden)

    Naim Deniz Ayaz

    2016-08-01

    Full Text Available Background: Staphylococcus aureus and Shiga toxin producing Escherichia coli O157:H7 (EHEC are significant foodborne pathogens worldwide. While S. aureus can cause mild superficial skin infections or life-threatening bacteremia and endocarditis, as well as toxininduced cases such as toxic shock syndrome; E. coli O157:H7 can cause symptoms from mild diarrhea to severe hemorrhagic colitis (HC, hemolytic uremic syndrome (HUS, thrombotic thrombocytopenic purpura (TTP. Objectives: The objectives of this study were to find out the prevalence and seasonal distribution of S. aureus in 214 frozen raw meat (turkey, chicken and beef and the prevalence of E. coli O157:H7 in 70 raw beef with the characterization of the E. coli O157:H7 isolate by multiplex polymerase chain reaction (PCR. Materials and Methods: For the detection of S. aureus, a total of 214 frozen raw meat samples including 74 turkey meat, 70 chicken meat and 70 beef cuts (approximately 2 × 3 cm cubic parts; and for the detection of E. coli O157:H7, a total of 70 frozen raw beef samples that all were produced from national companies and consumed in Ağrı, Turkey were analyzed. Results: Out of 214 meat samples, 25.7 % (18/70 of the beef, 11.4 % (8/74 of the chicken meat, and 5.4 % (4/70 of the turkey meat samples were contaminated with S. aureus. Out of 70 frozen raw beef samples, only 1 (1.4% was identified as both Shiga toxin 1 and 2producing E. coli O157:H7 by the detection of stx1, stx2, eaeA, hly, and fliCh7 according to multiplex PCR analysis. Conclusion: Our findings demonstrate that occurrence frequency of S. aureus was higher in frozen raw beef than in raw chicken and turkey meat samples. Although the prevalence of E. coli O157:H7 was low in beef, the presence of virulence genes, especially toxin genesrema in a significant public health concern.

  8. Immunomagnetic separation and conventional culture procedure for detection of naturally occurring Salmonella in raw pork sausages and chicken meat.

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Ruberto, A; Iannitto, G; Grasso, G M

    1997-06-01

    The aim of the study was to compare immunomagnetic separation (IMS) and conventional selective enrichment procedures using selenite cystine broth (SC) and Rappaport-Vassiliadis broth (RV) in 137 naturally contaminated food samples (69 raw pork sausages and 68 chicken meat). The utilization of SC or IMS appeared to be the most appropriate enrichment procedure: 15 out of 18 Salmonella-positive samples (83.3%) were detected by SC and 12 (66.7%) by IMS; RV yielded only seven positive isolations (38.9%). However, RV yielded the highest count of Salmonella colonies per plate and the lowest interference by competing organisms. IMS could become a reliable alternative to standard enrichment procedures and a combined IMS and selective enrichment broth could increase the chance of Salmonella recovery.

  9. Impact of rearing conditions on the microbiological quality of raw retail poultry meat.

    Science.gov (United States)

    Hardy, Bridgshe; Crilly, Nate; Pendleton, Sean; Andino, Ana; Wallis, Audra; Zhang, Nan; Hanning, Irene

    2013-08-01

    There is a gap in knowledge of microbiological quality in raw chicken products produced by nonconventional methods and no studies have reported the microbiological quality of turkeys produced under different rearing environments. Thus, the aim of this study was to compare the microbiological quality of conventionally and organically reared whole chicken and turkey carcasses purchased from 3 retail outlets in Knoxville, Tenn., U.S.A. A total of 100 raw broiler chickens organically (n = 50) and 50 raw turkey carcasses consisting of 3 brands reared either conventionally (n = 25) or organically (n = 25) were evaluated. The FDA BAM protocol for rinsing poultry carcasses was used to enumerate of aerobic bacteria, Campylobacter, and Staphylococcus spp., and for qualitative analysis of Salmonella. Organic chickens from one brand had the highest average counts of aerobic bacteria, Staphylococcus spp. and Campylobacter (4.8, 4.8, and 4.7 Log10 CFU/mL rinsate, respectively) while the other organic brand had the lowest average counts (3.4, 3.3, and 3.1, respectively) of all 4 brands evaluated. The organic turkeys had the highest average counts of these same bacteria (4, 3.9, and 3.8, respectively) compared to the 2 brands of conventional turkeys evaluated. Salmonella (5% prevalence) was isolated only from organic chickens and turkeys. From these data, it appears that the microbiological quality of the raw product was not dependent on rearing conditions and, thus, it cannot be assumed that organic raw poultry is safer than conventionally raised poultry in terms of microbiological quality. © 2013 Institute of Food Technologists®

  10. Effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits.

    Science.gov (United States)

    Liao, Kuoyao; Cai, Jingyi; Shi, Zhujun; Tian, Gang; Yan, Dong; Chen, Delin

    2017-06-01

    This study was conducted to investigate the effects of raw material extrusion and steam conditioning on feed pellet quality and nutrient digestibility of growing meat rabbits, in order to determine appropriate rabbit feed processing methods and processing parameters. In Exp. 1, an orthogonal design was adopted. Barrel temperature, material moisture content and feed rate were selected as test factors, and acid detergent fiber (ADF) content was selected as an evaluation index to research the optimum extrusion parameters. In Exp. 2, a two-factor design was adopted. Four kinds of rabbit feeds were processed and raw material extrusion adopted optimum extrusion parameters of Exp. 1. A total of 40 healthy and 42-day-old rabbits with similar weight were used in a randomized design, which consisted of 4 groups and 10 replicates in each group (1 rabbits in each replicate). The adaptation period lasted for 7 d, and the digestion trial lasted for 4 d. The results showed as follows: 1) ADF was significantly affected by barrel temperature ( P  digestibility of dry matter and total energy ( P  digestibility of crude fiber (CF), ADF and NDF ( P  digestibility of rabbit feed. Thus, using extrusion and steam conditioning technology at the same time in the weaning rabbits feed processing can improve the pellet quality and nutrient apparent digestibility of rabbit feed.

  11. Effect of type of suckling and polyunsaturated fatty acid use on lamb production. 2. Chemical and fatty acid composition of raw and cooked meat

    Directory of Open Access Journals (Sweden)

    Francesco Toteda

    2010-01-01

    Full Text Available This study was carried out in order to examine the chemical and fatty acid composition of raw and cooked meat obtained fromlambs raised under mothers or reared by artificial suckling with acidified milk replacers with or without polyunsaturated fattyacid (PUFA supplementation. Meat samples were taken from twenty Gentile di Puglia male lambs subjected to the followingfeeding treatments: the control group received only maternal milk (MM, n.=6 while two groups were reared by artificial sucklingwith an acidified milk replacer (MR, n.=7 or with an acidified milk replacer supplemented with 10 ml/l of a PUFA enrichedoil (MR+PUFA, n.=7. Lambs were slaughtered at 45 days of age. After 24 hours of refrigeration at 4 °C, the lumbar regionwas dissected from each right half-carcass and split into pieces, one of which was used raw while the other was cooked in aventilated electric oven at 180 °C until an internal temperature of 75 °C was reached. Chemical and fatty acid analysis wereperformed on raw and cooked meat, while only raw meat was assessed for cholesterol. Cooking losses were also evaluated.Meat obtained from MR+PUFA fed lambs contained more fat (Punder mothers increased the total amount of saturated fatty acids (SFA, compared with both the MR group (Pthe MR+PUFA one (Pcomparison with both MR diets. The highest PUFA/SFA ratio of meat was recorded for the MR+PUFA group (0.27, with statisticaldifferences respect to the MR group (0.21; Pmilk produced meat containing more cholesterol than the MR+PUFA group (85.89 vs 76.26 mg/100 g; Pindex of meat was higher following natural rearing in comparison with the MR+PUFA treatment (1.34 vs 1.05;Pand 0.76, respectively; Pparameters evaluated. In conclusion, artificial suckling with acidified milk replacers improves some meat quality features.Supplementation of milk replacers with PUFAs, although in a limited way, may improve the dietetic properties of lamb meat.

  12. Research on the Sensorial Quality and Economic Efficiency in Obtaining of a certain Raw Meat Product - Mici Paste

    Directory of Open Access Journals (Sweden)

    Claudiu-Dan Salagean

    2013-11-01

    Full Text Available Research aimed the sensorial quality connected with the economic efficiency to obtain a certain raw meat product (mici paste in 4 experimental variants: 1 and 3 variants, with animal raw materials (meat + bacon and mix of natural spices - fine grinding variant (1 and coarse grinding variant (3 - chopping at the volf through the sieve of 3-4 mm; 2 and 4 variants, with animal raw materials (meat + bacon + vegetable protein supplements (textured soy protein + binder (protein + fiber + additive mix - fine grinding variant (2 and coarse grinding variant (4 - chopping at the volf through the sieve of 3 - 4 mm. In this respect organoleptic analyzes were performed on appearance (exterior and section, color, smell, texture and taste of the finished product (after roasting, the results highlighting that, in terms of organoleptic, sample 1 obtained the highest score (on a scale of 1-poor to 5-very good quality (average 21.83, followed by sample 3 (average 19.22, the very small difference in the case of sample 2 (average 19.19 and finally, sample 4 (average 18.75. It was noted that sample 1 obtained the highest score (average of all analyzed organoleptic indicators: appearance (4.33, color (4.39, smell (4.67, texture (4.33 and taste (4.11 being favorite by all volunteer subjects who participated at the analysis. The same thing was found in sensory analysis of mici paste in fresh/chilled condition: 65% of subjects preferred variant 1 followed by variant 3 (19.2%, variant 2 (11.5% and finally, variant 4 (3.8%. In terms of economic the highest efficiency was found in 2 (specific consumption 0.73 and 4 (specific consumption 0.77 variants compared to 1 (specific consumption 0.80 and 3 (specific consumption 0.82 variants, which translates into a reduction in the cost of products manufactured in the variants 2 and 4 (with protein supplements and additive mix by about 25-20% (with importance for the manufacturer. Also, thermal processing (roasting revealed the

  13. Raw meat based diet influences faecal microbiome and end products of fermentation in healthy dogs.

    Science.gov (United States)

    Sandri, Misa; Dal Monego, Simeone; Conte, Giuseppe; Sgorlon, Sandy; Stefanon, Bruno

    2017-02-28

    Dietary intervention studies are required to deeper understand the variability of gut microbial ecosystem in healthy dogs under different feeding conditions and to improve diet formulations. The aim of the study was to investigate in dogs the influence of a raw based diet supplemented with vegetable foods on faecal microbiome in comparison with extruded food. Eight healthy adult Boxer dogs were recruited and randomly divided in two experimental blocks of 4 individuals. Dogs were regularly fed a commercial extruded diet (RD) and starting from the beginning of the trial, one group received the raw based diet (MD) and the other group continued to be fed with the RD diet (CD) for a fortnight. After 14 days, the two groups were inverted, the CD group shifted to the MD and the MD shifted to the CD, for the next 14 days. Faeces were collected at the beginning of the study (T0), after 14 days (T14) before the change of diet and at the end of experimental period (T28) for DNA extraction and analysis of metagenome by sequencing 16SrRNA V3 and V4 regions, short chain fatty acids (SCFA), lactate and faecal score. A decreased proportion of Lactobacillus, Paralactobacillus (P diet significantly (P diet composition modifies faecal microbial composition and end products of fermentation. The administration of MD diet promoted a more balanced growth of bacterial communities and a positive change in the readouts of healthy gut functions in comparison to RD diet.

  14. [Instinct therapy--raw food with meat with exclusion of milk products. Report No. 16].

    Science.gov (United States)

    Jallut, O

    1989-06-13

    Instinct therapy is a diet consisting exclusively of food in its natural form, which has not been subjected to cooking, preserving or seasoning. Dairy products are forbidden. Indications are numerous and rather imprecise including especially cancer. Burger developed Instinct therapy in 1964 as a diet according to his own philosophy. 1980 he left Switzerland because the practice of "metasexuality" had caused him problems with the law. He founded a school of Instinct therapy in 1982 in France and published his book "La guerre du cru" (The Raw Food Fight) in 1985. In Switzerland, Besuchet took on the teaching of Burger in 1978 and was very active in giving lectures. He died in June 1985 of mediastinal cancer. According to Burger, man originally ate raw food and his instinct has not evolved since those pre-historic times, but has been "artificially modified" by cooked food and the consumption of non-human milk. If man could re-develop his natural instinct and eat only fresh food, which is not prepared in any way, he could solve his health problems and restore defenses against diseases such that these could become beneficial. Cooked food, milk and cereals are thought to be the cause of cancer but instinctive eating would help to avoid or to cure cancer. No preclinical or clinical trials have been carried out. The theories of Burger and Besuchet are based on unverifiable personal experiences.

  15. Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria

    DEFF Research Database (Denmark)

    Tafida, S.Y.; Kabir, J.; Kwaga, J.K.P.

    2013-01-01

    Salmonella is among the most important food borne pathogens worldwide contaminating a wide range of animal products including meat products. Human illnesses due to this pathogen are attributed to poor biosecurity in production, improper processing and handling of meat and meat products....... This is more likely where surveillance and regulatory control is weak. There is however limited information on the occurrence of these pathogens in foods in Nigeria. The extent of contamination of retail-beef and related meat products with Salmonellae in Zaria was evaluated. A total of 435 retailed beef...... and related meat products consisting of muscle meat, offal and processed meat products were tested for the presence of Salmonella species. Sample types included raw meat, ‘suya’ (roasted meat), ‘balangu’ (barbequed meat), ‘Kilishi’ (spiced sun dried meat) and ‘dambu’ (shredded fried meat). Samples were...

  16. meat

    African Journals Online (AJOL)

    p2492989

    These nutrient values determined in meat from red hartebeest could ... percentage of a-linolenic acid (C18:3n-3) (Wiklund et al., 2001). .... system (1525 HPLC with a binary gradient delivery, 717 auto-sampler and Injector, 1500 ..... polyunsaturated fatty acids and conjugated linoleic acid in lamb, beef and pork: A review.

  17. Effects of diet, packaging, and irradiation on protein oxidation, lipid oxidation, and color of raw broiler thigh meat during refrigerated storage.

    Science.gov (United States)

    Xiao, S; Zhang, W G; Lee, E J; Ma, C W; Ahn, D U

    2011-06-01

    This study was designed to evaluate the effects of dietary treatment, packaging, and irradiation singly or in combination on the oxidative stability of broiler chicken thigh meat. A total of 120 four-week-old chickens were divided into 12 pens (10 birds/pen), and 4 pens of broilers were randomly assigned to a control oxidized diet (5% oxidized oil) or an antioxidant-added diet [500 IU of vitamin E + 200 mg/kg of butylated hydroxyanisole (BHA)] and fed for 2 wk. After slaughter, thigh meats were separated, ground, packaged in either oxygen-permeable or oxygen-impermeable vacuum bags, and irradiated at 0 or 3 kGy. Lipid oxidation (TBA-reactive substances), protein oxidation (carbonyl), and color of the meat were measured at 1, 4, and 7 d of refrigerated storage. The lipid and protein oxidation of thigh meats from birds fed the diet supplemented with antioxidants (vitamin E + BHA) was significantly lower than the lipid and protein oxidation of birds fed the control diet, whereas the lipid and protein oxidation of broilers fed the oxidized oil diet was higher than that of birds fed the control diet. Vacuum packaging slowed, but irradiation accelerated, the lipid and protein oxidation of thigh meat during storage. Dietary antioxidants (vitamin E + BHA) and irradiation treatments showed a stronger effect on lipid oxidation than on protein oxidation. A significant correlation between lipid and protein oxidation in meat was found during storage. Dietary supplementation of vitamin E + BHA and the irradiation treatment increased the lightness and redness of thigh meat, respectively. It is suggested that appropriate use of dietary antioxidants in combination with packaging could be effective in minimizing oxidative changes in irradiated raw chicken thigh meat.

  18. Predicting the concentration of verotoxin-producing Escherichia coli bacteria during processing and storage of fermented raw-meat sausages.

    Science.gov (United States)

    Quinto, E J; Arinder, P; Axelsson, L; Heir, E; Holck, A; Lindqvist, R; Lindblad, M; Andreou, P; Lauzon, H L; Marteinsson, V Þ; Pin, C

    2014-05-01

    A model to predict the population density of verotoxigenic Escherichia coli (VTEC) throughout the elaboration and storage of fermented raw-meat sausages (FRMS) was developed. Probabilistic and kinetic measurement data sets collected from publicly available resources were completed with new measurements when required and used to quantify the dependence of VTEC growth and inactivation on the temperature, pH, water activity (aw), and concentration of lactic acid. Predictions were compared with observations in VTEC-contaminated FRMS manufactured in a pilot plant. Slight differences in the reduction of VTEC were predicted according to the fermentation temperature, 24 or 34°C, with greater inactivation at the highest temperature. The greatest reduction was observed during storage at high temperatures. A population decrease greater than 6 decimal logarithmic units was observed after 66 days of storage at 25°C, while a reduction of only ca. 1 logarithmic unit was detected at 12°C. The performance of our model and other modeling approaches was evaluated throughout the processing of dry and semidry FRMS. The greatest inactivation of VTEC was predicted in dry FRMS with long drying periods, while the smallest reduction was predicted in semidry FMRS with short drying periods. The model is implemented in a computing tool, E. coli SafeFerment (EcSF), freely available from http://www.ifr.ac.uk/safety/EcoliSafeFerment. EcSF integrates growth, probability of growth, and thermal and nonthermal inactivation models to predict the VTEC concentration throughout FRMS manufacturing and storage under constant or fluctuating environmental conditions.

  19. Maintenance of raw and cooked ready-to-eat product quality of infused poultry meats with selected plant extracts during electron beam irradiation and after storage

    Science.gov (United States)

    Rababah, Taha

    The purpose of this study included: preparing plant extracts and evaluating these extracts for total phenolics and antioxidant activities (AA); infusing extract/combination that demonstrates superior AA into chicken breast and irradiating at 3.0 kGy; evaluating the physicochemical properties of irradiated and non-irradiated raw and cooked chicken breast at 5°C for 12 days and -20°C for 9 months; and selecting the extracts that demonstrated desirable AA, infusing these extracts into chicken breast and evaluating head-space volatiles, and conducting sensory evaluation. The total phenolic content and AA of the plant extracts ranged from 24.8 to 92.5 mg/g dry material (conjugated diene of methyl linoleate) and 3.4 to 86.3%, respectively. The AA of plant extracts using oxidative stability instrument were 4.6 to 10.2 h (Induction time). Green tea and grape seed extracts had the highest AA within several plant extracts, and were selected to retard lipid oxidation in further studies. Fresh boneless and skinless chicken breast meats were vacuum infused with varying concentrations of antioxidants: Green tea and grape seed extracts alone/in combination and tert-butylhydroquinone. The results showed that irradiation had no significant effect on pH, water holding capacity, but increased the redness and carbonyls in raw meats (p extracts into meats increased lightness and decreased redness as well as hardness and shear force. Irradiation increased TBARS, hexanal, and pentanal values in raw and cooked meats. Addition of plant extracts decreased the amount of TBARS, hexanal, pentanal, and carbonyl values. Similar results were observed when the samples were stored at -20°C for 9 months. Descriptive sensory flavor results showed that irradiation did not affect the flavor attributes. Consumer, descriptive, and instrumental results showed that irradiation increased toughness, green tea improved the meat color, and the panel indicated that irradiation decreased the tenderness of the

  20. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat.

    Science.gov (United States)

    Flakemore, Aaron Ross; Malau-Aduli, Bunmi Sherifat; Nichols, Peter David; Malau-Aduli, Aduli Enoch Othniel

    2017-01-01

    Omega-3 long-chain (≥C 20 ) polyunsaturated fatty acids (ω3 LC-PUFA) confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL) muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO) was evaluated. Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO): a control diet at 0 mL/kg DM of DCCO (DCCOC); 25 mL/kg DM of DCCO (DCCOM) and 50 mL/kg DCCO (DCCOH). Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Within raw meats: DCCOH supplemented lambs had significantly ( P  culinary preparation method can be used as effective management tools to deliver nutritionally improved ω3 LC-PUFA lamb to meat consumers.

  1. Prevalence of Methicillin-Resistant Staphylococcus aureus and Other Staphylococcus Species in Raw Meat Samples Intended for Human Consumption in Benin City, Nigeria: Implications for Public Health.

    Science.gov (United States)

    Igbinosa, Etinosa O; Beshiru, Abeni; Akporehe, Lucy U; Oviasogie, Faith E; Igbinosa, Owen O

    2016-09-24

    The present study was designed to characterize methicillin-resistant staphylococci from raw meat. A total of 126 meat samples were obtained from open markets between February and April, 2015. Antimicrobial susceptibility testing was carried out using the disc diffusion method. Molecular profiling was conducted using 16S rRNA, mecA, nuc, and PVL gene signatures were detected by polymerase chain reaction assay. Fifty isolates of methicillin-resistant Staphylococcus spp. were detected in 26 (52%) pork, 14 (28%) beef and 10 (20%) chicken samples. The staphylococcal isolates were identified through partial 16S ribosomal ribonucleic acid (16S rRNA) nucleotide sequencing, and BLAST analysis of the gene sequence revealed 98%-100% staphylococcal similarity. All isolates from beef and chicken samples amplified the mecA gene, while 100% of the MRSA isolates amplified the PVL gene. The multidrug resistance profile (resistant to ≥1 antimicrobial agent in ≥3 classes of antimicrobial agents) of the staphylococcal isolates showed that 7 isolates were resistant to methicillin, penicillin, clindamycin, chloramphenicol, trimethoprim-sulfamethoxazole, kanamycin, amoxicillin, cloxacillin, erythromycin, vancomycin, and gentamycin. There was a significant regression effect from the multidrug-resistant profile on the number of isolates (p resistant strains within bacterial populations. The findings of the present study indicate that raw meats in the Benin metropolis were possibly contaminated with pathogenic and multi-drug resistant staphylococci strains and therefore could constitute a risk to public health communities.

  2. Changes in quality of goat meat after alterations in animal Handling - doi:10.5020/18061230.2007.p33

    Directory of Open Access Journals (Sweden)

    Frederico José Beserra

    2012-01-01

    Full Text Available This study aimed at evaluating the effect of animal handling, consisting in castration and cashew nut diet supplementation, on the cholesterol content and percentage composition of the muscles that constitute the leg meat cut from crossbred goats, grown in Ceará State. A case experimental design was applied with twenty male-animals with 5-6 months age and mean weight of 12 Kg, randomly divided in two groups of castrated (10 and intact (10 animals. In individual bays, they received during 5 months, two food regimen based on dried elephant grass (Pennisetum purpureum and a standard isoproteic ration (corn and soy oil, one of them with the addition of 13% cashew nut bran (CNB, forming four sub-groups: A1 (intact with no CNB supplemented diet; A2 (intact with CNB supplemented diet; B1 (castrated with no CNB supplemented diet and B2 (castrated with CNB supplemented diet. The castration associated with the CNB supplementation increased the meat’s fat yield from 1.16% to 3.57% and the cholesterol content from 36.47 mg/100g to 62.30 mg/100g. The ash yield decreased from 1.14% to 1.04%. The castration isolated only reduced moisture yield from 75.98% on sub-group A2 to 74.19% on sub-group B2. In intact animals that fed diet supplemented with CNB the protein decreased from 20.58% to 18.85% (P < 0.05 (sub-groups A1 and A2. The increased cholesterol content was highly correlated with the increase of the fat (93% In conclusion, these results showed that the combined use of castration and cashew nut bran (13% diet negatively influenced the dietetic and nutritional quality of goat leg meat.

  3. Quality characteristics of raw and canned goat meat in water, brine, oil and Thai curry during storage

    OpenAIRE

    Yoottana Polpara; Thanyaporn Sornprasitt; Saowakon Wattanachant

    2008-01-01

    The quality characteristics of three groups of goat meat obtained from one year and three years old Anglonubian crossed native, and culled Saanen crossed native were investigated. Significant differences in fat, ash and total collagen content, were observed among groups of goat meat (P

  4. Analysis of raw meat for heavy metals and bacterial contamination and comparison of antibiotic susceptibility of isolated bacteria

    International Nuclear Information System (INIS)

    Ahmad, F.

    2016-01-01

    The focus of the study was to analyze the commercially available meat for its heavy metal contents and bacterial contamination. The meat samples were collected from four commercial markets of Lahore, i.e., as Wafaqi Colony (Site I),Township (Site II), G-1 Market (Site III) and Zenith (Site IV), and analyzed for heavy metal [i.e., manganese (Mn), nickel (Ni), chromium (Cr), cadmium (Cd) and copper (Cu)] contents and bacterial contaminants (E. coli, Pseudomonas sp., Bacillus sp. and Salmonella sp.) Atomic absorption spectrophotometery was employed for the detection of the heavy metals and plate count method was used for the detection of bacterial contaminants. The Ni concentration in the Site II sample only and Cd concentration in all meat samples were found above the standard value and the concentration of other metals (Cu, Cr, and Mn) was less than the standard concentrations. Bacterial (E. coli, Pseudomonas sp., Bacillus sp., Salmonella sp. and Staphylococcus sp.) contamination was found in all meat samples; however, the number was a little lower in the Site IV samples. Statistical analysis was done, by one-way ANOVA using SPSS, to compare heavy metal contamination in the meat samples. The results showed distribution of heavy metals in all meat samples there was significant difference of Ni concentration in the meat samples. The measure of antibiotic susceptibility showed that isolated species of bacteria were resistant to lincomycin, streptomycin, tertracyclin, ampicillin, amoxicillin and doxycyclin, but did not survive in the medium containing ofloxacin. (author)

  5. VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

    Science.gov (United States)

    Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

    2017-01-01

    Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

  6. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand.

    Science.gov (United States)

    Bojanić, K; Midwinter, A C; Marshall, J C; Rogers, L E; Biggs, P J; Acke, E

    2017-09-01

    Campylobacter causes acute gastroenteritis in people worldwide and is frequently isolated from food, animals and the environment. The disease is predominately food-borne but many routes of transmission and sources of infection have been described, including contact with pets. The prevalence of Campylobacter spp. in dogs and cats varies widely, and data on New Zealand pets are limited. This study aimed to investigate the prevalence of Campylobacter spp. in dogs, cats and retail raw meat pet food products in New Zealand and to characterize Campylobacter jejuni isolates using multilocus sequence typing (MLST). Ninety dogs and 110 cats examined at the Massey University Veterinary Teaching Hospital for elective procedures, and fifty locally purchased retail raw meat pet diets were sampled. Two culture protocols combining Bolton broth enrichment and mCCDA and CAT agars in a microaerobic atmosphere at 42°C and 37°C with species identification using PCR were performed. The prevalence of Campylobacter spp., C. jejuni, Campylobacter upsaliensis and Campylobacter helveticus was 36%, 13%, 23% and 1% in dogs and 16%, 5%, 5% and 7% in cats, respectively. One dog had Campylobacter lari confirmed, and three dogs and one cat had multiple Campylobacter spp. detected. Significantly more animals tested positive using CAT than mCCDA agar (P dogs, whereas attendance for dental treatment was a risk factor for cats. Campylobacter spp. were isolated from 28%, C. jejuni 22%, C. lari 6% and Campylobacter coli 6% of food samples. Six isolates positive by Campylobacter genus PCR were identified as Arcobacter butzleri. Poultry meat was more likely to be positive than non-poultry meat (P = 0.006). Of the 13 C. jejuni pet isolates with full MLST profiles, eight were of different sequence types (ST) and all nine food isolates were of different STs. © 2016 Blackwell Verlag GmbH.

  7. Chemical and biotechnological processing of collagen-containing raw materials into functional components of feed suitable for production of high-quality meat from farm animals

    Science.gov (United States)

    Baburina, M. I.; Ivankin, A. N.; Stanovova, I. A.

    2017-09-01

    The process of chemical biotechnological processing of collagen-containing raw materials into functional components of feeds for effective pig rearing was studied. Protein components of feeds were obtained as a result of hydrolysis in the presence of lactic acid of the animal collagen from secondary raw materials, which comprised subcutaneous collagen (cuticle), skin and veined mass with tendons from cattle. For comparison, a method is described for preparing protein components of feeds by cultivating Lactobacillus plantarum. Analysis of the kinetic data of the conversion of a high-molecular collagen protein to an aminolyte polypeptide mixture showed the advantage of microbiological synthesis in obtaining a protein for feeds. Feed formulations have been developed to include the components obtained, and which result in high quality pork suitable for the production of quality meat products.

  8. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  9. Lessons learned from a textbook outbreak: EHEC-O157:H7 infections associated with the consumption of raw meat products, June 2012, Limburg, Belgium.

    Science.gov (United States)

    Braeye, Toon; Denayer, Sarah; De Rauw, Klara; Forier, Anmarie; Verluyten, Jurgen; Fourie, Ludo; Dierick, Katelijne; Botteldoorn, Nadine; Quoilin, Sophie; Cosse, Pascale; Noyen, Jeannine; Pierard, Denis

    2014-01-01

    On 5 June 2012 several enterohemorrhagic Escherichia coli, EHEC, O157:H7 infections were reported to the public health authorities of Limburg. We performed a case-control study, a trace back/forward investigation and compared strains isolated from human cases and food samples. A case was defined as anyone with a laboratory-confirmed E. coli O157:H7-infection in North-East Limburg from May 30 2012 till July 15 2012. Family members with bloody diarrhea were also included as cases. E. coli O157 was isolated by culture and the presence of the virulence genes was verified using (q)PCR. Isolates were genotyped and compared by Pulsed Field Gel Electrophoresis (PFGE) and insertion sequence 629-printing (IS629-printing). The outbreak involved 24 cases, of which 17 were laboratory-confirmed. Five cases developed Hemolytic Uremic Syndrome (HUS) and fifteen were hospitalized. Cases reported a significantly higher consumption of "steak tartare", a raw meat product (OR 48.12; 95% CI; 5.62- 416.01). Cases were also more likely to buy meat-products at certain butcheries (OR 11.67; 95% CI; 1.41 - 96.49). PFGE and IS629-printing demonstrated that the vtx1a vtx2a eae ehxA positive EHEC O157:H7 strains isolated from three meat products and all seventeen human stool samples were identical. In a slaughterhouse, identified by the trace-back investigation, a carcass infected with a different EHEC strain was found and confiscated. We present a well described and effectively investigated foodborne outbreak associated with meat products. Our main recommendations are the facilitation and acceleration of the outbreak detection and the development of a communication plan to reaches all persons at risk. Foodborne diseases, Shiga-toxigenic Escherichia coli, Enterohemorrhagic Escherichia coli, Meat products, Case control studies, Electrophoresis, Gel, Pulsed-Field.

  10. Aerobic Mesophilic, Coliform, Escherichia coli, and Staphylococcus aureus Counts of Raw Meat from the Formal and Informal Meat Sectors in South Africa.

    Science.gov (United States)

    Jaja, Ishmael Festus; Green, Ezekiel; Muchenje, Voster

    2018-04-21

    Foodborne disease (FBD) is a global public health concern, and foods from animal sources have been associated with outbreaks of food-related illness. In this study, animal carcasses from the two abattoirs (HT1 and HT2) in the formal meat sector (FMS) and slaughter points in the informal meat sector (INMS) were examined at two stages of slaughter (before washing and after washing) for aerobic colony counts (ACC) and total viable count (TCC), as well as Escherichia coli and Staphylococcus aureus count. At each stage, carcasses were sampled by swabbing at the neck, brisket, flank, and rump. ACC for beef, mutton, and pork carcasses at HT1 and HT2 before washing were between 2.5⁻5.8, 2.2⁻4.7, and 2.7⁻3.7 mean log CFU/cm², respectively, and TCC count before washing was highest on the neck of cattle (6.3 ± 2.4) and after washing was highest on the perineal of sheep (5.7 ± 6.9). In the INMS, TCC count was highest on the brisket (6.9 ± 3.2) and in the neck (5.5 ± 2.4). Higher ACC values of 6.2⁻6.7 mean log CFU/cm² were obtained in the INMS. The highest count for E. coli (4.2 mean log CFU/cm²) after washing was in the neck, while the highest count for S. aureus (4.0 mean log CFU/cm²) was in the flank. All bacteria count in the INMS exceeded acceptable limits, and washing did not significantly reduce microbial load in meat in the FMS and INMS. Bacteria count in the FMS and INMS exceeded acceptable standards. However, meat processed in the INMS poses a more significant risk of FBD to consumers.

  11. FEEDING OF FERRETS WITH THE RAW MEAT AND LIVER OF CHICKENS CHRONICALLY POISONED WITH TOXIC GROUNDNUT MEAL.

    Science.gov (United States)

    PLATONOW, N; BEAUREGARD, M

    1965-03-01

    Chickens were fed a ration containing 30 per cent of toxic groundnut meal for up to six weeks. The concentration of aflatoxin (toxic metabolites of Aspergillus flavus) in the above ration was 3.06 p.p.m. At the end of 2nd, 4th or 6th week the birds were killed. The meat was removed from the bones and put through a meat grinder. The livers of three groups were pooled together. Three control groups of birds kept on commercial pellets were treated similarly. Female ferrets, two years of age, were used in the present study. They were divided into four groups. The first three groups were given for one month meat from chickens fed the toxic ration for 2, 4, and 6 weeks, respectively. Each of these three groups contained one control ferret that was fed with the meat of chickens fed a commercial ration for a similar period of time. One half of the 4th group was fed pooled liver from intoxicated birds and one half was fed liver from control birds. No significant changes in the ferret tissues were observed as a consequence of feeding them with the meat or liver from the chickens chronically poisoned with toxic groundnut meal.

  12. Analysis of micro-structure in raw and heat treated meat emulsions from multimodal X-ray microtomography

    DEFF Research Database (Denmark)

    Einarsdottir, Hildur; Nielsen, Mikkel Schou; Miklos, Rikke

    2014-01-01

    This study presents a novel non-destructive X-ray technique for analyzing meat emulsions before and after heat treatment. The method is based on X-ray grating-interferometry where three complementary imaging modalities are obtained simultaneously measuring the absorption, refraction and scatterin...

  13. Degummed crude canola oil, sire breed and gender effects on intramuscular long-chain omega-3 fatty acid properties of raw and cooked lamb meat

    Directory of Open Access Journals (Sweden)

    Aaron Ross Flakemore

    2017-08-01

    Full Text Available Abstract Background Omega-3 long-chain (≥C20 polyunsaturated fatty acids (ω3 LC-PUFA confer important attributes to health-conscious meat consumers due to the significant role they play in brain development, prevention of coronary heart disease, obesity and hypertension. In this study, the ω3 LC-PUFA content of raw and cooked Longissimus thoracis et lumborum (LTL muscle from genetically divergent Australian prime lambs supplemented with dietary degummed crude canola oil (DCCO was evaluated. Methods Samples of LTL muscle were sourced from 24 first cross ewe and wether lambs sired by Dorset, White Suffolk and Merino rams joined to Merino dams that were assigned to supplemental regimes of degummed crude canola oil (DCCO: a control diet at 0 mL/kg DM of DCCO (DCCOC; 25 mL/kg DM of DCCO (DCCOM and 50 mL/kg DCCO (DCCOH. Lambs were individually housed and offered 1 kg/day/head for 42 days before being slaughtered. Samples for cooked analysis were prepared to a core temperature of 70 °C using conductive dry-heat. Results Within raw meats: DCCOH supplemented lambs had significantly (P < 0.05 higher concentrations of eicosapentaenoic (EPA, 20:5ω3 and EPA + docosahexaenoic (DHA, 22:6ω3 acids than those supplemented with DCCOM or DCCOC; Dorset sired lambs contained significantly (P < 0.05 more EPA and EPA + DHA than other sire breeds; diet and sire breed interactions were significant (P < 0.05 in affecting EPA and EPA + DHA concentrations. In cooked meat, ω3 LC-PUFA concentrations in DCCOM (32 mg/100 g, DCCOH (38 mg/100 g, Dorset (36 mg/100 g, White Suffolk (32 mg/100 g, ewes (32 mg/100 g and wethers (33 mg/100 g, all exceeded the minimum content of 30 mg/100 g of edible cooked portion of EPA + DHA for Australian defined ‘source’ level ω3 LC-PUFA classification. Conclusion These results present that combinations of dietary degummed crude canola oil, sheep genetics and culinary preparation method can be used as

  14. Improvement of biomolecular methods for the identification and typing of Escherichia coli O157:H7 isolated from raw meat.

    Science.gov (United States)

    Paris, A; Bonardi, S; Bacci, C; Boni, E; Salmi, F; Bassi, L; Brindani, F

    2010-06-01

    The aim of the study was to evaluate the sensitivity of two m-PCR methods for the quantitative determination of E. coli O157:H7 in foodstuffs. Genomic serotyping was carried out on bacterial cultures, and the necessary time was optimized to increase the resolution of the method. Subsequently, artificial contamination trials using meat were conducted to assess method accuracy in foodstuffs and pursue the genetic typing of pathogens. Measurement thresholds were shown to range between 10(5) and 10(6) CFU/mL, but were reduced by four logarithmic cycles in 80% of samples. Relative to the meat contamination trials, serotypes were identified after 24 hours, corresponding to 10 CFU/mL inoculum, with higher rates seen when m-TSB was used for enrichment. Inoculated samples were found to contain three virulence factors (hlyA, eaeA, and stx1).

  15. Effect of irradiation dose and irradiation temperature on the thiamin content of raw and cooked chicken breast meat

    International Nuclear Information System (INIS)

    Graham, W.D.; Stevenson, M.H.; Stewart, E.M.

    1998-01-01

    The usefulness of ionising radiation for the elimination of pathogenic bacteria in poultry meat has been well documented as have the effects of this processing treatment on the nutritional status of the food, in particular, the vitamins. Unfortunately, much of the earlier research carried out on the effect of irradiation on vitamins was carried out in solution or in model systems at doses much greater than those used commercially thereby resulting in considerable destruction of these compounds. Thus, those opposed to the process of food irradiation labelled the treated food as nutritionally poor. However, in reality, due to the complexity of food systems the effects of irradiation on vitamins are generally not as marked and many processes, for example cooking, cause the same degree of change to the vitamins. Thiamin (vitamin B1) is the most radiation sensitive of the water-soluble vitamins and is therefore a good indicator of the effect of irradiation treatment. In this study the effects of irradiation at either 4°C or −20°C followed by cooking on the thiamin content of chicken breast meat was determined. Results showed that whilst both irradiation and cooking resulted in a decrease in thiamin concentration, the losses incurred were unlikely to be of nutritional significance and could be further minimised by irradiating the chicken meat at a low temperature. Thiamin analyses were carried out using high-performance liquid chromatography since this technique is faster and more selective than the chemical or microbiological methods more commonly employed. Total thiamin, both free and combined form, was determined following acid and enzyme hydrolysis. © 1998 Society of Chemical Industry

  16. Comparative antioxidant effect of BHT and water extracts of banana and sapodilla peels in raw poultry meat.

    Science.gov (United States)

    Devatkal, Suresh K; Kumboj, Ritu; Paul, Devosmita

    2014-02-01

    Antioxidant properties of banana (Musa paradisiaca) and Sapodilla/Chikoo (Manilkara zapota) peel extracts in chicken patties were evaluated. Four treatments viz., I. Control (meat + 2% salt), II.BHT (meat + 2% salt + 0.1% BHT), III. BPE (meat + 2% salt + 2% banana peel extract) and IV. SPE (meat + 2% salt + 2% sapodilla/chikoo peel extract) were compared for changes in colour and lipid oxidation during 8 days refrigerated storage (4 ± °C). The average phenolic content was 550.2 and 550.8 mg gallic acid equivalent per 10 g peel in BPE and SPE respectively. Free radical scavenging activity was 66.9 and 67.8% in BPE and SPE respectively. Banana peel extract had significantly (P peel extract (0.91). During refrigerated storage period, all color parameters decreased significantly in all treatments. Observation on lipid oxidation showed a significantly (P banana and sapodilla peels could be explored as natural antioxidants in poultry meat and meat products.

  17. Incomplete sanitation of a meat grinder and ingestion of raw ground beef: contributing factors to a large outbreak of Salmonella typhimurium infection.

    Science.gov (United States)

    Roels, T H; Frazak, P A; Kazmierczak, J J; Mackenzie, W R; Proctor, M E; Kurzynski, T A; Davis, J P

    1997-10-01

    Consumers in the United States continue to eat raw or undercooked foods of animal origin despite public health warnings following several well-publicized outbreaks. We investigated an outbreak of Salmonella serotype Typhimurium infection in 158 patients in Wisconsin during the 1994 Christmas holiday period. To determine the vehicle and source of the outbreak, we conducted cohort and case-control studies, and environmental investigations in butcher shop A. Eating raw ground beef purchased from butcher shop A was the only item significantly associated with illness [cohort study: relative risk = 5.8, 95% confidence interval (CI) = 1.5-21.8; case control study: odds ratio = 46.2, 95% CI = 3.8-2751]. Inadequate cleaning and sanitization of the meat grinder in butcher shop A likely resulted in sustained contamination of ground beef during an 8-day interval. Consumer education, coupled with hazard reduction efforts at multiple stages in the food processing chain, will continue to play an important role in the control of foodborne illness.

  18. Microbiological, physicochemical and sensory parameters of dry fermented sausages manufactured with high hydrostatic pressure processed raw meat.

    Science.gov (United States)

    Omer, M K; Prieto, B; Rendueles, E; Alvarez-Ordoñez, A; Lunde, K; Alvseike, O; Prieto, M

    2015-10-01

    The aim of this trial was to describe physicochemical, microbiological and organoleptic characteristics of dry fermented sausages produced from high hydrostatic pressure (HHP) pre-processed trimmings. During ripening of the meat products pH, weight, water activity (aw), and several microbiological parameters were measured at zero, eight, fifteen days and after 6weeks. Sensory characteristics were estimated at day 15 and after six weeks by a test panel by using several sensory tests. Enterobacteriaceae were not detected in sausages from HHP-processed trimmings. Fermentation was little affected, but weight and aw of the HHP-processed sausages decreased faster during ripening. HHP-treated sausages were consistently less favoured than non HHP-treated sausages, but the strategy may be an alternative approach if the process is optimized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Fate of acid-resistant and non-acid resistant Shiga toxin-producing Escherichia coli strains in experimentally contaminated French fermented raw meat sausages.

    Science.gov (United States)

    Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C

    2009-02-28

    Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.

  20. Effect of post-slaughter handling during distribution on ...

    African Journals Online (AJOL)

    Felistus

    2017-03-24

    Mar 24, 2017 ... Although these regulations are put into practice in the formal sector, meat safety ..... through consumption of poorly cooked meat or raw meat. .... environment, dirty tools and equipment, contamination of the meat when ...

  1. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  2. Healthier meat and meat products: Their role as functional foods

    OpenAIRE

    Jiménez Colmenero, Francisco; Carballo, José; Cofrades, Susana

    2001-01-01

    This review deals with the implications of meat and meat products for human health. It analyses the effect of the presence or absence of various factors: fat, fatty acid composition, cholesterol, calorific value, salt, nitrite or lipid oxidation products that can cause health problems. Bearing in mind these considerations, it then describes the strategies used in animal production, treatment of meat raw material and reformulation of meat products to obtain healthier meat and meat products. Fu...

  3. Field handling conditions of raw milk sold in vending machines: experimental evaluation of the behaviour of Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni

    Directory of Open Access Journals (Sweden)

    Renato G. Zanoni

    2012-01-01

    Full Text Available The direct sale by farmers of raw milk for human consumption has been allowed in Italy since 2004. The aim of this study was to evaluate the behaviour of selected foodborne pathogens in raw milk sold in vending machines, in field handling conditions, and during shelf-life from production to consumption. Temperature of storage of raw milk in 33 farms authorized to produce and sell raw milk were investigated from farm to vending machine delivery, together with consumer habits in one province of the Emilia-Romagna region of northern Italy. Failure to maintain appropriate low temperatures during shelf-life was recorded and 43% of consumers did not boil milk before consumption. Listeria monocytogenes, Escherichia coli O157:H7, Salmonella Typhimurium and Campylobacter jejuni strains were inoculated into raw milk samples, and the best (4°C as established by law and worst temperature storage conditions detected (variable temperature were simulated. Boiling tests were performed for each pathogen considered at high and low levels of contamination. Results showed an increase in L. monocytogenes in milk stored at 4°C and at variable temperatures recorded in shelf-life monitoring, an increase in E. coli O157:H7 and S. Typhimurium at variable temperatures but not at 4°C, and a decrease in C. jejuni in all storage conditions. Boiling milk is effective in making it safe for consumers. This study provides evidence that appropriate handling of raw milk, maintaining low temperatures, together with consumer education concerning boiling raw milk before consumption are key factors in preventing foodborne infections linked to raw milk consumption, and helps assess the risk of foodborne infection linked to raw milk consumption.

  4. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL producing Enterobacteriaceae in food producing animals, minced meat and raw milk

    Directory of Open Access Journals (Sweden)

    Geser Nadine

    2012-03-01

    Full Text Available Abstract Background The impact of food animals as a possible reservoir for extended-spectrum beta-lactamase (ESBL producing Enterobacteriaceae, and the dissemination of such strains into the food production chain need to be assessed. In this study 334 fecal samples from pigs, cattle, chicken and sheep were investigated at slaughter. Additionally, 100 raw milk samples, representing bulk tank milk of 100 different dairy farms, 104 minced meat (pork and beef samples and 67 E. coli isolates from cattle E. coli mastitis were analyzed. Results As many as 15.3% of the porcine, 13.7% of the bovine, 8.6% of the sheep and 63.4% of the chicken fecal samples yielded ESBL producers after an enrichment step. In contrast, none of the minced meat, none of the bulk tank milk samples and only one of the mastitis milk samples contained ESBL producing strains. Of the total of 91 isolates, 89 were E. coli, one was Citrobacter youngae and one was Enterobacter cloacae. PCR analysis revealed that 78 isolates (85.7% produced CTX-M group 1 ESBLs while six isolates (6.6% produced CTX-M group 9 enzymes. Five detected ESBLs (5.5% belonged to the SHV group and 2 isolates (2.2% contained a TEM-type enzyme. A total of 27 CTX-M producers were additionally PCR-positive for TEM-beta-lactamase. The ESBL-encoding genes of 53 isolates were sequenced of which 34 produced CTX-M-1, 6 produced CTX-M-14, 5 produced CTX-M-15 and also 5 produced SHV-12. Two isolates produced TEM-52 and one isolate expressed a novel CTX-M group 1 ESBL, CTX-M-117. One isolate--aside from a CTX-M ESBL-- contained an additional novel TEM-type broad-spectrum beta-lactamase, TEM-186. Conclusions The relatively high rates of ESBL producers in food animals and the high genetic diversity among these isolates are worrisome and indicate an established reservoir in farm animals.

  5. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  6. Rapid detection of peptide markers for authentication purposes in raw and cooked meat using ambient liquid extraction surface analysis mass spectrometry.

    Science.gov (United States)

    Montowska, Magdalena; Alexander, Morgan R; Tucker, Gregory A; Barrett, David A

    2014-10-21

    In this Article, our previously developed ambient LESA-MS methodology is implemented to analyze five types of thermally treated meat species, namely, beef, pork, horse, chicken, and turkey meat, to select and identify heat-stable and species-specific peptide markers. In-solution tryptic digests of cooked meats were deposited onto a polymer surface, followed by LESA-MS analysis and evaluation using multivariate data analysis and tandem electrospray MS. The five types of cooked meat were clearly discriminated using principal component analysis and orthogonal partial least-squares discriminant analysis. 23 heat stable peptide markers unique to species and muscle protein were identified following data-dependent tandem LESA-MS analysis. Surface extraction and direct ambient MS analysis of mixtures of cooked meat species was performed for the first time and enabled detection of 10% (w/w) of pork, horse, and turkey meat and 5% (w/w) of chicken meat in beef, using the developed LESA-MS/MS analysis. The study shows, for the first time, that ambient LESA-MS methodology displays specificity sufficient to be implemented effectively for the analysis of processed and complex peptide digests. The proposed approach is much faster and simpler than other measurement tools for meat speciation; it has potential for application in other areas of meat science or food production.

  7. Effects of meat juice on biofilm formation of Campylobacter and Salmonella.

    Science.gov (United States)

    Li, Jiaqi; Feng, Jinsong; Ma, Lina; de la Fuente Núñez, César; Gölz, Greta; Lu, Xiaonan

    2017-07-17

    Campylobacter and Salmonella are leading causes of foodborne illnesses worldwide, vastly harboured by raw meat as their common food reservoir. Both microbes are prevalent in meat processing environments in the form of biofilms that contribute to cross-contamination and foodborne infection. This study applied raw meat juice (chicken juice and pork juice) as a minimally processed food model to study its effects on bacterial biofilm formation. Meat juice was collected during the freeze-thaw process of raw meat and sterilized by filtration. In 96-well polystyrene plates and glass chambers, supplementation of over 25% meat juice (v/v) in laboratory media led to an increase in biofilm formation of Campylobacter and Salmonella. During the initial attachment stage of biofilm development, more bacterial cells were present on surfaces treated with meat juice residues compared to control surfaces. Meat juice particulates on abiotic surfaces facilitated biofilm formation of Campylobacter and Salmonella under both static and flow conditions, with the latter being assessed using a microfluidic platform. Further, the deficiency in biofilm formation of selected Campylobacter and Salmonella mutant strains was restored in the presence of meat juice particulates. These results suggested that meat juice residues on the abiotic surfaces might act as a surface conditioner to support initial attachment and biofilm formation of Campylobacter and Salmonella. This study sheds light on a possible survival mechanism of Campylobacter and Salmonella in meat processing environments, and indicates that thorough cleaning of meat residues during meat production and handling is critical to reduce the bacterial load of Campylobacter and Salmonella. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Assessment of levels of bacterial contamination of large wild game meat in Europe.

