WorldWideScience

Sample records for handle higher voltage

  1. Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

    KAUST Repository

    Kim, Younggy

    2011-01-01

    Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

  2. Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

    KAUST Repository

    Kim, Younggy; Hatzell, Marta C.; Hutchinson, Adam J.; Logan, Bruce E.

    2011-01-01

    to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses

  3. A research technique for the effect of higher harmonic voltages on the operating parameters of a permanent magnet synchronous generator

    Directory of Open Access Journals (Sweden)

    Hasanova L. H.

    2017-12-01

    Full Text Available Nowadays permanent magnet synchronous machines those frequency-controlled from stator side with frequency inverters made on the basis of power transistors or fully controlled thyristors, are widely used as motors and generators. In future they are also promising a good application in transport, including marine. Modern frequency inverters are equipped with a control system based on sine-shaped pulse width modulation. While shaping the voltage in the output of the inverter, in addition to the fundamental harmonic, higher harmonic components are also included in the voltage shape, which certainly affect the operating parameters of the generator (electromagnetic torque, power, currents. To determine this effect the modeling and investigation technique of higher harmonic voltages in the "electric network – frequency converter – synchronous machine with permanent magnets" system has been developed. The proposed equations of a frequency-controlled permanent magnet synchronous machine allow relatively simply reproduce the harmonic composition of the voltage in the output of a frequency inverter equipped with the control system based on a sinusoidal pulse width modulation. The developed research technique can be used for inverters with any number and composition of voltage harmonic components feeding a stator winding of a permanent magnet synchronous machine. On a particular case, the efficiency of the research technique of the higher harmonics influence on the operating parameters of the generator has been demonstrated. At the same time, the study has been carried out taking into account the shape of the voltage curve feeding the windings of the synchronous machine containing in addition to the fundamental harmonic the 8, 10, 11, 13, 14 and 16-th harmonic components, and the rated active power of the synchronous machine has been equal to 1 500 kW.

  4. Evaluation of higher distribution and/or utilization voltages. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hazelrigg, Jr, George A.

    1981-01-01

    An electric energy distribution/utilization system cost analysis model is presented for exploring cost tradeoffs (capital innvestment, operation and maintenance and cost of losses) and optimizing system configuration. The model focuses on the treatment of residential and light commercial service areas with time-varying load characteristics, including customer load profile changes, per customer load growth and service area population growth. Applications of the model are discussed. These include providing insight on: the selection of primary and secondary voltages; conductor sizing; distribution transformer sizing, change out policies and copper-to-core-loss ratio; and limits on allowable voltage variation at the service entrance. Examples are provided to illustrate model capabilities.

  5. Higher success rate with transcranial electrical stimulation of motor-evoked potentials using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery.

    Science.gov (United States)

    Shigematsu, Hideki; Kawaguchi, Masahiko; Hayashi, Hironobu; Takatani, Tsunenori; Iwata, Eiichiro; Tanaka, Masato; Okuda, Akinori; Morimoto, Yasuhiko; Masuda, Keisuke; Tanaka, Yuu; Tanaka, Yasuhito

    2017-10-01

    During spine surgery, the spinal cord is electrophysiologically monitored via transcranial electrical stimulation of motor-evoked potentials (TES-MEPs) to prevent injury. Transcranial electrical stimulation of motor-evoked potential involves the use of either constant-current or constant-voltage stimulation; however, there are few comparative data available regarding their ability to adequately elicit compound motor action potentials. We hypothesized that the success rates of TES-MEP recordings would be similar between constant-current and constant-voltage stimulations in patients undergoing spine surgery. The objective of this study was to compare the success rates of TES-MEP recordings between constant-current and constant-voltage stimulation. This is a prospective, within-subject study. Data from 100 patients undergoing spinal surgery at the cervical, thoracic, or lumbar level were analyzed. The success rates of the TES-MEP recordings from each muscle were examined. Transcranial electrical stimulation with constant-current and constant-voltage stimulations at the C3 and C4 electrode positions (international "10-20" system) was applied to each patient. Compound muscle action potentials were bilaterally recorded from the abductor pollicis brevis (APB), deltoid (Del), abductor hallucis (AH), tibialis anterior (TA), gastrocnemius (GC), and quadriceps (Quad) muscles. The success rates of the TES-MEP recordings from the right Del, right APB, bilateral Quad, right TA, right GC, and bilateral AH muscles were significantly higher using constant-voltage stimulation than those using constant-current stimulation. The overall success rates with constant-voltage and constant-current stimulations were 86.3% and 68.8%, respectively (risk ratio 1.25 [95% confidence interval: 1.20-1.31]). The success rates of TES-MEP recordings were higher using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery. Copyright © 2017

  6. Cable handling

    International Nuclear Information System (INIS)

    1980-01-01

    In computerized axial tomography scanning, problems arise in exchanging electrical signals between fixed and rotating assemblies. A novel method of overcoming this problem is described in detail for both signal and high voltage cables. Apparatus using a sequence of drums and pulleys is used to maintain the interconnecting cables in a neat arrangement and free from mechanical strain. The apparatus is simple and relatively easy and inexpensive to assemble and maintain. (UK)

  7. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    OpenAIRE

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  8. 30 CFR 75.817 - Cable handling and support systems.

    Science.gov (United States)

    2010-07-01

    ... High-Voltage Longwalls § 75.817 Cable handling and support systems. Longwall mining equipment must be provided with cable-handling and support systems that are constructed, installed and maintained to minimize... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cable handling and support systems. 75.817...

  9. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  10. Methods and Strategies for Overvoltage Prevention in Low Voltage Distribution Systems with PV

    DEFF Research Database (Denmark)

    Hashemi Toghroljerdi, Seyedmostafa; Østergaard, Jacob

    2016-01-01

    to handle a high share of PV power. This paper provides an in-depth review of methods and strategies proposed to prevent overvoltage in LV grids with PV, and discusses the effectiveness, advantages, and disadvantages of them in detail. Based on the mathematical framework presented in the paper......, the overvoltage caused by high PV penetration is described, solutions to facilitate higher PV penetration are classified, and their effectiveness, advantages, and disadvantages are illustrated. The investigated solutions include the grid reinforcement, electrical energy storage application, reactive power...... absorption by PV inverters, application of active medium voltage to low voltage (MV/LV) transformers, active power curtailment, and demand response (DR). Coordination between voltage control units by localized, distributed, and centralized voltage control methods is compared using the voltage sensitivity...

  11. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  12. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  13. A High Voltage Swing 1.9 GHz PA in Standard CMOS

    NARCIS (Netherlands)

    Aartsen, W.A.J.; Annema, Anne J.; Nauta, Bram

    2002-01-01

    A circuit technique for RF power amplifiers that reliably handle voltage peaks well above the nominal supply voltage is presented. To achieve this high-voltage tolerance the circuit implements switched-cascode transistors that yield reliable operation for voltages up to 7V at RF frequencies in a

  14. Voltage harmonic elimination with RLC based interface smoothing filter

    International Nuclear Information System (INIS)

    Chandrasekaran, K; Ramachandaramurthy, V K

    2015-01-01

    A method is proposed for designing a Dynamic Voltage Restorer (DVR) with RLC interface smoothing filter. The RLC filter connected between the IGBT based Voltage Source Inverter (VSI) is attempted to eliminate voltage harmonics in the busbar voltage and switching harmonics from VSI by producing a PWM controlled harmonic voltage. In this method, the DVR or series active filter produces PWM voltage that cancels the existing harmonic voltage due to any harmonic voltage source. The proposed method is valid for any distorted busbar voltage. The operating VSI handles no active power but only harmonic power. The DVR is able to suppress the lower order switching harmonics generated by the IGBT based VSI. Good dynamic and transient results obtained. The Total Harmonic Distortion (THD) is minimized to zero at the sensitive load end. Digital simulations are carried out using PSCAD/EMTDC to validate the performance of RLC filter. Simulated results are presented. (paper)

  15. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  16. Nuclear fuel handling apparatus

    International Nuclear Information System (INIS)

    Andrea, C.; Dupen, C.F.G.; Noyes, R.C.

    1977-01-01

    A fuel handling machine for a liquid metal cooled nuclear reactor in which a retractable handling tube and gripper are lowered into the reactor to withdraw a spent fuel assembly into the handling tube. The handling tube containing the fuel assembly immersed in liquid sodium is then withdrawn completely from the reactor into the outer barrel of the handling machine. The machine is then used to transport the spent fuel assembly directly to a remotely located decay tank. The fuel handling machine includes a decay heat removal system which continuously removes heat from the interior of the handling tube and which is capable of operating at its full cooling capacity at all times. The handling tube is supported in the machine from an articulated joint which enables it to readily align itself with the correct position in the core. An emergency sodium supply is carried directly by the machine to provide make up in the event of a loss of sodium from the handling tube during transport to the decay tank. 5 claims, 32 drawing figures

  17. How to Handle Abuse

    Science.gov (United States)

    ... Handle Abuse KidsHealth / For Kids / How to Handle Abuse What's in this article? Tell Right Away How Do You Know Something Is Abuse? ... babysitter, teacher, coach, or a bigger kid. Child abuse can happen anywhere — at ... building. Tell Right Away A kid who is being seriously hurt ...

  18. Grain Handling and Storage.

    Science.gov (United States)

    Harris, Troy G.; Minor, John

    This text for a secondary- or postecondary-level course in grain handling and storage contains ten chapters. Chapter titles are (1) Introduction to Grain Handling and Storage, (2) Elevator Safety, (3) Grain Grading and Seed Identification, (4) Moisture Control, (5) Insect and Rodent Control, (6) Grain Inventory Control, (7) Elevator Maintenance,…

  19. Mitigation of voltage sag using DVR under feedback and ...

    African Journals Online (AJOL)

    The paper deals with Dynamic Voltage Restorer (DVR) that aims at the integration of series active filter with minimum VA handling. The DVR not only regulates the voltage at load end but also acts as series active filter. The scheme of DVR is modeled and simulated with MATLAB/Simulink under feedback and feedforward ...

  20. 47 CFR 17.54 - Rated lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Rated lamp voltage. 17.54 Section 17.54... voltage. To insure the necessary lumen output by obstruction lights, the rated voltage of incandescent lamps used shall correspond to be within 3 percent higher than the voltage across the lamp socket during...

  1. Handling Pyrophoric Reagents

    Energy Technology Data Exchange (ETDEWEB)

    Alnajjar, Mikhail S.; Haynie, Todd O.

    2009-08-14

    Pyrophoric reagents are extremely hazardous. Special handling techniques are required to prevent contact with air and the resulting fire. This document provides several methods for working with pyrophoric reagents outside of an inert atmosphere.

  2. Remote handling equipment

    International Nuclear Information System (INIS)

    Clement, G.

    1984-01-01

    After a definition of intervention, problems encountered for working in an adverse environment are briefly analyzed for development of various remote handling equipments. Some examples of existing equipments are given [fr

  3. Ergonomics and patient handling.

    Science.gov (United States)

    McCoskey, Kelsey L

    2007-11-01

    This study aimed to describe patient-handling demands in inpatient units during a 24-hour period at a military health care facility. A 1-day total population survey described the diverse nature and impact of patient-handling tasks relative to a variety of nursing care units, patient characteristics, and transfer equipment. Productivity baselines were established based on patient dependency, physical exertion, type of transfer, and time spent performing the transfer. Descriptions of the physiological effect of transfers on staff based on patient, transfer, and staff characteristics were developed. Nursing staff response to surveys demonstrated how patient-handling demands are impacted by the staff's physical exertion and level of patient dependency. The findings of this study describe the types of transfers occurring in these inpatient units and the physical exertion and time requirements for these transfers. This description may guide selection of the most appropriate and cost-effective patient-handling equipment required for specific units and patients.

  4. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  5. Remote handling machines

    International Nuclear Information System (INIS)

    Sato, Shinri

    1985-01-01

    In nuclear power facilities, the management of radioactive wastes is made with its technology plus the automatic techniques. Under the radiation field, the maintenance or aid of such systems is important. To cope with this situation, MF-2 system, MF-3 system and a manipulator system as remote handling machines are described. MF-2 system consists of an MF-2 carrier truck, a control unit and a command trailer. It is capable of handling heavy-weight objects. The system is not by hydraulic but by electrical means. MF-3 system consists of a four-crawler truck and a manipulator. The truck is versatile in its posture by means of the four independent crawlers. The manipulator system is bilateral in operation, so that the delicate handling is made possible. (Mori, K.)

  6. Practices of Handling

    DEFF Research Database (Denmark)

    Ræbild, Ulla

    to touch, pick up, carry, or feel with the hands. Figuratively it is to manage, deal with, direct, train, or control. Additionally, as a noun, a handle is something by which we grasp or open up something. Lastly, handle also has a Nordic root, here meaning to trade, bargain or deal. Together all four...... meanings seem to merge in the fashion design process, thus opening up for an embodied engagement with matter that entails direction giving, organizational management and negotiation. By seeing processes of handling as a key fashion methodological practice, it is possible to divert the discourse away from...... introduces four ways whereby fashion designers apply their own bodies as tools for design; a) re-activating past garment-design experiences, b) testing present garment-design experiences c) probing for new garment-design experiences and d) design of future garment experiences by body proxy. The paper...

  7. Remote handling at LAMPF

    International Nuclear Information System (INIS)

    Grisham, D.L.; Lambert, J.E.

    1983-01-01

    Experimental area A at the Clinton P. Anderson Meson Physics Facility (LAMPF) encompasses a large area. Presently there are four experimental target cells along the main proton beam line that have become highly radioactive, thus dictating that all maintenance be performed remotely. The Monitor remote handling system was developed to perform in situ maintenance at any location within area A. Due to the complexity of experimental systems and confined space, conventional remote handling methods based upon hot cell and/or hot bay concepts are not workable. Contrary to conventional remote handling which require special tooling for each specifically planned operation, the Monitor concept is aimed at providing a totally flexible system capable of remotely performing general mechanical and electrical maintenance operations using standard tools. The Monitor system is described

  8. TRANSPORT/HANDLING REQUESTS

    CERN Multimedia

    Groupe ST/HM

    2002-01-01

    A new EDH document entitled 'Transport/Handling Request' will be in operation as of Monday, 11th February 2002, when the corresponding icon will be accessible from the EDH desktop, together with the application instructions. This EDH form will replace the paper-format transport/handling request form for all activities involving the transport of equipment and materials. However, the paper form will still be used for all vehicle-hire requests. The introduction of the EDH transport/handling request form is accompanied by the establishment of the following time limits for the various services concerned: 24 hours for the removal of office items, 48 hours for the transport of heavy items (of up to 6 metric tons and of standard road width), 5 working days for a crane operation, extra-heavy transport operation or complete removal, 5 working days for all transport operations relating to LHC installation. ST/HM Group, Logistics Section Tel: 72672 - 72202

  9. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  10. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  11. How to handle station black outs

    International Nuclear Information System (INIS)

    Reisch, Frigyes

    1986-01-01

    Station black out is defined as the loss of ail high voltage alternating current at a nuclear power site. An international study was made to survey the practices in the different countries. The best way to handle station black out is to avoid it therefore briefly the normal off site and emergency on site power supplies are discussed. The ways in use to enhance nuclear power plants using Boiling Water Reactors or Pressurized Water Reactors to cope with a station black out are discussed in some detail. (author)

  12. How to handle station black outs

    Energy Technology Data Exchange (ETDEWEB)

    Reisch, Frigyes [Swedish Nuclear Power Inspectorate, S-10252 Stockholm (Sweden)

    1986-02-15

    Station black out is defined as the loss of ail high voltage alternating current at a nuclear power site. An international study was made to survey the practices in the different countries. The best way to handle station black out is to avoid it therefore briefly the normal off site and emergency on site power supplies are discussed. The ways in use to enhance nuclear power plants using Boiling Water Reactors or Pressurized Water Reactors to cope with a station black out are discussed in some detail. (author)

  13. Safe handling of tritium

    International Nuclear Information System (INIS)

    1991-01-01

    The main objective of this publication is to provide practical guidance and recommendations on operational radiation protection aspects related to the safe handling of tritium in laboratories, industrial-scale nuclear facilities such as heavy-water reactors, tritium removal plants and fission fuel reprocessing plants, and facilities for manufacturing commercial tritium-containing devices and radiochemicals. The requirements of nuclear fusion reactors are not addressed specifically, since there is as yet no tritium handling experience with them. However, much of the material covered is expected to be relevant to them as well. Annex III briefly addresses problems in the comparatively small-scale use of tritium at universities, medical research centres and similar establishments. However, the main subject of this publication is the handling of larger quantities of tritium. Operational aspects include designing for tritium safety, safe handling practice, the selection of tritium-compatible materials and equipment, exposure assessment, monitoring, contamination control and the design and use of personal protective equipment. This publication does not address the technologies involved in tritium control and cleanup of effluents, tritium removal, or immobilization and disposal of tritium wastes, nor does it address the environmental behaviour of tritium. Refs, figs and tabs

  14. Grain Grading and Handling.

    Science.gov (United States)

    Rendleman, Matt; Legacy, James

    This publication provides an introduction to grain grading and handling for adult students in vocational and technical education programs. Organized in five chapters, the booklet provides a brief overview of the jobs performed at a grain elevator and of the techniques used to grade grain. The first chapter introduces the grain industry and…

  15. Mars Sample Handling Functionality

    Science.gov (United States)

    Meyer, M. A.; Mattingly, R. L.

