Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy
2011-01-01
Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.
Methods and Strategies for Overvoltage Prevention in Low Voltage Distribution Systems with PV
DEFF Research Database (Denmark)
Hashemi Toghroljerdi, Seyedmostafa; Østergaard, Jacob
2016-01-01
to handle a high share of PV power. This paper provides an in-depth review of methods and strategies proposed to prevent overvoltage in LV grids with PV, and discusses the effectiveness, advantages, and disadvantages of them in detail. Based on the mathematical framework presented in the paper......, the overvoltage caused by high PV penetration is described, solutions to facilitate higher PV penetration are classified, and their effectiveness, advantages, and disadvantages are illustrated. The investigated solutions include the grid reinforcement, electrical energy storage application, reactive power...... absorption by PV inverters, application of active medium voltage to low voltage (MV/LV) transformers, active power curtailment, and demand response (DR). Coordination between voltage control units by localized, distributed, and centralized voltage control methods is compared using the voltage sensitivity...
30 CFR 75.817 - Cable handling and support systems.
2010-07-01
... High-Voltage Longwalls § 75.817 Cable handling and support systems. Longwall mining equipment must be provided with cable-handling and support systems that are constructed, installed and maintained to minimize... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cable handling and support systems. 75.817...
Development of a New Cascade Voltage-Doubler for Voltage Multiplication
Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri
2014-01-01
For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.
A High Voltage Swing 1.9 GHz PA in Standard CMOS
Aartsen, W.A.J.; Annema, Anne J.; Nauta, Bram
2002-01-01
A circuit technique for RF power amplifiers that reliably handle voltage peaks well above the nominal supply voltage is presented. To achieve this high-voltage tolerance the circuit implements switched-cascode transistors that yield reliable operation for voltages up to 7V at RF frequencies in a
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
Mitigation of voltage sag using DVR under feedback and ...
African Journals Online (AJOL)
The paper deals with Dynamic Voltage Restorer (DVR) that aims at the integration of series active filter with minimum VA handling. The DVR not only regulates the voltage at load end but also acts as series active filter. The scheme of DVR is modeled and simulated with MATLAB/Simulink under feedback and feedforward ...
Voltage harmonic elimination with RLC based interface smoothing filter
International Nuclear Information System (INIS)
Chandrasekaran, K; Ramachandaramurthy, V K
2015-01-01
A method is proposed for designing a Dynamic Voltage Restorer (DVR) with RLC interface smoothing filter. The RLC filter connected between the IGBT based Voltage Source Inverter (VSI) is attempted to eliminate voltage harmonics in the busbar voltage and switching harmonics from VSI by producing a PWM controlled harmonic voltage. In this method, the DVR or series active filter produces PWM voltage that cancels the existing harmonic voltage due to any harmonic voltage source. The proposed method is valid for any distorted busbar voltage. The operating VSI handles no active power but only harmonic power. The DVR is able to suppress the lower order switching harmonics generated by the IGBT based VSI. Good dynamic and transient results obtained. The Total Harmonic Distortion (THD) is minimized to zero at the sensitive load end. Digital simulations are carried out using PSCAD/EMTDC to validate the performance of RLC filter. Simulated results are presented. (paper)
Directory of Open Access Journals (Sweden)
Hasanova L. H.
2017-12-01
Full Text Available Nowadays permanent magnet synchronous machines those frequency-controlled from stator side with frequency inverters made on the basis of power transistors or fully controlled thyristors, are widely used as motors and generators. In future they are also promising a good application in transport, including marine. Modern frequency inverters are equipped with a control system based on sine-shaped pulse width modulation. While shaping the voltage in the output of the inverter, in addition to the fundamental harmonic, higher harmonic components are also included in the voltage shape, which certainly affect the operating parameters of the generator (electromagnetic torque, power, currents. To determine this effect the modeling and investigation technique of higher harmonic voltages in the "electric network – frequency converter – synchronous machine with permanent magnets" system has been developed. The proposed equations of a frequency-controlled permanent magnet synchronous machine allow relatively simply reproduce the harmonic composition of the voltage in the output of a frequency inverter equipped with the control system based on a sinusoidal pulse width modulation. The developed research technique can be used for inverters with any number and composition of voltage harmonic components feeding a stator winding of a permanent magnet synchronous machine. On a particular case, the efficiency of the research technique of the higher harmonics influence on the operating parameters of the generator has been demonstrated. At the same time, the study has been carried out taking into account the shape of the voltage curve feeding the windings of the synchronous machine containing in addition to the fundamental harmonic the 8, 10, 11, 13, 14 and 16-th harmonic components, and the rated active power of the synchronous machine has been equal to 1 500 kW.
Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy; Hatzell, Marta C.; Hutchinson, Adam J.; Logan, Bruce E.
2011-01-01
to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses
International Nuclear Information System (INIS)
Frick, G.; Osswald, F.; Heusch, B.
1996-01-01
Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)
Evaluation of higher distribution and/or utilization voltages. Final report
Energy Technology Data Exchange (ETDEWEB)
Hazelrigg, Jr, George A.
1981-01-01
An electric energy distribution/utilization system cost analysis model is presented for exploring cost tradeoffs (capital innvestment, operation and maintenance and cost of losses) and optimizing system configuration. The model focuses on the treatment of residential and light commercial service areas with time-varying load characteristics, including customer load profile changes, per customer load growth and service area population growth. Applications of the model are discussed. These include providing insight on: the selection of primary and secondary voltages; conductor sizing; distribution transformer sizing, change out policies and copper-to-core-loss ratio; and limits on allowable voltage variation at the service entrance. Examples are provided to illustrate model capabilities.
BEHAVIOUR OF BACKFILL MATERIALS FOR ELECTRICAL GROUNDING SYSTEMS UNDER HIGH VOLTAGE CONDITIONS
Directory of Open Access Journals (Sweden)
S. C. LIM
2015-06-01
Full Text Available Backfill materials like Bentonite and cement are effective in lowering grounding resistance of electrodes for a considerable period. During lightning, switching impulses and earth fault occurrences in medium and high voltage networks, the grounding system needs to handle extremely high currents either for a short duration or prolonged period respectively. This paper investigates the behaviour of bentonite, cement and sand under impulse and alternating high voltage (50Hz conditions. Fulguritic-formation was observed in all materials under alternating high voltage. The findings reveal that performance of grounding systems under high voltage conditions may significantly change from the outcomes anticipated at design stage.
Advances in high voltage insulation and arc interruption in SF6 and vacuum
Maller, V N
1982-01-01
Advances in High Voltage Insulation and Arc Interruption in SF6 and Vacuum deals with high voltage breakdown and arc extinction in sulfur hexafluoride (SF6) and high vacuum, with special emphasis on the application of these insulating media in high voltage power apparatus and devices. The design and developmental aspects of various high voltage power apparatus using SF6 and high vacuum are highlighted. This book is comprised of eight chapters and opens with a discussion on electrical discharges in SF6 and high vacuum, along with the properties and handling of SF6 gas. The following chapters fo
Energy Technology Data Exchange (ETDEWEB)
Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering
1996-12-01
In this paper the hybrid wind farm connected to a weak grid is investigated. By combining different electrical wind power plant systems a cost-efficient solution is obtained. The point of common connection voltage level can be controlled by injecting reactive power from a phase-compensating capacitor battery and a voltage source inverter (VSI). If the short-circuit impedance ratio is lower than 1, the demanded reactive power injection to keep the voltage at nominal level is unrealistic. For short-circuit impedance ratios of 2 or higher the demanded reactive power level is acceptable. When using both induction generators and thyristor inverters the reactive power injector VSI size should be about 0.2 pu. If the hybrid farm consists of THYs, IGs and VSIs and the active power is equally shared between the systems, the VSI had to be scaled up by 5% to handle both active and reactive power. 7 refs, 10 figs, 2 tabs
Advanced concept for a medium-voltage switch gear; Neues Konzept einer Mittelspannungsschaltanlage
Energy Technology Data Exchange (ETDEWEB)
Buescher, A.; Wahle, A. [Areva Energietechnik GmbH, Regensburg (Germany). Sachsenwerk Mittelspannung
2008-03-15
The new series GHA of medium-voltage switch gears have advantages due to sulfur hexafluorides avoidance during operation of the service life. An ergonomic display device enables simple handling and reliable switching processes. (GL)
Kim, Diana H; Verdino, Ralph J
To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.
Local Identification of Voltage Instability from Load Tap Changer Response
DEFF Research Database (Denmark)
Weckesser, Johannes Tilman Gabriel; Papangelis, Lampros; Vournas, Costas D.
2017-01-01
. The new method is not bound to assessing system response over a predefined LTC tapping period. This allows handling LTCs with variable delays, as well as events taking place during the tapping sequence impacting the distribution voltages. For that purpose, eLIVES applies recursive least square fitting...
GECM-Based Voltage Stability Assessment Using Wide-Area Synchrophasors
Directory of Open Access Journals (Sweden)
Heng-Yi Su
2017-10-01
Full Text Available Voltage instability is a crucial issue in the secure operation of power grids. Several methods for voltage stability assessment were presented. Some of them are highly computationally intensive, while others are reported not to work properly under all circumstances. This paper proposes a new methodology based on the generator equivalent circuit model (GECM and the phasor measurement unit (PMU technology for online voltage stability monitoring of a power grid. First, the proposed methodology utilizes synchronized phasor (synchrophasor measurements to determine the impedance parameters of a transmission grid by means of the recursive least squares (RLS algorithm. Furthermore, it incorporates the dynamic models of generators to handle the cases with generator reactive power limit violations. After that, an enhanced voltage stability index with GECMs incorporated is developed for reliable and accurate voltage stability assessment. The proposed methodology was first demonstrated on several standard IEEE power systems, and then applied to a practical power system, the Taiwan power (Taipower system. The test results demonstrate the flexibility and effectiveness of the proposed methodology.
How to handle station black outs
Energy Technology Data Exchange (ETDEWEB)
Reisch, Frigyes [Swedish Nuclear Power Inspectorate, S-10252 Stockholm (Sweden)
1986-02-15
Station black out is defined as the loss of ail high voltage alternating current at a nuclear power site. An international study was made to survey the practices in the different countries. The best way to handle station black out is to avoid it therefore briefly the normal off site and emergency on site power supplies are discussed. The ways in use to enhance nuclear power plants using Boiling Water Reactors or Pressurized Water Reactors to cope with a station black out are discussed in some detail. (author)
How to handle station black outs
International Nuclear Information System (INIS)
Reisch, Frigyes
1986-01-01
Station black out is defined as the loss of ail high voltage alternating current at a nuclear power site. An international study was made to survey the practices in the different countries. The best way to handle station black out is to avoid it therefore briefly the normal off site and emergency on site power supplies are discussed. The ways in use to enhance nuclear power plants using Boiling Water Reactors or Pressurized Water Reactors to cope with a station black out are discussed in some detail. (author)
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2016-10-01
Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.
A nanoscale piezoelectric transformer for low-voltage transistors.
Agarwal, Sapan; Yablonovitch, Eli
2014-11-12
A novel piezoelectric voltage transformer for low-voltage transistors is proposed. Placing a piezoelectric transformer on the gate of a field-effect transistor results in the piezoelectric transformer field-effect transistor that can switch at significantly lower voltages than a conventional transistor. The piezoelectric transformer operates by using one piezoelectric to squeeze another piezoelectric to generate a higher output voltage than the input voltage. Multiple piezoelectrics can be used to squeeze a single piezoelectric layer to generate an even higher voltage amplification. Coupled electrical and mechanical modeling in COMSOL predicts a 12.5× voltage amplification for a six-layer piezoelectric transformer. This would lead to more than a 150× reduction in the power needed for communications.
47 CFR 17.54 - Rated lamp voltage.
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Rated lamp voltage. 17.54 Section 17.54... voltage. To insure the necessary lumen output by obstruction lights, the rated voltage of incandescent lamps used shall correspond to be within 3 percent higher than the voltage across the lamp socket during...
Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems
Directory of Open Access Journals (Sweden)
Dung Vo Tien
2018-01-01
Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.
Voltage protection scheme for MG sets used to drive inductive energy storage systems
International Nuclear Information System (INIS)
Campen, G.L.; Easter, R.B.
1977-01-01
A recent tokamak proposal at ORNL called for MG (motor-generator) sets to drive the ohmic heating (OH] coil, which was to be subjected to 20 kV immediately after coil charge-up to initiate the experiment. Since most rotating machinery is inherently low voltage, including the machines available at ORNL, a mechanism was necessary to isolate the generators from the high voltage portions of the circuit before the appearance of this voltage. It is not the expected 20 kV at the coil that causes difficulty, because the main interrupting switch handles this. The voltage induced in the armature due to di/dt and the possibility of faults are the greatest causes for concern and are responsible for the complexity of the voltage protection scheme, which must accommodate any possible combination of fault time and location. Such a protection scheme is presented in this paper
Electric devices used in radioactive handling enclosures of the high activity laboratory
International Nuclear Information System (INIS)
Gaigeot, F.; Laurent, H.
1958-08-01
This report describes several electric, electronic and electromechanical assemblies which are used in radioactive handling enclosures. The authors propose an overview of existing or foreseen devices: a device to lift covers, a brightness comparator, a high voltage device to perform electrophoresis, a level sensor or regulator device, a regulation device to control under-pressure in an enclosure [fr
Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160
Meier, F.
2012-05-01
Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.
Shigematsu, Hideki; Kawaguchi, Masahiko; Hayashi, Hironobu; Takatani, Tsunenori; Iwata, Eiichiro; Tanaka, Masato; Okuda, Akinori; Morimoto, Yasuhiko; Masuda, Keisuke; Tanaka, Yuu; Tanaka, Yasuhito
2017-10-01
During spine surgery, the spinal cord is electrophysiologically monitored via transcranial electrical stimulation of motor-evoked potentials (TES-MEPs) to prevent injury. Transcranial electrical stimulation of motor-evoked potential involves the use of either constant-current or constant-voltage stimulation; however, there are few comparative data available regarding their ability to adequately elicit compound motor action potentials. We hypothesized that the success rates of TES-MEP recordings would be similar between constant-current and constant-voltage stimulations in patients undergoing spine surgery. The objective of this study was to compare the success rates of TES-MEP recordings between constant-current and constant-voltage stimulation. This is a prospective, within-subject study. Data from 100 patients undergoing spinal surgery at the cervical, thoracic, or lumbar level were analyzed. The success rates of the TES-MEP recordings from each muscle were examined. Transcranial electrical stimulation with constant-current and constant-voltage stimulations at the C3 and C4 electrode positions (international "10-20" system) was applied to each patient. Compound muscle action potentials were bilaterally recorded from the abductor pollicis brevis (APB), deltoid (Del), abductor hallucis (AH), tibialis anterior (TA), gastrocnemius (GC), and quadriceps (Quad) muscles. The success rates of the TES-MEP recordings from the right Del, right APB, bilateral Quad, right TA, right GC, and bilateral AH muscles were significantly higher using constant-voltage stimulation than those using constant-current stimulation. The overall success rates with constant-voltage and constant-current stimulations were 86.3% and 68.8%, respectively (risk ratio 1.25 [95% confidence interval: 1.20-1.31]). The success rates of TES-MEP recordings were higher using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery. Copyright © 2017
Choice of operating voltage for a transmission electron microscope
International Nuclear Information System (INIS)
Egerton, R.F.
2014-01-01
An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical
DEFF Research Database (Denmark)
Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede
2017-01-01
relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...
Voltage-assisted polymer wafer bonding
International Nuclear Information System (INIS)
Varsanik, J S; Bernstein, J J
2012-01-01
Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
Flexible Electrostatic Technologies for Capture and Handling, Phase 1
Bryan, Thomas
2015-01-01
Fundamental to many of NASA's in-space transportation missions is the capture and handling of various objects and vehicles in various orbits for servicing, debris disposal, sample retrieval, and assembly without the benefit of sufficient grapple fixtures and docking ports. To perform similar material handling tasks on Earth, pincher grippers, suction grippers, or magnetic chucks are used, but are unable to reliably grip aluminum and composite spacecraft, insulation, radiators, solar arrays, or extra-terrestrial objects in the vacuum of outer space without dedicated handles in the right places. The electronic Flexible Electrostatic Technologies for space Capture and Handling (FETCH) will enable reliable and compliant gripping (soft dock) of practically any object in various orbits or surfaces without dedicated mechanical features, very low impact capture, and built-in proximity sensing without any conventional actuators. Originally developed to handle semiconductor and glass wafers during vacuum chamber processing without contamination, the normal rigid wafer handling chucks are replaced with thin metal foil segments laminated in flexible insulation driven by commercial off-the-shelf solid state, high-voltage power supplies. Preliminary testing in NASA Marshall Space Flight Center's (MSFC's) Flat Floor Robotics Lab demonstrated compliant alignment and gripping with a full-sized, 150-lb microsat mockup and translation before a clean release with a flip of a switch. The flexible electrostatic gripper pads can be adapted to various space applications with different sizes, shapes, and foil electrode layouts even with openings through the gripper pads for addition of guidance sensors or injection of permanent adhesives. With gripping forces estimated between 0.5 and 2.5 lb/in2 or 70-300 lb/ft2 of surface contact, the FETCH can turn on and off rapidly and repeatedly to enable sample handling, soft docking, in-space assembly, precision relocation, and surface translation
Planning aspects of ac extra high voltage lines
Energy Technology Data Exchange (ETDEWEB)
Engelhardt, H
1964-01-01
The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.
Diode-Assisted Buck-Boost Voltage-Source Inverters
DEFF Research Database (Denmark)
Gao, Feng; Loh, Poh Chiang; Teodorescu, Remus
2009-01-01
, a number of diode-assisted inverter variants can be designed with each having its own operational principle and voltage gain expression. For controlling them, a generic modulation scheme that can be used for controlling all diode-assisted variants with minimized harmonic distortion and component stress......This paper proposes a number of diode-assisted buck-boost voltage-source inverters with a unique X-shaped diode-capacitor network inserted between the inverter circuitry and dc source for producing a voltage gain that is comparatively higher than those of other buck-boost conversion techniques....... Using the diode-assisted network, the proposed inverters can naturally configure themselves to perform capacitive charging in parallel and discharging in series to give a higher voltage multiplication factor without compromising waveform quality. In addition, by adopting different front-end circuitries...
International Nuclear Information System (INIS)
Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.
2013-01-01
For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).
Directory of Open Access Journals (Sweden)
Rui Li
2016-12-01
Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.
High voltage switches having one or more floating conductor layers
Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson
2015-11-24
This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.
Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter
DEFF Research Database (Denmark)
Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus
2011-01-01
This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...
Design of shielded voltage divider for impulse voltage measurement
International Nuclear Information System (INIS)
Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.
1976-01-01
The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
High voltage investigations for ITER coils
International Nuclear Information System (INIS)
Fink, S.; Fietz, W.H.
2006-01-01
The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)
Distance protection of multiple-circuit shared tower transmission lines with different voltages
DEFF Research Database (Denmark)
Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...
Team effort leads to versatile handling solution for pipe manufacturer
Energy Technology Data Exchange (ETDEWEB)
Anon.
2010-09-15
This article discussed the development of a new pipe-handling system that resulted in increased efficiencies in plant-to-yard transport for a custom steel pipe manufacturer. In the previous system, loaders would move finished pipe to the yard for storage. However, for transport loading, the pipe would have to be brought back indoors because only the inside cranes could handle loading the pipe without damaging the special outer coating on the pipe. In the new pipe-handling system, the loader is replaced with a Sennebogen 850 M rubber-tired material handler, which was developed for the steel recycling industry. The generator that comes on the material handler is retrofitted to power a purpose-built pipe-handler attachment. The machine's higher lifting reach allows for higher stacking, effectively increasing the capacity of the yard. The new pipe-handling machine allows trucks to be loaded right in the yard, eliminating the need to double-handle the pipe. 1 fig.
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
Elevated voltage level I.sub.DDQ failure testing of integrated circuits
Righter, Alan W.
1996-01-01
Burn in testing of static CMOS IC's is eliminated by I.sub.DDQ testing at elevated voltage levels. These voltage levels are at least 25% higher than the normal operating voltage for the IC but are below voltage levels that would cause damage to the chip.
Elevated voltage level I{sub DDQ} failure testing of integrated circuits
Righter, A.W.
1996-05-21
Burn in testing of static CMOS IC`s is eliminated by I{sub DDQ} testing at elevated voltage levels. These voltage levels are at least 25% higher than the normal operating voltage for the IC but are below voltage levels that would cause damage to the chip. 4 figs.
Dynamic range of low-voltage cascode current mirrors
DEFF Research Database (Denmark)
Bruun, Erik; Shah, Peter Jivan
1995-01-01
Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...
Energy Technology Data Exchange (ETDEWEB)
Diwold, Konrad; Yan, Wei [Fraunhofer IWES, Kassel (Germany); Braun, Martin [Fraunhofer IWES, Kassel (Germany); Stuttgart Univ. (Germany). Inst. fuer Energieuebertragung und Hochspannungstechnik (IEH)
2012-07-01
The increased integration of distributed energy units creates challenges for the operators of distribution systems. This is due to the fact that distribution systems that were initially designed for distributed consumption and central generation now face decentralized feed-in. One imminent problem associated with decentralised fee-in are local voltage violations in the distribution system, which are hard to handle via conventional voltage control strategies. This article proposes a new voltage control framework for distribution system operation. The framework utilizes reactive power of distributed energy units as well on-load tap changers to mitigate voltage problems in the network. Using an optimization-band the control strategy can be used in situations where network information is derived from distribution state estimators and thus holds some error. The control capabilities in combination with a distribution state estimator are tested using data from a real rural distribution network. The results are very promising, as voltage control is achieved fast and accurate, preventing a majority of the voltage violations during system operation under realistic system conditions. (orig.)
High voltage superconducting switch for power application
International Nuclear Information System (INIS)
Mawardi, O.; Ferendeci, A.; Gattozzi, A.
1983-01-01
This paper reports the development of a novel interrupter which meets the requirements of a high voltage direct current (HVDC) power switch and at the same time doubles as a current limiter. The basic concept of the interrupter makes use of a fast superconducting, high capacity (SHIC) switch that carries the full load current while in the superconducting state and reverts to the normal resistive state when triggered. Typical design parameters are examined for the case of a HVDC transmission line handling 2.5KA at 150KVDC. The result is a power switch with superior performance and smaller size than the ones reported to date
A Novel Quasi-SEPIC High-Voltage Boost DC-DC Converter
DEFF Research Database (Denmark)
Siwakoti, Yam Prasad; N. Soltani, Mohsen; Blaabjerg, Frede
2017-01-01
This paper proposes a modified coupled-inductor SEPIC dc-dc converter for low power and high voltage gain applications such as for piezoelectric drive systems. The converter uses the same components as of SEPIC converter with an additional diode. Compared to conventional topologies with similar...... voltage gain expression, the proposed topology uses less components to achieve same or even higher voltage gain. This helps to design a very compact and light weight converter with higher power density at lower cost. Due to brevity, the principle of operation, theoretical analysis and comparison supported...
Power angle control of grid-connected voltage source converter in a wind energy application
Energy Technology Data Exchange (ETDEWEB)
Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering
1996-12-31
In this thesis, the connection of a voltage source converter to the grid in a wind energy application is examined. The possibility of using a cheap control system without grid current measurements, is investigated. The control method is based on controlling the voltage angle of the inverter, which governs the active power flow. The highest frequency of the power variation, coming from wind turbine, is approx. 5 Hz. Since the proposed control method easily can handle such power variations it is very well suited for wind turbine applications. The characteristics of the system depend on the DC-link capacitor, the grid filter inductance and resistance. Large values of the resistance damp the system well but increase the energy losses. A high inductance leads to a reduced harmonic level on the grid but makes the system slower. By using feed-forward of the generator/rectifier current signal, the performance is increased compared to an ordinary PI-control. Combining the Linear Quadratic (LQ) control method with Kalman filtered input signals, a robust control method with a good performance is obtained. The LQ controller controls both the phase displacement angle and the modulation index, resulting in higher bandwidth, and the typical power angle resonance at the grid frequency disappears. 22 refs, 109 figs, 14 tabs
Han, Zhou; Jin, Lei; Platisa, Jelena; Cohen, Lawrence B.; Baker, Bradley J.; Pieribone, Vincent A.
2013-01-01
We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms) are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ) less than 6ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9%) is not as large as the Ciona-based ArcLight (~35%), they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals. PMID:24312287
Directory of Open Access Journals (Sweden)
Zhou Han
Full Text Available We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ less than 6 ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9% is not as large as the Ciona-based ArcLight (~35%, they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals.
Momoh, James A.; Salkuti, Surender Reddy
2016-06-01
This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
Fuel handling machine and auxiliary systems for a fuel handling cell
International Nuclear Information System (INIS)
Suikki, M.
2013-10-01
This working report is an update for as well as a supplement to an earlier fuel handling machine design (Kukkola and Roennqvist 2006). A focus in the earlier design proposal was primarily on the selection of a mechanical structure and operating principle for the fuel handling machine. This report introduces not only a fuel handling machine design but also auxiliary fuel handling cell equipment and its operation. An objective of the design work was to verify the operating principles of and space allocations for fuel handling cell equipment. The fuel handling machine is a remote controlled apparatus capable of handling intensely radiating fuel assemblies in the fuel handling cell of an encapsulation plant. The fuel handling cell is air tight space radiation-shielded with massive concrete walls. The fuel handling machine is based on a bridge crane capable of traveling in the handling cell along wall tracks. The bridge crane has its carriage provided with a carousel type turntable having mounted thereon both fixed and telescopic masts. The fixed mast has a gripper movable on linear guides for the transfer of fuel assemblies. The telescopic mast has a manipulator arm capable of maneuvering equipment present in the fuel handling cell, as well as conducting necessary maintenance and cleaning operations or rectifying possible fault conditions. The auxiliary fuel handling cell systems consist of several subsystems. The subsystems include a service manipulator, a tool carrier for manipulators, a material hatch, assisting winches, a vacuum cleaner, as well as a hose reel. With the exception of the vacuum cleaner, the devices included in the fuel handling cell's auxiliary system are only used when the actual encapsulation process is not ongoing. The malfunctions of mechanisms or actuators responsible for the motion actions of a fuel handling machine preclude in a worst case scenario the bringing of the fuel handling cell and related systems to a condition appropriate for
Fuel handling machine and auxiliary systems for a fuel handling cell
Energy Technology Data Exchange (ETDEWEB)
Suikki, M. [Optimik Oy, Turku (Finland)
2013-10-15
This working report is an update for as well as a supplement to an earlier fuel handling machine design (Kukkola and Roennqvist 2006). A focus in the earlier design proposal was primarily on the selection of a mechanical structure and operating principle for the fuel handling machine. This report introduces not only a fuel handling machine design but also auxiliary fuel handling cell equipment and its operation. An objective of the design work was to verify the operating principles of and space allocations for fuel handling cell equipment. The fuel handling machine is a remote controlled apparatus capable of handling intensely radiating fuel assemblies in the fuel handling cell of an encapsulation plant. The fuel handling cell is air tight space radiation-shielded with massive concrete walls. The fuel handling machine is based on a bridge crane capable of traveling in the handling cell along wall tracks. The bridge crane has its carriage provided with a carousel type turntable having mounted thereon both fixed and telescopic masts. The fixed mast has a gripper movable on linear guides for the transfer of fuel assemblies. The telescopic mast has a manipulator arm capable of maneuvering equipment present in the fuel handling cell, as well as conducting necessary maintenance and cleaning operations or rectifying possible fault conditions. The auxiliary fuel handling cell systems consist of several subsystems. The subsystems include a service manipulator, a tool carrier for manipulators, a material hatch, assisting winches, a vacuum cleaner, as well as a hose reel. With the exception of the vacuum cleaner, the devices included in the fuel handling cell's auxiliary system are only used when the actual encapsulation process is not ongoing. The malfunctions of mechanisms or actuators responsible for the motion actions of a fuel handling machine preclude in a worst case scenario the bringing of the fuel handling cell and related systems to a condition appropriate for
Effects of tetracaine on insulin release and calcium handling by rat pancreatic islets
International Nuclear Information System (INIS)
Abdel El Motal, S.M.A.; Pian-Smith, M.C.M.; Sharp, G.W.G.
1987-01-01
The effects of tetracaine on insulin release and 45 Ca 2+ handling by rat pancreatic islets have been studied under basal, glucose-stimulated, and 3-isobutyl-1-methylxanthine (IBMX)-stimulated conditions. Islets were isolated by the use of collagenase and used either directly (freshly isolated islets) or after a period under tissue culture conditions. Tetracaine was found to stimulate insulin release under basal conditions, to inhibit glucose-stimulated insulin release, and to potentiate insulin release stimulated by IBMX. In studies on the mechanisms underlying these effects, tetracaine was found to decrease glucose-stimulated net retention of 45 Ca 2+ (by an action to block the voltage-dependent Ca channels) and to mobilize Ca 2+ from intracellular stores. These two actions form the basis for the inhibition of glucose-stimulated insulin release, which depends heavily on Ca 2+ entry via the voltage-dependent channels and the synergism with IBMX to potentiate release. No inhibition of IBMX-stimulated release occurs because IBMX does not use the voltage-dependent channels to raise intracellular Ca 2+
Harvesting and handling agricultural residues for energy
Energy Technology Data Exchange (ETDEWEB)
Jenkins, B.M.; Summer, H.R.
1986-05-01
Significant progress in understanding the needs for design of agricultural residue collection and handling systems has been made but additional research is required. Recommendations are made for research to (a) integrate residue collection and handling systems into general agricultural practices through the development of multi-use equipment and total harvest systems; (b) improve methods for routine evaluation of agricultural residue resources, possibly through remote sensing and image processing; (c) analyze biomass properties to obtain detailed data relevant to engineering design and analysis; (d) evaluate long-term environmental, social, and agronomic impacts of residue collection; (e) develop improved equipment with higher capacities to reduce residue collection and handling costs, with emphasis on optimal design of complete systems including collection, transportation, processing, storage, and utilization; and (f) produce standard forms of biomass fuels or products to enhance material handling and expand biomass markets through improved reliability and automatic control of biomass conversion and other utilization systems. 118 references.
Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.
Genc, Ayten; Bakirci, Busra
2015-01-01
The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.
Directory of Open Access Journals (Sweden)
Abderrahmane Beroual
2017-04-01
Full Text Available This paper deals with a comparative study of AC and DC breakdown voltages of based mineral oil mixtures with natural and synthetic esters mainly used in high voltage power transformers. The goal was to analyze the performances of oil mixtures from the dielectric withstand point of view and to predict the behavior of transformers originally filled with mineral oil and re-filled with synthetic or natural ester oils when emptied for maintenance. The study concerns mixtures based on 20%, 50%, and 80% of natural and synthetic ester oils. AC breakdown voltages were measured using a sphere-sphere electrode system according to IEC 60156 specifications; the same specification was adopted for DC measurements since there is no standard specifications for this voltage waveform. A statistical analysis of the mean values, standard deviations, and histograms of breakdown voltage data was carried out. The Normal and Weibull distribution functions were used to analyze the experimental data and the best function that the data followed was used to estimate the breakdown voltage with risk of 1%, 10%, and 50% probability. It was shown that whatever the applied voltage waveforms, ester oils always have a significantly higher breakdown voltage than mineral oil. The addition of only 20% of natural or synthetic ester oil was sufficient to considerably increase the breakdown voltage of mineral oil. The dielectric strength of such a mixture is much higher than that of mineral oil alone and can reach that of ester oils. From the point of view of dielectric strength, the mixtures constitute an option for improving the performance of mineral oil. Thus, re-filling of transformers containing up to 20% mineral oil residues with ester oils, does not present any problem; it is even advantageous when considering only the breakdown voltage. Under AC, the mixtures with natural ester always follow the behavior of vegetable oil alone. With the exception of the 20% mixture of natural
Particle swarm optimization for determining shortest distance to voltage collapse
Energy Technology Data Exchange (ETDEWEB)
Arya, L.D.; Choube, S.C. [Electrical Engineering Department, S.G.S.I.T.S. Indore, MP 452 003 (India); Shrivastava, M. [Electrical Engineering Department, Government Engineering College Ujjain, MP 456 010 (India); Kothari, D.P. [Centre for Energy Studies, Indian Institute of Technology, Delhi (India)
2007-12-15
This paper describes an algorithm for computing shortest distance to voltage collapse or determination of CSNBP using PSO technique. A direction along CSNBP gives conservative results from voltage security view point. This information is useful to the operator to steer the system away from this point by taking corrective actions. The distance to a closest bifurcation is a minimum of the loadability given a slack bus or participation factors for increasing generation as the load increases. CSNBP determination has been formulated as an optimization problem to be used in PSO technique. PSO is a new evolutionary algorithm (EA) which is population based inspired by the social behavior of animals such as fish schooling and birds flocking. It can handle optimization problems with any complexity since mechanization is simple with few parameters to be tuned. The developed algorithm has been implemented on two standard test systems. (author)
Integration of Electric Vehicles in Low Voltage Danish Distribution Grids
DEFF Research Database (Denmark)
Pillai, Jayakrishnan Radhakrishna; Thøgersen, Paul; Møller, Jan
2012-01-01
Electric Vehicles (EVs) are considered as one of the important components of the future intelligent grids. Their role as energy storages in the electricity grid could provide local sustainable solutions to support more renewable energy. In order to estimate the extent of interaction of EVs...... in the electricity grid operation, a careful examination in the local electricity system is essential. This paper investigates the degree of EV penetration and its key influence on the low voltage distribution grids. Three detailed models of residential grids in Denmark are considered as test cases in this study...... it is shown that there is enough head-space on the transformer capacity which can be used to charge many EVs during a day. The overall transformer capability of handling EV loads varies between 6-40% for peak and minimum demand hours, which is dependent on the robustness of the grids. The voltage drops...
Short-Term State Forecasting-Based Optimal Voltage Regulation in Distribution Systems: Preprint
Energy Technology Data Exchange (ETDEWEB)
Yang, Rui; Jiang, Huaiguang; Zhang, Yingchen
2017-05-17
A novel short-term state forecasting-based optimal power flow (OPF) approach for distribution system voltage regulation is proposed in this paper. An extreme learning machine (ELM) based state forecaster is developed to accurately predict system states (voltage magnitudes and angles) in the near future. Based on the forecast system states, a dynamically weighted three-phase AC OPF problem is formulated to minimize the voltage violations with higher penalization on buses which are forecast to have higher voltage violations in the near future. By solving the proposed OPF problem, the controllable resources in the system are optimally coordinated to alleviate the potential severe voltage violations and improve the overall voltage profile. The proposed approach has been tested in a 12-bus distribution system and simulation results are presented to demonstrate the performance of the proposed approach.