    Science.gov (United States)

    Membré, Jeanne-Marie; Laroche, Michel; Magras, Catherine

    2011-08-01

    The variations in prevalence and levels of pathogens and fecal contamination indicators in large wild game meat were studied to assess their potential impact on consumers. This analysis was based on hazard analysis, data generation and statistical analysis. A total of 2919 meat samples from three species (red deer, roe deer, wild boar) were collected at French game meat traders' facilities using two sampling protocols. Information was gathered on the types of meat cuts (forequarter or haunch; first sampling protocol) or type of retail-ready meat (stewing meat or roasting meat; second protocol), and also on the meat storage conditions (frozen or chilled), country of origin (eight countries) and shooting season (autumn, winter, spring). The samples were analyzed in both protocols for detection and enumeration of Escherichia coli, coagulase+staphylococci and Clostridium perfringens. In addition, detection and enumeration of thermotolerant coliforms and Listeria monocytogenes were performed for samples collected in the first and second protocols, respectively. The levels of bacterial contamination of the raw meat were determined by performing statistical analysis involving probabilistic techniques and Bayesian inference. C. perfringens was found in the highest numbers for the three indicators of microbial quality, hygiene and good handling, and L. monocytogenes in the lowest. Differences in contamination levels between game species and between meats distributed as chilled or frozen products were not significant. These results might be included in quantitative exposure assessments. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market

    Directory of Open Access Journals (Sweden)

    Alvarado Pavel Espinoza

    2017-08-01

    Full Text Available In this work a protocol for the extraction of DNA from the meat of different animals (beef, pork, and horse was established. The protocol utilized TE lysis buffer with varying concentrations of phenol and chloroform as a base reagent. Reactions were carried out for verying time periods and under differing temperatures. All samples analyzed were obtained from commercial grade meat sourced from the local region. 12 samples were used for methodological optimization with 30 repetitions per sample. Once optimized, purity results for the three species were 1.7 with a concentration (determined spectrophotometrically at 260 nm of 100 μl/ml of DNA. The protocol was tested using 465 different meat samples from different animal species. All meat used was fresh and processed. Results showed a purity of 1.35 ± 0.076 and a DNA concentration of 70 ± 0.31 μl for a time duration of 1.5 hours. These results were tested by polymerase chain reaction (PCR as reported by several authors. The extracts were tested using different PCR reactions using specific primers for horses. Results suggest that there was 39 positive samples. The proposed methodology provides an efficient way to detect DNA concentration and purity, suitable for amplification with PCR.

  10. ANTE-MORTEM FORMATION OF THE QUALITATIVE CHARACTERISTICS OF ENVIRONMENTALLY FRIENDLY MEAT RAW MATERIAL BY INTENSIFICATION OF THE MECHANISMS OF THE METABOLIC PROCESSES IN GILTS

    Directory of Open Access Journals (Sweden)

    T. M. Giro

    2016-01-01

    Full Text Available Abstract In order to reduce the time of feeding, increase the intensity of weight gain without hormones, antibiotics, anabolic drugs, as well as to obtain high-quality meat with marble structure, the authors studied the influence of ovarioectomy on the intensification of the metabolic processes in gilts. The experiments were carried out in the FGUP “Mummovskoe” – the educational experimental enterprise of the Russian State Agrarian University - Moscow Timiryazev Agricultural Academy (RSAU – MAA named after K.A.  Timiryazev, in the Atkarsky district of the Saratov region. Two groups of Duroc gilts (10 animals each raised under the same conditions were studied. As a result of the experiment, the influence of ovariectomy on the level of insulinlike growth factor-1 (IGF-1 and indicators of metabolic processes in gilts were established. It is confirmed that stimulation of the the somatotropin/insulin-like growth factor (ST-IGF system along with hereditary factors and the characteristics of feeding contributes to the development of muscle tissue. Stimulation of ST secretion with insulin-like growth factor facilitates the development of muscle tissue.An increase in IGF-1 level leads to the development of new muscle fibers and muscle hyperplasia. After surgery, the major factors of changes in meat and feeding indicators in gilts were the rise in the metabolic activity of muscle tissue and fat metabolism, enhancement of production of IGF-1, which has insulin-like action and ensures activation of the processes of cell proliferation and differentiation. Increase in IGF-1 level had a positive impact on meat productivity, chemical and biochemical composition of pork. Simultaneous triggering of the systemic catabolic and local anabolic reactions in gilts after ovariectomy contributed to obtaining higher nutritional value of meat.

  11. In Dogs with Periodontal Disease Is Feeding a Complete Raw Meat Diet More Effective Than a Complete Kibble 'Dental' Diet at Reducing Periodontal Disease?

    Directory of Open Access Journals (Sweden)

    Nieky van Veggel

    2017-04-01

    Full Text Available Clinical bottom line:In light of the absence of evidence, vets and vet nurses should be cautious when recommending raw diets to support periodontal health and advise clients accordingly by relying on their clinical experience rather than the literature until more evidence is generated.

  12. Presence of Salmonella Spp and Escherichia Coli O157:H7 in Raw Meat, in São Paulo City, Brazil and Evaluation of Low Temperature (Refrigeration and Freezing) Resistance of these Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Jakabi, M.; Gelli, D. S.; Ristori, C. A.; De Paula, A. M.R.; Sakuma, H.; Lopez, G. I.S. [Seção de Microbiologia Alimentar (Brazil); Fernandes, S. A. [Seção de Bacteriologia Médica (Brazil); Luchesi, R. B. [Seção de Meios de Cultura (Brazil); Instituto Adolfo Lutz, São Paulo (Brazil)

    2005-01-15

    A total of 253 samples of raw meat (bovine, swine and poultry) were collected in local supermarkets in Sao Paulo, Brazil, and analysed for Salmonella and E. coli 0157:H7, in order to determine their microbiological quality and compliance with the established standards for these two bacteria. Additionally, samples of ground beef were artificially contaminated with S. enteritidis and E. coli 0157:H7, in order to determine the effect of refrigeration and freezing temperature during the storage period (4ºC for 5 days, and - 18ºC for 90 days, respectively). Twenty-three samples (9.1%) were positive to Salmonella and seven different serotypes were isolated, S. enteritidis being the most common serotype founded (34,8%). The results of the artificially contaminated samples showed that E. coli 0157:H7 was sensitive to refrigeration as well as freezing temperature. S. enteritidis was only affected by freezing temperature during the storage time. (author)

  13. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  14. Volatile compounds in meat and meat products

    Directory of Open Access Journals (Sweden)

    Monika KOSOWSKA

    Full Text Available Abstract Meaty flavor is composed of a few hundreds of volatile compounds, only minor part of which are responsible for the characteristic odor. It is developed as a result of multi-directional reactions proceeding between non-volatile precursors contained in raw meat under the influence of temperature. The volatile compounds are generated upon: Maillard reactions, lipid oxidation, interactions between Maillard reaction products and lipid oxidation products as well as upon thiamine degradation. The developed flavor is determined by many factors associated with: raw material (breed, sex, diet and age of animal, conditions and process of slaughter, duration and conditions of meat storage, type of muscle, additives applied and the course of the technological process. The objective of this review article is to draw attention to the issue of volatile compounds characteristic for meat products and factors that affect their synthesis.

  15. In vitro evaluation of the antimicrobial effect of a raw bacteriocin extract in combination with chemical preservatives employed in meat industry

    Directory of Open Access Journals (Sweden)

    Luis A. Aguado Bautista

    2010-12-01

    Full Text Available Biopreservation can be defined as the foods shelf life extension employing antibacterial products like bacteriocins. The objective of this work was to determinate the efficacy of E. faecium MXVK29 bacteriocin in combination with chemical preservatives against spoilage and pathogens microorganisms. Bacteriocin raw extrac antimicrobial activity was 46.34 UA/g of protein. Growth of Pseudomonas putida was not affected by the preservatives employed at the conditions employed. Antimicrobial response was different for other microorganisms since a synergetic effect of the preservatives combination inhibited Brochothrix thermosphacta and Escherichia coli growth. Sodium lactate had additive effect only against Listeria innocua.

  16. Metabolic bone disease and central retinal degeneration in a kitten due to nutritional inadequacy of an all-meat raw diet

    Directory of Open Access Journals (Sweden)

    Catherine Lenox

    2015-05-01

    Full Text Available A 5-month-old castrated male Sphynx kitten presented with left hindlimb lameness shortly after adoption. Prior to adoption, the breeder had fed the kitten an exclusively raw chicken diet. Radiographs revealed generalized osteopenia and a left tibia–fibula fracture. Ophthalmic examination revealed corneal vascularization and opacity in the right eye, and lesions suggestive of feline central retinal degeneration in the left eye. The patient’s diagnoses included metabolic bone disease and feline central retinal degeneration, which can result from taurine deficiency. The kitten’s nutritional diseases were managed with a complete and balanced canned diet designed for kitten growth and with taurine supplementation.

  17. Lipid stability in meat and meat products.

    Science.gov (United States)

    Morrissey, P A; Sheehy, P J; Galvin, K; Kerry, J P; Buckley, D J

    1998-01-01

    Lipid oxidation is one of the main factors limiting the quality and acceptability of meats and meat products. Oxidative damage to lipids occurs in the living animal because of an imbalance between the production of reactive oxygen species and the animal's defence mechanisms. This may be brought about by a high intake of oxidized lipids or poly-unsaturated fatty acids, or a low intake of nutrients involved in the antioxidant defence system. Damage to lipids may be accentuated in the immediate post-slaughter period and, in particular, during handling, processing, storage and cooking. In recent years, pressure to reduce artificial additive use in foods has led to attempts to increase meat stability by dietary strategies. These include supplementation of animal diets with vitamin E, ascorbic acid, or carotenoids, or withdrawal of trace mineral supplements. Dietary vitamin E supplementation reduces lipid and myoglobin oxidation, and, in certain situations, drip losses in meats. However, vitamin C supplementation appears to have little, if any, beneficial effects on meat stability. The effect of feeding higher levels of carotenoids on meat stability requires further study. Some studies have demonstrated that reducing the iron and copper content of feeds improves meat stability. Post-slaughter carnosine addition may be an effective means of improving lipid stability in processed meats, perhaps in combination with dietary vitamin E supplementation.

  18. Myoglobin chemistry and meat color.

    Science.gov (United States)

    Suman, Surendranath P; Joseph, Poulson

    2013-01-01

    Consumers rely heavily on fresh meat color as an indicator of wholesomeness at the point of sale, whereas cooked color is exploited as an indicator of doneness at the point of consumption. Deviations from the bright cherry-red color of fresh meat lead to product rejection and revenue loss. Myoglobin is the sarcoplasmic heme protein primarily responsible for the meat color, and the chemistry of myoglobin is species specific. The mechanistic interactions between myoglobin and multiple extrinsic and intrinsic factors govern the color of raw as well as cooked meats. The objective of this review is to provide an overview of the current research in meat color and how the findings are applied in the meat industry. Characterizing the fundamental basis of myoglobin's interactions with biomolecules in postmortem skeletal muscles is necessary to interpret the chemistry of meat color phenomena and to engineer innovative processing strategies to minimize meat discoloration-induced revenue loss to the agricultural economy.

  19. Strand-specific transcriptomes of Enterohemorrhagic Escherichia coli in response to interactions with ground beef microbiota: interactions between microorganisms in raw meat.

    Science.gov (United States)

    Galia, Wessam; Leriche, Francoise; Cruveiller, Stéphane; Garnier, Cindy; Navratil, Vincent; Dubost, Audrey; Blanquet-Diot, Stéphanie; Thevenot-Sergentet, Delphine

    2017-08-03

    Enterohemorrhagic Escherichia coli (EHEC) are zoonotic agents associated with outbreaks worldwide. Growth of EHEC strains in ground beef could be inhibited by background microbiota that is present initially at levels greater than that of the pathogen E. coli. However, how the microbiota outcompetes the pathogenic bacteria is unknown. Our objective was to identify metabolic pathways of EHEC that were altered by natural microbiota in order to improve our understanding of the mechanisms controlling the growth and survival of EHECs in ground beef. Based on 16S metagenomics analysis, we identified the microbial community structure in our beef samples which was an essential preliminary for subtractively analyzing the gene expression of the EHEC strains. Then, we applied strand-specific RNA-seq to investigate the effects of this microbiota on the global gene expression of EHEC O26 21765 and O157 EDL933 strains by comparison with their behavior in beef meat without microbiota. In strain O26 21765 , the expression of genes connected with nitrate metabolism and nitrite detoxification, DNA repair, iron and nickel acquisition and carbohydrate metabolism, and numerous genes involved in amino acid metabolism were down-regulated. Further, the observed repression of ftsL and murF, involved respectively in building the cytokinetic ring apparatus and in synthesizing the cytoplasmic precursor of cell wall peptidoglycan, might help to explain the microbiota's inhibitory effect on EHECs. For strain O157 EDL933 , the induced expression of the genes implicated in detoxification and the general stress response and the repressed expression of the peR gene, a gene negatively associated with the virulence phenotype, might be linked to the survival and virulence of O157:H7 in ground beef with microbiota. In the present study, we show how RNA-Seq coupled with a 16S metagenomics analysis can be used to identify the effects of a complex microbial community on relevant functions of an individual

  20. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    OpenAIRE

    Juni Sumarmono; Samsu Wasito

    2010-01-01

    Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thor...

  1. Radiation decontamination of meat lyophylized products

    International Nuclear Information System (INIS)

    Migdal, W.; Owczarczyk, H.B.

    2002-01-01

    There is an increasing demand for a powder soups and sauces composed with lyophylizated meat. Technology of lyophylization is not always accompanied by thermal treatment of raw materials. That is the reason the meat lyophylization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment

  2. Detection of thermophilic Campylobacter sp. in raw chicken sausages by methods ISO 10272: 2006 in Curitiba - Parana State - Brazil

    Directory of Open Access Journals (Sweden)

    K. Konell

    2014-12-01

    Full Text Available The aim of this study was the detection of Campylobacter sp. in raw chicken sausages using the methods ISO 10272-1 and ISO 10272-2. The overall prevalence of Campylobacter sp. in the samples tested was 16.67%, representing a serious risk to the health of consumers, particularly if measures guaranteeing proper cooking of foods and prevention of cross-contamination are not adopted. Furthermore, the majority of campylobacteriosis cases in humans are caused by consumption or improper handling of contaminated raw or undercooked poultry meat, which constitute the main vehicle of this infection.

  3. Advancements in meat packaging.

    Science.gov (United States)

    McMillin, Kenneth W

    2017-10-01

    Packaging of meat provides the same or similar benefits for raw chilled and processed meats as other types of food packaging. Although air-permeable packaging is most prevalent for raw chilled red meat, vacuum and modified atmosphere packaging offer longer shelf life. The major advancements in meat packaging have been in the widely used plastic polymers while biobased materials and their integration into composite packaging are receiving much attention for functionality and sustainability. At this time, active and intelligent packaging are not widely used for antioxidant, antimicrobial, and other functions to stabilize and enhance meat properties although many options are being developed and investigated. The advances being made in nanotechnology will be incorporated into food packaging and presumably into meat packaging when appropriate and useful. Intelligent packaging using sensors for transmission of desired information and prompting of subsequent changes in packaging materials, environments or the products to maintain safety and quality are still in developmental stages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Survey of domestic food handling practices in New Zealand.

    Science.gov (United States)

    Gilbert, S E; Whyte, R; Bayne, G; Paulin, S M; Lake, R J; van der Logt, P

    2007-07-15

    The purpose of this survey was to obtain information on the domestic meat and poultry handling practices of New Zealanders in order to support the development of quantitative risk models, as well as providing data to underpin food safety campaigns to consumers. A sample of 1000 New Zealand residents, over 18 years of age, were randomly selected from the electoral roll and asked to participate in a national postal food safety study during 2005. Three hundred and twenty six respondents completed and returned questionnaires containing usable answers, and most of these respondents 'always' prepared the main meal within the household. The majority of meat (84.6%) and poultry (62.9%) purchased by New Zealanders was fresh (rather than frozen), and most consumers (94.4%) claimed that the time taken from food selection to reaching their home was 1 h or less. The majority (approximately 64%) of fresh meat and poultry was frozen in the home and the most favoured method of thawing was at room temperature for up to 12 h. The most common time period for storing cooked or raw meat and poultry in domestic refrigerators was up to 2 days. Most survey respondents preferred their meat and poultry to be cooked either medium or well done. The most popular cooking method for chicken was roasting or baking, while most respondents preferred to pan-fry steak/beef cuts, minced beef or sausages/hamburgers. The potential for undercooking was greatest with pan-fried steak with 19.8% of respondents preferring to consume this meat raw or rare. In answer to questions relating to food handling hygiene practices, 52.2% of respondents selected a hand washing sequence that would help prevent cross contamination. However, it was estimated that 41% and 28% of respondents would use knives and kitchen surfaces respectively in a manner that could allow cross contamination. The data in this survey are self-reported and, particularly for the hygiene questions, respondents may report an answer that they

  5. Consumer Poultry Handling Behavior in the Grocery Store and In-Home Storage.

    Science.gov (United States)

    Donelan, Amy K; Chambers, Delores H; Chambers, Edgar; Godwin, Sandria L; Cates, Sheryl C

    2016-04-01

    Considerable work on consumers' food safety habits has highlighted issues associated with home food preparation. However, consumer handling of foods, such as poultry, during shopping and storage has not been noted. The objective of this study was to determine consumer behaviors during purchasing and initial storage of raw poultry to determine potential cross-contamination issues. A shop-along observational study was conducted to determine actual shopping, transportation, and storage behavior of consumers who purchase raw poultry products. Neither hand sanitizer nor wipes were observed in 71% of grocery store meat sections of stores visited. Plastic bags could be found in the meat section 85% of the time, but only 25% of shoppers used the bag for their raw poultry purchases. During checkout, the poultry was bagged separately from other products 71% of the time. A majority of shoppers stored raw poultry in the original package without an additional container or overwrap. Overall, there needs to be an increase in food safety education on the handling of poultry during purchasing, transportation, and storage.

  6. U.S. Food Safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: analysis of set results.

    Science.gov (United States)

    Naugle, Alecia Larew; Barlow, Kristina E; Eblen, Denise R; Teter, Vanessa; Umholtz, Robert

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) tests sets of samples of selected raw meat and poultry products for Salmonella to ensure that federally inspected establishments meet performance standards defined in the pathogen reduction-hazard analysis and critical control point system (PR-HACCP) final rule. In the present report, sample set results are described and associations between set failure and set and establishment characteristics are identified for 4,607 sample sets collected from 1998 through 2003. Sample sets were obtained from seven product classes: broiler chicken carcasses (n = 1,010), cow and bull carcasses (n = 240), market hog carcasses (n = 560), steer and heifer carcasses (n = 123), ground beef (n = 2,527), ground chicken (n = 31), and ground turkey (n = 116). Of these 4,607 sample sets, 92% (4,255) were collected as part of random testing efforts (A sets), and 93% (4,166) passed. However, the percentage of positive samples relative to the maximum number of positive results allowable in a set increased over time for broilers but decreased or stayed the same for the other product classes. Three factors associated with set failure were identified: establishment size, product class, and year. Set failures were more likely early in the testing program (relative to 2003). Small and very small establishments were more likely to fail than large ones. Set failure was less likely in ground beef than in other product classes. Despite an overall decline in set failures through 2003, these results highlight the need for continued vigilance to reduce Salmonella contamination in broiler chicken and continued implementation of programs designed to assist small and very small establishments with PR-HACCP compliance issues.

  7. CLOSTRIDIUM PERFRINGENS IN MEAT AND MEAT PRODUCTS.

    Science.gov (United States)

    HALL, H E; ANGELOTTI, R

    1965-05-01

    A total of 262 specimens of meat and meat dishes were examined for the presence of Clostridium perfringens. Of this total, 161 were raw, unprocessed beef, veal, lamb, pork, or chicken; 101 were processed meats and meat dishes. C. perfringens was isolated from 113 (43.1%) of these specimens. The highest percentage of contamination (82%) was found in veal cuts, and the lowest (4.7%) in sliced sandwich meats and spreads. Only 2 of the 113 isolates were shown to produce heat-resistant spores, which indicates a very low incidence (0.8%) of contamination. These findings indicate that outbreaks of C. perfringens food-borne disease in the Cincinnati area are caused principally by the contamination of the food with vegetative cells or spores of the organism after cooking. Studies of the effects of various holding temperatures on the growth of C. perfringens indicated that, in the range of 5 to 15 C, no multiplication would occur, but that viable cells would still be present at the end of a 5-day holding period. Extremely rapid growth occurred at temperatures around 45 C, and complete inhibition of growth was accomplished between 49 and 52 C.

  8. Meat Processing.

    Science.gov (United States)

    Legacy, Jim; And Others

    This publication provides an introduction to meat processing for adult students in vocational and technical education programs. Organized in four chapters, the booklet provides a brief overview of the meat processing industry and the techniques of meat processing and butchering. The first chapter introduces the meat processing industry and…

  9. Meat spoilage during distribution.

    Science.gov (United States)

    Nychas, George-John E; Skandamis, Panos N; Tassou, Chrysoula C; Koutsoumanis, Konstantinos P

    2008-01-01

    Meat spoilage during distribution can be considered as an ecological phenomenon that encompasses the changes of the available substrata (e.g., low molecular compounds), during the prevailing of a particular microbial association, the so-called specific spoilage organisms (SSO). In fact, spoilage of meat depends on an even smaller fraction of SSO, called ephemeral spoilage organisms (ESO). These ESO are the consequence of factors that dynamically persist or imposed during, e.g., processing, transportation and storage in the market. Meanwhile spoilage is a subjective judgment by the consumer, which may be influenced by cultural and economic considerations and background as well as by the sensory acuity of the individual and the intensity of the change. Indeed, when spoilage progresses, most consumers would agree that gross discoloration, strong off-odors, and the development of slime would constitute the main qualitative criteria for meat rejection. On the other hand, meat industry needs rapid analytical methods or tools for quantification of these indicators to determine the type of processing needed for their raw material and to predict remaining shelf life of their products. The need of an objective evaluation of meat spoilage is of great importance. The use of metabolomics as a potential tool for the evaluation of meat spoilage can be of great importance. The microbial association of meat should be monitored in parallel with the estimation of changes occurring in the production and/or assimilation of certain compounds would allow us to evaluate spoilage found or produced during the storage of meat under different temperatures as well as packaging conditions.

  10. Raw data

    DEFF Research Database (Denmark)

    Walford, Antonia

    2017-01-01

    . Although science and technology studies (STS) makes a strong case for associating relationality with certainty, the article argues that a particular form of data, ‘raw data’, complicates this association. It further argues that scientific data is not simply composed out of relations, but is a relation......This article takes scientific ‘raw data’ as its ethnographic object in order to investigate the co-implication of nature and culture in scientific knowledge practices. The article traces out some of the activities that are involved in producing numerical climate data from the Brazilian Amazon...... itself. The article ends with a brief reflection on the possible repercussions of shifting from thinking of science as producing multiple natures and cultures to thinking of it as producing the potential for relations....

  11. Studies on the quality of duck meat sausages during refrigeration.

    Science.gov (United States)

    Naveen, Z; Naik, B R; Subramanyam, B V; Reddy, P M

    2016-01-01

    Duck farming is on the raise in the current scenario, but processed products from duck meat are still uncommon to find. Investigating the duck meat qualities during storage will provide information to enhance duck meat utilization. Development of ready-to-eat and ready-to-cook duck meat products is expected to increase and improve non-chicken meat-based protein. The Study was aimed to evaluate the changes in quality characteristics of duck meat sausages preserved by refrigeration (7 ± 1 °C). Duck meat sausages were prepared by utilizing raw and partially cooked duck meat with addition of soy flour at 10% level as a binder. Different quality characteristics like physical and chemical characteristics, proximate composition, and organoleptic characteristics were evaluated. Cooking loss of partially cooked meat sausages was lower than raw duck meat sausages, whereas emulsion stability and 2-thiobarbituric acid (TBA) values of raw duck meat sausages were lesser than partially cooked meat sausages. Cooking loss and emulsion stability decreased in both types of meat sausages, while, 2-TBA values increased as refrigerated storage progressed for 14 days. Percent moisture content of raw duck meat sausages was higher than partially cooked meat sausages, which decreased in both types of meat sausages as refrigerated storage progressed for 14 days. Percent crude protein (CP) and percent ether extract (EE) content of partially cooked duck meat sausages were higher than raw duck meat sausages. Regardless of type of meat used, refrigerated storage of sausages increased CP and EE up to 10th day but decreased upon further storage up to 14th day. Organoleptic scores for raw duck meat sausages were higher than partially cooked duck meat sausages and all the scores decreased with an increase in the storage period. However the scores were within the acceptable limits. The findings prove that, duck meat can be effectively acclaimed as an alternative avenue to meet the escalating

  12. Unraveling the chemical identity of meat pigments.

    Science.gov (United States)

    Pegg, R B; Shahidi, F

    1997-10-01

    This review examines the chemistry of nitrite curing of meat and meat products as it relates to the development of cured meat color and provides a detailed account of how nitrite-free processed meats could be prepared using the preformed cooked cured-meat pigment (CCMP). Thus, a chemical description of meat color, both raw and cooked, and characterization of nitrosylheme pigments follows. Based on electron paramagnetic resonance (EPR), visible and infrared spectroscopic studies, evidence has been provided to support the hypothesis that the chemical structure of the preformed CCMP is identical to that of the pigment prepared in situ after thermal processing of nitrite-cured meat and is in fact a mononitrosylheme complex. An appendix, which describes the basic principles of EPR spectroscopy used in the context of this review, is attached.

  13. Nutritional quality of raw and processed unripe Carica papaya fruit ...

    African Journals Online (AJOL)

    the unripe or green fruit is added into fresh salads (Boshra .... Copper showed the least concentration being undetectable in the raw and dried-cooked samples ..... meat. COMPETING INTERESTS. The authors declare that there is no conflict of ...

  14. Trichinellosis acquired in Nunavut, Canada in September 2009: meat from grizzly bear suspected.

    Science.gov (United States)

    Houzé, S; Ancelle, T; Matra, R; Boceno, C; Carlier, Y; Gajadhar, A A; Dupouy-Camet, J

    2009-11-05

    Five cases of trichinellosis with onset of symptoms in September 2009, were reported in France, and were probably linked to the consumption of meat from a grizzly bear in Cambridge Bay in Nunavut, Canada. Travellers should be aware of the risks of eating raw or rare meat products in arctic regions, particularly game meat such as bear or walrus meat.

  15. Influence of Skin Packaging on Raw Beef Quality: A Review

    Directory of Open Access Journals (Sweden)

    S. Stella

    2018-01-01

    Full Text Available A detailed revision of several aspects related to the application of skin packaging to raw beef was considered. Skin packaging, a relatively new technique derived from vacuum packaging, was developed with the aim of retailing small portions of fresh meat, minced meat, or meat preparations. Above all, the influence of this typology of packaging on the microbial population of raw meat was studied, with particular attention to total viable count, aerobic spoilage bacteria, anaerobic bacteria, Enterobacteriaceae, Brochothrix thermosphacta, and lactic acid bacteria. Moreover, the effect on acidification by LAB was also deepened. As colour is the main characteristic influencing purchase decisions at the point of sale, the effect of skin packaging on this parameter was evaluated for raw meat but also for cooked meat. Tenderness, juiciness, and the ability to hold liquid of raw meat when packed in skin conditions were also considered. Furthermore, odour and flavour were considered as sensorial parameters possibly affected by skin packaging. Finally, acceptability by consumer was also investigated. In the studies considered, results showed that skin packaging is advantageous in terms of maintenance of meat quality and for prolonging shelf-life, improving the stability of the products.

  16. Main Concerns of Pathogenic Microorganisms in Meat

    Science.gov (United States)

    Nørrung, Birgit; Andersen, Jens Kirk; Buncic, Sava

    Although various foods can serve as sources of foodborne illness, meat and meat products are important sources of human infections with a variety of foodborne pathogens, i.e. Salmonella spp., Campylobacter jejuni/coli, Yersinia enterocolitica, Verotoxigenic E. coli and, to some extent, Listeria monocytogenes. All these may be harboured in the gastrointestinal tract of food-producing animals. The most frequent chain of events leading to meat-borne illness involves food animals, which are healthy carriers of the pathogens that are subsequently transferred to humans through production, handling and consumption of meat and meat products. Occurrences of Salmonella spp., C. jejuni/coli, Y. enterocolitica and Verotoxigenic E. coli in fresh red meat vary relatively widely, although most often are between 1 and 10%, depending on a range of factors including the organism, geographical factors, farming and/or meat production practices.

  17. Meet meat

    NARCIS (Netherlands)

    Bekker, Gerben A.; Tobi, Hilde; Fischer, Arnout R.H.

    2017-01-01

    In this cross-cultural study we investigated how study participants from China, Ethiopia and the Netherlands operationalize the concept of meat and to what extent cultured meat fits or does not fit into this operationalization. We argue that combining the conceptual approaches symbolic boundaries

  18. Functional Characteristics of Spent Duck Meat for Use in Emulsion-Type Meat Products

    Directory of Open Access Journals (Sweden)

    Juni Sumarmono

    2010-01-01

    Full Text Available Spent ducks produce nutritive meat; however the meat possesses undesirable characteristics such as strong odor and tough. Hence, appropriate yet simple processing technologies need to be developed in order to maximize the use of duck meat. The experiment was conducted to evaluate functional characteristics of spent duck meat as raw material for the production of emulsion-type meat products, such as nugget and sausage. Chilled carcasses of 96 spent ducks were deboned manually, then mixed thoroughly and ground using a 5 mm diameter grinding plate. The ground meat was divided into 4 batches (group of treatments; one batch was treated with iced tap water (M1, one batch with 0.1% NaCl solution (M2, one batch with 0.5% NaHCO3 solution (M3, and one batch was left as is as control (M4. Variables measured were water holding capacity (WHC, pH, emulsion capacity and stability of the meat; and firmness and tenderness of the meat gel. Results showed that M1 meat has significantly higher WHC (less percentage of free water than control (M4, whereas M2 and M3 meat has similar WHC to control. Processing caused the ground duck meat to have significantly higher pH than control. The highest meat pH was observed in M3, followed by M2, M1 and control. Processing duck meat with iced tap water, NaCl or NaHCO3 produced significantly more tender meat gel compared to untreated meat (as is. Tenderness of meat gel of M3 was the most tender followed by M2 and M1. Similar results for meat gel firmness were observed. No significant differences were observed in term of emulsion capacity (expressed as ml oil/gr protein and ml oil/gr fresh meat, emulsion stability (expressed as ml oil and total liquid released per 100 gr emulsion, and cooking recovery (%. The study reported in this paper offers simple processing technologies to improve functional characteristics of spent duck meat to be use as raw material for the production of emulsion type meat products. (Animal Production 12

  19. Significance of authenticity in meat and meat products in Iran

    Directory of Open Access Journals (Sweden)

    Tahereh Rezazadeh

    2014-06-01

    Full Text Available The Authenticity of meat products is very important for religious and health reasons in Iran. According to legislation in Iran, the consumption and importation of pork, horse, donkey and cat products should be banned. Therefore, the identification of meat products cannot be judged solely by its appearance. This issue led to the authenticity of bovine, sheep, pig, horse, donkey, chicken and soya (Glycine max in raw and processed meat products.In this study, specific primers were designed for the identification of pig ( base pair, donkey (325 base pair, chicken (391 base pair, sheep (499 base pair, horse (607 base pair, soya (707 base pair and bovine (853 base pair by Polymerase chain reaction. Following PCR, expected,, , 499,,  and  base pair fragments were detectable in pig, donkey, chicken, sheep, horse, soya and bovine, respectively. This protocol can be used for identification of raw and processed meat products in various animal species for replication to regulatory obligations for meat species safety in Iran.

  20. Meat production perspective in Yucatan

    Directory of Open Access Journals (Sweden)

    Victor M. Toledo-Lopez

    2011-12-01

    Full Text Available The evolution of meat production in Mexico during the last decade is the result of the complex interaction between different areas of livestock production and consumers’ preferences, being the former widely influenced by new tendencies and purchasing capacity. In Yucatan, there are two meat product processing plants. Yucatan’s research projects are basically focused to production, handling and genetics. This research is developed in Research Centers like Universidad Autonoma Yucatan’s Ciencias Biologicas Agropecuarias Campus, INIFAP Mococha, Instituto Tecnologico Conkal and Instituto Tecnologoco Merida. Many projects are inter-institutional and others by Cuerpos Academicos inside the institutions. Grants are provided by state, national or international dependencies. In the Instituto Tecnologico Merida research projects are on different animals’ meat quality and novel meat products.

  1. Meat flavour

    International Nuclear Information System (INIS)

    Rosset, R.; Liger, P.; Roussel-Ciquard, N.

    1978-01-01

    For the consumer, meat is characterized by a certain number of organoleptic qualities; among them, flavour -that is to say the association of both odour and taste- plays a leading part. This property is based upon a great number of chemical components: some volatile components are responsible for the aroma and some non-volatile ones for the taste. These substances are either made or released during the heating of the meat on account of components called precursors which are produced during the aging of the meat. The two main reactions which preside over the elaboration of flavour are: the Maillard's reaction and the autooxidation reactions. Meat flavour is associated with the animal characteristics; it is influenced by the ante- and post mortem treatments as well as by the technological treatments for storing it. The use of synthetical flavours is to be considered as possible in the future [fr

  2. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

  3. Meat flavour in pork and beef - From animal to meal.

    Science.gov (United States)

    Aaslyng, Margit D; Meinert, Lene

    2017-10-01

    An intense meat flavour is greatly appreciated by consumers. Meat flavour is generated during the cooking process through a complex series of chemical reactions between precursors, intermediate reaction products and degradation products. The content and nature of the precursors present in the meat are affected by several factors including genetics, feed, handling of the live animals and subsequent handling of the meat. The fatty acid composition can easily be altered though feeding, especially in monogastric animals, while the carbohydrate content is more closely related to genetics (pigs), feeding in the last days before slaughter and handling at slaughter (both ante and post mortem). Ageing of the meat is not particularly important for the flavour, unless the meat is dry-aged. In comparison, cooking is crucial for the development of flavour. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. INFLUENCE OF AUTOLYTIC TRANSFORMATIONS ON ELECTROPHYSICAL PROPERTIES OF GOAT MEAT

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2014-01-01

    Full Text Available Functional foods represented an important element of a balanced, healthy diet. They play an important role in improving the structure of the diet of the population, are a means of prevention, correction and prevention of early transition premorbid conditions and various diseases. Meat and meat products based on it can be considered as a promising raw material for functional foods. Goat has certain dietary properties and can be used in manufacturing, but the production of high-grade products from goat meat, capable of long-term storage is not well developed. The chemical composition of the new raw meat - goat meat, on the example of the longissimus muscle of back is rich in protein, moisture, ash, and low-fat compared with other types of raw meat, which lets you create based on goat meat sector wide functional meat products. Therefore investigated the possibility of using goat meat in the production technology of functional foods. Showing the prospects for the development of goat in Russia. Investigated character of autolysis goat meat electro-physical methods and histological analysis. In the process of autolysis of goat meat are changing the electrical properties of raw meat, which are correlated with the morphological characteristics. Basic autolytic changes occurring in muscle tissue in the early stages of ripening, were reduced to a small extent the political process involving varying degrees of muscle structure in the early stages. In the later stages of maturation revealed changing widespread. Revealed that autolysis has characteristic periods and develops within 12 hours, further changes are irreversible. Shows the change in pH, carbohydrate fractions in the longissimus muscle of back goat. Results of the study of dynamics of change in pH, carbohydrate fractions in the longissimus muscle of back goat show compliance with the laws of classical autolysis noted in other sources, but differ in the time period. Defined stages of autolysis in

  5. Molecular assay to fraud identification of meat products.

    Science.gov (United States)

    Doosti, Abbas; Ghasemi Dehkordi, Payam; Rahimi, Ebrahim

    2014-01-01

    Detection of species fraud in meat products is important for consumer protection and food industries. A molecular technique such as PCR method for detection of beef, sheep, pork, chicken, donkey, and horse meats in food products was established. The purpose of this study was to identification of fraud and adulteration in industrial meat products by PCR-RFLP assay in Iran. In present study, 224 meat products include 68 sausages, 48 frankfurters, 55 hamburgers, 33 hams and 20 cold cut meats were collected from different companies and food markets in Iran. Genomic DNA was extracted and PCR was performed for gene amplification of meat species using specific oligonucleotid primers. Raw meat samples are served as the positive control. For differentiation between donkey's and horse's meat, the mitochondrial DNA segment (cytochrome-b gene) was amplified and products were digested with AluI restriction enzyme. Results showed that 6 of 68 fermented sausages (8.82%), 4 of 48 frankfurters (8.33%), 4 of 55 hamburgers (7.27%), 2 of 33 hams (6.6%), and 1 of 20 cold cut meat (5%) were found to contain Haram (unlawful or prohibited) meat. These results indicate that 7.58% of the total samples were not containing Halal (lawful or permitted) meat and have another meat. These findings showed that molecular methods such as PCR and PCR-RFLP are potentially reliable techniques for detection of meat type in meat products for Halal authentication.

  6. In-gel and OFFGEL-based proteomic approach for authentication of meat species from minced meat and meat products.

    Science.gov (United States)

    Naveena, Basappa M; Jagadeesh, Deepak S; Kamuni, Veeranna; Muthukumar, Muthupalani; Kulkarni, Vinayak V; Kiran, Mohan; Rapole, Srikanth

    2018-02-01

    Fraudulent mislabelling of processed meat products on a global scale that cannot be detected using conventional techniques necessitates sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed an in-gel (two-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes. The matrix-assisted liquid desorption/ionization time-of-flight mass spectrometric analysis of proteins separated using 2DE or OFFGEL electrophoresis delineated species-specific peptide biomarkers derived from myosin light chain 1 and 2 (MLC1 and MLC2) of buffalo-sheep-goat meat mix in definite proportions at 98:1:1, 99:0.5:0.5 and 99.8:0.1:0.1 that were found stable to resist thermal processing. In-gel and OFFGEL-based proteomic approaches are efficient in authenticating meat mixes spiked at minimum 1.0% and 0.1% levels, respectively, in triple meat mix for both raw and cooked samples. The study demonstrated that authentication of meat from a complex mix of three closely related species requires identification of more than one species-specific peptide due to close similarity between their amino acid sequences. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  7. SELECTION OF MICROORGANISMS FOR FERMENTATION OF MEAT MATERIALS

    Directory of Open Access Journals (Sweden)

    Danylenko S. G.

    2014-08-01

    Full Text Available Principal criteria for the selection of microorganisms with a wide range of biological and technological properties for fermentation of raw meats are considered. Attention is paid to the main groups of microorganisms such as Micrococсus, Staphylococcus, Lactobacillus, Bifidobacterium and Propionibacterium which are promising for creation of bacterial preparations. To create bacterial preparations, the basic criteria of selection for microorganisms were determined as follows: the ability of microorganisms to be developed within the specific ecological niche (raw meat materials and their influence on flavor characteristics of the final product under the conditions of intensification of production technologies of meat products. Methods used for search and retrieval of technologically promising strains from different natural sources (fresh meats, minced meats, meat, dairy and sour-milk products, vegetables, fruit, brines and mixtures for salting are considered.

  8. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    International Nuclear Information System (INIS)

    Castejón, David; García-Segura, Juan Manuel; Escudero, Rosa; Herrera, Antonio; Cambero, María Isabel

    2015-01-01

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by "1H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  9. Metabolomics of meat exudate: Its potential to evaluate beef meat conservation and aging

    Energy Technology Data Exchange (ETDEWEB)

    Castejón, David [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); García-Segura, Juan Manuel [Centro de Asistencia a la Investigación de Resonancia Magnética Nuclear y de Espín Electrónico, Universidad Complutense de Madrid, 28040 Madrid (Spain); Departamento de Bioquímica y Biología Molecular I, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Escudero, Rosa [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain); Herrera, Antonio [Departamento de Química Orgánica, Facultad de Químicas, Universidad Complutense de Madrid, 28040 Madrid (Spain); Cambero, María Isabel, E-mail: icambero@vet.ucm.es [Departamento de Nutrición, Bromatología y Tecnología de los Alimentos, Facultad de Veterinaria. Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2015-12-11

    In this study we analyzed the exudate of beef to evaluate its potential as non invasive sampling for nuclear magnetic resonance (NMR) based metabolomic analysis of meat samples. Exudate, as the natural juice from raw meat, is an easy to obtain matrix that it is usually collected in small amounts in commercial meat packages. Although meat exudate could provide complete and homogeneous metabolic information about the whole meat piece, this sample has been poorly studied. Exudates from 48 beef samples of different breeds, cattle and storage times have been studied by {sup 1}H NMR spectroscopy. The liquid exudate spectra were compared with those obtained by High Resolution Magic Angle Spinning (HRMAS) of the original meat pieces. The close correlation found between both spectra (>95% of coincident peaks in both registers; Spearman correlation coefficient = 0.945) lead us to propose the exudate as an excellent alternative analytical matrix with a view to apply meat metabolomics. 60 metabolites could be identified through the analysis of mono and bidimensional exudate spectra, 23 of them for the first time in NMR meat studies. The application of chemometric tools to analyze exudate dataset has revealed significant metabolite variations associated with meat aging. Hence, NMR based metabolomics have made it possible both to classify meat samples according to their storage time through Principal Component Analysis (PCA), and to predict that storage time through Partial Least Squares (PLS) regression. - Highlights: • NMR spectra from beef samples and their exudates are very strongly correlated. • 23 metabolites not reported in previous NMR meat studies have been identified. • Meat exudate NMR spectra allow monitoring of biochemical changes related to aging. • PCA of exudate NMR spectra classified meat samples by their storage time. • The aging of a meat sample can be predicted by PLS analysis of its exudate.

  10. Advances in ingredient and processing systems for meat and meat products.

    Science.gov (United States)

    Weiss, Jochen; Gibis, Monika; Schuh, Valerie; Salminen, Hanna

    2010-09-01

    Changes in consumer demand of meat products as well as increased global competition are causing an unprecedented spur in processing and ingredient system developments within the meat manufacturing sector. Consumers demand healthier meat products that are low in salt, fat, cholesterol, nitrites and calories in general and contain in addition health-promoting bioactive components such as for example carotenoids, unsaturated fatty acids, sterols, and fibers. On the other hand, consumers expect these novel meat products with altered formulations to taste, look and smell the same way as their traditionally formulated and processed counterparts. At the same time, competition is forcing the meat processing industry to use the increasingly expensive raw material "meat" more efficiently and produce products at lower costs. With these changes in mind, this article presents a review of novel ingredient systems and processing approaches that are emerging to create high quality, affordable meat products not only in batch mode but also in large-scale continuous processes. Fat replacers, fat profile modification and cholesterol reduction techniques, new texture modifiers and alternative antioxidant and antimicrobial systems are being discussed. Modern processing equipment to establish continuously operating product manufacturing lines and that allow new meat product structures to be created and novel ingredients to be effectively utilized including vacuum fillers, grinders and fine dispersers, and slicers is reviewed in the context of structure creation in meat products. Finally, trends in future developments of ingredient and processing systems for meat products are highlighted.

  11. Meat waste as feedstock for home composting: Effects on the process and quality of compost.

    Science.gov (United States)

    Storino, Francesco; Arizmendiarrieta, Joseba S; Irigoyen, Ignacio; Muro, Julio; Aparicio-Tejo, Pedro M

    2016-10-01

    Home composting is a powerful tool, which is spreading in different parts of the world, to reduce the generation of municipal waste. However, there is debate concerning the appropriateness, in terms of domestic hygiene and safety, of keeping a composter bin in the household deputed to kitchen waste of animal origin, such as meat or fish scraps and pet droppings. The purpose of our work was to study how the addition of meat scraps to household waste influences the composting process and the quality of the final compost obtained. We compared four raw material mixtures, characterized by a different combination of vegetable and meat waste and different ratios of woody bulking agent. Changes in temperature, mass and volume, phenotypic microbial diversity (by Biolog™) and organic matter humification were determined during the process. At the end of the experiment, the four composts were weighed and characterized by physicochemical analysis. In addition, the presence of viable weed seeds was investigated and a germination bioassay was carried out to determine the level of phytotoxicity. Finally, the levels of pathogens (Escherichia coli and Salmonella spp.) were also determined in the final compost. Here we show that the presence of meat waste as raw feedstock for composting in bins can improve the activity of the process, the physicochemical characteristics and maturity of the compost obtained, without significantly affecting its salinity, pH and phytotoxicity. Pathogen levels were low, showing that they can be controlled by an intensive management and proper handling of the composter bins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Microbiological quality of poultry meat: a review

    Directory of Open Access Journals (Sweden)

    GC Mead

    2004-09-01

    Full Text Available Poultry meat can be contaminated with a variety of microorganisms, including those capable of spoiling the product during chill storage, and certain foodborne pathogens. Human illness may follow from handling of raw meat, undercooking or mishandling of the cooked product. While Salmonella and Campylobacter spp. remain the organisms of greatest global concern in this respect, others present include the more recently reported Arcobacter and Helicobacter spp. and, occasionally, verotoxigenic Escherichia coli. Also considered here is the growing problem of antimicrobial resistance among poultry-associated pathogens. Because of the need for a systematic and universally applicable approach to food safety control, the Hazard Analysis Critical Control Point (HACCP concept is increasingly being introduced into the Poultry Industry, and Quantitative Risk Assessment (QRA is being applied to microbial hazards. Among a number of completed and on-going studies on QRA are those undertaken by FAO/WHO on Salmonella and Campylobacter in broilers. In the case of Campylobacter, however, any QRA must assume at present that all strains have the same pathogenic potential for humans and comparable survival capabilities, even though this is unlikely to be the case. Implementation of the HACCP system in poultry processing plants addresses zoonotic agents that are not detectable by conventional meat inspection procedures and can help to control contamination of carcasses with spoilage organisms. The system brings obvious benefits in optimising plant hygiene, ensuring compliance with legislation and providing evidence of 'due diligence' on the part of the processor. It is now being applied globally in two different situations: in one, such as that occurring in the USA, carcass contamination is clearly reduced as carcasses pass through the process and are finally chilled in super-chlorinated water. There is also the option to use a chemical-rinse treatment for further

  13. Radiation decontamination of meat lyophilized products

    International Nuclear Information System (INIS)

    Owczarczyk, H.B.; Migdal, W.

    2002-01-01

    There is an increasing demand for powder soups and sauces compose with lyophilized products. Technology of lyophilization is not always accompanied by thermal treatment of raw materials. That is the reason the products lyophilization process does not ensure as good microbiological quality as is required. Degree of microbiological decontamination and organoleptic properties of lyophilized meat were investigated after radiation treatment. (author)

  14. Thawing of Frozen Tuna Meat

    Science.gov (United States)

    Tanaka, Takeo; Nishiwaki, Kôji; Kakuda, Kitonari; Tomimatsu, Takao

    Frozen southern bluefin tuna meat discolors easily and sometimes contracts when thawed caused by thaw rigor. These phenomenon often become problematic in the transaction or handling of this kind of frozen tuna. Frozen meat blocks of southern Bluefin tuna were thawed separately by air thawing, running water thawing and microwave thawing. Changes occurring during thawing were checked for meat color by met-myoglobin ratio determination and for contract by microscopic observation. Results are as follows : (1) Discoloration scarcely occurred in the process of running water thawing (at 10°C for 50 min, or at 0°C for 6 hr). (2) No contraction was observed during thawing with running water described above and air thawing (at 18-20°C for 6 hr). (3) Discoloration and contraction seemed to be minimized, as to latently contractile blocks, when meat temperature passed through rapidly between -10°C and -5°C, and slowly (for 5-6 hr) between -5°C and -1°C. When the block was originally not contractile, discloration was minimized by rising meat temperature rapidly from -10°C to -l°C.

  15. U.S. Food safety and Inspection Service testing for Salmonella in selected raw meat and poultry products in the United States, 1998 through 2003: an establishment-level analysis.

    Science.gov (United States)

    Eblen, Denise R; Barlow, Kristina E; Naugle, Alecia Larew

    2006-11-01

    The U.S. Food Safety and Inspection Service (FSIS) pathogen reduction-hazard analysis critical control point systems final rule, published in 1996, established Salmonella performance standards for broiler chicken, cow and bull, market hog, and steer and heifer carcasses and for ground beef, chicken, and turkey meat. In 1998, the FSIS began testing to verify that establishments are meeting performance standards. Samples are collected in sets in which the number of samples is defined but varies according to product class. A sample set fails when the number of positive Salmonella samples exceeds the maximum number of positive samples allowed under the performance standard. Salmonella sample sets collected at 1,584 establishments from 1998 through 2003 were examined to identify factors associated with failure of one or more sets. Overall, 1,282 (80.9%) of establishments never had failed sets. In establishments that did experience set failure(s), generally the failed sets were collected early in the establishment testing history, with the exception of broiler establishments where failure(s) occurred both early and late in the course of testing. Small establishments were more likely to have experienced a set failure than were large or very small establishments, and broiler establishments were more likely to have failed than were ground beef, market hog, or steer-heifer establishments. Agency response to failed Salmonella sample sets in the form of in-depth verification reviews and related establishment-initiated corrective actions have likely contributed to declines in the number of establishments that failed sets. A focus on food safety measures in small establishments and broiler processing establishments should further reduce the number of sample sets that fail to meet the Salmonella performance standard.

  16. Some technological aspects of combined processing of meat by heat and ionizing radiations

    International Nuclear Information System (INIS)

    Gel'fand, S.Yu.; Nomenotskaya, N.F.; Mozul', M.Ya.

    1974-01-01

    The paper discusses the use of ionizing radiation to prolong the storage life of meat and meat products. Irradiating raw meat with doses of 0.4-0.6 Mrad increased storage life up to two months at low above-zero C temperatures. The difficulty of inhibiting autolytic processes during storage of irradiated raw meat led to searches for combined methods of meat treatment. A series of experiments was staged with pre-irradiation heating of meat up to 75, 77, and 80 0 C in order to see how cathepsin activity is affected by the duration and temperature of heating in the case of combined treatment. To increase the resistance of meat products to microbial damage, tests were carried out in which meat was exposed to short-term but intensive heat by immersing it in hot (130-160 0 C) vegetable oil (frying grease). The results are presented in the form of tables and diagrams. (E.T.)