    2018-04-01

    The final leg of a Mars Sample Return campaign would be an entity that we have referred to as Mars Returned Sample Handling (MRSH.) This talk will address our current view of the functional requirements on MRSH, focused on the Sample Receiving Facility (SRF).

  16. Handling wood shavings

    Energy Technology Data Exchange (ETDEWEB)

    1974-09-18

    Details of bulk handling equipment suitable for collection and compressing wood waste from commercial joinery works are discussed. The Redler Bin Discharger ensures free flow of chips from storage silo discharge prior to compression into briquettes for use as fuel or processing into chipboard.

  17. Possibilities by using a self-commutated voltage source inverter connected to a weak grid in wind parks

    Energy Technology Data Exchange (ETDEWEB)

    Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering

    1996-12-01

    In this paper the hybrid wind farm connected to a weak grid is investigated. By combining different electrical wind power plant systems a cost-efficient solution is obtained. The point of common connection voltage level can be controlled by injecting reactive power from a phase-compensating capacitor battery and a voltage source inverter (VSI). If the short-circuit impedance ratio is lower than 1, the demanded reactive power injection to keep the voltage at nominal level is unrealistic. For short-circuit impedance ratios of 2 or higher the demanded reactive power level is acceptable. When using both induction generators and thyristor inverters the reactive power injector VSI size should be about 0.2 pu. If the hybrid farm consists of THYs, IGs and VSIs and the active power is equally shared between the systems, the VSI had to be scaled up by 5% to handle both active and reactive power. 7 refs, 10 figs, 2 tabs

  18. Harvesting and handling agricultural residues for energy

    Energy Technology Data Exchange (ETDEWEB)

    Jenkins, B.M.; Summer, H.R.

    1986-05-01

    Significant progress in understanding the needs for design of agricultural residue collection and handling systems has been made but additional research is required. Recommendations are made for research to (a) integrate residue collection and handling systems into general agricultural practices through the development of multi-use equipment and total harvest systems; (b) improve methods for routine evaluation of agricultural residue resources, possibly through remote sensing and image processing; (c) analyze biomass properties to obtain detailed data relevant to engineering design and analysis; (d) evaluate long-term environmental, social, and agronomic impacts of residue collection; (e) develop improved equipment with higher capacities to reduce residue collection and handling costs, with emphasis on optimal design of complete systems including collection, transportation, processing, storage, and utilization; and (f) produce standard forms of biomass fuels or products to enhance material handling and expand biomass markets through improved reliability and automatic control of biomass conversion and other utilization systems. 118 references.

  19. Test sample handling apparatus

    International Nuclear Information System (INIS)

    1981-01-01

    A test sample handling apparatus using automatic scintillation counting for gamma detection, for use in such fields as radioimmunoassay, is described. The apparatus automatically and continuously counts large numbers of samples rapidly and efficiently by the simultaneous counting of two samples. By means of sequential ordering of non-sequential counting data, it is possible to obtain precisely ordered data while utilizing sample carrier holders having a minimum length. (U.K.)

  20. Handling and Transport Problems

    Energy Technology Data Exchange (ETDEWEB)

    Pomarola, J. [Head of Technical Section, Atomic Energy Commission, Saclay (France); Savouyaud, J. [Head of Electro-Mechanical Sub-Division, Atomic Energy Commission, Saclay (France)

    1960-07-01

    Arrangements for special or dangerous transport operations by road arising out of the activities of the Atomic Energy Commission are made by the Works and Installations Division which acts in concert with the Monitoring and Protection Division (MPD) whenever radioactive substances or appliances are involved. In view of the risk of irradiation and contamination entailed in handling and transporting radioactive substances, including waste, a specialized transport and storage team has been formed as a complement to the emergency and decontamination teams.

  1. Solid waste handling

    International Nuclear Information System (INIS)

    Parazin, R.J.

    1995-01-01

    This study presents estimates of the solid radioactive waste quantities that will be generated in the Separations, Low-Level Waste Vitrification and High-Level Waste Vitrification facilities, collectively called the Tank Waste Remediation System Treatment Complex, over the life of these facilities. This study then considers previous estimates from other 200 Area generators and compares alternative methods of handling (segregation, packaging, assaying, shipping, etc.)

  2. Handling of radioactive waste

    International Nuclear Information System (INIS)

    Sanhueza Mir, Azucena

    1998-01-01

    Based on characteristics and quantities of different types of radioactive waste produced in the country, achievements in infrastructure and the way to solve problems related with radioactive waste handling and management, are presented in this paper. Objectives of maintaining facilities and capacities for controlling, processing and storing radioactive waste in a conditioned form, are attained, within a great range of legal framework, so defined to contribute with safety to people and environment (au)

  3. Renal phosphate handling: Physiology

    Directory of Open Access Journals (Sweden)

    Narayan Prasad

    2013-01-01

    Full Text Available Phosphorus is a common anion. It plays an important role in energy generation. Renal phosphate handling is regulated by three organs parathyroid, kidney and bone through feedback loops. These counter regulatory loops also regulate intestinal absorption and thus maintain serum phosphorus concentration in physiologic range. The parathyroid hormone, vitamin D, Fibrogenic growth factor 23 (FGF23 and klotho coreceptor are the key regulators of phosphorus balance in body.

  4. Uranium hexafluoride handling

    International Nuclear Information System (INIS)

    1991-01-01

    The United States Department of Energy, Oak Ridge Field Office, and Martin Marietta Energy Systems, Inc., are co-sponsoring this Second International Conference on Uranium Hexafluoride Handling. The conference is offered as a forum for the exchange of information and concepts regarding the technical and regulatory issues and the safety aspects which relate to the handling of uranium hexafluoride. Through the papers presented here, we attempt not only to share technological advances and lessons learned, but also to demonstrate that we are concerned about the health and safety of our workers and the public, and are good stewards of the environment in which we all work and live. These proceedings are a compilation of the work of many experts in that phase of world-wide industry which comprises the nuclear fuel cycle. Their experience spans the entire range over which uranium hexafluoride is involved in the fuel cycle, from the production of UF 6 from the naturally-occurring oxide to its re-conversion to oxide for reactor fuels. The papers furnish insights into the chemical, physical, and nuclear properties of uranium hexafluoride as they influence its transport, storage, and the design and operation of plant-scale facilities for production, processing, and conversion to oxide. The papers demonstrate, in an industry often cited for its excellent safety record, continuing efforts to further improve safety in all areas of handling uranium hexafluoride

  5. Uranium hexafluoride handling. Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    1991-12-31

    The United States Department of Energy, Oak Ridge Field Office, and Martin Marietta Energy Systems, Inc., are co-sponsoring this Second International Conference on Uranium Hexafluoride Handling. The conference is offered as a forum for the exchange of information and concepts regarding the technical and regulatory issues and the safety aspects which relate to the handling of uranium hexafluoride. Through the papers presented here, we attempt not only to share technological advances and lessons learned, but also to demonstrate that we are concerned about the health and safety of our workers and the public, and are good stewards of the environment in which we all work and live. These proceedings are a compilation of the work of many experts in that phase of world-wide industry which comprises the nuclear fuel cycle. Their experience spans the entire range over which uranium hexafluoride is involved in the fuel cycle, from the production of UF{sub 6} from the naturally-occurring oxide to its re-conversion to oxide for reactor fuels. The papers furnish insights into the chemical, physical, and nuclear properties of uranium hexafluoride as they influence its transport, storage, and the design and operation of plant-scale facilities for production, processing, and conversion to oxide. The papers demonstrate, in an industry often cited for its excellent safety record, continuing efforts to further improve safety in all areas of handling uranium hexafluoride. Selected papers were processed separately for inclusion in the Energy Science and Technology Database.

  6. Torus sector handling system

    International Nuclear Information System (INIS)

    Grisham, D.L.

    1981-01-01

    A remote handling system is proposed for moving a torus sector of the accelerator from under the cryostat to a point where it can be handled by a crane and for the reverse process for a new sector. Equipment recommendations are presented, as well as possible alignment schemes. Some general comments about future remote-handling methods and the present capabilities of existing systems will also be included. The specific task to be addressed is the removal and replacement of a 425 to 450 ton torus sector. This requires a horizontal movement of approx. 10 m from a normal operating position to a point where its further transport can be accomplished by more conventional means (crane or floor transporter). The same horizontal movement is required for reinstallation, but a positional tolerance of 2 cm is required to allow reasonable fit-up for the vacuum seal from the radial frames to the torus sector. Since the sectors are not only heavy but rather tall and narrow, the transport system must provide a safe, stable, and repeatable method fo sector movement. This limited study indicates that the LAMPF-based method of transporting torus sectors offers a proven method of moving heavy items. In addition, the present state of the art in remote equipment is adequate for FED maintenance

  7. Handling of Solid Residues

    International Nuclear Information System (INIS)

    Medina Bermudez, Clara Ines

    1999-01-01

    The topic of solid residues is specifically of great interest and concern for the authorities, institutions and community that identify in them a true threat against the human health and the atmosphere in the related with the aesthetic deterioration of the urban centers and of the natural landscape; in the proliferation of vectorial transmitters of illnesses and the effect on the biodiversity. Inside the wide spectrum of topics that they keep relationship with the environmental protection, the inadequate handling of solid residues and residues dangerous squatter an important line in the definition of political and practical environmentally sustainable. The industrial development and the population's growth have originated a continuous increase in the production of solid residues; of equal it forms, their composition day after day is more heterogeneous. The base for the good handling includes the appropriate intervention of the different stages of an integral administration of residues, which include the separation in the source, the gathering, the handling, the use, treatment, final disposition and the institutional organization of the administration. The topic of the dangerous residues generates more expectation. These residues understand from those of pathogen type that are generated in the establishments of health that of hospital attention, until those of combustible, inflammable type, explosive, radio-active, volatile, corrosive, reagent or toxic, associated to numerous industrial processes, common in our countries in development

  8. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  9. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  10. ERROR HANDLING IN INTEGRATION WORKFLOWS

    Directory of Open Access Journals (Sweden)

    Alexey M. Nazarenko

    2017-01-01

    Full Text Available Simulation experiments performed while solving multidisciplinary engineering and scientific problems require joint usage of multiple software tools. Further, when following a preset plan of experiment or searching for optimum solu- tions, the same sequence of calculations is run multiple times with various simulation parameters, input data, or conditions while overall workflow does not change. Automation of simulations like these requires implementing of a workflow where tool execution and data exchange is usually controlled by a special type of software, an integration environment or plat- form. The result is an integration workflow (a platform-dependent implementation of some computing workflow which, in the context of automation, is a composition of weakly coupled (in terms of communication intensity typical subtasks. These compositions can then be decomposed back into a few workflow patterns (types of subtasks interaction. The pat- terns, in their turn, can be interpreted as higher level subtasks.This paper considers execution control and data exchange rules that should be imposed by the integration envi- ronment in the case of an error encountered by some integrated software tool. An error is defined as any abnormal behavior of a tool that invalidates its result data thus disrupting the data flow within the integration workflow. The main requirementto the error handling mechanism implemented by the integration environment is to prevent abnormal termination of theentire workflow in case of missing intermediate results data. Error handling rules are formulated on the basic pattern level and on the level of a composite task that can combine several basic patterns as next level subtasks. The cases where workflow behavior may be different, depending on user's purposes, when an error takes place, and possible error handling op- tions that can be specified by the user are also noted in the work.

  11. High voltage investigations for ITER coils

    International Nuclear Information System (INIS)

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  12. Design of shielded voltage divider for impulse voltage measurement

    International Nuclear Information System (INIS)

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  13. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  14. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  15. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  16. Preference Handling for Artificial Intelligence

    OpenAIRE

    Goldsmith, Judy; University of Kentucky; Junker, Ulrich; ILOG

    2009-01-01

    This article explains the benefits of preferences for AI systems and draws a picture of current AI research on preference handling. It thus provides an introduction to the topics covered by this special issue on preference handling.

  17. Crud handling circuit

    International Nuclear Information System (INIS)

    Smith, J.C.; Manuel, R.J.; McAllister, J.E.

    1981-01-01

    A process for handling the problems of crud formation during the solvent extraction of wet-process phosphoric acid, e.g. for uranium and rare earth removal, is described. It involves clarification of the crud-solvent mixture, settling, water washing the residue and treatment of the crud with a caustic wash to remove and regenerate the solvent. Applicable to synergistic mixtures of dialkylphosphoric acids and trialkylphosphine oxides dissolved in inert diluents and more preferably to the reductive stripping technique. (U.K.)

  18. Handling of potassium

    International Nuclear Information System (INIS)

    Schwarz, N.; Komurka, M.

    1983-03-01

    As a result for the Fast Breeder Development extensive experience is available worldwide with respect to Sodium technology. Due to the extension of the research program to topping cycles with Potassium as the working medium, test facilities with Potassium have been designed and operated in the Institute of Reactor Safety. The different chemical properties of Sodium and Potassium give rise in new safety concepts and operating procedures. The handling problems of Potassium are described in the light of theoretical properties and own experiences. Selected literature on main safety and operating problems complete this report. (Author) [de

  19. Extreme coal handling

    Energy Technology Data Exchange (ETDEWEB)

    Bradbury, S; Homleid, D. [Air Control Science Inc. (United States)

    2004-04-01

    Within the journals 'Focus on O & M' is a short article describing modifications to coal handling systems at Eielson Air Force Base near Fairbanks, Alaska, which is supplied with power and heat from a subbituminous coal-fired central plant. Measures to reduce dust include addition of an enclosed recirculation chamber at each transfer point and new chute designs to reduce coal velocity, turbulence, and induced air. The modifications were developed by Air Control Science (ACS). 7 figs., 1 tab.

  20. Voltage-assisted polymer wafer bonding

    International Nuclear Information System (INIS)

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  1. Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems

    Directory of Open Access Journals (Sweden)

    Dung Vo Tien

    2018-01-01

    Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.

  2. Advanced concept for a medium-voltage switch gear; Neues Konzept einer Mittelspannungsschaltanlage

    Energy Technology Data Exchange (ETDEWEB)

    Buescher, A.; Wahle, A. [Areva Energietechnik GmbH, Regensburg (Germany). Sachsenwerk Mittelspannung

    2008-03-15

    The new series GHA of medium-voltage switch gears have advantages due to sulfur hexafluorides avoidance during operation of the service life. An ergonomic display device enables simple handling and reliable switching processes. (GL)

  3. Remote handling in ZEPHYR

    International Nuclear Information System (INIS)

    Andelfinger, C.; Lackner, E.; Ulrich, M.; Weber, G.; Schilling, H.B.

    1982-04-01

    A conceptual design of the ZEPHYR building is described. The listed radiation data show that remote handling devices will be necessary in most areas of the building. For difficult repair and maintenance works it is intended to transfer complete units from the experimental hall to a hot cell which provides better working conditions. The necessary crane systems and other transport means are summarized as well as suitable commercially available manipulators and observation devices. The conept of automatic devices for cutting and welding and other operations inside the vacuum vessel and the belonging position control system is sketched. Guidelines for the design of passive components are set up in order to facilitate remote operation. (orig.)