High voltage performance of BARC-TIFR Pelletron Accelerator
Energy Technology Data Exchange (ETDEWEB)
Surendran, P.; Ansari, Q.N.; Nair, J.P., E-mail: surendra@tifr.res.in [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai (India); and others
2014-07-01
The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF{sub 6} drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)
High voltage performance of BARC-TIFR Pelletron Accelerator
International Nuclear Information System (INIS)
Surendran, P.; Ansari, Q.N.; Nair, J.P.
2014-01-01
The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF_6 drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)
Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
Transmission of power at high voltages
Energy Technology Data Exchange (ETDEWEB)
Lane, F J
1963-01-01
High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-11-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.
How Does Bug-Handling Effort Differ Among Different Programming Languages?
Zhang, Jie; Li, Feng; Hao, Dan; Wang, Meng; Zhang, Lu
2018-01-01
Handling bugs is an essential part of software development. The impact of programming language on this task has long been a topic of much debate. For example, some people hold the view that bugs in Python are easy to handle because its code is easy to read and understand, while some others believe the absence of static typing in Python will lead to higher bug-handling effort. This paper presents the first large-scale study to investigate whether the ecosystems of different (categories of) pro...
A 350 KV nanosecond pulse voltage generator with adjustable pulsed-width
International Nuclear Information System (INIS)
Wang, X.; Wang, M.; Chen, Y.Q.; Zeng, L.G.; Han, M.
2002-01-01
This paper presents a 350 kV nanosecond pulse voltage generator (NPVG). The voltage pulsed-width can be adjusted from 30 to 160 ns. The generator consists of: Marx generator, pulsed forming line (PFL), main switch and matched impedance. The output voltage of Marx generator is over than nU c (n- the stage number of Marx generator, U c -the charging voltage of capacitor). When the pulse forming line is terminated with an impedance that is over than the characteristic impedance of PFL, the higher voltage pulse was provided for the load
Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters
Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.
2015-01-01
The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
Technical and economic considerations of extra high voltage power transmission
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1966-09-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.
Dose profile variation with voltage in head CT scans using radiochromic films
Mourão, A. P.; Alonso, T. C.; DaSilva, T. A.
2014-02-01
The voltage source used in an X-ray tube is an important part of defining the generated beam spectrum energy profile. The X-ray spectrum energy defines the X-ray beam absorption as well as the characteristics of the energy deposition in an irradiated object. Although CT scanners allow one to choose between four different voltage values, most of them employ a voltage of 120 kV in their scanning protocols, regardless of the patient characteristics. Based on this fact, this work investigated the deposited dose in a polymethyl methacrylate (PMMA) cylindrical head phantom. The entire volume was irradiated twice. Two CT scanning protocols were used with two different voltage values: 100 and 120 kV. The phantom volume was irradiated, and radiochromic films were employed to record dose profiles. Measurements were conducted with a calibrated pencil ionization chamber, which was positioned in the center and in four peripheral bores of the head PMMA phantom, to calibrate the radiochromic films. The central slice was then irradiated. This procedure allowed us to find the conversion factors necessary to obtain dose values recorded in the films. The data obtained allowed us to observe the dose variation profile inside the phantom head as well as in the peripheral and central regions. The peripheral region showed higher dose values than those of the central region for scans using both voltage values: approximately 31% higher for scanning with 120 kV and 25% higher with 100 kV. Doses recorded with the highest voltage are significantly higher, approximately 50% higher in the peripheral region and 40% higher in the central region. A longitudinal variation could be observed, and the maximum dose was recorded at the peripheral region, at the midpoint of the longitudinal axis. The obtained results will most likely contribute to the dissemination of proper procedure as well as to optimize dosimetry and tests of quality control in CT because the choice of protocols with different voltage
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Advances in high voltage power switching with GTOs
International Nuclear Information System (INIS)
Podlesak, T.F.
1990-01-01
The control of high voltage at high power, particularly opening switches, has been difficult in the past. Using gate turnoff thyristors (GTOs) arranged in series enables large currents to be switched at high voltage. The authors report a high voltage opening switch has been successfully demonstrated. This switch uses GTOs in series and successfully operates at voltages higher than the rated voltage of the individual devices. It is believed that this is the first time this has been successfully demonstrated, in that GTOs have been operated in series before, but always in a manner as to not exceed the voltage capability of the individual devices. In short, the devices have not worked together, sharing the voltage, but one device has been operated using several backup devices. Of particular interest is how well the individual devices share the voltage applied to them. Equal voltage sharing between devices is absolutely essential, in order to not exceed the voltage rating of any of the devices in the series chain. This is accomplished at high (microsecond) switching speeds. Thus, the system is useful for high frequency applications as well as high power, making for a flexible circuit system element. This demonstration system is rated at 5 KV and uses 1 KV devices. A larger 24 KV system is under design and will use 4.5 KV devices. In order to design the 24 KV switch, the safe operating area of the large devices must be known thoroughly
Adaptive and energy efficient SMA-based handling systems
Motzki, P.; Kunze, J.; Holz, B.; York, A.; Seelecke, S.
2015-04-01
Shape Memory Alloys (SMA's) are known as actuators with very high energy density. This fact allows for the construction of very light weight and energy-efficient systems. In the field of material handling and automated assembly process, the avoidance of big moments of inertia in robots and kinematic units is essential. High inertial forces require bigger and stronger robot actuators and thus higher energy consumption and costs. For material handling in assembly processes, many different individual grippers for various work piece geometries are used. If one robot has to handle different work pieces, the gripper has to be exchanged and the assembly process is interrupted, which results in higher costs. In this paper, the advantages of using high energy density Shape Memory Alloy actuators in applications of material-handling and gripping-technology are explored. In particular, light-weight SMA actuated prototypes of an adaptive end-effector and a vacuum-gripper are constructed via rapid-prototyping and evaluated. The adaptive end-effector can change its configuration according to the work piece geometry and allows the handling of multiple different shaped objects without exchanging gripper tooling. SMA wires are used to move four independent arms, each arm adds one degree of freedom to the kinematic unit. At the tips of these end-effector arms, SMA-activated suction cups can be installed. The suction cup prototypes are developed separately. The flexible membranes of these suction cups are pulled up by SMA wires and thus a vacuum is created between the membrane and the work piece surface. The self-sensing ability of the SMA wires are used in both prototypes for monitoring their actuation.
Mitigation of voltage sags in the distribution system with dynamic voltage restorer
International Nuclear Information System (INIS)
Viglas, D.; Belan, A.
2012-01-01
Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)
2005-01-01
A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional
Mechanism of voltage-gated channel formation in lipid membranes.
Guidelli, Rolando; Becucci, Lucia
2016-04-01
Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.
Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters
Directory of Open Access Journals (Sweden)
Bulyga Leonid L.
2015-01-01
Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.
Handling of multiassembly sealed baskets between reactor storage and a remote handling facility
International Nuclear Information System (INIS)
Massey, J.V.; Kessler, J.H.; McSherry, A.J.
1989-06-01
The storage of multiple fuel assemblies in sealed (welded) dry storage baskets is gaining increasing use to augment at-reactor fuel storage capacity. Since this increasing use will place a significant number of such baskets on reactor sites, some initial downstream planning for their future handling scenarios for retrieving multi-assembly sealed baskets (MSBs) from onsite storage and transferring and shipping the fuel (and/or the baskets) to a federally operated remote handling facility (RHF). Numerous options or at-reactor and away-from-reactor handling were investigated. Materials handling flowsheets were developed along with conceptual designs for the equipment and tools required to handle and open the MSBs. The handling options were evaluated and compared to a reference case, fuel handling sequence (i.e., fuel assemblies are taken from the fuel pool, shipped to a receiving and handling facility and placed into interim storage). The main parameters analyzed are throughout, radiation dose burden and cost. In addition to evaluating the handling of MSBs, this work also evaluated handling consolidated fuel canisters (CFCs). In summary, the handling of MSBs and CFCs in the store, ship and bury fuel cycle was found to be feasible and, under some conditions, to offer significant benefits in terms of throughput, cost and safety. 14 refs., 20 figs., 24 tabs
Nuclear fuel handling apparatus
International Nuclear Information System (INIS)
Andrea, C.; Dupen, C.F.G.; Noyes, R.C.
1977-01-01
A fuel handling machine for a liquid metal cooled nuclear reactor in which a retractable handling tube and gripper are lowered into the reactor to withdraw a spent fuel assembly into the handling tube. The handling tube containing the fuel assembly immersed in liquid sodium is then withdrawn completely from the reactor into the outer barrel of the handling machine. The machine is then used to transport the spent fuel assembly directly to a remotely located decay tank. The fuel handling machine includes a decay heat removal system which continuously removes heat from the interior of the handling tube and which is capable of operating at its full cooling capacity at all times. The handling tube is supported in the machine from an articulated joint which enables it to readily align itself with the correct position in the core. An emergency sodium supply is carried directly by the machine to provide make up in the event of a loss of sodium from the handling tube during transport to the decay tank. 5 claims, 32 drawing figures
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Increased voltage photovoltaic cell
Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)
1985-01-01
A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.
Power System Stability Using Decentralized Under Frequency and Voltage Load Shedding
DEFF Research Database (Denmark)
Hoseinzadeh, Bakhtyar; Silva, Filipe Faria Da; Bak, Claus Leth
2014-01-01
information to shed the loads with higher voltage decay first. Therefore, this approach deals with coordination of voltage and frequency information instead of independent methods. Numerical simulations which are carried out in DigSilent PowerFactory software confirm the efficiency of proposed methodology...
Energy Technology Data Exchange (ETDEWEB)
Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies
2008-04-09
This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.
Electrophysiological properties and calcium handling of embryonic stem cell-derived cardiomyocytes
Directory of Open Access Journals (Sweden)
Jae Boum Youm
2016-03-01
Full Text Available Embryonic stem cell-derived cardiomyocytes (ESC-CMs hold great interest in many fields of research including clinical applications such as stem cell and gene therapy for cardiac repair or regeneration. ESC-CMs are also used as a platform tool for pharmacological tests or for investigations of cardiac remodeling. ESC-CMs have many different aspects of morphology, electrophysiology, calcium handling, and bioenergetics compared with adult cardiomyocytes. They are immature in morphology, similar to sinus nodal-like in the electrophysiology, higher contribution of trans-sarcolemmal Ca2+ influx to Ca2+ handling, and higher dependence on anaerobic glycolysis. Here, I review a detailed electrophysiology and Ca2+ handling features of ESC-CMs during differentiation into adult cardiomyocytes to gain insights into how all the developmental changes are related to each other to display cardinal features of developing cardiomyocytes.
Reghu, T; Mandloi, V; Shrivastava, Purushottam
2016-04-01
The design and development of a compact high voltage, high peak power, high frequency transformer for a converter type modulator of klystron amplifiers is presented. The transformer has been designed to operate at a frequency of 20 kHz and at a flux swing of ±0.6 T. Iron (Fe) based nanocrystalline material has been selected as a core for the construction of the transformer. The transformer employs a specially designed solid Teflon bobbin having 120 kV insulation for winding the high voltage secondary windings. The flux swing of the core has been experimentally found by plotting the hysteresis loop at actual operating conditions. Based on the design, a prototype transformer has been built which is per se a unique combination of high voltage, high frequency, and peak power specifications. The transformer was able to provide 58 kV (pk-pk) at the secondary with a peak power handling capability of 700 kVA. The transformation ratio was 1:17. The performance of the transformer is also presented and discussed.
Rao, Rathnamala; Katti, Guruprasad; Havaldar, Dnyanesh S.; DasGupta, Nandita; DasGupta, Amitava
2009-03-01
The paper describes the unified analytical threshold voltage model for non-uniformly doped, dual metal gate (DMG) fully depleted silicon-on-insulator (FDSOI) MOSFETs based on the solution of 2D Poisson's equation. 2D Poisson's equation is solved analytically for appropriate boundary conditions using separation of variables technique. The solution is then extended to obtain the threshold voltage of the FDSOI MOSFET. The model is able to handle any kind of non-uniform doping, viz. vertical, lateral as well as laterally asymetric channel (LAC) profile in the SOI film in addition to the DMG structure. The analytical results are validated with the numerical simulations using the device simulator MEDICI.
Neonatal handling induces anovulatory estrous cycles in rats
Directory of Open Access Journals (Sweden)
Gomes C.M.
1999-01-01
Full Text Available Since previous work has shown that stimulation early in life decreases sexual receptiveness as measured by the female lordosis quotient, we suggested that neonatal handling could affect the function of the hypothalamus-pituitary-gonadal axis. The effects of neonatal handling on the estrous cycle and ovulation were analyzed in adult rats. Two groups of animals were studied: intact (no manipulation, N = 10 and handled (N = 11. Pups were either handled daily for 1 min during the first 10 days of life or left undisturbed. At the age of 90 days, a vaginal smear was collected daily at 9:00 a.m. and analyzed for 29 days; at 9:00 a.m. on the day of estrus, animals were anesthetized with thiopental (40 mg/kg, ip, the ovaries were removed and the oviduct was dissected and squashed between 2 glass slides. The number of oocytes of both oviductal ampullae was counted under the microscope. The average numbers for each phase of the cycle (diestrus I, diestrus II, proestrus and estrus during the period analyzed were compared between the two groups. There were no significant differences between intact and handled females during any of the phases. However, the number of handled females that showed anovulatory cycles (8 out of 11 was significantly higher than in the intact group (none out of 10. Neonatal stimulation may affect not only the hypothalamus-pituitary-adrenal axis, as previously demonstrated, but also the hypothalamus-pituitary-gonadal axis in female rats.
Coplanar strips for Josephson voltage standard circuits
International Nuclear Information System (INIS)
Schubert, M.; May, T.; Wende, G.; Fritzsch, L.; Meyer, H.-G.
2001-01-01
We present a microwave circuit for Josephson voltage standards. Here, the Josephson junctions are integrated in a microwave transmission line designed as coplanar strips (CPS). The new layout offers the possibility of achieving a higher scale of integration and to considerably simplify the fabrication technology. The characteristic impedance of the CPS is about 50 Ω, and this should be of interest for programmable Josephson voltage standard circuits with SNS or SINIS junctions. To demonstrate the function of the microwave circuit design, conventional 10 V Josephson voltage standard circuits with 17000 Nb/AlO x /Nb junctions were prepared and tested. Stable Shapiro steps at the 10 V level were generated. Furthermore, arrays of 1400 SINIS junctions in this microwave layout exhibited first-order Shapiro steps. Copyright 2001 American Institute of Physics
Directory of Open Access Journals (Sweden)
Perić Dragoslav M.
2015-01-01
Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.
International Nuclear Information System (INIS)
Martin, M.
1991-01-01
Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance
Additional ion bombardment in PVD processes generated by a superimposed pulse bias voltage
International Nuclear Information System (INIS)
Olbrich, W.; Kampschulte, G.
1993-01-01
The superimposed pulse bias voltage is a tool to apply an additional ion bombardment during deposition in physical vapour deposition (PVD) processes. It is generated by the combination of a d.c. ground voltage and a higher d.c. pulse voltage. Using a superimposed pulse bias voltage in ion-assisted PVD processes effects an additional all-around ion bombardment on the surface with ions of higher energy. Both metal and reactive or inert-gas ions are accelerated to the surface. The basic principles and important characteristics of this newly developed process such as ion fluxes or deposition rates are shown. Because of pulsing the high voltage, the deposition temperature does not increase much. The adhesion, structure, morphology and internal stresses are influenced by these additional ion impacts. The columnar growth of the deposited films could be suppressed by using the superimposed pulse bias voltage without increasing the deposition temperature. Different metallizations (Cr and Cu) produced by arc and sputter ion plating are investigated. Carbon-fibre-reinforced epoxy are coated with PVD copper films for further treatment in electrochemical processes. (orig.)
SSP Technology Investigation of a High-Voltage DC-DC Converter
Pappas, J. A.; Grady, W. M.; George, Patrick J. (Technical Monitor)
2002-01-01
The goal of this project was to establish the feasibility of a high-voltage DC-DC converter based on a rod-array triggered vacuum switch (RATVS) for the Space Solar Power system. The RATVS has many advantages over silicon and silicon-carbide devices. The RATVS is attractive for this application because it is a high-voltage device that has already been demonstrated at currents in excess of the requirement for an SSP device and at much higher per-device voltages than existing or near-term solid state switching devices. The RATVS packs a much higher specific power rating than any solid-state device and it is likely to be more tolerant of its surroundings in space. In addition, pursuit of an RATVS-based system would provide NASA with a nearer-term and less expensive power converter option for the SSP.
Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors
Directory of Open Access Journals (Sweden)
Busi Rambabu
2014-01-01
Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.
Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors
Okuma, Takanori; Yasuura, Hiroto
2001-01-01
This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
High Input Voltage Discharge Supply for High Power Hall Thrusters Using Silicon Carbide Devices
Pinero, Luis R.; Scheidegger, Robert J.; Aulsio, Michael V.; Birchenough, Arthur G.
2014-01-01
A power processing unit for a 15 kW Hall thruster is under development at NASA Glenn Research Center. The unit produces up to 400 VDC with two parallel 7.5 kW discharge modules that operate from a 300 VDC nominal input voltage. Silicon carbide MOSFETs and diodes were used in this design because they were the best choice to handle the high voltage stress while delivering high efficiency and low specific mass. Efficiencies in excess of 97 percent were demonstrated during integration testing with the NASA-300M 20 kW Hall thruster. Electromagnet, cathode keeper, and heater supplies were also developed and will be integrated with the discharge supply into a vacuum-rated brassboard power processing unit with full flight functionality. This design could be evolved into a flight unit for future missions that requires high power electric propulsion.
Examples of remote handling of irradiated fuel assemblies in Germany
International Nuclear Information System (INIS)
Peehs, M.; Knecht, K.
1999-01-01
Examples for the remote handling of irradiated fuel in Germany are presented in the following areas: - fuel assembling pool service activities; - early encapsulation of spent fuel in the pool of a nuclear power plant (NPP) at the end of the wet storage period. All development in remote fuel assembly handling envisages minimization of the radioactive dose applied to the operating staff. In the service area a further key objective for applying advanced methods is to perform the work faster and at a higher quality standard. The early encapsulation is a new technology to provide the final packaging of spent fuel already in the pool of a NPP to ensure reliable handling for all further back end processes. (author)
Spectrum analysis of a voltage source converter due to semiconductor voltage drops
DEFF Research Database (Denmark)
Rasmussen, Tonny Wederberg; Eltouki, Mustafa
2017-01-01
It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...
Recommendations for cask features for robotic handling from the Advanced Handling Technology Project
International Nuclear Information System (INIS)
Drotning, W.
1991-02-01
This report describes the current status and recent progress in the Advanced Handling Technology Project (AHTP) initiated to explore the use of advanced robotic systems and handling technologies to perform automated cask handling operations at radioactive waste handling facilities, and to provide guidance to cask designers on the impact of robotic handling on cask design. Current AHTP tasks have developed system mock-ups to investigate robotic manipulation of impact limiters and cask tiedowns. In addition, cask uprighting and transport, using computer control of a bridge crane and robot, were performed to demonstrate the high speed cask transport operation possible under computer control. All of the current AHTP tasks involving manipulation of impact limiters and tiedowns require robotic operations using a torque wrench. To perform these operations, a pneumatic torque wrench and control system were integrated into the tool suite and control architecture of the gantry robot. The use of captured fasteners is briefly discussed as an area where alternative cask design preferences have resulted from the influence of guidance for robotic handling vs traditional operations experience. Specific robotic handling experiences with these system mock-ups highlight a number of continually recurring design principles: (1) robotic handling feasibility is improved by mechanical designs which emphasize operation with limited dexterity in constrained workspaces; (2) clearances, tolerances, and chamfers must allow for operations under actual conditions with consideration for misalignment and imprecise fixturing; (3) successful robotic handling is enhanced by including design detail in representations for model-based control; (4) robotic handling and overall quality assurance are improved by designs which eliminate the use of loose, disassembled parts. 8 refs., 15 figs
International Nuclear Information System (INIS)
Sahoo, N.C.; Prasad, K.
2006-01-01
This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration
ALTERATIONS IN ELECTROCARDIOGRAMS OF LABRADOR RETRIEVER DOGS DURING HANDLING WITH AND WITHOUT GLOVES
Directory of Open Access Journals (Sweden)
Swagat Mohapatra
2016-12-01
Full Text Available Healthy male Labrador Retriever dogs (n=8 aged between one to three years constituted the study material. The study was carried out to peruse the alterations in electrocardiograms, when the attendant restrained the dogs with bare hands and when the dogs were restrained by the attendant wearing gloves. The mean amplitude of P wave was higher in dogs handled with gloves. Similarly, the amplitudes of QRS complex and T wave were higher in the electrocardiograms of dogs handled with insulated hands. Meanwhile, the duration of T wave and Q-T interval were higher in the electrocardiograms recorded without gloves in hands. However, no alterations were perceived with respect to the duration of P wave, duration of T wave, the P-R interval, R-R interval and the heart rate. Except for the amplitude of P wave, no other differences were statistically significant. The study reported the alterations in the electrocardiogram while handling the animals with bare hands.
Application of high voltage electric field (HVEF) drying technology in potato chips
International Nuclear Information System (INIS)
Bai, Yaxiang; Shi, Hua; Yang, Yaxin
2013-01-01
In order to improve the drying efficiency and qualities of vegetable by high voltage electric field (HVEF), potato chips as a representative of vegetable was dried using a high voltage electric drying systems at 20°C. The shrinkage rate, water absorption and rehydration ratio of dried potato chips were measured. The results indicated that the drying rate of potato chips was significantly improved in the high voltage electric drying systems. The shrinkage rate of potato chips dried by high voltage electric field was 1.1% lower than that by oven drying method. And the rehydration rate of high voltage electric field was 24.6% higher than that by oven drying method. High voltage electric field drying is very advantageous and can be used as a substitute for traditional drying method.
Antonini, James M; Keane, Michael; Chen, Bean T; Stone, Samuel; Roberts, Jenny R; Schwegler-Berry, Diane; Andrews, Ronnee N; Frazer, David G; Sriram, Krishnan
2011-12-01
The goal was to determine if increasing welding voltage changes the physico-chemical properties of the fume and influences lung responses. Rats inhaled 40 mg/m³ (3 h/day × 3 days) of stainless steel (SS) welding fume generated at a standard voltage setting of 25 V (regular SS) or at a higher voltage (high voltage SS) of 30 V. Particle morphology, size and composition were characterized. Bronchoalveolar lavage was performed at different times after exposures to assess lung injury. Fumes collected from either of the welding conditions appeared as chain-like agglomerates of nanometer-sized primary particles. High voltage SS welding produced a greater number of ultrafine-sized particles. Fume generated by high voltage SS welding was higher in manganese. Pulmonary toxicity was more substantial and persisted longer after exposure to the regular SS fume. In summary, a modest raise in welding voltage affected fume size and elemental composition and altered the temporal lung toxicity profile.
Experimental validation of prototype high voltage bushing
Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.
2017-08-01
Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.
Thermometry in dielectrophoresis chips for contact-free cell handling
International Nuclear Information System (INIS)
Jaeger, M S; Mueller, T; Schnelle, T
2007-01-01
Cell biology applications, protocols in immunology and stem cell research, require that individual cells are handled under strict control of their contacts to other cells or synthetic surfaces. Dielectrophoresis (DEP) in microfluidic chips is an established technique to investigate, group, wash, cultivate and sort cells contact-free under physiological conditions: microelectrode octode cages, versatile dielectrophoretic elements energized with radio frequency electric fields, stably trap single cells or cellular aggregates. For medical applications and cell cultivation, possible side effects of the dielectrophoretic manipulation, such as membrane polarization and Joule heating, have to be quantified. Therefore, we characterized the electric field-induced warming in dielectrophoretic cages using ohmic resistance measurements, fluorometry, liquid crystal beads, infra-red thermography and bubble size thermometry. We compare the results of these techniques with respect to the influences of voltage, electric conductivity of buffer, frequency, cage size and electrode surface. We conclude that in the culture medium thermal effects may be neglected if low voltages and an electric field-reducing phase pattern are used. Our experimental results provide explicit values for estimating the thermal effect on dielectrophoretically caged cells and show that Joule heating is best minimized by optimizing the cage geometry and reducing the buffer conductivity. The results may additionally serve to evaluate and improve theoretical predictions on field-induced effects. Based on present-day chip processing possibilities, DEP is well suited for the manipulation of cells
Directory of Open Access Journals (Sweden)
Chaichana Amornchai
2017-01-01
Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.
Optimum voltage of auxiliary systems for thermal and nuclear power plants
International Nuclear Information System (INIS)
Tokumitsu, Iwao; Segawa, Motomichi
1979-01-01
In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)
Temporary over voltages in the high voltage networks
International Nuclear Information System (INIS)
Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto
2001-01-01
The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)
Voltage regulator for generator
Energy Technology Data Exchange (ETDEWEB)
Naoi, K
1989-01-17
It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.
Prediction of breakdown voltages in novel gases for high voltage insulation
International Nuclear Information System (INIS)
Koch, M.
2015-01-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media
Technical and economic aspects of the transmission of energy at extra high voltages
Energy Technology Data Exchange (ETDEWEB)
Kahnt, R
1967-01-01
The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.
Input-output rearrangement of isolated converters
DEFF Research Database (Denmark)
Madsen, Mickey Pierre; Kovacevic, Milovan; Mønster, Jakob Døllner
2015-01-01
This paper presents a new way of rearranging the input and output of isolated converters. The new arrangement posses several advantages, as increased voltage range, higher power handling capabilities, reduced voltage stress and improved efficiency, for applications where galvanic isolation...
Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility
STORK, Milan
2014-01-01
Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...
On-site voltage measurement with capacitive sensors on high voltage systems
Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.
2011-01-01
In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little
Distributed stability control using intelligent voltage-margin relay
Energy Technology Data Exchange (ETDEWEB)
Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology (Poland); Klimek, A. [Powertech Labs Inc., Surrey, BC (Canada)
2010-07-01
This paper presented an intelligent relay that operates if the load to source impedance ratio decreases to a level that is dangerously close to the stability limit, which leads to power system blackouts. The intelligent voltage-margin/difference relay installed at receiving substations automatically initiates action if the voltage stability margin drops to a dangerously low level. The relay decides if the tap changing devices are to be blocked and if under-voltage load shedding should be initiated, thereby mitigating an evolving instability. The intelligent relay has two levels of operation. At the first stage, which corresponds to the higher load to source impedance ratio, the relay initiates blocking of the tap changer. At the second stage, corresponding to the lower source to load impedance ratio, load shedding is initiated. The relay operates when the load to source impedance ratio reaches a certain predetermined level, but it does not depend either on the level of the source voltage or on the difference of source and load impedance phase angles. The algorithm for the relay is relatively simple and uses only locally available signals. Consequently, the transformer is well controlled to eliminate the cases of voltage instability. 6 refs., 7 figs.
Prediction of breakdown voltages in novel gases for high voltage insulation
Energy Technology Data Exchange (ETDEWEB)
Koch, M.
2015-07-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.
Rizk, Farouk AM
2014-01-01
Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec
Handling of Polyvinylsiloxane Versus Polyether for Implant Impressions.
Farhan, Daniel; Lauer, Wiebke; Heydecke, Guido; Aarabi, Ghazal; Reissmann, Daniel R
2016-01-01
This study compared polyvinylsiloxane with polyether in handling dental impressions. Each participant (N = 39) made four impressions, each a combination of pickup and reseating techniques with polyether or polyvinylsiloxane, of one implant cast representing a specific clinical situation (tooth gaps, limited residual dentition, or edentulous jaw). Handling of impressions was subsequently rated by using a 12-item questionnaire with 100-mm visual analog scales. While mean satisfaction scores were higher for polyvinylsiloxane than for polyether (69.5/63.0, P < .001), differences among subgroups were statistically significant only for pickup technique, limited residual dentition, and edentulous jaw. Implant impressions made with polyvinylsiloxane using a pickup technique seem to be the best option for most clinical situations.
Device for monitoring cell voltage
Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE
2012-08-21
A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.
High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC
Lizcano, M.
2017-01-01
High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.
Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings
Desrosiers, M. F.; Bandurski, R. S.
1988-01-01
The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.
Full scale tests on remote handled FFTF fuel assembly waste handling and packaging
International Nuclear Information System (INIS)
Allen, C.R.; Cash, R.J.; Dawson, S.A.; Strode, J.N.
1986-01-01
Handling and packaging of remote handled, high activity solid waste fuel assembly hardware components from spent FFTF reactor fuel assemblies have been evaluated using full scale components. The demonstration was performed using FFTF fuel assembly components and simulated components which were handled remotely using electromechanical manipulators, shielding walls, master slave manipulators, specially designed grapples, and remote TV viewing. The testing and evaluation included handling, packaging for current and conceptual shipping containers, and the effects of volume reduction on packing efficiency and shielding requirements. Effects of waste segregation into transuranic (TRU) and non-transuranic fractions also are discussed
Voltage stability in low voltage microgrids in aspects of active and reactive power demand
Directory of Open Access Journals (Sweden)
Parol Mirosław
2016-03-01
Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.
A Low-Power and Low-Voltage Power Management Strategy for On-Chip Micro Solar Cells
Directory of Open Access Journals (Sweden)
Ismail Cevik
2015-01-01
Full Text Available Fundamental characteristics of on-chip micro solar cell (MSC structures were investigated in this study. Several MSC structures using different layers in three different CMOS processes were designed and fabricated. Effects of PN junction structure and process technology on solar cell performance were measured. Parameters for low-power and low-voltage implementation of power management strategy and boost converter based circuits utilizing fractional voltage maximum power point tracking (FVMPPT algorithm were determined. The FVMPPT algorithm works based on the fraction between the maximum power point operation voltage and the open circuit voltage of the solar cell structure. This ratio is typically between 0.72 and 0.78 for commercially available poly crystalline silicon solar cells that produce several watts of power under typical daylight illumination. Measurements showed that the fractional voltage ratio is much higher and fairly constant between 0.82 and 0.85 for on-chip mono crystalline silicon micro solar cell structures that produce micro watts of power. Mono crystalline silicon solar cell structures were observed to result in better power fill factor (PFF that is higher than 74% indicating a higher energy harvesting efficiency.
76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop
2011-11-15
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...
A Low-input-voltage Wireless Power Transfer for Biomedical Implants
DEFF Research Database (Denmark)
Jiang, Hao; Bai, Kangjun; Zhu, Weijie
2015-01-01
Wireless power transfer is an essential technology to increase implants' longevity. A pair of inductivelycoupled coils operating at radio-frequency is extensively used to deliver electrical power to implants wirelessly. In this system, a power conditioning circuit is required convert the induced...... in the rectifier for the efficient AC to DC conversion. This requirement results in larger coil size, shorter operating distance or more stringent geometrical alignment between the two coils. In this paper, a low-input-voltage wireless power transfer has been demonstrated. In this system, the opencircuit voltage...... time-varying AC power harvested by the receiving coil to a stable DC power that is needed for powering circuits and sensors. Most existing power conditioning circuits require the induced voltage of the receiving coil to be significantly higher than the turn-on voltage of the diodes used...
Energy Technology Data Exchange (ETDEWEB)
Sahoo, N.C. [Faculty of Engineering and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia); Prasad, K. [Faculty of Information Science and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia)
2006-11-15
This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration. (author)
Constraint Handling Rules with Binders, Patterns and Generic Quantification
Serrano, Alejandro; Hage, J.
2017-01-01
Constraint Handling Rules provide descriptions for constraint solvers. However, they fall short when those constraints specify some binding structure, like higher-rank types in a constraint-based type inference algorithm. In this paper, the term syntax of constraints is replaced by λ-tree syntax, in
Mechanisms of Gain Control by Voltage-Gated Channels in Intrinsically-Firing Neurons
Patel, Ameera X.; Burdakov, Denis
2015-01-01
Gain modulation is a key feature of neural information processing, but underlying mechanisms remain unclear. In single neurons, gain can be measured as the slope of the current-frequency (input-output) relationship over any given range of inputs. While much work has focused on the control of basal firing rates and spike rate adaptation, gain control has been relatively unstudied. Of the limited studies on gain control, some have examined the roles of synaptic noise and passive somatic currents, but the roles of voltage-gated channels present ubiquitously in neurons have been less explored. Here, we systematically examined the relationship between gain and voltage-gated ion channels in a conductance-based, tonically-active, model neuron. Changes in expression (conductance density) of voltage-gated channels increased (Ca2+ channel), reduced (K+ channels), or produced little effect (h-type channel) on gain. We found that the gain-controlling ability of channels increased exponentially with the steepness of their activation within the dynamic voltage window (voltage range associated with firing). For depolarization-activated channels, this produced a greater channel current per action potential at higher firing rates. This allowed these channels to modulate gain by contributing to firing preferentially at states of higher excitation. A finer analysis of the current-voltage relationship during tonic firing identified narrow voltage windows at which the gain-modulating channels exerted their effects. As a proof of concept, we show that h-type channels can be tuned to modulate gain by changing the steepness of their activation within the dynamic voltage window. These results show how the impact of an ion channel on gain can be predicted from the relationship between channel kinetics and the membrane potential during firing. This is potentially relevant to understanding input-output scaling in a wide class of neurons found throughout the brain and other nervous systems
Ergonomic material-handling device
Barsnick, Lance E.; Zalk, David M.; Perry, Catherine M.; Biggs, Terry; Tageson, Robert E.
2004-08-24
A hand-held ergonomic material-handling device capable of moving heavy objects, such as large waste containers and other large objects requiring mechanical assistance. The ergonomic material-handling device can be used with neutral postures of the back, shoulders, wrists and knees, thereby reducing potential injury to the user. The device involves two key features: 1) gives the user the ability to adjust the height of the handles of the device to ergonomically fit the needs of the user's back, wrists and shoulders; and 2) has a rounded handlebar shape, as well as the size and configuration of the handles which keep the user's wrists in a neutral posture during manipulation of the device.
International Nuclear Information System (INIS)
Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan
1999-01-01
The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 micros (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract
Energy Technology Data Exchange (ETDEWEB)
Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan
1999-04-10
The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 {micro}s (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract.