  17. PREDICTION OF MEAT PRODUCT QUALITY BY THE MATHEMATICAL PROGRAMMING METHODS

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available Abstract Use of the prediction technologies is one of the directions of the research work carried out both in Russia and abroad. Meat processing is accompanied by the complex physico-chemical, biochemical and mechanical processes. To predict the behavior of meat raw material during the technological processing, a complex of physico-technological and structural-mechanical indicators, which objectively reflects its quality, is used. Among these indicators are pH value, water binding and fat holding capacities, water activity, adhesiveness, viscosity, plasticity and so on. The paper demonstrates the influence of animal proteins (beef and pork on the physico-chemical and functional properties before and after thermal treatment of minced meat made from meat raw material with different content of the connective and fat tissues. On the basis of the experimental data, the model (stochastic dependence parameters linking the quantitative resultant and factor variables were obtained using the regression analysis, and the degree of the correlation with the experimental data was assessed. The maximum allowable levels of meat raw material replacement with animal proteins (beef and pork were established by the methods of mathematical programming. Use of the information technologies will significantly reduce the costs of the experimental search and substantiation of the optimal level of replacement of meat raw material with animal proteins (beef, pork, and will also allow establishing a relationship of product quality indicators with quantity and quality of minced meat ingredients.

  18. Residual Nitrite in Some Egyptian Meat Products and the Reduction Effect of Electron Beam Irradiation

    OpenAIRE

    Dalia A. Zahran; Gehan M.A. Kassem

    2011-01-01

    Nitrite, a curing agent of meat products, is a precursor of carcinogenic N-nitrosamines during processing of meat products or under human stomach conditions, as well as having its own toxicity. To investigate the residual nitrite level in meat products marketed in Egyptian markets, 160 samples of cured cooked (luncheon and frankfurter) and cured raw (oriental sausages and pastirma) meat products (40 sample each) were analyzed for residual nitrite by a spectrophotometric method. Samples were s...

  19. The quality evaluation of frankfurter-type sausages from hand and mechanically deboned turkey meat.

    Science.gov (United States)

    Radomyski, T; Niewiarowicz, A

    1987-03-01

    A quality evaluation was made of frankfurter-type sausages made from hand and mechanically deboned meat from various parts of turkey carcasses. The results led to the conclusions that despite some differences in objective measurements of the sausage quality, mechanically deboned turkey meat can be considered as an exclusive meat raw material for the production of frankfurter-type sausages. The quality of sausages from mechanically deboned turkey meat from wings and frames with skin was the least satisfactory.

  20. MODERN TECHNOLOGY OF FERMENTED MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    L. V. Antipova

    2015-01-01

    Full Text Available Summary. New trends of meat industry development, on the example of sausages are shown. The detailed description of indicators of quality of meat raw materials, auxiliary materials and their influence on the processes of tissue and microbial fermentation in the process of ripening raw sausages. Measures for improving the quality control of meat raw materials, auxiliary materials, as well as the processing conditions in all stages of production of smoked products are suggested. The modern technology of production of raw sausages with starter cultures and complex products, allowing better standardization process is considered. Questions of chemistry of color formation, the formation of taste and flavor, textures and the suppression of undesired microflora in foods in general, and in particular the raw sausage are thoroughly covered. Ideas about factors affecting the formation of color in sausages are given. It is pointed out that the susceptibility to oxidation of nitrosilmioglobin is directly related to the fat oxidation in the whole redox potential. Trends in the market of raw sausages are shown. Requirements used in the meat industry to starting cultures are shown. Recommendations on the rational use of starter cultures, and other functional additives in technology of uncooked fermented products, which are used to improve the quality and ensure a high level of product safety are given. The characteristic of the innovative series of starter cultures Protect, its species belonging and qualitative composition, providing a unique protection system in the process of ripening and storage of smoked products is given. The properties are proved on the example of smoked poultry sausage.

  1. Raw material versus processing

    International Nuclear Information System (INIS)

    Berg, E.A.T.

    1989-01-01

    Some brazilian aspects related with the obtainment of raw materials for advanced ceramic products are described. The necessity of import raw materials by the advanced ceramic industries is mentioned, generating dangerous depedence for the country. The brazilian mineral reserves for using in raw materials of advanced ceramic are also cited. (C.G.C.) [pt

  2. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food

    DEFF Research Database (Denmark)

    Wilcks, Andrea; Andersen, Sigrid Rita; Licht, Tine Rask

    2005-01-01

    The prevalence of tetracycline resistance, and of specific genetic determinants for this resistance was investigated in 1003 strains of Enterococcus faecalis isolated from various raw food products originating from five categories including chicken meat, other poultry meat, beef, pork, and 'other...

  3. RAW CHICKEN LEG AND BREAST SENSORY EVALUATION

    Directory of Open Access Journals (Sweden)

    Octavian Baston

    2010-01-01

    Full Text Available In the paper we presented a method of sensorial evaluation for chicken meat (red and white. This is a descriptive method of analysis. It was perform with trained assessors for chicken refrigerated raw meat organoleptical evaluation. The sensorial attributes considered were: external aspect of anatomical part of chicken analyzed by slime, the surface odor, the skin and muscle color and muscular elasticity. Color was determined for the skin and white and red muscles. Our scale of analysis is formed by three values that characterize each quality attribute. The trained assessor appreciated the sensorial quality of raw anatomical part of chicken as excellent, acceptable and unacceptable. The objectives were: to establish the sensorial attributes to be analyzed for each type of muscular fiber, to describe the quality of each considered attribute and to realize a sensorial scale of quantification for the considered sensorial attributes. Our purpose was to determine the quality of the red and white refrigerated raw chicken anatomical parts (respectively for legs and breasts after one week of storage.

  4. A balancing method for calculating a component raw involving CGF

    International Nuclear Information System (INIS)

    Kim, K.; Kang, D.; Yang, J.E.

    2004-01-01

    In this paper, a method called the 'Balancing Method' to derive a component RAW (Risk Achievement Worth) with basic event RAWs including a CCF (Common Cause Failure) RAW is summarized, and compared with the method proposed by the NEI (Nuclear Energy Institute) by mathematically checking the background on which the two methods are based. It is proved that the Balancing Method has a strong mathematically background. While the NEI method significantly underestimates the component RAW and is a little bit ad hoc in handling CCF RAW, the Balancing Method estimates the true component RAW very closely. Validity of the Balancing Method is based on the fact that if an component is out-of-service, it does not mean that the component is non-existent, but integrates the possibility that the component might fail due to CCF. The validity of the Balancing Method is proved by comparing it to the exact component RAW generated from the fault tree model

  5. Food Safety and Raw Milk

    Science.gov (United States)

    ... and Food Safety Food Safety Modernization Act Raw Milk Recommend on Facebook Tweet Share Compartir RAW MILK ... Decide? Questions & Answers Outbreak Studies Resources & Publications Raw Milk Infographic [PDF – 1 page] More Resources 5 Raw ...

  6. Chemistry in the kitchen. Making ground meat more healthful.

    Science.gov (United States)

    Small, D M; Oliva, C; Tercyak, A

    1991-01-10

    The National Cholesterol Education Program recommends a diet containing less than 30 percent of calories in the form of fat, less than 10 percent in the form of saturated fat, and less than 300 mg of cholesterol per day. Since Americans' diets generally exceed these recommendations, we wished to find an easy kitchen method to reduce substantially saturated fat and cholesterol in ground meat. Raw ground meat was heated in vegetable oil and rinsed with boiling water to extract fat and cholesterol. The fat-free broth was recombined with the meat to restore flavor. The amounts of total fat, saturated fat, and cholesterol in the meat after extraction were compared with the amounts in meat cooked as patties and in stir-fried, rinsed meat. When raw ground beef containing 9.6 to 20.8 percent fat was cooked as patties and the fat poured off, 6 to 17 percent of the fat and 1.3 to 4.3 percent of the cholesterol were lost. In stir-fried, rinsed ground beef, 23 to 59 percent of the fat and 9.0 to 18.8 percent of the cholesterol were lost. When vegetable oil was used to extract fat and cholesterol from beef containing 20.7 percent fat, a mean (+/- SD) of 67.7 +/- 1.6 percent of the fat and 39.2 +/- 5.1 percent of the cholesterol were lost. The differences between conventionally cooked meat and meat prepared by the extraction of fat were significant (P less than 0.001). An average of 43 percent (range, 38 to 49) of cholesterol was extracted from a wide variety of ground meats. Although conventional cooking produced no change in fatty-acid composition as compared with raw meat, our extraction process greatly increased the ratio of unsaturated to saturated fat, from 1.32 in conventionally cooked meat to 2.92 to 4.56 in meat after extraction. Extraction resulted in the loss of 72 to 87 percent of saturated fat. This method produces a tasty meat product that is much lower in saturated fat and cholesterol than conventionally cooked meat, and that can be used in sauces, soups, and

  7. Qualitative Assessment for Toxoplasma gondii Exposure Risk Associated with Meat Products in the United States.

    Science.gov (United States)

    Guo, Miao; Buchanan, Robert L; Dubey, Jitender P; Hill, Dolores E; Lambertini, Elisabetta; Ying, Yuqing; Gamble, H Ray; Jones, Jeffrey L; Pradhan, Abani K

    2015-12-01

    Toxoplasma gondii is a global protozoan parasite capable of infecting most warm-blooded animals. Although healthy adult humans generally have no symptoms, severe illness does occur in certain groups, including congenitally infected fetuses and newborns, immunocompromised individuals including transplant patients. Epidemiological studies have demonstrated that consumption of raw or undercooked meat products is one of the major sources of infection with T. gondii. The goal of this study was to develop a framework to qualitatively estimate the exposure risk to T. gondii from various meat products consumed in the United States. Risk estimates of various meats were analyzed by a farm-to-retail qualitative assessment that included evaluation of farm, abattoir, storage and transportation, meat processing, packaging, and retail modules. It was found that exposure risks associated with meats from free-range chickens, nonconfinement-raised pigs, goats, and lamb are higher than those from confinement-raised pigs, cattle, and caged chickens. For fresh meat products, risk at the retail level was similar to that at the farm level unless meats had been frozen or moisture enhanced. Our results showed that meat processing, such as salting, freezing, commercial hot air drying, long fermentation times, hot smoking, and cooking, are able to reduce T. gondii levels in meat products. whereas nitrite and/or nitrate, spice, low pH, and cold storage have no effect on the viability of T. gondii tissue cysts. Raw-fermented sausage, cured raw meat, meat that is not hot-air dried, and fresh processed meat were associated with higher exposure risks compared with cooked meat and frozen meat. This study provides a reference for meat management control programs to determine critical control points and serves as the foundation for future quantitative risk assessments.

  8. Changes in endogenous bioactive compounds of Korean native chicken meat at different ages and during cooking.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Bae, Young Sik; Kim, Sun Hyo; Lee, Soo Kee; Lee, Jun Heon; Jo, Cheorun

    2014-07-01

    This study aimed to examine the effect of bird age on the contents of endogenous bioactive compounds, including carnosine, anserine, creatine, betaine, and carnitine, in meat from a certified meat-type commercial Korean native chicken strain (KNC; Woorimatdag). Additionally, the effects of the meat type (breast or leg meat) and the state of the meat (raw or cooked) were examined. Cocks of KNC were raised under similar standard commercial conditions at a commercial chicken farm. At various ages (10, 11, 12, 13, and 14 wk), breast and leg meats from a total of 10 birds from each age group were obtained. Raw and cooked meat samples were then prepared separately and analyzed for bioactive compounds. The age of the KNC had a significant effect only on the betaine content. The breast meat of KNC had higher amounts of carnosine and anserine but had lower amounts of betaine and carnitine than the leg meat (P cooking (P cooking, whereas breast meat showed almost complete retention of betaine and carnitine. The results of this study provide useful and rare information regarding the presence, amounts, and determinants of endogenous bioactive compounds in KNC meat, which can be useful for selection and breeding programs, and also for popularizing indigenous chicken meat. © 2014 Poultry Science Association Inc.

  9. Effect of cooking temperatures on characteristics and microstructure of camel meat emulsion sausages.

    Science.gov (United States)

    Mohamed, Hussein Mh; Emara, Mohamed Mt; Nouman, Taha M

    2016-07-01

    The camel is an excellent source of high quality meat and camel meat might be a potential alternative for beef. This study aimed to manipulate the raw camel meat for the production of stable and acceptable emulsion sausage, as well as to study the effect of cooking at different core temperatures on the tenderness, sensory quality and microstructure of produced sausage. Increasing the cooking temperature of sausages resulted in reduction of the shear force values from 2.67 kgf after cooking at 85 °C to 1.57 kgf after cooking at 105 °C. The sensory scores of sausages have been improved by increasing the cooking core temperature of meat batter. The light and scanning electron microscope micrographs revealed solubilisation of the high quantity of connective tissue of camel meat. High emulsion stability values for the camel meat batter associated with high values of water-holding capacity for raw camel meat and meat batter have been recorded. Stable and acceptable camel meat emulsion can be developed from camel meat. Increasing the cooking core temperature of meat batter improved the quality of produced sausages. Therefore, camel meat emulsion sausages might be a potential alternative for beef particularly in Asian and African countries. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  10. Detection of IgG against Toxocara in Sera of Employees of Meat Industry

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernández-Tinoco, Jesús; Sánchez-Anguiano, Luis Francisco; Ramos-Nevárez, Agar; Cerrillo-Soto, Sandra Margarita; Guido-Arreola, Carlos Alberto; Saenz-Soto, Leandro

    2015-01-01

    Contact with raw meat could represent a risk for Toxocara infection. We assessed the association of Toxocara infection with an occupation of meat worker though a case-control seroprevalence study of 124 meat workers and 248 subjects without this occupation. Sera of participants was analyzed for the presence of anti-Toxocara IgG antibodies. One (0.8%) of the 124 meat workers, and 5 (2.0%) of the 248 controls were positive for anti-Toxocara IgG antibodies (OR=0.39; 95% CI: 0.04-3.41; P=0.66). The seropositive meat worker was a male aged 28 years old, without vision impairment. None of the work characteristics i.e. frequency of contact with raw meat, use of safety practices, history of splashes at face with blood or raw meat, and injuries with sharp material at work was associated with Toxocara exposure. Seroprevalence of Toxocara infection was significantly higher (P=0.04) in meat workers with consumption of boar meat (1/6: 16.7%) than in those without this consumption (0/117: 0%). We conclude that meat workers do not have a higher risk for Toxocara infection than subjects without this occupation do. The 2% seroprevalence of Toxocara infection found in control subjects might suggest a low seroprevalence of this infection among people with other occupations in Durango City. However, additional case-control studies with larger sample sizes to confirm our results are needed. PMID:26508909

  11. Metronidazole resistance in Campylobacter jejuni from poultry meat

    DEFF Research Database (Denmark)

    Andersen, Sigrid Rita; Shukri, Naseer Mahmoud; Boel, Jeppe

    2006-01-01

    The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution with a signific......The occurrence of metronidazole resistance was investigated among Campylobacter jejuni in raw poultry meat collected from supermarkets. MICs were determined by the agar dilution procedure in the testing range of 3 to 60 mu g/ml metronidazole. The MICs showed a bimodal distribution...

  12. USE OF MEAT-BONE PASTE AS A PROTEIN SOURCE IN MEAT PRODUCT PRODUCTION

    Directory of Open Access Journals (Sweden)

    A. K. Kakimov

    2016-01-01

    Full Text Available In this paper, the results of the experimental research on developing the technology of a protein complex based on the meat-bone paste and protein-fat-blood emulsion are shown. The technological scheme of meat-bone paste production on the basis of complex grinding meat-bone raw material to bone particle size of 100 ∙10–6 m and further processing of bone particles using reagent, cheese whey, with pH 4,3 is presented. When studying the nutritive and biological value of the protein complex, it was established that the protein complex consisting of the food component from bone and protein-fat-blood emulsion could be used instead of the basic raw material in meat product production. The comparative analysis of the nutritive value of the protein complex and horse meat demonstrated the following results: the amino acid composition of the protein complex showed a balance of the essential amino acids and the high content of the essential amino acids which limit the biological value: lysine, leucine and threonine. The high content of polyunsaturated fatty acids was observed, which justified the biological value of the protein complex.

  13. Eosinophilic meningitis risk associated with raw Ampullarium canaliculatus snails consumption

    Directory of Open Access Journals (Sweden)

    Jiun-Jye Wang

    2011-05-01

    Full Text Available In Taiwan, Angiostrongylus cantonensis infection has been reported in foreign laborers who had consumed raw Ampullarium canaliculatus snails. This study analyzed three foreign laborers who had contracted enzyme-linked immunosorbent assay-confirmed A cantonensis infection while working in Taiwan. All three workers had consumed either roasted snails or raw snails flavored with seasoning while drinking wine. This study investigated possible risk factors for A cantonensis, including naturally occurring A cantonensis in A canaliculatus snails, viability of third-stage A cantonensis larvae in raw seasoned snails and in roasted snails, infectivity of larvae, and effects of alcohol while consuming snails. Positive infection rates in snails from five different irrigation canals in south Taiwan ranged from 12.3% to 29.4% and the average number of motile larvae per infected snail ranged from 36 to 65. The number of motile and coiled larvae in snail meat after 120 minutes seasoning was 93 (27.7% and 233 (69.3%, respectively. After 20 minutes of roasting, most larvae in the snail meat were dead. The infectivities of motile and coiled larvae from snail meat after 60 minutes seasoning were 53.2% and 33.2%, respectively, and those from snail meat after 5 minutes roasting were 33.2% and 7.0%, respectively. Eating Taiwan A canaliculatus snails raw is extremely risky given their high infection rates and infection intensities. Even after 120 minutes seasoning or after 20 minutes roasting, snail meat should be considered unsafe for human consumption. Finally, experimental rodent studies indicated that consuming alcohol while ingesting larvae does not significantly reduced infectivity.

  14. Raw material uranium

    International Nuclear Information System (INIS)

    Arnold, O.

    1975-01-01

    In this paper some aspects are being considered, in as far as they can contribute to a better understanding of uranium as a raw material and an energy carrier, and as they can indicate the possible ways and means open to the German Federal Republic for securing this highly desirable raw material, without becoming even more dependent on the economic and political views of the producing countries, than it is the case in respect of oil. (orig.) [de

  15. 9 CFR 317.344 - Identification of major cuts of meat products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Identification of major cuts of meat... AND VOLUNTARY INSPECTION AND CERTIFICATION LABELING, MARKING DEVICES, AND CONTAINERS Nutrition Labeling § 317.344 Identification of major cuts of meat products. The major cuts of single-ingredient, raw...

  16. SAG2 locus genotyping of Toxoplasma gondii in meat products of ...

    African Journals Online (AJOL)

    Toxoplasmosis is an infection caused by Toxoplasma gondii, an intracellular obligate parasite. Its transmission is usually attributed to ingestion of undercooked or raw meat. The aim of this study was the detection and genotyping of T. gondii in meat products using the molecular method in East Azerbaijan. DNA was ...

  17. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  18. Studies on emulsion-type buffalo meat sausages incorporating skeletal and offal meat with different levels of pork fat.

    Science.gov (United States)

    Krishnan, K R; Sharma, N

    1990-01-01

    Ready-to-eat emulsion-type buffalo meat sausages were developed by using a combination of 80% meat components with 20% pork back fat. The meat components were constituted of 70 parts buffalo skeletal meat and 30 parts offal meat (rumen meat and heart meat in equal proportions). The emulsion stability, cooking losses of emulsions and sausages, composition of cooked sausages, eating quality of sausages and the microscopic characteristics of the raw emulsion and cooked sausages were studied. The light microscope micrograph of the raw emulsion showed uniformly well distributed fat globules embedded in a dense protein gel. The cooked emulsion also showed uniformly sized fat globules well distributed in a fine, compact, coagulated protein gel, which retained their original spherical shape. Good quality emulsion-type sausages could be produced having a high emulsion stability (0·87 ± 0·07 ml fat release/100 g emulsion); a low emulsion cooking loss (9·60 ± 0·60%) and a low sausage cooking loss (8·83 ± 0·48%). The overall acceptability of sausages was also high. Copyright © 1990. Published by Elsevier Ltd.

  19. Nutritional value of traditional Italian meat-based dishes: influence of cooking methods and recipe formulation.

    Science.gov (United States)

    D'Evoli, L; Salvatore, P; Lucarini, M; Nicoli, S; Aguzzi, A; Gabrielli, P; Lombardi-Boccia, G

    2009-01-01

    The present study provides a picture of the compositional figure and nutritive value of meat-based dishes typical of Italian culinary tradition. Recipes specific for a bovine meat cut (top-side) were selected among the most widespread ones in Italy: in pan, pizzaiola, cutlet, meat ball, and escalope. The total fat and cholesterol content varied depending on the ingredients utilized (extra-virgin olive oil, parmesan, egg). Meat-based dishes that utilized extra-virgin olive oil showed a significant reduction in palmitic and stearic acids and a parallel increase in oleic acid compared with raw meat; furthermore, the ratio among saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids shifted in favour of monounsaturated fatty acids. B vitamins were affected at different extent by heating; by contrast, vitamin E content increased because of the new sources of this vitamin, which masked losses due to heating. Ingredients (parmesan, discretionary salt) induced significant increases in the calcium and sodium concentrations compared with raw meat. The total iron content did not show marked differences in most of the meat-based dishes compared with raw meat; by contrast, losses in the heme-iron concentration were detected depending on the severity of heating treatments. Our findings suggest that heme iron, because of its important health aspects, might be a useful index of the nutritional quality of cooked meats.

  20. Meat analog: a review.

    Science.gov (United States)

    Malav, O P; Talukder, S; Gokulakrishnan, P; Chand, S

    2015-01-01

    The health-conscious consumers are in search of nutritious and convenient food item which can be best suited in their busy life. The vegetarianism is the key for the search of such food which resembles the meat in respect of nutrition and sensory characters, but not of animal origin and contains vegetable or its modified form, this is the point when meat analog evolved out and gets shape. The consumers gets full satisfaction by consumption of meat analog due to its typical meaty texture, appearance and the flavor which are being imparted during the skilled production of meat analog. The supplement of protein in vegetarian diet through meat alike food can be fulfilled by incorporating protein-rich vegetative food grade materials in meat analog and by adopting proper technological process which can promote the proper fabrication of meat analog with acceptable meat like texture, appearance, flavor, etc. The easily available vegetables, cereals, and pulses in India have great advantages and prospects to be used in food products and it can improve the nutritional and functional characters of the food items. The various form and functional characters of food items are available world over and attracts the meat technologists and the food processors to bring some innovativeness in meat analog and its presentation and marketability so that the acceptability of meat analog can be overgrown by the consumers.

  1. Antimicrobial Edible Films and Coatings for Meat and Meat Products Preservation

    Directory of Open Access Journals (Sweden)

    Irais Sánchez-Ortega

    2014-01-01

    Full Text Available Animal origin foods are widely distributed and consumed around the world due to their high nutrients availability but may also provide a suitable environment for growth of pathogenic and spoilage microorganisms. Nowadays consumers demand high quality food with an extended shelf life without chemical additives. Edible films and coatings (EFC added with natural antimicrobials are a promising preservation technology for raw and processed meats because they provide good barrier against spoilage and pathogenic microorganisms. This review gathers updated research reported over the last ten years related to antimicrobial EFC applied to meat and meat products. In addition, the films gas barrier properties contribute to extended shelf life because physicochemical changes, such as color, texture, and moisture, may be significantly minimized. The effectiveness showed by different types of antimicrobial EFC depends on meat source, polymer used, film barrier properties, target microorganism, antimicrobial substance properties, and storage conditions. The perspective of this technology includes tailoring of coating procedures to meet industry requirements and shelf life increase of meat and meat products to ensure quality and safety without changes in sensory characteristics.

  2. Advances in research on poultry and rabbit meat quality

    Directory of Open Access Journals (Sweden)

    Gerolamo Xiccato

    2010-01-01

    Full Text Available Main force and weakness points of poultry and rabbit production chains are presented and meat quality discussed in relation to nutritional and technological issues. An analysis of the most important poultry and rabbit meat quality traits and their major relationships with production factors (genotype, feeding, housing, pre-slaughter handling, slaughtering, and processing is provided. Most recent research advancements are presen- ted in view of the consumer’s demand for healthy and safe products obtained respecting animal welfare.

  3. Irradiation of bovine meat: effect of heme-iron concentration

    International Nuclear Information System (INIS)

    Mistura, Liliana Perazzini Furtado

    2002-01-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  4. Technological characteristics of meat - viscosity

    OpenAIRE

    DIBĎÁK, Tomáš

    2012-01-01

    This bachelor thesis is focused on the technological characteristics of meat, mainly viscosity of meat. At the beginning I dealt with construction of meat and various types of meat: beef, veal, pork, mutton, rabbit, poultry and venison. Then I described basic chemical composition of meat and it?s characteristic. In detail I dealt with viscosity of meat. Viscosity is the ability of meat to bind water both own and added. I mentioned influences, which effects viscosity and I presented the possib...

  5. Vision-based method for tracking meat cuts in slaughterhouses

    DEFF Research Database (Denmark)

    Larsen, Anders Boesen Lindbo; Hviid, Marchen Sonja; Engbo Jørgensen, Mikkel

    2014-01-01

    Meat traceability is important for linking process and quality parameters from the individual meat cuts back to the production data from the farmer that produced the animal. Current tracking systems rely on physical tagging, which is too intrusive for individual meat cuts in a slaughterhouse envi...... (hanging, rough treatment and incorrect trimming) and our method is able to handle these perturbations gracefully. This study shows that the suggested vision-based approach to tracking is a promising alternative to the more intrusive methods currently available....

  6. UNDERSTANDING CONSUMERS' ATTITUDE TOWARD MEAT LABELS AND MEAT CONSUMPTION PATTERN

    OpenAIRE

    Rimal, Arbindra; Fletcher, Stanley M.

    2003-01-01

    This paper addressed consumers' attitude toward meat labels and the influence of different aspects of meat labels on beef, poultry and seafood consumption using a national survey data. Nutrition and ingredient information on meat labels were positively related with attitude toward meat labels as well as meat consumption frequency.

  7. Raw and renewable polymers

    CSIR Research Space (South Africa)

    Joseph, S

    2010-01-01

    Full Text Available in the permeability of the membrane and HO H3C H3C H2C H2C HO OH NH NH OH O OC C n O O O O Fig. 4 Structure of Chitin Raw and Renewable Polymers promoting internal osmotic imbalances. This results in leaching of electrolytes and proteins. 2... is often lost. In most cases this denaturation is not reversible. R-CH-COOH NH2 w Amino acid H2N COOHR a Amino acid Fig. 5 Structure of amino acid Raw and Renewable Polymers The solubilities of proteins vary considerably based on compositions...

  8. Quality, functionality, and shelf life of fermented meat and meat products: A review.

    Science.gov (United States)

    Kumar, Pavan; Chatli, M K; Verma, Akhilesh K; Mehta, Nitin; Malav, O P; Kumar, Devendra; Sharma, Neelesh

    2017-09-02

    Fermentation of meat is a traditional preservation method used widely for improving quality and shelf life of fermented meat products. Fermentation of meat causes a number of physical, biochemical, and microbial changes, which eventually impart functional properties, sensory characteristics, and nutritional aspects to these products and inhibit the growth of various pathogenic and spoilage microorganisms. These changes include acidification (carbohydrate catabolism), solubilization and gelation of myofibrillar and sarcoplasmic proteins of muscle, degradation of proteins and lipids, reduction of nitrate into nitrite, formation of nitrosomyoglobin, and dehydration. Dry-fermented sausages are increasingly being used as carrier of probiotics. The production of biogenic amines during fermentation can be controlled by selecting proper starter cultures and other preventive measures such as quality of raw materials, hygienic measures, temperature, etc.

  9. Evaluation of Technological Quality of Meat Produced from Nsukka ...

    African Journals Online (AJOL)

    The technological quality of raw meat from Nsukka local abattoir was evaluated by analyzing the proximate composition, water holding capacity, pH, Napole yield and sensory colour and texture of longissimus dorsi [LD] and psoas major [PM] of beef and pork. Results show that moisture [71.36 – 72.76%], protein [21.37 ...

  10. Hygienic quality of raw milk with regard to legislation

    Directory of Open Access Journals (Sweden)

    Slavko Kirin

    2001-01-01

    Full Text Available Hygienic quality of raw milk is basic indicator of hygienic conditionduring processing and handling of milk as well as economical valorisation of animal product as a raw material in dairy products manufacture. Thus, total bacterial count in 1 mL of raw milk is used in modern legislation in milk pricing system. Apart from the economical and technological reasons hygienic quality of raw milk is also important from the health safety issue. In this paper microbiological quality legislation, set down by the EU and Croatian directives, are presented. Apart form the total microorganisms number the normative on the somatic cell number in row milk, as one of the quality indicators, are also presented. Pricing system of raw milk with regard to hygienic quality, current legislation especially from the point of view of a new legislation on row milk quality as well as suggestions to faster association into progressive dairy, legislation are listed.

  11. Benefits of balancing method for component RAW importance measure

    International Nuclear Information System (INIS)

    Kim, Kil Yoo; Yang, Joon Eon

    2005-01-01

    In the Risk Informed Regulation and Applications (RIR and A), the determination of risk significant Structure, System and Components (SSCs) plays an important role, and importance measures such as Fussell-Vesely (FV) and RAW (Risk Achievement Worth) are widely used in the determination of risk significant SSCs. For example, in the Maintenance Rule, Graded Quality Assurance(GQA) and Option 2, FV and RAW are used in the categorization of SSCs. Especially, in the GQA and Option 2, the number of SSCs to be categorized is too many to handle, so the FVs and RAWs of the components are practically derived in a convenient way with those of the basic events which have already been acquired as PSA (Probabilistic Safety Assessment) results instead of by reevaluating the fault tree/event tree of the PSA model. That is, the group FVs and RAWs for the components are derived from the FVs and RAWs of the basic events which consist of the group. Here, the basic events include random failure, Common Cause Failure (CCF), test and maintenance, etc. which make the system unavailable. A method called 'Balancing Method' which can practically and correctly derive the component RAW with the basic event FVs and RAWs even if CCFs exists as basic events was introduced in Ref.. However, 'Balancing Method' has other advantage, i.e., it can also fairly correctly derive component RAW using fault tree without using basic events FVs and RAWs

  12. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-01-01

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100–400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat. PMID:27338486

  13. Effect of Oregano Essential Oil (Origanum vulgare subsp. hirtum) on the Storage Stability and Quality Parameters of Ground Chicken Breast Meat.

    Science.gov (United States)

    Al-Hijazeen, Marwan; Lee, Eun Joo; Mendonca, Aubrey; Ahn, Dong Uk

    2016-06-07

    A study was conducted to investigate the effect of oregano essential oil on the oxidative stability and color of raw and cooked chicken breast meats. Five treatments, including (1) control (none added); (2) 100 ppm oregano essential oil; (3) 300 ppm oregano essential oil; (4) 400 ppm oregano essential oil; and (5) 5 ppm butylated hydroxyanisole (BHA), were prepared with ground boneless, skinless chicken breast meat and used for both raw and cooked meat studies. For raw meat study, samples were individually packaged in oxygen-permeable bags and stored in a cold room (4 °C) for 7 days. For cooked meat study, the raw meat samples were vacuum-packaged in oxygen-impermeable vacuum bags and then cooked in-bag to an internal temperature of 75 °C. After cooling to room temperature, the cooked meats were repackaged in new oxygen-permeable bags and then stored at 4 °C for 7 days. Both raw and cooked meats were analyzed for lipid and protein oxidation, volatiles, and color at 0, 3, and 7 days of storage. Oregano essential oil significantly reduced (p oil at 400 ppm showed the strongest effect for all these parameters. Hexanal was the major aldehyde, which was decreased significantly (p oil treatment, in cooked meat. Overall, oregano essential oil at 100-400 ppm levels could be a good preservative that can replace the synthetic antioxidant in chicken meat.

  14. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  15. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  16. Dangerous Raw Oysters

    Centers for Disease Control (CDC) Podcasts

    2013-08-05

    Dr. Duc Vugia, chief of the Infectious Diseases Branch at the California Department of Public Health, discusses the dangers of eating raw oysters.  Created: 8/5/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 8/7/2013.

  17. Meat : a natural symbol.

    OpenAIRE

    Fiddes, Nick

    1989-01-01

    In Britain, and in cultures around the world, meat's significance extends beyond what might be anticipated from its nutritional utility. By looking at the academic and popular literature, and through a series of looselystructured interviews, this study investigates the range of ideas that people hold about meat in modern Britain for evidence as to what it is that makes animal flesh such an esteemed foodstuff. The principle conclusion is that meat's pre-eminence derives from ...

  18. Meat science research tendencies

    Directory of Open Access Journals (Sweden)

    José Arturo García Macías

    2010-12-01

    Full Text Available Meat is a high quality food due its higher protein content, besides to provide energy, vitamins particularly B complex, water and minerals, resulting in an appreciated food for humans. Even in same country, consumers search for different stuffs, since north consumers looks for meat cuts with fat and bone, whereas center-south consumers prefers fatless debones meat cuts. Modern consumers demand excellent appearance, color, taste and flavor in foods, microbiologically safe, minimal processed and curing salts, very nutritive and cheap. All these together in one single product are a hard challenge in the meat products area.

  19. Use of artificial intelligence in the production of high quality minced meat

    Science.gov (United States)

    Kapovsky, B. R.; Pchelkina, V. A.; Plyasheshnik, P. I.; Dydykin, A. S.; Lazarev, A. A.

    2017-09-01

    A design for an automatic line for minced meat production according to new production technology based on an innovative meat milling method is proposed. This method allows the necessary degree of raw material comminution at the stage of raw material preparation to be obtained, which leads to production intensification due to the traditional meat mass comminution equipment being unnecessary. To ensure consistent quality of the product obtained, the use of on-line automatic control of the technological process for minced meat production is envisaged. This system has been developed using artificial intelligence methods and technologies. The system is trainable during the operation process, adapts to changes in processed raw material characteristics and to external impacts that affect the system operation, and manufactures meat shavings with minimal dispersion of the typical particle size. The control system includes equipment for express analysis of the chemical composition of the minced meat and its temperature after comminution. In this case, the minced meat production process can be controlled strictly as a function of time, which excludes subjective factors for assessing the degree of finished product readiness. This will allow finished meat products with consistent, targeted high quality to be produced.

  20. 9 CFR 381.125 - Special handling label requirements.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY.... The safe handling information shall be set off by a border and shall be one color type printed on a single color contrasting background whenever practical. (2) (i) The labels of the poultry products...

  1. Animal Products and Handling: A Caution for Consumers and ...

    African Journals Online (AJOL)

    This study reviewed pertinent literature on edible animal products and handling with respect to contaminations and adulterations. Animal products include eggs, meat, milk, fish, skin/hide that are processed into other by products for human consumption. There is the need for awareness campaignsto consumers and ...

  2. A cluster of three cases of trichinellosis linked to bear meat consumption in the Arctic.

    Science.gov (United States)

    Dupouy-Camet, Jean; Yera, Hélène; Dahane, Naïma; Bouthry, Elise; Kapel, Christian M O

    2016-05-01

    We report here three cases of trichinellosis due to polar bear meat consumption in East Greenland. In the past 20 years, 31 cases of trichinellosis have been reported in French travellers to the Arctic (North Quebec, Nunavut and Greenland) who consumed undercooked meat from black, brown, or polar bears. If local communities are increasingly becoming aware of the risk of trichinellosis, travellers visiting regions where bear meat is consumed should be informed of the risk of eating raw or non-heat-processed meats. © International Society of Travel Medicine, 2016. All rights reserved. Published by Oxford University Press. For permissions, please e-mail: journals.permissions@oup.com.

  3. Importance of the producer on retail broiler meat product contamination with Campylobacter spp

    DEFF Research Database (Denmark)

    Kudirkiene, Egle; Buneviciene, Jurgita; Serniene, Loreta

    2013-01-01

    Background Campylobacter spp. are a leading cause of human bacterial gastroenteritis worldwide, with poultry meat being considered the most important source of the infection. To obtain data on broiler meat contamination with Campylobacter spp. in Lithuania, the occurrence, counts and genotypes...... of these pathogens on raw broiler meat products from different producers were examined. Results Out of 312 broiler meat product samples examined, 46.8% were contaminated with Campylobacter spp. Campylobacter jejuni was identified in 51.4% and Campylobacter coli in 37.7% of positive samples. Campylobacter jejuni...

  4. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some factors belonging to the intrinsic quality of meat, animal slaughter methods, technological operations applied to the meat, and the auxiliary materials used.

  5. Flavonoids in the development of functional meat products: A review

    Directory of Open Access Journals (Sweden)

    Pramod K. Singh

    2013-06-01

    Full Text Available Flavonoids or bioflavonoids are unique low molecular weight ubiquitous polyphenolic compounds produced by plants during their metabolic activities as a secondary metabolites and responsible for major organoleptic characteristics and health benefits of plant derived foods. The flavonoids are potent antioxidants agents and protect the cells by scavenging and inhibiting the production and initiation of free radicals, superoxide anions and lipid peroxy radicals. Besides potent antioxidant capacity, flavonoids also shows antimicrobial, antimutagenic, antidiabetic, antithrombosis, antirheumatic, antiatherosclerotic, antiallergic, anti-inflammatory, antiulcers and hepatoprotectives and better termed as neutraceuticals. The antioxidant capacity of meat is very low and this can be increased by adding flavonoids in meat during processing in the form of plant parts rich in flavonoids such as seeds, fruit skin or peel, bark and flower as raw or in extract form without comprising the sensory attributes of meat and meat products. [Vet World 2013; 6(8.000: 573-578

  6. Heterocyclic amines in meat and meat products

    Directory of Open Access Journals (Sweden)

    Aliye BULGAN

    2013-06-01

    Full Text Available Heterocyclic amines (HA are the mutagenic/carcinogenic compounds which generate as a result of cooking of red meat, poultry meat and fish fillets at high temperatures. Up to 20 different HAs were detected and classified in the researches that conducted on these types of meats cooked at high temperatures. HAs are the products of Maillard reactions and the Strecker degredation of main precursors such as creatine/creatinine, aminoacid and the polysaccharides. Many physical and chemical factors effect the formation of HAs. Thus, it was reported by many researchers that utilizing coating and marination processes in addition to using natural and synthetic antioxidants and seasonings-plant extracts were effective on inhibiting/decreasing the formation of HAs. Additionally, boiling/steaming and microwave cooking methodologies were recommended instead of barbecuing, grilling or frying to inhibit/decrease the formation of HAs. The HAs formed in meat and meat products and the factors which have effects on the formation of HAs are presented in this review.

  7. Microbiological quality of raw and roasted African palm weevil ...

    African Journals Online (AJOL)

    Microbiological quality of raw and roasted African palm weevil ( Rhynchophorus phoenicis ) consumed in the south eastern Nigeria. ... Rhynchophorus phoenicis though reported to be highly nutritious in terms of amino acid profile and presence of unsaturated fatty acid can be a source of food poison if not properly handled ...

  8. Bulk handling benefits from ICT

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-11-15

    The efficiency and accuracy of bulk handling is being improved by the range of management information systems and services available today. As part of the program to extend Richards Bay Coal Terminal, Siemens is installing a manufacturing execution system which coordinates and monitors all movements of raw materials. The article also reports recent developments by AXSMarine, SunGuard Energy, Fuelworx and Railworx in providing integrated tools for tracking, managing and optimising solid/liquid fuels and rail car maintenance activities. QMASTOR Ltd. has secured a contract with Anglo Coal Australia to provide its Pit to Port.net{reg_sign} and iFuse{reg_sign} software systems across all their Australians sites, to include pit-to-product stockpile management. 2 figs.

  9. Survey of Toxoplasma gondii antibodies in meat juice of wild boar (Sus scrofa in several districts of the Czech Republic

    Directory of Open Access Journals (Sweden)

    Karol Račka

    2015-05-01

    The obtained results indicate that consumption of raw or undercooked meat from wild boars can carry an important risk of toxoplasma infection. Post mortem detection of antibodies in meat juice samples using ELISA is a useful alternative to blood serum examination. In addition, a diaphragm sample has been well-proven as a matrix sample for the contemporaneous diagnostics of trichinellosis and toxoplasmosis.

  10. Meat and meat product preservation by ionizing radiation

    International Nuclear Information System (INIS)

    Egginger, R.

    A brief summary is given of experience with the preservation of meat and meat products by ionizing radiation, or by combined methods. The results of the research have proved that hygienically significant microorganisms (mainly salmonellas) are reliably destroyed and that the consumption of thus irradiated meat and meat products presents no danger to human health. (B.S.)

  11. Strategic raw materials. Risk management

    International Nuclear Information System (INIS)

    Bertau, Martin; Matschullat, Joerg; Kausch, Peter

    2014-01-01

    This volume is divided into four chapters: (1) Raw material management, (2) Primary raw materials, (3) Secondary raw materials and recycling, (4). Processing and products. The topics for the chapter ''Raw material management'' are: Substitution of raw materials - framework conditions and implementation; Thales: Strategic raw materials; Time for cooperation between the EU and China in raw materials policy; Availability of elements for the semiconductor industry; Market price risks of raw material-intensive companies - identification and management. The topics on the second item ''Primary raw materials'' are: The supply of economic-critical raw materials - A search and analysis for causes; Lithium extraction from primary raw materials - state and perspectives; The global market of rare earths - A balancing act; Rare earth deposits in Namibia; New technologies in exploration and discovery - Focus on activities in Europe. The third chapter, ''Secondary Raw Materials and Recycling'', covered the topics: Technology metals - Systemic Requirements along the recycling chain; Integrated re-use of high-tech and greentech wastes; From the sewage sludge ash to the phosphorus fertilizer RecoPhos P38 in the stress field of waste, fertilizer and soil protection. In chapter 4. ''Processing and products'' are the topics: Treatment and processing of rare earth metals; Processing of mineral resources - opportunities and challenges; Consequences of modern germanium chemistry; Strategic resources - Risk management. A review and outlook with a pinch of fantasy.. [de

  12. Quantifying and predicting meat and meat products quality attributes using electromagnetic waves: an overview.

    Science.gov (United States)

    Damez, Jean-Louis; Clerjon, Sylvie

    2013-12-01

    The meat industry needs reliable meat quality information throughout the production process in order to guarantee high-quality meat products for consumers. Besides laboratory researches, food scientists often try to adapt their tools to industrial conditions and easy handling devices useable on-line and in slaughterhouses already exist. This paper overviews the recently developed approaches and latest research efforts related to assessing the quality of different meat products by electromagnetic waves and examines the potential for their deployment. The main meat quality traits that can be assessed using electromagnetic waves are sensory characteristics, chemical composition, physicochemical properties, health-protecting properties, nutritional characteristics and safety. A wide range of techniques, from low frequency, high frequency impedance measurement, microwaves, NMR, IR and UV light, to X-ray interaction, involves a wide range of physical interactions between the electromagnetic wave and the sample. Some of these techniques are now in a period of transition between experimental and applied utilization and several sensors and instruments are reviewed. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Prevalence and antibiotic resistance of Salmonella spp. in meat products, meat preparations and minced meat

    Science.gov (United States)

    Rašeta, M.; Mrdović, B.; Janković, V.; Bečkei, Z.; Lakićević, B.; Vidanović, D.; Polaček, V.

    2017-09-01

    This study aimed to determine Salmonella spp. prevalence in meat products, meat preparations and minced meat. Over a period of three years, a total of 300 samples were taken (100 RTE meat products, 100 meat preparations and 100 minced meat) and examined for the presence of Salmonella spp. Sampling was carried out at the warehouses of the food manufacturers. Salmonella spp. were not detected in RTE meat products, while 7% of semi-finished meat products (fresh sausages, grill meat formed and unformed) contained Salmonella, as did 18% of minced meats (minced pork II category, minced beef II category, mixed minced meat). The 25 Salmonella isolates obtained were examined for antibiotic resistance by the disk diffusion test, according to the NCCLS and CLSI guidelines. Isolates showed resistance to ampicillin and nalidixic acid (80%), tetracycline (72%), cefotaxime/clavulanic acid (48%), but not to gentamicin (8%) or trimethoprim/sulfamethoxazole (0%).

  14. Tenacity of Alaria alata mesocercariae in homemade German meat products.

    Science.gov (United States)

    González-Fuentes, Hiromi; Hamedy, Ahmad; von Borell, Eberhard; Luecker, Ernst; Riehn, Katharina

    2014-04-17

    A renewed interest in the pathogenic potential of Alaria alata mesocercariae emerged over the last 10years as a result of increased findings of this parasite in feral pigs during official examination for Trichinella spp. Cases of food associated human alariosis in North America suggest that a risk associated with the consumption of traditional raw cured products from infected wild boar meat cannot be neglected because the commonly applied preservation techniques may not necessarily kill the mesocercariae. In addition, changes in consumer behavior and new preparation methods for game meat (e.g. pink roasting and grilling) may increase the risk for food-associated parasitic infections. Thus, there is a strong need for the evaluation of the tenacity of A. alata mesocercariae against different physical and chemical influences as pertaining to common preservation and preparation techniques. Against this backdrop the aim of our work was a sound analysis of the survivability of A. alata mesocercariae during curing, fermentation, cold smoking and drying in raw cured meat products. Eighty three samples of traditional German meat products were prepared from naturally infected game meat and partly spiked with additional vital mesocercariae to achieve an adequate dose of infection. The resultant products were examined chronologically for dead and viable A. alata mesocercariae with the Alaria mesocercariae migration technique. After 24h of production, vital A. alata mesocercariae were still found in raw type sausages but no vital parasites were detected in the final products. Based on these results a possible risk for the consumer for an infection with A. alata mesocercariae through the consumption of contaminated raw cured products can be largely ruled out if the respective food technological procedures are carried out properly. However, a risk for the consumer cannot be excluded in cases of very early consumption of these products. Copyright © 2014 Elsevier B.V. All rights

  15. Pragmatics of Raw Art

    DEFF Research Database (Denmark)

    Wilson, Alexander

    2014-01-01

    , and a contemporary zeitgeist marked by a general relativisation of aesthetic values has emerged, exploding into a plethora of parallel discourses on art. Perhaps there is no longer such a thing (if there ever was) as Culture with a capital C, which Dubuffet so vehemently opposed in his championing of art brut......’s adolescence without hypostatizing distinctions between inside and outside, or between culture and its raw or primitive origins, while nevertheless not conflating the dissolution of boundaries and hierarchies with a possible end to territoriality and control, nor promoting a resignation of thought...

  16. Prevalence of methicillin-resistant Staphylococcus aureus in meat.

    Science.gov (United States)

    de Boer, E; Zwartkruis-Nahuis, J T M; Wit, B; Huijsdens, X W; de Neeling, A J; Bosch, T; van Oosterom, R A A; Vila, A; Heuvelink, A E

    2009-08-31

    Recently the isolation of methicillin-resistant Staphylococcus aureus (MRSA) strains from several food-producing animals has been reported. During slaughtering of MRSA-positive animals, contamination of carcasses with MRSA may occur and consequently the meat of these animals may get contaminated. The aim of this study was to estimate the prevalence of MRSA in raw meat samples from the retail trade. Samples of raw beef, pork, veal, lamb/mutton, chicken, turkey, fowl and game were collected from the retail trade. A detection method including a two-step enrichment in Mueller-Hinton broth+6.5% NaCl and phenol red mannitol broth containing ceftizoxime and aztreonam, followed by isolation on MRSA ID agar (bioMérieux) was evaluated and subsequently applied for the detection of MRSA in samples of raw meats. MRSA strains were isolated from 264 (11.9%) of 2217 samples analyzed. Isolation percentages for the meat species were: beef (10.6%), veal (15.2%), lamb and mutton (6.2%), pork (10.7%), chicken (16.0%), turkey (35.3%), fowl (3.4%) and game (2.2%). The majority (85%) of the isolated strains belonged to spa-types of pulsed-field gel electrophoresis (PFGE) non-typeable (NT)-MRSA, corresponding to the multilocus sequence type ST398, a type also recently isolated in the Netherlands from pigs. However, a smaller part of these strains were found to be of other ST's, possibly of human origin. Further studies are needed to elucidate transmission routes of MRSA in relation to meat and other foods and to provide the tools for preventing the spread of MRSA. At present the high prevalence of MRSA in meat has not been shown to contribute significantly to the dissemination of MRSA to humans and the possible health hazard for consumers of the presence of MRSA in foods should be further elucidated.

  17. Human pathogens in marine mammal meat – a northern perspective.

    Science.gov (United States)

    Tryland, M; Nesbakken, T; Robertson, L; Grahek-Ogden, D; Lunestad, B T

    2014-09-01

    Only a few countries worldwide hunt seals and whales commercially. In Norway, hooded and harp seals and minke whales are commercially harvested, and coastal seals (harbour and grey seals) are hunted as game. Marine mammal meat is sold to the public and thus included in general microbiological meat control regulations. Slaughtering and dressing of marine mammals are performed in the open air on deck, and many factors on board sealing or whaling vessels may affect meat quality, such as the ice used for cooling whale meat and the seawater used for cleaning, storage of whale meat in the open air until ambient temperature is reached, and the hygienic conditions of equipment, decks, and other surfaces. Based on existing reports, it appears that meat of seal and whale does not usually represent a microbiological hazard to consumers in Norway, because human disease has not been associated with consumption of such foods. However, as hygienic control on marine mammal meat is ad hoc, mainly based on spot-testing, and addresses very few human pathogens, this conclusion may be premature. Additionally, few data from surveys or systematic quality control screenings have been published. This review examines the occurrence of potential human pathogens in marine mammals, as well as critical points for contamination of meat during the slaughter, dressing, cooling, storage and processing of meat. Some zoonotic agents are of particular relevance as foodborne pathogens, such as Trichinella spp., Toxoplasma gondii, Salmonella and Leptospira spp. In addition, Mycoplasma spp. parapoxvirus and Mycobacterium spp. constitute occupational risks during handling of marine mammals and marine mammal products. Adequate training in hygienic procedures is necessary to minimize the risk of contamination on board, and acquiring further data is essential for obtaining a realistic assessment of the microbiological risk to humans from consuming marine mammal meat.

  18. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    OpenAIRE

    Silvius STANCIU; Nicoleta STANCIUC; Loredana DUMITRASCU; Roxana ION; Costel NISTOR

    2013-01-01

    Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appea...

  19. Implications of domestic food practices for the presence of bioactive components in meats with special reference to meat-based functional foods.