  4. Handling hunger strikers.

    Science.gov (United States)

    1992-04-01

    Hunger strikes are being used increasingly and not only by those with a political point to make. Whereas in the past, hunger strikes in the United Kingdom seemed mainly to be started by terrorist prisoners for political purposes, the most recent was begun by a Tamil convicted of murder, to protest his innocence. In the later stages of his strike, before calling it off, he was looked after at the Hammersmith Hospital. So it is not only prison doctors who need to know how to handle a hunger strike. The following guidelines, adopted by the 43rd World Medical Assembly in Malta in November 1991, are therefore a timely reminder of the doctor's duties during a hunger strike.

  5. MFTF exception handling system

    International Nuclear Information System (INIS)

    Nowell, D.M.; Bridgeman, G.D.

    1979-01-01

    In the design of large experimental control systems, a major concern is ensuring that operators are quickly alerted to emergency or other exceptional conditions and that they are provided with sufficient information to respond adequately. This paper describes how the MFTF exception handling system satisfies these requirements. Conceptually exceptions are divided into one of two classes. Those which affect command status by producing an abort or suspend condition and those which fall into a softer notification category of report only or operator acknowledgement requirement. Additionally, an operator may choose to accept an exception condition as operational, or turn off monitoring for sensors determined to be malfunctioning. Control panels and displays used in operator response to exceptions are described

  6. Plutonium safe handling

    International Nuclear Information System (INIS)

    Tvehlov, Yu.

    2000-01-01

    The abstract, prepared on the basis of materials of the IAEA new leadership on the plutonium safe handling and its storage (the publication no. 9 in the Safety Reports Series), aimed at presenting internationally acknowledged criteria on the radiation danger evaluation and summarizing the experience in the safe management of great quantities of plutonium, accumulated in the nuclear states, is presented. The data on the weapon-class and civil plutonium, the degree of its danger, the measures for provision of its safety, including the data on accident radiation consequences with the fission number 10 18 , are presented. The recommendations, making it possible to eliminate the super- criticality danger, as well as ignition and explosion, to maintain the tightness of the facility, aimed at excluding the radioactive contamination and the possibility of internal irradiation, to provide for the plutonium security, physical protection and to reduce irradiation are given [ru

  7. Handle with care

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1965-03-15

    Full text: A film dealing with transport of radioactive materials by everyday means - rail, road, sea and air transport - has been made for IAEA. It illustrates in broad terms some of the simple precautions which should be followed by persons dealing with such materials during shipment. Throughout, the picture stresses the transport regulations drawn up and recommended by the Agency, and in particular the need to carry out carefully the instructions based on these regulations in order to ensure that there is no hazard to the public nor to those who handle radioactive materials in transit and storage. In straightforward language, the film addresses the porter of a goods wagon, an airline cargo clerk, a dockside crane operator, a truck driver and others who load and ship freight. It shows the various types of package used to contain different categories of radioactive substances according to the intensity of the radiation emitted. It also illustrates their robustness by a series of tests involving drops, fires, impact, crushing, etc. Clear instructions are conveyed on what to do in the event of an unlikely accident with any type of package. The film is entitled, 'The Safe Transport of Radioactive Materials', and is No. 3 in the series entitled, 'Handle with Care'. It was made for IAEA through the United Kingdom Atomic Energy Authority by the Film Producers' Guild in the United Kingdom. It is in 16 mm colour, optical sound, with a running time of 20 minutes. It is available for order at $50 either direct from IAEA or through any of its Member Governments. Prints can be supplied in English, French, Russian or Spanish. Copies are also available for adaptation for commentaries in other languages. (author)

  8. Local Identification of Voltage Instability from Load Tap Changer Response

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Papangelis, Lampros; Vournas, Costas D.

    2017-01-01

    . The new method is not bound to assessing system response over a predefined LTC tapping period. This allows handling LTCs with variable delays, as well as events taking place during the tapping sequence impacting the distribution voltages. For that purpose, eLIVES applies recursive least square fitting...

  9. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  10. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  11. Unvented Drum Handling Plan

    International Nuclear Information System (INIS)

    MCDONALD, K.M.

    2000-01-01

    This drum-handling plan proposes a method to deal with unvented transuranic drums encountered during retrieval of drums. Finding unvented drums during retrieval activities was expected, as identified in the Transuranic (TRU) Phase I Retrieval Plan (HNF-4781). However, significant numbers of unvented drums were not expected until excavation of buried drums began. This plan represents accelerated planning for management of unvented drums. A plan is proposed that manages unvented drums differently based on three categories. The first category of drums is any that visually appear to be pressurized. These will be vented immediately, using either the Hanford Fire Department Hazardous Materials (Haz. Mat.) team, if such are encountered before the facilities' capabilities are established, or using internal capabilities, once established. To date, no drums have been retrieved that showed signs of pressurization. The second category consists of drums that contain a minimal amount of Pu isotopes. This minimal amount is typically less than 1 gram of Pu, but may be waste-stream dependent. Drums in this category are assayed to determine if they are low-level waste (LLW). LLW drums are typically disposed of without venting. Any unvented drums that assay as TRU will be staged for a future venting campaign, using appropriate safety precautions in their handling. The third category of drums is those for which records show larger amounts of Pu isotopes (typically greater than or equal to 1 gram of Pu). These are assumed to be TRU and are not assayed at this point, but are staged for a future venting campaign. Any of these drums that do not have a visible venting device will be staged awaiting venting, and will be managed under appropriate controls, including covering the drums to protect from direct solar exposure, minimizing of container movement, and placement of a barrier to restrict vehicle access. There are a number of equipment options available to perform the venting. The

  12. New transport and handling contract

    CERN Multimedia

    SC Department

    2008-01-01

    A new transport and handling contract entered into force on 1.10.2008. As with the previous contract, the user interface is the internal transport/handling request form on EDH: https://edh.cern.ch/Document/TransportRequest/ To ensure that you receive the best possible service, we invite you to complete the various fields as accurately as possible and to include a mobile telephone number on which we can reach you. You can follow the progress of your request (schedule, completion) in the EDH request routing information. We remind you that the following deadlines apply: 48 hours for the transport of heavy goods (up to 8 tonnes) or simple handling operations 5 working days for crane operations, transport of extra-heavy goods, complex handling operations and combined transport and handling operations in the tunnel. For all enquiries, the number to contact remains unchanged: 72202. Heavy Handling Section TS-HE-HH 72672 - 160319

  13. Remote handling and accelerators

    International Nuclear Information System (INIS)

    Wilson, M.T.

    1983-01-01

    The high-current levels of contemporary and proposed accelerator facilities induce radiation levels into components, requiring consideration be given to maintenance techniques that reduce personnel exposure. Typical components involved include beamstops, targets, collimators, windows, and instrumentation that intercepts the direct beam. Also included are beam extraction, injection, splitting, and kicking regions, as well as purposeful spill areas where beam tails are trimmed and neutral particles are deposited. Scattered beam and secondary particles activate components all along a beamline such as vacuum pipes, magnets, and shielding. Maintenance techniques vary from hands-on to TV-viewed operation using state-of-the-art servomanipulators. Bottom- or side-entry casks are used with thimble-type target and diagnostic assemblies. Long-handled tools are operated from behind shadow shields. Swinging shield doors, unstacking block, and horizontally rolling shield roofs are all used to provide access. Common to all techniques is the need to make operations simple and to provide a means of seeing and reaching the area

  14. TFTR tritium handling concepts

    International Nuclear Information System (INIS)

    Garber, H.J.

    1976-01-01

    The Tokamak Fusion Test Reactor, to be located on the Princeton Forrestal Campus, is expected to operate with 1 to 2.5 MA tritium--deuterium plasmas, with the pulses involving injection of 50 to 150 Ci (5 to 16 mg) of tritium. Attainment of fusion conditions is based on generation of an approximately 1 keV tritium plasma by ohmic heating and conversion to a moderately hot tritium--deuterium ion plasma by injection of a ''preheating'' deuterium neutral beam (40 to 80 keV), followed by injection of a ''reacting'' beam of high energy neutral deuterium (120 to 150 keV). Additionally, compressions accompany the beam injections. Environmental, safety and cost considerations led to the decision to limit the amount of tritium gas on-site to that required for an experiment, maintaining all other tritium in ''solidified'' form. The form of the tritium supply is as uranium tritide, while the spent tritium and other hydrogen isotopes are getter-trapped by zirconium--aluminum alloy. The issues treated include: (1) design concepts for the tritium generator and its purification, dispensing, replenishment, containment, and containment--cleanup systems; (2) features of the spent plasma trapping system, particularly the regenerable absorption cartridges, their integration into the vacuum system, and the handling of non-getterables; (3) tritium permeation through the equipment and the anticipated releases to the environment; (4) overview of the tritium related ventilation systems; and (5) design bases for the facility's tritium clean-up systems

  15. Safe Handling of Radioisotopes

    International Nuclear Information System (INIS)

    1958-01-01

    Under its Statute the International Atomic Energy Agency is empowered to provide for the application of standards of safety for protection against radiation to its own operations and to operations making use of assistance provided by it or with which it is otherwise directly associated. To this end authorities receiving such assistance are required to observe relevant health and safety measures prescribed by the Agency. As a first step, it has been considered an urgent task to provide users of radioisotopes with a manual of practice for the safe handling of these substances. Such a manual is presented here and represents the first of a series of manuals and codes to be issued by the Agency. It has been prepared after careful consideration of existing national and international codes of radiation safety, by a group of international experts and in consultation with other international bodies. At the same time it is recommended that the manual be taken into account as a basic reference document by Member States of the Agency in the preparation of national health and safety documents covering the use of radioisotopes.

  16. Radioactive wastes handling facility

    International Nuclear Information System (INIS)

    Hirose, Emiko; Inaguma, Masahiko; Ozaki, Shigeru; Matsumoto, Kaname.

    1997-01-01

    There are disposed an area where a conveyor is disposed for separating miscellaneous radioactive solid wastes such as metals, on area for operators which is disposed in the direction vertical to the transferring direction of the conveyor, an area for receiving the radioactive wastes and placing them on the conveyor and an area for collecting the radioactive wastes transferred by the conveyor. Since an operator can conduct handling while wearing a working cloth attached to a partition wall as he wears his ordinary cloth, the operation condition can be improved and the efficiency for the separating work can be improved. When the area for settling conveyors and the area for the operators is depressurized, cruds on the surface of the wastes are not released to the outside and the working clothes can be prevented from being involved. Since the wastes are transferred by the conveyor, the operator's moving range is reduced, poisonous materials are fallen and moved through a sliding way to an area for collecting materials to be separated. Accordingly, the materials to be removed can be accumulated easily. (N.H.)

  17. Trends in Modern Exception Handling

    Directory of Open Access Journals (Sweden)

    Marcin Kuta

    2003-01-01

    Full Text Available Exception handling is nowadays a necessary component of error proof information systems. The paper presents overview of techniques and models of exception handling, problems connected with them and potential solutions. The aspects of implementation of propagation mechanisms and exception handling, their effect on semantics and general program efficiency are also taken into account. Presented mechanisms were adopted to modern programming languages. Considering design area, formal methods and formal verification of program properties we can notice exception handling mechanisms are weakly present what makes a field for future research.

  18. A nanoscale piezoelectric transformer for low-voltage transistors.

    Science.gov (United States)

    Agarwal, Sapan; Yablonovitch, Eli

    2014-11-12

    A novel piezoelectric voltage transformer for low-voltage transistors is proposed. Placing a piezoelectric transformer on the gate of a field-effect transistor results in the piezoelectric transformer field-effect transistor that can switch at significantly lower voltages than a conventional transistor. The piezoelectric transformer operates by using one piezoelectric to squeeze another piezoelectric to generate a higher output voltage than the input voltage. Multiple piezoelectrics can be used to squeeze a single piezoelectric layer to generate an even higher voltage amplification. Coupled electrical and mechanical modeling in COMSOL predicts a 12.5× voltage amplification for a six-layer piezoelectric transformer. This would lead to more than a 150× reduction in the power needed for communications.

  19. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    International Nuclear Information System (INIS)

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  20. High voltage superconducting switch for power application

    International Nuclear Information System (INIS)

    Mawardi, O.; Ferendeci, A.; Gattozzi, A.

    1983-01-01

    This paper reports the development of a novel interrupter which meets the requirements of a high voltage direct current (HVDC) power switch and at the same time doubles as a current limiter. The basic concept of the interrupter makes use of a fast superconducting, high capacity (SHIC) switch that carries the full load current while in the superconducting state and reverts to the normal resistive state when triggered. Typical design parameters are examined for the case of a HVDC transmission line handling 2.5KA at 150KVDC. The result is a power switch with superior performance and smaller size than the ones reported to date

  1. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  2. Safety measuring for sodium handling

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ji Young; Jeong, K C; Kim, T J; Kim, B H; Choi, J H

    2001-09-01

    This is the report for the safety measures of sodium handling. These contents are prerequisites for the development of sodium technology and thus the workers participate in sodium handling and experiments have to know them perfectly. As an appendix, the relating parts of the laws are presented.

  3. Electrocardiogram voltage discordance: Interpretation of low QRS voltage only in the precordial leads.

    Science.gov (United States)

    Kim, Diana H; Verdino, Ralph J

    To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Waste Handling Building Conceptual Study

    International Nuclear Information System (INIS)

    G.W. Rowe

    2000-01-01

    The objective of the ''Waste Handling Building Conceptual Study'' is to develop proposed design requirements for the repository Waste Handling System in sufficient detail to allow the surface facility design to proceed to the License Application effort if the proposed requirements are approved by DOE. Proposed requirements were developed to further refine waste handling facility performance characteristics and design constraints with an emphasis on supporting modular construction, minimizing fuel inventory, and optimizing facility maintainability and dry handling operations. To meet this objective, this study attempts to provide an alternative design to the Site Recommendation design that is flexible, simple, reliable, and can be constructed in phases. The design concept will be input to the ''Modular Design/Construction and Operation Options Report'', which will address the overall program objectives and direction, including options and issues associated with transportation, the subsurface facility, and Total System Life Cycle Cost. This study (herein) is limited to the Waste Handling System and associated fuel staging system

  5. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  6. Elevated voltage level I.sub.DDQ failure testing of integrated circuits

    Science.gov (United States)

    Righter, Alan W.

    1996-01-01

    Burn in testing of static CMOS IC's is eliminated by I.sub.DDQ testing at elevated voltage levels. These voltage levels are at least 25% higher than the normal operating voltage for the IC but are below voltage levels that would cause damage to the chip.

  7. Elevated voltage level I{sub DDQ} failure testing of integrated circuits

    Science.gov (United States)

    Righter, A.W.

    1996-05-21

    Burn in testing of static CMOS IC`s is eliminated by I{sub DDQ} testing at elevated voltage levels. These voltage levels are at least 25% higher than the normal operating voltage for the IC but are below voltage levels that would cause damage to the chip. 4 figs.

  8. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  9. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  10. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  11. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  12. Sophisticated fuel handling system evolved

    International Nuclear Information System (INIS)

    Ross, D.A.

    1988-01-01

    The control systems at Sellafield fuel handling plant are described. The requirements called for built-in diagnostic features as well as the ability to handle a large sequencing application. Speed was also important; responses better than 50ms were required. The control systems are used to automate operations within each of the three main process caves - two Magnox fuel decanners and an advanced gas-cooled reactor fuel dismantler. The fuel route within the fuel handling plant is illustrated and described. ASPIC (Automated Sequence Package for Industrial Control) which was developed as a controller for the plant processes is described. (U.K.)

  13. Production management of window handles

    Directory of Open Access Journals (Sweden)

    Manuela Ingaldi

    2014-12-01

    Full Text Available In the chapter a company involved in the production of aluminum window and door handles was presented. The main customers of the company are primarily companies which produce PCV joinery and wholesalers supplying these companies. One chosen product from the research company - a single-arm pin-lift window handle - was described and its production process depicted technologically. The chapter also includes SWOT analysis conducted in the research company and the value stream of the single-arm pin-lift window handle.

  14. Experimental validation of prototype high voltage bushing

    Science.gov (United States)

    Shah, Sejal; Tyagi, H.; Sharma, D.; Parmar, D.; M. N., Vishnudev; Joshi, K.; Patel, K.; Yadav, A.; Patel, R.; Bandyopadhyay, M.; Rotti, C.; Chakraborty, A.