Methodology for the assessment of possible damages in low voltage equipment due to lightning surges
Energy Technology Data Exchange (ETDEWEB)
Matsuo, Nelson M.; Kagan, Nelson [University of Sao Paulo (USP), SP (Brazil)], Emails: matsuonm@usp.br, nelsonk@pea.usp.br; Domingues, Ivo T. [AES Eletropaulo, SP (Brazil); Jesus, Nelson C. de [AES Sul, Porto Alegre, RS (Brazil); Silva, Marcelo H.I. da [Grupo Rede, Sao Paulo, SP (Brazil); Takauti, Edson H. [Bandeirante, Sao Paulo, SP (Brazil)
2007-07-01
This paper deals with the development of a methodology to assess the possibility of equipment damages in low voltage customers due to lightning surges. The main objective is to incorporate this methodology in a computation system that supports distribution companies to determine the possible causes of equipment damages claimed by customers and to decide whether the claims are to be reimbursed or not. The proposed methodology determines whether a specific customer could be affected by a lightning strike according to his/her location and to the lightning main parameters, by using data from a lightning detection system and from the specific equipment surge withstand capability. A specific study using ATP (Alternative Transients Program) was carried out to assess the propagation of lightning surges in electric power distribution systems and their impact over low voltage customers. On the other hand, the withstand capability of the main household appliances was determined by a series of tests carried out in the University's power quality laboratory. The paper details the modeling used for simulation, such as network configuration, grounding points, and modelling of insulator flashover, distribution transformer, low voltage loads. It also presents some results regarding the evaluation of over voltages in low voltage customers installations. A practical method is proposed for assessing the possibility of equipment damage and describes how the existing uncertainties were handled. Also, some issues regarding the withstand capability of electric household appliances to lightning surges are discussed and some results of the laboratory tests are presented. (author)
A voltage control method for an active capacitive DC-link module with series-connected circuit
DEFF Research Database (Denmark)
Wang, Haoran; Wang, Huai; Blaabjerg, Frede
2017-01-01
Many efforts have been made to improve the performance of power electronic systems with active capacitive DC-link module in terms of power density as well as reliability. One of the attractive solution is an active capacitive DC-link with the series-connected circuit because of handling small......-rated power. However, in the existing control method of this circuit, the DC-link current of the backward-stage or forward-stage need to be sensed for extracting the ripple components, which limits the flexibility of the active DC-link module. Thus, in this paper, a voltage control method of an active...... capacitive DC-link module is proposed. Current sensor at the DC-link will be cancel from the circuit. The controller of the series-connected circuit requires internal voltage signals of the DC-link module only, making it possible to be fully independent without any additional connection to the main circuit...
Influence of current limitation on voltage stability with voltage sourced converter HVDC
DEFF Research Database (Denmark)
Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela
2013-01-01
A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Effect of actuating voltage and discharge gap on plasma assisted detonation initiation process
Siyin, ZHOU; Xueke, CHE; Wansheng, NIE; Di, WANG
2018-06-01
The influence of actuating voltage and discharge gap on plasma assisted detonation initiation by alternating current dielectric barrier discharge was studied in detail. A loose coupling method was used to simulate the detonation initiation process of a hydrogen–oxygen mixture in a detonation tube under different actuating voltage amplitudes and discharge gap sizes. Both the discharge products and the detonation forming process assisted by the plasma were analyzed. It was found that the patterns of the temporal and spatial distributions of discharge products in one cycle keep unchanged as changing the two discharge operating parameters. However, the adoption of a higher actuating voltage leads to a higher active species concentration within the discharge zone, and atom H is the most sensitive to the variations of the actuating voltage amplitude among the given species. Adopting a larger discharge gap results in a lower concentration of the active species, and all species have the same sensitivity to the variations of the gap. With respect to the reaction flow of the detonation tube, the corresponding deflagration to detonation transition (DDT) time and distance become slightly longer when a higher actuating voltage is chosen. The acceleration effect of plasma is more prominent with a smaller discharge gap, and the benefit builds gradually throughout the DDT process. Generally, these two control parameters have little effect on the amplitude of the flow field parameters, and they do not alter the combustion degree within the reaction zone.
Influence of water trees on breakdown voltage of polymeric cables insulations
Energy Technology Data Exchange (ETDEWEB)
Stancu, Cristina [INCDIE ICPE CA, Bucharest (Romania); Notingher, Petru V.; Plopeanu, Mihai Gabriel [Politehnica University of Bucharest, Bucharest (Romania)
2011-07-01
In a previous paper was shown that water trees development modifies considerably the electric field repartition, which increases significantly in the vicinity of treed areas. In order to find the water trees influence on the breakdown voltage, in the present paper, an experimental study on model cables insulated with low density polyethylene is done. In insulation samples, water trees with various dimensions and densities were developed. For the reduction of the test duration, an electric field with a higher frequency (3-5 kHz) was used. For breakdown voltage measurement an automatic setup was realized. For each value of the ageing time the dimensions and densities of water trees and breakdown voltage were measured and the dependency of the breakdown voltage with these quantities were analysed. The results show a significant reduction of the breakdown voltage of treed cables insulations compared to un-treed ones. Key words: polyethylene, water treeing, electric field, breakdown, power cables.
Technological Aspects: High Voltage
Faircloth, D.C.
2013-12-16
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.
DEFF Research Database (Denmark)
Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav
2017-01-01
This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...
The relationship between emotional intelligence competencies and preferred conflict-handling styles.
Morrison, Jeanne
2008-11-01
The purpose of this study was to determine if a relationship exists between emotional intelligence (EI) and preferred conflict-handling styles of registered nurses. Conflict cannot be eliminated from the workplace therefore learning appropriate conflict-handling skills is important. Ninety-four registered nurses working in three south Mississippi healthcare facilities participated in this quantitative study. Ninety-two valid sets of data instruments were collected for this study. Higher levels of EI positively correlated with collaborating and negatively with accommodating. The issue of occupational stress and conflict among nurses is a major concern. It is imperative nurses learn how to effectively handle conflict in the work environment. Developing the competencies of EI and understanding how to effectively handle conflict is necessary for nurses working in a highly stressful occupation. Effective leadership management includes conflict management and collaboration. The art of relationship management is necessary when handling other people's emotions. When conflict is approached with high levels of EI, it creates an opportunity for learning effective interpersonal skills. Understanding how EI levels and conflict skills correlate can be used to improve interpersonal relationships in a healthcare facility.
Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level
DEFF Research Database (Denmark)
Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove
2004-01-01
power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...
International Nuclear Information System (INIS)
Nath, Madhumita; Roca i Cabarrocas, P.; Johnson, E.V.; Abramov, A.; Chatterjee, P.
2008-01-01
We have used a detailed electrical-optical computer model (ASDMP) in conjunction with the experimental characterization of microcrystalline silicon thin-film solar cells of different degrees of crystallinity (but having identical P- and N-layers) to understand the observed decrease of the open-circuit voltage with increasing crystalline fraction. In order to model all aspects of the experimental current density-voltage and quantum efficiency characteristics of cells having low (∼ 75%) and high (over 90%) crystalline fraction, we had to assume both a higher mobility gap defect density and a lower band gap for the more crystallized material. The former fact is widely known to bring down the open-circuit voltage. Our calculations also reveal that the proximity of the quasi-Fermi levels to the energy bands in the cell based on highly crystallized (and assumed to have a lower band gap) microcrystalline silicon results in higher free and trapped carrier densities in this device. The trapped hole population is particularly high at and close to the P/I interface on account of the higher inherent defect density in this region and the fact that the hole quasi-Fermi level is close to the valence band edge here. This fact results in a strong interface field, a collapse of the field in the volume, and hence a lower open-circuit voltage. Thus a combination of higher mobility gap defects and a lower band gap is probably the reason for the lower open-circuit voltage in cells based on highly crystallized microcrystalline silicon
How Farm Animals React and Perceive Stressful Situations Such As Handling, Restraint, and Transport
Directory of Open Access Journals (Sweden)
Temple Grandin
2015-12-01
Full Text Available An animal that has been carefully acclimated to handling may willingly re-enter a restrainer. Another animal may have an intense agitated behavioral reaction or refuse to re-enter the handling facility. Physiological measures of stress such as cortisol may be very low in the animal that re-enters willingly and higher in animals that actively resist restraint. Carefully acclimating young animals to handling and restraint can help improve both productivity and welfare by reducing fear stress. Some of the topics covered in this review are: How an animal perceives handling and restraint, the detrimental effects of a sudden novel event, descriptions of temperament and aversion tests and the importance of good stockmanship.
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Directory of Open Access Journals (Sweden)
Luciana C. C. B. Silva
2013-06-01
Full Text Available BACKGROUND: The handling of materials, which occurs in the industrial sector, is associated with lesions on the lumbar spine and in the upper limbs. Inserting handles in industrial boxes is a way to reduce work-related risks. Although the position and angle of the handles are significant factors in comfort and safety during handling, these factors have rarely been studied objectively. OBJECTIVE: To compare the handling of a commercial box and prototypes with handles and to evaluate the effects on upper limb posture, muscle electrical activity, and perceived acceptability using different grips while handling materials from different heights. METHOD: Thirty-seven healthy volunteers evaluated the handles of prototypes that allowed for changes in position (top and bottom and angle (0°, 15°, and 30°. Wrist, elbow, and shoulder movements were evaluated using electrogoniometry and inclinometry. The muscle electrical activity in the wrist extensors, biceps brachii, and the upper portion of the trapezius was measured using a portable electromyographer. The recorded data on muscle movements and electrical activity were synchronized. Subjective evaluations of acceptability were evaluated using a visual analog scale. RESULTS AND CONCLUSIONS: The prototypes with handles at a 30° angle produced the highest acceptability ratings, more neutral wrist positions, lower levels of electromyographic activity for the upper trapezius, and lower elevation angles for the arms. The different measurement methods were complementary in evaluating the upper limbs during handling.
New transport and handling contract
SC Department
2008-01-01
A new transport and handling contract entered into force on 1.10.2008. As with the previous contract, the user interface is the internal transport/handling request form on EDH: https://edh.cern.ch/Document/TransportRequest/ To ensure that you receive the best possible service, we invite you to complete the various fields as accurately as possible and to include a mobile telephone number on which we can reach you. You can follow the progress of your request (schedule, completion) in the EDH request routing information. We remind you that the following deadlines apply: 48 hours for the transport of heavy goods (up to 8 tonnes) or simple handling operations 5 working days for crane operations, transport of extra-heavy goods, complex handling operations and combined transport and handling operations in the tunnel. For all enquiries, the number to contact remains unchanged: 72202. Heavy Handling Section TS-HE-HH 72672 - 160319
Technological Aspects: High Voltage
International Nuclear Information System (INIS)
Faircloth, D C
2013-01-01
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)
DEFF Research Database (Denmark)
Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia
2014-01-01
The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...
Automatic voltage imbalance detector
Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.
1984-01-01
A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.
Bridger, R S; Cabion, N; Goedecke, J; Rickard, S; Schabort, E; Westgarth-Taylor, C; Lambert, M I
1997-11-01
Previous studies have suggested that the two-handled (levered) shovel is advantageous over the conventional spade from a biomechanical point of view. The aim of this experiment was to determine whether less energy was consumed while shovelling a load of sand with this shovel compared to a conventional tool. Accordingly, an experiment was designed in which subjects (n = 10) shovelled 1815 kg sand under laboratory conditions using either a conventional or a levered shovel. Heart rate and oxygen consumption were measured continuously during the trial and subjective data on perceived exertion, general fatigue and body discomfort were recorded after the trial. Although total energy expenditure was similar under both conditions (120 +/- 20 and 125 +/- 25 kcal; conventional versus two-handled spade), average heart rate was 4% higher when the two-handled shovel was used (p shovel (p shovel 1815 kg sand with the conventional shovel and the two-handled tool despite lower mass of sand per scoop with the latter. This can be explained by the fact that the increased mass of the additional handle compensated for the lower mass of sand per scoop. The higher average heart rate while shovelling with the two-handled shovel can be explained by the more erect posture.
Directory of Open Access Journals (Sweden)
Alicia Lundby
2008-06-01
Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Trends in Modern Exception Handling
Directory of Open Access Journals (Sweden)
Marcin Kuta
2003-01-01
Full Text Available Exception handling is nowadays a necessary component of error proof information systems. The paper presents overview of techniques and models of exception handling, problems connected with them and potential solutions. The aspects of implementation of propagation mechanisms and exception handling, their effect on semantics and general program efficiency are also taken into account. Presented mechanisms were adopted to modern programming languages. Considering design area, formal methods and formal verification of program properties we can notice exception handling mechanisms are weakly present what makes a field for future research.
Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks
Pace, D. C.; Austin, M. E.; Bardoczi, L.; Collins, C. S.; Crowley, B.; Davis, E.; Du, X.; Ferron, J.; Grierson, B. A.; Heidbrink, W. W.; Holcomb, C. T.; McKee, G. R.; Pawley, C.; Petty, C. C.; Podestà, M.; Rauch, J.; Scoville, J. T.; Spong, D. A.; Thome, K. E.; Van Zeeland, M. A.; Varela, J.; Victor, B.
2018-05-01
An engineering upgrade to the neutral beam system at the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)] enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic ( E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2 MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities and results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.
Energy Technology Data Exchange (ETDEWEB)
Ivanov, P. A., E-mail: Pavel.Ivanov@mail.ioffe.ru; Potapov, A. S.; Samsonova, T. P.; Grekhov, I. V. [Ioffe Physical–Technical Institute (Russian Federation)
2017-03-15
p{sup +}–n{sub 0}–n{sup +} 4H-SiC diodes with homogeneous avalanche breakdown at 1860 V are fabricated. The pulse current–voltage characteristics are measured in the avalanche-breakdown mode up to a current density of 4000 A/cm{sup 2}. It is shown that the avalanche-breakdown voltage increases with increasing temperature. The following diode parameters are determined: the avalanche resistance (8.6 × 10{sup –2} Ω cm{sup 2}), the electron drift velocity in the n{sub 0} base at electric fields higher than 10{sup 6} V/cm (7.8 × 10{sup 6} cm/s), and the relative temperature coefficient of the breakdown voltage (2.1 × 10{sup –4} K{sup –1}).
International Nuclear Information System (INIS)
Sato, Shinri
1985-01-01
In nuclear power facilities, the management of radioactive wastes is made with its technology plus the automatic techniques. Under the radiation field, the maintenance or aid of such systems is important. To cope with this situation, MF-2 system, MF-3 system and a manipulator system as remote handling machines are described. MF-2 system consists of an MF-2 carrier truck, a control unit and a command trailer. It is capable of handling heavy-weight objects. The system is not by hydraulic but by electrical means. MF-3 system consists of a four-crawler truck and a manipulator. The truck is versatile in its posture by means of the four independent crawlers. The manipulator system is bilateral in operation, so that the delicate handling is made possible. (Mori, K.)
Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control
DEFF Research Database (Denmark)
Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal
2014-01-01
This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...
Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.
Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong
2017-10-23
The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.
Directory of Open Access Journals (Sweden)
Lee Gyu-sub
2016-01-01
Full Text Available The exhaustion of fossil fuel and the greenhouse gas emission are one of the most significant energy and environmental issues, respectively. Photovoltaic (PV generators and battery energy storage systems (BESSs have been significantly increased for recent years. The BESSs are mainly used for smoothing active power fluctuation of the PV. In this paper, PV–BESSs integration of two DC/DC converters and one AC/DC converter is investigated and DC-link voltage control to compensate the AC voltage deviation is proposed for the PV‒BESS system in low-voltage (LV networks.
High-voltage transistor converter for pulsed x-ray sources
International Nuclear Information System (INIS)
Krasil'nikov, S.B.; Kristalinskii, A.L.; Lozovoi, L.N.; Markov, S.N.; Sindalovskii, E.I.
1986-01-01
A 24-V/12-kV converter for MIRA-2D and NORA pulsed x-ray sources is described. When the low-voltage supply varies within 20-26 V, the frequency stability of the x-ray pulses is higher by a factor of 3 ≅ 3 than when the PRIMA converter is used. For 14-24 V, the average output power of the converter is independent of the load impedance and increases linearly with an increase in supply voltage. The efficiency of the converter reaches 60%. The converter operates in the temperature range of -40 to +60 0 C
Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer
DEFF Research Database (Denmark)
Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev
1999-01-01
bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
High voltage generator circuit with low power and high efficiency applied in EEPROM
International Nuclear Information System (INIS)
Liu Yan; Zhang Shilin; Zhao Yiqiang
2012-01-01
This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)
Safety of Cargo Aircraft Handling Procedure
Directory of Open Access Journals (Sweden)
Daniel Hlavatý
2017-07-01
Full Text Available The aim of this paper is to get acquainted with the ways how to improve the safety management system during cargo aircraft handling. The first chapter is dedicated to general information about air cargo transportation. This includes the history or types of cargo aircraft handling, but also the means of handling. The second part is focused on detailed description of cargo aircraft handling, including a description of activities that are performed before and after handling. The following part of this paper covers a theoretical interpretation of safety, safety indicators and legislative provisions related to the safety of cargo aircraft handling. The fourth part of this paper analyzes the fault trees of events which might occur during handling. The factors found by this analysis are compared with safety reports of FedEx. Based on the comparison, there is a proposal on how to improve the safety management in this transportation company.
Kind, Dieter
2001-01-01
The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al
International Nuclear Information System (INIS)
Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.
1988-01-01
The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns
Directory of Open Access Journals (Sweden)
M. R. Aghamohammadi
2011-06-01
Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.
Effects of symmetrical voltage sags on squirrel-cage induction motors
Energy Technology Data Exchange (ETDEWEB)
Pedra, Joaquin; Sainz, Luis; Corcoles, Felipe [Department of Electrical Engineering, ETSEIB-UPC, Av. Diagonal, 647, 08028 Barcelona (Spain)
2007-10-15
This paper analyzes the symmetrical voltage sag consequences on the induction motor behavior when single- and double-cage models are considered, namely current and torque peaks, and speed loss. These effects depend on several variables like sag type, duration and depth. Voltage sag effects are studied by using single- and double-cage models for three motors of different rated power. The double-cage model always predicts torque and current peaks higher than those of the single-cage model. The single-cage model predicts that voltage sags can produce motor instability, whereas the double-cage model is always stable. Therefore, the double-cage model must be used for the simulation of the squirrel-cage induction motor, because the single-cage model can give erroneous results in some situations. (author)
A physical workload index to evaluate a safe resident handling program for nursing home personnel.
Kurowski, Alicia; Buchholz, Bryan; Punnett, Laura
2014-06-01
The aim of this study was to obtain a comprehensive analysis of the physical workload of clinical staff in long-term care facilities, before and after a safe resident handling program (SRHP). Ergonomic exposures of health care workers include manual handling of patients and many non-neutral postures. A comprehensive assessment requires the integration of loads from these varied exposures into a single metric. The Postures, Activities, Tools, and Handling observational protocol, customized for health care, was used for direct observations of ergonomic exposures in clinical jobs at 12 nursing homes before the SRHP and 3, 12, 24, and 36 months afterward. Average compressive forces on the spine were estimated for observed combinations of body postures and manual handling and then weighted by frequencies of observed time for the combination. These values were summed to obtain a biomechanical index for nursing assistants and nurses across observation periods. The physical workload index (PWI) was much higher for nursing assistants than for nurses and decreased more after 3 years (-24% versus -2.5%). Specifically during resident handling, the PWI for nursing assistants decreased by 41% of baseline value. Spinal loading was higher for nursing assistants than for nurses in long-term care centers. Both job groups experienced reductions in physical loading from the SRHP, especially the nursing assistants and especially while resident handling. The PWI facilitates a comprehensive investigation of physical loading from both manual handling and non-neutral postures. It can be used in any work setting to identify high-risk tasks and determine whether reductions in one exposure are offset by increases in another.
Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages
Energy Technology Data Exchange (ETDEWEB)
An, Seok Chan; Kim, Jin Sub [Yonsei University, Seoul (Korea, Republic of); Chu, Yong [National Fusion Research Institute(NFRI), Daejeon (Korea, Republic of)
2016-03-15
Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals.
Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages
International Nuclear Information System (INIS)
An, Seok Chan; Kim, Jin Sub; Chu, Yong
2016-01-01
Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals
Ergonomics and patient handling.
McCoskey, Kelsey L
2007-11-01
This study aimed to describe patient-handling demands in inpatient units during a 24-hour period at a military health care facility. A 1-day total population survey described the diverse nature and impact of patient-handling tasks relative to a variety of nursing care units, patient characteristics, and transfer equipment. Productivity baselines were established based on patient dependency, physical exertion, type of transfer, and time spent performing the transfer. Descriptions of the physiological effect of transfers on staff based on patient, transfer, and staff characteristics were developed. Nursing staff response to surveys demonstrated how patient-handling demands are impacted by the staff's physical exertion and level of patient dependency. The findings of this study describe the types of transfers occurring in these inpatient units and the physical exertion and time requirements for these transfers. This description may guide selection of the most appropriate and cost-effective patient-handling equipment required for specific units and patients.
Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching
Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest
2017-09-01
A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k = 2) at 1 MHz and 0.5 part in 106 (k = 2) at 100 kHz is within reach.
Equipment for the handling of thorium materials
International Nuclear Information System (INIS)
Heisler, S.W. Jr.; Mihalovich, G.S.
1988-01-01
The Feed Materials Production Center (FMPC) is the United States Department of Energy's storage facility for thorium. FMPC thorium handling and overpacking projects ensure the continued safe handling and storage of the thorium inventory until final disposition of the materials is determined and implemented. The handling and overpacking of the thorium materials requires the design of a system that utilizes remote handling and overpacking equipment not currently utilized at the FMPC in the handling of uranium materials. The use of remote equipment significantly reduces radiation exposure to personnel during the handling and overpacking efforts. The design system combines existing technologies from the nuclear industry, the materials processing and handling industry and the mining industry. The designed system consists of a modified fork lift truck for the transport of thorium containers, automated equipment for material identification and inventory control, and remote handling and overpacking equipment for material identification and inventory control, and remote handling and overpacking equipment for repackaging of the thorium materials
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam
Andreev, Andrey
2005-10-01
The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.
... Handle Abuse KidsHealth / For Kids / How to Handle Abuse What's in this article? Tell Right Away How Do You Know Something Is Abuse? ... babysitter, teacher, coach, or a bigger kid. Child abuse can happen anywhere — at ... building. Tell Right Away A kid who is being seriously hurt ...
Waste Handling Building Conceptual Study
International Nuclear Information System (INIS)
G.W. Rowe
2000-01-01
The objective of the ''Waste Handling Building Conceptual Study'' is to develop proposed design requirements for the repository Waste Handling System in sufficient detail to allow the surface facility design to proceed to the License Application effort if the proposed requirements are approved by DOE. Proposed requirements were developed to further refine waste handling facility performance characteristics and design constraints with an emphasis on supporting modular construction, minimizing fuel inventory, and optimizing facility maintainability and dry handling operations. To meet this objective, this study attempts to provide an alternative design to the Site Recommendation design that is flexible, simple, reliable, and can be constructed in phases. The design concept will be input to the ''Modular Design/Construction and Operation Options Report'', which will address the overall program objectives and direction, including options and issues associated with transportation, the subsurface facility, and Total System Life Cycle Cost. This study (herein) is limited to the Waste Handling System and associated fuel staging system
DEFF Research Database (Denmark)
Ræbild, Ulla
to touch, pick up, carry, or feel with the hands. Figuratively it is to manage, deal with, direct, train, or control. Additionally, as a noun, a handle is something by which we grasp or open up something. Lastly, handle also has a Nordic root, here meaning to trade, bargain or deal. Together all four...... meanings seem to merge in the fashion design process, thus opening up for an embodied engagement with matter that entails direction giving, organizational management and negotiation. By seeing processes of handling as a key fashion methodological practice, it is possible to divert the discourse away from...... introduces four ways whereby fashion designers apply their own bodies as tools for design; a) re-activating past garment-design experiences, b) testing present garment-design experiences c) probing for new garment-design experiences and d) design of future garment experiences by body proxy. The paper...
DEFF Research Database (Denmark)
Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob
2014-01-01
This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...
DEFF Research Database (Denmark)
Tang, Yi; Zhu, Dexuan; Jin, Chi
2015-01-01
voltages, and it will be very suitable for high-power applications where the output voltage can be either lower or higher than the peak ac input voltage, e.g., plug-in hybrid electric vehicle charging systems. Moreover, the involved dc/dc buck conversion stage may only need to process partial input power...
Effect of anodizing voltage on the sorption of water molecules on porous alumina
Energy Technology Data Exchange (ETDEWEB)
Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)
2012-05-01
The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).
ERROR HANDLING IN INTEGRATION WORKFLOWS
Directory of Open Access Journals (Sweden)
Alexey M. Nazarenko
2017-01-01
Full Text Available Simulation experiments performed while solving multidisciplinary engineering and scientific problems require joint usage of multiple software tools. Further, when following a preset plan of experiment or searching for optimum solu- tions, the same sequence of calculations is run multiple times with various simulation parameters, input data, or conditions while overall workflow does not change. Automation of simulations like these requires implementing of a workflow where tool execution and data exchange is usually controlled by a special type of software, an integration environment or plat- form. The result is an integration workflow (a platform-dependent implementation of some computing workflow which, in the context of automation, is a composition of weakly coupled (in terms of communication intensity typical subtasks. These compositions can then be decomposed back into a few workflow patterns (types of subtasks interaction. The pat- terns, in their turn, can be interpreted as higher level subtasks.This paper considers execution control and data exchange rules that should be imposed by the integration envi- ronment in the case of an error encountered by some integrated software tool. An error is defined as any abnormal behavior of a tool that invalidates its result data thus disrupting the data flow within the integration workflow. The main requirementto the error handling mechanism implemented by the integration environment is to prevent abnormal termination of theentire workflow in case of missing intermediate results data. Error handling rules are formulated on the basic pattern level and on the level of a composite task that can combine several basic patterns as next level subtasks. The cases where workflow behavior may be different, depending on user's purposes, when an error takes place, and possible error handling op- tions that can be specified by the user are also noted in the work.
International Nuclear Information System (INIS)
Yamada, Koji
1987-01-01
Automatic handling device for the steam relief valves (SRV's) is developed in order to achieve a decrease in exposure of workers, increase in availability factor, improvement in reliability, improvement in safety of operation, and labor saving. A survey is made during a periodical inspection to examine the actual SVR handling operation. An SRV automatic handling device consists of four components: conveyor, armed conveyor, lifting machine, and control/monitoring system. The conveyor is so designed that the existing I-rail installed in the containment vessel can be used without any modification. This is employed for conveying an SRV along the rail. The armed conveyor, designed for a box rail, is used for an SRV installed away from the rail. By using the lifting machine, an SRV installed away from the I-rail is brought to a spot just below the rail so that the SRV can be transferred by the conveyor. The control/monitoring system consists of a control computer, operation panel, TV monitor and annunciator. The SRV handling device is operated by remote control from a control room. A trial equipment is constructed and performance/function testing is carried out using actual SRV's. As a result, is it shown that the SRV handling device requires only two operators to serve satisfactorily. The required time for removal and replacement of one SRV is about 10 minutes. (Nogami, K.)
Kobayashi, Akihiro; Misumida, Naoki; Aoi, Shunsuke; Kanei, Yumiko
Low QRS voltage was reported to predict adverse outcomes in acute myocardial infarction in the pre-thrombolytic era. However, the association between low voltage and angiographic findings has not been fully addressed. We performed a retrospective analysis of patients with anterior ST-segment elevation myocardial infarction (STEMI). Low QRS voltage was defined as either peak to peak QRS complex voltage voltage. Patients with low voltage had a higher rate of multi-vessel disease (MVD) (76% vs. 52%, p=0.01). Patients with low voltage were more likely to undergo coronary artery bypass grafting (CABG) during admission (11% vs. 2%, p=0.028). Low voltage was an independent predictor for MVD (OR 2.50; 95% CI 1.12 to 6.03; p=0.032). Low QRS voltage was associated with MVD and in-hospital CABG in anterior STEMI. Copyright © 2017 Elsevier Inc. All rights reserved.
Symmetric voltage-controlled variable resistance
Vanelli, J. C.
1978-01-01
Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Harris, Troy G.; Minor, John
This text for a secondary- or postecondary-level course in grain handling and storage contains ten chapters. Chapter titles are (1) Introduction to Grain Handling and Storage, (2) Elevator Safety, (3) Grain Grading and Seed Identification, (4) Moisture Control, (5) Insect and Rodent Control, (6) Grain Inventory Control, (7) Elevator Maintenance,…
Organic dielectrics in high voltage cables
Energy Technology Data Exchange (ETDEWEB)
Vermeer, J
1962-03-01
It appears that the limit has been reached in the applicability of oil-impregnated paper as the dielectric for ehv cables, as with rising voltages the prevention of conductor losses becomes increasingly difficult, while the dielectric losses of the insulation, increasing as the square of the voltage, contribute to a greater extent to the temperature rise of the conductor. The power transmitting capacity of ehv cables reaches a maximum at 500 to 600 kV for these reasons. Apart from artificial cooling, a substantial improvement can be obtained only with the use of insulating materials with much lower dielectric losses; these can moreover be applied with a smaller wall thickness, but this means higher field strengths. Synthetic polymer materials meet these requirements but can be used successfully only in the form of lapped film tapes impregnated with suitable liquids. The electrical properties of these heterogeneous dielectrics, in particular, their impulse breakdown strengths are studied in detail.
Groupe ST/HM
2002-01-01
A new EDH document entitled 'Transport/Handling Request' will be in operation as of Monday, 11th February 2002, when the corresponding icon will be accessible from the EDH desktop, together with the application instructions. This EDH form will replace the paper-format transport/handling request form for all activities involving the transport of equipment and materials. However, the paper form will still be used for all vehicle-hire requests. The introduction of the EDH transport/handling request form is accompanied by the establishment of the following time limits for the various services concerned: 24 hours for the removal of office items, 48 hours for the transport of heavy items (of up to 6 metric tons and of standard road width), 5 working days for a crane operation, extra-heavy transport operation or complete removal, 5 working days for all transport operations relating to LHC installation. ST/HM Group, Logistics Section Tel: 72672 - 72202
International Nuclear Information System (INIS)
Chang, Chih-Hao; Wu, Zih-Jyun; Liang, Yi-Hu; Chang, Yu-Shuo; Chiu, Chuan-Hao; Tai, Cheng-Wei; Chang, Hsin-Hua
2013-01-01
In general, organic light-emitting devices (OLEDs) need to operate at higher current density levels to ensure an ample light flux. However, stressed operation will result in poor performance and limited device lifetime. Recently, a tandem structure has been proposed as a pivotal technique to meet the stringent lighting requirements for OLED commercialization, with a research focus on decreasing the concomitant higher operation voltage. Driving two connected emission units (EMUs) in a tandem structure often requires more than twice the driving voltage for a single EMU. This study investigates bipolar host materials and their effective employment in fabricating tandem white phosphorescent OLEDs (PhOLEDs). In addition, the design of a mechanism to align the energy level between the hole transport layer/emitting layer is shown to effectively mitigate operational voltages. In sharp contrast to devices using a unipolar host material, we demonstrate that the turn-on voltage of blue PhOLEDs could be decreased from 3.8 V to 2.7 V through utilizing a bipolar host. Furthermore, applying the proposed techniques to tandem white PhOLEDs produces a luminance of 10 3 cd/m 2 by a 10.1 V driving voltage. - Highlights: • The matched energy level between the hole transport/emitting layer lowers voltages. • Multiple conduction dopants were used to investigate charge generation layer. • Two-color emitters were used to quantify the charge generation strength
Factors influencing oncology nurses' use of hazardous drug safe-handling precautions.
Polovich, Martha; Clark, Patricia C
2012-05-01
To examine relationships among factors affecting nurses' use of hazardous drug (HD) safe-handling precautions, identify factors that promote or interfere with HD precaution use, and determine managers' perspectives on the use of HD safe-handling precautions. Cross-sectional, mixed methods; mailed survey to nurses who handle chemotherapy and telephone interviews with managers. Mailed invitation to oncology centers across the United States. 165 nurses who reported handling chemotherapy and 20 managers of nurses handling chemotherapy. Instruments measured the use of HD precautions and individual and organizational factors believed to influence precaution use. Data analysis included descriptive statistics and hierarchical regression. Manager interview data were analyzed using content analysis. Chemotherapy exposure knowledge, self-efficacy, perceived barriers, perceived risk, interpersonal influences, and workplace safety climate. Nurses were well educated, experienced, and certified in oncology nursing. The majority worked in outpatient settings and administered chemotherapy to an average of 6.8 patients per day. Exposure knowledge, self-efficacy for using personal protective equipment, and perceived risk of harm from HD exposure were high; total precaution use was low. Nurse characteristics did not predict HD precaution use. Fewer barriers, better workplace safety climate, and fewer patients per day were independent predictors of higher HD precaution use. HD handling policies were present, but many did not reflect current recommendations. Few managers formally monitored nurses' HD precaution use. Circumstances in the workplace interfere with nurses' use of HD precautions. Interventions should include fostering a positive workplace safety climate, reducing barriers, and providing appropriate nurse-patient ratios.
Bottlenecks reduction using superconductors in high voltage transmission lines
Directory of Open Access Journals (Sweden)
Daloub Labib
2016-01-01
Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.
Artificial intelligence techniques for voltage control
Energy Technology Data Exchange (ETDEWEB)
Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.
1997-12-31
In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)
A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level
DEFF Research Database (Denmark)
Newman, M.J.; Holmes, D.G.; Nielsen, J.G.
2005-01-01
Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... be advantageous if the series-connected inverter of a DVR could also be used to compensate for any steady-state load voltage harmonics, since this would increase the power quality "value-added" benefits to the grid system. However, before this can be done, consideration must be given to the control of steady......-state power through the DVR, the increased losses, and the low modulation depths at which the scheme must operate to achieve acceptable harmonic compensation performance. This paper presents a selective harmonic feedback control strategy that can be easily added to medium-voltage DVR systems to provide...
Impact of distributed generators on the power loss and voltage profile of sub-transmission network
Directory of Open Access Journals (Sweden)
A.S.O. Ogunjuyigbe
2016-05-01
Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
Sensing voltage across lipid membranes
Swartz, Kenton J.
2009-01-01
The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925
Study the flashover voltage for outdoor polymer insulators under desert climatic conditions
Directory of Open Access Journals (Sweden)
L.S. Nasrat
2013-06-01
Results showed that flashover voltage reaches to 38 kV for samples without filler and 47 kV for samples containing 50% of ATH filler in dry condition. A comparison between inorganic fillers under various environmental conditions showed higher flashover voltage values for samples containing ATH filler than that of samples containing H3BO3 and Mg(OH2 fillers at all filler concentrations. Flashover voltage increases 24% by adding ATH filler for polyester samples under sandstorm conditions. Also, in this study, the effects of sandstorm, ultra violet (UV radiation, mechanical strength (compressive and tensile strengths and thermal performance with respect to surface of the sample under test have been investigated in detail.
76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda
2011-11-22
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...
Cask system design guidance for robotic handling
International Nuclear Information System (INIS)
Griesmeyer, J.M.; Drotning, W.D.; Morimoto, A.K.; Bennett, P.C.