    Science.gov (United States)

    Jiménez-Colmenero, Francisco; Cofrades, Susana; Herrero, Ana M; Ruiz-Capillas, Claudia

    2017-06-14

    Although an essential component of the diet, the consumption of meat is in question. Meat is a major source of beneficial compounds but it also contains other substances with negative health implications. Functional foods, which are leading trends in the food industry, constitute an excellent opportunity for the meat sector to improve healthier meat options. Most studies on meat-based functional foods have focused mainly on the application of different strategies (animal production practices and meat transformation systems) to improve (increase/reduce) the presence of bioactive (healthy/unhealthy) compounds; these have led to the development of numerous products, many of them by the meat industry. However, like other foods, after purchase meats undergo certain processes before they are consumed, and these affect their composition. Although domestic handling practices can significantly alter the make-up of the marketed product in terms of healthy/unhealthy compounds, there are very few studies on their consequences. This paper provides an overview of the influence of different domestic practices (from shopping to eating) habitually followed by consumers on the presence of, and consequently on the levels of exposure to, (healthy and unhealthy) food components associated with the consumption of meats, with special reference to meat-based functional foods.

  20. Microorganisms, Qualitative Indicators for Meat Products

    Directory of Open Access Journals (Sweden)

    Marioara Nicoleta Filimon

    2010-10-01

    Full Text Available Due to the fact that, for a few years now, our focus is more and more concentrated on safety and security of meat and vegetable products, this study’s aim is to evaluate the quality of certain well - known meat products (sausages, dry salami, and half-dried salami, purchased in a supermarket, from Timisoara. Microbiological tests were made especially on sanitary microbiological indicators (Escherichia, Enterobacter, Klebsiella. These tests emphasize hygiene in processing ang handling of products. In some cases, it higtlights how various heat treatments (pasteurization type apply to food products. It also establishes the microbial load on the microscopic field and the colony forming units, by a culture method in plates, at 37º C for 48 hours. Based on the obtained results, it has been established that, concerning the microbial load and the presence or absence of coliform bacteria, studied products fall into the quality permitted by applicable law.

  1. Rabbit meat processing: historical perspective to future directions

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2013-12-01

    Full Text Available In past centuries, because rabbits are relatively small, animals slaughtered for consumption were generally eaten immediately. However, since a single rabbit would offer little more product than could be consumed at one sitting, little effort was devoted to developing preserved rabbit products (such as salted or dried meat, sausages, etc.. For this reason, although there is a rich history of recipes using rabbit meat in the Mediterranean area, there are few traditional further-processed products. Nowadays, even though the processing industry is pushing more and more towards the introduction of more attractive products (i.e. ready meals, ready-to-cook, etc. for consumers with little time for meal preparation, most rabbit meat worldwide is still sold as whole carcass or cut-up parts. This review analyses the main strength and weakness factors regarding the use of rabbit meat to manufacture further processed products. Bearing in mind these considerations, it then describes the more promising processing technologies for raw meat materials to obtain added-value products (marinated, formed, emulsified, coated, etc. by exploiting rabbit meat’s intrinsic characteristics, such as high protein/low fat content coupled with a balanced n-6 to n-3 PUFA ratio, low cholesterol and heme-iron content. Major trends in meat product formulation (modulation of lipid content and composition, use of novel antioxidants and salt reduction are also discussed by highlighting strategies to provide healthier meat products meeting current nutritional needs. Finally, major packaging solutions for rabbit meat and meat products (ordinary and modified atmosphere, vacuum are considered.

  2. Nuclear fuel handling apparatus

    International Nuclear Information System (INIS)

    Andrea, C.; Dupen, C.F.G.; Noyes, R.C.

    1977-01-01

    A fuel handling machine for a liquid metal cooled nuclear reactor in which a retractable handling tube and gripper are lowered into the reactor to withdraw a spent fuel assembly into the handling tube. The handling tube containing the fuel assembly immersed in liquid sodium is then withdrawn completely from the reactor into the outer barrel of the handling machine. The machine is then used to transport the spent fuel assembly directly to a remotely located decay tank. The fuel handling machine includes a decay heat removal system which continuously removes heat from the interior of the handling tube and which is capable of operating at its full cooling capacity at all times. The handling tube is supported in the machine from an articulated joint which enables it to readily align itself with the correct position in the core. An emergency sodium supply is carried directly by the machine to provide make up in the event of a loss of sodium from the handling tube during transport to the decay tank. 5 claims, 32 drawing figures

  3. A balancing method for calculating a component raw involving CGF

    Energy Technology Data Exchange (ETDEWEB)

    Kim, K.; Kang, D.; Yang, J.E. [Integrated Safety Assessment Division, Korea Atomic Energy Research Institute, Daejon (Korea, Republic of)

    2004-07-01

    In this paper, a method called the 'Balancing Method' to derive a component RAW (Risk Achievement Worth) with basic event RAWs including a CCF (Common Cause Failure) RAW is summarized, and compared with the method proposed by the NEI (Nuclear Energy Institute) by mathematically checking the background on which the two methods are based. It is proved that the Balancing Method has a strong mathematically background. While the NEI method significantly underestimates the component RAW and is a little bit ad hoc in handling CCF RAW, the Balancing Method estimates the true component RAW very closely. Validity of the Balancing Method is based on the fact that if an component is out-of-service, it does not mean that the component is non-existent, but integrates the possibility that the component might fail due to CCF. The validity of the Balancing Method is proved by comparing it to the exact component RAW generated from the fault tree model.

  4. Dietary energy source affecting fat deposition mechanism, muscle fiber metabolic and overall meat quality

    Directory of Open Access Journals (Sweden)

    M. Al-Hijazeen

    2017-03-01

    Full Text Available A study was conducted to investigate the effect of two dietary energy sources, soy bean oil, and sucrose on regulatory mechanisms of meat preservation. Twenty one day-old Hubbard commercial broilers were randomly allocated into two dietary treatment groups with six replicates per treatment, and four broilers per replicate. All birds were coded for the influence of energy source: fat based diet (FD, and sugar based diet (SD. Formulated grower diets were isonitrogenous and isocaloric. The chickens were slaughtered and then boneless, skinless ground chicken tight meat was prepared. Both raw and cooked meats were analyzed for lipid and protein oxidation, and sensory panel evaluation. In addition, meat from the small muscles of the raw thigh was used to evaluate other meat quality characteristics. Proximate analyses showed no significant differences between both dietary treatments on protein, ash and moisture percentage values. Meat samples of the group that was fed FD showed higher significant values of both TBARS and total carbonyl at day 7 of storage time. However, samples of the second group (Fed SD showed lower values of both ultimate pH and water separation % using raw thigh meat. The effect of FD treatment on the meat composition appeared clearly especially on fat percentage content. In addition, meat samples obtained from chickens fed SD showed better significant values of the overall acceptability attribute. According to the current findings, sucrose could be an excellent alternative to oil in dietary broilers which improved the meat preservation bio-system, and post-mortem storage stability.

  5. Food safety knowledge, attitude and practices of meat handler in abattoir and retail meat shops of Jigjiga Town, Ethiopia.

    Science.gov (United States)

    Tegegne, H A; Phyo, H W W

    2017-12-01

    A cross-sectional survey was carried out among 91 meat handlers by using structured questionnaire to determine the food safety knowledge, attitude and practices in abattoir and retail meat shops of Jigjiga Town. The result shows that majority of the meat handlers were illiterate (30.8%) and primary school leaver (52.7%), and no one went through any food safety training except one meat inspector. The food-handlers' knowledge and safety practices were below acceptable level with the mean score of 13.12 ± 2.33 and 7.7 ± 2.1 respectively. Only few respondents knew about Staphylococcus aureus (3.3% correct answer), hepatitis A virus (19.8% correct answer), and E. coli (5.5% correct answer) as food borne pathogens. About 64% of meat handlers have good attitude about safety of food with mean of total score 14.4 ± 2. All respondents answer correctly questions about proper meat handling and hand washing but they did not translate into strict food hygiene practices. Chi2 analysis testing for the association between knowledge, attitude and practices did not show any significant association. It may be due to meat handlers' below acceptable level safety practices regardless of sociodemographic characteristics, knowledge and attitude. However, there was strong association between level of education and knowledge, and knowledge and hand washing (p practices through better understanding and positive attitude.

  6. Physicochemical properties of meat of ducks of mulberries in modern technologies of meat products

    Directory of Open Access Journals (Sweden)

    R. F. Galin

    2017-01-01

    Full Text Available The article presents the results of studying the chemical composition of mullards duck meat in comparison with the ducks of the Beijingg white breed and musk ducks. The chemical analysis results allow us to note the high moisture content for mullard duck meat. The low fat content for white and red mullard duck meat opens up wide opportunities for the development of an assortment of meat products with a functional orientation. The limited amino acids are determined. The total number of essential amino acids in the mullard duck meat is higher than in musk (by 1.02 g / 100 g protein and Beijingg (by 0.86 g / 100 g protein, which indicates a higher biological value. The limiting amino acid is methionine and cysteine. The article presents the results of the raw material aroma assessment using the "MAG 8" - "electronic nose" analyzer. The content of easily volatile compounds in the equilibrium gas phase for samples of muscle and fat tissue from ducks of different breeding was compared and evaluated. The most informative in the matrix are sensors with films of polydiethylene glycol succinate, polyvinylpyrrolidone, polyethylene glycol PEG-2000, 18-crown-6, trioctylphosphine oxidase, which show maximum sensitivity to polar and nitrogen-containing compounds, aromatic hydrocarbons. This is explained by the fact that the easily volatile fraction of both meat and fat of the samples under study is represented by a variety of organic compounds of different concentrations. Such a variety of substances can be perceived by tasters as "a noticeable smell, difficult". In accordance with the results obtained, we concluded that the aroma of muscle and fat tissue of mulard ducks is more intense, more saturated than the Beijingg duck. The obtained data on the chemical composition indicate possible dietary properties of meat of ducks of mullards. The rich, pronounced aroma of muscle and fatty tissue causes high organoleptic parameters of the finished product, which is

  7. The Meat City

    DEFF Research Database (Denmark)

    Thelle, Mikkel

    2017-01-01

    This article investigates the emergence of the Copenhagen slaughterhouse, called the Meat City, during the late nineteenth century. This slaughterhouse was a product of a number of heterogeneous components: industrialization and new infrastructures were important, but hygiene and the significance...... of Danish bacon exports also played a key role. In the Meat City, this created a distinction between rising production and consumption on the one hand, and the isolation and closure of the slaughtering facility on the other. This friction mirrored an ambivalent attitude towards meat in the urban space: one...... where consumers demanded more meat than ever before, while animals were being removed from the public eye. These contradictions, it is argued, illustrate and underline the change of the city towards a ‘post-domestic’ culture. The article employs a variety of sources, but primarily the Copenhagen...

  8. Meat for keeps

    International Nuclear Information System (INIS)

    Niemand, J.G.

    1981-01-01

    The advantages of gamma irradiation as a food preservation technique for meat are such that the author envisages its wide acceptance and application during this decade both locally and internationally

  9. Irradiation and additive combinations on the pathogen reduction and quality of poultry meat.

    Science.gov (United States)

    Ahn, Dong U; Kim, Il Suk; Lee, Eun Joo

    2013-02-01

    Reduction of foodborne illnesses and deaths by improving the safety of poultry products is one of the priority areas in the United States, and developing and implementing effective food processing technologies can be very effective to accomplish that goal. Irradiation is an effective processing technology for eliminating pathogens in poultry meat. Addition of antimicrobial agents during processing can be another approach to control pathogens in poultry products. However, the adoption of irradiation technology by the meat industry is limited because of quality and health concerns about irradiated meat products. Irradiation produces a characteristic aroma as well as alters meat flavor and color that significantly affect consumer acceptance. The generation of a pink color in cooked poultry and off-odor in poultry by irradiation is a critical issue because consumers associate the presence of a pink color in cooked poultry breast meat as contaminated or undercooked, and off-odor in raw meat and off-flavor in cooked meat with undesirable chemical reactions. As a result, the meat industry has difficulties in using irradiation to achieve its food safety benefits. Antimicrobials such as sodium lactate, sodium diacetate, and potassium benzoate are extensively used to extend the shelf-life and ensure the safety of meat products. However, the use of these antimicrobial agents alone cannot guarantee the safety of poultry products. It is known that some of the herbs, spices, and antimicrobials commonly used in meat processing can have synergistic effects with irradiation in controlling pathogens in meat. Also, the addition of spices or herbs in irradiated meat improves the quality of irradiated poultry by reducing lipid oxidation and production of off-odor volatiles or masking off-flavor. Therefore, combinations of irradiation with these additives can accomplish better pathogen reduction in meat products than using them alone even at lower levels of antimicrobials/herbs and

  10. Identification of characteristic aroma compounds in raw and thermally processed African giant snail (Achatina fulica).

    Science.gov (United States)

    Lasekan, Ola; Muniady, Megala; Lin, Mee; Dabaj, Fatma

    2018-04-24

    Food flavor appreciation is one of the first signals along with food appearance and texture encountered by consumers during eating of food. Also, it is well known that flavor can strongly influence consumer's acceptability judgment. The increase in the consumption of snail meat across the world calls for the need to research into the aroma compounds responsible for the distinctive aroma notes of processed snail meat. The odorants responsible for the unique aroma notes in thermally processed giant African snail meats were evaluated by means of aroma extract dilution analysis (AEDA), gas chromatography-olfactometry (GC-O) and odor activity values (OAVs) respectively. Results revealed significant differences in the aroma profiles of the raw and thermally processed snail meats. Whilst the aroma profile of the raw snail meat was dominated with the floral-like β-ionone and β-iso-methyl ionone, sweaty/cheesy-like butanoic acid, and the mushroom-like 1-octen-3-one, the boiled and fried samples were dominated with the thermally generated odorants like 2-methylpyrazine, 2,5-dimethylpyrazine, 2-acetylthiazole and 2-acetylpyridine. Finally, results have shown that sotolon, 2-acetyl-1-pyrroline, 2-furanmethanethiol, 2-methylbutanal, 1-octen-3-one, octanal, furanone, 2-methoxyphenol, 2-acetylpyridine, 2-acetylthiazole, and 2-methylpyrazine contributed to the overall aroma of the thermally processed snail meat.

  11. Effect of comminution method and raw binder system in restructured beef.

    Science.gov (United States)

    Boles, J A; Shand, P J

    1998-07-01

    The effect of particle size, method of particle size reduction (grinding, flaking, slicing) and alginate or Fibrimex(™) binding systems on processing properties of restructured beef were investigated. The size of semimembranosus muscles was reduced with a meat slicer, grinder or flaker (Comitrol) through machine openings that were 2, 4 and 8 mm in size. Bind of meat pieces in raw and cooked beef steakettes were measured. Sensory evaluation to determine the effect of method of size reduction on texture of beef steakettes was done only on steakettes manufactured with alginate. Beef steakettes manufactured with the alginate binding system had significantly (p meat for the manufacture of restructured beef steakettes resulted in a higher raw bind than did either grinding or flaking the meat. Significant (p meat was sliced than when it was ground or flaked. However, when Fibrimex was used, bind was stronger when sliced meat was used. The alginate system resulted in higher binds for cooked product when particle size was smaller but with the Fibrimex system bind was higher when particle sizes were larger. A consumer panel on alginate restructured steakettes showed no preference for the texture produced by the different methods of particle size reduction.

  12. How to Handle Abuse

    Science.gov (United States)

    ... Handle Abuse KidsHealth / For Kids / How to Handle Abuse What's in this article? Tell Right Away How Do You Know Something Is Abuse? ... babysitter, teacher, coach, or a bigger kid. Child abuse can happen anywhere — at ... building. Tell Right Away A kid who is being seriously hurt ...

  13. Grain Handling and Storage.

    Science.gov (United States)

    Harris, Troy G.; Minor, John

    This text for a secondary- or postecondary-level course in grain handling and storage contains ten chapters. Chapter titles are (1) Introduction to Grain Handling and Storage, (2) Elevator Safety, (3) Grain Grading and Seed Identification, (4) Moisture Control, (5) Insect and Rodent Control, (6) Grain Inventory Control, (7) Elevator Maintenance,…

  14. Update on the bird-egg syndrome and genuine poultry meat allergy.

    Science.gov (United States)

    Hemmer, Wolfgang; Klug, Christoph; Swoboda, Ines

    Allergy to poultry meat is rare and affects both children and adults. The prevalence of poultry meat allergy is unknown, but presumably is similar to that of red meat allergy. There is no close relationship between allergy to poultry meat and allergy to red meat. Poultry meat allergy may present as primary (genuine) food allergy or as secondary food allergy resulting from cross-reactivity. Secondary poultry meat allergy may arise in the context of bird-egg-syndrome, which is due to sensitization to serum albumins present in many tissues including muscle tissue and egg yolk (Gal d 5). Primary sensitization to serum albumin may happen via the respiratory tract through exposure to pet birds (mainly in adults) or within the context of egg allergy in early childhood. Due to the heat lability of serum albumins, reactions are often limited to the skin upon contact with raw meat. Symptoms from meat ingestion are rare and mostly mild, whereas systemic reactions are common after ingestion of raw or soft-boiled egg yolk. Primary poultry meat allergy is mainly seen in adolescents and young adults, though hypersensitivity may have started already at (pre)school age. Egg allergy is usually absent. Typical symptoms of primary poultry meat allergy include OAS (±dyspnea), gastrointestinal complaints, urticaria and angioedema. Severe anaphylaxis with cardiovascular symptoms is rare. Chicken and turkey meat are highly cross-reactive and responsible for most reactions, while duck and goose meat causes milder or no symptoms. Soups, sausages, and ham represent relevant allergen sources, too. Patients with poultry meat allergy unexpectedly often suffer from concomitant allergy to fish and possibly shrimp. Serum specific IgE against fish and shrimp is found in respectively 60 and 40 % of sera, suggestive of cross-reactive allergens in these foods. The allergens thus far recognized in genuine poultry meat are LMW proteins of 5-25 kDa. One of them has been identified as

  15. Integrity of nuclear genomic deoxyribonucleic acid in cooked meat: Implications for food traceability.

    Science.gov (United States)

    Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M

    2009-01-01

    It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P 800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.

  16. VARIATION IN MEAT COMPOSITION VISCOSITY DURING THE MIXING PROCESS

    Directory of Open Access Journals (Sweden)

    DANIELA IANIłCHI

    2008-10-01

    Full Text Available Animal raw material processing is directly influenced by the physical and chemical characteristics of the materials which also influence their water holding capacity. The various combinations and status of the raw materials used in the food industry determine specific behaviours that may influence the processing equipment performance and construction. The study on meat composition viscosity depending upon the added components, temperature and mixing time length, has shown that viscosity is increasing with lower added water percentage, lower mixing temperature and higher mixing time length.

  17. Cardiotoxic Effects of Raw Opium.

    Science.gov (United States)

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  18. Cardiotoxic Effects of Raw Opium

    OpenAIRE

    Garg, Piyush; Hitawala, Asif Ali; Agarwal, Manoj

    2018-01-01

    While opioid drug toxicity and side effects of long-term opioid use during medical care are well studied, there is little information regarding effects of ingestion of raw opium. Characterization of the effects to a particular alkaloid is difficult since raw opium contains a number of alkaloids. Here, we present a case of poisoning due to ingestion of raw opium leading to severe myocardial suppression.

  19. NEW MEAT PRODUCTS WITH IMMUNOMODULATORY EFFECT CREATION METHOD

    Directory of Open Access Journals (Sweden)

    I. V. Kaltovich

    2016-01-01

    Full Text Available New meat products with immunomodulatory effect creation method reflecting differential characteristics of technological stages of manufacture of those types of meat products, including issues on the selection of primary and secondary raw materials, guidelines for development of formulations and production technologies, legislative requirements towards its labeling, etc, has been developed for the first time. A list of prospective meat raw materials for the manufacture of products with immunomodulatory effect was established: beef, pork, rabbit meat, broiler chicken meat, turkey, veal, ostrich meat, which have high content of protein (14,3– 21,7%, low content of fat (1,2–16,1%, excluding pork (33,3%, high levels of minimum amino-acid score (90,0–104,0%, protein quality indicator(0,91–1,64, essential amino acid index (1,16-1,25, coefficient of utility of amino acid content (0,72–0,86 and close to optimum fatty acid content, and also contain a great number of vitamins and minerals which play a significant role for immunity improvement. It was determined that the following functional ingredients are recommended to use: amino acids (valine, leucine, isoleucine, methionine, threonine, arginine, tryptophan, lysine, histidin, phenylalanyl, vitamins and provitamins (C,E, beta-carotene, B vitamins(Bc, B12, PP, etc., P(bioflavonoid complex, H, K, minerals (calcium, magnesium, iron, cuprum, zinc, manganese, selenium, polyunsaturated fatty acids omega-3 and omega-6, pseudo-vitamins (L-carnitin, coenzyme Q10, polysaccharides and peptides naturally occurring(squalen, B-Carotene, ginger, shiitake mushrooms, probiotics and prebiotics, glutathione, indole and lycopienes, bioflavonoids, L-arginine, N-acetylcysteine, gel from seaweed «Lamifaren». The use of the developed meat products with immunomodulatory effect creation method by process engineers of meat processing factories will allow them to form a single scientifically grounded approach during the

  20. Microstructure and physical changes in the Mexican cooked lamb meat barbacoa made with chilled and frozen meat.

    Science.gov (United States)

    Estrada-Solís, Joaquín; Figueroa-Rodríguez, Katia A; Figueroa-Sandoval, Benjamín; Hernández-Rosas, Francisco; Hernández-Cazares, Aleida S

    2016-08-01

    Longissimus dorci (LD) samples of different origin (imported and domestic) with pre-treatments (imported meat stored at -18°C for 6months, domestic meat stored at -18°C for 10days, and domestic meat stored at 4°C for 24h) were cooked as barbacoa and frozen using two treatments (air blast and liquid immersion) and then evaluated after 30days of storage. The results showed that the origin and pre-treatment of meat affected L*, a*, instrumental texture and microstructure; that the storage time affected pH, aw, b* and microstructure; and that the freezing treatments did not affect the meat. Overall, the frozen cooked lamb dish barbacoa could present some problems at the conservation stage due to an increase in pH, aw and changes in microstructure; however, the physical traits (color and texture) remained mostly unchanged and depended more on the quality of the raw meat. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    Science.gov (United States)

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (ppork head meat was increased from 0% to 20%, cooking loss, total expressible fluid separation, fat separation, and pH of frankfurters were increased, while the lightness, redness, yellowness, and apparent viscosity of frankfurters were decreased. Ash contents, cohesiveness, color, and tenderness of sensory characteristics of frankfurters added with different amounts of pork meat or pork head meat were not significantly (p>0.05) different from those of the control or there treatments. Frankfurters in T4 (frankfurter with 30% pork meat + 20% pork head) had the lowest (p0.05) from that in the control. Frankfurters with higher pork head meat concentrations had lower flavor, juiciness, and overall acceptability scores. Therefore, replacing pork meat with pork head meat in the formulation could successfully produce results similar to those of control frankfurters. The best results were obtained when 10% pork head meat was used to replace pork meat. PMID:27621683

  2. STUDY ON THE FACTORS INFLUENCING HYDRATION AND WATER RETENTION CAPACITY OF MEAT

    OpenAIRE

    DANIELA IANIłCHI; CARMEN NICOLAE; CRISTIANA DIACONESCU; GABRIELA MALOS; I. G. MALOS

    2008-01-01

    Top-quality food produce and high profitability in processing requires high quality in raw materials. Therefore, to achieve these objectives, it is imperative to know the properties of the war materials, and the factors that influence these properties.The properties of the meat directly involved in increasing economic efficiency and final produce quality are the so-called technological properties: hydration capacity and water retention capacity of meat. These properties are determined by some...

  3. Nutritional value and fatty acid composition of some traditional Argentinean meat sausages

    OpenAIRE

    Mara Cristina Romero; Ana María Romero; Mirtha Marina Doval; Maria Alicia Judis

    2013-01-01

    The aim of this work was to determine the nutritional composition (moisture, protein, carbohydrates, and total fat) of meat products elaborated in the northeast of Argentina, analyzing fatty acids composition, PUFA/SFA ratio, n-6/n-3 relation, and CLA content. Thirty traditional meat products from different processes were used. Samples were classified into 4 different categories as follows: salamín (dry cured and fermented sausage), chorizos (raw sausage), chorizo ahumado (cooked and smoked s...

  4. Effect of irradiated pork on physicochemical properties of meat emulsions

    Science.gov (United States)

    Choi, Yun-Sang; Sung, Jung-Min; Jeong, Tae-Jun; Hwang, Ko-Eun; Song, Dong-Heon; Ham, Youn-Kyung; Kim, Hyun-Wook; Kim, Young-Boong; Kim, Cheon-Jei

    2016-02-01

    The effect of pork irradiated with doses up to 10 kGy on meat emulsions formulated with carboxy methyl cellulose (CMC) was investigated. Raw pork was vacuums packaged at a thickness of 2.0 cm and irradiated by X-ray linear accelerator (15 kW, 5 MeV). The emulsion had higher lightness, myofibrillar protein solubility, total protein solubility, and apparent viscosity with increasing doses, whereas cooking loss, total expressible fluid separation, and hardness decreased. There were no significant differences in fat separation, sarcoplasmic protein solubility, springiness, and cohesiveness. Our results indicated that it is treatment by ionizing radiation which causes the effects the physicochemical properties of the final raw meat product.

  5. Effect of chopping time and heating on 1 H nuclear magnetic resonance and rheological behavior of meat batter matrix.

    Science.gov (United States)

    Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong

    2018-04-01

    The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.

  6. Effect of Selected Alternative Fuels and Raw Materials on the Cement Clinker Quality

    Directory of Open Access Journals (Sweden)

    Strigáč Július

    2015-11-01

    Full Text Available The article deals with the study of the effects of alternative fuels and raw materials on the cement clinker quality. The clinker quality was expressed by the content of two principal minerals alite C3S and belite C2S. The additions of alternative fuels ashes and raw materials, in principle, always increased the belite content and conversely reduced the amount of alite. The alternative fuels with high ash content were used such as the meat-bone meal, sewage sludge from sewage treatment plants and paper sludge and the used alternative raw materials were metallurgical slags - granulated blastfurnace slag, air cooled blastfurnace slag and demetallized steel slag, fluidized bed combustion fly ash and waste glass. Meat-bone meal, sewage sludge from sewage treatment plants and paper sludge were evaluated as moderately suitable alternative fuels which can be added in the amounts of 2.8 wt. % addition of meat-bone meals ash, 3.64 wt. % addition of sewage sludge ash and 3.8 wt. % addition of paper sludge ash to the cement raw mixture. Demetallised steel slag is suitable for production of special sulphate resistant cement clinker for CEM I –SR cement with addition up to 5 wt. %. Granulated blastfurnace slag is a suitable alternative raw material with addition 4 wt. %. Air cooled blastfurnace slag is a suitable alternative raw material with addition 4.2 wt. %. Waste glass is not very appropriate alternative raw material with addition only 1.16 wt. %. Fluidized bed combustion fly ash appears not to be equally appropriate alternative raw material for cement clinker burning with less potential utilization in the cement industry and with addition 3.41 wt. %, which forms undesired anhydrite CaSO4 in the cement clinker.

  7. An improved UPLC method for the detection of undeclared horse meat addition by using myoglobin as molecular marker.

    Science.gov (United States)

    Di Giuseppe, Antonella M A; Giarretta, Nicola; Lippert, Martina; Severino, Valeria; Di Maro, Antimo

    2015-02-15

    In 2013, following the scandal of the presence of undeclared horse meat in various processed beef products across the Europe, several researches have been undertaken for the safety of consumer health. In this framework, an improved UPLC separation method has been developed to detect the presence of horse myoglobin in raw meat samples. The separation of both horse and beef myoglobins was achieved in only seven minutes. The methodology was improved by preparing mixtures with different composition percentages of horse and beef meat. By using myoglobin as marker, low amounts (0.50mg/0.50g, w/w; ∼0.1%) of horse meat can be detected and quantified in minced raw meat samples with high reproducibility and sensitivity, thus offering a valid alternative to conventional PCR techniques. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Potential Biomarker of Myofibrillar Protein Oxidation in Raw and Cooked Ham: 3-Nitrotyrosine Formed by Nitrosation.

    Science.gov (United States)

    Feng, Xianchao; Li, Chenyi; Ullah, Niamat; Hackman, Robert M; Chen, Lin; Zhou, Guanghong

    2015-12-30

    The stability of cured meat products is increased by the protection of its proteins from oxidation by sodium nitrite (NaNO2) during processing. This study investigated the effects of NaNO2 (0, 50, 100, 200, and 400 mg/kg) on the physiochemical and structural characteristics of myofibrillar protein (MP) in raw and cooked ham. The NaNO2 showed a dose-dependent antioxidant effect, by inhibiting carbonyl formation, dityrosine formation, and denaturation of MP, and a nitrosative effect, through the formation of 3-Nitrotyrosine (3-NT). The 3-NT content within MP of raw ham had distinct negative correlations with sulfhydryl content and surface hydrophobicity. The 3-NT content within MP of cooked ham had significantly negative correlations with carbonyl, sulfhydryl content and turbidity and had significantly positive correlations with disulfide content. These results indicated that 3-NT may be a potential marker for protein oxidation in raw and cooked cured meat products.

  9. Vitamin D-3 and 25-hydroxyvitamin D-3 in raw and cooked pork cuts

    DEFF Research Database (Denmark)

    Clausen, Ina; Jakobsen, Jette; Leth, Torben

    2003-01-01

    The contents of vitamin D-3 and its metabolically active metabolite 25-hydroxyvitamin D-3 (25OHD(3)) were examined by HPLC in different parts of four common raw pork cuts (loin boneless, leg inside, thin belly, neck) and in cooked meat (loin boneless). In whole raw pork cuts, varying in fat content......, and that rind, despite its limited fat content, has a high concentration of vitamin D-3 and 25OHD(3). Cooking increased vitamin D-3 and 25OHD(3) calculated per 100 g of tissue in all parts and in the whole cut (in whole cuts in raw and cooked meat, respectively: vitamin D-3: 0.15 (0.08-0.24) mug/100 g and 0...... 25OHD(3) contributes significantly to vitamin D activity. Food databases should include concentrations of both vitamin D and 25OHD(3). (C) 2003 Elsevier Ltd. All rights reserved....

  10. Validation of low-volume enrichment protocols for detection of Escherichia coli O157 in raw ground beef components, using commercial kits.

    Science.gov (United States)

    Ahmed, Imtiaz; Hughes, Denise; Jenson, Ian; Karalis, Tass

    2009-03-01

    Testing of beef destined for use in ground beef products for the presence of Escherichia coli O157:H7 has become an important cornerstone of control and verification activities within many meat supply chains. Validation of the ability of methods to detect low levels of E. coli O157:H7 is critical to confidence in test systems. Many rapid methods have been validated against standard cultural methods for 25-g samples. In this study, a number of previously validated enrichment broths and commercially available test kits were validated for the detection of low numbers of E. coli O157:H7 in 375-g samples of raw ground beef component matrices using 1 liter of enrichment broth (large-sample:low-volume enrichment protocol). Standard AOAC International methods for 25-g samples in 225 ml of enrichment broth, using the same media, incubation conditions, and test kits, were used as reference methods. No significant differences were detected in the ability of any of the tests to detect low levels of E. coli O157:H7 in samples of raw ground beef components when enriched according to standard or large-sample:low-volume enrichment protocols. The use of large-sample:low-volume enrichment protocols provides cost savings for media and logistical benefits when handling and incubating large numbers of samples.

  11. Meat and meat products as a source of bioactive peptides

    Directory of Open Access Journals (Sweden)

    Alfonso Totosaus

    2016-12-01

    Full Text Available Meat is a high protein content food, with great nutritional and biological value. Meat protein hydrolysis begins with the muscle to meat conversion, during meat ageing. After slaughter, endogen enzymes are responsible of meat softening since myofibrillar anchorage proteins are degraded. Protein hydrolysis continues during food preparation. When meat reaches the stomach, pepsin is the first enzyme to interact. As the food travel trough out gastrointestinal tract, pancreatic enzymes degraded the remained protein and the peptidases made the final proteolysis process. The small proteins or peptides are the absorbed to the circulatory system and distributed to the rest of the body. Bioactive peptides activity of meat and meat products is anti-hypertensive mainly, where histidine, carnosine and anserine are the main peptides identified. Another peptide with anti-oxidant activity is glutathione. The content depends on animal species.

  12. Czech Foreign Trade with Meat and Meat Products

    Directory of Open Access Journals (Sweden)

    Karina Pohlová

    2016-04-01

    Full Text Available The meat production and meat processing industry are the most important parts of the agribusiness in the Czech Republic. The problem of the industry is its low competitiveness towards foreign producers and processors which results in negative balance of foreign trade. The aim of the article is to evaluate long-term development of value and structure of Czech foreign trade flows of meat and meat products. The analysis covers the period of 2001–2014. The problems of the negative trade balance are revealed through description of the trade flows of meat and meat products, the RCA index and relations between import and export prices. The analysis points out the problems of low competitiveness of the intermediate and finalized meat. Alternatively, Czech Republic has comparative advantage in live animals, sausages and homogenized meat products.

  13. Halal authenticity issues in meat and meat products.

    Science.gov (United States)

    Nakyinsige, Khadijah; Man, Yaakob Bin Che; Sazili, Awis Qurni

    2012-07-01

    In the recent years, Muslims have become increasingly concerned about the meat they eat. Proper product description is very crucial for consumers to make informed choices and to ensure fair trade, particularly in the ever growing halal food market. Globally, Muslim consumers are concerned about a number of issues concerning meat and meat products such as pork substitution, undeclared blood plasma, use of prohibited ingredients, pork intestine casings and non-halal methods of slaughter. Analytical techniques which are appropriate and specific have been developed to deal with particular issues. The most suitable technique for any particular sample is often determined by the nature of the sample itself. This paper sets out to identify what makes meat halal, highlight the halal authenticity issues that occur in meat and meat products and provide an overview of the possible analytical methods for halal authentication of meat and meat products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. A comparative study of functional properties of normal and wooden breast broiler chicken meat with NaCl addition.

    Science.gov (United States)

    Xing, Tong; Zhao, Xue; Han, Minyi; Cai, Linlin; Deng, Shaolin; Zhou, Guanghong; Xu, Xinglian

    2017-09-01

    The selection of broilers for augmented growth rate and breast has brought about wooden-breast (WB) muscle abnormalities, which caused substantial economic losses. The objective of this study was to compare water holding capacity, water mobility and distribution, salt-soluble protein (SSP) content, and protein profiles of normal and WB chicken meat with different additions of NaCl. Thirty WB and 30 normal chicken breasts were selected from a deboning line of a major Chinese processing plant at 2 to 3 h post mortem. Two different meat batters were formulated to 150 mg/g meat protein and different NaCl contents (0%, 1%, 2%, 3%, and 4%). Results indicated that as NaCl contents increased, the cooking loss of meat batters decreased (P meat showed different protein profiles, with myosin heavy chain exhibiting a higher intensity at ≥3% salt level. Low-field nuclear magnetic resonance (LF-NMR)revealed an increased T22 and higher P22 in raw WB meat compared to normal meat (P meat batters, WB meat batters had reduced T21 and lower immobilized water proportions at low NaCl contents (meat gels. Meat gels prepared from WB had a lower proportion of water within the myofibrillar protein matrix and a greater proportion of exuded bulk water at NaCl contents meat, meat batters and gels, water distribution and mobility of WB exhibited significant differences compared to normal meat. The addition of NaCl affected water mobility and distributions in meat batters, with a level of 3% NaCl eliminating the differences between processed normal and WB meat products. © 2017 Poultry Science Association Inc.

  15. Behavioral, Ecological, and Evolutionary Aspects of Meat-Eating by Sumatran Orangutans (Pongo abelii).

    Science.gov (United States)

    Hardus, Madeleine E; Lameira, Adriano R; Zulfa, Astri; Atmoko, S Suci Utami; de Vries, Han; Wich, Serge A

    2012-04-01

    Meat-eating is an important aspect of human evolution, but how meat became a substantial component of the human diet is still poorly understood. Meat-eating in our closest relatives, the great apes, may provide insight into the emergence of this trait, but most existing data are for chimpanzees. We report 3 rare cases of meat-eating of slow lorises, Nycticebus coucang, by 1 Sumatran orangutan mother-infant dyad in Ketambe, Indonesia, to examine how orangutans find slow lorises and share meat. We combine these 3 cases with 2 previous ones to test the hypothesis that slow loris captures by orangutans are seasonal and dependent on fruit availability. We also provide the first (to our knowledge) quantitative data and high-definition video recordings of meat chewing rates by great apes, which we use to estimate the minimum time necessary for a female Australopithecus africanus to reach its daily energy requirements when feeding partially on raw meat. Captures seemed to be opportunistic but orangutans may have used olfactory cues to detect the prey. The mother often rejected meat sharing requests and only the infant initiated meat sharing. Slow loris captures occurred only during low ripe fruit availability, suggesting that meat may represent a filler fallback food for orangutans. Orangutans ate meat more than twice as slowly as chimpanzees (Pan troglodytes), suggesting that group living may function as a meat intake accelerator in hominoids. Using orangutan data as a model, time spent chewing per day would not require an excessive amount of time for our social ancestors (australopithecines and hominids), as long as meat represented no more than a quarter of their diet. ELECTRONIC SUPPLEMENTARY MATERIAL: The online version of this article (doi:10.1007/s10764-011-9574-z) contains supplementary material, which is available to authorized users.

  16. Faktor Risiko Manual Handling dengan Keluhan Nyeri Punggung Bawah Pembuat Batu Bata

    Directory of Open Access Journals (Sweden)

    Heru Subaris Kasjono

    2017-08-01

    Full Text Available During done manual work handling for objects work hard, it will cause risk of injury or cause musculoskeletal systems. Risk assessment manual work handling with the methods indicators key-Leitmerkmal Method (LMM intended to know the relationship between time, burden, attitudes of the body, and working conditions manual handling with complaints of the lower back pain at all stages making bricks perceived maker bricks. The kind of research used is surveyed such data is cross sectional. The data taken by lower back pain questionnaire assisted examination physically by nurses and checklist Key-LMM. Analysis relations use the spearman. The results of research acquired at variable time manual handling based frequency raised or operation the transfer of on stage excavation raw materials, the formation and drying bricks there are relations with complaints of  low back pain with p value each are 0,039, 0,047, 0,038 while on the variables of working conditions manual handling in stage excavation raw materials obtained p value of 0,028 with so it can be said there was a correlation between working conditions manual handling with complaints low back pain. A variable load manual handling and attitudes of the body manual handling do not relate in significant to lower back pain all stages making bricks. Conclusion researchers that the variable time manual handling relate in significant with complaints lower back pain in stage excavation raw materials, the formation and drying bricks, while the phase processing raw materials that there was no correlation, in a variable load manual handling and attitudes of the body manual handling all these stage there was no correlation with complaints lower back pain, while variable working conditions manual handling only in stage excavation the raw materials there are relations with complaints lower back pain in the third stage other there was no correlation.

  17. Replacement of Pork Meat with Pork Head Meat for Frankfurters

    OpenAIRE

    Choi, Yun-Sang; Hwang, Ko-Eun; Kim, Hyun-Wook; Song, Dong-Heon; Jeon, Ki-Hong; Park, Jong-Dae; Sung, Jung-Min; Kim, Young-Boong; Kim, Cheon-Jei

    2016-01-01

    The effect of reducing pork meat concentrations from 50% to 30% and replacing it with up to 20% pork head meat on chemical composition, cooking characteristics, physicochemical and textural properties, apparent viscosity, and sensory characteristics of frankfurters was determined. The highest moisture content in frankfurters was found in the control and T1 (frankfurter with 45% pork meat + 5% pork head). Protein and fat contents in frankfurters with pork head meat added were significantly (p0...

  18. Decarbonising meat : Exploring greenhouse gas emissions in the meat sector

    NARCIS (Netherlands)

    Aan Den Toorn, S. I.; Van Den Broek, M. A.; Worrell, E.

    Consumption of meat is an important source of global greenhouse gas (GHG) emission and deep decarbonisation of the whole meat production chain is required to be able to meet global climate change (CC) mitigation goals. Emissions happen in different stages of meat production ranging from agricultural

  19. Handling Pyrophoric Reagents

    Energy Technology Data Exchange (ETDEWEB)

    Alnajjar, Mikhail S.; Haynie, Todd O.

    2009-08-14

    Pyrophoric reagents are extremely hazardous. Special handling techniques are required to prevent contact with air and the resulting fire. This document provides several methods for working with pyrophoric reagents outside of an inert atmosphere.

  20. Remote handling equipment

    International Nuclear Information System (INIS)

    Clement, G.

    1984-01-01

    After a definition of intervention, problems encountered for working in an adverse environment are briefly analyzed for development of various remote handling equipments. Some examples of existing equipments are given [fr

  1. Ergonomics and patient handling.

    Science.gov (United States)

    McCoskey, Kelsey L

    2007-11-01

    This study aimed to describe patient-handling demands in inpatient units during a 24-hour period at a military health care facility. A 1-day total population survey described the diverse nature and impact of patient-handling tasks relative to a variety of nursing care units, patient characteristics, and transfer equipment. Productivity baselines were established based on patient dependency, physical exertion, type of transfer, and time spent performing the transfer. Descriptions of the physiological effect of transfers on staff based on patient, transfer, and staff characteristics were developed. Nursing staff response to surveys demonstrated how patient-handling demands are impacted by the staff's physical exertion and level of patient dependency. The findings of this study describe the types of transfers occurring in these inpatient units and the physical exertion and time requirements for these transfers. This description may guide selection of the most appropriate and cost-effective patient-handling equipment required for specific units and patients.

  2. Meat and Appetite Regulation

    DEFF Research Database (Denmark)

    Kehlet, Ursula Nana

    effects of new formulations of pork products. Different strategies can be applied to potentially enhance the satiating properties of pork. Processed meat products such as meatballs can serve as a matrix for the addition of fiber ingredients. Based on their high protein and fiber contents, high......-fibre meatballs could provide a dual mechanistic action that would lead to greater satiety. For whole muscles, cooking is known to induce structural, physical and chemical changes of the meat proteins, which in turn may affect protein digestibility and potentially affect satiety. The overall aim of this Ph......D thesis was to investigate the effects of fiber addition to meatballs and the effects of cooking methods of pork on appetite regulation. The PhD thesis is based on three human meal test studies and one analytical study related to the characteristics of fiber meat products. In paper I, the objective...

  3. Ecological safety of meat products

    OpenAIRE

    A. K. Mikhailenko

    2009-01-01

    The level of toxicants was studied, and the biological value of sheep meat in the area of anthropogenic influence was checked up. The level of toxicants in meat depends straight on the age of animals.

  4. [Evaluation of the quality of poultry meat and its processing for vacuum packaging].

    Science.gov (United States)

    Swiderski, F; Russel, S; Waszkiewicz-Robak, B; Cholewińska, E

    1997-01-01

    The aim of study was to evaluate the quality of poultry meat, roasted and smoked chicken and poultry pie packing under low and high vacuum. All investigated products were stored at +4 degrees C and evaluated by microbiological analysis. It was showed that packing under low and high vacuum inhibited development of aerobic microorganisms, proteolytic bacteria, yeasts and moulds. Vacuum-packaged storage of poultry meat and its products stimulated activity of anaerobic, nonsporeforming bacteria. The fast spoilage of fresh poultry meat was observed both under vacuum and conventional storage. The microbiology quality of poultry products depended on technology of production and microbiological quality of raw material.

  5. Sustainability and meat consumption: is reduction realistic?

    NARCIS (Netherlands)

    Dagevos, H.; Voordouw, J.

    2013-01-01

    Meat is critical with respect to sustainability because meat products are among the most energy-intensive and ecologically burdensome foods. Empirical studies of the meat-consumption frequency of Dutch consumers show that, apart from meat-avoiders and meat-eaters, many people are meat-reducers that

  6. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Directory of Open Access Journals (Sweden)

    Monique Zagorec

    2017-09-01

    Full Text Available Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage.

  7. Lactobacillus sakei: A Starter for Sausage Fermentation, a Protective Culture for Meat Products

    Science.gov (United States)

    Zagorec, Monique; Champomier-Vergès, Marie-Christine

    2017-01-01

    Among lactic acid bacteria of meat products, Lactobacillus sakei is certainly the most studied species due to its role in the fermentation of sausage and its prevalence during cold storage of raw meat products. Consequently, the physiology of this bacterium regarding functions involved in growth, survival, and metabolism during meat storage and processing are well known. This species exhibits a wide genomic diversity that can be observed when studying different strains and on which probably rely its multiple facets in meat products: starter, spoiler, or protective culture. The emerging exploration of the microbial ecology of meat products also revealed the multiplicity of bacterial interactions L. sakei has to face and their various consequences on microbial quality and safety at the end of storage. PMID:28878171

  8. Comparision of the BAX® System with an in-house MSRV method for the detection of Salmonella in chicken carcasses and pork meat

    OpenAIRE

    Franchin,Paulo R.; Ogliari,Paulo J.; Andrade,Dalton F.; Chiapinoto,Maura; Lemos,Giovana; Rebelatto,Marina; Silva,Ivair G. da; Batista,Cleide R.V.

    2006-01-01

    A study was performed to compare the analytical procedure of the BAX® System for Salmonella PCR assay with the Modified Semi-Solid Rappaport-Vassiliadis (MSRV) method, for the detection of Salmonella in naturally contaminated chicken carcass samples (n = 762) and raw pork meat (n = 566). The chicken carcasses samples were collected during slaughtering after defeathering or immediately after evisceration and the raw pork meat collected from the deboned head of recently slaughtered pigs and oth...

  9. Handling construction waste of building demolition

    Directory of Open Access Journals (Sweden)

    Vondráčková Terezie

    2018-01-01

    Full Text Available Some building defects lead to their demolition. What about construction and demolition waste? According to the Waste Act 185/2001 Coll. and its amendment 223/2015 Coll., which comes into force on January 1, 2017, the production of waste has to be reduced because, as already stated in the amendment to Act No. 229/2014 Coll., the ban on landfilling of waste will apply from 2024 onwards. The main goals of waste management can thus be considered: Preventing or minimizing waste; Waste handling to be used as a secondary raw material - recycling, composting, combustion and the remaining waste to be dumped. Company AZS 98 s. r. o. was established, among other activities, also for the purpose of recycling construction and demolition waste. It operates 12 recycling centers throughout the Czech Republic and therefore we have selected it for a demonstration of the handling of construction and demolition waste in addressing the defects of the buildings.

  10. Methods and approaches to prediction in the meat industry

    Directory of Open Access Journals (Sweden)

    A. B. Lisitsyn

    2016-01-01

    Full Text Available The modern stage of the agro-industrial complex is characterized by an increasing complexity, intensification of technological processes of complex processing of materials of animal origin also the need for a systematic analysis of the variety of determining factors and relationships between them, complexity of the objective function of product quality and severe restrictions on technological regimes. One of the main tasks that face the employees of the enterprises of the agro-industrial complex, which are engaged in processing biotechnological raw materials, is the further organizational improvement of work at all stages of the food chain, besides an increase in the production volume. The meat industry as a part of the agro-industrial complex has to use the biological raw materials with maximum efficiency, while reducing and even eliminating losses at all stages of processing; rationally use raw material when selecting a type of processing products; steadily increase quality, biological and food value of products; broaden the assortment of manufactured products in order to satisfy increasing consumer requirements and extend the market for their realization in the conditions of uncertainty of external environment, due to the uneven receipt of raw materials, variations in its properties and parameters, limited time sales and fluctuations in demand for products. The challenges facing the meat industry cannot be solved without changes to the strategy for scientific and technological development of the industry. To achieve these tasks, it is necessary to use the prediction as a method of constant improvement of all technological processes and their performance under the rational and optimal regimes, while constantly controlling quality of raw material, semi-prepared products and finished products at all stages of the technological processing by the physico-chemical, physico-mechanical (rheological, microbiological and organoleptic methods. The paper

  11. Meat safety consequences of implementing visual postmortem meat inspection procedures in Danish slaughter pigs

    DEFF Research Database (Denmark)

    Mousing, Jan; Kyrval, J.; Jensen, Tim Kåre

    1997-01-01

    The consequences of a change from a traditional meat inspection procedure, including manual handling, palpation and incision, to an entirely postmortem meat inspection procedure in Danish slaughter pigs were assessed by a comparative study of the two methods in 188,383 slaughter pigs. Out of 58...... lesion codes (selected with a prevalence less-than-or-equal-to 5.5 x 10(-5)), 26 (45 percent) were assessed either as merely aesthetic or as the healed stage of an earlier lesion and nine (15 percent) as active, but local processes, occurring only in non-edible tissue. Five lesion codes (9 percent) were...... assessed as active, non-abscessal processes occurring in edible tissue, caused by swine-specific pathogens and 10 (17 percent) were abscessal or pyaemic lesions occurring in edible tissue. Seven lesion codes (12 percent) may be associated with consumer health hazards (two frequently and five rarely...

  12. Polina Fedorova, About Camel Meat

    OpenAIRE

    Gedeeva, Darina; Babaev, Andrei

    2016-01-01

    In the past, the Kalmyks ate beef and horse meat. The poor ate camel meat. People who ate camel meat had pimples on their faces. The camel’s pelt and humps were used to make vessels. The intestines were cleaned, stretched and dried. It was used to make strings for dombra instruments. Arcadia

  13. THE EFFECTS OF HORSE MEAT SCANDAL ON ROMANIAN MEAT MARKET

    Directory of Open Access Journals (Sweden)

    Silvius STANCIU

    2013-06-01

    Full Text Available Sustainable business in the domestic production of meat must meet both the usual Requirements regarding quality, safety for customer and New Challenges in the European meat market. The Romanian food industry must meet the challenge of recent suspicions regarding the substitution of beef meat with horse meat. The modern applicable to meat traceability systems and authentication procedures can be considered as new ways to support fair trade and transparency, THUS, removing suspicions that appeared lately. Lack of safety measures in the field can affect business continuity critically, creating significant losses.