    2017-08-01

    Prototype High voltage bushing (PHVB) is a scaled down configuration of DNB High Voltage Bushing (HVB) of ITER. It is designed for operation at 50 kV DC to ensure operational performance and thereby confirming the design configuration of DNB HVB. Two concentric insulators viz. Ceramic and Fiber reinforced polymer (FRP) rings are used as double layered vacuum boundary for 50 kV isolation between grounded and high voltage flanges. Stress shields are designed for smooth electric field distribution. During ceramic to Kovar brazing, spilling cannot be controlled which may lead to high localized electrostatic stress. To understand spilling phenomenon and precise stress calculation, quantitative analysis was performed using Scanning Electron Microscopy (SEM) of brazed sample and similar configuration modeled while performing the Finite Element (FE) analysis. FE analysis of PHVB is performed to find out electrical stresses on different areas of PHVB and are maintained similar to DNB HV Bushing. With this configuration, the experiment is performed considering ITER like vacuum and electrical parameters. Initial HV test is performed by temporary vacuum sealing arrangements using gaskets/O-rings at both ends in order to achieve desired vacuum and keep the system maintainable. During validation test, 50 kV voltage withstand is performed for one hour. Voltage withstand test for 60 kV DC (20% higher rated voltage) have also been performed without any breakdown. Successful operation of PHVB confirms the design of DNB HV Bushing. In this paper, configuration of PHVB with experimental validation data is presented.

  15. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  16. Safe handling of radiation sources

    International Nuclear Information System (INIS)

    Abd Nasir Ibrahim; Azali Muhammad; Ab Razak Hamzah; Abd Aziz Mohamed; Mohammad Pauzi Ismail

    2004-01-01

    This chapter discussed the subjects related to the safe handling of radiation sources: type of radiation sources, method of use: transport within premises, transport outside premises; Disposal of Gamma Sources

  17. How Retailers Handle Complaint Management

    DEFF Research Database (Denmark)

    Hansen, Torben; Wilke, Ricky; Zaichkowsky, Judy

    2009-01-01

    This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained as to the......This article fills a gap in the literature by providing insight about the handling of complaint management (CM) across a large cross section of retailers in the grocery, furniture, electronic and auto sectors. Determinants of retailers’ CM handling are investigated and insight is gained...... as to the links between CM and redress of consumers’ complaints. The results suggest that retailers who attach large negative consequences to consumer dissatisfaction are more likely than other retailers to develop a positive strategic view on customer complaining, but at the same time an increase in perceived...

  18. Ergonomic material-handling device

    Science.gov (United States)

    Barsnick, Lance E.; Zalk, David M.; Perry, Catherine M.; Biggs, Terry; Tageson, Robert E.

    2004-08-24

    A hand-held ergonomic material-handling device capable of moving heavy objects, such as large waste containers and other large objects requiring mechanical assistance. The ergonomic material-handling device can be used with neutral postures of the back, shoulders, wrists and knees, thereby reducing potential injury to the user. The device involves two key features: 1) gives the user the ability to adjust the height of the handles of the device to ergonomically fit the needs of the user's back, wrists and shoulders; and 2) has a rounded handlebar shape, as well as the size and configuration of the handles which keep the user's wrists in a neutral posture during manipulation of the device.

  19. High voltage switches having one or more floating conductor layers

    Science.gov (United States)

    Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

    2015-11-24

    This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.

  20. The technique on handling radiation

    International Nuclear Information System (INIS)

    1997-11-01

    This book describes measurement of radiation and handling radiation. The first part deals with measurement of radiation. The contents of this part are characteristic on measurement technique of radiation, radiation detector, measurement of energy spectrum, measurement of radioactivity, measurement for a level of radiation and county's statistics on radiation. The second parts explains handling radiation with treating of sealed radioisotope, treating unsealed source and radiation shield.

  1. Civilsamfundets ABC: H for Handling

    DEFF Research Database (Denmark)

    Lund, Anker Brink; Meyer, Gitte

    2015-01-01

    Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling.......Hvad er civilsamfundet? Anker Brink Lund og Gitte Meyer fra CBS Center for Civil Society Studies gennemgår civilsamfundet bogstav for bogstav. Vi er nået til H for Handling....

  2. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

  3. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  4. Flexible Electrostatic Technologies for Capture and Handling, Phase 1

    Science.gov (United States)

    Bryan, Thomas

    2015-01-01

    Fundamental to many of NASA's in-space transportation missions is the capture and handling of various objects and vehicles in various orbits for servicing, debris disposal, sample retrieval, and assembly without the benefit of sufficient grapple fixtures and docking ports. To perform similar material handling tasks on Earth, pincher grippers, suction grippers, or magnetic chucks are used, but are unable to reliably grip aluminum and composite spacecraft, insulation, radiators, solar arrays, or extra-terrestrial objects in the vacuum of outer space without dedicated handles in the right places. The electronic Flexible Electrostatic Technologies for space Capture and Handling (FETCH) will enable reliable and compliant gripping (soft dock) of practically any object in various orbits or surfaces without dedicated mechanical features, very low impact capture, and built-in proximity sensing without any conventional actuators. Originally developed to handle semiconductor and glass wafers during vacuum chamber processing without contamination, the normal rigid wafer handling chucks are replaced with thin metal foil segments laminated in flexible insulation driven by commercial off-the-shelf solid state, high-voltage power supplies. Preliminary testing in NASA Marshall Space Flight Center's (MSFC's) Flat Floor Robotics Lab demonstrated compliant alignment and gripping with a full-sized, 150-lb microsat mockup and translation before a clean release with a flip of a switch. The flexible electrostatic gripper pads can be adapted to various space applications with different sizes, shapes, and foil electrode layouts even with openings through the gripper pads for addition of guidance sensors or injection of permanent adhesives. With gripping forces estimated between 0.5 and 2.5 lb/in2 or 70-300 lb/ft2 of surface contact, the FETCH can turn on and off rapidly and repeatedly to enable sample handling, soft docking, in-space assembly, precision relocation, and surface translation

  5. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  6. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  7. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  8. BEHAVIOUR OF BACKFILL MATERIALS FOR ELECTRICAL GROUNDING SYSTEMS UNDER HIGH VOLTAGE CONDITIONS

    Directory of Open Access Journals (Sweden)

    S. C. LIM

    2015-06-01

    Full Text Available Backfill materials like Bentonite and cement are effective in lowering grounding resistance of electrodes for a considerable period. During lightning, switching impulses and earth fault occurrences in medium and high voltage networks, the grounding system needs to handle extremely high currents either for a short duration or prolonged period respectively. This paper investigates the behaviour of bentonite, cement and sand under impulse and alternating high voltage (50Hz conditions. Fulguritic-formation was observed in all materials under alternating high voltage. The findings reveal that performance of grounding systems under high voltage conditions may significantly change from the outcomes anticipated at design stage.

  9. Advances in high voltage insulation and arc interruption in SF6 and vacuum

    CERN Document Server

    Maller, V N

    1982-01-01

    Advances in High Voltage Insulation and Arc Interruption in SF6 and Vacuum deals with high voltage breakdown and arc extinction in sulfur hexafluoride (SF6) and high vacuum, with special emphasis on the application of these insulating media in high voltage power apparatus and devices. The design and developmental aspects of various high voltage power apparatus using SF6 and high vacuum are highlighted. This book is comprised of eight chapters and opens with a discussion on electrical discharges in SF6 and high vacuum, along with the properties and handling of SF6 gas. The following chapters fo

  10. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  11. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  12. Asthma, guides for diagnostic and handling

    International Nuclear Information System (INIS)

    Salgado, Carlos E; Caballero A, Andres S; Garcia G, Elizabeth

    1999-01-01

    The paper defines the asthma, includes topics as diagnostic, handling of the asthma, special situations as asthma and pregnancy, handling of the asthmatic patient's perioperatory and occupational asthma

  13. SRV-automatic handling device

    International Nuclear Information System (INIS)

    Yamada, Koji

    1987-01-01

    Automatic handling device for the steam relief valves (SRV's) is developed in order to achieve a decrease in exposure of workers, increase in availability factor, improvement in reliability, improvement in safety of operation, and labor saving. A survey is made during a periodical inspection to examine the actual SVR handling operation. An SRV automatic handling device consists of four components: conveyor, armed conveyor, lifting machine, and control/monitoring system. The conveyor is so designed that the existing I-rail installed in the containment vessel can be used without any modification. This is employed for conveying an SRV along the rail. The armed conveyor, designed for a box rail, is used for an SRV installed away from the rail. By using the lifting machine, an SRV installed away from the I-rail is brought to a spot just below the rail so that the SRV can be transferred by the conveyor. The control/monitoring system consists of a control computer, operation panel, TV monitor and annunciator. The SRV handling device is operated by remote control from a control room. A trial equipment is constructed and performance/function testing is carried out using actual SRV's. As a result, is it shown that the SRV handling device requires only two operators to serve satisfactorily. The required time for removal and replacement of one SRV is about 10 minutes. (Nogami, K.)

  14. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  15. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  16. Dynamic range of low-voltage cascode current mirrors

    DEFF Research Database (Denmark)

    Bruun, Erik; Shah, Peter Jivan

    1995-01-01

    Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...

  17. Handling of waste in ports

    International Nuclear Information System (INIS)

    Olson, P.H.

    1994-01-01

    The regulations governing the handling of port-generated waste are often national and/or local legislation, whereas the handling of ship-generated waste is governed by the MARPOL Convention in most parts of the world. The handling of waste consists of two main phases -collection and treatment. Waste has to be collected in every port and on board every ship, whereas generally only some wastes are treated and to a certain degree in ports and on board ships. This paper considers the different kinds of waste generated in both ports and on board ships, where and how it is generated, how it could be collected and treated. The two sources are treated together to show how some ship-generated waste may be treated in port installations primarily constructed for the treatment of the port-generated waste, making integrated use of the available treatment facilities. (author)

  18. Coplanar strips for Josephson voltage standard circuits

    International Nuclear Information System (INIS)

    Schubert, M.; May, T.; Wende, G.; Fritzsch, L.; Meyer, H.-G.

    2001-01-01

    We present a microwave circuit for Josephson voltage standards. Here, the Josephson junctions are integrated in a microwave transmission line designed as coplanar strips (CPS). The new layout offers the possibility of achieving a higher scale of integration and to considerably simplify the fabrication technology. The characteristic impedance of the CPS is about 50 Ω, and this should be of interest for programmable Josephson voltage standard circuits with SNS or SINIS junctions. To demonstrate the function of the microwave circuit design, conventional 10 V Josephson voltage standard circuits with 17000 Nb/AlO x /Nb junctions were prepared and tested. Stable Shapiro steps at the 10 V level were generated. Furthermore, arrays of 1400 SINIS junctions in this microwave layout exhibited first-order Shapiro steps. Copyright 2001 American Institute of Physics

  19. Advances in high voltage power switching with GTOs

    International Nuclear Information System (INIS)

    Podlesak, T.F.

    1990-01-01

    The control of high voltage at high power, particularly opening switches, has been difficult in the past. Using gate turnoff thyristors (GTOs) arranged in series enables large currents to be switched at high voltage. The authors report a high voltage opening switch has been successfully demonstrated. This switch uses GTOs in series and successfully operates at voltages higher than the rated voltage of the individual devices. It is believed that this is the first time this has been successfully demonstrated, in that GTOs have been operated in series before, but always in a manner as to not exceed the voltage capability of the individual devices. In short, the devices have not worked together, sharing the voltage, but one device has been operated using several backup devices. Of particular interest is how well the individual devices share the voltage applied to them. Equal voltage sharing between devices is absolutely essential, in order to not exceed the voltage rating of any of the devices in the series chain. This is accomplished at high (microsecond) switching speeds. Thus, the system is useful for high frequency applications as well as high power, making for a flexible circuit system element. This demonstration system is rated at 5 KV and uses 1 KV devices. A larger 24 KV system is under design and will use 4.5 KV devices. In order to design the 24 KV switch, the safe operating area of the large devices must be known thoroughly

  20. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  1. Transmission of power at high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Lane, F J

    1963-01-01

    High voltage transmission is considered to be concerned with circuits and systems operating at or above 132 kV. While the general examination is concerned with ac transmission, dc systems are also included. The choice of voltage for a system will usually involve hazardous assessments of the future requirements of industry, commerce and a changing population. Experience suggests that, if the estimated economic difference between two voltages is not significant, there is good reason to choose the higher voltage, as this will make the better provision for unexpected future expansion. Two principal functions served by transmission circuits in a supply system are: (a) the transportation of energy in bulk from the generator to the reception point in the distribution system; and (b) the interconnection and integration of the generating plant and associated loads. These functions are considered and various types of system are discussed in terms of practicability, viability, quality and continuity of supply. Future developments requiring transmission voltages up to 750 kV will raise many problems which are in the main empirical. Examples are given of the type of problem envisaged and it is suggested that these can only be partially solved by theory and model operation.

  2. Procedure of safe handling with cytostatic drugs

    Directory of Open Access Journals (Sweden)

    Kodžo Dragan

    2003-01-01

    Full Text Available Working group for safe handling with cytostatic drugs has been formed by the Ministry of Health, and it consists of professionals from IORS, Federal Bureau of Weights and Measures, Industrial Medicine, Institute of Hematology, Military Medical Academy, and Crown Agents. The aim of this working group is to prepare procedures for safe handling with cytostatic drugs, as well as program for educational seminar for nurses, medical technicians, and pharmaceutical technicians. The procedures will serve as a guide of good practice of oncology health care, and will refer to all actions that health care professionals carry out from the moment of drugs arrival to the pharmacy to the moment of their application. In the first segment of this procedure, general rules are given for working with cytotoxic agents, control for risky exposures, safe system of work, control of working environment, monitoring of the employees' health condition adequate protection in the working environment, protective equipment of the employees (gloves, mask, cap, eyeglasses, shoe covers, coats and chambers for vertical laminary air stream. Storing of cytostatics, procedure in case of accident, and waste handling and removal are also described in this segment. Fifty-three standard operational procedures are described in detail in the second segment. Training scheme for preparation of chemotherapy is given in the third segment - education related to various fields and practical part, which would be carried out through workshops, and at the end of the course participants would pass a test and obtain certificate. After the procedures for safe handling with cytostatics are legally regulated employer will have to provide minimum of protective equipment, special rooms for the drugs dissolving, chambers with laminar airflow, 6 hours working time, rotation of the staff working with drugs dissolving in intervals of every five years, higher efficiency, better health control. In conclusion

  3. Square-Wave Voltage Injection Algorithm for PMSM Position Sensorless Control With High Robustness to Voltage Errors

    DEFF Research Database (Denmark)

    Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede

    2017-01-01

    relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...

  4. Electric devices used in radioactive handling enclosures of the high activity laboratory

    International Nuclear Information System (INIS)

    Gaigeot, F.; Laurent, H.

    1958-08-01

    This report describes several electric, electronic and electromechanical assemblies which are used in radioactive handling enclosures. The authors propose an overview of existing or foreseen devices: a device to lift covers, a brightness comparator, a high voltage device to perform electrophoresis, a level sensor or regulator device, a regulation device to control under-pressure in an enclosure [fr

  5. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  6. Software for handling MFME1

    International Nuclear Information System (INIS)

    Van der Merwe, W.G.

    1984-01-01

    The report deals with SEMFIP, a computer code for determining magnetic field measurements. The program is written in FORTRAN and ASSEMBLER. The preparations for establishing SEMFIP, the actual measurements, data handling and the problems that were experienced are discussed. Details on the computer code are supplied in an appendix

  7. Welding method by remote handling

    International Nuclear Information System (INIS)

    Hashinokuchi, Minoru.

    1994-01-01

    Water is charged into a pit (or a water reservoir) and an article to be welded is placed on a support in the pit by remote handling. A steel plate is disposed so as to cover the article to be welded by remote handling. The welding device is positioned to the portion to be welded and fixed in a state where the article to be welded is shielded from radiation by water and the steel plate. Water in the pit is drained till the portion to be welded is exposed to the atmosphere. Then, welding is conducted. After completion of the welding, water is charged again to the pit and the welding device and fixing jigs are decomposed in a state where the article to be welded is shielded again from radiation by water and the steel plate. Subsequently, the steel plate is removed by remote handling. Then, the article to be welded is returned from the pit to a temporary placing pool by remote handling. This can reduce operator's exposure. Further, since the amount of the shielding materials can be minimized, the amount of radioactive wastes can be decreased. (I.N.)

  8. Planning aspects of ac extra high voltage lines

    Energy Technology Data Exchange (ETDEWEB)

    Engelhardt, H

    1964-01-01

    The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

  9. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  10. Choice of operating voltage for a transmission electron microscope

    International Nuclear Information System (INIS)

    Egerton, R.F.