1990-10-01
Remote automated cask handling has the potential to reduce both the occupational exposure and the time required to process a nuclear waste transport cask at a handling facility. The ongoing Advanced Handling Technologies Project (AHTP) at Sandia National Laboratories is described. AHTP was initiated to explore the use of advanced robotic systems to perform cask handling operations at handling facilities for radioactive waste, and to provide guidance to cask designers regarding the impact of robotic handling on cask design. The proof-of-concept robotic systems developed in AHTP are intended to extrapolate from currently available commercial systems to the systems that will be available by the time that a repository would be open for operation. The project investigates those cask handling operations that would be performed at a nuclear waste repository facility during cask receiving and handling. The ongoing AHTP indicates that design guidance, rather than design specification, is appropriate, since the requirements for robotic handling do not place severe restrictions on cask design but rather focus on attention to detail and design for limited dexterity. The cask system design features that facilitate robotic handling operations are discussed, and results obtained from AHTP design and operation experience are summarized. The application of these design considerations is illustrated by discussion of the robot systems and their operation on cask feature mock-ups used in the AHTP project. 11 refs., 11 figs
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
Production management of window handles
Directory of Open Access Journals (Sweden)
Manuela Ingaldi
2014-12-01
Full Text Available In the chapter a company involved in the production of aluminum window and door handles was presented. The main customers of the company are primarily companies which produce PCV joinery and wholesalers supplying these companies. One chosen product from the research company - a single-arm pin-lift window handle - was described and its production process depicted technologically. The chapter also includes SWOT analysis conducted in the research company and the value stream of the single-arm pin-lift window handle.
2010-01-01
... 7 Agriculture 3 2010-01-01 2010-01-01 false Whey handling. 58.443 Section 58.443 Agriculture... Procedures § 58.443 Whey handling. (a) Adequate sanitary facilities shall be provided for the handling of whey. If outside, necessary precautions shall be taken to minimize flies, insects and development of...
Distance protection of multiple-circuit shared tower transmission lines with different voltages
DEFF Research Database (Denmark)
Silva, Filipe Miguel Faria da; Bak, Claus Leth
2017-01-01
combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...
Daikin Advanced Lithium Ion Battery Technology – High Voltage Electrolyte - REVISED
Energy Technology Data Exchange (ETDEWEB)
Sunstrom, Joseph [Daikin America, Inc., Orangeburg, NY (United States); Hendershot, Ron E. [Daikin America, Inc., Orangeburg, NY (United States)
2017-03-06
An evaluation of high voltage electrolytes which contain fluorochemicals as solvents/additive has been completed with the objective of formulating a safe, stable electrolyte capable of operation to 4.6 V. Stable cycle performance has been demonstrated in LiNi1/3Mn1/3Co1/3O2 (NMC111)/graphite cells to 4.5 V. The ability to operate at high voltage results in significant energy density gain (>30%) which would manifest as longer battery life resulting in higher range for electric vehicles. Alternatively, a higher energy density battery can be made smaller without sacrificing existing energy. In addition, the fluorinated electrolytes examined showed better safety performance when tested in abuse conditions. The results are promising for future advanced battery development for vehicles as well as other applications.
Medication-handling challenges among visually impaired population
Directory of Open Access Journals (Sweden)
Ling Zhi-Han
2017-01-01
Full Text Available Objective: Visually impaired individuals are particularly at higher risk for experiencing a medication error. The aim of this study is to identify the problems encountered by the visually impaired population when handling their medication. Methods: A cross-sectional survey was conducted using an interviewer-guided questionnaire with 100 visually impaired individuals. The questionnaire comprised a series of questions in medication management. Results: All of the respondents perceived that self-administration of medication was a challenging task. A total of 89% of respondents were unable to read the prescription labels, 75% of respondents did not know the expiry date of their own medication, and 58% of respondents did not know the name of the medication. With regard to storage of medication, 72% of respondents did not practice appropriate methods to store their medication, and 80% of respondents kept the unused medication. All of the respondents disposed leftover medication through household rubbish. A total of 64% of respondents never practice medication review. Most (96% of them did not tell health-care providers when they faced difficulties in handling their medication. Conclusion: Most of the visually impaired individuals did not receive appropriate assistance regarding medicine use and having low awareness in medication management. This can lead to increased risk of medication errors or mismanagement among visually impaired population. Hence, effective strategies, especially in pharmaceutical care services, should be structured to assist this special population in medication handling.
Ultra Low-Voltage Energy Harvesting
2013-09-01
if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE
International Nuclear Information System (INIS)
Wang Yongshun; Rui Li; Adnan Ghaffar; Wang Zaixing; Liu Chunjuan
2015-01-01
In order to improve the reverse voltage capacity and low junction temperature characteristics of the traditional silicon-based Schottky diode, a Schottky diode with high reverse voltage capacity and high junction temperature was fabricated using ion implantation, NiPt60 sputtering, silicide-forming and other major technologies on an N-type silicon epitaxial layer of 10.6–11.4 μm and (2.2–2.4) × 10 15 cm −3 doping concentration. The measurement results show that the junction temperature of the Schottky diode fabricated can reach 175 °C, that is 50 °C higher than that of the traditional one; the reverse voltage capacity V R can reach 112 V, that is 80 V higher than that of the traditional one; the leakage current is only 2 μA and the forward conduction voltage drop is V F = 0.71 V at forward current I F = 3 A. (semiconductor devices)
Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV
DEFF Research Database (Denmark)
Demirok, Erhan; Sera, Dezso; Teodorescu, Remus
2010-01-01
Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....
Development of commercial robots for radwaste handling
International Nuclear Information System (INIS)
Colborn, K.A.
1988-01-01
The cost and dose burden associated with low level radwaste handling activities is a matter of increasing concern to the commercial nuclear power industry. This concern is evidenced by the fact that many utilities have begun to revaluate waste generation, handling, and disposal activities at their plants in an effort to improve their overall radwaste handling operations. This paper reports on the project Robots for Radwaste Handling, to identify the potential of robots to improve radwaste handling operations. The project has focussed on the potential of remote or automated technology to improve well defined, recognizable radwaste operations. The project focussed on repetitive, low skill level radwaste handling and decontamination tasks which involve significant radiation exposure
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
Benchmarking of Voltage Sag Generators
DEFF Research Database (Denmark)
Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang
2012-01-01
The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...
International Nuclear Information System (INIS)
1987-09-01
This plan describes the preoperational checkout for handling Remote-Handled Transuranic (RH-TRU) Wastes from their receipt at the Waste Isolation Pilot Plant (WIPP) to their emplacement underground. This plan identifies the handling operations to be performed, personnel groups responsible for executing these operations, and required equipment items. In addition, this plan describes the quality assurance that will be exercised throughout the checkout, and finally, it establishes criteria by which to measure the success of the checkout. 7 refs., 5 figs
Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission
Energy Technology Data Exchange (ETDEWEB)
1977-11-01
For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.
Preference Handling for Artificial Intelligence
Goldsmith, Judy; University of Kentucky; Junker, Ulrich; ILOG
2009-01-01
This article explains the benefits of preferences for AI systems and draws a picture of current AI research on preference handling. It thus provides an introduction to the topics covered by this special issue on preference handling.
Religious Serpent Handling and Community Relations.
Williamson, W Paul; Hood, Ralph W
2015-01-01
Christian serpent handling sects of Appalachia comprise a community that has long been mischaracterized and marginalized by the larger communities surrounding them. To explore this dynamic, this article traces the emergence of serpent handling in Appalachia and the emergence of anti-serpent-handling state laws, which eventually failed to curb the practice, as local communities gave serpent handling groups support. We present two studies to consider for improving community relations with serpent handling sects. In study 1, we present data relating the incidence of reported serpent-bite deaths with the rise of anti-serpent-handling laws and their eventual abatement, based on increasing acceptance of serpent handlers by the larger community. Study 2 presents interview data on serpent bites and death that provide explanations for these events from the cultural and religious perspective. We conclude that first-hand knowledge about serpent handlers, and other marginalized groups, helps to lessen suspicion and allows them to be seen as not much different, which are tendencies that are important for promoting inter-community harmony.
Assessment of dose using TLD during activity handling at RPhL, BRIT
International Nuclear Information System (INIS)
Choughule, Nitin V.; Bairwa, S.M.; Murali, S.; Rakesh, R.B.; Madhumita, B.; Adtani, M.M.; Mehra, Kiran; Padmanabhan, D.; Borkute, S.D.; Pal, N.; Sachdev, S.S.
2012-01-01
Radiopharmaceutical Lab (RPhL), BRIT undertakes production, supply of radiopharmaceuticals. At RPhL short lived isotopes 131 I, 99 Mo, 99m Tc, 125 I, 153 Sm, 32 P and 51 Cr, are handled with total activity handled per week ranging from MBq to TBq (mCiCi). Radiological survey provides idea on radiation level helps to ensure safe working condition. In order to improve the working condition and to estimate the integrated dose over a period of week with uniform pattern of activity handling in the period, a study was carried out using TLD badges. Specifically prepared TLD badges containing CaSO 4 :Dy phosphor were placed at various locations at RPhL It is used for personnel monitoring. One set of TLD was exposed for a week long period while the other set was exposed only during activity handling, kept in the lead pot during the rest of the period. Dose measured by TLDs were compared with the dose estimated using the survey data for the respective locations as well as with the dose estimated using the activity handled by taking into account the time, distance and shielding. The maximum radiation level recorded during lab survey was used to estimate the TLD exposure during the period. It was observed that results on TLD dose measurement and estimated doses using survey results were of same order. The cumulative TLD dose recorded for week duration (168 h) was significantly higher than doses recorded by exposed TLD only during activity handling (8 h). It was expected that the TLD dose would not be more than dose estimated using radiation survey data, while in 3 among 8 experimental TLDs, the dose was ∼ 25% higher. This could be due to the movement of active material or open handling of activity do not get reflected during normal radiation survey and contribution from background radiation at the lab where those TLDs were placed. The individual dose of all the personnel working in different labs were well within the relevant dose limits indicating the safe working condition
Color change mechanism of niobium oxide thin film with incidental light angle and applied voltage
Energy Technology Data Exchange (ETDEWEB)
Komatsu, Isao [Course of Information Science and Technology, Graduate School of Science and Technology, Tokai University (Japan); Aoki, Hayata [Course of Electro Photo Optics, Graduate School of Engineering, Tokai University (Japan); Ebisawa, Mizue [Tokyo Metropolitan Industrial Technology Research Institute (Japan); Kuroda, Akihiro [Department of Optical and Imaging Science & Technology, Faculty of Engineering, Tokai University (Japan); Kuroda Consulting Incorporated (Japan); Kuroda, Koichi [Kuroda Consulting Incorporated (Japan); Maeda, Shuichi [Course of Information Science and Technology, Graduate School of Science and Technology, Tokai University (Japan); Course of Electro Photo Optics, Graduate School of Engineering, Tokai University (Japan); Department of Optical and Imaging Science & Technology, Faculty of Engineering, Tokai University (Japan)
2016-03-31
Niobium oxide thin layers made by the anodization process showed coloration owing to thin film interference. The reflection spectra depended on both the applied voltage and incident light angle. Large color differences were observed at incident light angles between 5° and 70°, when the applied voltage was over 60 V. In this study, we explored the cause of these results using ellipsometry and goniophotometry to understand the transition of optical constants and the reflection spectra with applied voltage. Finally, we concluded that the coloration of the reflection spectra, which included only a first-order interference peak, exhibits a smaller change because the first order interference peak has a wider half value width than higher order interference peaks. - Highlights: • We investigated color change of Nb{sub 2}O{sub 5} oxide thin layers with incidental light angle. • The reflection spectra shift to lower wavelength region with increasing incident light angle. • The reflection spectra shift to higher wavelength region with increasing applied voltage. • First-order interference has wider half value width, and exhibits small color change.
Low-Voltage Switched-Capacitor Circuits
DEFF Research Database (Denmark)
Bidari, E.; Keskin, M.; Maloberti, F.
1999-01-01
Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....
Bootstrapped Low-Voltage Analog Switches
DEFF Research Database (Denmark)
Steensgaard-Madsen, Jesper
1999-01-01
Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...
[Development of residual voltage testing equipment].
Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng
2014-07-01
For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.
International Nuclear Information System (INIS)
1991-01-01
The main objective of this publication is to provide practical guidance and recommendations on operational radiation protection aspects related to the safe handling of tritium in laboratories, industrial-scale nuclear facilities such as heavy-water reactors, tritium removal plants and fission fuel reprocessing plants, and facilities for manufacturing commercial tritium-containing devices and radiochemicals. The requirements of nuclear fusion reactors are not addressed specifically, since there is as yet no tritium handling experience with them. However, much of the material covered is expected to be relevant to them as well. Annex III briefly addresses problems in the comparatively small-scale use of tritium at universities, medical research centres and similar establishments. However, the main subject of this publication is the handling of larger quantities of tritium. Operational aspects include designing for tritium safety, safe handling practice, the selection of tritium-compatible materials and equipment, exposure assessment, monitoring, contamination control and the design and use of personal protective equipment. This publication does not address the technologies involved in tritium control and cleanup of effluents, tritium removal, or immobilization and disposal of tritium wastes, nor does it address the environmental behaviour of tritium. Refs, figs and tabs
How Retailers Handle Complaint Management
DEFF Research Database (Denmark)
Hansen, Torben; Wilke, Ricky; Zaichkowsky, Judy
2009-01-01
This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained as to the......This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained...... as to the links between CM and redress of consumers’ complaints. The results suggest that retailers who attach large negative consequences to consumer dissatisfaction are more likely than other retailers to develop a positive strategic view on customer complaining, but at the same time an increase in perceived...
Czech Academy of Sciences Publication Activity Database
Chomát, Miroslav; Schreier, Luděk
2005-01-01
Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005
Directory of Open Access Journals (Sweden)
Guido Ala
2018-03-01
Full Text Available This paper presents the results of a first investigation on the effects of lightning stroke on medium voltage installations’ grounding systems, interconnected with the metal shields of the Medium Voltage (MV distribution grid cables or with bare buried copper ropes. The study enables us to evaluate the distribution of the lightning current among interconnected ground electrodes in order to estimate if the interconnection, usually created to reduce ground potential rise during a single-line-to-ground fault, can give place to dangerous situations far from the installation hit by the lightning stroke. Four different case studies of direct lightning stroke are presented and discussed: (1 two secondary substations interconnected by the cables’ shields; (2 two secondary substations interconnected by a bare buried conductor; (3 a high voltage/medium voltage station connected with a secondary substation by the medium voltage cables’ shields; (4 a high voltage/medium voltage station connected with a secondary substation by a bare buried conductor. The results of the simulations show that a higher peak-lowering action on the lighting-stroke current occurs due to the use of bare conductors as interconnection elements in comparison to the cables’ shields.
2010-01-01
... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DATA COLLECTION, REPORTING AND RECORDKEEPING REQUIREMENTS APPLICABLE TO CRANBERRIES NOT SUBJECT TO THE CRANBERRY MARKETING ORDER § 926.9 Handle. Handle...
DEFF Research Database (Denmark)
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar
2008-01-01
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...
Energy Technology Data Exchange (ETDEWEB)
Chang, Chih-Hao, E-mail: chc@saturn.yzu.edu.tw [Department of Photonics Engineering, Yuan Ze University, Chung-Li 32003, Taiwan, ROC (China); Wu, Zih-Jyun; Liang, Yi-Hu; Chang, Yu-Shuo; Chiu, Chuan-Hao; Tai, Cheng-Wei [Department of Photonics Engineering, Yuan Ze University, Chung-Li 32003, Taiwan, ROC (China); Chang, Hsin-Hua, E-mail: hhua3@mail.vnu.edu.tw [Department of Electro-Optical Engineering, Vanung University, Chung-Li 32061, Taiwan, ROC (China)
2013-12-02
In general, organic light-emitting devices (OLEDs) need to operate at higher current density levels to ensure an ample light flux. However, stressed operation will result in poor performance and limited device lifetime. Recently, a tandem structure has been proposed as a pivotal technique to meet the stringent lighting requirements for OLED commercialization, with a research focus on decreasing the concomitant higher operation voltage. Driving two connected emission units (EMUs) in a tandem structure often requires more than twice the driving voltage for a single EMU. This study investigates bipolar host materials and their effective employment in fabricating tandem white phosphorescent OLEDs (PhOLEDs). In addition, the design of a mechanism to align the energy level between the hole transport layer/emitting layer is shown to effectively mitigate operational voltages. In sharp contrast to devices using a unipolar host material, we demonstrate that the turn-on voltage of blue PhOLEDs could be decreased from 3.8 V to 2.7 V through utilizing a bipolar host. Furthermore, applying the proposed techniques to tandem white PhOLEDs produces a luminance of 10{sup 3} cd/m{sup 2} by a 10.1 V driving voltage. - Highlights: • The matched energy level between the hole transport/emitting layer lowers voltages. • Multiple conduction dopants were used to investigate charge generation layer. • Two-color emitters were used to quantify the charge generation strength.
Directory of Open Access Journals (Sweden)
Ana B. Oliveira
Full Text Available OBJECTIVES: To evaluate the effect of surface height and load weight on upper limb movements and electromyographic (EMG recordings during manual handling performed by both experienced and inexperienced lifter subjects. METHODS: Sixteen experienced and sixteen inexperienced lifters handled a box (both 7 and 15 kg from an intermediate height (waist level to either a high or low surface. Electromyography and video images were recorded during the tasks. The 10th, 50th and 90th percentiles were calculated for the deltoid and biceps muscles, shoulder flexion, shoulder abduction, and elbow flexion movements. Groups, right/left sides, weights and heights were compared. There were no differences between either groups or sides. RESULTS: Weight and height variations affected EMG and posture, although weight had more impact on EMG. Shoulder abduction and flexion movements higher than 60º occurred, particularly for the higher surface. Shoulder flexion was also higher when the box was moved to the low height. This study provides new evidence as shoulder postures during boxes handling on low surfaces had not previously been evaluated. CONCLUSIONS: The high demand of upper limb in manual material handling tasks is clear, particularly for the shoulder. This knowledge can be used by physical therapists to plan better rehabilitation programs for manual material handling-related disorders, particularly focusing on return to work.
Voltage-sensing phosphatase modulation by a C2 domain.
Castle, Paul M; Zolman, Kevin D; Kohout, Susy C
2015-01-01
The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Adell, Philippe C.; Mojarradi, Mohammad; DelCastillo, Linda Y.; Vo, Tuan A.
2011-01-01
A paper discusses the successful development of a miniaturized radiation hardened high-voltage switching module operating at 2.5 kV suitable for space application. The high-voltage architecture was designed, fabricated, and tested using a commercial process that uses a unique combination of 0.25 micrometer CMOS (complementary metal oxide semiconductor) transistors and high-voltage lateral DMOS (diffusion metal oxide semiconductor) device with high breakdown voltage (greater than 650 V). The high-voltage requirements are achieved by stacking a number of DMOS devices within one module, while two modules can be placed in series to achieve higher voltages. Besides the high-voltage requirements, a second generation prototype is currently being developed to provide improved switching capabilities (rise time and fall time for full range of target voltages and currents), the ability to scale the output voltage to a desired value with good accuracy (few percent) up to 10 kV, to cover a wide range of high-voltage applications. In addition, to ensure miniaturization, long life, and high reliability, the assemblies will require intensive high-voltage electrostatic modeling (optimized E-field distribution throughout the module) to complete the proposed packaging approach and test the applicability of using advanced materials in a space-like environment (temperature and pressure) to help prevent potential arcing and corona due to high field regions. Finally, a single-event effect evaluation would have to be performed and single-event mitigation methods implemented at the design and system level or developed to ensure complete radiation hardness of the module.
Intrinsic non-radiative voltage losses in fullerene-based organic solar cells
Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen
2017-06-01
Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.
SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION
Directory of Open Access Journals (Sweden)
A. G. Stryzhniou
2014-01-01
Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.
Development of Multi-Functional Voltage Restore System
Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki
Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.
International Nuclear Information System (INIS)
Grisham, D.L.; Lambert, J.E.
1983-01-01
Experimental area A at the Clinton P. Anderson Meson Physics Facility (LAMPF) encompasses a large area. Presently there are four experimental target cells along the main proton beam line that have become highly radioactive, thus dictating that all maintenance be performed remotely. The Monitor remote handling system was developed to perform in situ maintenance at any location within area A. Due to the complexity of experimental systems and confined space, conventional remote handling methods based upon hot cell and/or hot bay concepts are not workable. Contrary to conventional remote handling which require special tooling for each specifically planned operation, the Monitor concept is aimed at providing a totally flexible system capable of remotely performing general mechanical and electrical maintenance operations using standard tools. The Monitor system is described
International Nuclear Information System (INIS)
Muhammad, Ali; Esque, Salvador; Aha, Liisa; Mattila, Jouni; Siuko, Mikko; Vilenius, Matti; Jaervenpaeae, Jorma; Irving, Mike; Damiani, Carlo; Semeraro, Luigi
2009-01-01
The advantages of Product Lifecycle Management (PLM) systems are widely understood among the industry and hence a PLM system is already in use by International Thermonuclear Experimental Reactor (ITER) Organization (IO). However, with the increasing involvement of software in the development, the role of Software Configuration Management (SCM) systems have become equally important. The SCM systems can be useful to meet the higher demands on Safety Engineering (SE), Quality Assurance (QA), Validation and Verification (V and V) and Requirements Management (RM) of the developed software tools. In an experimental environment, such as ITER, the new remote handling requirements emerge frequently. This means the development of new tools or the modification of existing tools and the development of new remote handling procedures or the modification of existing remote handling procedures. PLM and SCM systems together can be of great advantage in the development and maintenance of such remote handling system. In this paper, we discuss how PLM and SCM systems can be integrated together and play their role during the development and maintenance of ITER remote handling system. We discuss the possibility to investigate such setup at DTP2 (Divertor Test Platform 2), which is the full scale mock-up facility to verify the ITER divertor remote handling and maintenance concepts.
Triple Line-Voltage Cascaded VIENNA Converter Applied as the Medium-Voltage AC Drive
Directory of Open Access Journals (Sweden)
Jia Zou
2018-04-01
Full Text Available A novel rectifier based on a triple line-voltage cascaded VIENNA converter (LVC-VC was proposed. Compared to the conventional cascaded H-bridge converters, the switch voltage stress is lower, and the numbers of switches and dc capacitors are fewer under similar operating conditions in the proposed new multilevel converter. The modeling and control for the LVC-VC ware presented. Based on the analysis of the operation principle of the new converter, the power factor correction of the proposed converter was realized by employing a traditional one-cycle control strategy. The minimum average value and maximum harmonic components of the dc-link voltages of the three VIENNA rectifier modules ware calculated. Three VIENNA dc-link voltages were unbalanced under the unbalanced load conditions, so the zero sequence current was injected to the three inner currents for balancing three VIENNA dc-link voltages. Simulation and the results of the experiment verified the availability of the new proposed multilevel converter and the effectiveness of the corresponding control strategy applied.
Coordinated single-phase control scheme for voltage unbalance reduction in low voltage network.
Pullaguram, Deepak; Mishra, Sukumar; Senroy, Nilanjan
2017-08-13
Low voltage (LV) distribution systems are typically unbalanced in nature due to unbalanced loading and unsymmetrical line configuration. This situation is further aggravated by single-phase power injections. A coordinated control scheme is proposed for single-phase sources, to reduce voltage unbalance. A consensus-based coordination is achieved using a multi-agent system, where each agent estimates the averaged global voltage and current magnitudes of individual phases in the LV network. These estimated values are used to modify the reference power of individual single-phase sources, to ensure system-wide balanced voltages and proper power sharing among sources connected to the same phase. Further, the high X / R ratio of the filter, used in the inverter of the single-phase source, enables control of reactive power, to minimize voltage unbalance locally. The proposed scheme is validated by simulating a LV distribution network with multiple single-phase sources subjected to various perturbations.This article is part of the themed issue 'Energy management: flexibility, risk and optimization'. © 2017 The Author(s).
Resilient architecture design for voltage variation
Reddi, Vijay Janapa
2013-01-01
Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe
Power-MOSFET Voltage Regulator
Miller, W. N.; Gray, O. E.
1982-01-01
Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.
CMOS-compatible high-voltage integrated circuits
Energy Technology Data Exchange (ETDEWEB)
Parpia, Z
1988-01-01
Considerable savings in cost and development time can be achieved if high-voltage ICs (HVICs) are fabricated in an existing low-voltage process. In this thesis, the feasibility of fabricating HVICs in a standard CMOS process is investigated. The high-voltage capabilities of an existing 5-{mu}m CMOS process are first studied. High-voltage n- and p-channel transistors with breakdown voltages of 50 and 190 V, respectively, were fabricated without any modifications to the process under consideration. SPICE models for these transistors are developed, and their accuracy verified by comparison with experimental results. In addition, the effect of the interconnect metallization on the high-voltage performance of these devices is also examined. Polysilicon field plates are found to be effective in preventing premature interconnect induced breakdown in these devices. A novel high-voltage transistor structure, the insulated base transistor (IBT), based on a merged MOS-bipolar concept, is proposed and implemented. In order to enhance the high-voltage device capabilities, an improved CMOS-compatible HVIC process using junction isolation is developed.
MRI of meniscal bucket-handle tears
Energy Technology Data Exchange (ETDEWEB)
Magee, T.H.; Hinson, G.W. [Menorah Medical Center, Overland Park, KS (United States). Dept. of Radiology
1998-09-01
A meniscal bucket-handle tear is a tear with an attached fragment displaced from the meniscus of the knee joint. Low sensitivity of MRI for detection of bucket-handle tears (64% as compared with arthroscopy) has been reported previously. We report increased sensitivity for detecting bucket-handle tears with the use of coronal short tau inversion recovery (STIR) images. Results. By using four criteria for diagnosis of meniscal bucket-handle tears, our overall sensitivity compared with arthroscopy was 93% (28 of 30 meniscal bucket-handle tears seen at arthroscopy were detected by MRI). The meniscal fragment was well visualized in all 28 cases on coronal STIR images. The double posterior cruciate ligament sign was seen in 8 of 30 cases, the flipped meniscus was seen in 10 of 30 cases and a fragment in the intercondylar notch was seen in 18 of 30 cases. (orig.)
Voltage Controlled Dynamic Demand Response
DEFF Research Database (Denmark)
Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...
International Nuclear Information System (INIS)
Spassov, Velin
1996-01-01
This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)
Sophisticated fuel handling system evolved
International Nuclear Information System (INIS)
Ross, D.A.
1988-01-01
The control systems at Sellafield fuel handling plant are described. The requirements called for built-in diagnostic features as well as the ability to handle a large sequencing application. Speed was also important; responses better than 50ms were required. The control systems are used to automate operations within each of the three main process caves - two Magnox fuel decanners and an advanced gas-cooled reactor fuel dismantler. The fuel route within the fuel handling plant is illustrated and described. ASPIC (Automated Sequence Package for Industrial Control) which was developed as a controller for the plant processes is described. (U.K.)
High Voltage GaN Schottky Rectifiers
Energy Technology Data Exchange (ETDEWEB)
CAO,X.A.; CHO,H.; CHU,S.N.G.; CHUO,C.-C.; CHYI,J.-I.; DANG,G.T.; HAN,JUNG; LEE,C.-M.; PEARTON,S.J.; REN,F.; WILSON,R.G.; ZHANG,A.P.
1999-10-25
Mesa and planar GaN Schottky diode rectifiers with reverse breakdown voltages (V{sub RB}) up to 550V and >2000V, respectively, have been fabricated. The on-state resistance, R{sub ON}, was 6m{Omega}{center_dot} cm{sup 2} and 0.8{Omega}cm{sup 2}, respectively, producing figure-of-merit values for (V{sub RB}){sup 2}/R{sub ON} in the range 5-48 MW{center_dot}cm{sup -2}. At low biases the reverse leakage current was proportional to the size of the rectifying contact perimeter, while at high biases the current was proportional to the area of this contact. These results suggest that at low reverse biases, the leakage is dominated by the surface component, while at higher biases the bulk component dominates. On-state voltages were 3.5V for the 550V diodes and {ge}15 for the 2kV diodes. Reverse recovery times were <0.2{micro}sec for devices switched from a forward current density of {approx}500A{center_dot}cm{sup -2} to a reverse bias of 100V.
Young, Justin G; Lin, Jia-Hua; Chang, Chien-Chi; McGorry, Raymond W
2013-01-01
The purpose of this experiment was to quantify the natural angle between the hand and a handle, and to investigate three design factors: handle rotation, handle tilt and between-handle width on the natural angle as well as resultant wrist radial/ulnar deviation ('RUD') for pushing tasks. Photographs taken of the right upper limb of 31 participants (14 women and 17 men) performing maximal seated push exertions on different handles were analysed. Natural hand/handle angle and RUD were assessed. It was found that all of the three design factors significantly affected natural handle angle and wrist RUD, but participant gender did not. The natural angle between the hand and the cylindrical handle was 65 ± 7°. Wrist deviation was reduced for handles that were rotated 0° (horizontal) and at the narrow width (31 cm). Handles that were tilted forward 15° reduced radial deviation consistently (12-13°) across handle conditions. Manual materials handling (MMH) tasks involving pushing have been related to increased risk of musculoskeletal injury. This study shows that handle orientation influences hand and wrist posture during pushing, and suggests that the design of push handles on carts and other MMH aids can be improved by adjusting their orientation to fit the natural interface between the hand and handle.
High-voltage electrical burns due to copper theft - Case series.
Braga, M J; Oliveira, I; Egipto, P; Silva, A
2016-03-31
Electrical burns are among the most devastating trauma inflicted on the human body. These burns have a higher morbidity, length of stay and a much higher risk of amputation than any other type of burn. Electrical burns affect mostly young, working males because they are more frequently the result of a work accident. However, possibly due to the worldwide economic crisis, we are experiencing a new phenomenon: the theft of high-voltage copper wiring.
International Nuclear Information System (INIS)
Hilscher, A.
2002-01-01
A new method for the determination of the cathode fall voltage of fluorescent lamps is shown. The cathode fall voltage can be determined by measurement of the lamp operating voltage at constant lamp wall temperature, constant discharge current and variation of the electrode heating current. Commercial lamps, which do not need to be specially prepared, can be used for the measurement. The results show good correlation to other measurements of the cathode fall voltage at various discharge currents by means of capacitive coupling. The measured values of the cathode fall voltage are used for determining the minimum, target and maximum setting of the sum of the squares of the pin currents of one electrode (the so-called SOS value) as a function of the discharge current in fluorescent lamp dimming. (author)
Shimer, Daniel W.; Lange, Arnold C.
1995-01-01
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.
Shimer, D.W.; Lange, A.C.
1995-05-23
A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling. 3.118 Section 3.118 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE STANDARDS Specifications for the Humane Handling, Care, Treatment, and Transportation of Marine...
Safety measuring for sodium handling
Energy Technology Data Exchange (ETDEWEB)
Jeong, Ji Young; Jeong, K C; Kim, T J; Kim, B H; Choi, J H
2001-09-01
This is the report for the safety measures of sodium handling. These contents are prerequisites for the development of sodium technology and thus the workers participate in sodium handling and experiments have to know them perfectly. As an appendix, the relating parts of the laws are presented.
International Nuclear Information System (INIS)
Haist, B.; Hamilton, D.; Sanders, St.
2006-01-01
A large-scale fusion device presents many challenges to the remote handling operations team. This paper is based on unique operational experience at JET and gives a perspective on remote handling task development, logistics and resource management, as well as command, control and human-machine interface systems. Remote operations require an accurate perception of a dynamic environment, ideally providing the operators with the same unrestricted knowledge of the task scene as would be available if they were actually at the remote work location. Traditional camera based systems suffer from a limited number of viewpoints and also degrade quickly when exposed to high radiation. Virtual Reality and Augmented Reality software offer great assistance. The remote handling system required to maintain a tokamak requires a large number of different and complex pieces of equipment coordinating to perform a large array of tasks. The demands on the operator's skill in performing the tasks can escalate to a point where the efficiency and safety of operations are compromised. An operations guidance system designed to facilitate the planning, development, validation and execution of remote handling procedures is essential. Automatic planning of motion trajectories of remote handling equipment and the remote transfer of heavy loads will be routine and need to be reliable. This paper discusses the solutions developed at JET in these areas and also the trends in management and presentation of operational data as well as command, control and HMI technology development offering the potential to greatly assist remote handling in future fusion machines. (author)
Procedure of safe handling with cytostatic drugs
Directory of Open Access Journals (Sweden)
Kodžo Dragan
2003-01-01
Full Text Available Working group for safe handling with cytostatic drugs has been formed by the Ministry of Health, and it consists of professionals from IORS, Federal Bureau of Weights and Measures, Industrial Medicine, Institute of Hematology, Military Medical Academy, and Crown Agents. The aim of this working group is to prepare procedures for safe handling with cytostatic drugs, as well as program for educational seminar for nurses, medical technicians, and pharmaceutical technicians. The procedures will serve as a guide of good practice of oncology health care, and will refer to all actions that health care professionals carry out from the moment of drugs arrival to the pharmacy to the moment of their application. In the first segment of this procedure, general rules are given for working with cytotoxic agents, control for risky exposures, safe system of work, control of working environment, monitoring of the employees' health condition adequate protection in the working environment, protective equipment of the employees (gloves, mask, cap, eyeglasses, shoe covers, coats and chambers for vertical laminary air stream. Storing of cytostatics, procedure in case of accident, and waste handling and removal are also described in this segment. Fifty-three standard operational procedures are described in detail in the second segment. Training scheme for preparation of chemotherapy is given in the third segment - education related to various fields and practical part, which would be carried out through workshops, and at the end of the course participants would pass a test and obtain certificate. After the procedures for safe handling with cytostatics are legally regulated employer will have to provide minimum of protective equipment, special rooms for the drugs dissolving, chambers with laminar airflow, 6 hours working time, rotation of the staff working with drugs dissolving in intervals of every five years, higher efficiency, better health control. In conclusion
Voltage-gated lipid ion channels
DEFF Research Database (Denmark)
Blicher, Andreas; Heimburg, Thomas Rainer
2013-01-01
Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...
Radio and television interference caused by corona discharges from high-voltage transmission lines
International Nuclear Information System (INIS)
Sarmadi, M.
1996-01-01
Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather
DEFF Research Database (Denmark)
Meyer, Christoph; De Doncker, Rik W.; Li, Yun Wei
2008-01-01
Most power quality problems in distribution systems are related to voltage sags. Therefore, different solutions have been examined to compensate these sags to avoid production losses at sensitive loads. Dynamic voltage restorers (DVRs) have been proposed to provide higher power quality. Currently......, a system wide integration of DVRs is hampered because of their high cost, in particular, due to the expensive DC-link energy storage devices. The cost of these DC-link capacitors remains high because the DVR requires a minimum DC-link voltage to be able to operate and to compensate a sag. As a result, only...... a small fraction of the energy stored in the DC-link capacitor is used, which makes it impractical for DVRs to compensate relatively long voltage sags. Present control strategies are only able to minimize the distortions at the load or to allow a better utilization of the storage system by minimizing...
Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.
2017-11-01
Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.
Rendos, Nicole K; Heredia Vargas, Héctor M; Alipio, Taislaine C; Regis, Rebeca C; Romero, Matthew A; Signorile, Joseph F
2016-07-01
Rendos, NK, Heredia Vargas, HM, Alipio, TC, Regis, RC, Romero, MA, and Signorile, JF. Differences in muscle activity during cable resistance training are influenced by variations in handle types. J Strength Cond Res 30(7): 2001-2009, 2016-There has been a recent resurgence in the use of cable machines for resistance training allowing movements that more effectively simulate daily activities and sports-specific movements. By necessity, these devices require a machine/human interface through some type of handle. Considerable data from material handling, industrial engineering, and exercise training studies indicate that handle qualities, especially size and shape, can significantly influence force production and muscular activity, particularly of the forearm muscles, which affect the critical link in activities that require object manipulation. The purpose for this study was to examine the influence of three different handle conditions: standard handle (StandH), ball handle with the cable between the index and middle fingers (BallIM), and ball handle with the cable between the middle and ring fingers (BallMR), on activity levels (rmsEMG) of the triceps brachii lateral and long heads (TriHLat, TriHLong), brachioradialis (BR), flexor carpi radialis (FCR), extensor carpi ulnaris, and extensor digitorum (ED) during eight repetitions of standing triceps pushdown performed from 90° to 0° elbow flexion at 1.5 s per contractile stage. Handle order was randomized. No significant differences were seen for triceps or BR rmsEMG across handle conditions; however, relative patterns of activation did vary for the forearm muscles by handle condition, with more coordinated activation levels for the FCR and ED during the ball handle conditions. In addition, the rmsEMG for the ED was significantly higher during the BallIM than any other condition and during the BallMR than the StandH. These results indicate that the use of ball handles with the cable passing between different fingers
Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi
2013-09-15
One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.
DEFF Research Database (Denmark)
Hu, Junjie; Zecchino, Antonio; Marinelli, Mattia
2016-01-01
This paper investigates the control logics of an on-load tap-changer (OLTC) transformer by means of an experimental system validation. The experimental low-voltage unbalanced system consists of a decoupled single-phase OLTC transformer, a 75-metre 16 mm2 cable, a controllable single-phase resistive...... load and an electric vehicle, which has the vehicle-to-grid function. Three control logics of the OLTC transformer are described in the study. The three control logics are classified based on their control objectives and control inputs, which include network currents and voltages, and can be measured...... either locally or remotely. To evaluate and compare the control performances of the three control logics, all the tests use the same loading profiles. The experimental results indicate that the modified line compensation control can regulate voltage in a safe band in the case of various load...
Asthma, guides for diagnostic and handling
International Nuclear Information System (INIS)
Salgado, Carlos E; Caballero A, Andres S; Garcia G, Elizabeth
1999-01-01
The paper defines the asthma, includes topics as diagnostic, handling of the asthma, special situations as asthma and pregnancy, handling of the asthmatic patient's perioperatory and occupational asthma
Macroeconomic Assessment of Voltage Sags
Directory of Open Access Journals (Sweden)
Sinan Küfeoğlu
2016-12-01
Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.
Energy Technology Data Exchange (ETDEWEB)
Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)
2014-11-14
Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.
Remote-handled transuranic system assessment appendices. Volume 2
Energy Technology Data Exchange (ETDEWEB)
NONE
1995-11-01
Volume 2 of this report contains six appendices to the report: Inventory and generation of remote-handled transuranic waste; Remote-handled transuranic waste site storage; Characterization of remote-handled transuranic waste; RH-TRU waste treatment alternatives system analysis; Packaging and transportation study; and Remote-handled transuranic waste disposal alternatives.
Remote-handled transuranic system assessment appendices. Volume 2
International Nuclear Information System (INIS)
1995-11-01
Volume 2 of this report contains six appendices to the report: Inventory and generation of remote-handled transuranic waste; Remote-handled transuranic waste site storage; Characterization of remote-handled transuranic waste; RH-TRU waste treatment alternatives system analysis; Packaging and transportation study; and Remote-handled transuranic waste disposal alternatives
Transient voltage oscillations in coils
International Nuclear Information System (INIS)
Chowdhuri, P.
1985-01-01
Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated
International Nuclear Information System (INIS)
Chen, Zhiting; Wang, Cun; Xing, Lidan; Wang, Xianshu; Tu, Wenqiang; Zhu, Yunmin; Li, Weishan
2017-01-01
Highlights: •TMB and TEB effective improve the cyclic stability of LNMO at high voltage. •The performance of LNMO with TMB-containing electrolyte is superior to that of TEB. •LNMO shows catalytic effect on the oxidation reaction of TEB. •The film generated in TMB shows better ability on suppressing LNMO shedding than TEB. -- Abstract: Trimethyl borate (TMB) and triethyl borate (TEB) are used as film-forming electrolyte additives for high voltage Lithium nickel manganese oxide (LNMO) cathode. DFT calculation and initial charge curve of LNMO reveal that the oxidation activity of TEB is higher than that of TMB. Addition of 2% TMB and 2% TEB effectively improve the capacity retention of high voltage LNMO from 23.4% to 85.3% and 72.6% after 600 cycles, respectively. The film generated in TMB-containing electrolyte shows better ability on suppressing the LNMO shedding in comparison with that of TEB, resulting in higher capacity retention of LNMO in TMB-containing electrolyte at high voltage. The superior performance of LNMO with TMB-containing electrolyte should be ascribed to its less intense film-forming reaction which generates a denser protective surface film on LNMO surface. However, why LNMO shows catalyzation effect on TEB oxidation but not on TMB is unclear, which needs further intensive investigation.
Design and Control of a Dynamic Voltage Restorer
DEFF Research Database (Denmark)
Nielsen, John Godsk
voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...
Padhee, Varsha
Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any
Energy Technology Data Exchange (ETDEWEB)
Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)
2014-07-01
Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.
International Nuclear Information System (INIS)
Poyai, A.; Simoen, E.; Claeys, C.; Hayama, K.; Kobayashi, K.; Ohyama, H.
2002-01-01
This paper investigates the impact of 20 MeV proton irradiation on the current-voltage (I-V) and capacitance-voltage (C-V) characteristics of different geometry n + -p-well junction diodes surrounded by shallow trench isolation and processed in a 0.18 μm CMOS technology. From I-V characteristics, a higher current damage coefficient was found for the bulk than for the peripheral component. The radiation-induced boron de-activation resulted in a lowering of the p-well doping, which has been derived from high-frequency C-V measurements. This was confirmed by deep level transient spectroscopy (DLTS) analysis, revealing the presence of interstitial boron related radiation defects. As will be demonstrated for the bulk leakage-current damage coefficient, the electric field enhanced generation rate of charge carriers and the radiation-induced boron de-activation should be accounted for properly
International Nuclear Information System (INIS)
Vukic, V.; Osmokrovic, P.; Stankovic, S.; Kovacevic, M.
2005-01-01
Research topic presented in this paper is degradation of characteristics of low-dropout voltage regulator's serial transistor during exposure of device to the ionizing radiation. Voltage regulators were exposed to X and γ radiation in two modes: without bias conditions, and with bias conditions and load. Tested circuits are representatives of the first and the second generation of low-dropout voltage regulators, with lateral and vertical PNP serial transistor: LM2940 and L4940. Experimental results of output voltage and serial dropout voltage change in function of total ionizing dose, during the medium-dose-rate exposure, were presented. (author) [sr
Modelling voltage sag mitigation using dynamic voltage restorer and analyzing power quality issue
Ismail, Nor Laili; Hidzir, Hizrin Dayana Mohd; Thanakodi, Suresh; Nazar, Nazatul Shiema Moh; Ibrahim, Pungut; Ali, Che Ku Muhammad Sabri Che Ku
2018-02-01
Power quality problem which are arise due to a fault or a pulsed load can have caused an interruption of critical load. The modern power systems are becoming more sensitive to the quality of the power supplied by the utility company. Voltage sags and swells, flicker, interruptions, harmonic distortion and other distortion to the sinusoidal waveform are the examples of the power quality problems. The most affected due to these problems is industrial customers who use a lot of sensitive equipment. There has suffered a huge loss to these problems. Resulting of broken or damage equipment if voltage sag exceeds the sensitive threshold of the equipment. Thus, device such as Static Synchronous Compensator (STATCOM) and Dynamic Voltage Restorer (DVR) has been created to solve this problem among users. DVR is a custom power device that most effective and efficient. This paper intended to report the DVR operations during voltage sag compensation.
Directory of Open Access Journals (Sweden)
Brwene Salah Gadalla
2015-12-01
Full Text Available The Y-source topology has a unique advantage of having high voltages gain with small shoot through duty cycles. Furthermore, having the advantage of high modulation index which increase the power density and improve the performance of the converter. In this paper, a collective thermal and efficiency investigation has been performed in order to improve the reliability of the converter. Evaluation of relevant losses as ( switching, conduction, capacitor ESR, core and winding losses , and evaluation of the junction temperature of the devices under 25C ambient temperature. The analysis is done for different voltage gain factors (2, 3, and 4, and different winding factor (4, and 5 using PLECS toolbox. The results shows that the higher the voltage gain and winding factor, the higher power losses and rising in the junction temperature of the device.
DDOS ATTACK DETECTION SIMULATION AND HANDLING MECHANISM
Directory of Open Access Journals (Sweden)
Ahmad Sanmorino
2013-11-01
Full Text Available In this study we discuss how to handle DDoS attack that coming from the attacker by using detection method and handling mechanism. Detection perform by comparing number of packets and number of flow. Whereas handling mechanism perform by limiting or drop the packets that detected as a DDoS attack. The study begins with simulation on real network, which aims to get the real traffic data. Then, dump traffic data obtained from the simulation used for detection method on our prototype system called DASHM (DDoS Attack Simulation and Handling Mechanism. From the result of experiment that has been conducted, the proposed method successfully detect DDoS attack and handle the incoming packet sent by attacker.
Development of spent fuel remote handling technology
International Nuclear Information System (INIS)
Yoon, J. S.; Hong, H. D.; Kim, S. H.
2004-02-01
In this research, the remote handling technology is developed for the advanced spent fuel conditioning process which gives a possible solution to deal with the rapidly increasing spent fuels. In detail, a fuel rod slitting device is developed for the decladding of the spent fuel. A series of experiments has been performed to find out the optimal condition of the spent fuel voloxidation which converts the UO 2 pellet into U 3 O 8 powder. The design requirements of the ACP equipment for hot test is established by analysing the modular requirement, radiation hardening and thermal protection of the process equipment, etc. The prototype of the servo manipulator is developed. The manipulator has an excellent performance in terms of the payload to weight ratio that is 30 % higher than that of existing manipulators. To provide reliability and safety of the ACP, the 3 dimensional graphic simulator is developed. Using the simulator the remote handling operation is simulated and as a result, the optimal layout of ACP is obtained. The supervisory control system is designed to control and monitor the several different unit processes. Also the failure monitoring system is developed to detect the possible accidents of the reduction reactor
Locational Pricing to Mitigate Voltage Problems Caused by High PV Penetration
Directory of Open Access Journals (Sweden)
Sam Weckx
2015-05-01
Full Text Available In this paper, a locational marginal pricing algorithm is proposed to control the voltage in unbalanced distribution grids. The increasing amount of photovoltaic (PV generation installed in the grid may cause the voltage to rise to unacceptable levels during periods of low consumption. With locational prices, the distribution system operator can steer the reactive power consumption and active power curtailment of PV panels to guarantee a safe network operation. Flexible loads also respond to these prices. A distributed gradient algorithm automatically defines the locational prices that avoid voltage problems. Using these locational prices results in a minimum cost for the distribution operator to control the voltage. Locational prices can differ between the three phases in unbalanced grids. This is caused by a higher consumption or production in one of the phases compared to the other phases and provides the opportunity for arbitrage, where power is transferred from a phase with a low price to a phase with a high price. The effect of arbitrage is analyzed. The proposed algorithm is applied to an existing three-phase four-wire radial grid. Several simulations with realistic data are performed.
Electron bunch structure in energy recovery linac with high-voltage dc photoelectron gun
Directory of Open Access Journals (Sweden)
Y. M. Saveliev
2016-09-01
Full Text Available The internal structure of electron bunches generated in an injector line with a dc photoelectron gun is investigated. Experiments were conducted on the ALICE (accelerators and lasers in combined experiments energy recovery linac at Daresbury Laboratory. At a relatively low dc gun voltage of 230 kV, the bunch normally consisted of two beamlets with different electron energies, as well as transverse and longitudinal characteristics. The beamlets are formed at the head and the tail of the bunch. At a higher gun voltage of 325 kV, the beam substructure is much less pronounced and could be observed only at nonoptimal injector settings. Experiments and computer simulations demonstrated that the bunch structure develops during the initial beam acceleration in the superconducting rf booster cavity and can be alleviated either by increasing the gun voltage to the highest possible level or by controlling the beam acceleration from the gun voltage in the first accelerating structure.
International Nuclear Information System (INIS)
Doane, Harry J.
1986-01-01
The ease and speed of handling transient data is enhanced by the use of a voltage to frequency converter (VFC). This analogue to digital semiconductor device provides an inexpensive and portable alternative to electro-mechanical recorders and hand entry of data into computer codes. The VFC used at The University of Arizona is a Teledyne Philbrick 4705/01. A zero to positive ten volt input signal provides a zero to one megahertz output signal which is TTL/DTL compatible. VFC is used at the University of Arizona to collect data for super prompt critical TRIGA excursions. The VFC provides a low cost, convenient method of transient data storage and retrieval for experimentation and laboratory demonstration
Choi, Kwang-Soon; Kondaveeti, Sanath; Min, Booki
2017-12-01
Microbial electrolysis cells (MECs) at various cell voltages (0.5, 0.7 1.0 and 1.5V) were operated in anaerobic fermentation. During the start-up period, the cathode potential decreased from -0.63 to -1.01V, and CH 4 generation increased from 168 to 199ml. At an applied voltage of 1.0V, the highest methane yields of 408.3ml CH 4 /g COD glucose was obtained, which was 30.3% higher than in the control tests (313.4ml CH 4 /g COD glucose). The average current of 5.1mA was generated at 1.0V at which the maximum methane yield was obtained. The other average currents were 1.42, 3.02, 0.53mA at 0.5, 0.7, and 1.5V, respectively. Cyclic voltammetry and EIS analysis revealed that enhanced reduction currents were present at all cell voltages with biocatalyzed cathode electrodes (no reduction without biofilm), and the highest value was obtained with 1V external voltage. Copyright © 2017 Elsevier Ltd. All rights reserved.
Increasing break-down strength of the support colomn of high-voltage accelerators
International Nuclear Information System (INIS)
Rezvykh, K.A.; Romanov, V.A.
1981-01-01
Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru
Ergonomics of disposable handles for minimally invasive surgery.
Büchel, D; Mårvik, R; Hallabrin, B; Matern, U
2010-05-01
The ergonomic deficiencies of currently available minimally invasive surgery (MIS) instrument handles have been addressed in many studies. In this study, a new ergonomic pistol handle concept, realized as a prototype, and two disposable ring handles were investigated according to ergonomic properties set by new European standards. In this study, 25 volunteers performed four practical tasks to evaluate the ergonomics of the handles used in standard operating procedures (e.g., measuring a suture and cutting to length, precise maneuvering and targeting, and dissection of a gallbladder). Moreover, 20 participants underwent electromyography (EMG) tests to measure the muscle strain they experienced while carrying out the basic functions (grasp, rotate, and maneuver) in the x, y, and z axes. The data measured included the number of errors, the time required for task completion, perception of pressure areas, and EMG data. The values for usability in the test were effectiveness, efficiency, and user satisfaction. Surveys relating to the subjective rating were completed after each task for each of the three handles tested. Each handle except the new prototype caused pressure areas and pain. Extreme differences in muscle strain could not be observed for any of the three handles. Experienced surgeons worked more quickly with the prototype when measuring and cutting a suture (approximately 20%) and during precise maneuvering and targeting (approximately 20%). On the other hand, they completed the dissection task faster with the handle manufactured by Ethicon. Fewer errors were made with the prototype in dissection of the gallbladder. In contrast to the handles available on the market, the prototype was always rated as positive by the volunteers in the subjective surveys. None of the handles could fulfil all of the requirements with top scores. Each handle had its advantages and disadvantages. In contrast to the ring handles, the volunteers could fulfil most of the tasks more
Voltage gating of mechanosensitive PIEZO channels.
Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R
2018-03-15
Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.
Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter
Directory of Open Access Journals (Sweden)
Padalko D.A.
2017-12-01
Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.
Radiological safety aspects of handling plutonium
International Nuclear Information System (INIS)
Sundararajan, A.R.
2016-01-01
Department of Atomic Energy in its scheme of harnessing the nuclear energy for electrical power generation and strategic applications has given a huge role to utilization of plutonium. In the power production programme, fast reactors with plutonium as fuel are expected to play a major role. This would require establishing fuel reprocessing plants to handle both thermal and fast reactor fuels. So in the nuclear fuel cycle facilities variety of chemical, metallurgical, mechanical operations have to be carried out involving significant inventories of "2"3"9 Pu and associated radionuclides. Plutonium is the most radiotoxic radionuclide and therefore any facility handling it has to be designed and operated with utmost care. Two problems of major concern in the protection of persons working in plutonium handling facilities are the internal exposure to the operating personnel from uptake of plutonium and transplutonic nuclides as they are highly radiotoxic and the radiation exposure of hands and eye lens during fuel fabrication operations especially while handling recycled high burn up plutonium. In view of the fact that annual limit for intake is very small for "2"3"9Pu and its radiation emission characteristics are such that it is a huge challenge for the health physicists to detect Pu in air and in workers. This paper discusses the principles and practices followed in providing radiological surveillance to workers in plutonium handling areas. The challenges in protecting the workers from receiving exposures to hands and eye lens in handling high burn up plutonium are also discussed. The sites having Pu fuel cycle facilities should have trained medical staff to handle cases involving excessive intake of plutonium. (author)
Voltage-sensing phosphatase modulation by a C2 domain
Directory of Open Access Journals (Sweden)
Paul M. Castle
2015-04-01
Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in
Enclosure for handling high activity materials
International Nuclear Information System (INIS)
Jimeno de Osso, F.
1977-01-01
One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With this purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. In this report a description is given of those aspects that may be of interest to people working in this field. (Author)
Enclosure for handling high activity materials
Energy Technology Data Exchange (ETDEWEB)
Jimeno de Osso, F
1977-07-01
One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With this purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. In this report a description is given of those aspects that may be of interest to people working in this field. (Author)
Voltage Unbalance Compensation with Smart Three-phase Loads
DEFF Research Database (Denmark)
Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig
2016-01-01
unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....
LED-Based High-Voltage Lines Warning System
Directory of Open Access Journals (Sweden)
Eldar MUSA
2013-04-01
Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area
Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin
2018-04-01
This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.
Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing
Zhang, Yu
2017-10-17
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.
Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni
2017-11-08
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Practical considerations in voltage stability assessment
Energy Technology Data Exchange (ETDEWEB)
Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)
1994-12-31
This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.
49 CFR 234.221 - Lamp voltage.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...
Reduced Voltage Scaling in Clock Distribution Networks
Directory of Open Access Journals (Sweden)
Khader Mohammad
2009-01-01
Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.
Specialization and Flexibility in Port Cargo Handling
Directory of Open Access Journals (Sweden)
Hakkı KİŞİ
2016-11-01
Full Text Available Cargo handling appears to be the fundamental function of ports. In this context, the question of type of equipment and capacity rate need to be tackled with respect to cargo handling principles. The purpose of this study is to discuss the types of equipment to be used in ports, relating the matter to costs and capacity. The question is studied with a basic economic theoretical approach. Various conditions like port location, size, resources, cargo traffic, ships, etc. are given parameters to dictate the type and specification of the cargo handling equipment. Besides, a simple approach in the context of cost capacity relation can be useful in deciding whether to use specialized or flexible equipment. Port equipment is sometimes expected to be flexible to handle various types of cargo as many as possible and sometimes to be specialized to handle one specific type of cargo. The cases that might be suitable for those alternatives are discussed from an economic point of view in this article. Consequently, effectiveness and efficiency criteria play important roles in determining the handling equipment in ports.
Directory of Open Access Journals (Sweden)
Yong Chen
2016-01-01
Full Text Available The Modular Multilevel Converters (MMC have been a spotlight for the high voltage and high power transmission systems. In the VSC-HVDC (High Voltage Direct Current based on Voltage Source Converter transmission system, the energy of DC link is stored in the distributed capacitors, and the difference of capacitors in parameters and charge rates causes capacitor voltage balance which affects the safety and stability of HVDC system. A method of MMC based on the expert system for reducing the frequency of the submodules (SMs of the IGBT switching frequency is proposed. Firstly, MMC with 51 levels for HVDC is designed. Secondly, the nearest level control (NLC for 51-level MMC is introduced. Thirdly, a modified capacitor voltage balancing method based on expert system for MMC-based HVDC transmission system is proposed. Finally, a simulation platform for 51-level Modular Multilevel Converter is constructed by using MATLAB/SIMULINK. The results indicate that the strategy proposed reduces the switching frequency on the premise of keeping submodule voltage basically identical, which greatly reduces the power losses for MMC-HVDC system.
HMSRP Hawaiian Monk Seal Handling Data
National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains records for all handling and measurement of Hawaiian monk seals since 1981. Live seals are handled and measured during a variety of events...
Microprocessor-controlled, programmable ramp voltage generator
International Nuclear Information System (INIS)
Hopwood, J.
1978-11-01
A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds
International Nuclear Information System (INIS)
Shokri, Abdollah; Shareef, Hussain; Mohamed, Azah; Farhoodnea, Masoud; Zayandehroodi, Hadi
2014-01-01
Highlights: • A new phase space based voltage mode controller for D-STATCOM was proposed. • The proposed compensator was tested to mitigate voltage disturbances in distribution systems. • Voltage fluctuation, voltage sag and voltage swell are considered to evaluate the performance of the proposed compensator. - Abstract: Distribution static synchronous compensator (D-STATCOM) has been developed and attained a great interest to compensate the power quality disturbances of distribution systems. In this paper, a novel single-phase control scheme for D-STATCOM is proposed to improve voltage profile at the Point of Common Coupling (PCC). The proposed voltage mode (VM) controller is based on the phase space algorithm, which is able to rapidly detect and mitigate any voltage deviations from reference voltage including voltage sags and voltage swells. To investigate the efficiency and accuracy of the proposed compensator, a system is modeled using Matlab/Simulink. The simulation results approve the capability of the proposed VM controller to provide a regulated and disturbance-free voltage for the connected loads at the PCC
Voltage-Controlled Floating Resistor Using DDCC
Directory of Open Access Journals (Sweden)
M. Kumngern
2011-04-01
Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.
Fiber-optic voltage measuring system
Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang
1993-09-01
A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.
Reliability of high-voltage pulse capacitors operating in large energy storages
International Nuclear Information System (INIS)
Kuchinskij, G.S.; Fedorova, V.S.; Shilin, O.V.
1982-01-01
To improve the reliability of pulse capacitors operating in capacitive energy storages, processes, resulting in break-down of capacitor insulation were investigated. A statistic model of failures was constructed and reliability of real capacitors, functioning at operating electric intensity Usub(oper) equal 70 kV/mm and at elevated intensity 90 kV/mm was calculated. Results of testing the IK50-ZU4 capacitor are given. The form of the capacitor service life distribution function was specified. To provide and confirm the assigned capacitor reliability, it is necessary to speed up tests at a higher voltage (1.3-1.5) Usub(oper). To improve the capacitor reliability, it is advisable to conduct acceptance tests, which include hold at increased constant voltage (1.3-1.5) Usub(oper) during 1-3 min and the effect of pulses of increased voltage (1.2-1.3) Usub(oper) with the pulse shape corresponding to operating conditions
DEFF Research Database (Denmark)
Li, Mingshen; Gui, Yonghao; Quintero, Juan Carlos Vasquez
2017-01-01
In this paper, an improved grid voltage modulated control (GVM) with power compensation is proposed for grid-connected voltage inverters when the grid voltage is unbalanced. The objective of the proposed control is to remove the power ripple and to improve current quality. Three power compensation...... objectives are selected to eliminate the negative sequence components of currents. The modified GVM method is designed to obtain two separate second-order systems for not only the fast convergence rate of the instantaneous active and reactive powers but also the robust performance. In addition, this method...
Management of transport and handling contracts
Rühl, I
2004-01-01
This paper shall outline the content, application and management strategies for the various contracts related to transport and handling activities. In total, the two sections Logistics and Handling Maintenance are in charge of 27 (!) contracts ranging from small supply contracts to big industrial support contracts. The activities as well as the contracts can generally be divided into four main topics "Vehicle Fleet Management"; "Supply, Installation and Commissioning of Lifting and Hoisting Equipment"; "Equipment Maintenance" and "Industrial Support for Transport and Handling". Each activity and contract requires different approaches and permanent adaptation to the often changing CERN's requirements. In particular, the management and the difficulties experienced with the contracts E072 "Maintenance of lifting and hoisting equipment", F420 "Supply of seven overhead traveling cranes for LHC" and S090/S103 "Industrial support for transport and handling" will be explained in detail.
High frequency breakdown voltage
International Nuclear Information System (INIS)
Chu, Thanh Duy.
1992-03-01
This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance
Non-contact current and voltage sensor
Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A
2014-03-25
A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.
Fuel Cell/Electrochemical Cell Voltage Monitor
Vasquez, Arturo
2012-01-01
A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.
Ergonomics: safe patient handling and mobility.
Hallmark, Beth; Mechan, Patricia; Shores, Lynne
2015-03-01
This article reviews and investigates the issues surrounding ergonomics, with a specific focus on safe patient handling and mobility. The health care worker of today faces many challenges, one of which is related to the safety of patients. Safe patient handling and mobility is on the forefront of the movement to improve patient safety. This article reviews the risks associated with patient handling and mobility, and informs the reader of current evidence-based practice relevant to this area of care. Copyright © 2015 Elsevier Inc. All rights reserved.
High voltage capacitor design and the determination of solid dielectric voltage breakdown
International Nuclear Information System (INIS)
Hutapea, S.
1976-01-01
The value of the external field intensity serves as an electrical insulating material and is a physical characteristic of the substance. Capacitor discharge in the dielectric medium are experimentally investigated. The high voltage power supply and other instrument needed are briefly discussed. Capacitors with working voltage of 30.000 volt and the plastic being used for dielectrics in the capacitors are also discussed. (author)
International Nuclear Information System (INIS)
Clement, G.
1984-01-01
After a definition of intervention, problems encountered for working in an adverse environment are briefly analyzed for development of various remote handling equipments. Some examples of existing equipments are given [fr
Frequency pulling in a low-voltage medium-power gyrotron
Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun
2018-04-01
Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.
Novel Voltage limiting concept for avalance breakdown protection
Ruijs, L.C.H.; Bezooijen, van A.; Mahmoudi, R.; Roermund, van A.H.M.
2006-01-01
Destructive over-voltage breakdown of cellular phone power transistors is prevented by using a new voltage-limiting concept. The output voltage is detected by an avalanche-based detector, and limited by decreasing the output power when needed. The voltage detector contains a low voltage bipolar NPN
Welding method by remote handling
International Nuclear Information System (INIS)
Hashinokuchi, Minoru.
1994-01-01
Water is charged into a pit (or a water reservoir) and an article to be welded is placed on a support in the pit by remote handling. A steel plate is disposed so as to cover the article to be welded by remote handling. The welding device is positioned to the portion to be welded and fixed in a state where the article to be welded is shielded from radiation by water and the steel plate. Water in the pit is drained till the portion to be welded is exposed to the atmosphere. Then, welding is conducted. After completion of the welding, water is charged again to the pit and the welding device and fixing jigs are decomposed in a state where the article to be welded is shielded again from radiation by water and the steel plate. Subsequently, the steel plate is removed by remote handling. Then, the article to be welded is returned from the pit to a temporary placing pool by remote handling. This can reduce operator's exposure. Further, since the amount of the shielding materials can be minimized, the amount of radioactive wastes can be decreased. (I.N.)
Directory of Open Access Journals (Sweden)
Pui-Sun Lei
2015-01-01
Full Text Available This Letter presents a low start-up voltage dc–dc converter for low-power thermoelectric systems which uses a native n-type MOS transistor as the start-up switch. The start-up voltage of the proposed converter is 300 mV and the converter does not need batteries to start up. The negative voltage control is proposed to reduce the leakage current caused by native n-type transistor and increase the efficiency. The proposed converter was designed using standard 0.18 µm CMOS process with chip size of 0.388 mm^2. The peak efficiency is 63% at load current of 1.5 mA. The proposed converter provides output voltage >1 V at maximum load current of 3.2 mA.
Modular high voltage power supply for chemical analysis
Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA
2008-07-15
A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
Study on compact design of remote handling equipment for ITER blanket maintenance
International Nuclear Information System (INIS)
Takeda, Nobukazu; Kakudate, Satoshi; Nakahira, Masataka; Shibanuma, Kiyoshi
2006-03-01
In the ITER, the neutrons created by D-T reactions activate structural materials, and thereby, the circumstance in the vacuum vessel is under intense gamma radiation field. Thus, the in-vessel components such as blanket are handled and replaced by remote handling equipment. The objective of this report is to study the compactness of the remote handling equipment (a vehicle/manipulator) for the ITER blanket maintenance. In order to avoid the interferences between the blanket and the equipment during blanket replacement in the restricted vacuum vessel, a compact design of the equipment is required. Therefore, the compact design is performed, including kinematic analyses aiming at the reduction of the sizes of the vehicle equipped with a manipulator handling the blanket and the rail for the vehicle traveling in the vacuum vessel. Major results are as follows: 1. The compact vehicle/manipulator is designed concentration on the reduction of the rail size and simplification of the guide roller mechanism as well as the reduction of the gear diameter for vehicle rotation around the rail. Height of the rail is reduced from 500 mm to 400 mm by a parameter survey for weight, stiffness and stress of the rail. The roller mechanism is divided into two simple functional mechanisms composed of rollers and a pad, that is, the rollers support relatively light loads during rail deployment and vehicle traveling while a pad supports heavy loads during blanket replacement. Regarding the rotation mechanism, the double helical gear is adopted, because it has higher contact ratio than the normal spur gear and consequently can transfer higher force. The smaller double helical gear, 996 mm in diameter, can achieve 26% higher output torque, 123.5 kN·m, than that of the original spur gear of 1,460 mm in diameter, 98 kN·m. As a result, the manipulator becomes about 30% lighter, 8 tons, than the original weight, 11.2 tons. 2. Based on the compact design of the vehicle/manipulator, the
International Nuclear Information System (INIS)
Nudnova, M. M.; Aleksandrov, N. L.; Starikovskii, A. Yu.
2010-01-01
The properties of a surface barrier discharge in atmospheric-pressure air at different polarities of applied voltage were studied experimentally. The influence of the voltage polarity on the spatial structure of the discharge and the electric field in the discharge plasma was determined by means of spectroscopic measurements. It is found that the energy deposited in the discharge does not depend on the voltage polarity and that discharges of positive polarity are more homogenous and the electric fields in them are higher.
Energy Technology Data Exchange (ETDEWEB)
Su, Guo-Qiang; Wang, Yi-Bo; Song, Bai-Peng; Mu, Hai-Bao, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn; Zhang, Guan-Jun, E-mail: haibaomu@xjtu.edu.cn, E-mail: gjzhang@xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, School of Electrical Engineering, Xi’an Jiaotong University, Xi’an, Shaanxi 710049 (China); Li, Feng; Wang, Meng [Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang, Sichuan 621900 (China)
2016-06-15
The luminescence evolution phenomena from alumina ceramic surface in vacuum under high voltage of direct and alternating current are reported, with the voltage covering a large range from far below to close to the flashover voltage. Its time resolved and spatial distributed behaviors are examined by a photon counting system and an electron-multiplying charge-coupled device (EMCCD) together with a digital camera, respectively. The luminescence before flashover exhibits two stages as voltage increasing, i.e., under a relative low voltage (Stage A), the luminescence is ascribed to radiative recombination of hetero-charges injected into the sample surface layer by Schottky effect; under a higher voltage (Stage B), a stable secondary electron emission process, resulting from the Fowler-Nordheim emission at the cathode triple junction (CTJ), is responsible for the luminescence. Spectrum analysis implies that inner secondary electrons within the surface layer of alumina generated during the SSEE process also participate in the luminescence of Stage B. A comprehensive interpretation of the flashover process is formulated, which might promote a better understanding of flashover issue in vacuum.
Civilsamfundets ABC: H for Handling
DEFF Research Database (Denmark)
Lund, Anker Brink; Meyer, Gitte
2015-01-01
Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling.......Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling....
The technique on handling radiation
International Nuclear Information System (INIS)
1997-11-01
This book describes measurement of radiation and handling radiation. The first part deals with measurement of radiation. The contents of this part are characteristic on measurement technique of radiation, radiation detector, measurement of energy spectrum, measurement of radioactivity, measurement for a level of radiation and county's statistics on radiation. The second parts explains handling radiation with treating of sealed radioisotope, treating unsealed source and radiation shield.
International Nuclear Information System (INIS)
1991-01-01
The United States Department of Energy, Oak Ridge Field Office, and Martin Marietta Energy Systems, Inc., are co-sponsoring this Second International Conference on Uranium Hexafluoride Handling. The conference is offered as a forum for the exchange of information and concepts regarding the technical and regulatory issues and the safety aspects which relate to the handling of uranium hexafluoride. Through the papers presented here, we attempt not only to share technological advances and lessons learned, but also to demonstrate that we are concerned about the health and safety of our workers and the public, and are good stewards of the environment in which we all work and live. These proceedings are a compilation of the work of many experts in that phase of world-wide industry which comprises the nuclear fuel cycle. Their experience spans the entire range over which uranium hexafluoride is involved in the fuel cycle, from the production of UF 6 from the naturally-occurring oxide to its re-conversion to oxide for reactor fuels. The papers furnish insights into the chemical, physical, and nuclear properties of uranium hexafluoride as they influence its transport, storage, and the design and operation of plant-scale facilities for production, processing, and conversion to oxide. The papers demonstrate, in an industry often cited for its excellent safety record, continuing efforts to further improve safety in all areas of handling uranium hexafluoride
A 600kV 15mA Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage
International Nuclear Information System (INIS)
Su Tongling; Zhang Yimin; Chen Shangwen; Liu Yantong; Lv Huiyi; Liu Jiangtao
2006-01-01
A Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage has been developed. This power supply has been operated in a ns pulse neutron generator. The maximum non-load voltage is 600kV while the working voltage and load current are 550kV and 15mA, respectively. The tested results indicate that when the power supply is operated at 300kV, 6.7mA and the input voltage varies +/-10%, the long-term stability of the output voltage is S=(0.300-1.006)x10 -3 . The ripple voltage is δU P-P =6.2V at 300kV, 6.8-8.3mA and the ratio of δU P-P to the output voltage V H is δU P-P /V H =2.1x10 -5
Ionization smoke detectors - the high-voltage issues
International Nuclear Information System (INIS)
Anon.