  14. High Seroprevalence of Leptospira Exposure in Meat Workers in Northern Mexico: A Case-Control Study

    Science.gov (United States)

    Alvarado-Esquivel, Cosme; Hernandez-Tinoco, Jesus; Sanchez-Anguiano, Luis Francisco; Ramos-Nevarez, Agar; Cerrillo-Soto, Sandra Margarita; Saenz-Soto, Leandro; Martinez-Ramirez, Lucio

    2016-01-01

    Background The seroepidemiology of Leptospira infection in workers occupationally exposed to raw meat has been poorly studied. This work aimed to determine the association between Leptospira exposure and the occupation of meat worker, and to determine the seroprevalence association with socio-demographic, work, clinical and behavioral characteristics of the meat workers studied. Methods We performed a case-control study in 124 meat workers and 124 age- and gender-matched control subjects in Durango City, Mexico. Sera of cases and controls were analyzed for anti-Leptospira IgG antibodies using a commercially available enzyme immunoassay. Data of meat workers were obtained with the aid of a questionnaire. The association of Leptospira exposure with the characteristics of meat workers was analyzed by bivariate and multivariate analyses. Results Anti-Leptospira IgG antibodies were found in 22 (17.7%) of 124 meat workers and in eight (6.5%) of 124 controls (OR = 3.12; 95% CI: 1.33 - 7.33; P = 0.006). Seroprevalence of Leptospira infection was similar between male butchers (17.6%) and female butchers (18.2%) (P = 1.00). Multivariate analysis of socio-demographic, work and behavioral variables showed that Leptospira exposure was associated with duration in the activity, rural residence, and consumption of snake meat and unwashed raw fruits. Conclusions This is the first case-control study of the association of Leptospira exposure with the occupation of meat worker. Results indicate that meat workers represent a risk group for Leptospira exposure. Risk factors for Leptospira exposure found in this study may help in the design of optimal preventive measures against Leptospira infection. PMID:26858797

  15. Tracking Foodborne Pathogenic Bacteria in Raw and Ready-to-Eat Food Illegally Sold at the Eastern EU Border.

    Science.gov (United States)

    Ciolacu, Luminita; Stessl, Beatrix; Bolocan, Andrei Sorin; Oniciuc, Elena Alexandra; Wagner, Martin; Rychli, Kathrin; Nicolau, Anca Ioana

    2016-03-01

    Food illegally brought into the European Union, mainly in the personal luggage of travelers, represents a potential threat to consumers' health. The aim of this study was to investigate the presence of five pathogens in food brought into the European Union by Moldavian citizens as personal goods and illegally sold in Romania in the vicinity of the border. The occurrence of Staphylococcus aureus and Listeria monocytogenes was 7.5% and 8%, while Campylobacter spp., Escherichia coli O157:H7, and Salmonella spp. were absent in all samples. L. monocytogenes sequence type 2, 9, 121, and 155, highly prevalent among foodstuffs worldwide, was also present among isolates from ready-to-eat food illegally sold in Romania, even at the same date of sampling, indicating cross-contamination during food handling. S. aureus spa types t449, t304, and t524 were most often isolated from raw-milk cheeses contaminated with 10(3)-10(5) colony-forming units per gram, evidencing a contamination at herd level or unhygienic conditions during processing. S. aureus t011 and t3625, both included in the livestock-associated CC398, were isolated from pork lard and poultry meat. This study shows that cross-border trade from nonmember states represents a neglected route of transmission of foodborne pathogens into the European Union that could lead to sporadic or family-associated cases of disease.

  16. Safety of street vended meat products - chicken and beef suya ...

    African Journals Online (AJOL)

    leftover, heated, spiced and roasted suya of the following day, were collected from three locations in Ibadan metropolis, to identify the specific microorganisms in street vended chicken and beef suya and measure the microbial count at each stage of handling from the raw state to marketing and consumption. The plate count ...

  17. an intermediate moisture meat

    African Journals Online (AJOL)

    Bunmi

    A total of 50 sticks of Suya weighing from 38.10 - 59.30 grams of sliced meat per stick were prepared for .... prolong shelflife and provide a natural alternative (or supplement) to chemical preservatives. Its antimicrobial ... Although O. gratissimum appears safe to use in both food and as medicine, its level of inclusion in food.

  18. MARKET CHOICES FOR BROILER CHICKEN MEAT IN THE OPINION

    Directory of Open Access Journals (Sweden)

    Anna Augustyńska-Prejsnar

    2014-09-01

    Full Text Available Recently there has, been growing a increase in consumption of poultry meat in Poland. The most important material for slaughter poultry are broilers. Among factors that influence rising demand for poultry meat are: low price, availability of raw materials and promotional campaigns of safe nutrition. Its nutritional and sensory value makes it a choice product. University students are a specific group that has aroused the interest of nutritionists. The students’ lifestyle is characterised by high active social life and intense responsibilities, which ought to be augmented with a carefully chosen diet. The youth do not only have significant impact on the family purchasing decisions but display a strong purchasing power due to financial resources at their disposal and would in the future become mature and rational consumers. The article lists factors that determine purchasing needs, reasons for choice of markets and the consumption frequency of broiler meat. The feeling of lack of other products coupled with current sales promotions were, in the opinion of the students surveyed, often responsible for the decision to purchase of broiler chicken meat. Low price and the ease of preparation were also key reasons for the choice of this meat product. Responding students noted that skinless chicken breast fillet was most commonly consumed.

  19. Detection of Salmonella in Meat

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Hansen, Flemming; Mansdal, Susanne

    2012-01-01

    Cost-effective and rapid monitoring of Salmonella in the meat production chain can contribute to food safety. The objective of this study was to validate an easy-to-use pre-PCR sample preparation method based on a simple boiling protocol for screening of Salmonella in meat and carcass swab samples...... obtained (SP, SE, and AC were 100, 95, and 97%, respectively). This test is under implementation by the Danish meat industry, and can be useful for screening of large number of samples in the meat production, especially for fast release of minced meat with a short shelf life....

  20. Lead, cadmium and chromium in raw and boiled portions of Norway lobster.

    Science.gov (United States)

    Perugini, Monia; Visciano, Pierina; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Amorena, Michele

    2014-01-01

    Lead, cadmium and chromium levels were determined in different raw and boiled portions of Norway lobster caught in the central Adriatic Sea (Italy). In raw specimens, the lowest concentrations were always detected in the white meat. Lead and cadmium content in the edible portion never exceeded the maximum levels set by European legislation. The highest cadmium and chromium values (0.47 ± 0.04 and 0.62 ± 0.13 mg/kg wet weight, respectively) were detected in the brown meat, while the highest lead concentrations were found in the exoskeleton (0.21 ± 0.01 mg/kg wet weight). Also, the boiled samples showed the lowest metal levels in the white meat, even if a significant increase (p < 0.01) was found for lead and cadmium compared to the corresponding raw portions. Among metals, chromium showed the highest concentrations in both raw and boiled portions, but up to now, the European legislation did not envisage any limits in seafood.

  1. Remote handling machines

    International Nuclear Information System (INIS)

    Sato, Shinri

    1985-01-01

    In nuclear power facilities, the management of radioactive wastes is made with its technology plus the automatic techniques. Under the radiation field, the maintenance or aid of such systems is important. To cope with this situation, MF-2 system, MF-3 system and a manipulator system as remote handling machines are described. MF-2 system consists of an MF-2 carrier truck, a control unit and a command trailer. It is capable of handling heavy-weight objects. The system is not by hydraulic but by electrical means. MF-3 system consists of a four-crawler truck and a manipulator. The truck is versatile in its posture by means of the four independent crawlers. The manipulator system is bilateral in operation, so that the delicate handling is made possible. (Mori, K.)

  2. Practices of Handling

    DEFF Research Database (Denmark)

    Ræbild, Ulla

    to touch, pick up, carry, or feel with the hands. Figuratively it is to manage, deal with, direct, train, or control. Additionally, as a noun, a handle is something by which we grasp or open up something. Lastly, handle also has a Nordic root, here meaning to trade, bargain or deal. Together all four...... meanings seem to merge in the fashion design process, thus opening up for an embodied engagement with matter that entails direction giving, organizational management and negotiation. By seeing processes of handling as a key fashion methodological practice, it is possible to divert the discourse away from...... introduces four ways whereby fashion designers apply their own bodies as tools for design; a) re-activating past garment-design experiences, b) testing present garment-design experiences c) probing for new garment-design experiences and d) design of future garment experiences by body proxy. The paper...

  3. Remote handling at LAMPF

    International Nuclear Information System (INIS)

    Grisham, D.L.; Lambert, J.E.

    1983-01-01

    Experimental area A at the Clinton P. Anderson Meson Physics Facility (LAMPF) encompasses a large area. Presently there are four experimental target cells along the main proton beam line that have become highly radioactive, thus dictating that all maintenance be performed remotely. The Monitor remote handling system was developed to perform in situ maintenance at any location within area A. Due to the complexity of experimental systems and confined space, conventional remote handling methods based upon hot cell and/or hot bay concepts are not workable. Contrary to conventional remote handling which require special tooling for each specifically planned operation, the Monitor concept is aimed at providing a totally flexible system capable of remotely performing general mechanical and electrical maintenance operations using standard tools. The Monitor system is described

  4. TRANSPORT/HANDLING REQUESTS

    CERN Multimedia

    Groupe ST/HM

    2002-01-01

    A new EDH document entitled 'Transport/Handling Request' will be in operation as of Monday, 11th February 2002, when the corresponding icon will be accessible from the EDH desktop, together with the application instructions. This EDH form will replace the paper-format transport/handling request form for all activities involving the transport of equipment and materials. However, the paper form will still be used for all vehicle-hire requests. The introduction of the EDH transport/handling request form is accompanied by the establishment of the following time limits for the various services concerned: 24 hours for the removal of office items, 48 hours for the transport of heavy items (of up to 6 metric tons and of standard road width), 5 working days for a crane operation, extra-heavy transport operation or complete removal, 5 working days for all transport operations relating to LHC installation. ST/HM Group, Logistics Section Tel: 72672 - 72202

  5. Consumer attitudes to meat eating.

    Science.gov (United States)

    Richardson, N J; Macfie, H J; Shepherd, R

    1994-01-01

    This study reports on current meat consumption in the UK and the factors that are percieved by the subjects to be influential in their choice of diet. A random sample of individuals from the population (n-1018) were questioned on their consumption and attitudes towards meat by a postal survey. The study revealed that 28·3% of the population considered themselves to be reducing meat consumption; attitudes found to be determinant in changes in the consumption of meat were healthiness, taste and concerns over additives. Hypothetical future events were found to affect people's estimated meat-eating. Knowledge of meat-related information was investigated with specific reference to the respondents' trust in the various sources used; food package labels were found to be an influential source of meat-related information. Copyright © 1993. Published by Elsevier Ltd.

  6. Raw materials for aluminium production

    International Nuclear Information System (INIS)

    Galushkin, N.V.

    1995-01-01

    This chapter of monograph is devoted to to raw materials which used in aluminium production. Therefore, the using of alumina, and fluoride salts in aluminium production was considered. The physical properties of alumina were studied.

  7. Bem-estar animal no manejo pré-abate e a influência na qualidade da carne suína e nos parâmetros fisilógicos do estresse Animal welfare at pre-slaughter handling and the influence on pork meat quality and on stress physiological parameters

    Directory of Open Access Journals (Sweden)

    Charli Beatriz Ludtke

    2012-03-01

    Full Text Available Avaliaram-se os efeitos do sistema de embarque/desembarque (S1: veículo 1, carroceria com piso móvel e uso de prancha de manejo para condução dos suínos; S2: veículo 2, carroceria com piso fixo e uso de bastão elétrico para condução dos suínos e da genética (A, B e C sobre as características físico-químicas da carne, lesões na pele e parâmetros fisiológicos do estresse. Foram utilizados 120 suínos machos castrados (peso médio de 115kg provenientes de três granjas divididos em seis grupos (n=20 e submetidos a dois tipos de veículos para o transporte. Para a análise estatística, consideram-se, no modelo de análise da variância, os efeitos de blocos (dias de avaliação, sistema de embarque/desembarque, genética e interação entre as linhagens genéticas e modelos dos veículos dispostos no esquema fatorial (2 modelos de veículos x 3 linhagens genéticas. Os valores médios obtidos para o pH24h (5,60±0,046 e 5,57±0,046, cor*24h(41,52±1,256 e 41,21±1,486, perda por exsudação (4,76±0,391 e 4,86±0,391, capacidade de retenção de água (0,038±0,03 e 0,039±0,003 não demonstraram diferença entre os sistemas de embarque e desembarque (S1 e S2 nas genéticas A, B e C. A incidência de escoriações de pele no pernil, corpo e paleta não diferiram entre os métodos de embarque e desembarque nas genéticas A, B e C. Ambos os sistemas S1 e S2 geraram baixos níveis de estresse e proporcionaram facilidade de manejo nas genéticas avaliadas.The effects of the loading/unloading systems have been evaluated (S1: vehicle 1, with mobile floor and using management board for conducting pigs, S2: vehicle 2, with fixed floor and using electric goads to conduct pigs and genetic (A, B and C on the physiochemical characteristics of the meat, skin damage and physiological parameters of stress. 120 castrated pigs have been used (average weight 115kg from three farms, divided into six groups (n = 20 and subjected to two types of

  8. Survival of experimentally induced Toxoplasma gondii tissue cysts in vacuum packed goat meat and dry fermented goat meat sausages.

    Science.gov (United States)

    Neumayerová, Helena; Juránková, Jana; Saláková, Alena; Gallas, Leo; Kovařčík, Kamil; Koudela, Břetislav

    2014-05-01

    Ingestion of raw or undercooked meat is a potential source of human toxoplasmosis. The aim of this study was to determine the viability of Toxoplasma gondii cysts in vacuum packed (VP) goat meat and in dry fermented sausages (DFS), and evaluate certain physical and chemical parameters, like water activity (aw), pH value, content of salt, dry matter and fat. A portion of muscle tissue from experimentally infected animals was used for production of VP meat with or without addition of 2.5% curing salt, and stored at 4 °C or at -20 °C. Results of bioassay showed that, samples of vacuum packed Toxoplasma positive meat without salt addition were alive after six weeks at 4 °C. Incubation at -20 °C supported the viability after 3 h, but not after 4 h. After 7 days in 2.5% of curing salt, samples of T. gondii VP goat meat were still viable, but not after 14 days at 4 °C. All the DFS samples were not positive for infective cysts which mean that, they do not pose a risk of T. gondii transmission. These data suggest that vacuum packaging increases the survival of T. gondii cysts. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Total arsenic in raw and boiled portions of Norway lobster (Nephrops norvegicus) from the central Adriatic Sea.

    Science.gov (United States)

    Visciano, Pierina; Perugini, Monia; Manera, Maurizio; Abete, Maria Cesarina; Tarasco, Renata; Salese, Carmine; Amorena, Michele

    2013-12-18

    The distribution of total arsenic in different portions of Norway lobster (Nephrops norvegicus L., Crustacea) was studied both in fresh samples and after a boiling process. All individuals (n = 80) were selected of medium standard commercial size (13-15 cm). The highest mean concentrations (26.86 ± 1.57 mg/kg wet weight (ww)) were found in the raw brown meat of the crustacean, probably due to its detoxification role, whereas the lowest mean values (15.97 ± 0.85 mg/kg ww) were in the raw exoskeleton. The raw white meat reported mean values of 16.09 ± 0.61 mg/kg ww. The levels of arsenic contamination detected in the boiled portions showed a significant (p < 0.01) decrease compared to the raw portions, as a consequence of solubilization phenomena. In fact, a large amount of arsenic from raw lobsters was transferred to the corresponding boiling broth. In the most commonly consumed portion, the white meat, only slight losses (7.22%) in total arsenic content were observed compared to the raw portion.

  10. OZONE ABSORPTION IN RAW WATERS

    Directory of Open Access Journals (Sweden)

    LJILJANA TAKIĆ

    2008-03-01

    Full Text Available The ozone absorption in raw water entering the main ozonization step at the Belgrade drinking water supply plant was investigated in a continuous stirred tank reactor (CSTR. A slow chemical reaction rate of dissolved ozone and pollutants present in raw water have been experimentally determined. The modified Hatta number was defined and calculated as a criterion which determines whether and to which extent the reactions of ozone and pollutants influence the rate of the pure physical ozone absorption.

  11. Raw Materials Market of China

    Directory of Open Access Journals (Sweden)

    Dmitry Alexandrovich Izotov

    2013-12-01

    Full Text Available Deficit of raw materials is becoming an important concern for the Chinese economy as it continues to grow. This deficit is amended with imports, which – in their own turn – are limited by the high level of global prices. The build-up issue of raw materials imports is going to solve by the measures of monetary policy (RMB’s revaluation against the USD. Analysis of China’s market of raw materials reveals that the largest increase in the physical volume of imports is concentrated in crude oil, LNG, iron ore and coal. As for Russia, its supplies and share in total Chinese imports of raw materials tend to increase. Author employs regression equations based on international statistics data to show that RMB’s revaluation, ceteris paribus, increases physical volumes of raw materials imports. However, the main factor of coal and LNG imports growth is energy consumption by Chinese heavy industry; imports of oil products – producers’ prices; meanwhile imports of steel products tend to decrease with the growth of steel exports. RMB’s revaluation increases physical volumes of imports of low value added raw materials from Russia (coal, crude oil, iron ore

  12. A Review of the Poultry Meat Production Industry for Food Safety in Indonesia

    Science.gov (United States)

    Wahyono, N. D.; Utami, M. M. D.

    2018-01-01

    Poultry meat is an indispensable source of animal protein in human growth and development, so it is in great demand by people all over the world. Poultry meat has several advantages, namely the quality of nutrition is good enough, delicious taste, relatively affordable price, easy to get and accepted all levels of society with diverse backgrounds. The era of globalization requires competitive products, such as chicken meat in Indonesia, the current chicken meat industry is not only based on high production capacity and decreased production costs but also chicken products are safe to eat. As a consequence of trade liberalization, the poultry industry faces the threat of competition with cheaper products with better quality. The food safety of chicken meat starts from the farm, processing process until consumed. Food safety is a requirement of food products that must be handled by involving government, industry and consumers.

  13. Safe handling of tritium

    International Nuclear Information System (INIS)

    1991-01-01

    The main objective of this publication is to provide practical guidance and recommendations on operational radiation protection aspects related to the safe handling of tritium in laboratories, industrial-scale nuclear facilities such as heavy-water reactors, tritium removal plants and fission fuel reprocessing plants, and facilities for manufacturing commercial tritium-containing devices and radiochemicals. The requirements of nuclear fusion reactors are not addressed specifically, since there is as yet no tritium handling experience with them. However, much of the material covered is expected to be relevant to them as well. Annex III briefly addresses problems in the comparatively small-scale use of tritium at universities, medical research centres and similar establishments. However, the main subject of this publication is the handling of larger quantities of tritium. Operational aspects include designing for tritium safety, safe handling practice, the selection of tritium-compatible materials and equipment, exposure assessment, monitoring, contamination control and the design and use of personal protective equipment. This publication does not address the technologies involved in tritium control and cleanup of effluents, tritium removal, or immobilization and disposal of tritium wastes, nor does it address the environmental behaviour of tritium. Refs, figs and tabs

  14. Grain Grading and Handling.

    Science.gov (United States)

    Rendleman, Matt; Legacy, James

    This publication provides an introduction to grain grading and handling for adult students in vocational and technical education programs. Organized in five chapters, the booklet provides a brief overview of the jobs performed at a grain elevator and of the techniques used to grade grain. The first chapter introduces the grain industry and…

  15. Mars Sample Handling Functionality

    Science.gov (United States)

    Meyer, M. A.; Mattingly, R. L.

    2018-04-01

    The final leg of a Mars Sample Return campaign would be an entity that we have referred to as Mars Returned Sample Handling (MRSH.) This talk will address our current view of the functional requirements on MRSH, focused on the Sample Receiving Facility (SRF).

  16. Handling wood shavings

    Energy Technology Data Exchange (ETDEWEB)

    1974-09-18

    Details of bulk handling equipment suitable for collection and compressing wood waste from commercial joinery works are discussed. The Redler Bin Discharger ensures free flow of chips from storage silo discharge prior to compression into briquettes for use as fuel or processing into chipboard.

  17. Comparison of quality attributes of buffalo meat curry at different storage temperature.

    Science.gov (United States)

    Kandeepan, Gurunathan; Anjaneyulu, Anne Seet Ram; Kondaiah, Napa; Mendiratta, Sanjod Kumar

    2011-01-01

    The product quality of curry is determined by the food animal source, raw materials and the method of processing. Moreover the scientific information on processing and quality of traditional buffalo meat curry from different groups of buffaloes is not available. This study was undertaken to develop processed curry from different buffalo groups and to compare its quality during storage at ambient and refrigeration temperature. The meat samples were collected from the longissimus dorsi muscle of the carcasses from each group of buffaloes slaughtered according to the traditional halal method. Buffalo meat curry was prepared in a pressure cooker with the standardized formulation. This final product was subjected to evaluation of quality and shelf life. To evaluate the effect of different groups of meat samples on the quality of curry, product yield, pH, proximate composition, water activity (aw), thiobarbituric acid reactive substances (TBARS), calorific value, sensory attributes and microbiological assay were determined The energy of meat curry from young buffaloes was significantly lower than the meat curry from spent animal groups. The overall acceptability of curry decreased significantly during 3 days ambient storage compared to refrigeration storage. Scientific processing by adopting good manufacturing practices and suitable packaging helped greatly to improve the shelf life of the ambient temperature stored buffalo meat curry. Buffalo meat curry from young male group showed better product characteristics and overall acceptability scores than spent buffalo group.

  18. Development and validation of a rapid test system for detection of pork meat and collagen residues.

    Science.gov (United States)

    Masiri, J; Benoit, L; Barrios-Lopez, B; Thienes, C; Meshgi, M; Agapov, A; Dobritsa, A; Nadala, C; Samadpour, M

    2016-11-01

    Mislabeling, contamination, and economic adulteration of meat products with undeclared pork tissues are illegal under regulations promulgated by numerous regulatory agencies. Nonetheless, analysis of the European meat industry has revealed pervasive meat adulteration, necessitating more extensive application of meat authentication testing. As existing methods for meat speciation require specialized equipment and/or training, we developed a detection system based on a lateral flow device (LFD) assay format capable of rapidly (~35min) identifying porcine residues derived from raw meat, cooked meat, and gelatin down to 0.01%, 1.0%, and 2.5% contamination, respectively. Specificity analysis revealed no cross-reactivity with meat derived from chicken, turkey, horse, beef, lamb, or goat. Comparison with a commercial ELISA kit and PCR method revealed similar if not improved sensitivity, with the added feature that the LFD-based system required considerably less time to perform. Accordingly, this test system should aid the food industry and food control authorities in monitoring for adulteration with pork. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. COLD CHAIN MANAGEMENT IN MEAT SUPPLY: «OLD» AND NOVEL STRATEGIES

    Directory of Open Access Journals (Sweden)

    I. Nastasijevic

    2017-01-01

    Full Text Available Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP, active packaging, wireless sensors, supported with the software-based cold chain database (CCD.

  20. Nutritional profiling of Eurasian woodcock meat: chemical composition and myoglobin characterization.

    Science.gov (United States)

    Landi, Nicola; Ragucci, Sara; Di Giuseppe, Antonella Ma; Russo, Rosita; Poerio, Elia; Severino, Valeria; Di Maro, Antimo

    2018-04-10

    Meat from birds is a rich source of proteins for the human diet. In this framework, Eurasian woodcock (Scolopax rusticola L.), a medium-small wading bird hunted as game in many Eurasian countries, is considered one of the best meats for culinary purposes. Since the nutritional composition of Eurasian woodcock meat has not yet been reported, we decided to determine the nutritional profile of S. rusticola meat. Macronutrient components (proteins, lipids and fatty acids) were determined, as well as free and total amino acids, and compared with those of the common pheasant. Eurasian woodcock meat contains high levels of proteins and essential amino acids. The levels of unsaturated fatty acids represent a great contribution to the total lipid amount. Among polyunsaturated fatty acids, linoleic acid (C18:2, n-6) is the major essential fatty acid. Finally, we report the characterization of myoglobin (Mb) from Eurasian woodcock. The data revealed that meat from this bird could be a good source of quality raw proteins because of its amino acid composition, and it had a low lipid content. On the other hand, Mb characterization might be of benefit to the meat industry, by providing useful information for the determination of species-specific differences in meat from birds. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  1. Cold chain management in meat storage, distribution and retail: A review

    Science.gov (United States)

    Nastasijević, I.; Lakićević, B.; Petrović, Z.

    2017-09-01

    Meat is a perishable product with a short shelf life and therefore short selling times. Therefore, cold chain management in meat supply is of utmost importance for the maintenance of quality and safety of meat/meat products. Raw meat/meat products are likely to support the growth of pathogenic microorganisms and/or spoilage bacteria, and should be kept at temperatures that do not result in a risk to health. The cold chain should not be interrupted at all times along the meat distribution chain. The complexity of global meat supply chain, with frequently long distribution chains associated with transportation of the product within one country, from one to another country and from one to another continent, makes the solutions for the chilling and freezing regimes, as well as monitoring of time-temperature profiles, very important for the overall success in delivery of product which will be accepted by consumer for its freshness and safety levels. From recently, there are several available options for control and management of the cold chain, such as chilled and frozen storage combinations, superchilling, ionizing radiation, biopreservation, high hydrostatic pressure (HHP), active packaging, wireless sensors, supported with the software-based cold chain database (CCD).

  2. Effects of goat milk or milk replacer diet on meat quality and fat composition of suckling goat kids.

    Science.gov (United States)

    Bañón, S; Vila, R; Price, A; Ferrandini, E; Garrido, M D

    2006-02-01

    The effects of a diet with goat milk "GM" or milk replacer "MR" on the meat quality and fat composition of suckling Murciano-Granadina kids were studied. MR consisted of powdered skimmed milk, coconut oil and fat, and cereal products and by-products. Raw meat quality (moisture, protein, lipids, ash, collagen, cholesterol, haem pigments, CIELab colour, pH and water retention capacity), fatty acid "FA" composition and eating quality of cooked meat (odour, flavour and texture) were determined. Diet had only a slight effect on raw meat quality but had a pronounced effect on fatty acid composition and eating quality of cooked meat. MR diet increased the water/protein proportion in the muscle. The saturated/unsaturated FA ratio in GM and MR fat was 0.94 and 2.27, respectively. The major FA in GM and MR fat were C16:0 and C18:1, respectively. Short-chain C4-C12 hardly accumulated in the adipose tissue of suckling kid, increasing the relative percentages of C14-C20. This effect was more pronounced in MR fat, due to the fact that MR contained more short-chain fatty acids than GM. MR diet gave cooked meat a more intense characteristic goat meat odour and flavour, more tenderness and more juiciness than the natural suckling diet. This fact could be related to differences in meat and fat composition.

  3. “Fish, chicken, lean meat and eggs can be eaten daily”: a food ...

    African Journals Online (AJOL)

    2013-04-09

    Apr 9, 2013 ... meat and eggs, constitute high-quantity and high-quality protein, as they contain essential ... Food (per 100 g, raw, edible portion). Fat. SFAs. MUFAs. PUFAs n-3 .... milk.27 The naturally present fibres, phytates, oxalates and.

  4. Effect of probiotics on broiler meat quality | Kabir | African Journal of ...

    African Journals Online (AJOL)

    The study was carried out on “Hubbard Isa Starbo” broilers to evaluate the raw meat quality of both probiotics and conventional fed broilers in pre-freezing condition and ... The groups C and D were taken as control birds and were fed with commercial ration and the groups A and B as experimental birds which were fed with ...

  5. Radurization of fowl meat

    International Nuclear Information System (INIS)

    Gel'fand, S.

    1974-01-01

    The effects of pre-slaughter adrenalization and of treatment with additives of semifinished poultry products were studied with a view to improving the storage quality of irradiated poultry. It was found that pre-slaughter adrenalization, pre-irradiation treatment with phosphates and, particularly, a combination of these two methods considerably delayed the formation of carbonyl compounds, the delay being somewhat greater in white meat. (E.T.)

  6. Gamma irradiation of meat

    International Nuclear Information System (INIS)

    Whitburn, K.D.; Hoffman, M.Z.; Taub, I.A.

    1982-01-01

    In ''A Re-Evaluation of the Products of Gamma Irradiation of Beef Ferrimyoglobin'', J. Food Sci. 46:1814 (1981), authors Whitburn, Hoffman and Taub state that color pigment myoglobin (Mb) undergoes chemical changes during irradiation that cause color changes in meat. They also state that they are in disagreement with Giddings and Markakis, J. Food Sci. 47:361 (1972) in regard to generation of MbO 2 in deaerated solutions, claiming their analysis demonstrates only Mb and Mb(IV) production. Giddings, in a letter, suggests that Whitburn, et al may have used differing systems and approaches which critically changed the radiation chemistry. He also states that radiation sterilization of aerobically packaged meats affects color only slightly. Whitburn, in a reply, shares Dr. Giddings concern for caution in interpretation of results for this system. The compositional changes are dependent on identity of free radicals, dose, O 2 and the time of analysis after irradiation. The quantification of these parameters in pure systems, sarcoplasma extracts and in meat samples should lead to a better understanding of color change mechanisms and how to minimize them

  7. THE IMPORTANCE OF BACTERIOCINS IN MEAT AND MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    Meltem SERDAROĞLU

    2000-03-01

    Full Text Available There is an increasing consumer demand for food products which are free of chemical additives, reduced in salt and processed as little as possible. These minimally processed foods require special application to assure their microbiological safety. The use of microorganisms and enzymes for food preservatives is called biopreservation. The most important group of microorganisms with antimicrobial effect used in the production of foods is the lactic acid bacteria. In meats although lactic acid bacteria constitue apart of the initial microflora, they become dominant during the processing of meats. In this research bacteriocins of lactic acid bacteria and their usage in meat and meat products for biopreservation are discussed.

  8. QUALITY CONTROL OF SOME TRADITIONAL MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    S. DOBRINAS

    2014-03-01

    Full Text Available In this paper, we present the characterization of six traditional meat products: smoked file, smoked bacon, pork sausages, sausage prepared from swine’s entrails, pork pastrami, sheep sausages. Organoleptic tests (the aspect and shape, the aspect of freshly cut in the section, smell, taste and consistency, physico-chemical and microbiological determinations (NTG, Salmonella, Listeria monocytogenes and Escherichia coli were performed. These analyzes are a part of quality control that must be done in order to obtain a certificate from the Ministry of Agriculture for a traditional product. After identification of H2S and starch and according to fat oxidation degree it was concluded that analyzed samples didn’t contain counterfeiters and all parameters analyzed are within the maximum limits allowed by law. Considering all the procedures for manufacturing, characteristics of raw and auxiliary materials, organoleptic properties of final products analyzed in this study, it can be concluded that analyzed meat specialties meet the requirements of Ministry Order no. 690/28.09.2004 for the traditional products certification.

  9. International red meat trade.

    Science.gov (United States)

    Brester, Gary W; Marsh, John M; Plain, Ronald L

    2003-07-01

    The maturation of the US beef and pork markets and increasing consumer demands for convenience, safety, and nutrition suggests that the beef and pork industries must focus on product development and promotion. New marketing arrangements are developing that help coordinate production with consumer demands. The relative high levels of incomes in the United States are likely to increase the demands for branded products rather than increase total per capita consumption. Foreign markets represent the greatest opportunity for increased demand for commodity beef and pork products. Increasing incomes in developing countries will likely allow consumers to increase consumption of animal-source proteins. Real prices of beef and pork have declined substantially because of sagging domestic demand and increasing farm-level production technologies. Increasing US beef and pork exports have obviated some of the price declines. Pork attained a net export position from a quantity perspective in 1995. The United States continues to be a net importer of beef on a quantity basis but is close to becoming a net exporter in terms of value. By-products continue to play a critical role in determining the red meat trade balance and producer prices. The United States, however, must continue to become cost, price, and quality competitive with other suppliers and must secure additional market access if it is to sustain recent trade trends. Several trade tensions remain in the red meat industry. For example, mandated COOL will undoubtedly have domestic and international effects on the beef and pork sectors. Domestically, uncertainty regarding consumer demand responses or quality perceptions regarding product origin, as well as added processor-retailer costs will be nontrivial. How these factors balance out in terms of benefits versus costs to the industry is uncertain. From an international perspective, some beef and pork export suppliers to the United States could view required labeling as a

  10. Identification of new food alternatives: how do consumers categorize meat and meat substitutes?

    NARCIS (Netherlands)

    Hoek, A.C.; Boekel, van M.A.J.S.; Voordouw, J.; Luning, P.A.

    2011-01-01

    New meat substitutes need to be recognized as alternatives to meat. We therefore investigated which category representations consumers have of meat and meat substitutes. Thirty-four non-vegetarian participants performed a free sorting task with 17 meat products and 19 commercially available meat

  11. Test sample handling apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    A test sample handling apparatus using automatic scintillation counting for gamma detection, for use in such fields as radioimmunoassay, is described. The apparatus automatically and continuously counts large numbers of samples rapidly and efficiently by the simultaneous counting of two samples. By means of sequential ordering of non-sequential counting data, it is possible to obtain precisely ordered data while utilizing sample carrier holders having a minimum length. (U.K.)

  12. Handling and Transport Problems

    Energy Technology Data Exchange (ETDEWEB)

    Pomarola, J. [Head of Technical Section, Atomic Energy Commission, Saclay (France); Savouyaud, J. [Head of Electro-Mechanical Sub-Division, Atomic Energy Commission, Saclay (France)

    1960-07-01

    Arrangements for special or dangerous transport operations by road arising out of the activities of the Atomic Energy Commission are made by the Works and Installations Division which acts in concert with the Monitoring and Protection Division (MPD) whenever radioactive substances or appliances are involved. In view of the risk of irradiation and contamination entailed in handling and transporting radioactive substances, including waste, a specialized transport and storage team has been formed as a complement to the emergency and decontamination teams.

  13. Solid waste handling

    International Nuclear Information System (INIS)

    Parazin, R.J.

    1995-01-01

    This study presents estimates of the solid radioactive waste quantities that will be generated in the Separations, Low-Level Waste Vitrification and High-Level Waste Vitrification facilities, collectively called the Tank Waste Remediation System Treatment Complex, over the life of these facilities. This study then considers previous estimates from other 200 Area generators and compares alternative methods of handling (segregation, packaging, assaying, shipping, etc.)

  14. Handling of radioactive waste

    International Nuclear Information System (INIS)

    Sanhueza Mir, Azucena

    1998-01-01

    Based on characteristics and quantities of different types of radioactive waste produced in the country, achievements in infrastructure and the way to solve problems related with radioactive waste handling and management, are presented in this paper. Objectives of maintaining facilities and capacities for controlling, processing and storing radioactive waste in a conditioned form, are attained, within a great range of legal framework, so defined to contribute with safety to people and environment (au)

  15. Renal phosphate handling: Physiology

    Directory of Open Access Journals (Sweden)

    Narayan Prasad

    2013-01-01

    Full Text Available Phosphorus is a common anion. It plays an important role in energy generation. Renal phosphate handling is regulated by three organs parathyroid, kidney and bone through feedback loops. These counter regulatory loops also regulate intestinal absorption and thus maintain serum phosphorus concentration in physiologic range. The parathyroid hormone, vitamin D, Fibrogenic growth factor 23 (FGF23 and klotho coreceptor are the key regulators of phosphorus balance in body.

  16. Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA.

    Science.gov (United States)

    Thapaliya, Dipendra; Forshey, Brett M; Kadariya, Jhalka; Quick, Megan K; Farina, Sarah; O' Brien, Ashley; Nair, Rajeshwari; Nworie, Amos; Hanson, Blake; Kates, Ashley; Wardyn, Shylo; Smith, Tara C

    2017-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of infectious disease morbidity and mortality. Previous studies have confirmed the presence of S. aureus, including MRSA, on raw meat products. We investigated the prevalence and molecular epidemiology of S. aureus and MRSA in commercially-distributed antibiotic-free and conventional raw meat products (n = 3290) purchased in 8 Iowa retail stores weekly for a period of one year. Isolates were characterized using spa typing, and PCR was used to detect the presence of the Panton-Valentine leukocidin (PVL) and mecA genes. Quantitation of S. aureus on meat products was carried out one week per month. The prevalence of S. aureus on meat samples was 27.8% (913/3290). Compared to antibiotic-free meat samples, higher prevalence of both MRSA and methicillin-susceptible S. aureus (MSSA) were found in conventional meat samples. Among the S. aureus isolates, 18 were PVL-positive (1.9%) and 41 (4.5%) carried mecA. Phenotypic oxacillin resistance was observed for 17.1% (41/239) of the isolates tested, while 23% (55/239) were multi-drug resistant. A total of 132 spa types were detected from 913 contaminated meat samples. Overall, t002 was the most common spa type identified (137; 15.0%). The number of colony-forming units (CFU) per 10 g meat ranged from 2 to 517 (median: 8 CFU per 10 g of meat; mean: 28) with the highest bacterial load observed on turkey samples. These data reinforce the need to consider meat products as potential vehicles of S. aureus transmission from farm into human households, and the potential need for public health intervention programs pre and post-slaughter in meat processing facilities. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Uranium hexafluoride handling

    International Nuclear Information System (INIS)

    1991-01-01

    The United States Department of Energy, Oak Ridge Field Office, and Martin Marietta Energy Systems, Inc., are co-sponsoring this Second International Conference on Uranium Hexafluoride Handling. The conference is offered as a forum for the exchange of information and concepts regarding the technical and regulatory issues and the safety aspects which relate to the handling of uranium hexafluoride. Through the papers presented here, we attempt not only to share technological advances and lessons learned, but also to demonstrate that we are concerned about the health and safety of our workers and the public, and are good stewards of the environment in which we all work and live. These proceedings are a compilation of the work of many experts in that phase of world-wide industry which comprises the nuclear fuel cycle. Their experience spans the entire range over which uranium hexafluoride is involved in the fuel cycle, from the production of UF 6 from the naturally-occurring oxide to its re-conversion to oxide for reactor fuels. The papers furnish insights into the chemical, physical, and nuclear properties of uranium hexafluoride as they influence its transport, storage, and the design and operation of plant-scale facilities for production, processing, and conversion to oxide. The papers demonstrate, in an industry often cited for its excellent safety record, continuing efforts to further improve safety in all areas of handling uranium hexafluoride

  18. Uranium hexafluoride handling. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-31

    The United States Department of Energy, Oak Ridge Field Office, and Martin Marietta Energy Systems, Inc., are co-sponsoring this Second International Conference on Uranium Hexafluoride Handling. The conference is offered as a forum for the exchange of information and concepts regarding the technical and regulatory issues and the safety aspects which relate to the handling of uranium hexafluoride. Through the papers presented here, we attempt not only to share technological advances and lessons learned, but also to demonstrate that we are concerned about the health and safety of our workers and the public, and are good stewards of the environment in which we all work and live. These proceedings are a compilation of the work of many experts in that phase of world-wide industry which comprises the nuclear fuel cycle. Their experience spans the entire range over which uranium hexafluoride is involved in the fuel cycle, from the production of UF{sub 6} from the naturally-occurring oxide to its re-conversion to oxide for reactor fuels. The papers furnish insights into the chemical, physical, and nuclear properties of uranium hexafluoride as they influence its transport, storage, and the design and operation of plant-scale facilities for production, processing, and conversion to oxide. The papers demonstrate, in an industry often cited for its excellent safety record, continuing efforts to further improve safety in all areas of handling uranium hexafluoride. Selected papers were processed separately for inclusion in the Energy Science and Technology Database.

  19. Torus sector handling system

    International Nuclear Information System (INIS)

    Grisham, D.L.

    1981-01-01

    A remote handling system is proposed for moving a torus sector of the accelerator from under the cryostat to a point where it can be handled by a crane and for the reverse process for a new sector. Equipment recommendations are presented, as well as possible alignment schemes. Some general comments about future remote-handling methods and the present capabilities of existing systems will also be included. The specific task to be addressed is the removal and replacement of a 425 to 450 ton torus sector. This requires a horizontal movement of approx. 10 m from a normal operating position to a point where its further transport can be accomplished by more conventional means (crane or floor transporter). The same horizontal movement is required for reinstallation, but a positional tolerance of 2 cm is required to allow reasonable fit-up for the vacuum seal from the radial frames to the torus sector. Since the sectors are not only heavy but rather tall and narrow, the transport system must provide a safe, stable, and repeatable method fo sector movement. This limited study indicates that the LAMPF-based method of transporting torus sectors offers a proven method of moving heavy items. In addition, the present state of the art in remote equipment is adequate for FED maintenance

  20. Handling of Solid Residues

    International Nuclear Information System (INIS)

    Medina Bermudez, Clara Ines

    1999-01-01

    The topic of solid residues is specifically of great interest and concern for the authorities, institutions and community that identify in them a true threat against the human health and the atmosphere in the related with the aesthetic deterioration of the urban centers and of the natural landscape; in the proliferation of vectorial transmitters of illnesses and the effect on the biodiversity. Inside the wide spectrum of topics that they keep relationship with the environmental protection, the inadequate handling of solid residues and residues dangerous squatter an important line in the definition of political and practical environmentally sustainable. The industrial development and the population's growth have originated a continuous increase in the production of solid residues; of equal it forms, their composition day after day is more heterogeneous. The base for the good handling includes the appropriate intervention of the different stages of an integral administration of residues, which include the separation in the source, the gathering, the handling, the use, treatment, final disposition and the institutional organization of the administration. The topic of the dangerous residues generates more expectation. These residues understand from those of pathogen type that are generated in the establishments of health that of hospital attention, until those of combustible, inflammable type, explosive, radio-active, volatile, corrosive, reagent or toxic, associated to numerous industrial processes, common in our countries in development

  1. PENGARUH BERBAGAI KECAMBAH KACANG-KACANGAN LOKAL SEBAGAI BAHAN DASAR MEAT ANALOG TERHADAP SIFAT FISIK (TEKSTUR, KESUKAAN DAN RASIO ARGININ/LISIN

    Directory of Open Access Journals (Sweden)

    Bayu Kanetro

    2013-06-01

    Full Text Available The aims of this research were to determine the best of local legume sprout as raw material of meat analog, based on its texture, sensory (preference properties, and the ratio of arginine/lysine, compared to meat analog from soybean. Meat analogs were made of protein of local legumes sprout, which were velvet beans, cowpeas, and winged beans that had been germinated for 48, 36 and 24 hr respectively. The protein of velvet beans, cowpeas, and winged beans sprout for meat analog production were extracted at pH 9 and precipitated at pH 4, 5, and 5 respectively. Hence their products were analyzed the texture, the sensory properties (the hedonic scales of color, texture, odor, taste, and overall, and the ratio of arginine/lysine. The characteristics of meat analog from the legumes sprout were compared to meat analog from soybean for determination of the best legume sprout as raw material of meat analog. The result of this research showed the properties of meat analog from winged bean and cowpeas sprouts were better than velvet beans sprout. The meat analog from soybean was still better than meat analog from the local legumes sprout, especially its texture. The arginine content, that was known as  hypocholesterolemic and hypoglycemic component,  of meat analog from cowpeas sprout was lower than meat analog from soybean, but its ratio of arginie/lysine was not signifi cantly different. While the ratio of arginine/lysine of meat analog from the other legumes sprout were lower than meat analog from soybean. Therefore the meat analog from cowpeas sprout was chosen as the best product and was potential as functional food especially for reducing blood cholesterol. Keywords: Meat analog, sprout, local legumes, arginine/lysine ratio   ABSTRAK Tujuan penelitian ini adalah untuk menentukan jenis kecambah kacang-kacangan lokal terbaik sebagai bahan baku kedelai berdasarkan tekstur, sifat sensoris, dan rasio arginin/lisin dibandingkan meat analog dari biji

  2. Occurrence of Campylobacter spp. in raw and ready-to-eat foods and in a Canadian food service operation.

    Science.gov (United States)

    Medeiros, Diane T; Sattar, Syed A; Farber, Jeffrey M; Carrillo, Catherine D

    2008-10-01

    The occurrence of Campylobacter spp. in a variety of foods from Ottawa, Ontario, Canada, and raw milk samples from across Canada was determined over a 2-year period. The samples consisted of 55 raw foods (chicken, pork, and beef), 126 raw milk samples from raw milk cheese manufacturers, and 135 ready-to-eat foods (meat products, salads, and raw milk cheeses). Campylobacter jejuni was detected in 4 of the 316 samples analyzed: 1 raw beef liver sample and 3 raw chicken samples. An isolation rate of 9.7% was observed among the raw chicken samples tested. This study also investigated the role of cross-contamination in disseminating Campylobacter from raw poultry within a food service operation specializing in poultry dishes. Accordingly, kitchen surfaces within a restaurant in Ottawa, Ontario, were sampled between March and August 2001. Tests of the sampling method indicated that as few as 100 Campylobacter cells could be detected if sampling was done within 45 min of inoculation; however, Campylobacter spp. were not detected in 125 swabs of surfaces within the kitchens of this food service operation. Despite the reported high prevalence of Campylobacter spp. in raw poultry, this organism was not detected on surfaces within a kitchen of a restaurant specializing in poultry dishes.

  3. Essential oils of thyme and Rosemary in the control of Listeria monocytogenes in raw beef

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira

    2013-12-01

    Full Text Available This study was developed in order to evaluate two alternatives for the control of Listeria monocytogenes in raw bovine meat pieces, both based on the use of Thymus vulgaris and Rosmarinus officinalis essential oils (EOs. The antilisterial activity of different concentrations of the EOs was tested in vitro using agar dilution and disk volatilization techniques. In addition, L. monocytogenes was inoculated in meat pieces, which were submerged in edible gelatin coatings containing 2% (v/v EOs or submitted to the vapor of EOs (0.74 μL.cm-3. L. monocytogenes was quantified after one, 48 and 96 hours of storage (7 °C. In the in vitro tests, the EO of T. vulgaris presented higher activity. The two options used (edible gelatin coating and vapor activity, in spite of exercising effects with differentiated behaviors, presented antibacterial activity against L. monocytogenes inoculated in raw bovine meat (p < 0.05. Greatest antibacterial activity were obtained in the experiment that used edible coatings containing EOs, at 48 hours of storage reductions in bacterial counts between 1.09 and 1.25 Log CFU.g-1 were obtained. In the vapor effect experiment, the EO of T. vulgaris caused the highest reduction in the population of bacteria inoculated in raw bovine meat (p < 0.05, 0.40 Log CFU.g-1 at 96 hours of storage. This study supplied important information regarding new and promising natural alternatives, based on the concept of active packaging, for the control of L. monocytogenes in the meat industry.

  4. Effect of the raw materials processing on their dustiness

    International Nuclear Information System (INIS)

    López Lilaoa, A.; Juárezb, M.; Sanfelix Fornera, V.; Mallol Gascha, G.; Monfort Gimeno, E.

    2017-01-01

    During the handling and/or processing of powdered materials in the CERAMICS INDUSTRY, one of the most important risks regarding the environmental and occupational health is the potential generation of dust. In this regard, a parameter of great interest is the dustiness of the processed materials; this parameter quantifies the tendency of the powdered materials to generate dust when handled. In this study, to determine the dustiness of a ceramic raw material composition (mixture of the body raw materials), the continuous drop method has been used. This test apparatus was selected because it is considered to better simulate how ceramic materials are handled in the CERAMICS INDUSTRY. The obtained results show that the dustiness of the same ceramic composition exhibits significant changes during the manufacturing process, depending on the presentation form. In this regard, the dry milling sample presents the highest dustiness, which can be significantly reduced (>75%) applying the the moisturization and agglomeration. The obtained results also shown that the best presentation form, regarding the minimization of the dust generation, is achieved in the spray-drying process, where the dustiness is reduced by 95%. [es

  5. Bacterial spoilage of meat and cured meat products

    NARCIS (Netherlands)

    Borch, E.; Kant-Muermans, M.L.T.; Blixt, Y.

    1996-01-01

    The influence of environmental factors (product composition and storage conditions) on the selection, growth rate and metabolic activity of the bacterial flora is presented for meat (pork and beef) and cooked, cured meat products. The predominant bacteria associated with spoilage of refrigerated

  6. Meat and Meat Product Consumption among Infants in Latvia

    Directory of Open Access Journals (Sweden)

    Širina Inga

    2017-12-01

    Full Text Available Meat consumption during the first year of life is especially important to provide necessary iron requirements. The aim of the study was to assess meat and meat product consumption of Latvian infants during their first year of life, in relation to different factors. Data were collected by interview method using two types of questionnaires: food frequency questionnaires and food diary. The study included a representative sample of infants and toddlers from all regions of Latvia with a target sample of 560 participants. The study included 266 infants: 127 girls, 139 boys, aged from 0 to 12 month. Data were summarised using the Excel software and analysed using the SPSS software. For data analysis two age groups were created: 0–5.9 months and 6–12 months. Consumption was analysed by two parameters: frequency and amount per feeding. Meat products were defined as offal products, sausages, and meat in baby food. Meat was mainly consumed after 6 months of age and by 73% of infants (n = 107. Meat from baby food was consumed only after 6 months and by 23% (n = 34. Sausages and offal products were consumed after 6 months of age. Sausages were consumed by 18% (n = 28 and offal products by 11% (n = 16 of infants. Meat consumption for the majority of infants was introduced after 6 months and was in accordance with recommendations.

  7. Breast meat yield, muscle linear measurements and meat ...

    African Journals Online (AJOL)

    Breast meat yield, chemical composition, mineral profile and linear measurement of the resultant breast meat Supracoracoides and Pectoralis thoracicus of one hundred and eighty (28 days old BUT) male turkeys fed diet containing wheat or sorghum as sole cereal source were studied. One hundred and eighty 28-days old ...

  8. GAME MEAT MARKET IN EASTERN CROATIA

    OpenAIRE

    Z. Tolušić; T. Florijančić; I. Kralik; M. Sesar; M. Tolušić

    2006-01-01

    In the Republic of Croatia, game meat is consumed far less than meat of domestic animals. Yearly game meat consumption amounts to only 0.55 kg per household member. Consumers prefer meat of domestic animals, because it is cheaper, not paying attention to specific nutritive advantages of game meat. A research on the game meat market and consumers’ preferences was carried out on 101 examinees, chosen among inhabitants of Slavonia and Baranja. The majority of questioned inhabitants did consume g...