    2014-01-01

    An accelerating voltage of 100–300 kV remains a good choice for the majority of TEM or STEM specimens, avoiding the expense of high-voltage microscopy but providing the possibility of atomic resolution even in the absence of lens-aberration correction. For specimens thicker than a few tens of nm, the image intensity and scattering contrast are likely to be higher than at lower voltage, as is the visibility of ionization edges below 1000 eV (as required for EELS elemental analysis). In thick (>100 nm) specimens, higher voltage ensures less beam broadening and better spatial resolution for STEM imaging and EDX spectroscopy. Low-voltage (e.g. 30 kV) TEM or STEM is attractive for a very thin (e.g. 10 nm) specimen, as it provides higher scattering contrast and fewer problems for valence-excitation EELS. Specimens that are immune to radiolysis suffer knock-on damage at high current densities, and this form of radiation damage can be reduced or avoided by choosing a low accelerating voltage. Low-voltage STEM with an aberration-corrected objective lens (together with a high-angle dark-field detector and/or EELS) offers atomic resolution and elemental identification from very thin specimens. Conventional TEM can provide atomic resolution in low-voltage phase-contrast images but requires correction of chromatic aberration and preferably an electron-beam monochromator. Many non-conducting (e.g. organic) specimens damage easily by radiolysis and radiation damage then determines the TEM image resolution. For bright-field scattering contrast, low kV can provide slightly better dose-limited resolution if the specimen is very thin (a few nm) but considerably better resolution is possible from a thicker specimen, for which higher kV is required. Use of a phase plate in a conventional TEM offers the most dose-efficient way of achieving atomic resolution from beam-sensitive specimens. - Highlights: • 100–300 kV accelerating voltage is suitable for TEM specimens of typical

  11. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  12. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  13. Experience in handling concentrated tritium

    International Nuclear Information System (INIS)

    Holtslander, W.J.

    1985-12-01

    The notes describe the experience in handling concentrated tritium in the hydrogen form accumulated in the Chalk River Nuclear Laboratories Tritium Laboratory. The techniques of box operation, pumping systems, hydriding and dehydriding operations, and analysis of tritium are discussed. Information on the Chalk River Tritium Extraction Plant is included as a collection of reprints of papers presented at the Dayton Meeting on Tritium Technology, 1985 April 30 - May 2

  14. International handling of fissionable material

    International Nuclear Information System (INIS)

    1975-01-01

    The opinion of the ministry for foreign affairs on international handling of fissionable materials is given. As an introduction a survey is given of the possibilities to produce nuclear weapons from materials used in or produced by power reactors. Principles for international control of fissionable materials are given. International agreements against proliferation of nuclear weapons are surveyed and methods to improve them are proposed. (K.K.)

  15. Confinement facilities for handling plutonium

    International Nuclear Information System (INIS)

    Maraman, W.J.; McNeese, W.D.; Stafford, R.G.

    1975-01-01

    Plutonium handling on a multigram scale began in 1944. Early criteria, equipment, and techniques for confining contamination have been superseded by more stringent criteria and vastly improved equipment and techniques for in-process contamination control, effluent air cleaning and treatment of liquid wastes. This paper describes the evolution of equipment and practices to minimize exposure of workers and escape of contamination into work areas and into the environment. Early and current contamination controls are compared. (author)

  16. Remote handling equipment for SNS

    International Nuclear Information System (INIS)

    Poulten, B.H.

    1983-01-01

    This report gives information on the areas of the SNS, facility which become highly radioactive preventing hands-on maintenance. Levels of activity are sufficiently high in the Target Station Area of the SNS, especially under fault conditions, to warrant reactor technology to be used in the design of the water, drainage and ventilation systems. These problems, together with the type of remote handling equipment required in the SNS, are discussed

  17. Remote handling in reprocessing plants

    International Nuclear Information System (INIS)

    Streiff, G.

    1984-01-01

    Remote control will be the rule for maintenance in hot cells of future spent fuel reprocessing plants because of the radioactivity level. New handling equipments will be developed and intervention principles defined. Existing materials, recommendations for use and new manipulators are found in the PMDS' documentation. It is also a help in the choice and use of intervention means and a guide for the user [fr

  18. Equipment for the handling of thorium materials

    International Nuclear Information System (INIS)

    Heisler, S.W. Jr.; Mihalovich, G.S.

    1988-01-01

    The Feed Materials Production Center (FMPC) is the United States Department of Energy's storage facility for thorium. FMPC thorium handling and overpacking projects ensure the continued safe handling and storage of the thorium inventory until final disposition of the materials is determined and implemented. The handling and overpacking of the thorium materials requires the design of a system that utilizes remote handling and overpacking equipment not currently utilized at the FMPC in the handling of uranium materials. The use of remote equipment significantly reduces radiation exposure to personnel during the handling and overpacking efforts. The design system combines existing technologies from the nuclear industry, the materials processing and handling industry and the mining industry. The designed system consists of a modified fork lift truck for the transport of thorium containers, automated equipment for material identification and inventory control, and remote handling and overpacking equipment for material identification and inventory control, and remote handling and overpacking equipment for repackaging of the thorium materials

  19. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  20. Enteral Feeding Set Handling Techniques.

    Science.gov (United States)

    Lyman, Beth; Williams, Maria; Sollazzo, Janet; Hayden, Ashley; Hensley, Pam; Dai, Hongying; Roberts, Cristine

    2017-04-01

    Enteral nutrition therapy is common practice in pediatric clinical settings. Often patients will receive a pump-assisted bolus feeding over 30 minutes several times per day using the same enteral feeding set (EFS). This study aims to determine the safest and most efficacious way to handle the EFS between feedings. Three EFS handling techniques were compared through simulation for bacterial growth, nursing time, and supply costs: (1) rinsing the EFS with sterile water after each feeding, (2) refrigerating the EFS between feedings, and (3) using a ready-to-hang (RTH) product maintained at room temperature. Cultures were obtained at baseline, hour 12, and hour 21 of the 24-hour cycle. A time-in-motion analysis was conducted and reported in average number of seconds to complete each procedure. Supply costs were inventoried for 1 month comparing the actual usage to our estimated usage. Of 1080 cultures obtained, the overall bacterial growth rate was 8.7%. The rinse and refrigeration techniques displayed similar bacterial growth (11.4% vs 10.3%, P = .63). The RTH technique displayed the least bacterial growth of any method (4.4%, P = .002). The time analysis in minutes showed the rinse method was the most time-consuming (44.8 ± 2.7) vs refrigeration (35.8 ± 2.6) and RTH (31.08 ± 0.6) ( P refrigerating the EFS between uses is the next most efficacious method for handling the EFS between bolus feeds.

  1. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  2. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  3. High voltage performance of BARC-TIFR Pelletron Accelerator

    International Nuclear Information System (INIS)

    Surendran, P.; Ansari, Q.N.; Nair, J.P.

    2014-01-01

    The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF_6 drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)

  4. Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors

    Directory of Open Access Journals (Sweden)

    Busi Rambabu

    2014-01-01

    Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.

  5. Neonatal handling induces anovulatory estrous cycles in rats

    Directory of Open Access Journals (Sweden)

    Gomes C.M.

    1999-01-01

    Full Text Available Since previous work has shown that stimulation early in life decreases sexual receptiveness as measured by the female lordosis quotient, we suggested that neonatal handling could affect the function of the hypothalamus-pituitary-gonadal axis. The effects of neonatal handling on the estrous cycle and ovulation were analyzed in adult rats. Two groups of animals were studied: intact (no manipulation, N = 10 and handled (N = 11. Pups were either handled daily for 1 min during the first 10 days of life or left undisturbed. At the age of 90 days, a vaginal smear was collected daily at 9:00 a.m. and analyzed for 29 days; at 9:00 a.m. on the day of estrus, animals were anesthetized with thiopental (40 mg/kg, ip, the ovaries were removed and the oviduct was dissected and squashed between 2 glass slides. The number of oocytes of both oviductal ampullae was counted under the microscope. The average numbers for each phase of the cycle (diestrus I, diestrus II, proestrus and estrus during the period analyzed were compared between the two groups. There were no significant differences between intact and handled females during any of the phases. However, the number of handled females that showed anovulatory cycles (8 out of 11 was significantly higher than in the intact group (none out of 10. Neonatal stimulation may affect not only the hypothalamus-pituitary-adrenal axis, as previously demonstrated, but also the hypothalamus-pituitary-gonadal axis in female rats.

  6. High voltage performance of BARC-TIFR Pelletron Accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Surendran, P.; Ansari, Q.N.; Nair, J.P., E-mail: surendra@tifr.res.in [Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai (India); and others

    2014-07-01

    The 14 UD Pelletron Accelerator at TIFR, Mumbai is operational since its inception in 1988. It was decided to impart enough time for high voltage conditioning to achieve higher operational voltage. Prior to this, comprehensive works such as replacing all the sputter ion pumps and Titanium sublimation pumps across the accelerator tube with new or refurbished ones and replacement of Alumina balls in the SF{sub 6} drier with fresh balls were carried out. High voltage conditioning of each module was done. Further conditioning of two modules at a time in overlapping mode improved the terminal voltage. As a result of this rigorous conditioning Terminal voltage of 12.6 MV was achieved and beam has been delivered to users at 12 MV terminal. Details of this effort will be presented in this paper. (author)

  7. Power angle control of grid-connected voltage source converter in a wind energy application

    Energy Technology Data Exchange (ETDEWEB)

    Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering

    1996-12-31

    In this thesis, the connection of a voltage source converter to the grid in a wind energy application is examined. The possibility of using a cheap control system without grid current measurements, is investigated. The control method is based on controlling the voltage angle of the inverter, which governs the active power flow. The highest frequency of the power variation, coming from wind turbine, is approx. 5 Hz. Since the proposed control method easily can handle such power variations it is very well suited for wind turbine applications. The characteristics of the system depend on the DC-link capacitor, the grid filter inductance and resistance. Large values of the resistance damp the system well but increase the energy losses. A high inductance leads to a reduced harmonic level on the grid but makes the system slower. By using feed-forward of the generator/rectifier current signal, the performance is increased compared to an ordinary PI-control. Combining the Linear Quadratic (LQ) control method with Kalman filtered input signals, a robust control method with a good performance is obtained. The LQ controller controls both the phase displacement angle and the modulation index, resulting in higher bandwidth, and the typical power angle resonance at the grid frequency disappears. 22 refs, 109 figs, 14 tabs

  8. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  9. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  10. 7 CFR 926.9 - Handle.

    Science.gov (United States)

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE DATA COLLECTION, REPORTING AND RECORDKEEPING REQUIREMENTS APPLICABLE TO CRANBERRIES NOT SUBJECT TO THE CRANBERRY MARKETING ORDER § 926.9 Handle. Handle...

  11. HMSRP Hawaiian Monk Seal Handling Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains records for all handling and measurement of Hawaiian monk seals since 1981. Live seals are handled and measured during a variety of events...

  12. Grid Filter Design for a Multi-Megawatt Medium-Voltage Voltage Source Inverter

    DEFF Research Database (Denmark)

    Rockhill, A.A.; Liserre, Marco; Teodorescu, Remus

    2011-01-01

    This paper describes the design procedure and performance of an LCL grid filter for a medium-voltage neutral point clamped (NPC) converter to be adopted for a multimegawatt wind turbine. The unique filter design challenges in this application are driven by a combination of the medium voltage...... converter, a limited allowable switching frequency, component physical size and weight concerns, and the stringent limits for allowable injected current harmonics. Traditional design procedures of grid filters for lower power and higher switching frequency converters are not valid for a multi......-megawatt filter connecting a medium-voltage converter switching at low frequency to the electric grid. This paper demonstrates a frequency domain model based approach to determine the optimum filter parameters that provide the necessary performance under all operating conditions given the necessary design...

  13. Development of spent fuel remote handling technology

    International Nuclear Information System (INIS)

    Yoon, J. S.; Hong, H. D.; Kim, S. H.

    2004-02-01

    In this research, the remote handling technology is developed for the advanced spent fuel conditioning process which gives a possible solution to deal with the rapidly increasing spent fuels. In detail, a fuel rod slitting device is developed for the decladding of the spent fuel. A series of experiments has been performed to find out the optimal condition of the spent fuel voloxidation which converts the UO 2 pellet into U 3 O 8 powder. The design requirements of the ACP equipment for hot test is established by analysing the modular requirement, radiation hardening and thermal protection of the process equipment, etc. The prototype of the servo manipulator is developed. The manipulator has an excellent performance in terms of the payload to weight ratio that is 30 % higher than that of existing manipulators. To provide reliability and safety of the ACP, the 3 dimensional graphic simulator is developed. Using the simulator the remote handling operation is simulated and as a result, the optimal layout of ACP is obtained. The supervisory control system is designed to control and monitor the several different unit processes. Also the failure monitoring system is developed to detect the possible accidents of the reduction reactor

  14. LACIE data-handling techniques

    Science.gov (United States)

    Waits, G. H. (Principal Investigator)

    1979-01-01

    Techniques implemented to facilitate processing of LANDSAT multispectral data between 1975 and 1978 are described. The data that were handled during the large area crop inventory experiment and the storage mechanisms used for the various types of data are defined. The overall data flow, from the placing of the LANDSAT orders through the actual analysis of the data set, is discussed. An overview is provided of the status and tracking system that was developed and of the data base maintenance and operational task. The archiving of the LACIE data is explained.

  15. The handling of radiation accidents

    International Nuclear Information System (INIS)

    Macdonald, H.F.; Orchard, H.C.; Walker, C.W.

    1977-04-01

    Some of the more interesting and important contributions to a recent International Symposium on the Handling of Radiation Accidents are discussed and personal comments on many of the papers presented are included. The principal conclusion of the Symposium was that although the nuclear industry has an excellent safety record, there is no room for complacency. Continuing attention to emergency planning and exercising are essential in order to maintain this position. A full list of the papers presented at the Symposium is included as an Appendix. (author)

  16. Distance protection of multiple-circuit shared tower transmission lines with different voltages

    DEFF Research Database (Denmark)

    Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. This study presents a detailed theoretical analysis of such combined faults, including the development...... of a formula for estimating the magnitude of the short-circuit current. It is demonstrated that if the faulted phase from the higher voltage level leads the faulted phase from the lower voltage level, a distance relay at the higher voltage level sees the fault in the forward direction, whereas a distance relay...

  17. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  18. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Science.gov (United States)

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  19. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. 7 CFR 58.443 - Whey handling.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Whey handling. 58.443 Section 58.443 Agriculture... Procedures § 58.443 Whey handling. (a) Adequate sanitary facilities shall be provided for the handling of whey. If outside, necessary precautions shall be taken to minimize flies, insects and development of...

  1. Team effort leads to versatile handling solution for pipe manufacturer

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    2010-09-15

    This article discussed the development of a new pipe-handling system that resulted in increased efficiencies in plant-to-yard transport for a custom steel pipe manufacturer. In the previous system, loaders would move finished pipe to the yard for storage. However, for transport loading, the pipe would have to be brought back indoors because only the inside cranes could handle loading the pipe without damaging the special outer coating on the pipe. In the new pipe-handling system, the loader is replaced with a Sennebogen 850 M rubber-tired material handler, which was developed for the steel recycling industry. The generator that comes on the material handler is retrofitted to power a purpose-built pipe-handler attachment. The machine's higher lifting reach allows for higher stacking, effectively increasing the capacity of the yard. The new pipe-handling machine allows trucks to be loaded right in the yard, eliminating the need to double-handle the pipe. 1 fig.

  2. Constraint Handling Rules with Binders, Patterns and Generic Quantification

    NARCIS (Netherlands)

    Serrano, Alejandro; Hage, J.

    2017-01-01

    Constraint Handling Rules provide descriptions for constraint solvers. However, they fall short when those constraints specify some binding structure, like higher-rank types in a constraint-based type inference algorithm. In this paper, the term syntax of constraints is replaced by λ-tree syntax, in

  3. Voltage protection scheme for MG sets used to drive inductive energy storage systems

    International Nuclear Information System (INIS)

    Campen, G.L.; Easter, R.B.