1992-01-01
Production of high-voltage ionization smoke detectors ceased in 1978 following the development of lower voltage models which used much smaller amounts of radioactive material. Despite this fact, thousands of high-voltage detectors are still in use today in many large UK companies. The major users argue that there is no reason to stop using their detectors if they are still fit for their purpose - many could last for another 15 to 20 years if properly maintained. But pressure has been mounting on businesses to replace all their high-voltage detectors with new low-voltage models within the next couple of years. This could place a huge financial burden on the companies concerned, with costs possibly running into millions of pounds. Traditionally, the major detector installers offered cleaning and maintenance services for high-voltage detectors to their customers but these have now been withdrawn. The installers give no clear reasons for this decision except that the detectors are outmoded and should be disposed of as soon as possible. Most users would agree that conversion to low-voltage types is inevitable but their main worry is the financial strain of replacing all their detectors - and associated equipment - in one go. They would prefer to phase out their high-voltage detectors in stages over a number of years to spread the costs of conversion. The problems of maintenance is discussed. A dual voltage fire alarm panel which allows the high-voltage detectors to be phased out is mentioned. (Author)
Mitigation of voltage sag, swell and power factor correction using solid-state transformer b
Directory of Open Access Journals (Sweden)
M.R. Banaei
2014-09-01
Full Text Available This paper presents a novel topology of solid-state transformer (SST. In the design process, the AC/DC, DC/AC and AC/AC converters have been integrated to achieve higher efficiency. To obtain higher efficiency from other SST with DC-link topologies, the AC/DC and DC/AC converters have been integrated in one matrix converter. The proposed SST performs typical functions and has advantages such as power factor correction, voltage sag and swell elimination, voltage flicker reduction and protection capability in fault situations. In addition, it has other benefits such as light weight, low volume and elimination of hazardous liquid dielectrics because it uses medium frequency transformer. The operation and some performances of the proposed SST have been verified by the simulation results.
International Nuclear Information System (INIS)
Borghi, Carlo A; Cristofolini, Andrea; Grandi, Gabriele; Neretti, Gabriele; Seri, Paolo
2015-01-01
In this work a high voltage—high frequency generator for the power supply of a dielectric barrier discharge (DBD) plasma actuator for the aerodynamic control obtained by the electro-hydro-dynamic (EHD) interaction is described and tested. The generator can produce different voltage waveforms. The operating frequency is independent of the load characteristics and does not require impedance matching. The peak-to-peak voltage is 30 kV at a frequency up to 20 kHz and time variation rates up to 60 kV μs −1 . The performance of the actuator when supplied by several voltage waveforms is investigated. The tests have been performed in still air at atmospheric pressure. Voltage and current time behaviors have been measured. The evaluation of the energy delivered to the actuator allowed the estimation of the periods in which the plasma was ignited. Vibrational and rotational temperatures of the plasma have been estimated through spectroscopic acquisitions. The flow field induced in the region above the surface of the DBD actuator has been studied and the EHD conversion efficiency has been evaluated for the voltage waveforms investigated. The nearly sinusoidal multilevel voltage of the proposed generator and the sinusoidal voltage waveform of a conventional ac generator obtain comparable plasma features, EHD effects, and efficiencies. Inverse saw tooth waveform presents the highest effects and efficiency. The rectangular waveform generates suitable EHD effects but with the lowest efficiency. The voltage waveforms that induce plasmas with higher rotational temperatures are less efficient for the conversion of the electric into kinetic energy. (paper)
DEFF Research Database (Denmark)
Liu, Changjin; Xu, Dehong; Zhu, Nan
2013-01-01
Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav
2014-01-01
The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.
Phase-wise enhanced voltage support from electric vehicles in a Danish low-voltage distribution grid
DEFF Research Database (Denmark)
Knezovic, Katarina; Marinelli, Mattia
2016-01-01
High deployment of electric vehicles (EVs) imposes great challenges for the distribution grids, especially in unbalanced systems with notable voltage variations which detrimentally affect security of supply. On the other hand, with development of Vehicle-to-Grid technology, EVs may be able...... to provide numerous services for grid support, e.g., voltage control. Implemented electronic equipment will allow them to exchange reactive power for autonomous voltage support without communicating with the distribution system operator or influencing the available active power for primary transportation...
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Energy Technology Data Exchange (ETDEWEB)
Alnajjar, Mikhail S.; Haynie, Todd O.
2009-08-14
Pyrophoric reagents are extremely hazardous. Special handling techniques are required to prevent contact with air and the resulting fire. This document provides several methods for working with pyrophoric reagents outside of an inert atmosphere.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Admissibility of building cost subsidy in the power grid above the low voltage level
International Nuclear Information System (INIS)
Foerster, Sven
2015-01-01
Electricity networks are essential to the provision of electrical power to businesses and individuals. In particular for manufacturing businesses a connection to the grid above the low-voltage level is often useful. Network operators demand a subsidy for the new connection and for the change to a higher network level under the auspices of construction cost. The power network market above the low-voltage level is a natural monopoly. This leaves consumers looking for a connection to the power grid with no possibility to select among different network operators. Construction cost subsidies are not regulated by law above the low voltage level. The lack of legal regulation and the natural monopoly above the low-voltage level affect the balance of power between network operators and system users. The lawfulness of the construction cost subsidies, the prerequisites for their demand and a review of the calculation models (Leistungspreismodell, 2-Ebenen-Modell) as well as a proposal for a reform of this system form the subject of this work.
A STATCOM with Supercapacitors for Low-Voltage Ride-Through in Fixed-Speed Wind Turbines
Directory of Open Access Journals (Sweden)
Andrés Felipe Obando-Montaño
2014-09-01
Full Text Available Fixed-speed wind generator (FSWG technology has an important presence in countries where wind energy started to be developed more than a decade ago. This type of technology cannot be directly adapted to the grid codes, for example those requirements related to the immunity level under voltage dips. That behavior is typically referred as low-voltage ride through (LVRT, and it usually implies certain reactive and active power injection requirements, both during a voltage dip and during the voltage recovery. In this context, a review is presented of the LVRT exigencies present in some of the countries with the most advanced grid codes (Denmark, Germany, Spain and the United Kingdom. In this paper, the capabilities of STATCOM-based devices for fulfilling the LVRT requirements in FSWGs are analyzed. For this purpose, two technologies are considered: a STATCOM with a supercapacitor, which improves its energy storage features; and a STATCOM with a supercapacitor and a DC-DC converter, to achieve higher discharge levels.
DEFF Research Database (Denmark)
Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas
2010-01-01
A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane...... as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy....... Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing...
High-voltage electrical burns due to copper theft – Case series
Braga, M.J.; Oliveira, I.; Egipto, P.; Silva, A.
2016-01-01
Summary Electrical burns are among the most devastating trauma inflicted on the human body. These burns have a higher morbidity, length of stay and a much higher risk of amputation than any other type of burn. Electrical burns affect mostly young, working males because they are more frequently the result of a work accident. However, possibly due to the worldwide economic crisis, we are experiencing a new phenomenon: the theft of high-voltage copper wiring. PMID:27857650
ATA diagnostic data handling system: an overview
International Nuclear Information System (INIS)
Chambers, F.W.; Kallman, J.; McDonald, J.; Slominski, M.
1984-01-01
The functions to be performed by the ATA diagnostic data handling system are discussed. The capabilities of the present data acquisition system (System 0) are presented. The goals for the next generation acquisition system (System 1), currently under design, are discussed. Facilities on the Octopus system for data handling are reviewed. Finally, we discuss what has been learned about diagnostics and computer based data handling during the past year
Maximum permissible voltage of YBCO coated conductors
Energy Technology Data Exchange (ETDEWEB)
Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)
2014-06-15
Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.
Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel.
Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J
2012-07-01
Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.
Constant potential high-voltage generator
International Nuclear Information System (INIS)
Resnick, T.A.; Dupuis, W.A.; Palermo, T.
1980-01-01
An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)
Power system voltage stability and agent based distribution automation in smart grid
Nguyen, Cuong Phuc
2011-12-01
Our interconnected electric power system is presently facing many challenges that it was not originally designed and engineered to handle. The increased inter-area power transfers, aging infrastructure, and old technologies, have caused many problems including voltage instability, widespread blackouts, slow control response, among others. These problems have created an urgent need to transform the present electric power system to a highly stable, reliable, efficient, and self-healing electric power system of the future, which has been termed "smart grid". This dissertation begins with an investigation of voltage stability in bulk transmission networks. A new continuation power flow tool for studying the impacts of generator merit order based dispatch on inter-area transfer capability and static voltage stability is presented. The load demands are represented by lumped load models on the transmission system. While this representation is acceptable in traditional power system analysis, it may not be valid in the future smart grid where the distribution system will be integrated with intelligent and quick control capabilities to mitigate voltage problems before they propagate into the entire system. Therefore, before analyzing the operation of the whole smart grid, it is important to understand the distribution system first. The second part of this dissertation presents a new platform for studying and testing emerging technologies in advanced Distribution Automation (DA) within smart grids. Due to the key benefits over the traditional centralized approach, namely flexible deployment, scalability, and avoidance of single-point-of-failure, a new distributed approach is employed to design and develop all elements of the platform. A multi-agent system (MAS), which has the three key characteristics of autonomy, local view, and decentralization, is selected to implement the advanced DA functions. The intelligent agents utilize a communication network for cooperation and
Energy Technology Data Exchange (ETDEWEB)
Hourdakis, C J, E-mail: khour@gaec.gr [Ionizing Radiation Calibration Laboratory-Greek Atomic Energy Commission, PO Box 60092, 15310 Agia Paraskevi, Athens, Attiki (Greece)
2011-04-07
The practical peak voltage (PPV) has been adopted as the reference measuring quantity for the x-ray tube voltage. However, the majority of commercial kV-meter models measure the average peak, U-bar{sub P}, the average, U-bar, the effective, U{sub eff} or the maximum peak, U{sub P} tube voltage. This work proposed a method for determination of the PPV from measurements with a kV-meter that measures the average U-bar or the average peak, U-bar{sub p} voltage. The kV-meter reading can be converted to the PPV by applying appropriate calibration coefficients and conversion factors. The average peak k{sub PPV,kVp} and the average k{sub PPV,Uav} conversion factors were calculated from virtual voltage waveforms for conventional diagnostic radiology (50-150 kV) and mammography (22-35 kV) tube voltages and for voltage ripples from 0% to 100%. Regression equation and coefficients provide the appropriate conversion factors at any given tube voltage and ripple. The influence of voltage waveform irregularities, like 'spikes' and pulse amplitude variations, on the conversion factors was investigated and discussed. The proposed method and the conversion factors were tested using six commercial kV-meters at several x-ray units. The deviations between the reference and the calculated - according to the proposed method - PPV values were less than 2%. Practical aspects on the voltage ripple measurement were addressed and discussed. The proposed method provides a rigorous base to determine the PPV with kV-meters from U-bar{sub p} and U-bar measurement. Users can benefit, since all kV-meters, irrespective of their measuring quantity, can be used to determine the PPV, complying with the IEC standard requirements.
Directory of Open Access Journals (Sweden)
Yanbin Hou
2016-01-01
Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.
Automation of 3D micro object handling process
DEFF Research Database (Denmark)
Gegeckaite, Asta; Hansen, Hans Nørgaard
2007-01-01
Most of the micro objects in industrial production are handled with manual labour or in semiautomatic stations. Manual labour usually makes handling and assembly operations highly flexible, but slow, relatively imprecise and expensive. Handling of 3D micro objects poses special challenges due to ...
The pulse-driven AC Josephson voltage normal
International Nuclear Information System (INIS)
Kieler, Oliver
2016-01-01
In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.
International Nuclear Information System (INIS)
Peixoto, J.G.P.; Selbach, H.J.; Kramer, H.M.; Lange, B.
2001-04-01
In Working Group 3 of Sub-committee 62C of the international electrotechnical commission (IEC) a new project is underway [1] with the objective of specifying requirements for the performance characteristics of instruments for the non-invasive measurement of the X-ray tube voltage in diagnostic radiology. In this draft the X-ray tube voltage is specified in terms of the practical peak voltage [2]. The objective of the present work is to perform a tentative type test, based on the ''Requirements for Instruments for Non-invasive Measurements of the X-ray Tube Voltage'' defined in the IEC draft, with a commercially available non-invasive high-voltage meter. The instrument was modified so that the practical peak voltage can be measured. It is shown that the instrument, with the modifications made, is suitable for the non-invasive measurement of the practical peak voltage between 50 kV and 150 kV within the required limits of variation of the response. (orig.)
Computer controlled high voltage system
Energy Technology Data Exchange (ETDEWEB)
Kunov, B; Georgiev, G; Dimitrov, L [and others
1996-12-31
A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.
Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission
Energy Technology Data Exchange (ETDEWEB)
Myhre, Joergen Chr.
2001-07-01
of the main features when the details of the transients are of less importance. The study indicates that power supply by HVDC transmission from land to offshore oil installations could be technically feasible, even without the large synchronous compensators normally required. It has been shown that in a network only supplied by an inverter, variations of active and reactive loads have significant influence on both voltage and frequency. Particularly it should be noted that the frequency shows a positive sensitivity to increases in load. This could make the system intrinsically unstable in the case of a frequency dependent load such as motors. It was not a part of the study to optimize controllers, but even with simple controllers it was possible to keep the frequency within limits given by norms and regulations, but the voltages were dynamically outside the limits, though not very far. These voltage overswings take place in the first few instances after a disturbance, so it takes unrealistically fast controllers to handle them. They are partly due to the model, where the land based rectifier and the DC reactors are simulated by a constant current source, but partly they have to be handled by overdimensioning of the system. The simulations indicate that it should be technically possible to supply an oil platform with electrical power from land by means of HVDC transmission with small synchronous compensators. Whether this is financially feasible has not been investigated. Neither has it been considered whether the necessary equipment can actually be installed on an oil platform. Recently both ABB and Siemens have presented solutions for HVDC transmission in the lower and medium power range based on voltage source converters based on IGBTs. Fully controllable voltage source HVDC converters have properties that may be better suited than conventional line commutated current source thyristor inverters, to supply weak or passive networks, such as offshore oil installations
Qin, Qi-Zhong; Chen, Yu; Fu, Ting-Ting; Ding, Li; Han, Ling-Li; Li, Jian-Chao
2012-03-01
To understand electromagnetic radiation field strength and its influencing factors of certain 110-kV high-voltage lines in one urban area of Chongqing by measuring 110-kV high-voltage line's electromagnetic radiation level. According to the methodology as determined by the National Hygienic Standards, we selected certain adjacent residential buildings, high-voltage lines along a specific street and selected different distances around its vertical projection point as monitoring points. The levels of electromagnetic radiations were measured respectively. In this investigation within the frequency of 5-1,000 Hz both the electric field strength and magnetic field strength of each monitoring sites were lower than the public exposure standards as determined by the International Commission on Non-Ionizing Radiation Protection. However, the electrical field strength on the roof adjacent to the high-voltage lines was significantly higher than that as measured on the other floors in the same buildings (p electromagnetic radiation measurements of different monitoring points, under the same high-voltage lines, showed the location which is nearer the high-voltage line maintain a consistently higher level of radiation than the more distant locations (p Electromagnetic radiation generated by high-voltage lines decreases proportionally to the distance from the lines. The buildings can to some extent shield (or absorb) the electric fields generated by high-voltage lines nearby. The electromagnetic radiation intensity near high-voltage lines may be mitigated or intensified by the manner in which the high-voltage lines are set up, and it merits attention for the potential impact on human health.
Directory of Open Access Journals (Sweden)
Seok-Yong Lee
2009-03-01
Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.
Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung
2017-10-01
Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Scheduling of outbound luggage handling at airports
DEFF Research Database (Denmark)
Barth, Torben C.; Pisinger, David
2012-01-01
This article considers the outbound luggage handling problem at airports. The problem is to assign handling facilities to outbound flights and decide about the handling start time. This dynamic, near real-time assignment problem is part of the daily airport operations. Quality, efficiency......). Another solution method is a decomposition approach. The problem is divided into different subproblems and solved in iterative steps. The different solution approaches are tested on real world data from Frankfurt Airport....
Sequence trajectory generation for garment handling systems
Liu, Honghai; Lin, Hua
2008-01-01
This paper presents a novel generic approach to the planning strategy of garment handling systems. An assumption is proposed to separate the components of such systems into a component for intelligent gripper techniques and a component for handling planning strategies. Researchers can concentrate on one of the two components first, then merge the two problems together. An algorithm is addressed to generate the trajectory position and a clothes handling sequence of clothes partitions, which ar...
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2013-01-01
Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.
Enhanced wood fuel handling: market and design studies
Energy Technology Data Exchange (ETDEWEB)
Landen, R.; Rippengal, R.; Redman, A.N.
1997-09-01
This report examines the potential for the manufacture and sale of novel wood fuel handling systems as a means of addressing users' concerns regarding current capital costs and potential high labour costs of non-automated systems. The report considers fuel handling technology that is basically appropriate for wood-fired heating systems of between c.100kW and c.1MW maximum continuous rating. This report details work done by the project collaborators in order to: (1) assess the current status of wood fuel handling technology; (2) evaluate the market appetite for improved wood fuel handling technology; (3) derive capital costs which are acceptable to customers; (4) review design options; and (5) select one or more design options worthy of further development. The current status of wood fuel handling technology is determined, and some basic modelling to give guidance on acceptable capital costs of 100-1000kW wood fuel handling systems is undertaken. (author)
Voltage scheduling for low power/energy
Manzak, Ali
2001-07-01
Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned
Transition voltages of vacuum-spaced and molecular junctions with Ag and Pt electrodes
Wu, Kunlin
2014-07-07
The transition voltage of vacuum-spaced and molecular junctions constructed with Ag and Pt electrodes is investigated by non-equilibrium Green\\'s function formalism combined with density functional theory. Our calculations show that, similarly to the case of Au-vacuum-Au previously studied, the transition voltages of Ag and Pt metal-vacuum-metal junctions with atomic protrusions on the electrode surface are determined by the local density of states of the p-type atomic orbitals of the protrusion. Since the energy position of the Pt 6p atomic orbitals is higher than that of the 5p/6p of Ag and Au, the transition voltage of Pt-vacuum-Pt junctions is larger than that of both Ag-vacuum-Ag and Au-vacuum-Au junctions. When one moves to analyzing asymmetric molecular junctions constructed with biphenyl thiol as central molecule, then the transition voltage is found to depend on the specific bonding site for the sulfur atom in the thiol group. In particular agreement with experiments, where the largest transition voltage is found for Ag and the smallest for Pt, is obtained when one assumes S binding at the hollow-bridge site on the Ag/Au(111) surface and at the adatom site on the Pt(111) one. This demonstrates the critical role played by the linker-electrode binding geometry in determining the transition voltage of devices made of conjugated thiol molecules. © 2014 AIP Publishing LLC.
Lindahl, C; Pinzke, S; Herlin, A; Keeling, L J
2016-03-01
Cattle handling is a dangerous activity on dairy farms, and cows are a major cause of injuries to livestock handlers. Even if dairy cows are generally tranquil and docile, when situations occur that they perceive or remember as aversive, they may become agitated and hazardous to handle. This study aimed to compare human-animal interactions, cow behavior, and handler safety when moving cows to daily milking and moving cows to more rarely occurring and possibly aversive hoof trimming. These processes were observed on 12 Swedish commercial dairy farms. The study included behavioral observations of handler and cows and cow heart rate recordings, as well as recording frequencies of situations and incidents related to an increased injury risk to the handler. At milking, cows were quite easily moved using few interactions. As expected, the cows showed no behavioral signs of stress, fear, or resistance and their heart rate only rose slightly from the baseline (i.e., the average heart rate during an undisturbed period before handling). Moving cows to hoof trimming involved more forceful and gentle interactions compared with moving cows to milking. Furthermore, the cows showed much higher frequencies of behaviors indicative of aversion and fear (e.g., freezing, balking, and resistance), as well as a higher increase in heart rate. The risk of injury to which handlers were exposed also increased when moving cows to hoof trimming rather than to routine milking. Some interactions (such as forceful tactile interactions with an object and pulling a neck strap or halter) appeared to be related to potentially dangerous incidents where the handler was being kicked, head-butted, or run over by a cow. In conclusion, moving cows to hoof trimming resulted in higher frequencies of behaviors indicating fear, more forceful interactions, and increased injury risks to the handler than moving cows to milking. Improving potentially stressful handling procedures (e.g., by better animal handling
DEFF Research Database (Denmark)
Oleschuk, Valentin; Blaabjerg, Frede
2002-01-01
A novel method of direct synchronous pulse-width modulation (PWM) is disseminated to three-level voltage source inverters with control algorithms with elimination of the common-mode voltages in three-phase drive systems with PWM. It provides smooth pulses-ratio changing and a quarter-wave symmetry...... of the voltage waveforms during the whole control range including overmodulation. Continuous, discontinuous and "direct-direct" schemes of synchronous PWM with both algebraic and trigonometric control functions have been analysed and compared. Simulations give the behaviour of the proposed methods and show some...... advantages of synchronous PWM in comparison with asynchronous at low ratios between the switching frequency and fundamental frequency....
Directory of Open Access Journals (Sweden)
Yongchun Yang
2018-04-01
Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.
Cai, Yuanji; Guan, Yonggang; Liu, Weidong
2017-06-01
Transient enclosure voltage (TEV), which is a phenomenon induced by the inner dielectric breakdown of SF6 during disconnector operations in a gas-insulated switchgear (GIS), may cause issues relating to shock hazard and electromagnetic interference to secondary equipment. This is a critical factor regarding the electromagnetic compatibility of ultra-high-voltage (UHV) substations. In this paper, the statistical characteristics of TEV at UHV level are collected from field experiments, and are analyzed and compared to those from a repeated strike process. The TEV waveforms during disconnector operations are recorded by a self-developed measurement system first. Then, statistical characteristics, such as the pulse number, duration of pulses, frequency components, magnitude and single pulse duration, are extracted. The transmission line theory is introduced to analyze the TEV and is validated by the experimental results. Finally, the relationship between the TEV and the repeated strike process is analyzed. This proves that the pulse voltage of the TEV is proportional to the corresponding breakdown voltage. The results contribute to the definition of the standard testing waveform of the TEV, and can aid the protection of electronic devices in substations by minimizing the threat of this phenomenon.
Piezo Voltage Controlled Planar Hall Effect Devices.
Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You
2016-06-22
The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.
Coordinated Voltage Control of Active Distribution Network
Directory of Open Access Journals (Sweden)
Xie Jiang
2016-01-01
Full Text Available This paper presents a centralized coordinated voltage control method for active distribution network to solve off-limit problem of voltage after incorporation of distributed generation (DG. The proposed method consists of two parts, it coordinated primal-dual interior point method-based voltage regulation schemes of DG reactive powers and capacitors with centralized on-load tap changer (OLTC controlling method which utilizes system’s maximum and minimum voltages, to improve the qualified rate of voltage and reduce the operation numbers of OLTC. The proposed coordination has considered the cost of capacitors. The method is tested using a radial edited IEEE-33 nodes distribution network which is modelled using MATLAB.
Remote handling for an ISIS target change
International Nuclear Information System (INIS)
Broome, T.A.; Holding, M.
1989-01-01
During 1987 two ISIS targets were changed. This document describes the main features of the remote handling aspects of the work. All the work has to be carried out using remote handling techniques. The radiation level measured on the surface of the reflector when the second target had been removed was about 800 mGy/h demonstrating that hands on operations on any part of the target reflector moderator assembly is not practical. The target changes were the first large scale operations in the Target Station Remote Handling Cell and a great deal was learned about both equipment and working practices. Some general principles emerged which are applicable to other active handling tasks on facilities like ISIS and these are discussed below. 8 figs
International Nuclear Information System (INIS)
Ramgren, Birgitta; Holtaas, Stig; Siemund, Roger; Dept. of Radiology, Lund Univ., Lund
2012-01-01
Background Computed tomography angiography (CTA) of intracranial arteries has high demands on image quality. Important parameters influencing vessel enhancement are injection rate, concentration of contrast media and tube voltage. Purpose To evaluate the impact of an increase of contrast media concentration from 300 to 400 mg iodine/mL (mgI/mL) and the effect of a decrease of tube voltage from 120 to 90 kVp on vessel attenuation and image quality in CT angiography of intracranial arteries. Material and Methods Sixty-three patients were included into three protocol groups: Group I, 300 mgI/mL 120 kVp; Group II, 400 mgI/mL 120 kVp; Group III, 400 mgI/mL 90 kVp. Hounsfield units (HU) were measured in the internal carotid artery (ICA) and the M1 and M2 segments of the middle cerebral artery. Image quality grading was performed regarding M1 and M2 segments, volume rendering and general image impression. Results The difference in mean HU in ICA concerning the effect of contrast media concentration was statistically significant (P = 0.03) in favor of higher concentration. The difference in ICA enhancement due to the effect of tube voltage was statistically significant (P < 0.01) in favor of lower tube voltage. The increase of contrast medium concentration raised the mean enhancement in ICA with 18% and the decrease of tube voltage raised the mean enhancement with 37%. Image quality grading showed a trend towards improved grading for higher contrast concentration and lower tube voltage. Statistically significant better grading was found for the combined effect of both measures except for general impression (P 0.01-0.05). Conclusion The uses of highly concentrated contrast media and low tube voltage are easily performed measures to improve image quality in CTA of intracranial vessel
Directory of Open Access Journals (Sweden)
Kota Kasahara
Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.
International Nuclear Information System (INIS)
Wang, Jia; Cao, Zhongyue; Pan, Fuping; Wang, Fuguo; Liang, Aimin; Zhang, Junyan
2015-01-01
Highlights: • a-C:H films deposited by high frequency unipolar pulse PECVD. • The film structures can be adjusted by bias voltage. • More graphitic structures form at high bias voltage. • The mechanical and tribological properties are improved by these structures. - Abstract: Amorphous hydrogenated carbon (a-C:H) films were prepared by high frequency unipolar pulse plasma-enhanced chemical vapor deposition in CH 4 , Ar, and H 2 atmosphere with the bias voltage in the range of −800 –−1600 V. The microstructures and mechanical properties of a-C:H films were investigated via high resolution transmission electron microscope (HRTEM), Raman spectroscopy, and Nanoindenter. The results reveal that the curved and straight graphitic microstructures appear in amorphous carbon matrix, and their contents increase obviously with the bias voltage. At the same time, the corresponding hardness decreases and elastic recovery increases, however even in such a case films still possess excellent mechanical properties. According to the tribological property characterization, we believe that the bias voltage also influences their tribological performances significantly, the higher the bias voltage finally gets, the lower the friction coefficient and wear rate occur. These results indicate that the microstructures of a-C:H films can be tuned efficiently by bias voltage and the films with good mechanical and tribological properties can be obtained at a higher range.
Energy Technology Data Exchange (ETDEWEB)
Wang, Jia; Cao, Zhongyue; Pan, Fuping [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Wang, Fuguo, E-mail: fgwang@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Liang, Aimin [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Zhang, Junyan, E-mail: zhangjunyan@licp.cas.cn [State Key Laboratory of Solid Lubrication, Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)
2015-11-30
Highlights: • a-C:H films deposited by high frequency unipolar pulse PECVD. • The film structures can be adjusted by bias voltage. • More graphitic structures form at high bias voltage. • The mechanical and tribological properties are improved by these structures. - Abstract: Amorphous hydrogenated carbon (a-C:H) films were prepared by high frequency unipolar pulse plasma-enhanced chemical vapor deposition in CH{sub 4}, Ar, and H{sub 2} atmosphere with the bias voltage in the range of −800 –−1600 V. The microstructures and mechanical properties of a-C:H films were investigated via high resolution transmission electron microscope (HRTEM), Raman spectroscopy, and Nanoindenter. The results reveal that the curved and straight graphitic microstructures appear in amorphous carbon matrix, and their contents increase obviously with the bias voltage. At the same time, the corresponding hardness decreases and elastic recovery increases, however even in such a case films still possess excellent mechanical properties. According to the tribological property characterization, we believe that the bias voltage also influences their tribological performances significantly, the higher the bias voltage finally gets, the lower the friction coefficient and wear rate occur. These results indicate that the microstructures of a-C:H films can be tuned efficiently by bias voltage and the films with good mechanical and tribological properties can be obtained at a higher range.
Materials Handling. Module SH-01. Safety and Health.
Center for Occupational Research and Development, Inc., Waco, TX.
This student module on materials handling is one of 50 modules concerned with job safety and health. It presents the procedures for safe materials handling. Discussed are manual handling methods (lifting and carrying by hand) and mechanical lifting (lifting by powered trucks, cranes or conveyors). Following the introduction, 15 objectives (each…
Incorporating Handling Qualities Analysis into Rotorcraft Conceptual Design
Lawrence, Ben
2014-01-01
This paper describes the initial development of a framework to incorporate handling qualities analyses into a rotorcraft conceptual design process. In particular, the paper describes how rotorcraft conceptual design level data can be used to generate flight dynamics models for handling qualities analyses. Also, methods are described that couple a basic stability augmentation system to the rotorcraft flight dynamics model to extend analysis to beyond that of the bare airframe. A methodology for calculating the handling qualities characteristics of the flight dynamics models and for comparing the results to ADS-33E criteria is described. Preliminary results from the application of the handling qualities analysis for variations in key rotorcraft design parameters of main rotor radius, blade chord, hub stiffness and flap moment of inertia are shown. Varying relationships, with counteracting trends for different handling qualities criteria and different flight speeds are exhibited, with the action of the control system playing a complex part in the outcomes. Overall, the paper demonstrates how a broad array of technical issues across flight dynamics stability and control, simulation and modeling, control law design and handling qualities testing and evaluation had to be confronted to implement even a moderately comprehensive handling qualities analysis of relatively low fidelity models. A key outstanding issue is to how to 'close the loop' with an overall design process, and options for the exploration of how to feedback handling qualities results to a conceptual design process are proposed for future work.
Enclosure for handling high activity materials abstract
International Nuclear Information System (INIS)
Jimeno de Osso, F.; Dominguez Rodriguez, G.; Cruz Castillo, F. de la; Rodriguez Esteban, A.
1977-01-01
One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With that purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. A description is given of those aspects that may be of interest to people working in this field. (author) [es
LOFT voltage insertion calibaration program
International Nuclear Information System (INIS)
Tillitt, D.N.; Miyasaki, F.S.
1975-08-01
The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)
Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B
2017-09-20
Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In
30 CFR 75.804 - Underground high-voltage cables.
2010-07-01
... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution § 75.804 Underground high-voltage cables. (a) Underground high-voltage cables used in resistance... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Underground high-voltage cables. 75.804 Section...
Electron heating of voltage-driven and matched dual frequency discharges
International Nuclear Information System (INIS)
Lieberman, M A; Lichtenberg, A J
2010-01-01
In a dual frequency capacitive sheath, a high frequency uniform sheath motion is coupled with a low frequency Child law sheath motion. For current-driven high and low frequency sheaths, the high frequency sheath motion generates most of the ohmic and stochastic heating of the discharge electrons. The low frequency motion, in addition to its primary purpose of establishing the ion bombarding energy, also increases the heating by widening the sheath width and transporting the oscillating electrons to regions of lower plasma density, and hence higher sheath velocity. In this work, we show that for voltage-driven high and low frequency sheaths, increasing the low frequency voltage reduces the heating, due to the reduced high frequency current that flows through the sheath under voltage-driven conditions. We determine the dependence of the heating on various parameters and compare the results with the current-driven case. Particle-in-cell simulations are used to confirm this result. Discharges generally employ a matching network to maximize the power transmitted to the plasma. We obtain analytic expressions for the effect of the low frequency source under matched conditions and, again, find that the low frequency source reduces the heating.
Successful application of Low Voltage Electron Microscopy to practical materials problems
International Nuclear Information System (INIS)
Bell, David C.; Mankin, Max; Day, Robert W.; Erdman, Natasha
2014-01-01
Low-voltage High-Resolution Electron Microscopy (LVHREM) has several advantages, including increased cross-sections for inelastic and elastic scattering, increased contrast per electron, decreased delocalization effects and reduced knock-on damage. Imaging at differing voltages has shown advantages for imaging materials that are knock-on damage sensitive. We show experimentally that different materials systems benefit from low voltage high-resolution microscopy. There are advantages for imaging single layer materials such as graphene at below the knock-on threshold; we present an example of imaging a graphene sheet at 40 kV. We have also examined mesoporous silica decorated with Pd nanoparticles and carbon black functionalized with Pd/Pt nanoparticles. In these cases we show that the lower voltage imaging maintains the structure of the surrounding matrix during imaging, whereas aberration correction provides the higher resolution for imaging the nanoparticle lattice. Perhaps surprisingly we show that zeolites damage preferentially by ionization effects (radiolysis). The current literature suggests that below incident energies of 40 kV the damage is mainly radiolitic, whereas at incident energies above 200 kV the knock-on damage and material sputtering will be the dominant effect. Our experimental observations support this conclusion and the effects we have observed at 40 kV are not indicative of knock-on damage. Other nanoscale materials such as thin silicon nanowires also benefit from lower voltage imaging. LVHREM imaging provides an excellent option to avoid beam damage to nanowires; our results suggest that LVHREM is suitable for nanowire-biological composites. Our experimental observations serve as a clear demonstration that even at 40 keV accelerating voltage, LVHREM can be used without inducing beam damage to locate dislocations and other crystalline defects, which may have adverse effects on nanowire device performance. Low voltage operation will likely
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Development of tritium-handling technique
International Nuclear Information System (INIS)
Ohmura, Hiroshi; Hosaka, Akio; Okamoto, Takahumi
1988-01-01
The overview of developing activities for tritium-handling techniques in IHI are presented. To establish a fusion power plant, tritium handling is one of the key technologies. Recently in JAERI, conceptual design of FER (Fusion Experimental Reactor) has been carried out, and the FER system requires a processing system for a large amount of tritium. IHI concentrate on investigation of fuel gas purification, isotope separation and storage systems under contract with Toshiba Corporation. Design results of the systems and each components are reviewed. IHI has been developing fundamental handling techniques which are the ZrNi bed for hydrogen isotope storage and isotope separation by laser. The ZrNi bed with a tritium storage capacity of 1000 Ci has been constructed and recovery capability of the hydrogen isotope until 10 -4 Torr {0.013 Pa} was confirmed. In laser isotope separation, the optimum laser wave length has been determined. (author)
International Nuclear Information System (INIS)
Olson, P.H.