  9. THE YIELD OF DNA IN THERMAL TERATED DEER MEAT

    Directory of Open Access Journals (Sweden)

    Jozef Golian

    2011-07-01

    Full Text Available Residuals of DNA are one of the most important factors for detection, traceability and reverse authentication of deer meat. In this project we isolated DNA from deer processed meat and analysed by electrophoresis. Goal of the study was compute ratio between raw meat and several heat processed deer meat. Samples were prepared by five heat treatment techniques (pan roasted with temperature 180-240°C, fried with 156°C, braised with temperature 100-150°C, boiled in 100.2°C water and autoclaved in different time intervals. The highest amount of residual DNA 1927ng was obtained with two hours boiled sample. The lowest value 89.89ng was obtained with one hour braised sample. In technological adjustments highest amount of DNA and 1927ng, so the total yield of 192.7ng.-l was observed in the sample we cooked for two hours at boiling temperature.   doi:10.5219/153 

  10. Topical papers on raw materials

    International Nuclear Information System (INIS)

    1978-01-01

    In the papers of this working group, the availability of uranium and the long-term supply situation for this raw material are discussed. A problem closely connected with uranium supply are the commercial contracts and their particularities. The points of view of the reporting countries of Great Britain, South Africa, Switzerland, Australia, Japan, and Korea are made clear

  11. Preference Handling for Artificial Intelligence

    OpenAIRE

    Goldsmith, Judy; University of Kentucky; Junker, Ulrich; ILOG

    2009-01-01

    This article explains the benefits of preferences for AI systems and draws a picture of current AI research on preference handling. It thus provides an introduction to the topics covered by this special issue on preference handling.

  12. A Potential Use of 3-D Scanning to Evaluate the Chemical Composition of Pork Meat.

    Science.gov (United States)

    Adamczak, Lech; Chmiel, Marta; Florowski, Tomasz; Pietrzak, Dorota; Witkowski, Marcin; Barczak, Tomasz

    2015-07-01

    The aim of this study was to determine the possibility of 3-D scanning method in chemical composition evaluation of pork meat. The sampling material comprised neck muscles (1000 g each) obtained from 20 pork carcasses. The volumetric estimation process of the elements was conducted on the basis of point cloud collected using 3-D scanner. Knowing the weight of neck muscles, their density was calculated which was subsequently correlated with the content of basic chemical components of the pork meat (water, protein and fat content, determined by standard methods). The significant correlations (P ≤ 0.05) between meat density and water (r = 0.5213), protein (r = 0.5887), and fat (r = -0.6601) content were obtained. Based on the obtained results it seems likely to employ the 3-D scanning method to compute the meat chemical composition. The use of the 3-D scanning method in industrial practice will allow to evaluate the chemical composition of meat in online mode on a dressing and fabrication line and in a rapid, noninvasive manner. The control of the raw material using the 3-D scanning will allow to make visual assessment more objective and will enable optimal standardization of meat batches prior to processing stage. It will ensure not only the repeatability of product quality characteristics, but also optimal use of raw material-lean and fat meat. The knowledge of chemical composition of meat is essential due to legal requirements associated with mandatory nutrition facts labels on food products. © 2015 Institute of Food Technologists®

  13. Crud handling circuit

    International Nuclear Information System (INIS)

    Smith, J.C.; Manuel, R.J.; McAllister, J.E.

    1981-01-01

    A process for handling the problems of crud formation during the solvent extraction of wet-process phosphoric acid, e.g. for uranium and rare earth removal, is described. It involves clarification of the crud-solvent mixture, settling, water washing the residue and treatment of the crud with a caustic wash to remove and regenerate the solvent. Applicable to synergistic mixtures of dialkylphosphoric acids and trialkylphosphine oxides dissolved in inert diluents and more preferably to the reductive stripping technique. (U.K.)

  14. Handling of potassium

    International Nuclear Information System (INIS)

    Schwarz, N.; Komurka, M.

    1983-03-01

    As a result for the Fast Breeder Development extensive experience is available worldwide with respect to Sodium technology. Due to the extension of the research program to topping cycles with Potassium as the working medium, test facilities with Potassium have been designed and operated in the Institute of Reactor Safety. The different chemical properties of Sodium and Potassium give rise in new safety concepts and operating procedures. The handling problems of Potassium are described in the light of theoretical properties and own experiences. Selected literature on main safety and operating problems complete this report. (Author) [de

  15. Extreme coal handling

    Energy Technology Data Exchange (ETDEWEB)

    Bradbury, S; Homleid, D. [Air Control Science Inc. (United States)

    2004-04-01

    Within the journals 'Focus on O & M' is a short article describing modifications to coal handling systems at Eielson Air Force Base near Fairbanks, Alaska, which is supplied with power and heat from a subbituminous coal-fired central plant. Measures to reduce dust include addition of an enclosed recirculation chamber at each transfer point and new chute designs to reduce coal velocity, turbulence, and induced air. The modifications were developed by Air Control Science (ACS). 7 figs., 1 tab.

  16. Color of Meat and Poultry

    Science.gov (United States)

    ... color. It can also occur when vegetables containing nitrites are cooked along with the meat. Because doneness and safety cannot be judged by ... or greenish cast when exposed to heat and processing. Wrapping the meat in airtight packages and storing it away from ...

  17. Ecological safety of meat products

    Directory of Open Access Journals (Sweden)

    A. K. Mikhailenko

    2009-01-01

    Full Text Available The level of toxicants was studied, and the biological value of sheep meat in the area of anthropogenic influence was checked up. The level of toxicants in meat depends straight on the age of animals.

  18. The In vitro meat cookbook

    NARCIS (Netherlands)

    Mensvoort, van K.M.; Grievink, H.J.

    2014-01-01

    With the world's population expected to reach nine billion people by 2050, it becomes impossible to produce and consume meat like we do today. In vitro meat, grown from cells in a laboratory, could provide a sustainable and animal-friendly alternative. Yet, before we can decide if we are willing to

  19. Cultured Meat in Islamic Perspective.

    Science.gov (United States)

    Hamdan, Mohammad Naqib; Post, Mark J; Ramli, Mohd Anuar; Mustafa, Amin Rukaini

    2017-04-29

    Cultured meat is a promising product that is derived through biotechnology that partially circumvents animal physiology, thereby being potentially more sustainable, environmentally friendly and animal friendly than traditional livestock meat. Such a novel technology that can impact many consumers evokes ethical, philosophical and religious discussions. For the Islamic community, the crucial question is whether cultured meat is halal, meaning compliant with Islamic laws. Since the culturing of meat is a new discovery, invention and innovation by scientists that has never been discussed by classical jurists (fuqaha'), an ijtihad by contemporary jurists must look for and provide answers for every technology introduced, whether it comply the requirements of Islamic law or not. So, this article will discuss an Islamic perspective on cultured meat based on the original scripture in the Qur'an and interpretations by authoritative Islamic jurists. The halal status of cultured meat can be resolve through identifying the source cell and culture medium used in culturing the meat. The halal cultured meat can be obtained if the stem cell is extracted from a (Halal) slaughtered animal, and no blood or serum is used in the process. The impact of this innovation will give positive results in the environmental and sustain the livestock industry.

  20. Production of fungal chitosan from date wastes and its application as a biopreservative for minced meat.

    Science.gov (United States)

    Tayel, Ahmed A; Ibrahim, Sami I A; Al-Saman, Mahmoud A; Moussa, Shaaban H

    2014-08-01

    Raw and processed meat contaminated with pathogenic microorganisms is a continuing worldwide problem facing health and industry overseers. Fungal chitosan was extracted, purified and characterized from Aspergillus brasiliensis (niger) ATCC 16404 grown in date syrup (dips) and applied as a potential meat biopreservative. The main features of produced chitosan were a deacetylation degree of 81.3%, a molecular weight of 31,000Da, 96% solubility in 1% acetic acid solution and a harmonized IR-spectrum to standard commercial chitosan. The application of fungal chitosan, as a natural and safe biopreservative for minced meat, was conducted in comparison with potassium sorbate, as a commercial meat preservative. Treated meat samples with 0.02% chitosan was the least trials in microbial contents, i.e. total count, coliforms, β-glucuronidase-positive Escherichia coli, Enterobacteriaceae, yeasts and molds, Staphylococcus aureus and coagulase positive staphylococci. The antimicrobial activity of fungal chitosan was considerably greater than that of potassium sorbate or their combination at 0.01% from each. Sensory characteristics, e.g. color, odor and texture, of treated meat with chitosan, were higher than those of control and potassium sorbate treated samples. Fungal chitosan, however, could be recommended as a powerful, natural and eco-friendly alternative for meat preservation and overall quality maintenance. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Development of rabbit meat products fortified with n-3 polyunsaturated fatty acids.

    Science.gov (United States)

    Petracci, Massimiliano; Bianchi, Maurizio; Cavani, Claudio

    2009-02-01

    Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a "functional food" by including n-3 polyunsaturated fatty acids (n-3 PUFA), conjugated linoleic acid (CLA), vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA) for n-3 PUFA.

  2. Influence of the marinating type on the morphological and sensory properties of horse meat.

    Science.gov (United States)

    Vlahova-Vangelova, Dessislava B; Abjanova, Sholpan; Dragoev, Stefan G

    2014-01-01

    The aim of this study was to explore the influence of acid, alkaline and water-oil marinating on morphological changes and sensory properties of horse meat (m. Longissimus dorsi). Nine samples (C - control stored in air, AL - alkaline marinated in 2% polyphosphates and 2% sodium chloride brine solution, AC - acid marinated in 2% sodium lactate and 2% sodium chloride brine solution, WO - marinated in water-oil emulsion (50/50) contained and 2% sodium chloride and SC - marinated in 2% sodium chloride brine solution) were examined. After 24 h and 48 h of marinating changes in morphology of marinated meat, pH and sensory properties of raw and roasted samples were established. It was determined that sensory properties (aroma, flavor and tenderness) after roasting were classified as follows: AL48 > AL24 > AC24 > AC48 > SC48 > SC24 > WO24 > WO48 > С. Meat tenderness in AL48, AL24, AC24 and AC48 showed better results due to stronger morphological changes in connective and muscle tissues. Alkaline solutions were more suitable for horse meat marinating compared to acid solutions and the possible reason for strong action of alkaline solutions was lower internal meat pH. Alkaline marinating should be conducted for 24 h because after 48 h the meat acquires a soft and unusually tender texture. Water-oil marinating was not appropriate for horse meat.

  3. Design and testing of small scale fish meat bone separator useful for fish processing.

    Science.gov (United States)

    Ali Muhammed, M; Manjunatha, N; Murthy, K Venkatesh; Bhaskar, N

    2015-06-01

    The present study relates to the food processing machinery and, more specifically machine for producing boneless comminuted meat from raw fish fillet. This machine is of belt and drum type meat bone separator designed for small scale fish processing in a continuous mode. The basic principal involved in this machine is compression force. The electric geared motor consists of 1HP and the conveyor belt has a linear velocity of 19 to 22 m min(-1), which was sufficient to debone the fish effectively. During the meat bone separation trials an efficiency up to 75 % on dressed fish weight basis was observed and with a capacity to separate 70 kg h(-1) of meat from fish at the machine speed of 25 rpm. During the trials, it was demonstrated that there was no significant change in the proximate composition of comminuted fish meat when compared to unprocessed fish meat. This design has a greater emphasis on hygiene, provision for cleaning-in-place (CIP) and gives cost effective need and reliability for small scale industries to produce fish meat in turn used for their value added products.

  4. Development of Rabbit Meat Products Fortified With n-3 Polyunsaturated Fatty Acids

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci

    2009-10-01

    Full Text Available Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a “functional food” by including n-3 polyunsaturated fatty acids (n-3 PUFA, conjugated linoleic acid (CLA, vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA for n-3 PUFA.

  5. Food safety and organic meats.

    Science.gov (United States)

    Van Loo, Ellen J; Alali, Walid; Ricke, Steven C

    2012-01-01

    The organic meat industry in the United States has grown substantially in the past decade in response to consumer demand for nonconventionally produced products. Consumers are often not aware that the United States Department of Agriculture (USDA) organic standards are based only on the methods used for production and processing of the product and not on the product's safety. Food safety hazards associated with organic meats remain unclear because of the limited research conducted to determine the safety of organic meat from farm-to-fork. The objective of this review is to provide an overview of the published results on the microbiological safety of organic meats. In addition, antimicrobial resistance of microbes in organic food animal production is addressed. Determining the food safety risks associated with organic meat production requires systematic longitudinal studies that quantify the risks of microbial and nonmicrobial hazards from farm-to-fork.

  6. Iodine in meat in Macedonia

    International Nuclear Information System (INIS)

    Bogdanov, Bogdan; Gonev, Mihajlo; Tadzher, Isak

    2000-01-01

    Iodine deficiency in Macedonia still persists in a mild form. In 1999 the iodination of salt rose to 20 m gr iodine in Kg salt. The consumption of salt diminished after the last war from 20-30 gr salt per day to 10-20 gr salt daily. This shows that the problem of the elimination of iodine deficiency is being vigorously tackled. Since 1956 the iodine in salt in Macedonia rose to 10 m gr KI/Kg salt. The content of iodine in the Macedonian diet seems to be important. The amount of iodine in milk, eggs and bread is low as found by the investigation of MANU. The content of iodine in meat is low, compared to British meat is 10 times lower. The average iodine content in Macedonian meat is 95.15 micro gr per Kg, whereas in British meat it is 850-1510 micro gr iodine per k gr meat. (Original)

  7. Effect of direct adding oregano essential oil (Origanum syriacum L. on quality and stability of chicken meat patties

    Directory of Open Access Journals (Sweden)

    Marwan AL-HIJAZEEN

    2017-09-01

    Full Text Available Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1 control (no additive; (2 100 ppm oregano essential oil (OE; (3 150 ppm OE; (4 300 ppm L-ascorbic acid (E-300; (5 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320 for both breast and thigh meat respectively, and 6 150 ppm Sodium nitrite (E-250, were prepared using ground chicken meat. Generally, OE at level of 150 ppm was the most effective decreasing TBARS, and total carbonyl values compared to the other treatments. Furthermore, it showed better color values (L* and a* in term of meat color stability. However, OE and E-250 also showed the highest significant values among the other treatments. Sensory evaluation results showed that adding OE at level of 150 ppm and 100 ppm were the best values maintaining meat storage stability. Therefore, it can be recommended that OE at level of 150 ppm could be an excellent replacement to the synthetic antioxidant in the future of uncured, natural fresh meat products, and raw meat prepared for processing.

  8. Radioecological studies of 137Cs in limnological ecosystems. Biochemical states of 137Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    International Nuclear Information System (INIS)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki; Izumo, Yoshiro; Nakamura, Fumio.

    1997-01-01

    Biochemical states of 137 Cs accumulated in killifish's (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of 137 Cs radioactivity in the killifish's raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish's control raw meat mixed with 137 Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to 137 CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD 280nm in the samples were different from those of each radioactive peak. It was so suggested that 137 Cs accumulated in the killifish's meat was shown not to be binding to protein's composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with 137 Cs in samples and ammonium phosphomolybdate, 137 Cs in the NPNC fraction of the killifish's meat was not almost different from those of each control and 137 CsCl solution. (author)

  9. The utilization of coconut waste fermentated by aspergillus niger and saccharomyces cerevisiae on meat quality of weaning males rex rabbit

    Science.gov (United States)

    Wahyuni, T. H.; Ginting, N.; Yunilas; Hasnudi; Mirwandono, E.; Siregar, G. A.; Sinaga, I. G.; Sembiring, I.

    2018-02-01

    Coconut waste (CW) could be applied for animal feed while its nutrition quality were low. This study aims to investigate fermented CW effect on meat quality of Rex rabbit which feed by fermented CW either by Aspergillus niger or Tape Yeast. This research was conducted in rabbit farm Brastagi, using 24 male Rex rabbits with initial weight 1012 ± 126.67 gram in July-October 2016. The design used was complete randomized design : 6 treatment 4 replications. Treatment were T1 (unfermented 10%); T2 (unfermented 20%); T3 (a.niger fermentation 10%); T4 (a niger fermentation 20%); T5 (tape yeast fermentation 10%) and T6 (tape yeast fermentation 20%). The parameters were pH, meat texture either raw or cooked, water content, fat content, protein content of meat and cooking loss. The results showed that effect of treatment was not significantly different (P>0.05) on pH and raw meat texture, but significantly different (Pmeat cooked and meat fat content and very significantly different effect ( P> 0,01) on cooking loss, water content and protein content of meat. The conclusion of this research was the utilization of fermented CW by Aspergillius niger and Tape Yeast improved the quality of Rex rabbit meat

  10. Managing meat tenderness.

    Science.gov (United States)

    Thompson, John

    2002-11-01

    This paper discusses the management of meat tenderness using a carcass grading scheme which utilizes the concept of total quality management of those factors which impact on beef palatability. The scheme called Meat Standards Australia (MSA) has identified the Critical Control Points (CCPs) from the production, pre-slaughter, processing and value adding sectors of the beef supply chain and quantified their relative importance using large-scale consumer testing. These CCPs have been used to manage beef palatability in two ways. Firstly, CCPs from the pre-slaughter and processing sectors have been used as mandatory criteria for carcasses to be graded. Secondly, other CCPs from the production and processing sectors have been incorporated into a model to predict palatability for individual muscles. The evidence for the importance of CCPs from the production (breed, growth path and HGP implants), pre-slaughter and processing (pH/temperature window, alternative carcass suspension, marbling and ageing) sectors are reviewed and the accuracy of the model to predict palatability for specific muscle×cooking techniques is presented.

  11. Ionizing energy treatment of meat and meat products

    International Nuclear Information System (INIS)

    Macfarlane, J.J.; Eustace, I.J.; Grau, F.H.

    1983-01-01

    The radiation treatments that have received most attention with respect to red meats are radappertization, i.e. radiation sterilization (25-70 kGy), to enable the long term storage of meat without refrigeration, and radurization (0.5-10 kGy) in which a sufficient proportion of spoilage organisms are inactivated to enable the storage life of chilled meat to be extended. Shelf-stable radappertized meats cannot be produced in the fresh-like condition; they need to be heated to about 70 deg. C to inactivate endogenous enzymes that would otherwise cause flavour and texture defects. The products should be vacuum sealed in oxgyen-impermeable packages and irradiated in the frozen state, otherwise pronounced off-flavours and off-odours are formed. The radiation dose required to give a useful degree of microbial inactivation and permit an increase of storage life depends upon treatment and storage conditions. The dose required is likely to be in the range 0.25 to 1.0 kGy if aerobic conditions apply, and 1 to 4 kGy if anaerobic conditions apply. An acceleration in the rate of development of rancidity in meat as a result of irradiation may be of concern when meat is treated under aerobic conditions. At the highest dose indicated above for meat irradiated under anaerobic conditions (4 kGy), effects on the organoleptic attributes of mutton have been detected

  12. Hygiene quality and presence of ESBL-producing Escherichia coli in raw food diets for dogs

    Directory of Open Access Journals (Sweden)

    Oskar Nilsson

    2015-10-01

    CMY-2 group and only one of them was also resistant to a non-beta-lactam antibiotic. Conclusion: The results of this study indicate that raw food diets could be a source of ESC-resistant E. coli to dogs and highlight the need for maintaining good hygiene when handling these products to prevent infection.

  13. Influence radurization on the sensory properties of broiler meat

    International Nuclear Information System (INIS)

    Zabielski, J.; Fiszer, W.; Mroz, J.; Niewiarowicz, A.

    1981-01-01

    The sensory properties of normal, PSE and DFD chicken carcasses have been investigated. Raw carcasses treated with 2,5 kGy and 5,0 kGy could be distinguished from non-irradiated by its appearance and slight irradiation odour, however all samples were in the acceptable range. The broiler carcasses after 14 days of storage in 4+-1 degC had received sensory acceptance ratings comparable with fresh, non-irradiated samples. Due to unpalatable odour, the shelf-life of radurized PSE carcasses was limited to 14 days in comparison with 21 days for normal and DFD type broiler meat. (author)

  14. Raw milk consumption and health

    Directory of Open Access Journals (Sweden)

    Popović-Vranješ Anka

    2015-01-01

    Full Text Available Contrary to the safe practices of milk pasteurization or sterilization, which effectively reduce foodborne outbreaks incidence associated with raw milk and dairy products use, outbreaks caused by such products continue to occur. Despite this fact, a worldwide movement advocating for the rights of raw milk and cheese selling and consumption, due to their specific nutritive characteristics, has strengthened significantly in recent years. Traditional agricultural manufacturers from Serbia still sell products related to thermally unprocessed milk, such as cottage cheese and raw cream. In AP Vojvodina during the period of 1981-2010 a total of 179 foodborne outbreaks were reported, where the incriminated cause of the outbreak were milk or diary. In 126 (70.39% outbreaks, totaling 2276 sick individuals and one casualty, it was confirmed that the incriminated food was from the group of dairy products. In 48 instances (26.82%, bacteriological tests confirmed that milk and dairy products were excluded as the outbreak causes, while in another 5 (2.79% outbreaks, microbiological analysis of food failed to confirm any relation to the actual epidemiological instances. In some cases, bacteriological testing of incriminated foods was not possible. In the cases of outbreaks associated with the consumption of milk and dairy products, traditional raw milk products were cited as being used. Consumption of unpasteurized milk and cheese represents public health threat. National and international rules ensuring use of safe products for human consumption have to set rules of trade of thermally processed milk and products on the market. [Projekat Ministarstva nauke Republike Srbije, br. TR31095

  15. Raw material uranium; Rohstoff Uran

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2017-03-15

    Uranium is an important raw material in human life. Mostly using nuclear fission uranium is used in nuclear medicine, industry and research. The most important application is the generation of electricity in nuclear power plants. Due to the global availability the worldwide uranium supply is guaranties for a long time. The contribution covers the issues medicine, neutron research, energy generation, occurrence, mining, processing, recycling and disposal.

  16. Remote handling in ZEPHYR

    International Nuclear Information System (INIS)

    Andelfinger, C.; Lackner, E.; Ulrich, M.; Weber, G.; Schilling, H.B.

    1982-04-01

    A conceptual design of the ZEPHYR building is described. The listed radiation data show that remote handling devices will be necessary in most areas of the building. For difficult repair and maintenance works it is intended to transfer complete units from the experimental hall to a hot cell which provides better working conditions. The necessary crane systems and other transport means are summarized as well as suitable commercially available manipulators and observation devices. The conept of automatic devices for cutting and welding and other operations inside the vacuum vessel and the belonging position control system is sketched. Guidelines for the design of passive components are set up in order to facilitate remote operation. (orig.)

  17. Handling hunger strikers.

    Science.gov (United States)

    1992-04-01

    Hunger strikes are being used increasingly and not only by those with a political point to make. Whereas in the past, hunger strikes in the United Kingdom seemed mainly to be started by terrorist prisoners for political purposes, the most recent was begun by a Tamil convicted of murder, to protest his innocence. In the later stages of his strike, before calling it off, he was looked after at the Hammersmith Hospital. So it is not only prison doctors who need to know how to handle a hunger strike. The following guidelines, adopted by the 43rd World Medical Assembly in Malta in November 1991, are therefore a timely reminder of the doctor's duties during a hunger strike.

  18. MFTF exception handling system

    International Nuclear Information System (INIS)

    Nowell, D.M.; Bridgeman, G.D.

    1979-01-01

    In the design of large experimental control systems, a major concern is ensuring that operators are quickly alerted to emergency or other exceptional conditions and that they are provided with sufficient information to respond adequately. This paper describes how the MFTF exception handling system satisfies these requirements. Conceptually exceptions are divided into one of two classes. Those which affect command status by producing an abort or suspend condition and those which fall into a softer notification category of report only or operator acknowledgement requirement. Additionally, an operator may choose to accept an exception condition as operational, or turn off monitoring for sensors determined to be malfunctioning. Control panels and displays used in operator response to exceptions are described

  19. Plutonium safe handling

    International Nuclear Information System (INIS)

    Tvehlov, Yu.

    2000-01-01

    The abstract, prepared on the basis of materials of the IAEA new leadership on the plutonium safe handling and its storage (the publication no. 9 in the Safety Reports Series), aimed at presenting internationally acknowledged criteria on the radiation danger evaluation and summarizing the experience in the safe management of great quantities of plutonium, accumulated in the nuclear states, is presented. The data on the weapon-class and civil plutonium, the degree of its danger, the measures for provision of its safety, including the data on accident radiation consequences with the fission number 10 18 , are presented. The recommendations, making it possible to eliminate the super- criticality danger, as well as ignition and explosion, to maintain the tightness of the facility, aimed at excluding the radioactive contamination and the possibility of internal irradiation, to provide for the plutonium security, physical protection and to reduce irradiation are given [ru

  20. Handle with care

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1965-03-15

    Full text: A film dealing with transport of radioactive materials by everyday means - rail, road, sea and air transport - has been made for IAEA. It illustrates in broad terms some of the simple precautions which should be followed by persons dealing with such materials during shipment. Throughout, the picture stresses the transport regulations drawn up and recommended by the Agency, and in particular the need to carry out carefully the instructions based on these regulations in order to ensure that there is no hazard to the public nor to those who handle radioactive materials in transit and storage. In straightforward language, the film addresses the porter of a goods wagon, an airline cargo clerk, a dockside crane operator, a truck driver and others who load and ship freight. It shows the various types of package used to contain different categories of radioactive substances according to the intensity of the radiation emitted. It also illustrates their robustness by a series of tests involving drops, fires, impact, crushing, etc. Clear instructions are conveyed on what to do in the event of an unlikely accident with any type of package. The film is entitled, 'The Safe Transport of Radioactive Materials', and is No. 3 in the series entitled, 'Handle with Care'. It was made for IAEA through the United Kingdom Atomic Energy Authority by the Film Producers' Guild in the United Kingdom. It is in 16 mm colour, optical sound, with a running time of 20 minutes. It is available for order at $50 either direct from IAEA or through any of its Member Governments. Prints can be supplied in English, French, Russian or Spanish. Copies are also available for adaptation for commentaries in other languages. (author)

  1. Human health risks associated with antimicrobial-resistant enterococci and Staphylococcus aureus on poultry meat

    DEFF Research Database (Denmark)

    Bortolaia, V.; Gongora, Carmen Espinosa; Guardabassi, L.

    2016-01-01

    health risks associated with the occurrence of these opportunistic human pathogens on poultry meat with particular focus on the risk of food-borne transmission of antimicrobial resistance. In the absence of conclusive evidence of transmission, this risk was inferred using data from scientific articles......-resistant S. aureus of livestock origin has been reported on poultry meat. In theory handling or ingestion of contaminated meat is a potential risk factor for colonization by methicillin-resistant S. aureus. However, this risk is presently regarded as negligible by public health authorities. Clinical......Enterococci and staphylococci are frequent contaminants on poultry meat. Enterococcus faecalis, Enterococcus faecium and Staphylococcus aureus are also well-known aetiological agents of a wide variety of infections resulting in major healthcare costs. This review provides an overview of the human...

  2. Growth of a plasmid-bearing (pYV) Yersinia pestis KIM5 in retail raw ground pork

    Science.gov (United States)

    Yersinia pestis can cause oro-pharyngeal plague as a result of consumption or handling of meat from infected animals. Thus, food naturally or intentionally contaminated can have a role in the dissemination of human plague. The growth of a conditionally virulent plasmid (pYV)-bearing rifampicin-res...

  3. Meat Consumption Culture in Ethiopia

    Science.gov (United States)

    Jo, Cheorun

    2014-01-01

    The consumption of animal flesh food in Ethiopia has associated with cultural practices. Meat plays pivotal and vital parts in special occasions and its cultural symbolic weight is markedly greater than that accorded to most other food. Processing and cooking of poultry is a gender based duty and has socio-cultural roles. Ethiopians are dependent on limited types of animals for meats due to the taboo associated culturally. Moreover, the consumption of meat and meat products has a very tidy association with religious beliefs, and are influenced by religions. The main religions of Ethiopia have their own peculiar doctrines of setting the feeding habits and customs of their followers. They influence meat products consumption through dictating the source animals that should be used or not be used for food, and scheduling the days of the years in periodical permeation and restriction of consumptions which in turn influences the pattern of meat consumption in the country. In Ethiopia, a cow or an ox is commonly butchered for the sole purpose of selling within the community. In special occasions, people have a cultural ceremony of slaughtering cow or ox and sharing among the group, called Kircha, which is a very common option of the people in rural area where access of meat is challenging frequently. PMID:26760739

  4. 9 CFR 319.80 - Barbecued meats.

    Science.gov (United States)

    2010-01-01

    ... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Cooked Meats § 319.80 Barbecued meats. Barbecued meats, such as product labeled “Beef Barbecue” or “Barbecued Pork,” shall be cooked by the direct... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Barbecued meats. 319.80 Section 319.80...

  5. GAME MEAT MARKET IN EASTERN CROATIA

    Directory of Open Access Journals (Sweden)

    Z. Tolušić

    2006-12-01

    Full Text Available In the Republic of Croatia, game meat is consumed far less than meat of domestic animals. Yearly game meat consumption amounts to only 0.55 kg per household member. Consumers prefer meat of domestic animals, because it is cheaper, not paying attention to specific nutritive advantages of game meat. A research on the game meat market and consumers’ preferences was carried out on 101 examinees, chosen among inhabitants of Slavonia and Baranja. The majority of questioned inhabitants did consume game meat (92%, of whom 66% consider game meat to be of better quality than meat of domestic animals. Significant number of examinees considers game meat as healthy food, being also convinced that game was healthier to consume if hunted in their natural environment, than if reared on specialized farms (90%. Irrespective of quality, only 22% of examinees buy game meat, and 51% think such meat is too expensive. This is the main reason why consumers have game meat only once a month (51%. Taking into consideration monthly income of their respective household, 58% of examinees can afford game meat only once a month, and, if having an opportunity, they would opt for meat of roe deer (55% and rabbit (25%. When asked what would stimulate the game meat market in Croatia, 56% of examinees believe this could be achieved by lowering of prices, 27% think the issue could be addressed by opening of specialty stores, and only 17% opted for more aggressive marketing activities.

  6. Irradiation of bovine meat: effect of heme-iron concentration.; Irradiacao de carne bovina: efeito na concentracao de ferro heme

    Energy Technology Data Exchange (ETDEWEB)

    Mistura, Liliana Perazzini Furtado

    2002-07-01

    The irradiation is often used, nowadays, for meat conservation and it is important to know how much this process interferes with the nutritional quality of the meat. In this study round cut meat, ground and steaks (from a local supermarket) was irradiated with doses of O; 1; 2; 3; 4; 5; 7,5 and 10 kGy (JS-7500 Nordium Inc -Canada) and the interference of irradiation and the process of food preparation on heme-iron (H Fe) content was determined. Half of the sample was kept raw and the other half was grilled in a pre-warmed oven at 250 deg C for 9 min and a controlled humidity of 70%. The chemical composition, the total iron (T Fe) (EM) and the heme iron concentration were determined (Hornsey,1956) and the sensorial quality evaluated. The average T Fe concentration of raw and ground , ground and grilled, raw steaks and grilled steak meat, on dry and degreased basis was 113 mug/g, 121 mug/g , 91 mug/g and 77 mug/g; and the H Fe concentration 105 mug/g (93% of T Fe) , 88 mug/g (73% of T Fe), 90 mug/g (99% of T Fe) and 52 mug/g (68% of T Fe) respectively. Data were evaluated by ANOVA with fixed effects and multiple comparisons. The irradiation neither altered the chemical composition nor the proportion of heme iron of meat. The preparation conditions (temperature, cooking time, environment humidity, meat presentation) of the sample interfered more with the heme iron content than the irradiation. With the sensorial analysis we verified that meats irradiated with doses of 3 kGy were better evaluated in softness and succulency attributes than the others. Meat submitted to irradiation doses up to 3 kGy were accepted by the specialists' panel. (author)

  7. Comparison of the Microbial Quality of Lamb and Goat Meat Acquired from Internet and Local Retail Markets.

    Science.gov (United States)

    Kim, Chyer; Stein, Roslyn A; Pao, Steven

    2015-11-01

    This study was conducted to evaluate the microbial quality of lamb and goat meat sold through local (Virginia) and Internet (U. S.) retail markets. A total of 134 frozen meat products consisting of locally purchased lamb ground (LLG) and lamb chops and Internet-procured lamb ground, goat ground, lamb chops (ILC), goat chops (IGC), lamb stew, and goat stew were tested. Significantly higher levels of aerobic mesophiles, psychrotrophs, and coliforms were found in the meat locally acquired than in the meat procured from the Internet. Similar average prevalence (27%) of Escherichia coli was observed regardless of market source. Ground meat had significantly high levels and prevalence of mesophiles, psychrotrophs, coliforms, and Listeria spp. One sample of LLG contained Campylobacter, and one sample of IGC contained Salmonella. Listeria spp. were present in 23 to 40% and 17 to 80% of samples from local and Internet markets, respectively. Pulsed-field gel electrophoresis (PFGE) of isolated E. coli strains revealed brand specificity and genomic diversity. No isolate from different brands and market sources had matching PFGE profiles. The average price of Internet meat ($23.4/kg) was about 1.2 times higher than the price of local meat, except for ILC, whose price was 2.7 times higher. This study revealed differences in microbial quality of lamb and goat meat based on market source; thus, meat products should be handled carefully regardless of market source because of the presence of high microbial levels and the high prevalence of pathogens.

  8. Irradiation of meats and poultry

    International Nuclear Information System (INIS)

    Urbain, W.M.

    1978-01-01

    A number of beneficial effects can be achieved by irradiating meats and poultry under different conditions. It is possible, for example, to extend the market life of both fresh and processed meats by applying radiation doses sufficient to reduce the microbial population, thereby delaying onset of spoilage; higher doses aimed at destroying both spoilage and pathogenic microorganisms can also be applied to meats, packaged to prevent recontamination, resulting in a shelf-stable product; the objective may also be to inactivate pathogenic bacteria, parasites and viruses in order to obtain a product which is acceptable from the point of view of public health. (orig.) [de

  9. Study on the meat isotopic composition for origin identification

    Directory of Open Access Journals (Sweden)

    Irina Chernukha

    2018-03-01

    Full Text Available Russian consumer and governmental authorities are equally concerned to know where food products come from. This requires more accurate and specialized methods for the evaluation of geographical location. The following methods are used: chemometrics, histological and histochemical, genomic and proteomic, microbiological, immunochemical and mass spectrometric. Method of stable isotope analysis is becoming increasingly promising nowadays for the identification of meat and meat products' place of origin. The isotope ratios of the four elements - carbon, nitrogen, oxygen and hydrogen, are mainly determined. The method is successfully used to identify a country of origin of wines, juices and water. The aim of the research was to study the stable isotope ratios for pork and beef samples purchased in Moscow supermarkets (Russian Federation. The country of production of meat samples was determined according to specifications and/or labels. The geography of countries of meat samples origin includes Europe, both America continents and Australia. Databases collected by the All-Russian Scientific Research Institute of the Brewing, Non-Alcoholic and Wine Industrywere used for the analysis and interpretation of the results. Values of 13С/12С, δ13С, 18О/16О, δ18О, 2Н/1Н, δ2Н for 30 pork and beef samples from 13 countries were obtained. Differences in stable isotope ratios were found depending on place of origin. The data correlated with the oxygen isotope characteristics for wine, which were in the range from 2.5 to 4.5 ppm. According to the 13С/12С, δ13С results, the assumption was made about a false indication of the region for the beef sample. Despite the fact that beef was labeled as a product of Lithuania, the region of origin was most probably defined as Germany. The studies carried out showed the possibility to identify the region of raw meat origin by the stable isotope ratio.

  10. Combination treatment of gamma radiation and paraben in controlling spoilage of poultry meat

    International Nuclear Information System (INIS)

    Shiralkar, N.D.; Rege, D.V.

    1977-01-01

    With a view of controlling spoilage, combination treatment of poultry meat with gamma radiation and a chemical preservative has been investigated. Raw poultry pieces of about 25 g. weight were dipped in 0.1% propyl-paraben solution for two hours and were given a 0.1 Mrad dose from 60 Co gamma radiation. It was found that paraben was not affected by irradiation. The flavour evaluation scores indicated the shelf-life of poultry meat was prolonged by a couple of days as compared to untreated controls in refrigerated storage. (M.G.B.)

  11. Meat and Fish Entree Item Production Guides Prepared for Walter Reed Army Medical Center

    Science.gov (United States)

    1977-04-01

    diced Salt 0.41 Vinegar, cider 0.32 Sugar, granulated 0.27 Paprika 0.13 Garlic, dehydrated 0.05 granular Pepper, black, ground 0!01 ARROZ CON...table pans. ARROZ CON POI.l.O Ingredients Percent Pounds Grans Procedure TarALs 100.00 2$708 NarES: 1. Reheating: Reheat in a convection oven at...yield from raw weigpt-~to cooked edible (boned) meat. Edible weight of chicken equals 12 lb {5443 g). 68 ARROZ CON POLLO Meat 1. Bacon - NSN

  12. Improving functional value of meat products.

    Science.gov (United States)

    Zhang, Wangang; Xiao, Shan; Samaraweera, Himali; Lee, Eun Joo; Ahn, Dong U

    2010-09-01

    In recent years, much attention has been paid to develop meat and meat products with physiological functions to promote health conditions and prevent the risk of diseases. This review focuses on strategies to improve the functional value of meat and meat products. Value improvement can be realized by adding functional compounds including conjugated linoneleic acid, vitamin E, n3 fatty acids and selenium in animal diets to improve animal production, carcass composition and fresh meat quality. In addition, functional ingredients such as vegetable proteins, dietary fibers, herbs and spices, and lactic acid bacteria can be directly incorporated into meat products during processing to improve their functional value for consumers. Functional compounds, especially peptides, can also be generated from meat and meat products during processing such as fermentation, curing and aging, and enzymatic hydrolysis. This review further discusses the current status, consumer acceptance, and market for functional foods from the global viewpoints. Future prospects for functional meat and meat products are also discussed.

  13. Effect of storage conditions on the biogenic amine content in wild boar meat

    Directory of Open Access Journals (Sweden)

    Zdeňka Hutařová

    2014-01-01

    Full Text Available Hygienic quality of game meat depends on many factors during and after hunting. Freshness of meat is connected with the concentration of biogenic amines which is related to meat spoilage. The aim of this study was to assess changes in concentration of biogenic amines in raw meat of wild boar (n = 20, mean age 1–2 years during storage at different temperatures. Carcases of wild boars hunted in winter 2012 in hunting districts of south Moravia were stored unskinned during 21 days at various temperatures (0, 7 and 15 °C. Concentrations of biogenic amines (putrescine, cadaverine, tyramine, tryptamine, phenylethylamine, histamine, spermine and spermidine were determined in the shoulder and leg muscles by high-performance liquid chromatography in combination with triple quadrupole tandem mass spectrometry. Good hygienic quality was maintained when wild boar carcasses were stored for a maximum of 14 days at 0 °C (content of biogenic amines in 3 meat samples exceed the limit of 5 mg/kg on day 21 of storage or a maximum of 7 days at 7 °C (content of biogenic amines in 4 meat samples exceed the limit of 5 mg/kg on day 14 of storage. The temperature of 15 °C should be considered as unsuitable storage temperature if good hygienic quality of game meat during storage is to be guaranteed (content of biogenic amines in 2 meat samples exceed the limit of 5 mg/kg already on day 7 of storage. The study brings new information about the biogenic amine content and its changes in wild boar meat during the storage period of 21 days.

  14. Cattle cruelty and risks of meat contamination at Akinyele cattle market and slaughter slab in Oyo State, Nigeria.

    Science.gov (United States)

    Adeyemo, Olanike K; Adeyemi, Isaac G; Awosanya, Emmanuel J

    2009-12-01

    Cattle transported to the government-run cattle market and slaughter slab in Akinyele, Oyo State, Nigeria on their final voyage are facing a disturbingly cruel, filthy and unsafe environment that is also raising the risk of contamination of meat sold for human consumption. This report gives a picture of what the cattle have to go through before they are slaughtered. This study also reveals cattle awaiting slaughter in abysmal health conditions, cows pulled with extreme force towards lairage and slaughter slab. Equally disturbing is the filthy situation inside the abattoir where the risk of contamination of meat is significant. Also, poor meat handling, transportation and sales practices subject meat to contamination leading to poor quality and exposure of human consumers to health risk. Development of hygienic slaughter slab operations, improved transportation system for both livestock and meat is therefore recommended; not only for Akinyele, but all abattoirs and slaughter slabs in Nigeria.

  15. Unvented Drum Handling Plan

    International Nuclear Information System (INIS)

    MCDONALD, K.M.

    2000-01-01

    This drum-handling plan proposes a method to deal with unvented transuranic drums encountered during retrieval of drums. Finding unvented drums during retrieval activities was expected, as identified in the Transuranic (TRU) Phase I Retrieval Plan (HNF-4781). However, significant numbers of unvented drums were not expected until excavation of buried drums began. This plan represents accelerated planning for management of unvented drums. A plan is proposed that manages unvented drums differently based on three categories. The first category of drums is any that visually appear to be pressurized. These will be vented immediately, using either the Hanford Fire Department Hazardous Materials (Haz. Mat.) team, if such are encountered before the facilities' capabilities are established, or using internal capabilities, once established. To date, no drums have been retrieved that showed signs of pressurization. The second category consists of drums that contain a minimal amount of Pu isotopes. This minimal amount is typically less than 1 gram of Pu, but may be waste-stream dependent. Drums in this category are assayed to determine if they are low-level waste (LLW). LLW drums are typically disposed of without venting. Any unvented drums that assay as TRU will be staged for a future venting campaign, using appropriate safety precautions in their handling. The third category of drums is those for which records show larger amounts of Pu isotopes (typically greater than or equal to 1 gram of Pu). These are assumed to be TRU and are not assayed at this point, but are staged for a future venting campaign. Any of these drums that do not have a visible venting device will be staged awaiting venting, and will be managed under appropriate controls, including covering the drums to protect from direct solar exposure, minimizing of container movement, and placement of a barrier to restrict vehicle access. There are a number of equipment options available to perform the venting. The

  16. New transport and handling contract

    CERN Multimedia

    SC Department

    2008-01-01

    A new transport and handling contract entered into force on 1.10.2008. As with the previous contract, the user interface is the internal transport/handling request form on EDH: https://edh.cern.ch/Document/TransportRequest/ To ensure that you receive the best possible service, we invite you to complete the various fields as accurately as possible and to include a mobile telephone number on which we can reach you. You can follow the progress of your request (schedule, completion) in the EDH request routing information. We remind you that the following deadlines apply: 48 hours for the transport of heavy goods (up to 8 tonnes) or simple handling operations 5 working days for crane operations, transport of extra-heavy goods, complex handling operations and combined transport and handling operations in the tunnel. For all enquiries, the number to contact remains unchanged: 72202. Heavy Handling Section TS-HE-HH 72672 - 160319

  17. The Ethics of Producing In Vitro Meat

    OpenAIRE

    Schaefer, G Owen; Savulescu, Julian

    2014-01-01

    The prospect of consumable meat produced in a laboratory setting without the need to raise and slaughter animals is both realistic and exciting. Not only could such in vitro meat become popular due to potential cost savings, but it also avoids many of the ethical and environmental problems with traditional meat productions. However, as with any new technology, in vitro meat is likely to face some detractors. We examine in detail three potential objections: 1) in vitro meat is disrespectful, e...

  18. Bioactive Compounds in Functional Meat Products

    OpenAIRE

    Ewelina Pogorzelska-Nowicka; Atanas G. Atanasov; Jarosław Horbańczuk; Agnieszka Wierzbicka

    2018-01-01

    Meat and meat products are a good source of bioactive compounds with positive effect on human health such as vitamins, minerals, peptides or fatty acids. Growing food consumer awareness and intensified global meat producers competition puts pressure on creating new healthier meat products. In order to meet these expectations, producers use supplements with functional properties for animal diet and as direct additives for meat products. In the presented work seven groups of key functional cons...

  19. A survey of commercially available broilers marketed as organic, free-range, and conventional broilers for cooked meat yields, meat composition, and relative value.

    Science.gov (United States)

    Husak, R L; Sebranek, J G; Bregendahl, K

    2008-11-01

    The objective of this survey was to investigate qualitative and quantitative properties of meat from organic, free-range, and conventional broilers as currently provided to consumers. Fifteen broilers from 4 suppliers of each type were evaluated for raw meat yield, cooked meat yield, proximate composition, pH, color, lipid oxidation, fatty acid composition, and sensory attributes. Organic broilers yielded more dark (thigh) meat (P free-range or conventional, when compared on a raw-meat basis, but conventional and free-range broilers yielded more (P free-range or conventional. Organic breast and thigh meat was less yellow (P free-range or conventional. Fatty acid analysis showed that organic breasts and thighs were lower (P free-range and conventional broilers. Shear force measurements were less (P free-range and organic broilers. Sensory panel results indicated that thighs from conventional broilers were more tender (P free-range and organic broilers, whereas other sensory properties did not differ. At the time of the study, March through May of 2006, the average retail prices for US broilers were USD 3.19, USD 2.78, and USD 1.29 per pound (USD 7.03, USD 6.13, and USD 2.84/kg) for organic, free-range, and conventional, respectively. Whereas a difference in the fatty acid composition was the largest difference observed between retail broilers in this survey, it is important to note that diets and production environments within the study were not controlled. It is apparent that the market prices for broilers at the time of this study are not fully reflected in the quantitative and qualitative measurements included in this study. It appears that consumers may be placing significant value on more intangible attributes associated with broilers marketed as organic and free-range chicken than on those attributes measured in this study.

  20. Environmental costs of meat production

    DEFF Research Database (Denmark)

    Nguyen, T Lan T; Hermansen, John Erik; Mogensen, Lisbeth

    2012-01-01

    This paper aims to address two questions: First, what is the real cost of meat to society if taking into account the environmental costs arising throughout the product life cycle; and second, whether and how the environmental costs related to meat production can be reduced. In addressing the issues...... to be the main contributor to the costs (55%), followed by global warming (21%) and respiratory inorganics (18%). A viable option combining improvement measures in three aspects: feed use, manure management, and manure utilization, reduces the environmental costs by a factor of 1.4. This results in an equal size......, we use pig meat production in the EU as a case study. The environmental costs of meat are displayed first as characterized results at different midpoint categories e.g. global warming, nature occupation, acidification, eutrophication, ecotoxicity, etc., and then aggregated into a single score using...

  1. Reindeer meat – is it always tender, tasty and healthy?

    Directory of Open Access Journals (Sweden)

    Eva Wiklund

    2007-04-01

    Full Text Available Meat with high pH values, so called DFD (Dark, Firm, Dry meat, is a persistent quality defect foundmin all meat species. DFD shortens shelf life, especially for vacuum-packed meat and affects meat colour, tenderness and water-holding properties. High pH values in reindeer meat have been related to pre-slaughter handling stress and poor nutritional status of the animals. There are numerous reports that variation in muscle pH and glycogen content give rise to considerable variations in meat tenderness in species such as beef and lamb. In contrast, reindeer meat has been found to be extremely tender regardless of ultimate pH. This phenomenon has been related to the speed of post mortem protein degradation and the small muscle fibre size in reindeer. Previous research has demonstrated that the fatty acid composition of meat changes in response to diets. Generally, a higher proportion of long, unsaturated fatty acids were found in meat from grazing animals compared with animals fed a grain-based diet. Reindeer meat has been found to contain moderate amounts of polyunsaturated fatty acids (PUFA, especially so-called n-3 (or omega-3 PUFAs. The PUFAs are known to be susceptible to oxidation and may therefore be easily oxidized during processing by techniques like smoking and drying. A trained sensory panel concluded that meat from reindeer fed commercial feed scored higher for liverish and sweet flavours and lower for off-flavou (i.e. ‘grass’, ‘wild’ and ‘game’ compared with meat from grazing animals. Consumer preference tests on reindeer meat showed that 50 per cent of the consumers preferred meat from grazing reindeer and 50 per cent meat from pellet-fed animals. Recent reindeer meat research has included new feed mixtures using ingredients like linseed and fishmeal. Crushed linseed in the feed gave meat with a fat composition similar to that of natural pasture, which meant more PUFA than in meat from reindeer fed the normal grain

  2. Remote handling and accelerators

    International Nuclear Information System (INIS)

    Wilson, M.T.

    1983-01-01

    The high-current levels of contemporary and proposed accelerator facilities induce radiation levels into components, requiring consideration be given to maintenance techniques that reduce personnel exposure. Typical components involved include beamstops, targets, collimators, windows, and instrumentation that intercepts the direct beam. Also included are beam extraction, injection, splitting, and kicking regions, as well as purposeful spill areas where beam tails are trimmed and neutral particles are deposited. Scattered beam and secondary particles activate components all along a beamline such as vacuum pipes, magnets, and shielding. Maintenance techniques vary from hands-on to TV-viewed operation using state-of-the-art servomanipulators. Bottom- or side-entry casks are used with thimble-type target and diagnostic assemblies. Long-handled tools are operated from behind shadow shields. Swinging shield doors, unstacking block, and horizontally rolling shield roofs are all used to provide access. Common to all techniques is the need to make operations simple and to provide a means of seeing and reaching the area

  3. TFTR tritium handling concepts

    International Nuclear Information System (INIS)

    Garber, H.J.