    1977-01-01

    A recent tokamak proposal at ORNL called for MG (motor-generator) sets to drive the ohmic heating (OH] coil, which was to be subjected to 20 kV immediately after coil charge-up to initiate the experiment. Since most rotating machinery is inherently low voltage, including the machines available at ORNL, a mechanism was necessary to isolate the generators from the high voltage portions of the circuit before the appearance of this voltage. It is not the expected 20 kV at the coil that causes difficulty, because the main interrupting switch handles this. The voltage induced in the armature due to di/dt and the possibility of faults are the greatest causes for concern and are responsible for the complexity of the voltage protection scheme, which must accommodate any possible combination of fault time and location. Such a protection scheme is presented in this paper

  4. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  5. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  6. Diode-Assisted Buck-Boost Voltage-Source Inverters

    DEFF Research Database (Denmark)

    Gao, Feng; Loh, Poh Chiang; Teodorescu, Remus

    2009-01-01

    , a number of diode-assisted inverter variants can be designed with each having its own operational principle and voltage gain expression. For controlling them, a generic modulation scheme that can be used for controlling all diode-assisted variants with minimized harmonic distortion and component stress......This paper proposes a number of diode-assisted buck-boost voltage-source inverters with a unique X-shaped diode-capacitor network inserted between the inverter circuitry and dc source for producing a voltage gain that is comparatively higher than those of other buck-boost conversion techniques....... Using the diode-assisted network, the proposed inverters can naturally configure themselves to perform capacitive charging in parallel and discharging in series to give a higher voltage multiplication factor without compromising waveform quality. In addition, by adopting different front-end circuitries...

  7. Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.

    Science.gov (United States)

    Genc, Ayten; Bakirci, Busra

    2015-01-01

    The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.

  8. Organic dielectrics in high voltage cables

    Energy Technology Data Exchange (ETDEWEB)

    Vermeer, J

    1962-03-01

    It appears that the limit has been reached in the applicability of oil-impregnated paper as the dielectric for ehv cables, as with rising voltages the prevention of conductor losses becomes increasingly difficult, while the dielectric losses of the insulation, increasing as the square of the voltage, contribute to a greater extent to the temperature rise of the conductor. The power transmitting capacity of ehv cables reaches a maximum at 500 to 600 kV for these reasons. Apart from artificial cooling, a substantial improvement can be obtained only with the use of insulating materials with much lower dielectric losses; these can moreover be applied with a smaller wall thickness, but this means higher field strengths. Synthetic polymer materials meet these requirements but can be used successfully only in the form of lapped film tapes impregnated with suitable liquids. The electrical properties of these heterogeneous dielectrics, in particular, their impulse breakdown strengths are studied in detail.

  9. Safety of Cargo Aircraft Handling Procedure

    Directory of Open Access Journals (Sweden)

    Daniel Hlavatý

    2017-07-01

    Full Text Available The aim of this paper is to get acquainted with the ways how to improve the safety management system during cargo aircraft handling. The first chapter is dedicated to general information about air cargo transportation. This includes the history or types of cargo aircraft handling, but also the means of handling. The second part is focused on detailed description of cargo aircraft handling, including a description of activities that are performed before and after handling. The following part of this paper covers a theoretical interpretation of safety, safety indicators and legislative provisions related to the safety of cargo aircraft handling. The fourth part of this paper analyzes the fault trees of events which might occur during handling. The factors found by this analysis are compared with safety reports of FedEx. Based on the comparison, there is a proposal on how to improve the safety management in this transportation company.

  10. Transfer Area Mechanical Handling Calculation

    International Nuclear Information System (INIS)

    Dianda, B.

    2004-01-01

    This calculation is intended to support the License Application (LA) submittal of December 2004, in accordance with the directive given by DOE correspondence received on the 27th of January 2004 entitled: ''Authorization for Bechtel SAX Company L.L. C. to Include a Bare Fuel Handling Facility and Increased Aging Capacity in the License Application, Contract Number DE-AC--28-01R W12101'' (Arthur, W.J., I11 2004). This correspondence was appended by further Correspondence received on the 19th of February 2004 entitled: ''Technical Direction to Bechtel SAIC Company L.L. C. for Surface Facility Improvements, Contract Number DE-AC--28-OIRW12101; TDL No. 04-024'' (BSC 2004a). These documents give the authorization for a Fuel Handling Facility to be included in the baseline. The purpose of this calculation is to establish preliminary bounding equipment envelopes and weights for the Fuel Handling Facility (FHF) transfer areas equipment. This calculation provides preliminary information only to support development of facility layouts and preliminary load calculations. The limitations of this preliminary calculation lie within the assumptions of section 5 , as this calculation is part of an evolutionary design process. It is intended that this calculation is superseded as the design advances to reflect information necessary to support License Application. The design choices outlined within this calculation represent a demonstration of feasibility and may or may not be included in the completed design. This calculation provides preliminary weight, dimensional envelope, and equipment position in building for the purposes of defining interface variables. This calculation identifies and sizes major equipment and assemblies that dictate overall equipment dimensions and facility interfaces. Sizing of components is based on the selection of commercially available products, where applicable. This is not a specific recommendation for the future use of these components or their

  11. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  12. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  13. High voltage distributions in RPCs

    International Nuclear Information System (INIS)

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  14. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    Energy Technology Data Exchange (ETDEWEB)

    J.F. Beesley

    2005-04-21

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process.

  15. Bulk handling benefits from ICT

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-11-15

    The efficiency and accuracy of bulk handling is being improved by the range of management information systems and services available today. As part of the program to extend Richards Bay Coal Terminal, Siemens is installing a manufacturing execution system which coordinates and monitors all movements of raw materials. The article also reports recent developments by AXSMarine, SunGuard Energy, Fuelworx and Railworx in providing integrated tools for tracking, managing and optimising solid/liquid fuels and rail car maintenance activities. QMASTOR Ltd. has secured a contract with Anglo Coal Australia to provide its Pit to Port.net{reg_sign} and iFuse{reg_sign} software systems across all their Australians sites, to include pit-to-product stockpile management. 2 figs.

  16. Handling and transport problems (1960)

    International Nuclear Information System (INIS)

    Pomarola, J.; Savouyaud, J.

    1960-01-01

    I. The handling and transport of radioactive wastes involves the danger of irradiation and contamination. It is indispensable: - to lay down a special set of rules governing the removal and transport of wastes within centres or from one centre to another; - to give charge of this transportation to a group containing teams of specialists. The organisation, equipment and output of these teams is being examined. II. Certain materials are particularly dangerous to transport, and for these special vehicles and fixed installations are necessary. This is the case especially for the evacuation of very active liquids. A transport vehicle is described, consisting of a trailer tractor and a recipient holding 500 litres of liquid of which the activity can reach 1000 C/l; the decanting operation, the route to be followed by the vehicle, and the precautions taken are also described. (author) [fr

  17. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    International Nuclear Information System (INIS)

    Beesley. J.F.

    2005-01-01

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process

  18. Fuel Handling Facility Description Document

    International Nuclear Information System (INIS)

    M.A. LaFountain

    2005-01-01

    The purpose of the facility description document (FDD) is to establish the requirements and their bases that drive the design of the Fuel Handling Facility (FHF) to allow the design effort to proceed to license application. This FDD is a living document that will be revised at strategic points as the design matures. It identifies the requirements and describes the facility design as it currently exists, with emphasis on design attributes provided to meet the requirements. This FDD was developed as an engineering tool for design control. Accordingly, the primary audience and users are design engineers. It leads the design process with regard to the flow down of upper tier requirements onto the facility. Knowledge of these requirements is essential to performing the design process. It trails the design with regard to the description of the facility. This description is a reflection of the results of the design process to date

  19. Data Handling and Parameter Estimation

    DEFF Research Database (Denmark)

    Sin, Gürkan; Gernaey, Krist

    2016-01-01

    ,engineers, and professionals. However, it is also expected that they will be useful both for graduate teaching as well as a stepping stone for academic researchers who wish to expand their theoretical interest in the subject. For the models selected to interpret the experimental data, this chapter uses available models from...... literature that are mostly based on the ActivatedSludge Model (ASM) framework and their appropriate extensions (Henze et al., 2000).The chapter presents an overview of the most commonly used methods in the estimation of parameters from experimental batch data, namely: (i) data handling and validation, (ii......Modelling is one of the key tools at the disposal of modern wastewater treatment professionals, researchers and engineers. It enables them to study and understand complex phenomena underlying the physical, chemical and biological performance of wastewater treatment plants at different temporal...

  20. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  1. A matter of quantum voltages

    Energy Technology Data Exchange (ETDEWEB)

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  2. Examples of remote handling of irradiated fuel assemblies in Germany

    International Nuclear Information System (INIS)

    Peehs, M.; Knecht, K.

    1999-01-01

    Examples for the remote handling of irradiated fuel in Germany are presented in the following areas: - fuel assembling pool service activities; - early encapsulation of spent fuel in the pool of a nuclear power plant (NPP) at the end of the wet storage period. All development in remote fuel assembly handling envisages minimization of the radioactive dose applied to the operating staff. In the service area a further key objective for applying advanced methods is to perform the work faster and at a higher quality standard. The early encapsulation is a new technology to provide the final packaging of spent fuel already in the pool of a NPP to ensure reliable handling for all further back end processes. (author)

  3. Particle swarm optimization for determining shortest distance to voltage collapse

    Energy Technology Data Exchange (ETDEWEB)

    Arya, L.D.; Choube, S.C. [Electrical Engineering Department, S.G.S.I.T.S. Indore, MP 452 003 (India); Shrivastava, M. [Electrical Engineering Department, Government Engineering College Ujjain, MP 456 010 (India); Kothari, D.P. [Centre for Energy Studies, Indian Institute of Technology, Delhi (India)

    2007-12-15

    This paper describes an algorithm for computing shortest distance to voltage collapse or determination of CSNBP using PSO technique. A direction along CSNBP gives conservative results from voltage security view point. This information is useful to the operator to steer the system away from this point by taking corrective actions. The distance to a closest bifurcation is a minimum of the loadability given a slack bus or participation factors for increasing generation as the load increases. CSNBP determination has been formulated as an optimization problem to be used in PSO technique. PSO is a new evolutionary algorithm (EA) which is population based inspired by the social behavior of animals such as fish schooling and birds flocking. It can handle optimization problems with any complexity since mechanization is simple with few parameters to be tuned. The developed algorithm has been implemented on two standard test systems. (author)

  4. Integration of Electric Vehicles in Low Voltage Danish Distribution Grids

    DEFF Research Database (Denmark)

    Pillai, Jayakrishnan Radhakrishna; Thøgersen, Paul; Møller, Jan

    2012-01-01

    Electric Vehicles (EVs) are considered as one of the important components of the future intelligent grids. Their role as energy storages in the electricity grid could provide local sustainable solutions to support more renewable energy. In order to estimate the extent of interaction of EVs...... in the electricity grid operation, a careful examination in the local electricity system is essential. This paper investigates the degree of EV penetration and its key influence on the low voltage distribution grids. Three detailed models of residential grids in Denmark are considered as test cases in this study...... it is shown that there is enough head-space on the transformer capacity which can be used to charge many EVs during a day. The overall transformer capability of handling EV loads varies between 6-40% for peak and minimum demand hours, which is dependent on the robustness of the grids. The voltage drops...

  5. Cask system design guidance for robotic handling

    International Nuclear Information System (INIS)

    Griesmeyer, J.M.; Drotning, W.D.; Morimoto, A.K.; Bennett, P.C.

    1990-10-01

    Remote automated cask handling has the potential to reduce both the occupational exposure and the time required to process a nuclear waste transport cask at a handling facility. The ongoing Advanced Handling Technologies Project (AHTP) at Sandia National Laboratories is described. AHTP was initiated to explore the use of advanced robotic systems to perform cask handling operations at handling facilities for radioactive waste, and to provide guidance to cask designers regarding the impact of robotic handling on cask design. The proof-of-concept robotic systems developed in AHTP are intended to extrapolate from currently available commercial systems to the systems that will be available by the time that a repository would be open for operation. The project investigates those cask handling operations that would be performed at a nuclear waste repository facility during cask receiving and handling. The ongoing AHTP indicates that design guidance, rather than design specification, is appropriate, since the requirements for robotic handling do not place severe restrictions on cask design but rather focus on attention to detail and design for limited dexterity. The cask system design features that facilitate robotic handling operations are discussed, and results obtained from AHTP design and operation experience are summarized. The application of these design considerations is illustrated by discussion of the robot systems and their operation on cask feature mock-ups used in the AHTP project. 11 refs., 11 figs

  6. Artificial intelligence techniques for voltage control

    Energy Technology Data Exchange (ETDEWEB)

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  7. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

    OpenAIRE

    Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.

    2015-01-01

    The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...

  8. Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

    Directory of Open Access Journals (Sweden)

    Bulyga Leonid L.

    2015-01-01

    Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.

  9. Hot Laboratories and Remote Handling

    International Nuclear Information System (INIS)

    Bart, G.; Blanc, J.Y.; Duwe, R.

    2003-01-01

    The European Working Group on ' Hot Laboratories and Remote Handling' is firmly established as the major contact forum for the nuclear R and D facilities at the European scale. The yearly plenary meetings intend to: - Exchange experience on analytical methods, their implementation in hot cells, the methodologies used and their application in nuclear research; - Share experience on common infrastructure exploitation matters such as remote handling techniques, safety features, QA-certification, waste handling; - Promote normalization and co-operation, e.g., by looking at mutual complementarities; - Prospect present and future demands from the nuclear industry and to draw strategic conclusions regarding further needs. The 41. plenary meeting was held in CEA Saclay from September 22 to 24, 2003 in the premises and with the technical support of the INSTN (National Institute for Nuclear Science and Technology). The Nuclear Energy Division of CEA sponsored it. The Saclay meeting was divided in three topical oral sessions covering: - Post irradiation examination: new analysis methods and methodologies, small specimen technology, programmes and results; - Hot laboratory infrastructure: decommissioning, refurbishment, waste, safety, nuclear transports; - Prospective research on materials for future applications: innovative fuels (Generation IV, HTR, transmutation, ADS), spallation source materials, and candidate materials for fusion reactor. A poster session was opened to transport companies and laboratory suppliers. The meeting addressed in three sessions the following items: Session 1 - Post Irradiation Examinations. Out of 12 papers (including 1 poster) 7 dealt with surface and solid state micro analysis, another one with an equally complex wet chemical instrumental analytical technique, while the other four papers (including the poster) presented new concepts for digital x-ray image analysis; Session 2 - Hot laboratory infrastructure (including waste theme) which was

  10. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    International Nuclear Information System (INIS)

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  11. A 350 KV nanosecond pulse voltage generator with adjustable pulsed-width

    International Nuclear Information System (INIS)

    Wang, X.; Wang, M.; Chen, Y.Q.; Zeng, L.G.; Han, M.

    2002-01-01

    This paper presents a 350 kV nanosecond pulse voltage generator (NPVG). The voltage pulsed-width can be adjusted from 30 to 160 ns. The generator consists of: Marx generator, pulsed forming line (PFL), main switch and matched impedance. The output voltage of Marx generator is over than nU c (n- the stage number of Marx generator, U c -the charging voltage of capacitor). When the pulse forming line is terminated with an impedance that is over than the characteristic impedance of PFL, the higher voltage pulse was provided for the load

  12. Development of commercial robots for radwaste handling

    International Nuclear Information System (INIS)

    Colborn, K.A.

    1988-01-01

    The cost and dose burden associated with low level radwaste handling activities is a matter of increasing concern to the commercial nuclear power industry. This concern is evidenced by the fact that many utilities have begun to revaluate waste generation, handling, and disposal activities at their plants in an effort to improve their overall radwaste handling operations. This paper reports on the project Robots for Radwaste Handling, to identify the potential of robots to improve radwaste handling operations. The project has focussed on the potential of remote or automated technology to improve well defined, recognizable radwaste operations. The project focussed on repetitive, low skill level radwaste handling and decontamination tasks which involve significant radiation exposure

  13. Fluorescent Protein Voltage Probes Derived from ArcLight that Respond to Membrane Voltage Changes with Fast Kinetics

    Science.gov (United States)

    Han, Zhou; Jin, Lei; Platisa, Jelena; Cohen, Lawrence B.; Baker, Bradley J.; Pieribone, Vincent A.

    2013-01-01

    We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms) are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ) less than 6ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9%) is not as large as the Ciona-based ArcLight (~35%), they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals. PMID:24312287

  14. Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics.