1994-01-01
The regulations governing the handling of port-generated waste are often national and/or local legislation, whereas the handling of ship-generated waste is governed by the MARPOL Convention in most parts of the world. The handling of waste consists of two main phases -collection and treatment. Waste has to be collected in every port and on board every ship, whereas generally only some wastes are treated and to a certain degree in ports and on board ships. This paper considers the different kinds of waste generated in both ports and on board ships, where and how it is generated, how it could be collected and treated. The two sources are treated together to show how some ship-generated waste may be treated in port installations primarily constructed for the treatment of the port-generated waste, making integrated use of the available treatment facilities. (author)
Novel high-voltage power lateral MOSFET with adaptive buried electrodes
International Nuclear Information System (INIS)
Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji
2012-01-01
A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Magnetic resonance imaging of meniscal bucket-handle tears
International Nuclear Information System (INIS)
Dfouni, N.; Garcia, J.; Kindynis, Ph.; Bosson, D.
1997-01-01
To define MR signs of meniscal bucket-handle tears and evaluate the diagnostic efficiency of this technique. Retrospective study of 30 patients with a meniscal bucket-handle tear and 30 with a different type of tear, all proven by arthroscopy. The following MR signs of a bucket-handle tear were evaluated: 'separate meniscal fragment, 'double posterior cruciate ligament', 'snake sign' and 'double anterior horn'. A correct diagnosis of a bucket-handle tear was only made in 18/30 of patients. Several of the MR signs were seen in the same patient in 17 cases. A double posterior cruciate ligament was present only in cases of medial meniscus tears. The 12 menisci without these signs, and therefore not diagnosed as bucket-handle tears, were all classified as meniscal tears on the basis of signal extending to the meniscal surface. Nine of these were not displaced into the inter-condylar notch at arthroscopy. The interobserver agreement was excellent: kappa 0.88. The diagnosis of a bucket-handle meniscal tear, if it is displaced, can be made when one or more of the four MR evaluated signs are present. Other forms of meniscal tears are only exceptionally diagnosed as bucket-handle tears. (authors)
Voltage Support from Electric Vehicles in Distribution Grid
DEFF Research Database (Denmark)
Huang, Shaojun; Pillai, Jayakrishnan Radhakrishna; Bak-Jensen, Birgitte
2013-01-01
The paper evaluates the voltage support functions from electric vehicles (EVs) on a typical Danish distribution grid with high EV penetration. In addition to the popular voltage control modes, such as voltage droop charging (low voltage level leads to low charging power) and reactive power support...
Directory of Open Access Journals (Sweden)
Rajeev Gupta
2017-06-01
Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Gupta, Rajeev; Ghosh, Subhendu
2017-06-01
Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.
Theoretical analysis of magnetic sensor output voltage
International Nuclear Information System (INIS)
Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming
2011-01-01
The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.
A Voltage Quality Detection Method
DEFF Research Database (Denmark)
Chen, Zhe; Wei, Mu
2008-01-01
This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...
Elimination of output voltage oscillations in DC-DC converter using PWM with PI controller
Directory of Open Access Journals (Sweden)
Sreenivasappa Veeranna Bhupasandra
2010-01-01
Full Text Available In this paper the SIMULINK model of a PWM controlled DC-DC converter is modeled using switching function concept to control the speed of the DC motor. The presence of the voltage oscillation cycles due to higher switching frequency in the DC-DC converter is identified. The effect of these oscillations on the output voltage of the converter, Armature current, Developed torque and Speed of the DC motor is analyzed. In order to minimize the oscillation cycles the PI controller is proposed in the PWM controller.
Nonlinear electrokinetics at large voltages
Energy Technology Data Exchange (ETDEWEB)
Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu
2009-07-15
The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)
2016-03-07
We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.
How to Handle Impasses in Bargaining.
Durrant, Robert E.
Guidelines in an outline format are presented to school board members and administrators on how to handle impasses in bargaining. The following two rules are given: there sometimes may be strikes, but there always will be settlements; and on the way to settlements, there always will be impasses. Suggestions for handling impasses are listed under…
Okuda, Hiroko; Yonezawa, Yasushige; Takano, Yu; Okamura, Yasushi; Fujiwara, Yuichiro
2016-01-01
The voltage-gated H+ channel (Hv) is a voltage sensor domain-like protein consisting of four transmembrane segments (S1?S4). The native Hv structure is a homodimer, with the two channel subunits functioning cooperatively. Here we show that the two voltage sensor S4 helices within the dimer directly cooperate via a ?-stacking interaction between Trp residues at the middle of each segment. Scanning mutagenesis showed that Trp situated around the original position provides the slow gating kineti...
DEFF Research Database (Denmark)
Zhu, Jiebei; Guerrero, Josep M.; Hung, William
2014-01-01
A generic Inertia Emulation Controller (INEC) scheme for Multi-Terminal Voltage-Source-Converter based HVDC (VSC-MTDC) systems is proposed and presented in this paper. The proposed INEC can be incorporated in any Grid-side Voltage-Source-Converter (GVSC) station, allowing the MTDC terminal...
Current-Voltage Characteristics of Nb2O5 nanoporous via light illumination
Samihah Khairir, Nur; Rani, Rozina Abdul; Fazlida Hanim Abdullah, Wan; Hafiz Mamat, Mohamad; Kadir, Rosmalini Abdul; Rusop, M.; Sabirin Zoolfakar, Ahmad
2018-03-01
This work discussed the effect of light on I-V characteristics of anodized niobium pentoxide (Nb2O5) which formed nanoporous structure film. The structure was synthesized by anodizing niobium foils in glycerol based solution with 10 wt% supplied by two different voltages, 5V and 10V. The anodized foils that contained Nb2O5 film were then annealed to obtain an orthorhombic phase for 30 minutes at 450°C. The metal contact used for I-V testing was platinum (Pt) and it was deposited using thermal evaporator at 30nm thickness. I-V tests were conducted under different condition; dark and illumination to study the effect of light on I-V characteristics of anodized nanoporous Nb2O5. Higher anodization voltage and longer anodization time resulted in higher pore dispersion and larger pore size causing the current to increase. The increase of conductivity in I-V behaviour of Nb2O5 device is also affected by the illumination test as higher light intensity caused space charge region width to increase, thus making it easier for electron transfer between energy band gap.
30 CFR 75.813 - High-voltage longwalls; scope.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage longwalls; scope. 75.813 Section... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage Distribution High-Voltage Longwalls § 75.813 High-voltage longwalls; scope. Sections 75.814 through 75.822 of this...
Current-voltage characteristics of individual conducting polymer nanotubes and nanowires
Institute of Scientific and Technical Information of China (English)
Long Yun-ze; Yin Zhi-Hua; Li Meng-Meng; Gu Chang-Zhi; Duvail Jean-Luc; Jin Ai-zi; Wan Mei-xiang
2009-01-01
We report the current-voltage (Ⅰ-Ⅴ) characteristics of individual polypyrrole nanotubes and poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires in a temperature range from 300 K to 2 K. Considering the complex structures of such quasi-one-dimensional systems with an array of ordered conductive regions separated by disordered barriers, we use the extended fluctuation-induced tunneling (FIT) and thermal excitation model (Kaiser expression) to fit the temperature and electric-field dependent Ⅰ-Ⅴ curves. It is found that the Ⅰ-Ⅴ data measured at higher temperatures or higher voltages can be well fitted by the Kaiser expression. However, the low-temperature data around the zero bias clearly deviate from those obtained from this model. The deviation (or zero-bias conductance suppression)could be possibly ascribed to the occurrence of the Coulomb-gap in the density of states near the Femi level and/or the enhancement of electron-electron interaction resulting from nanosize effects, which have been revealed in the previous studies on low-temperature electronic transport in conducting polymer films, pellets and nanostructures. In addition,similar Ⅰ-Ⅴ characteristics and deviation are also observed in an isolated K0.27MnO2 nanowire.
Voltage Quality of Grid Connected Wind Turbines
DEFF Research Database (Denmark)
Chen, Zhe; Blaabjerg, Frede; Sun, Tao
2004-01-01
Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...
Beam induced rf cavity transient voltage
International Nuclear Information System (INIS)
Kramer, S.L.; Wang, J.M.
1998-10-01
The authors calculate the transient voltage induced in a radio frequency cavity by the injection of a relativistic bunched beam into a circular accelerator. A simplified model of the beam induced voltage, using a single tone current signal, is generated and compared with the voltage induced by a more realistic model of a point-like bunched beam. The high Q limit of the bunched beam model is shown to be related simply to the simplified model. Both models are shown to induce voltages at the resonant frequency ω r of the cavity and at an integer multiple of the bunch revolution frequency (i.e. the accelerating frequency for powered cavity operation) hω ο . The presence of two nearby frequencies in the cavity leads to a modulation of the carrier wave exp(hω ο t). A special emphasis is placed in this paper on studying the modulation function. These models prove useful for computing the transient voltage induced in superconducting rf cavities, which was the motivation behind this research. The modulation of the transient cavity voltage discussed in this paper is the physical basis of the recently observed and explained new kinds of longitudinal rigid dipole mode which differs from the conventional Robinson mode
Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.
Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo
2014-03-01
The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.
Directory of Open Access Journals (Sweden)
Rianne M. Bijlsma
2011-03-01
Full Text Available Stakeholder participation is advocated widely, but there is little structured, empirical research into its influence on policy development. We aim to further the insight into the characteristics of participatory policy development by comparing it to expert-based policy development for the same case. We describe the process of problem framing and analysis, as well as the knowledge base used. We apply an uncertainty perspective to reveal differences between the approaches and speculate about possible explanations. We view policy development as a continuous handling of substantive uncertainty and process uncertainty, and investigate how the methods of handling uncertainty of actors influence the policy development. Our findings suggest that the wider frame that was adopted in the participatory approach was the result of a more active handling of process uncertainty. The stakeholders handled institutional uncertainty by broadening the problem frame, and they handled strategic uncertainty by negotiating commitment and by including all important stakeholder criteria in the frame. In the expert-based approach, we observed a more passive handling of uncertainty, apparently to avoid complexity. The experts handled institutional uncertainty by reducing the scope and by anticipating windows of opportunity in other policy arenas. Strategic uncertainty was handled by assuming stakeholders' acceptance of noncontroversial measures that balanced benefits and sacrifices. Three other observations are of interest to the scientific debate on participatory policy processes. Firstly, the participatory policy was less adaptive than the expert-based policy. The observed low tolerance for process uncertainty of participants made them opt for a rigorous "once and for all" settling of the conflict. Secondly, in the participatory approach, actors preferred procedures of traceable knowledge acquisition over controversial topics to handle substantive uncertainty. This
WASTE HANDLING BUILDING FIRE PROTECTION SYSTEM DESCRIPTION DOCUMENT
Energy Technology Data Exchange (ETDEWEB)
J. D. Bigbee
2000-06-21
The Waste Handling Building Fire Protection System provides the capability to detect, control, and extinguish fires and/or mitigate explosions throughout the Waste Handling Building (WHB). Fire protection includes appropriate water-based and non-water-based suppression, as appropriate, and includes the distribution and delivery systems for the fire suppression agents. The Waste Handling Building Fire Protection System includes fire or explosion detection panel(s) controlling various detectors, system actuation, annunciators, equipment controls, and signal outputs. The system interfaces with the Waste Handling Building System for mounting of fire protection equipment and components, location of fire suppression equipment, suppression agent runoff, and locating fire rated barriers. The system interfaces with the Waste Handling Building System for adequate drainage and removal capabilities of liquid runoff resulting from fire protection discharges. The system interfaces with the Waste Handling Building Electrical Distribution System for power to operate, and with the Site Fire Protection System for fire protection water supply to automatic sprinklers, standpipes, and hose stations. The system interfaces with the Site Fire Protection System for fire signal transmission outside the WHB as needed to respond to a fire emergency, and with the Waste Handling Building Ventilation System to detect smoke and fire in specific areas, to protect building high-efficiency particulate air (HEPA) filters, and to control portions of the Waste Handling Building Ventilation System for smoke management and manual override capability. The system interfaces with the Monitored Geologic Repository (MGR) Operations Monitoring and Control System for annunciation, and condition status.
WASTE HANDLING BUILDING FIRE PROTECTION SYSTEM DESCRIPTION DOCUMENT
International Nuclear Information System (INIS)
J. D. Bigbee
2000-01-01
The Waste Handling Building Fire Protection System provides the capability to detect, control, and extinguish fires and/or mitigate explosions throughout the Waste Handling Building (WHB). Fire protection includes appropriate water-based and non-water-based suppression, as appropriate, and includes the distribution and delivery systems for the fire suppression agents. The Waste Handling Building Fire Protection System includes fire or explosion detection panel(s) controlling various detectors, system actuation, annunciators, equipment controls, and signal outputs. The system interfaces with the Waste Handling Building System for mounting of fire protection equipment and components, location of fire suppression equipment, suppression agent runoff, and locating fire rated barriers. The system interfaces with the Waste Handling Building System for adequate drainage and removal capabilities of liquid runoff resulting from fire protection discharges. The system interfaces with the Waste Handling Building Electrical Distribution System for power to operate, and with the Site Fire Protection System for fire protection water supply to automatic sprinklers, standpipes, and hose stations. The system interfaces with the Site Fire Protection System for fire signal transmission outside the WHB as needed to respond to a fire emergency, and with the Waste Handling Building Ventilation System to detect smoke and fire in specific areas, to protect building high-efficiency particulate air (HEPA) filters, and to control portions of the Waste Handling Building Ventilation System for smoke management and manual override capability. The system interfaces with the Monitored Geologic Repository (MGR) Operations Monitoring and Control System for annunciation, and condition status
International Nuclear Information System (INIS)
Xiong, Rui; Siegel, David; Ross, David
2014-01-01
Para-quinones such as 1,4-Benzoquinone (BQ) and menadione (MD) and ortho-quinones including the oxidation products of catecholamines, are derived from xenobiotics as well as endogenous molecules. The effects of quinones on major protein handling systems in cells; the 20/26S proteasome, the ER stress response, autophagy, chaperone proteins and aggresome formation, have not been investigated in a systematic manner. Both BQ and aminochrome (AC) inhibited proteasomal activity and activated the ER stress response and autophagy in rat dopaminergic N27 cells. AC also induced aggresome formation while MD had little effect on any protein handling systems in N27 cells. The effect of NQO1 on quinone induced protein handling changes and toxicity was examined using N27 cells stably transfected with NQO1 to generate an isogenic NQO1-overexpressing line. NQO1 protected against BQ–induced apoptosis but led to a potentiation of AC- and MD-induced apoptosis. Modulation of quinone-induced apoptosis in N27 and NQO1-overexpressing cells correlated only with changes in the ER stress response and not with changes in other protein handling systems. These data suggested that NQO1 modulated the ER stress response to potentiate toxicity of AC and MD, but protected against BQ toxicity. We further demonstrated that NQO1 mediated reduction to unstable hydroquinones and subsequent redox cycling was important for the activation of the ER stress response and toxicity for both AC and MD. In summary, our data demonstrate that quinone-specific changes in protein handling are evident in N27 cells and the induction of the ER stress response is associated with quinone-mediated toxicity. - Highlights: • Unstable hydroquinones contributed to quinone-induced ER stress and toxicity
Energy Technology Data Exchange (ETDEWEB)
Xiong, Rui; Siegel, David; Ross, David, E-mail: david.ross@ucdenver.edu
2014-10-15
Para-quinones such as 1,4-Benzoquinone (BQ) and menadione (MD) and ortho-quinones including the oxidation products of catecholamines, are derived from xenobiotics as well as endogenous molecules. The effects of quinones on major protein handling systems in cells; the 20/26S proteasome, the ER stress response, autophagy, chaperone proteins and aggresome formation, have not been investigated in a systematic manner. Both BQ and aminochrome (AC) inhibited proteasomal activity and activated the ER stress response and autophagy in rat dopaminergic N27 cells. AC also induced aggresome formation while MD had little effect on any protein handling systems in N27 cells. The effect of NQO1 on quinone induced protein handling changes and toxicity was examined using N27 cells stably transfected with NQO1 to generate an isogenic NQO1-overexpressing line. NQO1 protected against BQ–induced apoptosis but led to a potentiation of AC- and MD-induced apoptosis. Modulation of quinone-induced apoptosis in N27 and NQO1-overexpressing cells correlated only with changes in the ER stress response and not with changes in other protein handling systems. These data suggested that NQO1 modulated the ER stress response to potentiate toxicity of AC and MD, but protected against BQ toxicity. We further demonstrated that NQO1 mediated reduction to unstable hydroquinones and subsequent redox cycling was important for the activation of the ER stress response and toxicity for both AC and MD. In summary, our data demonstrate that quinone-specific changes in protein handling are evident in N27 cells and the induction of the ER stress response is associated with quinone-mediated toxicity. - Highlights: • Unstable hydroquinones contributed to quinone-induced ER stress and toxicity.
Handling Kids in Crisis with Care
Bushinski, Cari
2018-01-01
The Handle with Care program helps schools help students who experience trauma. While at the scene of an event like a domestic violence call, drug raid, or car accident, law enforcement personnel determine the names and school of any children present. They notify that child's school to "handle ___ with care" the next day, and the school…
High voltage designing of 300.000 Volt
International Nuclear Information System (INIS)
Hutapea, Sumihar.
1978-01-01
Some methods of designing a.c and d.c high voltage supplies are discussed. A high voltage supply for the Gama Research Centre accelerator is designed using transistor pulse generators. High voltage transformers being made using radio transistor ferrits as a core are also discussed. (author)
Lightning Overvoltage on Low-Voltage Distribution System
Michishita, Koji
The portion of the faults of a medium-voltage line, cause by lightning, tends to increase with often reaching beyond 30%. However, due to the recent progress of the lightning protection design, the number of faults has decreased to 1/3 of that at 30 years ago. As for the low-voltage distribution line, the fault rate has been estimated primarily, although the details of the overvoltages have not been studied yet. For the further development of highly information-oriented society, improvement of reliability of electric power supply to the appliance in a low-voltage customer will be socially expected. Therefore, it is important to establish effective lightning protection design of the low-voltage distribution system, defined to be composed of lines having mutual interaction on the customers' electric circuits, such as a low-voltage distribution line, an antenna line and a telecommunication line. In this report, the author interprets the recent research on the lightning overvoltage on a low-voltage distribution system.
Wind Power Plant Voltage Stability Evaluation: Preprint
Energy Technology Data Exchange (ETDEWEB)
Muljadi, E.; Zhang, Y. C.
2014-09-01
Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.
Survey of tritiated oil sources and handling practices
International Nuclear Information System (INIS)
Miller, J.M.
1994-08-01
Tritium interactions with oil sources (primarily associated with pumps) in tritium-handling facilities can lead to the incorporation of tritium in the oil and the production of tritiated hydrocarbons. This results in a source of radiological hazard and the need for special handling considerations during maintenance, decontamination, decommissioning and waste packaging and storage. The results of a general survey of tritiated-oil sources and their associated characteristics, handling practices, analysis techniques and waste treatment/storage methods are summarized here. Information was obtained from various tritium-handling laboratories, fusion devices, and CANDU plants. 38 refs., 1 fig
Effects of handling on fear reactions in young Icelandic horses
DEFF Research Database (Denmark)
Marsbøll, Anna Feldberg; Christensen, Janne Winther
2015-01-01
To investigate the effect of a short-term standardised handling procedure on reactions of young horses in 2 types of fear tests (including and excluding human handling). Study design An experimental study with 3-year-old Icelandic horses (n = 24). Methods Handled horses (n = 12) were trained according...... to a standardised handling procedure whereas controls (n = 12) remained untrained. Behavioural and heart rate responses in a novel object test and 2 handling fear tests (HFTs) were measured. The HFTs were conducted with both an unknown (HFT-unknown) and a known handler (HFT-known). Results There was no effect...... correlated significantly between tests. Conclusions Previous handling may affect the behavioural fear response of horses when handled by their usual handler, whereas this effect did not apply to an unknown handler. Heart rates appeared unaffected by handling and may be a more reliable indicator...
Petit, C.; Zander, D.
2007-10-01
It has been shown that the low voltage gate current in ultrathin oxide metal-oxide-semiconductor devices is very sensitive to electrical stresses. Therefore, it can be used as a reliability monitor when the oxide thickness becomes too small for traditional electrical measurements to be used. In this work, we present a study on n-MOSCAP devices at negative gate bias in the direct tunneling (DT) regime. If the low voltage stress-induced leakage current (LVSILC) depends strongly on the low sense voltages, it also depends strongly on the stress voltage magnitude. We show that two LVSILC peaks appear as a function of the sense voltage in the LVSILC region and that their magnitude, one compared to the other, depends strongly on the stress voltage magnitude. One is larger than the other at low stress voltage and smaller at high stress voltage. From our experimental results, different conduction mechanisms are analyzed. To explain LVSILC variations, we propose a model of the conduction through the ultrathin gate oxide based on two distinctly different trap-assisted tunneling mechanisms: inelastic of gate electron (INE) and trap-assisted electron (ETAT).
Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels
Cui, Jianmin
2016-01-01
Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405
Light emitting diode driver with differential voltage supply
2015-01-01
The current invention relates to a driver for driving one or a plurality of LEDs (D1, D2), comprising at least one driving unit (201, 202) adapted to be supplied with a differential voltage, between one first bias voltage (VB1) and one second bias voltage (VB2), the differential voltage being
DEFF Research Database (Denmark)
Shokri, Yunes; Ebrahimzadeh, Esmaeil; Lesani, Hamid
2014-01-01
under unbalanced grid voltage and small voltage sag conditions without needing additional DC link capacitor or energy storage unlike other methods. The control system includes negative and positive sequence controllers which make the stator voltage balanced and keep it constant at the nominal value...
Use of the V-sign in the diagnosis of bucket-handle meniscal tear of the knee
Energy Technology Data Exchange (ETDEWEB)
Rao, Nisha [Radiology Associates of Tampa, Tampa, FL (United States); Patel, Yogita [Jamaica Hospital Medical Center, Jamaica, NY (United States); Opsha, Oleg; Eisemon, Eric; Beltran, Javier [Maimonides Medical Center, Brooklyn, NY (United States); Chen, Qi [SUNY Downstate Medical Center, Department of Radiology, Brooklyn, NY (United States); Owen, Joshua [Saint Louis University School of Medicine, Department of Radiology, St. Louis, MO (United States); Fogel, Joshua [Brooklyn College of the City University of New York, Department of Economics, Brooklyn, NY (United States)
2012-03-15
Bucket-handle tear is a displaced vertical longitudinal tear of the meniscus. Several signs of the tear have been described on MRI but none in the axial plane. We propose to describe such a sign named the V-sign that is seen at the junction of the displaced fragment and the meniscus, which is in place. MRI imaging of 25 surgically proven bucket-handle tears was reviewed for presence of the V-sign. Two control groups, one with normal menisci (n = 75) and one with surgically proven non-bucket-handle tears (n = 25), were also evaluated. Comparisons for presence or absence of the V-sign were performed among the three groups, and also for other commonly associated signs such as double PCL sign, double delta sign, and presence of ACL tear. Also, sensitivity, specificity, and positive and negative predictive values were calculated. Among those with bucket-handle tear, 72% demonstrated the V-sign while no participant in either control group had the V-sign (P {<=} 0.001). The V-sign occurred in 38% of those with double PCL sign, 55.6% with ACL tear, and 66.7% with double delta sign. The V-sign had higher sensitivity and negative predictive values than other signs related to bucket-handle tear. The V-sign, when seen on an axial plane image, is highly suggestive of bucket-handle tear. Our data suggest the benefit of using the V-sign for detecting bucket-handle tears, perhaps even above other commonly used approaches. (orig.)
Use of the V-sign in the diagnosis of bucket-handle meniscal tear of the knee
International Nuclear Information System (INIS)
Rao, Nisha; Patel, Yogita; Opsha, Oleg; Eisemon, Eric; Beltran, Javier; Chen, Qi; Owen, Joshua; Fogel, Joshua
2012-01-01
Bucket-handle tear is a displaced vertical longitudinal tear of the meniscus. Several signs of the tear have been described on MRI but none in the axial plane. We propose to describe such a sign named the V-sign that is seen at the junction of the displaced fragment and the meniscus, which is in place. MRI imaging of 25 surgically proven bucket-handle tears was reviewed for presence of the V-sign. Two control groups, one with normal menisci (n = 75) and one with surgically proven non-bucket-handle tears (n = 25), were also evaluated. Comparisons for presence or absence of the V-sign were performed among the three groups, and also for other commonly associated signs such as double PCL sign, double delta sign, and presence of ACL tear. Also, sensitivity, specificity, and positive and negative predictive values were calculated. Among those with bucket-handle tear, 72% demonstrated the V-sign while no participant in either control group had the V-sign (P ≤ 0.001). The V-sign occurred in 38% of those with double PCL sign, 55.6% with ACL tear, and 66.7% with double delta sign. The V-sign had higher sensitivity and negative predictive values than other signs related to bucket-handle tear. The V-sign, when seen on an axial plane image, is highly suggestive of bucket-handle tear. Our data suggest the benefit of using the V-sign for detecting bucket-handle tears, perhaps even above other commonly used approaches. (orig.)
Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian
2011-11-30
We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.
A High-Voltage Level Tolerant Transistor Circuit
Annema, Anne J.; Geelen, Godefridus Johannes Gertrudis Maria
2001-01-01
A high-voltage level tolerant transistor circuit, comprising a plurality of cascoded transistors, including a first transistor (T1) operatively connected to a high-voltage level node (3) and a second transistor (T2) operatively connected to a low-voltage level node (2). The first transistor (T1)
Energy Technology Data Exchange (ETDEWEB)
Profili, J. [LAPLACE, Université de Toulouse, CNRS, INPT, UPS, Toulouse (France); Département de Physique, Université de Montréal, Montréal, Québec H3C 3J7 (Canada); Levasseur, O.; Stafford, L. [Département de Physique, Université de Montréal, Montréal, Québec H3C 3J7 (Canada); Naudé, N.; Gherardi, N., E-mail: nicolas.gherardi@laplace.univ-tlse.fr [LAPLACE, Université de Toulouse, CNRS, INPT, UPS, Toulouse (France); Chaneac, C. [Sorbonne Universités, UPMC Univ. Paris 06, CNRS, Collège de France, Laboratoire de Chimie de la Matière Condensée de Paris (CMCP), 4 place Jussieu, F-75005 Paris (France)
2016-08-07
This work examines the growth dynamics of TiO{sub 2}-SiO{sub 2} nanocomposite coatings in plane-to-plane Dielectric Barrier Discharges (DBDs) at atmospheric pressure operated in a Townsend regime using nebulized TiO{sub 2} colloidal suspension in hexamethyldisiloxane as the growth precursors. For low-frequency (LF) sinusoidal voltages applied to the DBD cell, with voltage amplitudes lower than the one required for discharge breakdown, Scanning Electron Microscopy of silicon substrates placed on the bottom DBD electrode reveals significant deposition of TiO{sub 2} nanoparticles (NPs) close to the discharge entrance. On the other hand, at higher frequencies (HF), the number of TiO{sub 2} NPs deposited strongly decreases due to their “trapping” in the oscillating voltage and their transport along the gas flow lines. Based on these findings, a combined LF-HF voltage waveform is proposed and used to achieve significant and spatially uniform deposition of TiO{sub 2} NPs across the whole substrate surface. For higher voltage amplitudes, in the presence of hexamethyldisiloxane and nitrous oxide for plasma-enhanced chemical vapor deposition of inorganic layers, it is found that TiO{sub 2} NPs become fully embedded into a silica-like matrix. Similar Raman spectra are obtained for as-prepared TiO{sub 2} NPs and for nanocomposite TiO{sub 2}-SiO{sub 2} coating, suggesting that plasma exposure does not significantly alter the crystalline structure of the TiO{sub 2} NPs injected into the discharge.
International Nuclear Information System (INIS)
Freitas Colaco, Daniel; Alexandria, Auzuir R. de; Cortez, Paulo Cesar; Frota, Joao Batista B.; Nunes de Lima, Jose Nunes de; Albuquerque, Victor Hugo C. de
2010-01-01
This work has the objective of developing, analysing and applying a new tool for management the status of break disconnectors in high voltage substations from digital images. This tool uses a non-supervised kind of artificial neural network using the Kohonen learning algorithm, known as a self-organizing maps. In order to develop the proposed tool, C/C++ programming language, provided with easily used interfaces, is used. In order to obtain the results, three environments are considered: one for laboratory simulation and two pilot projects installed in the Fortaleza II/CHESF substation. These pilots are used for 230 kV EV-2000 type and 500 kV semi-pantographic type break disconnector management tests. The results prove the developed system's efficiency, because it is able to detect 100% of open and closed identification situations. However, the neural network utilised for management break disconnectors has become suitable for installation in high voltage substations in order to support the maintenance team in safely handling these disconnectors.
Energy Technology Data Exchange (ETDEWEB)
Freitas Colaco, Daniel, E-mail: colaco@deti.ufc.b [Universidade Federal do Ceara (UFC), Centro de Tecnologia (CT), Departamento de Engenharia de Teleinformatica - DETI, Campus do PICI S/N, Bloco 723, 60455-970 Fortaleza, Ceara (Brazil); Alexandria, Auzuir R. de, E-mail: auzuir@ifce.edu.b [Instituto Federal de Educacao, Ciencia e Tecnologia do Ceara (IFCE), Area da industria, Nucleo de Simulacao Computacional-N5IMCO, Campus Fortaleza, Av. Treze de Maio, 2081, 60040-531 Fortaleza, Ceara (Brazil); Cortez, Paulo Cesar, E-mail: cortez@deti.ufc.b [Universidade Federal do Ceara (UFC), Centro de Tecnologia (CT), Departamento de Engenharia de Teleinformatica - DETI, Campus do PICI S/N, Bloco 723, 60455-970 Fortaleza, Ceara (Brazil); Frota, Joao Batista B., E-mail: jb@ifce.edu.b [Instituto Federal de Educacao, Ciencia e Tecnologia do Ceara (IFCE), Area da industria, Nucleo de Simulacao Computacional-N5IMCO, Campus Fortaleza, Av. Treze de Maio, 2081, 60040-531 Fortaleza, Ceara (Brazil); Nunes de Lima, Jose Nunes de, E-mail: josenl@chesf.gov.b [Companhia Hidro Eletrica do Sao Francisco (CHESF), Rua Delmiro Gouveia, 333, 50761-901 Recife, Pernambuco (Brazil); Albuquerque, Victor Hugo C. de, E-mail: victor.albuquerque@fe.up.p [Universidade de Fortaleza (UNIFOR), Centro de Ciencias Tecnologicas (CCT), Nucleo de Pesquisas Tecnologicas - NPT, Av. Washington Soares, 1321, Sala NPT/CCT, CEP 60.811-905, Edson Queiroz (Brazil); Universidade Federal da Paraiba (UFPB), Departamento de Engenharia Mecanica (DEM), Cidade Universitaria, S/N, 58059-900 Joao Pessoa, Paraiba (Brazil)
2010-11-15
This work has the objective of developing, analysing and applying a new tool for management the status of break disconnectors in high voltage substations from digital images. This tool uses a non-supervised kind of artificial neural network using the Kohonen learning algorithm, known as a self-organizing maps. In order to develop the proposed tool, C/C++ programming language, provided with easily used interfaces, is used. In order to obtain the results, three environments are considered: one for laboratory simulation and two pilot projects installed in the Fortaleza II/CHESF substation. These pilots are used for 230 kV EV-2000 type and 500 kV semi-pantographic type break disconnector management tests. The results prove the developed system's efficiency, because it is able to detect 100% of open and closed identification situations. However, the neural network utilised for management break disconnectors has become suitable for installation in high voltage substations in order to support the maintenance team in safely handling these disconnectors.
Energy Technology Data Exchange (ETDEWEB)
1974-09-18
Details of bulk handling equipment suitable for collection and compressing wood waste from commercial joinery works are discussed. The Redler Bin Discharger ensures free flow of chips from storage silo discharge prior to compression into briquettes for use as fuel or processing into chipboard.
A cascaded three-phase symmetrical multistage voltage multiplier
International Nuclear Information System (INIS)
Iqbal, Shahid; Singh, G K; Besar, R; Muhammad, G
2006-01-01
A cascaded three-phase symmetrical multistage Cockcroft-Walton voltage multiplier (CW-VM) is proposed in this report. It consists of three single-phase symmetrical voltage multipliers, which are connected in series at their smoothing columns like string of batteries and are driven by three-phase ac power source. The smoothing column of each voltage multiplier is charged twice every cycle independently by respective oscillating columns and discharged in series through load. The charging discharging process completes six times a cycle and therefore the output voltage ripple's frequency is of sixth order of the drive signal frequency. Thus the proposed approach eliminates the first five harmonic components of load generated voltage ripples and sixth harmonic is the major ripple component. The proposed cascaded three-phase symmetrical voltage multiplier has less than half the voltage ripple, and three times larger output voltage and output power than the conventional single-phase symmetrical CW-VM. Experimental and simulation results of the laboratory prototype are given to show the feasibility of proposed cascaded three-phase symmetrical CW-VM
Yunxiao, ZHANG; Yuanxiang, ZHOU; Ling, ZHANG; Zhen, LIN; Jie, LIU; Zhongliu, ZHOU
2018-05-01
In this paper, work was conducted to reveal electrical tree behaviors (initiation and propagation) of silicone rubber (SIR) under an impulse voltage with high temperature. Impulse frequencies ranging from 10 Hz to 1 kHz were applied and the temperature was controlled between 30 °C and 90 °C. Experimental results show that tree initiation voltage decreases with increasing pulse frequency, and the descending amplitude is different in different frequency bands. As the pulse frequency increases, more frequent partial discharges occur in the channel, increasing the tree growth rate and the final shape intensity. As for temperature, the initiation voltage decreases and the tree shape becomes denser as the temperature gets higher. Based on differential scanning calorimetry results, we believe that partial segment relaxation of SIR at high temperature leads to a decrease in the initiation voltage. However, the tree growth rate decreases with increasing temperature. Carbonization deposition in the channel under high temperature was observed under microscope and proven by Raman analysis. Different tree growth models considering tree channel characteristics are proposed. It is believed that increasing the conductivity in the tree channel restrains the partial discharge, holding back the tree growth at high temperature.
ПАНЧЕНКО, В В
2015-01-01
The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...