    1976-01-01

    The Tokamak Fusion Test Reactor, to be located on the Princeton Forrestal Campus, is expected to operate with 1 to 2.5 MA tritium--deuterium plasmas, with the pulses involving injection of 50 to 150 Ci (5 to 16 mg) of tritium. Attainment of fusion conditions is based on generation of an approximately 1 keV tritium plasma by ohmic heating and conversion to a moderately hot tritium--deuterium ion plasma by injection of a ''preheating'' deuterium neutral beam (40 to 80 keV), followed by injection of a ''reacting'' beam of high energy neutral deuterium (120 to 150 keV). Additionally, compressions accompany the beam injections. Environmental, safety and cost considerations led to the decision to limit the amount of tritium gas on-site to that required for an experiment, maintaining all other tritium in ''solidified'' form. The form of the tritium supply is as uranium tritide, while the spent tritium and other hydrogen isotopes are getter-trapped by zirconium--aluminum alloy. The issues treated include: (1) design concepts for the tritium generator and its purification, dispensing, replenishment, containment, and containment--cleanup systems; (2) features of the spent plasma trapping system, particularly the regenerable absorption cartridges, their integration into the vacuum system, and the handling of non-getterables; (3) tritium permeation through the equipment and the anticipated releases to the environment; (4) overview of the tritium related ventilation systems; and (5) design bases for the facility's tritium clean-up systems

  4. Safe Handling of Radioisotopes

    International Nuclear Information System (INIS)

    1958-01-01

    Under its Statute the International Atomic Energy Agency is empowered to provide for the application of standards of safety for protection against radiation to its own operations and to operations making use of assistance provided by it or with which it is otherwise directly associated. To this end authorities receiving such assistance are required to observe relevant health and safety measures prescribed by the Agency. As a first step, it has been considered an urgent task to provide users of radioisotopes with a manual of practice for the safe handling of these substances. Such a manual is presented here and represents the first of a series of manuals and codes to be issued by the Agency. It has been prepared after careful consideration of existing national and international codes of radiation safety, by a group of international experts and in consultation with other international bodies. At the same time it is recommended that the manual be taken into account as a basic reference document by Member States of the Agency in the preparation of national health and safety documents covering the use of radioisotopes.

  5. Radioactive wastes handling facility

    International Nuclear Information System (INIS)

    Hirose, Emiko; Inaguma, Masahiko; Ozaki, Shigeru; Matsumoto, Kaname.

    1997-01-01

    There are disposed an area where a conveyor is disposed for separating miscellaneous radioactive solid wastes such as metals, on area for operators which is disposed in the direction vertical to the transferring direction of the conveyor, an area for receiving the radioactive wastes and placing them on the conveyor and an area for collecting the radioactive wastes transferred by the conveyor. Since an operator can conduct handling while wearing a working cloth attached to a partition wall as he wears his ordinary cloth, the operation condition can be improved and the efficiency for the separating work can be improved. When the area for settling conveyors and the area for the operators is depressurized, cruds on the surface of the wastes are not released to the outside and the working clothes can be prevented from being involved. Since the wastes are transferred by the conveyor, the operator's moving range is reduced, poisonous materials are fallen and moved through a sliding way to an area for collecting materials to be separated. Accordingly, the materials to be removed can be accumulated easily. (N.H.)

  6. Trends in Modern Exception Handling

    Directory of Open Access Journals (Sweden)

    Marcin Kuta

    2003-01-01

    Full Text Available Exception handling is nowadays a necessary component of error proof information systems. The paper presents overview of techniques and models of exception handling, problems connected with them and potential solutions. The aspects of implementation of propagation mechanisms and exception handling, their effect on semantics and general program efficiency are also taken into account. Presented mechanisms were adopted to modern programming languages. Considering design area, formal methods and formal verification of program properties we can notice exception handling mechanisms are weakly present what makes a field for future research.

  7. Experiences with mobile units for liquid raw management in slovak and czech nuclear power plants

    International Nuclear Information System (INIS)

    Rapant, T.; Tatransky, P.; Vasko, M.; Hlavacka, R.

    2015-01-01

    Text describes the experience from multiple projects of retrieval, pre-treatment and final treatment of liquid radioactive waste in Slovak and Czech NPPs during last 20 years. The purpose of these projects was to retrieve RAW (sludge, used resins, crystalline sediments, other types of liquid RAW) from operational tanks or technological systems, its pre-treatment and its solidification into 200 l or 60 l drums. Slovak and Czech NPPs are WWER 440 type (except Bohunice A1 NPP) where operational liquid RAW should be stored in large capacity tanks during the whole operational period. Volume of tanks placed in auxiliary buildings is from 460 to 550 m 3 , usually they are situated in rooms with limited access and minimal handling space. The liquid RAW management process is described. (authors)

  8. Electrical impedance spectroscopy for quality assessment of meat and fish: A review on basic principles, measurement methods, and recent advances

    Science.gov (United States)

    Electrical impedance spectroscopy (EIS), as an effective analytical technique for electrochemical system, has shown a wide application for food quality and safety assessment recently. Individual differences of livestock cause high variation in quality of raw meat and fish and their commercialized pr...

  9. Effects of vitamin E and organic selenium on oxidative stability of omega-3 enriched dark chicken meat during cooking.

    Science.gov (United States)

    Perez, T I; Zuidhof, M J; Renema, R A; Curtis, J M; Ren, Y; Betti, M

    2010-03-01

    The influence of vitamin E and selenomethionine (SeMet) on lipid oxidation in frozen-raw and cooked omega-3 enriched dark chicken meat was evaluated. Feed was supplemented with 2 levels of vitamin E (250 and 50 IU/kg of feed) and selenium (0.1 mg of sodium selenite/kg of feed and 0.3 mg of SeMet/kg of feed). An extruded linseed product was used as the alpha-linolenic acid source. Fatty acid (FA) profile, oxysterols, and thiobarbituric reactive acid substances (TBARs) were analyzed in frozen-raw, boiled, pan-fried, and roasted meat. After 6 mo of storage, oxysterols in frozen-raw meat remained stable with either high or low levels of dietary antioxidants. During cooking, high levels of vitamin E reduced oxysterol formation, whereas high levels of SeMet were inconsistent and even increased oxysterols during roasting. TBARs in frozen-raw meat stored for 6 mo were inhibited by high levels of either antioxidant. Conversely, no protective effect during cooking was observed at this time of storage. After 12 mo at -30 degrees C no antioxidant protection was observed.

  10. Identification of Particles in Parenteral Drug Raw Materials.

    Science.gov (United States)

    Lee, Kathryn; Lankers, Markus; Valet, Oliver

    2018-04-18

    Particles in drug products are not good and are therefore regulated. These particles can come from the very beginning of the manufacturing process, from the raw materials. To prevent particles, it is important to understand what they are and where they come from so the raw material quality, processing, and shipping can be improved. Thus, it is important to correctly identify particles seen in raw materials. Raw materials need to be of a certain quality with respect to physical and chemical composition, and need to have no contaminants in the form of particles which could contaminate the product or indicate the raw materials are not pure enough to make a good quality product. Particles are often seen when handling raw materials due to color, size, or shape characteristics different from those in the raw materials. Particles may appear to the eye to be very different things than they actually are, so microscope, chemical, and elemental analyses are required for accuracy in proper identification. This paper shows how using three different spectroscopy tools correctly and together can be used to identify particles from extrinsic, intrinsic, and inherent particles. Sources of materials can be humans and the environment (extrinsic), from within the process (intrinsic), and part of the formulation (inherent). Microscope versions of Raman spectroscopy, laser-induced breakdown spectroscopy (LIBS), and IR spectroscopy are excellent tools for identifying particles because they are fast and accurate techniques needing minimal sample preparation that can provide chemical composition as well as images that can be used for identification. The micro analysis capabilities allow for easy analysis of different portions of samples so multiple components can be identified and sample preparation can be reduced. Using just one of these techniques may not be sufficient to give adequate identification results so that the source of contamination can be adequately identified. The

  11. 9 CFR 355.42 - Marking of mule meat and animal food mule meat by-product.

    Science.gov (United States)

    2010-01-01

    ... mule meat by-product. 355.42 Section 355.42 Animals and Animal Products FOOD SAFETY AND INSPECTION... Meat and Animal Food, Mule Meat By-Product § 355.42 Marking of mule meat and animal food mule meat by-product. All mule meat and animal food mule meat by-product inspected under this part shall be marked and...

  12. ALTERNATIVE METHODS OF TECHNOLOGICAL PROCESSING TO REDUCE SALT IN MEAT PRODUCTS

    Directory of Open Access Journals (Sweden)

    E. K. Tunieva

    2017-01-01

    Full Text Available The world trends in table salt reduction in meat products contemplate the use of different methods for preservation of taste and consistency in finished products as well as shelf life prolongation. There are several approaches to a sodium chloride reduction in meat products. The paper presents a review of the foreign studies that give evidence of the possibility to maintain quality of traditional meat products produced with the reduced salt content. The studies in the field of salty taste perception established that a decrease in a salt crystal size to 20 µm enabled reducing an amount of added table salt due to an increase in the salty taste intensity in food products. Investigation of the compatibility of different taste directions is also interesting as one of the approaches to a sodium chloride reduction in food products. The use of water-in-oil-in-water (w/o/w double emulsions allows controlling a release of encapsulated ingredients (salt, which enables enhancement of salty taste. The other alternative method of technological processing of meat raw material for reducing salt in meat products is the use of high pressure processing. This method has several advantages and allows not only an increase in the salty taste intensity, but also formation of a stable emulsion, an increase in water binding capacity of minced meat and extension of shelf-life.

  13. Effect of radiation processing on meat tenderisation

    International Nuclear Information System (INIS)

    Kanatt, Sweetie R.; Chawla, S.P.; Sharma, Arun

    2015-01-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour. - Highlights: • Effect of radiation processing on tenderness of three meat systems was evaluated. • Dose dependant reduction in shear force seen in buffalo meat. • Collagen solubility increased with irradiation

  14. Safety measuring for sodium handling

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ji Young; Jeong, K C; Kim, T J; Kim, B H; Choi, J H

    2001-09-01

    This is the report for the safety measures of sodium handling. These contents are prerequisites for the development of sodium technology and thus the workers participate in sodium handling and experiments have to know them perfectly. As an appendix, the relating parts of the laws are presented.

  15. Meat products and consumption culture in the East.

    Science.gov (United States)

    Nam, Ki-Chang; Jo, Cheorun; Lee, Mooha

    2010-09-01

    Food consumption is a basic activity necessary for survival of the human race and evolved as an integral part of mankind's existence. This not only includes food consumption habits and styles but also food preparation methods, tool development for raw materials, harvesting and preservation as well as preparation of food dishes which are influenced by geographical localization, climatic conditions and abundance of the fauna and flora. Food preparation, trade and consumption have become leading factors shaping human behavior and developing a way of doing things that created tradition which has been passed from generation to generation making it unique for almost every human niche in the surface of the globe. Therefore, the success in understanding the culture of other countries or ethnic groups lies in understanding their rituals in food consumption customs. Meat consumption culture in the East has not been well developed by its characteristic environment, religion, history, and main food staples. However, recently, the amount of meat production and consumption of the Eastern countries has grown rapidly by the globalization of food industry and rapid economic growth of the countries. This manuscript introduces meat-based products and consumption culture in Asian countries. However, because the environments and cultures within Asia are too diverse to cover all food cultures, this manuscript focused mainly on three northeast Asian countries including China, Japan, and Korea (Republic of) and some southeast Asian countries including Vietnam and Thailand, which have similar environments and cultural interactions historically but retain their own characteristic food culture.

  16. Experimental robot gripper control for handling of soft objects

    Science.gov (United States)

    Friedrich, Werner E.; Ziegler, T. H.; Lim, P.

    1996-10-01

    The challenging task of automated handling of variable objects necessitates a combination of innovative engineering and advanced information technology. This paper describes the application of a recently developed control strategy applied to overcome some limitations of robot handling, particularly when dealing with variable objects. The paper focuses on a novel approach to accommodate the need for sensing and actuation in controlling the pickup procedure. An experimental robot-based system for the handling of soft parts, ranging from artificial components to natural objects such as fruit and meat pieces was developed. The configuration comprises a modular gripper subsystem, and an industrial robot as part of a distributed control system. The gripper subsystem features manually configurable fingers with integrated sensing capabilities. The control architecture is based on a concept of decentralized control differentiating between positioning and gripping procedures. In this way, the robot and gripper systems are treated as individual handling operations. THis concept allows very short set-up times for future changes involving one or more sub-systems.

  17. Waste Handling Building Conceptual Study

    International Nuclear Information System (INIS)

    G.W. Rowe

    2000-01-01

    The objective of the ''Waste Handling Building Conceptual Study'' is to develop proposed design requirements for the repository Waste Handling System in sufficient detail to allow the surface facility design to proceed to the License Application effort if the proposed requirements are approved by DOE. Proposed requirements were developed to further refine waste handling facility performance characteristics and design constraints with an emphasis on supporting modular construction, minimizing fuel inventory, and optimizing facility maintainability and dry handling operations. To meet this objective, this study attempts to provide an alternative design to the Site Recommendation design that is flexible, simple, reliable, and can be constructed in phases. The design concept will be input to the ''Modular Design/Construction and Operation Options Report'', which will address the overall program objectives and direction, including options and issues associated with transportation, the subsurface facility, and Total System Life Cycle Cost. This study (herein) is limited to the Waste Handling System and associated fuel staging system

  18. Antibiotic Resistance Patterns of Enterococci and Occurrence of Vancomycin-Resistant Enterococci in Raw Minced Beef and Pork in Germany

    Science.gov (United States)

    Klein, Günter; Pack, Alexander; Reuter, Gerhard

    1998-01-01

    The food chain, especially raw minced meat, is thought to be responsible for an increase in the incidence of vancomycin-resistant enterococci (VRE) in human nosocomial infections. Therefore, 555 samples from 115 batches of minced beef and pork from a European Union-licensed meat-processing plant were screened for the occurrence of VRE. The processed meat came from 45 different slaughterhouses in Germany. Enterococci were isolated directly from Enterococcosel selective agar plates and also from Enterococcosel selective agar plates supplemented with 32 mg of vancomycin per liter. In addition, peptone broth was used in a preenrichment procedure, and samples were subsequently plated onto Enterococcosel agar containing vancomycin. To determine resistance, 209 isolates from 275 samples were tested with the glycopeptides vancomycin, teicoplanin, and avoparcin and 19 other antimicrobial substances by using a broth microdilution test. When the direct method was used, VRE were found in 3 of 555 samples (0.5%) at a concentration of 1.0 log CFU/g of minced meat. When the preenrichment procedure was used, 8% of the samples were VRE positive. Our findings indicate that there is a low incidence of VRE in minced meat in Germany. In addition, the resistance patterns of the VRE isolates obtained were different from the resistance patterns of clinical isolates. A connection between the occurrence of VRE in minced meat and nosocomial infections could not be demonstrated on the basis of our findings. PMID:9572958

  19. Radiation preservation of meat and meat products: A review.

    Science.gov (United States)

    Dempster, J F

    1985-01-01

    The World Health Organisation (WHO) in 1980 clarified the position regarding the medical acceptability of irradiated foods when it said'…no health hazard results from consuming any food irradiated up to a dose of one megarad (1 Mrad)'. This resulted in renewed interest in irradiation as a cost-effective alternative to traditional preservation methods such as canning and freezing. Thus, radurisation (the application of ionising radiation at a dose level which substantially reduces the microbial population) increases the shelf life of poultry, comminuted meat and meat dishes significantly. Low dose irradiation, or radicidation, eliminates parasites such as Trichinae and cysticerci in pork and, very importantly, salmonella organisms in poultry and red meat. Therefore, irradiation has an important rôle to play in public health protection. High dose irradiation, or radappertisation ('cold sterilisation'), uses doses in excess of 1 Mrad and is analogous to retorting as understood in the canning industry. However, it can adversely affect quality in producing 'free radicals' in high protein foods such as meat. To prevent this, special precautions are necessary, e.g. irradiation is conducted at very low temperatures and the product is usually vacuum packed. A further potential use of irradiation is its ability to reduce the quantity of nitrite necessary in cured meats. This may become of practical significance if legislation further reduces the amount of nitrite permitted in these products. Copyright © 1985. Published by Elsevier Ltd.

  20. Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

    Science.gov (United States)

    Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

    2010-05-01

    A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

  1. Snail meat: Significance and consumption

    Directory of Open Access Journals (Sweden)

    Dragićević Olgica

    2005-01-01

    Full Text Available The consumption of snail meat goes back to prehistoric times. Different ancient nations had snails on their menu, but Helices culture as a productive activity was born as a Roman culture. Some of the most economically important edible species are: Helix aspersa (Mtiller Helixpomatia (Linne, Helix iucorum (Linne, Helix aperta (Born, Eobania vermiculata (Miiller. Together with its tasie, snail meat has several advantages over others: quite low lipid rate and calorie values versus rich mineral, essential amino acid and fatty acid content. The composition of snail meat is presented. In addition, the composition of different snail species and the part analyzed (pedal mass and visceral mass is presented. Also, the differences in composition according to the species (snail meat horse/chicken meat, beef, swine meat, fish meat are presented. The French are the world's leading consumers of snails. !n France snails come to market in a variety of ways. Estimated consumption of snails in France is around 40 000 tones/year. Total French imports account for 25% of world imports. France is also the leading exporter of prepared snails, mainly sold as preserved snails and prepared dishes. Snail imports have been much higher than exports (65 tones exported in 2002. vs. 2.700 tones imported. Despite the large consumption, only 3% of snails in France come from production (farming. Italy is in second place in the world consumption of snails, and Spain and Germany are in the third and fourth place. The development of snails consumption in Italy is followed with the same amount of production of snails in the whole biological circle. In 2001, from 24,700 tons, 9,350 tons (37.8% came from production, 6 00 tons (2.4% came from nature, and 14,750 tons (59.70% came from imports (frozen, fresh and prepared snails. In Serbia, at the beginning of 2005, we had over 400 registered farms for snail production.

  2. Improvement of shelf stability and processing properties of meat products by gamma irradiation

    International Nuclear Information System (INIS)

    Byun, M.-W.; Lee, J.-W.; Yook, H.-S.; Lee, K.-H.; Kim, H.-Y.

    2002-01-01

    To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams

  3. Improvement of shelf stability and processing properties of meat products by gamma irradiation

    Science.gov (United States)

    Byun, Myung-Woo; Lee, Ju-Woon; Yook, Hong-Sun; Lee, Kyong-Haeng; Kim, Hee-Yun

    2002-03-01

    To evaluate the effects of gamma irradiation on the processing properties of meat products, emulsion-type sausage, beef patties and pork loin ham were manufactured. Most contaminated bacteria were killed by 3 kGy-irradiation to raw ground beef, and sausage can be manufactured with desirable flavor, a reduction of NaCl and phosphate, and extension of shelf life using gamma irradiation on the raw meat. The beef patties were manufactured with the addition of antioxidants (200 ppm), BHA, ascorbyl palmitate, α-tocopherol, or β-carotene, and gamma-irradiation. Retardation of lipid oxidation appeared at the patties with an antioxidant. A dose of 5 kGy was observed to be as effective as the use of 200 ppm NaNO 2 to provide and maintain the desired color of the product during storage. After curing, irradiation, heating and smoking could extensively prolong the shelf life of the hams.

  4. Occurrence of Listeria monocytogenes in Ready-to-Eat Meat Products and Meat Processing Plants in Spain

    Directory of Open Access Journals (Sweden)

    Diego Gómez

    2015-07-01

    Full Text Available The aim of this work was to study the occurrence of Listeria monocytogenes in several types of ready-to-eat (RTE meat products and in the environment of meat processing plants. A total of 129 samples of RTE meat products and 110 samples from work surfaces and equipment were analyzed. L. monocytogenes was detected in 6 out of 35 cooked products (17.14%, 21 out of 57 raw-cured products (36.84%, and 9 out of 37 dry-cured, salted products (24.32%. The number of sample units that exceeded the food safety limit of 100 cfu/g decreased from the manufacture date to half shelf life, and then it was further reduced at the end of shelf life. L. monocytogenes was detected in 25 out of 110 (22.72% food contact surfaces. The number of positive and negative results from both food and environmental samples were cross-tabulated and the calculated Cohen’s kappa coefficient (κ was 0.3233, indicating a fair agreement in terms of Listeria contamination. L. monocytogenes was recovered after cleaning and disinfection procedures in four plants, highlighting the importance of thorough cleaning and disinfection.

  5. Alternative of raw material’s suppliers using TOPSIS method in chicken slaughterhouse industry

    Science.gov (United States)

    Sari, R. M.; Rizkya, I.; Syahputri, K.; Anizar; Siregar, I.

    2018-02-01

    Chicken slaughterhouse industry is one of the fastest growing industries that depends on the freshness of raw materials. The raw materials quality arrive at the company depends heavily on the suppliers. Fresh chicken and frozen chicken meat are the main raw materials for this industry. Problems occurred by the suppliers are catering the amount of raw material needs that are not appropriate and also delay during delivery process. This condition causes disruption of the production process in the company. Therefore, it is necessary to determine the best suppliers to supply the main raw materials of fresh and frozen chicken meat on the slaughterhouse chicken industry. This study analyze the supplier’s capability by using TOPSIS method. This method use to find out the best supplier. The TOPSIS method is performed using the principle that chosen alternative must have the shortest distance from the positive solution and furthest from the ideal solution of the geometric point by using the Euclidean distance to determine the relative proximity of the optimum solution alternative. TOPSIS method found the rank of best supplier’s order is supplier A followed by supplier D, supplier B, supplier C, supplier E, supplier F, and supplier G. Based on the rank order obtained from each company, it will assist the company in prioritizing the order to the supplier with the best rank. Total supply from All suppliers are 885,994 kg per month. Based on the results of research, the top five suppliers have been sufficient to meet the needs of the company.

  6. Irradiation as an alternative environmentally friendly method for microbiological decontamination of herbal raw material

    International Nuclear Information System (INIS)

    Dragusin, M.; Rotaru, R.

    2000-01-01

    Microbiological contamination of herbal raw materials is a serious problem in the production of therapeutical preparations. A good quality of the product, according to the pharmaceutical requirements may be achieved by applying suitable methods of decontamination. The decontamination treatments should be fast and effective against all microorganisms. It should ensure the decontamination of both packaging and the microorganisms present and must not reduce the sensory and technological qualities of the commodities. Decontamination of herbal raw materials by irradiation is a method by choice. It is because chemical methods are recognized recently as not safe to the consumer. Irradiation, in turn, is technically feasible, very effective and friendly enough to environment process. Under the prevailing production and handling conditions, most herbs contain a large number of microorganisms what is a serious problem in the production of therapeutical preparations. For several years the most widely used methods for decontamination of herbs was fumigation with ethylene oxide or methyl bromide. Both methods today banned in most countries. Irradiation is an alternative and safe method for effective reducing the microbial contamination of herbal raw materials. The following raw materials have been examined: Folium Cynara, Folium Plantago, Flos Chamomillae, Semen Sylibum Marianum and Folium Farfara. The content of biologically active compounds before and after irradiation of the raw materials did not change in a significant degree after irradiation. The dose of radiation for herbals raw materials was 10 kGy. There are two groups of raw materials: - The raw materials designed for preparing granulates, tablets, dragees, capsules, aqueous extracts, infusions, macerations and preparations for external use; - The raw materials assigned for preparing alcoholic preparations, isolated compounds, oil preparations and essential oils. The medical herbs and herbal raw materials before their

  7. Influence of color on dielectric properties of marinated poultry breast meat.

    Science.gov (United States)

    Samuel, D; Trabelsi, S

    2012-08-01

    The dielectric behavior of foods when exposed to radio-frequency and microwave electric fields is highly influenced by moisture content and the degree of water binding with constituents of the food materials. The ability to correlate specific food quality characteristics with the dielectric properties can lead to the development of rapid, nondestructive techniques for such quality measurements. Water-holding capacity is a critical attribute in meat quality. Up to 50% of raw poultry meat in the United States is marinated with mixtures of water, salts, and phosphates. The objective of this study was to determine if variations in breast meat color would affect the dielectric properties of marinated poultry meat over a broad frequency range from 500 MHz to 50 GHz. Poultry meat was obtained from a local commercial plant in Georgia (USA). Color and pH measurements were taken on the breast filets. Groups of breast filets were sorted into classes of pale and normal before adding marination pickup percentages of 0, 5, 10, and 15. Breast filets were vacuum-tumbled and weighed for pickup percentages. Dielectric properties of the filets were measured with a coaxial open-ended probe on samples equilibrated to 25°C. Samples from pale meat exhibited higher dielectric properties than samples from normal meat. No differences could be observed between samples from pale and normal meat after marination of the samples. Overall, dielectric properties increased as the marination pickup increased (α=0.05). Marination pickup strongly influenced the dielectric loss factor. Differences between samples marinated at different pickup levels were more pronounced at lower frequencies for the dielectric loss factor. As frequency increased, the differences between samples decreased. Differences in dielectric constant between samples were not as consistent as those seen with the dielectric loss factor.

  8. High pressure processing of meat: effects on ultrastructure and protein digestibility.

    Science.gov (United States)

    Kaur, Lovedeep; Astruc, Thierry; Vénien, Annie; Loison, Olivier; Cui, Jian; Irastorza, Marion; Boland, Mike

    2016-05-18

    The effects of high pressure processing (HPP, at 175 and 600 MPa) on the ultrastructure and in vitro protein digestion of bovine longissimus dorsi muscle meat were studied. HPP caused a significant change in the visual appearance and texture of the meat subjected to HPP at 600 MPa so that it appeared similar to cooked meat, unlike the meat subjected to HPP at 175 MPa that showed no significant visible change in the colour and texture compared to the raw meat. The muscles were subjected to digestion under simulated gastric conditions for 1 h and then under simulated small-intestinal conditions for a further 2 h. The digests were analysed using gel electrophoresis (SDS-PAGE) and ninhydrin assay for amino N. The effect of the acid conditions of the stomach alone was also investigated. Reduced SDS-PAGE results showed that pepsin-digested (60 min) HPP meats showed fewer proteins or peptides of high molecular weight than the pepsin-digested untreated meat, suggesting more breakdown of the parent proteins in HPP-treated meats. This effect was more pronounced in the muscles treated at 600 MPa. These results are in accordance with microscopy results, which showed greater changes in the myofibrillar structure after simulated gastric digestion of the sample processed at 600 MPa than at 175 MPa. Transmission electron microscopy also showed the presence of protein aggregates in the former sample, resulting probably from protein denaturation of sarcoplasmic proteins, in the subcellular space and between myofibrils; along with cell contraction (similar to that caused by heating) in the former.

  9. EFFICIENCY OF RAW MATERIAL INVENTORIES IN IMPROVING SUPPLY CHAIN PERFORMANCE of CV. FIVA FOOD

    Directory of Open Access Journals (Sweden)

    Artadi Nugraha

    2016-01-01

    Full Text Available The production and number of processed food industries have slightly increased; as a result, the companies must compete to maximize their profits by conducting their efficient production process. CV. Fiva Food is one of the companies in the field of processed foods, especially in processed meat that has implemented supply chain management. It is necessary for the company to take measurements of its performance and efficiency for the entire supply chain such as procurement of raw materials. The purposes of this study were to analyze the performance of the company's supply chain and determine the most efficient  method of procurement for its raw materials as well as and to provide recommendations for the company to improve its performance of entire supply chain. This study used SCOR in analyzing the performance of supply chain and EOQ and POQ method to be compared with the method that the company uses to determine which method of procurement for raw materials is the most efficient one. The result showed that based on the matrix, the company's performance is unfavorable when it was compared to the benchmark performance of inventory days of supply. In addition, this study showed that the POQ method produces the lowest total inventory cost with savings of Rp6.647.015 for raw materials of MDM whereas EOQ method produced the lowest total inventory cost with savings of Rp222.153,78 for raw materials of FQ85CL. Keywords: performance suppy chain, SCOR, fiva food, EOQ, POQ

  10. Detection of irradiated meat, fish and their products by measuring 2-alkylcyclobutanones levels after frozen storage

    International Nuclear Information System (INIS)

    Obana, H.; Furuta, M.; Tanaka, Y.

    2007-01-01

    2-Alkylcyclobutanones, such as 2-dodecylcyclobutanone and 2-tetradecylcyclobutanone, were analyzed to assess the irradiation history of irradiated meats or fish, and cooked foods with irradiated ingredients, which had been stored frozen for up to one year. The purpose of the study was to show that irradiated meats could be detected even after having been stored in the distribution system. 2-Alkylcyclobutanones showed a small decrease in irradiated raw meats that had been stored frozen for one year. Cooked foods, such as pancake and fried chicken made with irradiated eggs and chicken, respectively, contained detectable levels of 2-alkylcyclobutanones after storage frozen for one year. The 2-alkylcyclobutanones became undetectable in highly dried samples, such as feed for lab animals, during the same period

  11. Strategies for designing novel functional meat products.

    Science.gov (United States)

    Arihara, Keizo

    2006-09-01

    In recent years, much attention has been paid to physiological functions of foods due to increasing concerns for health. Although there has been limited information of physiological functions of meat until recently, several attractive meat-based bioactive compounds, such as carnosine, anserine, l-carnitine, conjugated linoleic acid, have been studied. Emphasizing these activities is one possible approach for improving the health image of meat and developing functional meat products. This article provides potential benefits of representative meat-based bioactive compounds on human health and an overview of meat-based functional products. Strategies for designing novel functional meat products utilizing bioactive peptides and/or probiotic bacteria, is also discussed. This article focuses particularly on the possibility of meat protein-derived bioactive peptides, such as antihypertensive peptides. There are still some hurdles in developing and marketing novel functional meat products since such products are unconventional and consumers in many countries recognize meat and meat products to be bad for health. Along with accumulation of scientific data, there is an urgent need to inform consumers of the exact functional value of meat and meat products including novel functional foods.

  12. Operation of data acquisition and handling system in the INS-SF cyclotron

    International Nuclear Information System (INIS)

    Yasue, M.; Omata, K.

    1976-01-01

    Operations of following data processing routines are described. 1) One-dimensional multiplexer PHA. 2) Two-dimensional multiplexer PHA. 3) Two or three parameter data handling: Digital gating, dumping of raw data onto MT and processing in function modes. These processing routines are executed under the control of a real time disk operating system in TOSBAC-40C. (auth.)

  13. CO2 Capture by Cement Raw Meal

    DEFF Research Database (Denmark)

    Pathi, Sharat Kumar; Lin, Weigang; Illerup, Jytte Boll

    2013-01-01

    The cement industry is one of the major sources of CO2 emissions and is likely to contribute to further increases in the near future. The carbonate looping process has the potential to capture CO2 emissions from the cement industry, in which raw meal for cement production could be used...... as the sorbent. Cyclic experiments were carried out in a TGA apparatus using industrial cement raw meal and synthetic raw meal as sorbents, with limestone as the reference. The results show that the CO2 capture capacities of the cement raw meal and the synthetic raw meal are comparable to those of pure limestone...... that raw meal could be used as a sorbent for the easy integration of the carbonate looping process into the cement pyro process for reducing CO2 emissions from the cement production process....

  14. Sophisticated fuel handling system evolved

    International Nuclear Information System (INIS)

    Ross, D.A.

    1988-01-01

    The control systems at Sellafield fuel handling plant are described. The requirements called for built-in diagnostic features as well as the ability to handle a large sequencing application. Speed was also important; responses better than 50ms were required. The control systems are used to automate operations within each of the three main process caves - two Magnox fuel decanners and an advanced gas-cooled reactor fuel dismantler. The fuel route within the fuel handling plant is illustrated and described. ASPIC (Automated Sequence Package for Industrial Control) which was developed as a controller for the plant processes is described. (U.K.)

  15. Production management of window handles

    Directory of Open Access Journals (Sweden)

    Manuela Ingaldi

    2014-12-01

    Full Text Available In the chapter a company involved in the production of aluminum window and door handles was presented. The main customers of the company are primarily companies which produce PCV joinery and wholesalers supplying these companies. One chosen product from the research company - a single-arm pin-lift window handle - was described and its production process depicted technologically. The chapter also includes SWOT analysis conducted in the research company and the value stream of the single-arm pin-lift window handle.

  16. Photoshop CS3 RAW Transforming your RAW data into works of art

    CERN Document Server

    Aaland, Mikkel

    2008-01-01

    Because RAW files remain virtually untouched by in-camera processing, working with them has given digital photographers greater flexibility and control during the editing process -- for those who are familiar enough with the format. Camera RAW, the plug in for Adobe Photoshop CS3, has emerged as one of the best and most familiar tools for editing RAW images, and the best way to master this workflow is with Photoshop CS3 RAW. Award-winning author Mikkel Aaland explores the entire RAW process, from the practical reasons to shoot RAW, to managing the images with the new features of Bridge 2.0 n

  17. Power ultrasound in meat processing.

    Science.gov (United States)

    Alarcon-Rojo, A D; Janacua, H; Rodriguez, J C; Paniwnyk, L; Mason, T J

    2015-09-01

    Ultrasound has a wide range of applications in various agricultural sectors. In food processing, it is considered to be an emerging technology with the potential to speed up processes without damaging the quality of foodstuffs. Here we review the reports on the applications of ultrasound specifically with a view to its use in meat processing. Emphasis is placed on the effects on quality and technological properties such as texture, water retention, colour, curing, marinating, cooking yield, freezing, thawing and microbial inhibition. After the literature review it is concluded that ultrasound is a useful tool for the meat industry as it helps in tenderisation, accelerates maturation and mass transfer, reduces cooking energy, increases shelf life of meat without affecting other quality properties, improves functional properties of emulsified products, eases mould cleaning and improves the sterilisation of equipment surfaces. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Spoilage-related activity of Carnobacterium maltaromaticum strains in air-stored and vacuum-packed meat.

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-10-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall.

  19. Spoilage-Related Activity of Carnobacterium maltaromaticum Strains in Air-Stored and Vacuum-Packed Meat ▿ †

    Science.gov (United States)

    Casaburi, Annalisa; Nasi, Antonella; Ferrocino, Ilario; Di Monaco, Rossella; Mauriello, Gianluigi; Villani, Francesco; Ercolini, Danilo

    2011-01-01

    One hundred three isolates of Carnobacterium spp. from raw meat were analyzed by random amplification of polymorphic DNA (RAPD) and PCR and were identified by 16S rRNA gene sequencing. Forty-five strains of Carnobacterium maltaromaticum were characterized for their growth capabilities at different temperatures, NaCl concentrations, and pH values and for in vitro lipolytic and proteolytic activities. Moreover, their spoilage potential in meat was investigated by analyzing the release of volatile organic compounds (VOCs) in meat stored in air or vacuum packs. Almost all the strains were able to grow at 4, 10, and 20°C, at pH values of 6 to 9, and in the presence of 2.5% NaCl. The release of VOCs by each strain in beef stored at 4°C in air and vacuum packs was evaluated by headspace solid-phase microextraction (HS-SPME)-gas chromatography-mass spectrometry (GC-MS) analysis. All the meat samples inoculated and stored in air showed higher numbers of VOCs than the vacuum-packed meat samples. Acetoin, 1-octen-3-ol, and butanoic acid were the compounds most frequently found under both storage conditions. The contaminated meat samples were evaluated by a sensory panel; the results indicated that for all sensory odors, no effect of strain was significant (P > 0.05). The storage conditions significantly affected (P meat, and mozzarella cheese odors, which were more intense in meat stored in air than in vacuum packs but were never very intense. In conclusion, different strains of C. maltaromaticum can grow efficiently in meat stored at low temperatures both in air and in vacuum packs, producing volatile molecules with low sensory impacts, with a negligible contribution to meat spoilage overall. PMID:21784913

  20. 9 CFR 317.308 - Labeling of meat or meat food products with number of servings.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Labeling of meat or meat food products with number of servings. 317.308 Section 317.308 Animals and Animal Products FOOD SAFETY AND INSPECTION... Nutrition Labeling § 317.308 Labeling of meat or meat food products with number of servings. The label of...

  1. 9 CFR 317.300 - Nutrition labeling of meat or meat food products.

    Science.gov (United States)

    2010-01-01

    ... Labeling § 317.300 Nutrition labeling of meat or meat food products. (a) Nutrition labeling shall be... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Nutrition labeling of meat or meat food products. 317.300 Section 317.300 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE...

  2. Will novel protein foods beat meat? : consumer acceptance of meat substitutes - a multidisciplinary research approach

    NARCIS (Netherlands)

    Hoek, A.C.

    2010-01-01

    Meat production places a heavy burden on the environment and therefore options are sought to reduce meat consumption. One option is to let new meat substitutes take the place of meat on the plate. This can only succeed when these products are acceptable to consumers. The thesis investigated which

  3. The Efficacy of the clay meat ball as a method of traditional meat ...

    African Journals Online (AJOL)

    Keywords: meat ball, protein, mineral content. This work was carried out to determine the effectiveness of the use of clay meat balls (an African traditional method of preserving meat) in extending the shelf life of meat over a period of months against microbial (bacterial and fungal) spoilage and contamination without ...

  4. Meat Quality Assessment by Electronic Nose (Machine Olfaction Technology

    Directory of Open Access Journals (Sweden)

    Sundar Balasubramanian

    2009-07-01

    Full Text Available Over the last twenty years, newly developed chemical sensor systems (so called “electronic noses” have made odor analyses possible. These systems involve various types of electronic chemical gas sensors with partial specificity, as well as suitable statistical methods enabling the recognition of complex odors. As commercial instruments have become available, a substantial increase in research into the application of electronic noses in the evaluation of volatile compounds in food, cosmetic and other items of everyday life is observed. At present, the commercial gas sensor technologies comprise metal oxide semiconductors, metal oxide semiconductor field effect transistors, organic conducting polymers, and piezoelectric crystal sensors. Further sensors based on fibreoptic, electrochemical and bi-metal principles are still in the developmental stage. Statistical analysis techniques range from simple graphical evaluation to multivariate analysis such as artificial neural network and radial basis function. The introduction of electronic noses into the area of food is envisaged for quality control, process monitoring, freshness evaluation, shelf-life investigation and authenticity assessment. Considerable work has already been carried out on meat, grains, coffee, mushrooms, cheese, sugar, fish, beer and other beverages, as well as on the odor quality evaluation of food packaging material. This paper describes the applications of these systems for meat quality assessment, where fast detection methods are essential for appropriate product management. The results suggest the possibility of using this new technology in meat handling.

  5. Meat quality assessment by electronic nose (machine olfaction technology).

    Science.gov (United States)

    Ghasemi-Varnamkhasti, Mahdi; Mohtasebi, Seyed Saeid; Siadat, Maryam; Balasubramanian, Sundar

    2009-01-01

    Over the last twenty years, newly developed chemical sensor systems (so called "electronic noses") have made odor analyses possible. These systems involve various types of electronic chemical gas sensors with partial specificity, as well as suitable statistical methods enabling the recognition of complex odors. As commercial instruments have become available, a substantial increase in research into the application of electronic noses in the evaluation of volatile compounds in food, cosmetic and other items of everyday life is observed. At present, the commercial gas sensor technologies comprise metal oxide semiconductors, metal oxide semiconductor field effect transistors, organic conducting polymers, and piezoelectric crystal sensors. Further sensors based on fibreoptic, electrochemical and bi-metal principles are still in the developmental stage. Statistical analysis techniques range from simple graphical evaluation to multivariate analysis such as artificial neural network and radial basis function. The introduction of electronic noses into the area of food is envisaged for quality control, process monitoring, freshness evaluation, shelf-life investigation and authenticity assessment. Considerable work has already been carried out on meat, grains, coffee, mushrooms, cheese, sugar, fish, beer and other beverages, as well as on the odor quality evaluation of food packaging material. This paper describes the applications of these systems for meat quality assessment, where fast detection methods are essential for appropriate product management. The results suggest the possibility of using this new technology in meat handling.

  6. Safe handling of radiation sources

    International Nuclear Information System (INIS)

    Abd Nasir Ibrahim; Azali Muhammad; Ab Razak Hamzah; Abd Aziz Mohamed; Mohammad Pauzi Ismail

    2004-01-01

    This chapter discussed the subjects related to the safe handling of radiation sources: type of radiation sources, method of use: transport within premises, transport outside premises; Disposal of Gamma Sources

  7. How Retailers Handle Complaint Management

    DEFF Research Database (Denmark)

    Hansen, Torben; Wilke, Ricky; Zaichkowsky, Judy

    2009-01-01

    This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained as to the......This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained...... as to the links between CM and redress of consumers’ complaints. The results suggest that retailers who attach large negative consequences to consumer dissatisfaction are more likely than other retailers to develop a positive strategic view on customer complaining, but at the same time an increase in perceived...

  8. Ergonomic material-handling device

    Science.gov (United States)

    Barsnick, Lance E.; Zalk, David M.; Perry, Catherine M.; Biggs, Terry; Tageson, Robert E.

    2004-08-24

    A hand-held ergonomic material-handling device capable of moving heavy objects, such as large waste containers and other large objects requiring mechanical assistance. The ergonomic material-handling device can be used with neutral postures of the back, shoulders, wrists and knees, thereby reducing potential injury to the user. The device involves two key features: 1) gives the user the ability to adjust the height of the handles of the device to ergonomically fit the needs of the user's back, wrists and shoulders; and 2) has a rounded handlebar shape, as well as the size and configuration of the handles which keep the user's wrists in a neutral posture during manipulation of the device.

  9. BIOTECHNOLOGIES OF MEAT PRODUCTS MANUFACTURE. CURRENT STATE

    OpenAIRE

    Bal-Prilipko L. V.; Leonova B. I.

    2014-01-01

    The analysis of literature and patents related to the possibilities of biotechnology for optimizing the domestic meat processing plants was the aim of the article. The analysis of the results of the use of biotechnological methods in the meat processing industry is given. The prospects for their implementation are evaluated. The main development strategy of technological meat processing to develop the methods of obtaining high quality and safe meat products is highlighted. Targeted use of spe...

  10. Goat Meat Consumer Preferences: Implications for Goat Meat Marketing in Metropolitan Nashville, Tennessee Area

    OpenAIRE

    Ekanem, Enefiok; Mafuyai-Ekanem, Mary; Tagegne, Fisseha; Singh, Surendra; Favors, Delicia

    2013-01-01

    Goat meat has become an increasingly good source of protein for meat eaters in the global marketplace. Goat meat constitutes about 63% of all red meat consumed worldwide. It is the main source of animal protein in many North African, Middle Eastern nations, Southeast Asia, the Caribbean, and other tropical regions. This notwithstanding, goat meat is yet to take such prominence in the U.S. diet. Despite the acknowledgement of the meat as lean, tasty and less fatty than other meats (USDA 2001),...

  11. The technique on handling radiation

    International Nuclear Information System (INIS)

    1997-11-01

    This book describes measurement of radiation and handling radiation. The first part deals with measurement of radiation. The contents of this part are characteristic on measurement technique of radiation, radiation detector, measurement of energy spectrum, measurement of radioactivity, measurement for a level of radiation and county's statistics on radiation. The second parts explains handling radiation with treating of sealed radioisotope, treating unsealed source and radiation shield.

  12. Civilsamfundets ABC: H for Handling

    DEFF Research Database (Denmark)

    Lund, Anker Brink; Meyer, Gitte

    2015-01-01

    Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling.......Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling....

  13. Taste-active compound levels in Korean native chicken meat: The effects of bird age and the cooking process.

    Science.gov (United States)

    Jayasena, Dinesh D; Jung, Samooel; Kim, Hyun Joo; Yong, Hae In; Nam, Ki Chang; Jo, Cheorun

    2015-08-01

    The effects of bird age and the cooking process on the levels of several taste-active compounds, including inosine 5'-monophosphate (IMP), glutamic acid, cysteine, reducing sugars, as well as oleic, linoleic, arachidonic, and docosahexaenoic acids (DHA), in the breast and leg meats from a certified meat-type commercial Korean native chicken (KNC) strain (Woorimatdag) were investigated. KNC cocks were raised under similar standard conditions at a commercial chicken farm, and breast and leg meats from birds of various ages (10, 11, 12, 13, and 14 wk; 10 birds/age group) were obtained. After raw and cooked meat samples were prepared, they were analyzed for the aforementioned taste-active compounds. Compared to the leg meat, KNC breast meat had higher levels of IMP, arachidonic acid, and DHA, but lower levels of the other taste-active compounds (P cooking process (P cooking process. This information could be useful for selection and breeding programs, and for popularizing native chicken meat. © 2015 Poultry Science Association Inc.

  14. Identification of fraud (with pig stuffs) in chicken-processed meat through information of mitochondrial cytochrome b.

    Science.gov (United States)

    Yacoub, Haitham A; Sadek, Mahmoud A

    2017-11-01

    This study was conducted to find out the fraud in chicken-processed meat ingredients to protect consumers from commercial adulteration and authentication through a reliable way: direct amplification of conserved segment of cytochrome b gene of mitochondrial DNA, in addition, using species-specific primer assay for a certain cytochrome b. The results reported that chicken-processed meats were identified as a chicken meat based on amplification of conserved cytochrome b gene of mtDNA, while different fragments sizes were produced after the application of species-specific primer as follows: 227, 157, 274, 331, 389 and 439 bp for raw meat of chicken, goat, cattle, sheep, pig and horse, respectively. The results revealed that all chicken meat products are produced with 227 bp in size. While, an adulteration with pork stuffs was observed in some of the chicken meat products using a species-specific primer of cytochrome b gene, namely, chicken luncheon and chicken burger. This study represents a reliable technique that could be used to provide a promising solution for identifying the commercial adulteration and substitutions in processed meat in retail markets.

  15. Radioecological studies of {sup 137}Cs in limnological ecosystems. Biochemical states of {sup 137}Cs accumulated in killifish (Medaka, Oryzias latipes) meat

    Energy Technology Data Exchange (ETDEWEB)

    Miyake, Sadaaki; Motegi, Misako; Oosawa, Takashi; Nakazawa, Kiyoaki [Saitama Institute of Public Health, Urawa (Japan); Izumo, Yoshiro; Nakamura, Fumio

    1997-07-01

    Biochemical states of {sup 137}Cs accumulated in killifish`s (Medaka, Oryzias latipes) meat were investigated in order to elucidate the accumulation mechanism of the radionuclide in goldfish, Carassius auratus auratus, examined in our preceding report. Most of {sup 137}Cs radioactivity in the killifish`s raw meat accumulated this radionuclide in the radioactive freshwater, were found in the non-protein nitrogenous compound (NPNC) fraction (>92%), also in the killifish`s control raw meat mixed with {sup 137}Cs, the difference between both meat samples was not clear. As the results of gel filtration profiles on Sephadex G-25 for the NPNC fraction of these meats, each only one radioactive peak was shown, also similar to {sup 137}CsCl solution. Moreover, these peaks appeared at the same position. On the other hand, the peak positions absorbed at OD{sub 280nm} in the samples were different from those of each radioactive peak. It was so suggested that {sup 137}Cs accumulated in the killifish`s meat was shown not to be binding to protein`s composition. Furthermore, as the results on thin-layer chromatography, ion-exchange resin chromatography and reaction with {sup 137}Cs in samples and ammonium phosphomolybdate, {sup 137}Cs in the NPNC fraction of the killifish`s meat was not almost different from those of each control and {sup 137}CsCl solution. (author)

  16. In the elderly, meat protein assimilation from rare meat is lower than that from meat that is well done.

    Science.gov (United States)

    Buffière, Caroline; Gaudichon, Claire; Hafnaoui, Noureddine; Migné, Carole; Scislowsky, Valérie; Khodorova, Nadezda; Mosoni, Laurent; Blot, Adeline; Boirie, Yves; Dardevet, Dominique; Santé-Lhoutellier, Véronique; Rémond, Didier

    2017-11-01

    Background: Meat cooking conditions in in vitro and in vivo models have been shown to influence the rate of protein digestion, which is known to affect postprandial protein metabolism in the elderly. Objective: The present study was conducted to demonstrate the effect of cooking conditions on meat protein assimilation in the elderly. We used a single-meal protocol to assess the meat protein absorption rate and estimate postprandial meat protein utilization in elderly subjects. Design: The study recruited 10 elderly volunteers aged 70-82 y. Each received, on 2 separate occasions, a test meal exclusively composed of intrinsically 15 N-labeled bovine meat (30 g protein), cooked at 55°C for 5 min [rare meat (RM)] or at 90°C for 30 min [fully cooked meat (FCM)], and minced. Whole-body fluxes of leucine, before and after the meal, were determined with the use of a [1- 13 C]leucine intravenous infusion. Meat protein absorption was recorded with the use of 15 N enrichment of amino acids. Results: Postprandial time course observations showed a lower concentration in the plasma of indispensable amino acids ( P meat leucine in the plasma ( P meat nitrogen to plasma amino acid nitrogen ( P meat amino acids with RM than with FCM. This was associated with decreased postprandial whole-body protein synthesis with RM than with FCM (40% compared with 56% of leucine intake, respectively; P meat cooking conditions have little effect on postprandial protein utilization in young adults, the present work showed that the bioavailability and assimilation of meat amino acids in the elderly is lower when meat is poorly cooked. In view to preventing sarcopenia, elderly subjects should be advised to favor the consumption of well-cooked meat. This trial was registered at clinicaltrials.gov as NCT02157805. © 2017 American Society for Nutrition.

  17. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  18. 9 CFR 319.261 - Meat loaf.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat loaf. 319.261 Section 319.261... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  19. 9 CFR 319.500 - Meat pies.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat pies. 319.500 Section 319.500... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Meat Food Entree Products, Pies, and...

  20. Breeding for meat quality in pigs

    NARCIS (Netherlands)

    Hovenier, R.

    1993-01-01

    The aim of this study was to investigate the possibilities of improving pig meat quality by selection. Therefore, literature is reviewed to determine the meat quality traits to be used and genetic parameters of those meat quality traits are calculated. A method is described to obtain

  1. 9 CFR 319.304 - Meat stews.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Meat stews. 319.304 Section 319.304... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Canned, Frozen, or Dehydrated Meat Food...

  2. 9 CFR 319.260 - Luncheon meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Luncheon meat. 319.260 Section 319.260... ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Luncheon Meat, Loaves and Jellied Products...

  3. Meat consumption, diabetes and its complications

    NARCIS (Netherlands)

    Feskens, E.J.M.; Sluik, D.; Woudenbergh, van G.J.