    Directory of Open Access Journals (Sweden)

    Zhou Han

    Full Text Available We previously reported the discovery of a fluorescent protein voltage probe, ArcLight, and its derivatives that exhibit large changes in fluorescence intensity in response to changes of plasma membrane voltage. ArcLight allows the reliable detection of single action potentials and sub-threshold activities in individual neurons and dendrites. The response kinetics of ArcLight (τ1-on ~10 ms, τ2-on ~ 50 ms are comparable with most published genetically-encoded voltage probes. However, probes using voltage-sensing domains other than that from the Ciona intestinalis voltage sensitive phosphatase exhibit faster kinetics. Here we report new versions of ArcLight, in which the Ciona voltage-sensing domain was replaced with those from chicken, zebrafish, frog, mouse or human. We found that the chicken and zebrafish-based ArcLight exhibit faster kinetics, with a time constant (τ less than 6 ms for a 100 mV depolarization. Although the response amplitude of these two probes (8-9% is not as large as the Ciona-based ArcLight (~35%, they are better at reporting action potentials from cultured neurons at higher frequency. In contrast, probes based on frog, mouse and human voltage sensing domains were either slower than the Ciona-based ArcLight or had very small signals.

  15. Sequence trajectory generation for garment handling systems

    OpenAIRE

    Liu, Honghai; Lin, Hua

    2008-01-01

    This paper presents a novel generic approach to the planning strategy of garment handling systems. An assumption is proposed to separate the components of such systems into a component for intelligent gripper techniques and a component for handling planning strategies. Researchers can concentrate on one of the two components first, then merge the two problems together. An algorithm is addressed to generate the trajectory position and a clothes handling sequence of clothes partitions, which ar...

  16. Enclosure for handling high activity materials

    International Nuclear Information System (INIS)

    Jimeno de Osso, F.

    1977-01-01

    One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With this purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. In this report a description is given of those aspects that may be of interest to people working in this field. (Author)

  17. Enclosure for handling high activity materials abstract

    International Nuclear Information System (INIS)

    Jimeno de Osso, F.; Dominguez Rodriguez, G.; Cruz Castillo, F. de la; Rodriguez Esteban, A.

    1977-01-01

    One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With that purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. A description is given of those aspects that may be of interest to people working in this field. (author) [es

  18. Scheduling of outbound luggage handling at airports

    DEFF Research Database (Denmark)

    Barth, Torben C.; Pisinger, David

    2012-01-01

    This article considers the outbound luggage handling problem at airports. The problem is to assign handling facilities to outbound flights and decide about the handling start time. This dynamic, near real-time assignment problem is part of the daily airport operations. Quality, efficiency......). Another solution method is a decomposition approach. The problem is divided into different subproblems and solved in iterative steps. The different solution approaches are tested on real world data from Frankfurt Airport....

  19. ATA diagnostic data handling system: an overview

    International Nuclear Information System (INIS)

    Chambers, F.W.; Kallman, J.; McDonald, J.; Slominski, M.

    1984-01-01

    The functions to be performed by the ATA diagnostic data handling system are discussed. The capabilities of the present data acquisition system (System 0) are presented. The goals for the next generation acquisition system (System 1), currently under design, are discussed. Facilities on the Octopus system for data handling are reviewed. Finally, we discuss what has been learned about diagnostics and computer based data handling during the past year

  20. Enclosure for handling high activity materials

    Energy Technology Data Exchange (ETDEWEB)

    Jimeno de Osso, F

    1977-07-01

    One of the most important problems that are met at the laboratories producing and handling radioisotopes is that of designing, building and operating enclosures suitable for the safe handling of active substances. With this purpose in mind, an enclosure has been designed and built for handling moderately high activities under a shielding made of 150 mm thick lead. In this report a description is given of those aspects that may be of interest to people working in this field. (Author)

  1. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    OpenAIRE

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  2. Cavity Voltage Phase Modulation MD

    CERN Document Server

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  3. Optimum voltage of auxiliary systems for thermal and nuclear power plants

    International Nuclear Information System (INIS)

    Tokumitsu, Iwao; Segawa, Motomichi

    1979-01-01

    In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)

  4. Novel Interleaved Converter with Extra-High Voltage Gain to Process Low-Voltage Renewable-Energy Generation

    Directory of Open Access Journals (Sweden)

    Chih-Lung Shen

    2016-10-01

    Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.

  5. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    DEFF Research Database (Denmark)

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  6. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  7. Hot Laboratories and Remote Handling

    International Nuclear Information System (INIS)

    2007-01-01

    The Opening talk of the workshop 'Hot Laboratories and Remote Handling' was given by Marin Ciocanescu with the communication 'Overview of R and D Program in Romanian Institute for Nuclear Research'. The works of the meeting were structured into three sections addressing the following items: Session 1. Hot cell facilities: Infrastructure, Refurbishment, Decommissioning; Session 2. Waste, transport, safety and remote handling issues; Session 3. Post-Irradiation examination techniques. In the frame of Section 1 the communication 'Overview of hot cell facilities in South Africa' by Wouter Klopper, Willie van Greunen et al, was presented. In the framework of the second session there were given the following four communications: 'The irradiated elements cell at PHENIX' by Laurent Breton et al., 'Development of remote equipment for DUPIC fuel fabrication at KAERI', by Jung Won Lee et al., 'Aspects of working with manipulators and small samples in an αβγ-box, by Robert Zubler et al., and 'The GIOCONDA experience of the Joint Research Centre Ispra: analysis of the experimental assemblies finalized to their safe recovery and dismantling', by Roberto Covini. Finally, in the framework of the third section the following five communications were presented: 'PIE of a CANDU fuel element irradiated for a load following test in the INR TRIGA reactor' by Marcel Parvan et al., 'Adaptation of the pole figure measurement to the irradiated items from zirconium alloys' by Yury Goncharenko et al., 'Fuel rod profilometry with a laser scan micrometer' by Daniel Kuster et al., 'Raman spectroscopy, a new facility at LECI laboratory to investigate neutron damage in irradiated materials' by Lionel Gosmain et al., and 'Analysis of complex nuclear materials with the PSI shielded analytical instruments' by Didier Gavillet. In addition, eleven more presentations were given as posters. Their titles were: 'Presentation of CETAMA activities (CEA analytic group)' by Alain Hanssens et al. 'Analysis of

  8. Fuel handling problems at KANUPP

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, I; Mazhar Hasan, S; Mugtadir, A [Karachi Nuclear Power Plant (KANUPP), Karachi (Pakistan)

    1991-04-01

    KANUPP experienced two abnormal fuel and fuel handling related problems during the year 1990. One of these had arisen due to development of end plate to end plate coupling between the two bundles at the leading end of the fuel string in channel HO2-S. The incident occurred when attempts were being made to fuel this channel. Due to pulling of sticking bundles into the acceptor fuelling machine (north) magazine, which was not designed to accommodate two bundles, a magazine rotary stop occurred. The forward motion of the charge tube was simultaneously discovered to be restricted. The incident led to stalling of fuelling machine locked on to the channel HO2, necessitating a reactor shut down. Removal of the fuelling machine was accomplished sometime later after draining of the channel. The second incident which made the fuelling of channel KO5-N temporarily inexecutable, occurred during attempts to remove its north end shield plug when this channel came up for fuelling. The incident resulted due to breaking of the lugs of the shield plug, making its withdrawal impossible. The Plant however kept operating with suspended fuelling of channel KO5, until it could no longer sustain a further increase in fuel burnup at the maximum rating position. Resolving both these problems necessitated draining of the respective channels, leaving the resident fuel uncovered for the duration of the associated operation. Due to substantial difference in the oxidation temperatures Of UO{sub 2} and Zircaloy and its influence as such on the cooling requirement, it was necessary either to determine explicitly that the respective channels did not contain defective fuel bundles or wait for time long enough to allow the decay heat to reduce to manageable proportions. This had a significant bearing on the Plant down time necessary for the rectification of the problems. This paper describes the two incidents in detail and dwells upon the measures adopted to resolve the related problems. (author)

  9. Fuel handling problems at KANUPP

    International Nuclear Information System (INIS)

    Ahmed, I.; Mazhar Hasan, S.; Mugtadir, A.

    1991-01-01

    KANUPP experienced two abnormal fuel and fuel handling related problems during the year 1990. One of these had arisen due to development of end plate to end plate coupling between the two bundles at the leading end of the fuel string in channel HO2-S. The incident occurred when attempts were being made to fuel this channel. Due to pulling of sticking bundles into the acceptor fuelling machine (north) magazine, which was not designed to accommodate two bundles, a magazine rotary stop occurred. The forward motion of the charge tube was simultaneously discovered to be restricted. The incident led to stalling of fuelling machine locked on to the channel HO2, necessitating a reactor shut down. Removal of the fuelling machine was accomplished sometime later after draining of the channel. The second incident which made the fuelling of channel KO5-N temporarily inexecutable, occurred during attempts to remove its north end shield plug when this channel came up for fuelling. The incident resulted due to breaking of the lugs of the shield plug, making its withdrawal impossible. The Plant however kept operating with suspended fuelling of channel KO5, until it could no longer sustain a further increase in fuel burnup at the maximum rating position. Resolving both these problems necessitated draining of the respective channels, leaving the resident fuel uncovered for the duration of the associated operation. Due to substantial difference in the oxidation temperatures Of UO 2 and Zircaloy and its influence as such on the cooling requirement, it was necessary either to determine explicitly that the respective channels did not contain defective fuel bundles or wait for time long enough to allow the decay heat to reduce to manageable proportions. This had a significant bearing on the Plant down time necessary for the rectification of the problems. This paper describes the two incidents in detail and dwells upon the measures adopted to resolve the related problems. (author)

  10. Resilient architecture design for voltage variation

    CERN Document Server

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  11. Thermometry in dielectrophoresis chips for contact-free cell handling

    International Nuclear Information System (INIS)

    Jaeger, M S; Mueller, T; Schnelle, T

    2007-01-01

    Cell biology applications, protocols in immunology and stem cell research, require that individual cells are handled under strict control of their contacts to other cells or synthetic surfaces. Dielectrophoresis (DEP) in microfluidic chips is an established technique to investigate, group, wash, cultivate and sort cells contact-free under physiological conditions: microelectrode octode cages, versatile dielectrophoretic elements energized with radio frequency electric fields, stably trap single cells or cellular aggregates. For medical applications and cell cultivation, possible side effects of the dielectrophoretic manipulation, such as membrane polarization and Joule heating, have to be quantified. Therefore, we characterized the electric field-induced warming in dielectrophoretic cages using ohmic resistance measurements, fluorometry, liquid crystal beads, infra-red thermography and bubble size thermometry. We compare the results of these techniques with respect to the influences of voltage, electric conductivity of buffer, frequency, cage size and electrode surface. We conclude that in the culture medium thermal effects may be neglected if low voltages and an electric field-reducing phase pattern are used. Our experimental results provide explicit values for estimating the thermal effect on dielectrophoretically caged cells and show that Joule heating is best minimized by optimizing the cage geometry and reducing the buffer conductivity. The results may additionally serve to evaluate and improve theoretical predictions on field-induced effects. Based on present-day chip processing possibilities, DEP is well suited for the manipulation of cells

  12. 9 CFR 3.118 - Handling.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling. 3.118 Section 3.118 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL WELFARE STANDARDS Specifications for the Humane Handling, Care, Treatment, and Transportation of Marine...

  13. How to Handle Impasses in Bargaining.

    Science.gov (United States)

    Durrant, Robert E.

    Guidelines in an outline format are presented to school board members and administrators on how to handle impasses in bargaining. The following two rules are given: there sometimes may be strikes, but there always will be settlements; and on the way to settlements, there always will be impasses. Suggestions for handling impasses are listed under…

  14. Handling uncertainty through adaptiveness in planning approaches

    NARCIS (Netherlands)

    Zandvoort, M.; Vlist, van der M.J.; Brink, van den A.

    2018-01-01

    Planners and water managers seek to be adaptive to handle uncertainty through the use of planning approaches. In this paper, we study what type of adaptiveness is proposed and how this may be operationalized in planning approaches to adequately handle different uncertainties. We took a

  15. Survey of postharvest handling, preservation and processing ...

    African Journals Online (AJOL)

    Survey of postharvest handling, preservation and processing practices along the camel milk chain in Isiolo district, Kenya. ... Despite the important contribution of camel milk to food security for pastoralists in Kenya, little is known about the postharvest handling, preservation and processing practices. In this study, existing ...

  16. PND fuel handling decontamination: facilities and techniques

    International Nuclear Information System (INIS)

    Pan, R.Y.

    1996-01-01

    The use of various decontamination techniques and equipment has become a critical part of Fuel Handling maintenance work at Ontario Hydro's Pickering Nuclear Division. This paper presents an overview of the set up and techniques used for decontamination in the PND Fuel Handling Maintenance Facility and the effectiveness of each. (author). 1 tab., 9 figs

  17. Handling Kids in Crisis with Care

    Science.gov (United States)

    Bushinski, Cari

    2018-01-01

    The Handle with Care program helps schools help students who experience trauma. While at the scene of an event like a domestic violence call, drug raid, or car accident, law enforcement personnel determine the names and school of any children present. They notify that child's school to "handle ___ with care" the next day, and the school…

  18. PND fuel handling decontamination: facilities and techniques

    Energy Technology Data Exchange (ETDEWEB)

    Pan, R Y [Ontario Hydro, Toronto, ON (Canada)

    1997-12-31

    The use of various decontamination techniques and equipment has become a critical part of Fuel Handling maintenance work at Ontario Hydro`s Pickering Nuclear Division. This paper presents an overview of the set up and techniques used for decontamination in the PND Fuel Handling Maintenance Facility and the effectiveness of each. (author). 1 tab., 9 figs.

  19. Handling knowledge on osteoporosis - a qualitative study

    DEFF Research Database (Denmark)

    Nielsen, Dorthe; Huniche, Lotte; Brixen, Kim

    2013-01-01

    Scand J Caring Sci; 2012 Handling knowledge on osteoporosis - a qualitative study The aim of this qualitative study was to increase understanding of the importance of osteoporosis information and knowledge for patients' ways of handling osteoporosis in their everyday lives. Interviews were...

  20. Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160

    Science.gov (United States)

    Meier, F.

    2012-05-01

    Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.

  1. DDOS ATTACK DETECTION SIMULATION AND HANDLING MECHANISM

    Directory of Open Access Journals (Sweden)

    Ahmad Sanmorino

    2013-11-01

    Full Text Available In this study we discuss how to handle DDoS attack that coming from the attacker by using detection method and handling mechanism. Detection perform by comparing number of packets and number of flow. Whereas handling mechanism perform by limiting or drop the packets that detected as a DDoS attack. The study begins with simulation on real network, which aims to get the real traffic data. Then, dump traffic data obtained from the simulation used for detection method on our prototype system called DASHM (DDoS Attack Simulation and Handling Mechanism. From the result of experiment that has been conducted, the proposed method successfully detect DDoS attack and handle the incoming packet sent by attacker.

  2. MRI of meniscal bucket-handle tears

    Energy Technology Data Exchange (ETDEWEB)

    Magee, T.H.; Hinson, G.W. [Menorah Medical Center, Overland Park, KS (United States). Dept. of Radiology

    1998-09-01

    A meniscal bucket-handle tear is a tear with an attached fragment displaced from the meniscus of the knee joint. Low sensitivity of MRI for detection of bucket-handle tears (64% as compared with arthroscopy) has been reported previously. We report increased sensitivity for detecting bucket-handle tears with the use of coronal short tau inversion recovery (STIR) images. Results. By using four criteria for diagnosis of meniscal bucket-handle tears, our overall sensitivity compared with arthroscopy was 93% (28 of 30 meniscal bucket-handle tears seen at arthroscopy were detected by MRI). The meniscal fragment was well visualized in all 28 cases on coronal STIR images. The double posterior cruciate ligament sign was seen in 8 of 30 cases, the flipped meniscus was seen in 10 of 30 cases and a fragment in the intercondylar notch was seen in 18 of 30 cases. (orig.)

  3. Adaptive and energy efficient SMA-based handling systems

    Science.gov (United States)

    Motzki, P.; Kunze, J.; Holz, B.; York, A.; Seelecke, S.