Directory of Open Access Journals (Sweden)
F. Azma
2015-06-01
Full Text Available This paper develops an effective control framework for DC voltage control and power-sharing of multi-terminal DC (MTDC grids based on an optimal power flow (OPF procedure and the voltage-droop control. In the proposed approach, an OPF algorithm is executed at the secondary level to find optimal reference of DC voltages and active powers of all voltage-regulating converters. Then, the voltage droop characteristics of voltage-regulating converters, at the primary level, are tuned based on the OPF results such that the operating point of the MTDC grid lies on the voltage droop characteristics. Consequently, the optimally-tuned voltage droop controller leads to the optimal operation of the MTDC grid. In case of variation in load or generation of the grid, a new stable operating point is achieved based on the voltage droop characteristics. By execution of a new OPF, the voltage droop characteristics are re-tuned for optimal operation of the MTDC grid after the occurrence of the load or generation variations. The results of simulation on a grid inspired by CIGRE B4 DC grid test system demonstrate efficient grid performance under the proposed control strategy.
Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.
Pervukhin, Viktor V; Sheven, Dmitriy G
2010-01-01
The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
Influence of tube voltage on CT attenuation, radiation dose, and image quality: phantom study
International Nuclear Information System (INIS)
Li Fengtan; Li Dong; Zhang Yunting
2013-01-01
Objective: To assess the influence of tube current and tube voltage on the CT attenuation, radiation dose, and image quality. Methods: A total of 113 saline solutions with decreasing dilution of contrast medium (370 mg I/ml) was produced. MDCT scan was performed with 15 series of different settings of tube current and tube voltage. CT attenuations with 15 series of different settings were all measured, and influence of tube current and tube voltage on CT attenuations was analyzed. CT dose index (CTDIvol) was recorded. The CT attenuations with different tube voltage and current were compared with one-way ANOVA and Kruskal-Wallis rank sum test. The correlation of CT attenuation with different tube voltage and the influence of tube voltage and current on radiation dose and image quality were tested by correlation analysis. Results: Tube current (250, 200, 150, 100, and 50 mA) had no significant effect on CT attenuation (F = 0.001, 0.008, 0.075, P > 0.05), while tube voltage (120, 100, and 80 kV) had significant effect (H = 17.906, 17.906, 13.527, 20.124, 23.563, P < 0.05). The correlation between CT attenuation and tube voltage was determined with equation: CT attenuatio N_1_0_0 _k_V = 1.561 × CT attenuatio N_1_2_0 _k_v + 4.0818, CT attenuatio N_8_0 _k_v = 1.2131 × CT attenuatio N_1_2_0 _k_v + 0.9283. The influence of tube voltage on radiation dose and image quality was also analyzed, and equations were also obtained: N_1_2_0 -k_v = -5.9771 Ln (D_1_2_0 kv) + 25.412, N_1_0_0 _k_v = -10.544 Ln (D_1_0_0 _k_v) + 36.262, N_8_0 _k_v = -25.326 Ln (D_8_0 _k_v) + 62.816. According to the results of relationship among CT attenuation, radiation dose, and image quality, lower tube voltage with higher tube current can reduce the radiation dose. Conclusions: Lower tube voltage can reduce the radiation dose. However, CT attenuation was influenced, and correction should be done with the equations. (authors)
Manufacturing technology for practical Josephson voltage normals
International Nuclear Information System (INIS)
Kohlmann, Johannes; Kieler, Oliver
2016-01-01
In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.
Triple voltage dc-to-dc converter and method
Su, Gui-Jia
2008-08-05
A circuit and method of providing three dc voltage buses and transforming power between a low voltage dc converter and a high voltage dc converter, by coupling a primary dc power circuit and a secondary dc power circuit through an isolation transformer; providing the gating signals to power semiconductor switches in the primary and secondary circuits to control power flow between the primary and secondary circuits and by controlling a phase shift between the primary voltage and the secondary voltage. The primary dc power circuit and the secondary dc power circuit each further comprising at least two tank capacitances arranged in series as a tank leg, at least two resonant switching devices arranged in series with each other and arranged in parallel with the tank leg, and at least one voltage source arranged in parallel with the tank leg and the resonant switching devices, said resonant switching devices including power semiconductor switches that are operated by gating signals. Additional embodiments having a center-tapped battery on the low voltage side and a plurality of modules on both the low voltage side and the high voltage side are also disclosed for the purpose of reducing ripple current and for reducing the size of the components.
Handling of bulk solids theory and practice
Shamlou, P A
1990-01-01
Handling of Bulk Solids provides a comprehensive discussion of the field of solids flow and handling in the process industries. Presentation of the subject follows classical lines of separate discussions for each topic, so each chapter is self-contained and can be read on its own. Topics discussed include bulk solids flow and handling properties; pressure profiles in bulk solids storage vessels; the design of storage silos for reliable discharge of bulk materials; gravity flow of particulate materials from storage vessels; pneumatic transportation of bulk solids; and the hazards of solid-mater
Erwin, Patrick; Thompson, Mark E.
2011-01-01
made with the structure indium tin oxide/copper phthalocyanine (200 Å)/PDI (200 Å)/bathocuproine (100 Å)/aluminum (1000 Å). We found that PDIs with larger substituents produced higher open circuit voltages (VOC's) despite the donor acceptor interface
International Nuclear Information System (INIS)
Grisham, D.L.
1981-01-01
A remote handling system is proposed for moving a torus sector of the accelerator from under the cryostat to a point where it can be handled by a crane and for the reverse process for a new sector. Equipment recommendations are presented, as well as possible alignment schemes. Some general comments about future remote-handling methods and the present capabilities of existing systems will also be included. The specific task to be addressed is the removal and replacement of a 425 to 450 ton torus sector. This requires a horizontal movement of approx. 10 m from a normal operating position to a point where its further transport can be accomplished by more conventional means (crane or floor transporter). The same horizontal movement is required for reinstallation, but a positional tolerance of 2 cm is required to allow reasonable fit-up for the vacuum seal from the radial frames to the torus sector. Since the sectors are not only heavy but rather tall and narrow, the transport system must provide a safe, stable, and repeatable method fo sector movement. This limited study indicates that the LAMPF-based method of transporting torus sectors offers a proven method of moving heavy items. In addition, the present state of the art in remote equipment is adequate for FED maintenance
Dragon-I injector based on the induction voltage adder technique
Directory of Open Access Journals (Sweden)
Zhang Kaizhi
2006-08-01
Full Text Available The Dragon-I injector based on the induction voltage adder technique is introduced. Twelve ferrite loaded induction cells are connected in a series through central conducting stalks to achieve a pulsed voltage higher than 3.5 MV across the diode. Electrons are extracted from the velvet emitter and guided through the anode pipe by the magnets placed inside the cathode and anode shrouds. Measurements at the exit of injector show that, with an electric field of 200 kV/cm near the velvet surface and suitable magnetic field distribution, an electron beam up to 2.8 kA can be obtained with a normalized emittance of 1040π mm mrad, and energy spread of 2.1% (3σ around the central energy of 3.5 MeV.
A New Asymmetrical Current-fed Converter with Voltage Lifting
Directory of Open Access Journals (Sweden)
DELSHAD, M.
2011-05-01
Full Text Available This paper presents a new zero voltage switching current-fed DC-DC converter with high voltage gain. In this converter all switches (main and auxiliary turn on under zero voltage switching and turn off under almost zero voltage switching due to snubber capacitor. Furthermore, the voltage spike across the main switch due to leakage inductance of forward transformer is absorbed. The flyback transformer which is connected to the output in series causes to high voltage gain and less voltage stress on the power devices. Considering high efficiency and voltage gain of this converter, it is suitable for green generated systems such as fuel cells or photovoltaic systems. The presented experimental results verify the integrity of the proposed converter.
VKCDB: Voltage-gated potassium channel database
Directory of Open Access Journals (Sweden)
Gallin Warren J
2004-01-01
Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.
Muroi, Yukiko; Chanda, Baron
2009-01-01
Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.
TiN coated aluminum electrodes for DC high voltage electron guns
International Nuclear Information System (INIS)
Mamun, Md Abdullah A.; Elmustafa, Abdelmageed A.; Taus, Rhys; Forman, Eric; Poelker, Matthew
2015-01-01
Preparing electrodes made of metals like stainless steel, for use inside DC high voltage electron guns, is a labor-intensive and time-consuming process. In this paper, the authors report the exceptional high voltage performance of aluminum electrodes coated with hard titanium nitride (TiN). The aluminum electrodes were comparatively easy to manufacture and required only hours of mechanical polishing using silicon carbide paper, prior to coating with TiN by a commercial vendor. The high voltage performance of three TiN-coated aluminum electrodes, before and after gas conditioning with helium, was compared to that of bare aluminum electrodes, and electrodes manufactured from titanium alloy (Ti-6Al-4V). Following gas conditioning, each TiN-coated aluminum electrode reached −225 kV bias voltage while generating less than 100 pA of field emission (<10 pA) using a 40 mm cathode/anode gap, corresponding to field strength of 13.7 MV/m. Smaller gaps were studied to evaluate electrode performance at higher field strength with the best performing TiN-coated aluminum electrode reaching ∼22.5 MV/m with field emission less than 100 pA. These results were comparable to those obtained from our best-performing electrodes manufactured from stainless steel, titanium alloy and niobium, as reported in references cited below. The TiN coating provided a very smooth surface and with mechanical properties of the coating (hardness and modulus) superior to those of stainless steel, titanium-alloy, and niobium electrodes. These features likely contributed to the improved high voltage performance of the TiN-coated aluminum electrodes
Voltage regulation in distribution networks with distributed generation
Blažič, B.; Uljanić, B.; Papič, I.
2012-11-01
The paper deals with the topic of voltage regulation in distribution networks with relatively high distributed energy resources (DER) penetration. The problem of voltage rise is described and different options for voltage regulation are given. The influence of DER on voltage profile and the effectiveness of the investigated solutions are evaluated by means of simulation in DIgSILENT. The simulated network is an actual distribution network in Slovenia with a relatively high penetration of distributed generation. Recommendations for voltage control in networks with DER penetration are given at the end.
High-voltage engineering and testing
Ryan, Hugh M
2013-01-01
This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.
Directory of Open Access Journals (Sweden)
Junhao Luo
2018-05-01
Full Text Available As a key factor in the design of a voltage-adjustable LLC resonant converter, frequency regulation range is very important to the optimization of magnetic components and efficiency improvement. This paper presents a novel optimal design method for LLC resonant converters, which can narrow the frequency variation range and ensure high efficiency under the premise of a required gain achievement. A simplified gain model was utilized to simplify the calculation and the expected efficiency was initially set as 96.5%. The restricted area of parameter optimization design can be obtained by taking the intersection of the gain requirement, the efficiency requirement, and three restrictions of ZVS (Zero Voltage Switch. The proposed method was verified by simulation and experiments of a 150 W prototype. The results show that the proposed method can achieve ZVS from full-load to no-load conditions and can reach 1.6 times the normalized voltage gain in the frequency variation range of 18 kHz with a peak efficiency of up to 96.3%. Moreover, the expected efficiency is adjustable, which means a converter with a higher efficiency can be designed. The proposed method can also be used for the design of large-power LLC resonant converters to obtain a wide output voltage range and higher efficiency.
Directory of Open Access Journals (Sweden)
Kiorsak M.
2015-12-01
Full Text Available The article is devoted to the elaboration of the principle of relay protection against short circuits between the closely placed phases of higher voltage electrical line with self-compensation, based on the six phase’s symmetrical components. It is shown that the unsymmetrical short circuits between the closely placed phases are characterized by appearance of zero and tertiary sequences of symmetrical components. This fact can be used to choose them for relay protection. The electrical basic circuits and formulas for calculation of the passive parameters of zero and tertiary filters of currents (voltages are done. It is presented the structural-functional basic circuit scheme for relay protection against short circuits between the closely placed phases of higher voltage electrical line with self-compensation.
Getting to grips with remote handling and robotics
Energy Technology Data Exchange (ETDEWEB)
Mosey, D [Ontario Hydro, Toronto (Canada)
1984-12-01
A report on the Canadian Nuclear Society Conference on robotics and remote handling in the nuclear industry, September 1984. Remote handling in reactor operations, particularly in the Candu reactors is discussed, and the costs and benefits of use of remote handling equipment are considered. Steam generator inspection and repair is an area in which practical application of robotic technology has made a major advance.
DEFF Research Database (Denmark)
Liu, Dong; Wang, Yanbo; Chen, Zhe
2017-01-01
The input capacitor's voltages are unbalanced under the conventional control strategy in a dual half-bridge cascaded three-level (TL) DC/DC converter, which would affect the high voltage stresses on the capacitors. This paper proposes a pulse-wide modulation (PWM) strategy with two working modes...... for the dual half-bridge cascaded TL DC/DC converter, which can realize the zero-voltage switching (ZVS). More significantly, a capacitor voltage balance control is proposed by alternating the two working modes of the proposed ZVS PWM strategy, which can eliminate the voltage unbalance on the four input...... capacitors. Therefore, the proposed control strategy can improve the converter's performances in: 1) reducing the switching losses and noises of the power switches; and 2) reducing the voltage stresses on the input capacitors. Finally, the simulation results are conducted to verify the proposed control...
Cyberbullying in Higher Education: Implications and Solutions
Smith, Gina S.; Minor, Maria A.; Brashen, Henry M.
2014-01-01
Cyberbullying exists in all levels of education, from kindergarten to postsecondary. Few studies have been conducted to examine the impact of cyberbullying in higher education. Minor, Smith, and Brashen (2013) identified the need for colleges and universities to set policies and standards on how to handle faculty being cyberbullying by students.…
A low knee voltage and high breakdown voltage of 4H-SiC TSBS employing poly-Si/Ni Schottky scheme
Kim, Dong Young; Seok, Ogyun; Park, Himchan; Bahng, Wook; Kim, Hyoung Woo; Park, Ki Cheol
2018-02-01
We report a low knee voltage and high breakdown voltage 4H-SiC TSBS employing poly-Si/Ni dual Schottky contacts. A knee voltage was significantly improved from 0.75 to 0.48 V by utilizing an alternative low work-function material of poly-Si as an anode electrode. Also, reverse breakdown voltage was successfully improved from 901 to 1154 V due to a shrunk low-work-function Schottky region by a proposed self-align etching process between poly-Si and SiC. SiC TSBS with poly-Si/Ni dual Schottky scheme is a suitable structure for high-efficiency rectification and high-voltage blocking operation.
Low voltage arc formation in railguns
Hawke, R.S.
1985-08-05
A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.
High voltage engineering fundamentals
Kuffel, E; Hammond, P
1984-01-01
Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over
Growth and decay of surface voltage on silver diffused polyimide exposed to 3-15 keV electrons
Energy Technology Data Exchange (ETDEWEB)
Mahapatra, S K; Dhole, S D; Bhoraskar, V N [Department of Physics, University of Pune, Pune-411007 (India)
2007-02-21
During electron irradiation, the growth in the surface voltage on virgin and silver diffused polyimide sample was studied by varying electron energy from 3 to 15 keV and beam diameter from 3 to 15 mm. At a constant beam current, the surface voltage increased nonlinearly with electron energy but decreased slowly with beam diameter at fixed electron energy. At a surface voltage around saturation or beyond 3 kV, the electron beam was switched off and the decay in the surface voltage was studied for a period of 9 x 10{sup 4} s. The surface analysis revealed that the relative concentrations of carbon increased and that of the oxygen and the nitrogen decreased in the electron irradiated virgin and silver diffused polyimide sample, however in different proportions. Under the identical conditions of electron irradiation, the growth rate of the surface voltage, the post irradiated surface resistivity and the voltage decay constant of the silver diffused polyimide were lower than that of the virgin polyimide. The results of the present study reveal that the resistance of the silver diffused polyimide to keV electrons is higher than that of the virgin polyimide.
Handling knowledge on osteoporosis - a qualitative study
DEFF Research Database (Denmark)
Nielsen, Dorthe; Huniche, Lotte; Brixen, Kim
2013-01-01
Scand J Caring Sci; 2012 Handling knowledge on osteoporosis - a qualitative study The aim of this qualitative study was to increase understanding of the importance of osteoporosis information and knowledge for patients' ways of handling osteoporosis in their everyday lives. Interviews were...
Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.
1998-01-01
The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured
Grafting voltage and pharmacological sensitivity in potassium channels.
Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing
2016-08-01
A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.
DEFF Research Database (Denmark)
Knezovic, Katarina; Marinelli, Mattia; Juul Møller, René
2014-01-01
of incorporating electric vehicles (EVs) in a low voltage distribution network with high penetration of photovoltaic installations (PVs), and focuses on analysing potential voltage support functions from EVs and PVs. In addition, the paper evaluates the benefits that reactive power control may provide...
International Nuclear Information System (INIS)
Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda
2013-01-01
HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V
Redefining NHS complaint handling--the real challenge.
Seelos, L; Adamson, C
1994-01-01
More and more organizations find that a constructive and open dialogue with their customers can be an effective strategy for building long-term customer relations. In this context, it has been recognized that effective complaint-contact handling can make a significant contribution to organizations' attempts to maximize customer satisfaction and loyalty. Within the NHS, an intellectual awareness exists that effective complaint/contact handling can contribute to making services more efficient and cost-effective by developing customer-oriented improvement initiatives. Recent efforts have focused on redefining NHS complaint-handling procedures to make them more user-friendly and effective for both NHS employees and customers. Discusses the challenges associated with opening up the NHS to customer feedback. Highlights potential weaknesses in the current approach and argues that the real challenge is for NHS managers to facilitate a culture change that moves the NHS away from a long-established defensive complaint handling practice.
Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki
2017-08-01
A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.
Radiation effects on residual voltage of polyethylene films
International Nuclear Information System (INIS)
Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.
1986-01-01
It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)
The LMF triaxial MITL voltage adder system
International Nuclear Information System (INIS)
Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.
1992-01-01
The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed
Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei
2017-03-01
The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.
Light-voltage conversion apparatus
Energy Technology Data Exchange (ETDEWEB)
Fujioka, Yoshiki
1987-09-19
In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)
Energy Technology Data Exchange (ETDEWEB)
Pazos, Francisco Jose; Amantegui, Javier; Ferrandis, Francisco; Barona, Amaya [Iberdrola, Madrid (Spain)
2008-04-15
The voltage interruption due to mean voltage maneuverers normal operation produces a transient type which is converted in a overvoltage on the low voltage circuit. Nevertheless to be considered a normal phenomena those over voltages have been pointed out as cause for damage in electric home appliances. What are the reasons? Inadequate protection or lack of immunity of the equipment?.
International Nuclear Information System (INIS)
1980-01-01
In computerized axial tomography scanning, problems arise in exchanging electrical signals between fixed and rotating assemblies. A novel method of overcoming this problem is described in detail for both signal and high voltage cables. Apparatus using a sequence of drums and pulleys is used to maintain the interconnecting cables in a neat arrangement and free from mechanical strain. The apparatus is simple and relatively easy and inexpensive to assemble and maintain. (UK)
Voltage Dependence of a Neuromodulator-Activated Ionic Current123
2016-01-01
Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619
Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna
2018-02-01
Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.
Ye, Bo; Luo, Haiping; Lu, Yaobin; Liu, Guangli; Zhang, Renduo; Li, Xiao
2017-11-01
The aim of this study was to improve performance of the microbial electrolysis desalination and chemical-production cell (MEDCC) using enlarged anode and high applied voltages. MEDCCs with anode lengths of 9 and 48cm (i.e., the 9cm-anode MEDCC and 48cm-anode MEDCC, respectively) were tested under different voltages (1.2-3.0V). Our results demonstrated for the first time that the MEDCC could maintain high performance even under the applied voltage higher than that for water dissociation (i.e., 1.8V). Under the applied voltage of 2.5V, the maximum current density in the 48cm-anode MEDCC reached 32.8±2.6A/m 2 , which is one of the highest current densities reported so far in the bioelectrochemical system (BES). The relative abundance of Geobacter was changed along the anode length. Our results show the great potential of the BES with enlarged anode and high applied voltages. Copyright © 2017 Elsevier Ltd. All rights reserved.
MHSS: a material handling system simulator
Energy Technology Data Exchange (ETDEWEB)
Pomernacki, L.; Hollstien, R.B.
1976-04-07
A Material Handling System Simulator (MHSS) program is described that provides specialized functional blocks for modeling and simulation of nuclear material handling systems. Models of nuclear fuel fabrication plants may be built using functional blocks that simulate material receiving, storage, transport, inventory, processing, and shipping operations as well as the control and reporting tasks of operators or on-line computers. Blocks are also provided that allow the user to observe and gather statistical information on the dynamic behavior of simulated plants over single or replicated runs. Although it is currently being developed for the nuclear materials handling application, MHSS can be adapted to other industries in which material accountability is important. In this paper, emphasis is on the simulation methodology of the MHSS program with application to the nuclear material safeguards problem. (auth)
DEFF Research Database (Denmark)
Zhao, Xin; Meng, Lexuan; Dragicevic, Tomislav
2015-01-01
it can make the MG a contributor in smooth ride through the faults. In this paper, a reactive power support strategy using droop controlled converters is proposed to aid MG riding through three phase symmetrical voltage sags. In such a case, the MGs should inject reactive power to the grid to boost...... the voltage in all phases at AC common bus. However, since the line admittances from each converter to point of common coupling (PCC) are not identical, the injected reactive power may not be equally shared. In order to achieve low voltage ride through (LVRT) capability along with a good power sharing...
Time-division-multiplex control scheme for voltage multiplier rectifiers
Directory of Open Access Journals (Sweden)
Bin-Han Liu
2017-03-01
Full Text Available A voltage multiplier rectifier with a novel time-division-multiplexing (TDM control scheme for high step-up converters is proposed in this study. In the proposed TDM control scheme, two full-wave voltage doubler rectifiers can be combined to realise a voltage quadrupler rectifier. The proposed voltage quadrupler rectifier can reduce transformer turn ratio and transformer size for high step-up converters and also reduce voltage stress for the output capacitors and rectifier diodes. An N-times voltage rectifier can be straightforwardly produced by extending the concepts from the proposed TDM control scheme. A phase-shift full-bridge (PSFB converter is adopted in the primary side of the proposed voltage quadrupler rectifier to construct a PSFB quadrupler converter. Experimental results for the PSFB quadrupler converter demonstrate the performance of the proposed TDM control scheme for voltage quadrupler rectifiers. An 8-times voltage rectifier is simulated to determine the validity of extending the proposed TDM control scheme to realise an N-times voltage rectifier. Experimental and simulation results show that the proposed TDM control scheme has great potential to be used in high step-up converters.
Development of Safe Food Handling Guidelines for Korean Consumers.
Kang, Hee-Jin; Lee, Min-Woo; Hwang, In-Kyeong; Kim, Jeong-Weon
2015-08-01
The purpose of this study was to develop guidelines for Korean consumers with regard to safe food handling practices at home by identifying current food handling issues. Korean consumers' behaviors regarding their safe food handling were identified via survey questionnaires that included items on individual hygiene practices, prepreparation steps when cooking, the cooking process, and the storage of leftover foods. The subjects were 417 Korean parents with elementary school children living in Seoul and Gyeonggi Province in the central area of Korea. The survey results revealed gaps between the knowledge or practices of Korean consumers and scientific evidence pertaining to safe food handling practices. Based on these findings, a leaflet on safe food handling guidelines was developed in accordance with Korean food culture. These guidelines suggest personal hygiene practices as well as fundamental principles and procedures for safe food handling from the stage of food purchase to that of keeping leftover dishes. A pilot application study with 50 consumers revealed that the guidelines effectively improved Korean consumers' safe food handling practices, suggesting that they can serve as practical educational material suitable for Korean consumers.
Single-nanowire, low-bandgap hot carrier solar cells with tunable open-circuit voltage
Limpert, Steven; Burke, Adam; Chen, I.-Ju; Anttu, Nicklas; Lehmann, Sebastian; Fahlvik, Sofia; Bremner, Stephen; Conibeer, Gavin; Thelander, Claes; Pistol, Mats-Erik; Linke, Heiner
2017-10-01
Compared to traditional pn-junction photovoltaics, hot carrier solar cells offer potentially higher efficiency by extracting work from the kinetic energy of photogenerated ‘hot carriers’ before they cool to the lattice temperature. Hot carrier solar cells have been demonstrated in high-bandgap ferroelectric insulators and GaAs/AlGaAs heterostructures, but so far not in low-bandgap materials, where the potential efficiency gain is highest. Recently, a high open-circuit voltage was demonstrated in an illuminated wurtzite InAs nanowire with a low bandgap of 0.39 eV, and was interpreted in terms of a photothermoelectric effect. Here, we point out that this device is a hot carrier solar cell and discuss its performance in those terms. In the demonstrated devices, InP heterostructures are used as energy filters in order to thermoelectrically harvest the energy of hot electrons photogenerated in InAs absorber segments. The obtained photovoltage depends on the heterostructure design of the energy filter and is therefore tunable. By using a high-resistance, thermionic barrier, an open-circuit voltage is obtained that is in excess of the Shockley-Queisser limit. These results provide generalizable insight into how to realize high voltage hot carrier solar cells in low-bandgap materials, and therefore are a step towards the demonstration of higher efficiency hot carrier solar cells.
Resistive foil edge grading for accelerator and other high voltage structures
Caporaso, George J.; Sampayan, Stephen F.; Sanders, David M.
2014-06-10
In a structure or device having a pair of electrical conductors separated by an insulator across which a voltage is placed, resistive layers are formed around the conductors to force the electric potential within the insulator to distribute more uniformly so as to decrease or eliminate electric field enhancement at the conductor edges. This is done by utilizing the properties of resistive layers to allow the voltage on the electrode to diffuse outwards, reducing the field stress at the conductor edge. Preferably, the resistive layer has a tapered resistivity, with a lower resistivity adjacent to the conductor and a higher resistivity away from the conductor. Generally, a resistive path across the insulator is provided, preferably by providing a resistive region in the bulk of the insulator, with the resistive layer extending over the resistive region.
Energy Technology Data Exchange (ETDEWEB)
Verbeeck, Jens; Cao, Ying [KU Leuven - KUL, Div. LRD-MAGyICS, Kasteelpark Arenberg 10, 3001 Heverlee (Belgium); Van Uffelen, Marco; Mont Casellas, Laura; Damiani, Carlo; Morales, Emilio Ruiz; Santana, Roberto Ranz [Fusion for Energy - F4E, c/Josep,n deg. 2, Torres Diagonal Litoral, Ed. B3, 08019 Barcelona (Spain); Meek, Richard; Haist, Bernhard [Oxford Technologies Ltd. OTL, 7 Nuffield Way, Abingdon OX14 1RL (United Kingdom); De Cock, Wouter; Vermeeren, Ludo [SCK-CEN, Boeretang 200, 2400 Mol (Belgium); Steyaert, Michiel [KU Leuven, ESAT-MICAS, KasteelparkArenberg 10, 3001 Heverlee (Belgium); Leroux, Paul [KU Leuven, ESAT-MICAS, KasteelparkArenberg 10, 3001 Heverlee (Belgium)
2015-07-01
Decommissioning, dismantling and remote handling applications in nuclear facilities all require robotic solutions that are able to survive in radiation environments. Recently raised safety, radiation hardness and cost efficiency demands from both the nuclear regulatory and the society impose severe challenges in traditional methods. For example, in case of the dismantling of the Fukushima sites, solutions that survive accumulated doses higher than 1 MGy are mandatory. To allow remote operation of these tools in nuclear environments, electronics were used to be shielded with several centimeters of lead or even completely banned in these solutions. However, shielding electronics always leads to bulky and heavy solutions, which reduces the flexibility of robotic tools. It also requires longer repair time and produces extra waste further in a dismantling or decommissioning cycle. In addition, often in current reactor designs, due to size restrictions and the need to inspect very tight areas there are limitations to the use of shielding. A MGy radiation-hardened sensor instrumentation link developed by MAGyICS provides a solution to build a flexible, easy removable and small I and C module with MGy radiation tolerance without any shielding. Hereby it removes all these pains to implement electronics in robotic tools. The demonstrated solution in this poster is developed for ITER Remote Handling equipments operating in high radiation environments (>1 MGy) in and around the Tokamak. In order to obtain adequately accurate instrumentation and control information, as well as to ease the umbilical management, there is a need of front-end electronics that will have to be located close to those actuators and sensors on the remote handling tool. In particular, for diverter remote handling, it is estimated that these components will face gamma radiation up to 300 Gy/h (in-vessel) and a total dose of 1 MGy. The radiation-hardened sensor instrumentation link presented here, consists
High-Voltage-Input Level Translator Using Standard CMOS
Yager, Jeremy A.; Mojarradi, Mohammad M.; Vo, Tuan A.; Blalock, Benjamin J.
2011-01-01
proposed integrated circuit would translate (1) a pair of input signals having a low differential potential and a possibly high common-mode potential into (2) a pair of output signals having the same low differential potential and a low common-mode potential. As used here, "low" and "high" refer to potentials that are, respectively, below or above the nominal supply potential (3.3 V) at which standard complementary metal oxide/semiconductor (CMOS) integrated circuits are designed to operate. The input common-mode potential could lie between 0 and 10 V; the output common-mode potential would be 2 V. This translation would make it possible to process the pair of signals by use of standard 3.3-V CMOS analog and/or mixed-signal (analog and digital) circuitry on the same integrated-circuit chip. A schematic of the circuit is shown in the figure. Standard 3.3-V CMOS circuitry cannot withstand input potentials greater than about 4 V. However, there are many applications that involve low-differential-potential, high-common-mode-potential input signal pairs and in which standard 3.3-V CMOS circuitry, which is relatively inexpensive, would be the most appropriate circuitry for performing other functions on the integrated-circuit chip that handles the high-potential input signals. Thus, there is a need to combine high-voltage input circuitry with standard low-voltage CMOS circuitry on the same integrated-circuit chip. The proposed circuit would satisfy this need. In the proposed circuit, the input signals would be coupled into both a level-shifting pair and a common-mode-sensing pair of CMOS transistors. The output of the level-shifting pair would be fed as input to a differential pair of transistors. The resulting differential current output would pass through six standoff transistors to be mirrored into an output branch by four heterojunction bipolar transistors. The mirrored differential current would be converted back to potential by a pair of diode-connected transistors
Skuginna, Veronika; Nguyen, Daniel P; Seiler, Roland; Kiss, Bernhard; Thalmann, George N; Roth, Beat
2016-02-01
Renal damage is more frequent with new-generation lithotripters. However, animal studies suggest that voltage ramping minimizes the risk of complications following extracorporeal shock wave lithotripsy (SWL). In the clinical setting, the optimal voltage strategy remains unclear. To evaluate whether stepwise voltage ramping can protect the kidney from damage during SWL. A total of 418 patients with solitary or multiple unilateral kidney stones were randomized to receive SWL using a Modulith SLX-F2 lithotripter with either stepwise voltage ramping (n=213) or a fixed maximal voltage (n=205). SWL. The primary outcome was sonographic evidence of renal hematomas. Secondary outcomes included levels of urinary markers of renal damage, stone disintegration, stone-free rate, and rates of secondary interventions within 3 mo of SWL. Descriptive statistics were used to compare clinical outcomes between the two groups. A logistic regression model was generated to assess predictors of hematomas. Significantly fewer hematomas occurred in the ramping group(12/213, 5.6%) than in the fixed group (27/205, 13%; p=0.008). There was some evidence that the fixed group had higher urinary β2-microglobulin levels after SWL compared to the ramping group (p=0.06). Urinary microalbumin levels, stone disintegration, stone-free rate, and rates of secondary interventions did not significantly differ between the groups. The logistic regression model showed a significantly higher risk of renal hematomas in older patients (odds ratio [OR] 1.03, 95% confidence interval [CI] 1.00-1.05; p=0.04). Stepwise voltage ramping was associated with a lower risk of hematomas (OR 0.39, 95% CI 0.19-0.80; p=0.01). The study was limited by the use of ultrasound to detect hematomas. In this prospective randomized study, stepwise voltage ramping during SWL was associated with a lower risk of renal damage compared to a fixed maximal voltage without compromising treatment effectiveness. Lithotripsy is a noninvasive
Energy Technology Data Exchange (ETDEWEB)
Woehlbier, R.H. (ed.)
2000-07-01
The book contains articles published either during 1992-1997 in ''bulk solids handling'' or during 1989-1997 in ''powder handling and processing''. Main topics are aspects of safety and environmental protection in bulk solids handling: dusts, hazardous powders, prevention and mitigation of dust explosions, powdered coal handling, dedusting, filters, electrostatic precipitation, materials recovery, occupational safety.(uke)
7 CFR 959.126 - Handling of culls.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Handling of culls. 959.126 Section 959.126 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements...) Handled for canning or freezing. (b) As a safeguard against culls entering fresh market channels each...
Survey of postharvest handling, preservation and processing ...
African Journals Online (AJOL)
Survey of postharvest handling, preservation and processing practices along the camel milk chain in Isiolo district, Kenya. ... Despite the important contribution of camel milk to food security for pastoralists in Kenya, little is known about the postharvest handling, preservation and processing practices. In this study, existing ...
Handling uncertainty through adaptiveness in planning approaches
Zandvoort, M.; Vlist, van der M.J.; Brink, van den A.
2018-01-01
Planners and water managers seek to be adaptive to handle uncertainty through the use of planning approaches. In this paper, we study what type of adaptiveness is proposed and how this may be operationalized in planning approaches to adequately handle different uncertainties. We took a
International Nuclear Information System (INIS)
Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M
2016-01-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)
Distributed Monitoring of Voltage Collapse Sensitivity Indices
Simpson-Porco, John W.; Bullo, Francesco
2016-01-01
The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...
Ethics rounds do not improve the handling of ethical issues by psychiatric staff.
Silén, Marit; Haglund, Kristina; Hansson, Mats G; Ramklint, Mia
2015-08-01
One way to support healthcare staff in handling ethically difficult situations is through ethics rounds that consist of discussions based on clinical cases and are moderated by an ethicist. Previous research indicates that the handling of ethically difficult situations in the workplace might have changed after ethics rounds. This, in turn, would mean that the "ethical climate", i.e. perceptions of how ethical issues are handled, would have changed. To investigate whether ethics rounds could improve the ethical climate perceived by staff working in psychiatry outpatient clinics. In this quasi-experimental study, six inter-professional ethics rounds led by a philosopher/ethicist were conducted at two psychiatry outpatient clinics. Changes in ethical climate were measured at these clinics as well as at two control clinics at baseline and after the intervention period using the instrument Hospital Ethical Climate Survey. Within-groups comparisons of median sum scores of ethical climate showed that no statistically significant differences were found in the intervention group before or after the intervention period. The median sum scores for ethical climate were significantly higher, both at baseline and after the intervention period (P ≤ 0.001; P = 0.046), in the intervention group. Ethics rounds in psychiatric outpatient clinics did not result in significant changes in ethical climate. Outcomes of ethics rounds might, to a higher degree, be directed towards patient-related outcomes rather than towards the staff's working environment, as the questions brought up for discussion during the ethics rounds concerned patient-related issues.