    2013-01-01

    Several prospective studies have reported that risk of type 2 diabetes (T2DM) is elevated in meat consumers, especially when processed meats are consumed. Elevated risks of coronary heart disease (CHD) and stroke in meat consumers have also been reported. In this overview, the evidence regarding

  4. Raw Pea (Pisum sativum, raw Faba bean (Vicia faba var. minor and raw Lupin (Lupinus albus var. multitalia as alternative protein sources in broiler diets

    Directory of Open Access Journals (Sweden)

    Gianfranco Piva

    2010-01-01

    Full Text Available The ban of the meat and bone meal for entering animal diets and the concern of transgenic feeds poses a challenge toanimal nutritionists in Europe. The challenge is to find homegrown protein-rich feedstuffs, making sure no antinutritionalfactors are present which could interfere in the animals’ performance. The raw Pea (Pisum sativum (RP, raw Fababean (Vicia faba, variety minor (RFb and raw Lupin (Lupinus albus, variety multitalia (RL were evaluated as alternativeprotein sources into broiler diets. Six hundred thirty 1d-old Ross male chicks, Marek vaccinated, were randomlyassigned to seven dietary treatments (5 pens per treatment/18 birds per pen. Chicks were floor housed, ad libitum fedisocaloric and isonitrogenous diets and had free access to water. Artificial light was provided 10 h/d. The bulk of the basediet (control diet was corn (48.7%, 56.6% and 57%, solvent-extracted soybean meal (42.8%, 37.3% and 33.4%, cornoil (4.4%, 5.2% and 6.3%, plus synthetic amino acids, minerals, trace minerals and vitamins, respectively for the 1-10d-old, 11-28d-old and 29 to 42d-old growing periods. The RP, RFb and RL entered diets in substitution of the soybeanand corn according to the cost optimization (P100, Fb100 and L100, respectively for RP, RFb and RL and at half of theoptimized quantity (RP50, RFb50 and RL50, respectively for RP, RFb and RL. The amount used as fed basis for the higherlevel of inclusion were: P100: 350 g/kg for all diets; Fb100: 480 g/kg (1-10d-old and 500 g/kg (11-42d-old; L100:360 g/kg (1-10d-old and 300 g/kg (11-42d-old. The average daily gain (ADG were lower (P compared to the control group. Over the whole period of growth, the RFb group had similar ADG compared to the controlgroup and for both levels of inclusion, whereas reduced (P (P growth. Birds performance was improved (P and breast and leg quarter cuts. The RFb and RL could represent valuable protein feeds in broilers diet formulation.

  5. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity.

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine; Chaillou, Stéphane

    2016-07-01

    Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in dietary salt intake

  6. Reducing Salt in Raw Pork Sausages Increases Spoilage and Correlates with Reduced Bacterial Diversity

    Science.gov (United States)

    Fougy, Lysiane; Desmonts, Marie-Hélène; Coeuret, Gwendoline; Fassel, Christine; Hamon, Erwann; Hézard, Bernard; Champomier-Vergès, Marie-Christine

    2016-01-01

    ABSTRACT Raw sausages are perishable foodstuffs; reducing their salt content raises questions about a possible increased spoilage of these products. In this study, we evaluated the influence of salt reduction (from 2.0% to 1.5% [wt/wt]), in combination with two types of packaging (modified atmosphere [50% mix of CO2-N2] and vacuum packaging), on the onset of spoilage and on the diversity of spoilage-associated bacteria. After 21 days of storage at 8°C, spoilage was easily observed, characterized by noticeable graying of the products and the production of gas and off-odors defined as rancid, sulfurous, or sour. At least one of these types of spoilage occurred in each sample, and the global spoilage intensity was more pronounced in samples stored under modified atmosphere than under vacuum packaging and in samples with the lower salt content. Metagenetic 16S rRNA pyrosequencing revealed that vacuum-packaged samples contained a higher total bacterial richness (n = 69 operational taxonomic units [OTUs]) than samples under the other packaging condition (n = 46 OTUs). The core community was composed of 6 OTUs (Lactobacillus sakei, Lactococcus piscium, Carnobacterium divergens, Carnobacterium maltaromaticum, Serratia proteamaculans, and Brochothrix thermosphacta), whereas 13 OTUs taxonomically assigned to the Enterobacteriaceae, Enterococcaceae, and Leuconostocaceae families comprised a less-abundant subpopulation. This subdominant community was significantly more abundant when 2.0% salt and vacuum packaging were used, and this correlated with a lower degree of spoilage. Our results demonstrate that salt reduction, particularly when it is combined with CO2-enriched packaging, promotes faster spoilage of raw sausages by lowering the overall bacterial diversity (both richness and evenness). IMPORTANCE Our study takes place in the context of raw meat product manufacturing and is linked to a requirement for salt reduction. Health guidelines are calling for a reduction in

  7. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  8. Data extraction from proteomics raw data

    DEFF Research Database (Denmark)

    Mancuso, Francesco; Bunkenborg, Jakob; Wierer, Michael

    2012-01-01

    In shot-gun proteomics raw tandem MS data are processed with extraction tools to produce condensed peak lists that can be uploaded to database search engines. Many extraction tools are available but to our knowledge, a systematic comparison of such tools has not yet been carried out. Using raw data...

  9. Meat, dairy, and cancer1234

    Science.gov (United States)

    Abid, Zaynah; Cross, Amanda J; Sinha, Rashmi

    2014-01-01

    In 2007 the World Cancer Research Fund and American Institute for Cancer Research (WCRF/AICR) report judged that the evidence for an association between red and processed meat consumption and colorectal cancer was convincing. In addition, the effect of other animal products on cancer risk has been studied, and the WCRF/AICR report concluded that milk probably decreases the risk of colorectal cancer but diets high in calcium probably increase the risk of prostate cancer, whereas there was limited evidence for an association between milk and bladder cancer and insufficient evidence for other cancers. There are several potential mechanisms relating meat to cancer, including heterocyclic amines, polycyclic aromatic hydrocarbons, N-nitroso compounds, and heme iron. Although the evidence in favor of a link between red and processed meat and colorectal cancer is convincing, the relations with other cancers are unclear. In this review, we summarize cohort studies conducted by the National Cancer Institute on meat and dairy intake in relation to cancer since the 2007 WCRF/AICR report. We also report the findings of meta-analyses published since 2007. PMID:24847855

  10. Clostridium difficile in Retail Meats

    Centers for Disease Control (CDC) Podcasts

    Clostridium difficile is a common cause of diarrhea in healthcare settings but little is known about what causes cases in the community. In this podcast, CDC's Dr. L. Clifford McDonald discusses two papers in the May 2009 edition of Emerging Infectious Diseases that explore whether the organism could be found in meat samples purchased in grocery stores in Arizona and Canada.

  11. High pressure processing of meat

    DEFF Research Database (Denmark)

    Grossi, Alberto; Christensen, Mette; Ertbjerg, Per

    the rheological properties of pork meat batters by inducing formation of protein gels. HP induced protein gels are suggested to be formed by high molecular weight myofibrillar protein aggregates and by peptides formed by lysosomal enzyme-induced cleavage of myofibrillar proteins. Perspectives: The data presented...

  12. Fetal programming in meat production.

    Science.gov (United States)

    Du, Min; Wang, Bo; Fu, Xing; Yang, Qiyuan; Zhu, Mei-Jun

    2015-11-01

    Nutrient fluctuations during the fetal stage affects fetal development, which has long-term impacts on the production efficiency and quality of meat. During the early development, a pool of mesenchymal progenitor cells proliferate and then diverge into either myogenic or adipogenic/fibrogenic lineages. Myogenic progenitor cells further develop into muscle fibers and satellite cells, while adipogenic/fibrogenic lineage cells develop into adipocytes, fibroblasts and resident fibro-adipogenic progenitor cells. Enhancing the proliferation and myogenic commitment of progenitor cells during fetal development enhances muscle growth and lean production in offspring. On the other hand, promoting the adipogenic differentiation of adipogenic/fibrogenic progenitor cells inside the muscle increases intramuscular adipocytes and reduces connective tissue, which improves meat marbling and tenderness. Available studies in mammalian livestock, including cattle, sheep and pigs, clearly show the link between maternal nutrition and the quantity and quality of meat production. Similarly, chicken muscle fibers develop before hatching and, thus, egg and yolk sizes and hatching temperature affect long-term growth performance and meat production of chicken. On the contrary, because fishes are able to generate new muscle fibers lifelong, the impact of early nutrition on fish growth performance is expected to be minor, which requires further studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Meeting the demand for meat?

    NARCIS (Netherlands)

    Yates-Doerr, E.

    2012-01-01

    Renewed fears expressed by the United Nations about worldwide population growth have coincided with international concerns about the increased consumption of meat. This article, which draws upon long-term fieldwork in the Guatemalan highlands and ongoing scientific research in the Netherlands,

  14. Toxinotyping and antimicrobial susceptibility of enterotoxigenic Clostridium perfringens isolates from mutton, beef and chicken meat.

    Science.gov (United States)

    Khan, Madiha; Nazir, Jawad; Anjum, Aftab Ahmad; Ahmad, Mansur-Ud-Din; Nawaz, Muhammad; Shabbir, Muhammad Zubair

    2015-08-01

    A total of 300 meat samples comprising mutton, beef, and chicken meat (n = 100) collected from either local butcher shops or large meat outlets situated at various areas of Lahore City located in Punjab province of Pakistan were tested for the isolation of Clostridium perfringens. Prevalence of the organism was highest in the chicken (6 %) followed by mutton (5 %) and beef (1 %). Contamination level was high (10/150) in the samples collected from local butcher shops in comparison to the samples collected from large meat outlets (2/150). All of the raw meat samples were negative for the presence of alpha, beta and epsilon toxins of C. perfringens as detected through ELISA. Out of a total number of 12 isolates only half were capable of producing enterotoxins when cultured in trypticase glucose yeast (TGY) broth. Toxinotyping of the isolates showed that 3 were of type A while one each of the remaining three belonged to type B, C, and D. Antibiotic susceptibility testing of the toxin producing isolates revealed that C. perfringens were susceptible to chloramphenicol, ciprofloxacin, metronidazole, and ceftriaxone. All of the other drugs were relatively less effective with a least activity of amoxicillin against the isolates.

  15. Prevalence and Antibiotic Susceptibility of Campylobacter species Isolated From Chicken and Beef Meat

    Directory of Open Access Journals (Sweden)

    Hossein Dabiri

    2014-05-01

    Full Text Available Background: To study prevalence of Campylobacter spp. in chicken and beef meat, and determine the drug susceptibility of strains, 450 samples in Tehran, Iran were investigated. Objectives: This study aimed to determine the prevalence and the antimicrobial resistance of entropathogenic Campylobacter strains ,especially C. jejuni isolated from raw chicken and beef meat in Tehran- Iran. Materials and Methods: Out of 250 chickens and 200 beef meats, 121(26.8 % contaminated cases with Campylobacter strains were isolated. Campylobacter was isolated from a significantly larger number of chickens (44% than beef meats (5.5 % (P < 0.05. Results: From all isolated Campylobacter organisms, 93 (76.8% species were identified as C. jejuni and 28 cases (23.1% as C. coli. Susceptibilities of 121 strains (93 C. jejuni and 28 C. coli were determined against 12 antimicrobial drugs using the disk agar diffusion method. Resistance to nalidixic acid (75% and ciprofloxacin (50% was an alarming finding, moreover, 32.6% of isolates was resistant to tetracycline, 10.8% to ampicillin, 29.3% to colisitin and 26.1% to amoxicillin. The highest sensitivity was seen to erythromycin (95 % and gentamicin (96%. Conclusions: These results showed that a high proportion of chicken and beef meat in Iran is contaminated with Campylobacter, particularly with Campylobacter jejuni. The high rate of contamination, especially chicken is a significant public health concern. Most of the isolates were resistant; therefore, human infection with Campylobacter spp. via consumption of these products is possible.

  16. Blood serum metabolites and meat quality in crossbred pigs experiencing different lairage time

    Directory of Open Access Journals (Sweden)

    Ivan Juric

    2010-01-01

    Full Text Available Pigs of two crosses: A (Duroc x Swedish Landrace x Pietrain (n=24 and B (Swedish Landrace x Large White x Pietrain (n=26 were used to investigate the effects of different lairage time (2 and 24 hours on levels of stress and meat quality traits. No direct effect of lairage time on cortisol, lactate, electrolytes and meat quality parameters was observed. However, after long lairage time, pigs showed lower level of glucose and higher CK, AST and ALT activity. Crossbred B pigs exposed to short lairage time, showed higher blood lactate, sodium, and potassium level, higher drip loss and lower pHi, whereas there were no significant differences between the crossbreeds in the long lairage group. The results indicate that long lairage time decreases blood glucose level and produces signs of muscle damage. In the short lairage period, the crossbreed B showed a higher response to pre-slaughter handling affecting the meat quality.

  17. Feasibility study about handling plant and logistics of rotted spruce for energy and pulpwood; Esiselvitys energia- ja teollisuuspuun kaesittelylaitteistosta ja logistiikasta

    Energy Technology Data Exchange (ETDEWEB)

    Laurila, P [Biowatti Oy, Espoo (Finland)

    1997-12-01

    The aim of this feasibility study is to clarify the handling demands, technical and logistical possibilities, profitabilities both outlays and benefits in combined energy- and pulpwood production from rotted spruce raw material. The results of the study will be taken into consideration, if a handling plant will be decided to build and demonstrate beside the Forssa biomass power plant. (orig.)

  18. [Control of toxicity of Sarcocystis fayeri in horsemeat by freezing treatment and prevention of food poisoning caused by raw consumption of horsemeat].

    Science.gov (United States)

    Harada, Seiya; Furukawa, Masato; Tokuoka, Eisuke; Matsumoto, Kazutoshi; Yahiro, Shunsuke; Miyasaka, Jiro; Saito, Morihiro; Kamata, Yoichi; Watanabe, Maiko; Irikura, Daisuke; Matsumoto, Hiroshi; Sugita-Konishi, Yoshiko

    2013-01-01

    More than 27 outbreaks per year of food poisoning caused by consuming horse meat were reported in Kumamoto Prefecture (including Kumamoto City) from January 2009 to September 2011. It was found that the causative agent of the outbreaks was a protein with a molecular weight of 15 kDa that had originated from bradyzoites of Sarcocystis fayeri parasitizing the horse meat. Rabit ileal loop tests showed that pepsin treatment of homogenates of frozen horse meat containing the cysts of S. fayeri induced loss of toxicity, presumably by digestion of the proteinous causative agent(s). Slices of horse meat containing the cysts were frozen at below -20°C for various periods. The cysts were collected after thawing the slices, then treated in an artificial stomach juice containing pepsin. The bradyzoites of the cysts kept at -20°C for 48 hr or more completely disappeared. Simultaneously, the 15 kDa protein also disappeared in the frozen cysts. After notifying the public and recommending freezing treatment of horse meat, no subsequent cases of food poisoning were reported. This indicates that freezing of horse meat is effective to prevent the occurrence of food poisoning caused by consuming raw horse meat containing S. fayeri.

  19. Asthma, guides for diagnostic and handling

    International Nuclear Information System (INIS)

    Salgado, Carlos E; Caballero A, Andres S; Garcia G, Elizabeth

    1999-01-01

    The paper defines the asthma, includes topics as diagnostic, handling of the asthma, special situations as asthma and pregnancy, handling of the asthmatic patient's perioperatory and occupational asthma

  20. SRV-automatic handling device

    International Nuclear Information System (INIS)

    Yamada, Koji

    1987-01-01

    Automatic handling device for the steam relief valves (SRV's) is developed in order to achieve a decrease in exposure of workers, increase in availability factor, improvement in reliability, improvement in safety of operation, and labor saving. A survey is made during a periodical inspection to examine the actual SVR handling operation. An SRV automatic handling device consists of four components: conveyor, armed conveyor, lifting machine, and control/monitoring system. The conveyor is so designed that the existing I-rail installed in the containment vessel can be used without any modification. This is employed for conveying an SRV along the rail. The armed conveyor, designed for a box rail, is used for an SRV installed away from the rail. By using the lifting machine, an SRV installed away from the I-rail is brought to a spot just below the rail so that the SRV can be transferred by the conveyor. The control/monitoring system consists of a control computer, operation panel, TV monitor and annunciator. The SRV handling device is operated by remote control from a control room. A trial equipment is constructed and performance/function testing is carried out using actual SRV's. As a result, is it shown that the SRV handling device requires only two operators to serve satisfactorily. The required time for removal and replacement of one SRV is about 10 minutes. (Nogami, K.)

  1. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  2. Salmonella in meats, water, fruit and vegetables as disclosed from testing undertaken by Food Business Operators in Ireland from 2005 to 2009

    Directory of Open Access Journals (Sweden)

    Duggan Sharon

    2012-09-01

    Full Text Available Abstract Food Business Operators (FBO are responsible for the safety of the food they produce and in Ireland those under the regulatory control of the Department of Agriculture, Food and Marine are required to provide summary data on microbiological tests undertaken as part of their food safety controls. These data are provided to the National Reference Laboratory through the 25 private laboratories undertaking the testing. Results Over the five-year period Salmonella sp. was isolated from 0.7% of the 254,000 raw meat or raw meat products tested with the annual prevalence ranging from 0.5 to 1.1%. Poultry meats were consistently more contaminated than other meats with higher recovery rates in turkey (3.3%, duck (3.3%, and chicken (2.5% compared with meats of porcine (1.6%, ovine (0.2% and bovine origin (0.1%. Salmonella sp. was also isolated from 58 (0.06% of the 96,115 cooked or partially cooked meat and meat products tested during the reporting period with the annual percentage positive samples ranging from 0.01 to 0.16%. A total of 50 different serotypes were recovered from raw meats over this period with the greatest diversity found in poultry samples (n = 36. Four serotypes, Kentucky, Typhimurium, Agona and Derby accounted for over 70% of all isolates detected on FBO testing over the period 2005 to 2009. Conclusions Capturing microbiological data generated by Food Business Operators allows the regulatory sector access to a substantial amount of valuable data with the minimum financial outlay.

  3. Effect of radiation processing on meat tenderisation

    Science.gov (United States)

    Kanatt, Sweetie R.; Chawla, S. P.; Sharma, Arun

    2015-06-01

    The effect of radiation processing (0, 2.5, 5 and 10 kGy) on the tenderness of three types of popularly consumed meat in India namely chicken, lamb and buffalo was investigated. In irradiated meat samples dose dependant reduction in water holding capacity, cooking yield and shear force was observed. Reduction in shear force upon radiation processing was more pronounced in buffalo meat. Protein and collagen solubility as well as TCA soluble protein content increased on irradiation. Radiation processing of meat samples resulted in some change in colour of meat. Results suggested that irradiation leads to dose dependant tenderization of meat. Radiation processing of meat at a dose of 2.5 kGy improved its texture and had acceptable odour.

  4. Influence of raw milk quality on processed dairy products: How do raw milk quality test results relate to product quality and yield?

    Science.gov (United States)

    Murphy, Steven C; Martin, Nicole H; Barbano, David M; Wiedmann, Martin

    2016-12-01

    This article provides an overview of the influence of raw milk quality on the quality of processed dairy products and offers a perspective on the merits of investing in quality. Dairy farmers are frequently offered monetary premium incentives to provide high-quality milk to processors. These incentives are most often based on raw milk somatic cell and bacteria count levels well below the regulatory public health-based limits. Justification for these incentive payments can be based on improved processed product quality and manufacturing efficiencies that provide the processor with a return on their investment for high-quality raw milk. In some cases, this return on investment is difficult to measure. Raw milks with high levels of somatic cells and bacteria are associated with increased enzyme activity that can result in product defects. Use of raw milk with somatic cell counts >100,000cells/mL has been shown to reduce cheese yields, and higher levels, generally >400,000 cells/mL, have been associated with textural and flavor defects in cheese and other products. Although most research indicates that fairly high total bacteria counts (>1,000,000 cfu/mL) in raw milk are needed to cause defects in most processed dairy products, receiving high-quality milk from the farm allows some flexibility for handling raw milk, which can increase efficiencies and reduce the risk of raw milk reaching bacterial levels of concern. Monitoring total bacterial numbers in regard to raw milk quality is imperative, but determining levels of specific types of bacteria present has gained increasing importance. For example, spores of certain spore-forming bacteria present in raw milk at very low levels (e.g., products to levels that result in defects. With the exception of meeting product specifications often required for milk powders, testing for specific spore-forming groups is currently not used in quality incentive programs in the United States but is used in other countries (e.g., the

  5. Nutritional evaluation of lowering consumption of meat and meat products in the Nordic context

    DEFF Research Database (Denmark)

    Tetens, Inge; Hoppe, Camilla; Frost Andersen, Lene

    The World Cancer Research Fund (WCRF) recommended in 2007 that consumer intake of red meat is minimized and processed meat eliminated. The recommendation was based on a systematic review of the available literature on the association between meat consumption and cancer. The recommendation...... to individuals was to ingest less than 500 grams of red meat per weeks, and very little - if anything - processed meats. In a new study, National Food Institute has assessed the nutritional consequences from living the recommendations of the WCRF, in Norway, Sweden, Finland and Denmark. The current consumption...... of meat in the Nordic countries is not far from the level WCRF has proposed on an individual level. The study also shows that it will have no significant nutritional consequences to reduce the intake of meat to the recommended, neither when it comes to red meat nor processed meat....

  6. Handling of waste in ports

    International Nuclear Information System (INIS)

    Olson, P.H.

    1994-01-01

    The regulations governing the handling of port-generated waste are often national and/or local legislation, whereas the handling of ship-generated waste is governed by the MARPOL Convention in most parts of the world. The handling of waste consists of two main phases -collection and treatment. Waste has to be collected in every port and on board every ship, whereas generally only some wastes are treated and to a certain degree in ports and on board ships. This paper considers the different kinds of waste generated in both ports and on board ships, where and how it is generated, how it could be collected and treated. The two sources are treated together to show how some ship-generated waste may be treated in port installations primarily constructed for the treatment of the port-generated waste, making integrated use of the available treatment facilities. (author)

  7. Of Meat and Men: Sex Differences in Implicit and Explicit Attitudes Toward Meat

    Directory of Open Access Journals (Sweden)

    Hamish J. Love

    2018-04-01

    Full Text Available Modern attitudes to meat in both men and women reflect a strong meat-masculinity association. Sex differences in the relationship between meat and masculinity have not been previously explored. In the current study we used two IATs (implicit association tasks, a visual search task, and a questionnaire to measure implicit and explicit attitudes toward meat in men and women. Men exhibited stronger implicit associations between meat and healthiness than did women, but both sexes associated meat more strongly with ‘healthy’ than ‘unhealthy’ concepts. As ‘healthy’ was operationalized in the current study using terms such as “virile” and “powerful,” this suggests that a meat-strength/power association may mediate the meat-masculinity link readily observed across western cultures. The sex difference was not related to explicit attitudes to meat, nor was it attributable to a variety of other factors, such as a generally more positive disposition toward meat in men than women. Men also exhibited an attention bias toward meats, compared to non-meat foods, while females exhibited more caution when searching for non-meat foods, compared to meat. These biases were not related to implicit attitudes, but did tend to increase with increasing hunger levels. Potential ultimate explanations for these differences, including sex differences in bio-physiological needs and receptivity to social signals are discussed.

  8. Effect of direct adding oregano essential oil (Origanum syriacum L.) on quality and stability of chicken meat patties

    OpenAIRE

    AL-HIJAZEEN, Marwan

    2017-01-01

    Abstract Evaluate of Origanum syriacum L. essential oil grown in Jordan, and other comparable antioxidant on TBARS, total carbonyl, color values, and sensory attributes of raw chicken meat was investigated. Six treatments were prepared: (1) control (no additive); (2) 100 ppm oregano essential oil (OE); (3) 150 ppm OE; (4) 300 ppm L-ascorbic acid (E-300); (5) 5 and 14 ppm butylatedhydroxyanisole (BHA/E-320) for both breast and thigh meat respectively, and 6) 150 ppm Sodium nitrite (E-250), wer...

  9. Organic beef production by Maremmana breed: qualitative meat characteristics

    OpenAIRE

    Mele, Prof. Marcello; Morbidini, Prof. Luciano; Cozza, Dr. Francesca; Pauselli, Prof. Mariano; Pollicardo, Dr. Alice

    2008-01-01

    Meat quality of Maremmana young bulls and steers was evaluated during three consecutive years, according to an extension service experimental program. Cooking loss values of meat samples were lower in meat from steers, whereas shear force values were higher. Meat from steers was darker than meat from young bulls, as a consequence of a low level of Lightness and a high level of Chroma. Meat chemical composition showed a higher content of intramuscular fat in steer meat, which showed also a low...

  10. Control of salmonella in meat and meat products by irradiation

    International Nuclear Information System (INIS)

    Dempster, J.F.

    1985-01-01

    This paper highlights the importance of food irradiation in the protection of the public against food poisoning from eating meat or meat products contaminated with salmonella. Salmonella infections are increasing at an alarming rate (2000 in 1952 to 12000 reported cases in 1982 in England and Wales alone). Dr. Dempster reports that 50% of the chicken carcasses examined by workers in America were found to be salmonella contaminated. Use of irradiation in conjunction with mild refrigeration can extend the shelf-life of vacuum packed chicken by a factor of three. Important legislation now under discussion in the U.S.A. is likely to extend the applicability of food irradiation rapidly in the near future

  11. Bacteriophages safely reduce Salmonella contamination in pet food and raw pet food ingredients.

    Science.gov (United States)

    Soffer, Nitzan; Abuladze, Tamar; Woolston, Joelle; Li, Manrong; Hanna, Leigh Farris; Heyse, Serena; Charbonneau, Duane; Sulakvelidze, Alexander

    2016-01-01

    Contamination of pet food with Salmonella is a serious public health concern, and several disease outbreaks have recently occurred due to human exposure to Salmonella tainted pet food. The problem is especially challenging for raw pet foods (which include raw meats, seafood, fruits, and vegetables). These foods are becoming increasingly popular because of their nutritional qualities, but they are also more difficult to maintain Salmonella -free because they lack heat-treatment. Among various methods examined to improve the safety of pet foods (including raw pet food), one intriguing approach is to use bacteriophages to specifically kill Salmonella serotypes. At least 2 phage preparations (SalmoFresh® and Salmonelex™) targeting Salmonella are already FDA cleared for commercial applications to improve the safety of human foods. However, similar preparations are not yet available for pet food applications. Here, we report the results of evaluating one such preparation (SalmoLyse®) in reducing Salmonella levels in various raw pet food ingredients (chicken, tuna, turkey, cantaloupe, and lettuce). Application of SalmoLyse® in low (ca. 2-4×10 6 PFU/g) and standard (ca. 9×10 6 PFU/g) concentrations significantly ( P contamination in all raw foods examined compared to control treatments. When SalmoLyse®-treated (ca. 2×10 7 PFU/g) dry pet food was fed to cats and dogs, it did not trigger any deleterious side effects in the pets. Our data suggest that the bacteriophage cocktail lytic for Salmonella can significantly and safely reduce Salmonella contamination in various raw pet food ingredients.

  12. Immunofluorescent determination of wheat protein in meat products

    Directory of Open Access Journals (Sweden)

    Michaela Petrášová

    2014-02-01

    Full Text Available In food industry nowadays, there are various plant-origin protein additives which are meant for production of meat products. Among the most frequent additives of this type there are different kinds of flour, starch, fiber, and plant-origin proteins. Their usage at present is limited by the existing legislation not to prevent consumer deception but also for reasons of possible influence on consumer health. Therefore, this problem is paid a lot of attention not only in the Czech Republic but also all over the world. The main risk is seen in the impossibility to choose a suitable foodstuff for an individual prone to allergic reactions. Potential allergens are also often plant-origin raw materials which are added into foodstuffs for their technological qualities and low price. Wheat is widely cultivated cereal as well as an important source of proteins. After ingestion or inhalation, wheat proteins may cause adverse reactions. These adverse effects include a wide range of disorders which are dependent on the method of contact with wheat protein. These adverse effects can then take the form of various clinical manifestations, such as celiac disease, T-cell mediated inflammatory bowel disease, dermatitis, skin rash, breathing difficulties, allergy to pollen or to wheat flour or food allergy to foodstuffs containing gluten. The only possible protection against adverse immune reactions for those with food allergies is strictly excluding the allergen from their diet. Although the number of studies dealing with the reduction or loss of allergenicity is increasing, yet these practices are not common. Most of the population suffering from food allergies is thus still dependent on strict exclusion of foodstuffs causing adverse allergic reactions from their diet. In order to avoid misleading consumers and also to protect allergic consumers, analytical methods applicable to all types of foodstuffs have been developed. Unfortunately, detection of allergens in

  13. Knowledge and Attitudes towards Handling Eggs in the Home: An Unexplored Food Safety Issue?

    Directory of Open Access Journals (Sweden)

    Harriet Whiley

    2017-01-01

    Full Text Available Foodborne illness is a global public health issue, with food handling in the home identified as an underestimated source. In Australia, there has been a significant increase in the incidence of salmonellosis with the majority of outbreaks linked to eggs. This study investigated Australian eggs consumer attitudes, behaviours and risk perceptions associated with the handling of raw eggs in the home. It was identified that 67% of participants chose free range eggs, 11% kept poultry, 7% did not have any preference, 7% cage eggs, 4% barn eggs, 2% organic eggs and 1% pasteurized eggs. The majority of participants (91% reported they stored eggs in the fridge. It was identified that there is an underestimation of “risky behaviour” associated with the consumption of raw eggs in the home, as 84% of participants indicated that they did not consume raw eggs, but subsequently 86% indicated that they had eaten mixture/batter containing raw eggs. Participants’ responses relating to food safety were also examined in relation to their profession and gender. Safer food handling practices were identified by Environmental Health Officers (EHO and Food handlers compared to all other professions (p < 0.05. However, the gender of participants did not significantly affect (p > 0.05 their responses.

  14. Knowledge and Attitudes towards Handling Eggs in the Home: An Unexplored Food Safety Issue?

    Science.gov (United States)

    Whiley, Harriet; Clarke, Beverley; Ross, Kirstin

    2017-01-06

    Foodborne illness is a global public health issue, with food handling in the home identified as an underestimated source. In Australia, there has been a significant increase in the incidence of salmonellosis with the majority of outbreaks linked to eggs. This study investigated Australian eggs consumer attitudes, behaviours and risk perceptions associated with the handling of raw eggs in the home. It was identified that 67% of participants chose free range eggs, 11% kept poultry, 7% did not have any preference, 7% cage eggs, 4% barn eggs, 2% organic eggs and 1% pasteurized eggs. The majority of participants (91%) reported they stored eggs in the fridge. It was identified that there is an underestimation of "risky behaviour" associated with the consumption of raw eggs in the home, as 84% of participants indicated that they did not consume raw eggs, but subsequently 86% indicated that they had eaten mixture/batter containing raw eggs. Participants' responses relating to food safety were also examined in relation to their profession and gender. Safer food handling practices were identified by Environmental Health Officers (EHO) and Food handlers compared to all other professions ( p 0.05) their responses.

  15. Raw materials policy: implications for Germany

    Energy Technology Data Exchange (ETDEWEB)

    Gaertner, E

    1978-04-01

    The contribution characterizes the situation of the national mining industry in 1977, deals with international raw materials policies within the framework of the North-South dialogue and with the policies of the western industrial countries, points out the dangers of worldwide state-controlled raw materials policies and calls for a) the political risk of enterprise cooperation with developing countries to be covered and b) double taxation to be avoided. Finally, the problems of securing the Federal Republic of Germany's raw materials supplies on a long-term basis are portrayed.

  16. Characteristics and consumer acceptance of healthier meat and meat product formulations-a review.

    Science.gov (United States)

    Hathwar, Swapna C; Rai, Amit Kumar; Modi, Vinod Kumar; Narayan, Bhaskar

    2012-12-01

    Awareness of health and nutrition has led to the development of "functional foods" which is a new approach to achieve healthier status thus reducing the risk of diseases. Meat has been highly exploited as a functional ingredient/food in recent years wherein meat has either been modified or incorporated into non meat products. Changing consumer demand has influenced the market for all types of meat. The development and marketing the functional foods can be, however, very challenging compared to the foods that conventionally have a high health image. This review gives the overall perception about importance of using meat/meat products as a functional food.

  17. [Proximal chemical composition and functional properties of fresh meat of crab claws (Homalaspis plana)].

    Science.gov (United States)

    Abugoch, L; Barrios, J; Guarda, A

    1996-12-01

    The research of alternative technological processes is being necessary in order to obtain a better utilization of hydrobiologic resources and food products, with higher added value. Crab (Homolaspis plana) is a crustacean found along the Chilean coast, whose flesh is exported as a frozen product. The resource crab is scantly studied in Chile and could became an excellent raw material for "delicatessen" products, with a high market value. The proximal composition, through the protein, fat, moisture and ashes content was determined. The non nitrogen extract was calculated by difference. The functional properties (water retention, emulsifying and gel-forming capacities) of fresh crab claws meat without additives were measured. The proximal composition for the claw meat was: 79,34 +/- 1.12% moisture, 16.75 +/- 1.29% protein, 1.86 +/- 0.11% ashes, 0.11 +/- 0.01 fat % and 1.93 +/- 1.07% N.N.E. In relation with the emulsifying capacity, claw meat was able to emulsify 2,259.03 +/- 73.04 g vegetal oil/g protein. The water retention was 154.49 +/- 6.85% representing the increase in mass percent; and the force of the gel formed in claw meat was 195.3 +/- 17.16 g-force x cm. According to these results, the claw crab is an attractive food, with a high protein and low fat content. Crab meat showed an excellent emulsifying capacity and water retention, so it can be used as a good raw material for the development of smearing products. In the case of gel-like products, further studies will be required, in order to optimize the conditions in which a stronger gel could be obtained.

  18. Developments and competitiveness of Mozambican chicken meat industry

    Directory of Open Access Journals (Sweden)

    Carlos Alberto de Oliveira

    2015-12-01

    Full Text Available Mozambican poultry industry might be an option to facilitate people's access to animal protein, as well as to reduce the dependence on imports of the product, bringing jobs and income forth. This study aimed to characterize and to analyze the competitiveness of poultry industry in Mozambique. Porter’s Five Forces Model, which focuses on the five strengths that shape business competition, was applied. The results show a low level of competition within the industry, a limited supply of raw material and the fact that national products are commodities and competes with strong foreign participants. Domestic demand for chicken meat is increasing, but buyers base their decision mainly on price. Challenges include establishment of governance structure and policies for poultry sector and consumer welfare. Another alternative to improve the poultry industry in Mozambique is to promote technical cooperation with other countries, such as Brazil, in order to acquire specific structures for chicken production, genetic material and adequate nutrition.

  19. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  20. Software for handling MFME1

    International Nuclear Information System (INIS)

    Van der Merwe, W.G.

    1984-01-01

    The report deals with SEMFIP, a computer code for determining magnetic field measurements. The program is written in FORTRAN and ASSEMBLER. The preparations for establishing SEMFIP, the actual measurements, data handling and the problems that were experienced are discussed. Details on the computer code are supplied in an appendix

  1. Welding method by remote handling

    International Nuclear Information System (INIS)

    Hashinokuchi, Minoru.

    1994-01-01

    Water is charged into a pit (or a water reservoir) and an article to be welded is placed on a support in the pit by remote handling. A steel plate is disposed so as to cover the article to be welded by remote handling. The welding device is positioned to the portion to be welded and fixed in a state where the article to be welded is shielded from radiation by water and the steel plate. Water in the pit is drained till the portion to be welded is exposed to the atmosphere. Then, welding is conducted. After completion of the welding, water is charged again to the pit and the welding device and fixing jigs are decomposed in a state where the article to be welded is shielded again from radiation by water and the steel plate. Subsequently, the steel plate is removed by remote handling. Then, the article to be welded is returned from the pit to a temporary placing pool by remote handling. This can reduce operator's exposure. Further, since the amount of the shielding materials can be minimized, the amount of radioactive wastes can be decreased. (I.N.)

  2. Raw oysters can be a risk for infections

    Directory of Open Access Journals (Sweden)

    Regine Helena Silva dos Fernandes Vieira

    Full Text Available The aims of this study were to count and identify sucrose positive and negative vibrios isolated from cultivated Crassostrea rhizophorae oysters during their growing cycle. Every month for 12 months, 10 to 18 oysters were collected for study. Collections occurred at the Center for Studies of Coastal Aquaculture (CSCA, which is associated with the Institute of Marine Science, Labomar, located in Euzebio, Ceará, Brazil. Approximately 150 oysters and their intervalvular liquor were studied. Vibrio Standard Plates Counts (SPC from oyster meat and their intervalvular liquor varied from 25 to 59,000,000 CFU/g. For most of the 12 months of the oysters' life, it was possible to identify Vibrio parahaemolyticus. Vibrio carchariae was identified in four collections. Among other isolated species, the most important, considering public health risks, was V. vulnificus, although only one strain was confirmed. We concluded that retail purchased oysters should never be eaten raw or undercooked because many species of the genus Vibrio are known to be pathogenic to humans and live naturally on and in shellfish throughout their life cycle.

  3. Concentrations of environmental organic contaminants in meat and meat products and human dietary exposure: A review.

    Science.gov (United States)

    Domingo, José L

    2017-09-01

    Meat and meat products is one of the most relevant food groups in an important number of human diets. Recently, the IARC, based on results of a number of epidemiological studies, classified the consumptions of red meat and processed meat as "probably carcinogenic to humans" and as "carcinogenic to humans", respectively. It was suggested that the substances responsible of the potential carcinogenicity would be mainly generated during meat processing, such as curing and smoking, or when meat is heated at high temperatures. However, the exposure to environmental pollutants through meat consumption was not discussed. The purpose of the present paper was to review recent studies reporting the concentrations of PCDD/Fs, DL-PCBs and PAHs in meat and meat products, as well as the human exposure to these pollutants through the diet. It is concluded that the health risks derived from exposure to carcinogenic environmental contaminants must be considered in the context of each specific diet, which besides meat and meat products, includes other foodstuffs containing also chemical pollutants, some of them with carcinogenic potential. Anyhow, meat and meat products are not the main food group responsible of the dietary exposure to carcinogenic (or probably carcinogenic) environmental organic pollutants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Quality quantification model of basic raw materials

    Directory of Open Access Journals (Sweden)

    Š. Vilamová

    2016-07-01

    Full Text Available Basic raw materials belong to the key input sources in the production of pig iron. The properties of basic raw materials can be evaluated using a variety of criteria. The essential ones include the physical and chemical properties. Current competitive pressures, however, force the producers of iron more and more often to include cost and logistic criteria into the decision-making process. In this area, however, they are facing a problem of how to convert a variety of vastly different parameters into one evaluation indicator in order to compare the available raw materials. This article deals with the analysis of a model created to evaluate the basic raw materials, which was designed as part of the research.

  5. raw data collected from Malvern Instrument

    Data.gov (United States)

    U.S. Environmental Protection Agency — These are raw data/image files from the Malvern Zetasizer Instrument. This dataset is associated with the following publication: Buse, H., J. Hoelle, C. Muhlen, and...

  6. Annual report 1997. Energies and raw materials

    International Nuclear Information System (INIS)

    1997-01-01

    This report gives the important directions of French energy policy. Nuclear energy, electric power, natural gas, coal and petroleum products are reviewed. The situations and the forecasting for raw materials are also given. (N.C.)

  7. Aluminium reprocessing with local mineral raw material

    International Nuclear Information System (INIS)

    Mirsaidov, U.M.

    2002-01-01

    With the purpose of utilization of ice sediment, receiving from mud fields solutions and flotation tails and at using local aluminium and fluorine-containing raw material was elaborated fundamental technologic scheme presented in this chapter of book

  8. Meat-based enteral nutrition

    Science.gov (United States)

    Derevitskay, O. K.; Dydykin, A. S.

    2017-09-01

    Enteral nutrition is widely used in hospitals as a means of nutritional support and therapy for different diseases. Enteral nutrition must fulfil the energy needs of the body, be balanced by the nutrient composition and meet patient’s nutritional needs. Meat is a source of full-value animal protein, vitamins and minerals. On the basis of this research, recipes and technology for a meat-based enteral nutrition product were developed. The product is a ready-to-eat sterilised mixture in the form of a liquid homogeneous mass, which is of full value in terms of composition and enriched with vitamins and minerals, consists of particles with a size of not more than 0.3 mm and has the modified fat composition and rheological characteristics that are necessary for passage through enteral feeding tubes. The study presents experimental data on the content of the main macro- and micro-nutrients in the developed product. The new product is characterised by a balanced fatty acid composition, which plays an important role in correction of lipid metabolism disorders and protein-energy deficiency, and it is capable of satisfying patients’ daily requirements for vitamins and the main macro- and microelements when consuming 1500-2000 ml. Meat-based enteral nutrition can be used in diets as a standard mixture for effective correction of the energy and anabolic requirements of the body and support of the nutritional status of patients, including those with operated stomach syndrome.

  9. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov

    2014-03-01

    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  10. Effect of storage and cooking on the fatty acid profile of omega-3 enriched eggs and pork meat marketed in Belgium.

    Science.gov (United States)

    Douny, Caroline; El Khoury, Rawad; Delmelle, Julien; Brose, François; Degand, Guy; Moula, Nassim; Farnir, Frédéric; Clinquart, Antoine; Maghuin-Rogister, Guy; Scippo, Marie-Louise

    2015-03-01

    The fatty acids (FA) profile was determined in n-3 enriched (Columbus™) Belgian eggs and pork in order to evaluate to what extent the n-3 fatty acids, which are very sensitive to oxidation, are resistant to storage or cooking. In standard eggs or pork, no change of the fatty acid profile was observed after storage or cooking without culinary fat, as well as in Columbus™ eggs and pork after storage. Some cooking processes (eggs in custard and meat in oven) induced a slight significant loss of n-3 fatty acids in Columbus™ eggs or pork (11.1% in fat from eggs cooked in custard vs. 15.3% in raw Columbus™ eggs and 11.0% in fat from oven cooked meat vs. 11.6% in raw Columbus™ meat). As expected, when Columbus™ pork is cooked with culinary fat, its fatty acid profile is modified according to the nature of the fat used.

  11. MANU. Handling of bentonite prior buffer block manufacturing

    International Nuclear Information System (INIS)

    Laaksonen, R.

    2010-01-01

    The aim of this study is to describe the entire bentonite handling process starting from freight from harbour to storage facility and ending up to the manufacturing filling process of the bentonite block moulds. This work describes the bentonite handling prior to the process in which bentonite blocks are manufactured in great quantities. This work included a study of relevant Nordic and international well documented cases of storage, processing and techniques involving bentonite material. Information about storage and handling processes from producers or re-sellers of bentonite was collected while keeping in mind the requirements coming from the Posiva side. Also a limited experiment was made for humidification of different material types. This work includes a detailed description of methods and equipment needed for bentonite storage and processing. Posiva Oy used Jauhetekniikka Oy as a consultant to prepare handling process flow charts for bentonite. Jauhetekniikka Oy also evaluated the content of this report. The handling of bentonite was based on the assumption that bentonite process work is done in one factory for 11 months of work time while the weekly volume is around 41-45 tons. Storage space needed in this case is about 300 tons of bentonite which equals about seven weeks of raw material consumption. This work concluded several things to be carefully considered: sampling at various phases of the process, the air quality at the production/storage facilities (humidity and temperature), the level of automation/process control of the manufacturing process and the means of producing/saving data from different phases of the process. (orig.)

  12. Plastic raw materials in Neolithic pottery production

    Directory of Open Access Journals (Sweden)

    Alexander A. Bobrinsky

    2012-12-01

    Full Text Available The paper is dedicated to the investigation of various natural silts as the most ancient type of raw material used in pottery production. The authors describe the specific features of the composition of plain and mountain silts, and discover the same features in ancient ceramics from different regions in Russia. It can be concluded that silts were the earliest raw material used, a tradition that faded away during the evolution of pottery production.

  13. Price stabilization for raw jute in Bangladesh

    OpenAIRE

    Takamasa Akiyama; Varangis, Panos

    1991-01-01

    Fluctuating prices for raw jute have been viewed as contributing to economic problems in the jute subsector. Price fluctuations were thought to reduce the jute farmers'welfare and there has been concern about the costs of parastatals'stocking operations in attempts to stabilize jute prices and incomes. The authors examine these fluctuations and analyze policies that might reduce them. They find that price fluctuations for raw jute reduce farmers'welfare only slightly because farmers'activitie...

  14. The Influence of Moderate Pressure and Subzero Temperature on the Shelf Life of Minced Cod, Salmon, Pork and Beef Meat

    Directory of Open Access Journals (Sweden)

    Ilona Kołodziejska

    2013-01-01

    Full Text Available The effect of moderate pressure at subzero temperature on natural microflora of minced cod, salmon, pork and beef meat was studied. Pressure of 193 MPa at –20 °C caused the reduction of total bacterial count in pork and beef meat by 1.1 and 0.6 log cycles, respectively, and by about 1.5 log cycles in fish meat. Under these conditions the psychrophilic and psychrotrophic bacteria were below the detection limit (<10 CFU/g of sample in pork and beef meat, while in cod and salmon meat they were reduced only by 1.3 and 2.0 log cycles, respectively. In all tested samples of meat treated with the pressure of 193 MPa at –20 °C, the number of coliforms was below 10 CFU/g. Under these conditions a significant reduction in the number of coagulase-positive Staphylococcus was also observed. During storage of samples at 4 °C after pressurization at 193 MPa and –20 °C, the inhibition of growth of all tested groups of bacteria was observed. Moderate pressure at subzero temperature does not ensure complete inactivation of bacteria; however, it allows the improvement of microbiological quality and extension of shelf life of food, which depends on the level of bacterial contamination of the initial raw material.

  15. Isolation of Toxoplasma gondii from horse meat in Egypt.

    Science.gov (United States)

    Shaapan, R M; Ghazy, A A

    2007-01-01

    Portions of heart, liver, skeletal and diaphragmatic muscles obtained from 150 slaughtered horses at Giza-Zoo abattoir were used for bioassays in mice and cats. T. gondii tachyzoites were isolated successfully from the peritoneal exudates of the inoculated mice 6-8 days post inoculation with pooled horse tissues. Whereas, T. gondii tissue cysts containing bradyzoites were detected in the impression smears of mice brain on the 45th days or more post infection. The oocysts were detected in feces of cats 3-6 days post feeding on horse tissues containing tissue cysts. The oocysts became sporulated within 3-5 days in 2.5% Potassium dichromate. A total of 79 out of 150 horse meat samples were found to be infected with an incidence rate of 52.6 %. This is the first trial for isolation of T. gondii infective stages from horses in Egypt. Moreover, this study pointed out to the high infection rate of T. gondii in horse meat which may be considered as an important source of infection to wild zoo-animals in Egypt and humans in some countries if consumed raw or insufficiently cooked.

  16. The complete raw workflow guide how to get the most from your raw images in Adobe Camera Raw, Lightroom, Photoshop, and Elements

    CERN Document Server

    Andrews, Philip

    2007-01-01

    One of the most important technologies a photographer can master is shooting and working with raw images. However, figuring out the best way to work with raw files can be confusing and overwhelming. What's the advantage to working in raw? How do you manage, organize, and store raw files? What's the best way to process your files to meet your photographic needs? How do Photoshop, Lightroom and Adobe Camera Raw work together? Is it possible to keep your photos in the raw format and still enhance them extensively? Philip Andrews answers these questions and more in his all-new essential raw workfl

  17. The Ethics of Producing In Vitro Meat.

    Science.gov (United States)

    Schaefer, G Owen; Savulescu, Julian

    2014-05-01

    The prospect of consumable meat produced in a laboratory setting without the need to raise and slaughter animals is both realistic and exciting. Not only could such in vitro meat become popular due to potential cost savings, but it also avoids many of the ethical and environmental problems with traditional meat productions. However, as with any new technology, in vitro meat is likely to face some detractors. We examine in detail three potential objections: 1) in vitro meat is disrespectful, either to nature or to animals; 2) it will reduce the number of happy animals in the world; and 3) it will open the door to cannibalism. While each objection has some attraction, we ultimately find that all can be overcome. The upshot is that in vitro meat production is generally permissible and, especially for ethical vegetarians, worth promoting.

  18. Meat and colo-rectal cancer.

    Science.gov (United States)

    Hill, M J

    1999-05-01

    In early epidemiological studies of diet and cancer the stress was on the search for causal factors. Population (ecological) studies tended to show a strong correlation between meat intake, particularly red meat, and the risk of colo-rectal cancer. They also tended to show meat to be strongly inversely correlated with cancers of the stomach and oesophagus and liver. Early case-control studies tended to support the postulated role for red meat in colo-rectal carcinogenesis, although more recent case-control studies, particularly those from Europe, have tended to show no relationship. The cohort studies in general failed to detect any relationship between meat intake and colo-rectal cancer risk. The available evidence points to the intake of protective factors such as vegetables and whole-grain cereals being the main determinants of colo-rectal cancer risk, with meat intake only coincidentally related.

  19. Introducing the new meat. Problems and prospects

    Directory of Open Access Journals (Sweden)

    Stellan Welin

    2013-05-01

    Full Text Available Cultured meat, or in vitro meat, is one of the ideas that are being proposed to help solve the problems associated with the ever-growing global meat consumption. The prospect may bring benefit for the environment, climate, and animal ethics, but has also generated doubts and criticism. A discussion of the possible environmental benefit and of animal ethics issues in relation to cultured meat production will be given. A perceived 'unnaturalness' of cultured meat may be one of the strongest barriers for public acceptance. This will be discussed and rejected. As to our relations with nature and animals, it is plausible that cultured meat will lead to improvement rather than to deterioration. The issue of public acceptance and some of the problems of introducing this new product on the market will also be discussed.http://dx.doi.org/10.5324/eip.v7i1.1788

  20. Efficiency of raw materials. Relief of the economy, environmental protection; Rohstoffeffizienz. Wirtschaft entlasten, Umwelt schonen

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-11-15

    In the contribution under consideration, the Federal Statistical Office (Wiesbaden, Federal Republic of Germany) and the Federal Environmental Agency (Dessau-Rosslau, Federal Republic of Germany) present actual data and analyses from environmentally economic total computations. In Germany, the use of raw materials became more efficient. Thus, 580 tons of raw materials per million Euro of gross domestic product were needed in the year 2008, while still 680 tons of raw materials were needed in the year 2000. The economical handling of natural resources relieves the environment and enables economic chances for individual companies and national economy. The lowering of environmental effects is to be in the focus of withdrawal and use of raw materials. This requires a stronger reduction of the consumption of raw materials. Savings potentials and an increased efficiency must be aspired in the short and medium term. The politics must create suitable incentives and framework conditions. The contribution under consideration presents new activities and strategies in order to achieve these targets.