    2015-04-01

    Shape Memory Alloys (SMA's) are known as actuators with very high energy density. This fact allows for the construction of very light weight and energy-efficient systems. In the field of material handling and automated assembly process, the avoidance of big moments of inertia in robots and kinematic units is essential. High inertial forces require bigger and stronger robot actuators and thus higher energy consumption and costs. For material handling in assembly processes, many different individual grippers for various work piece geometries are used. If one robot has to handle different work pieces, the gripper has to be exchanged and the assembly process is interrupted, which results in higher costs. In this paper, the advantages of using high energy density Shape Memory Alloy actuators in applications of material-handling and gripping-technology are explored. In particular, light-weight SMA actuated prototypes of an adaptive end-effector and a vacuum-gripper are constructed via rapid-prototyping and evaluated. The adaptive end-effector can change its configuration according to the work piece geometry and allows the handling of multiple different shaped objects without exchanging gripper tooling. SMA wires are used to move four independent arms, each arm adds one degree of freedom to the kinematic unit. At the tips of these end-effector arms, SMA-activated suction cups can be installed. The suction cup prototypes are developed separately. The flexible membranes of these suction cups are pulled up by SMA wires and thus a vacuum is created between the membrane and the work piece surface. The self-sensing ability of the SMA wires are used in both prototypes for monitoring their actuation.

  4. Voltage Weak DC Distribution Grids

    NARCIS (Netherlands)

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  5. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  6. High voltage power network construction

    CERN Document Server

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  7. Voltage control of ferromagnetic resonance

    Directory of Open Access Journals (Sweden)

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  8. High voltage MOSFET switching circuit

    Science.gov (United States)

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  9. Higher Education

    African Journals Online (AJOL)

    Kunle Amuwo: Higher Education Transformation: A Paradigm Shilt in South Africa? ... ty of such skills, especially at the middle management levels within the higher ... istics and virtues of differentiation and diversity. .... may be forced to close shop for lack of capacity to attract ..... necessarily lead to racial and gender equity,.

  10. Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages

    Energy Technology Data Exchange (ETDEWEB)

    An, Seok Chan; Kim, Jin Sub [Yonsei University, Seoul (Korea, Republic of); Chu, Yong [National Fusion Research Institute(NFRI), Daejeon (Korea, Republic of)

    2016-03-15

    Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals.

  11. Study on quench detection of the KSTAR CS coil with CDA+MIK compensation of inductive voltages

    International Nuclear Information System (INIS)

    An, Seok Chan; Kim, Jin Sub; Chu, Yong

    2016-01-01

    Quench Detection System (QDS) is essential to guarantee the stable operation of the Korea Superconducting Tokamak Advanced Research (KSTAR) Poloidal Field (PF) magnet system because the stored energy in the magnet system is very large. For the fast response, voltage-based QDS has been used. Co-wound voltage sensors and balanced bridge circuits were applied to eliminate the inductive voltages generated during the plasma operation. However, as the inductive voltages are hundreds times higher than the quench detection voltage during the pulse-current operation, Central Difference Averaging (CDA) and MIK, where I and K stand for mutual coupling indexes of different circuits, which is an active cancellation of mutually generated voltages have been suggested and studied. In this paper, the CDA and MIK technique were applied to the KSTAR magnet for PF magnet quench detection. The calculated inductive voltages from the MIK and measured voltages from the CDA circuits were compared to eliminate the inductive voltages at result signals

  12. Low QRS Voltage on Presenting Electrocardiogram Predicts Multi-vessel Disease in Anterior ST-segment Elevation Myocardial Infarction.

    Science.gov (United States)

    Kobayashi, Akihiro; Misumida, Naoki; Aoi, Shunsuke; Kanei, Yumiko

    Low QRS voltage was reported to predict adverse outcomes in acute myocardial infarction in the pre-thrombolytic era. However, the association between low voltage and angiographic findings has not been fully addressed. We performed a retrospective analysis of patients with anterior ST-segment elevation myocardial infarction (STEMI). Low QRS voltage was defined as either peak to peak QRS complex voltage voltage. Patients with low voltage had a higher rate of multi-vessel disease (MVD) (76% vs. 52%, p=0.01). Patients with low voltage were more likely to undergo coronary artery bypass grafting (CABG) during admission (11% vs. 2%, p=0.028). Low voltage was an independent predictor for MVD (OR 2.50; 95% CI 1.12 to 6.03; p=0.032). Low QRS voltage was associated with MVD and in-hospital CABG in anterior STEMI. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Handling Procedures of Vegetable Crops

    Science.gov (United States)

    Perchonok, Michele; French, Stephen J.

    2004-01-01

    The National Aeronautics and Space Administration (NASA) is working towards future long duration manned space flights beyond low earth orbit. The duration of these missions may be as long as 2.5 years and will likely include a stay on a lunar or planetary surface. The primary goal of the Advanced Food System in these long duration exploratory missions is to provide the crew with a palatable, nutritious, and safe food system while minimizing volume, mass, and waste. Vegetable crops can provide the crew with added nutrition and variety. These crops do not require any cooking or food processing prior to consumption. The vegetable crops, unlike prepackaged foods, will provide bright colors, textures (crispy), and fresh aromas. Ten vegetable crops have been identified for possible use in long duration missions. They are lettuce, spinach, carrot, tomato, green onion, radish, bell pepper, strawberries, fresh herbs, and cabbage. Whether these crops are grown on a transit vehicle (e.g., International Space Station) or on the lunar or planetary surface, it will be necessary to determine how to safely handle the vegetables while maintaining acceptability. Since hydrogen peroxide degrades into water and oxygen and is generally recognized as safe (GRAS), hydrogen peroxide has been recommended as the sanitizer. The objective of th is research is to determine the required effective concentration of hydrogen peroxide. In addition, it will be determined whether the use of hydrogen peroxide, although a viable sanitizer, adversely affects the quality of the vegetables. Vegetables will be dipped in 1 % hydrogen peroxide, 3% hydrogen peroxide, or 5% hydrogen peroxide. Treated produce and controls will be stored in plastic bags at 5 C for up to 14 days. Sensory, color, texture, and total plate count will be measured. The effect on several vegetables including lettuce, radish, tomato and strawberries has been completed. Although each vegetable reacts to hydrogen peroxide differently, the

  14. The handling of radiation accidents

    International Nuclear Information System (INIS)

    1977-01-01

    The symposium was attended by 204 participants from 39 countries and 5 international organizations. Forty-two papers were presented in 8 sessions. The purpose of the meeting was to foster an exchange of experiences gained in establishing and exercising plans for mitigating the effects of radiation accidents and in the handling of actual accident situations. Only a small number of accidents were reported at the symposium, and this reflects the very high standards of safety that has been achieved by the nuclear industry. No accidents of radiological significance were reported to have occurred at commercial nuclear power plants. Of the accidents reported, industrial radiography continues to be the area in which most of the radiation accidents occur. The experience gained in the reported accident situations served to confirm the crucial importance of the prompt availability of medical and radiological services, particularly in the case of uptake of radioactive material, and emphasized the importance of detailed investigation into the causes of the accident in order to improve preventative measures. One of the principal themes of the symposium involved emergency procedures related to nuclear power plant accidents, and several papers defining the scope, progression and consequences of design base accidents for both thermal and fast reactor systems were presented. These were complemented by papers defining the resultant protection requirements that should be satisfied in the establishment of plans designed to mitigate the effects of the postulated accident situations. Several papers were presented describing existing emergency organizational arrangements relating both to specific nuclear power plants and to comprehensive national schemes, and a particularly informative session was devoted to the topic of training of personnel in the practical conduct of emergency arrangements. The general feeling of the participants was one of studied confidence in the competence and

  15. Voltage linear transformation circuit design

    Science.gov (United States)

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  16. AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-12-01

    Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

  17. Short-Term State Forecasting-Based Optimal Voltage Regulation in Distribution Systems: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Rui; Jiang, Huaiguang; Zhang, Yingchen

    2017-05-17

    A novel short-term state forecasting-based optimal power flow (OPF) approach for distribution system voltage regulation is proposed in this paper. An extreme learning machine (ELM) based state forecaster is developed to accurately predict system states (voltage magnitudes and angles) in the near future. Based on the forecast system states, a dynamically weighted three-phase AC OPF problem is formulated to minimize the voltage violations with higher penalization on buses which are forecast to have higher voltage violations in the near future. By solving the proposed OPF problem, the controllable resources in the system are optimally coordinated to alleviate the potential severe voltage violations and improve the overall voltage profile. The proposed approach has been tested in a 12-bus distribution system and simulation results are presented to demonstrate the performance of the proposed approach.

  18. Fuel handling machine and auxiliary systems for a fuel handling cell

    International Nuclear Information System (INIS)

    Suikki, M.

    2013-10-01

    This working report is an update for as well as a supplement to an earlier fuel handling machine design (Kukkola and Roennqvist 2006). A focus in the earlier design proposal was primarily on the selection of a mechanical structure and operating principle for the fuel handling machine. This report introduces not only a fuel handling machine design but also auxiliary fuel handling cell equipment and its operation. An objective of the design work was to verify the operating principles of and space allocations for fuel handling cell equipment. The fuel handling machine is a remote controlled apparatus capable of handling intensely radiating fuel assemblies in the fuel handling cell of an encapsulation plant. The fuel handling cell is air tight space radiation-shielded with massive concrete walls. The fuel handling machine is based on a bridge crane capable of traveling in the handling cell along wall tracks. The bridge crane has its carriage provided with a carousel type turntable having mounted thereon both fixed and telescopic masts. The fixed mast has a gripper movable on linear guides for the transfer of fuel assemblies. The telescopic mast has a manipulator arm capable of maneuvering equipment present in the fuel handling cell, as well as conducting necessary maintenance and cleaning operations or rectifying possible fault conditions. The auxiliary fuel handling cell systems consist of several subsystems. The subsystems include a service manipulator, a tool carrier for manipulators, a material hatch, assisting winches, a vacuum cleaner, as well as a hose reel. With the exception of the vacuum cleaner, the devices included in the fuel handling cell's auxiliary system are only used when the actual encapsulation process is not ongoing. The malfunctions of mechanisms or actuators responsible for the motion actions of a fuel handling machine preclude in a worst case scenario the bringing of the fuel handling cell and related systems to a condition appropriate for

  19. Fuel handling machine and auxiliary systems for a fuel handling cell

    Energy Technology Data Exchange (ETDEWEB)

    Suikki, M. [Optimik Oy, Turku (Finland)

    2013-10-15

    This working report is an update for as well as a supplement to an earlier fuel handling machine design (Kukkola and Roennqvist 2006). A focus in the earlier design proposal was primarily on the selection of a mechanical structure and operating principle for the fuel handling machine. This report introduces not only a fuel handling machine design but also auxiliary fuel handling cell equipment and its operation. An objective of the design work was to verify the operating principles of and space allocations for fuel handling cell equipment. The fuel handling machine is a remote controlled apparatus capable of handling intensely radiating fuel assemblies in the fuel handling cell of an encapsulation plant. The fuel handling cell is air tight space radiation-shielded with massive concrete walls. The fuel handling machine is based on a bridge crane capable of traveling in the handling cell along wall tracks. The bridge crane has its carriage provided with a carousel type turntable having mounted thereon both fixed and telescopic masts. The fixed mast has a gripper movable on linear guides for the transfer of fuel assemblies. The telescopic mast has a manipulator arm capable of maneuvering equipment present in the fuel handling cell, as well as conducting necessary maintenance and cleaning operations or rectifying possible fault conditions. The auxiliary fuel handling cell systems consist of several subsystems. The subsystems include a service manipulator, a tool carrier for manipulators, a material hatch, assisting winches, a vacuum cleaner, as well as a hose reel. With the exception of the vacuum cleaner, the devices included in the fuel handling cell's auxiliary system are only used when the actual encapsulation process is not ongoing. The malfunctions of mechanisms or actuators responsible for the motion actions of a fuel handling machine preclude in a worst case scenario the bringing of the fuel handling cell and related systems to a condition appropriate for

  20. Higher Education

    Science.gov (United States)

    & Development (LDRD) National Security Education Center (NSEC) Office of Science Programs Richard P Databases National Security Education Center (NSEC) Center for Nonlinear Studies Engineering Institute Scholarships STEM Education Programs Teachers (K-12) Students (K-12) Higher Education Regional Education

  1. Handling of multiassembly sealed baskets between reactor storage and a remote handling facility

    International Nuclear Information System (INIS)

    Massey, J.V.; Kessler, J.H.; McSherry, A.J.

    1989-06-01

    The storage of multiple fuel assemblies in sealed (welded) dry storage baskets is gaining increasing use to augment at-reactor fuel storage capacity. Since this increasing use will place a significant number of such baskets on reactor sites, some initial downstream planning for their future handling scenarios for retrieving multi-assembly sealed baskets (MSBs) from onsite storage and transferring and shipping the fuel (and/or the baskets) to a federally operated remote handling facility (RHF). Numerous options or at-reactor and away-from-reactor handling were investigated. Materials handling flowsheets were developed along with conceptual designs for the equipment and tools required to handle and open the MSBs. The handling options were evaluated and compared to a reference case, fuel handling sequence (i.e., fuel assemblies are taken from the fuel pool, shipped to a receiving and handling facility and placed into interim storage). The main parameters analyzed are throughout, radiation dose burden and cost. In addition to evaluating the handling of MSBs, this work also evaluated handling consolidated fuel canisters (CFCs). In summary, the handling of MSBs and CFCs in the store, ship and bury fuel cycle was found to be feasible and, under some conditions, to offer significant benefits in terms of throughput, cost and safety. 14 refs., 20 figs., 24 tabs

  2. Safeguards information handling and treatment

    International Nuclear Information System (INIS)

    Carchon, R.; Liu, J.; Ruan, D.

    2001-01-01

    Many states are currently discussing the new additional protocol (INFCIRC/540). This expanded framework is expected to establish the additional confirmation that there are no undeclared activities and facilities in that state. The information collected by the IAEA mainly comes from three different sources: information either provided by the state, collected by the IAEA, and from open sources. This information can be uncertain, incomplete, imprecise, not fully reliable, contradictory, etc. Hence, there is a need for a mathematical framework that provides a basis for handling and treatment of multidimensional information of varying quality. We use a linguistic assessment based on fuzzy set theory, as a flexible and realistic approach. The concept of a linguistic variable serves the purpose of providing a means of approximated characterization of information that may be imprecise, too complex or ill-defined, for which the traditional quantitative approach does not give an adequate answer. In the application of this linguistic assessment approach, a problem arises on how to aggregate linguistic information. Two different approaches can be followed: (1) approximation approach using the associated membership function; (2) symbolic approach acting by the direct computation on labels, where the use of membership function and the linguistic approximation is unnecessary, which makes computation simple and quick. To manipulate the linguistic information in this context, we work with aggregation operators for combining the linguistic non-weighted and weighted values by direct computation on labels, like the Min-type and Max-type weighted aggregation operators as well as the median aggregation operator. A case study on the application of these aggregation operators to the fusion of safeguards relevant information is given. The IAEA Physical Model of the nuclear fuel cycle can be taken as a systematic and comprehensive indicator system. It identifies and describes indicators of

  3. Ergonomics: safe patient handling and mobility.

    Science.gov (United States)

    Hallmark, Beth; Mechan, Patricia; Shores, Lynne

    2015-03-01

    This article reviews and investigates the issues surrounding ergonomics, with a specific focus on safe patient handling and mobility. The health care worker of today faces many challenges, one of which is related to the safety of patients. Safe patient handling and mobility is on the forefront of the movement to improve patient safety. This article reviews the risks associated with patient handling and mobility, and informs the reader of current evidence-based practice relevant to this area of care. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. How the NWC handles software as product

    Energy Technology Data Exchange (ETDEWEB)

    Vinson, D.

    1997-11-01

    This tutorial provides a hands-on view of how the Nuclear Weapons Complex project should be handling (or planning to handle) software as a product in response to Engineering Procedure 401099. The SQAS has published the document SQAS96-002, Guidelines for NWC Processes for Handling Software Product, that will be the basis for the tutorial. The primary scope of the tutorial is on software products that result from weapons and weapons-related projects, although the information presented is applicable to many software projects. Processes that involve the exchange, review, or evaluation of software product between or among NWC sites, DOE, and external customers will be described.

  5. Handling of bulk solids theory and practice

    CERN Document Server

    Shamlou, P A

    1990-01-01

    Handling of Bulk Solids provides a comprehensive discussion of the field of solids flow and handling in the process industries. Presentation of the subject follows classical lines of separate discussions for each topic, so each chapter is self-contained and can be read on its own. Topics discussed include bulk solids flow and handling properties; pressure profiles in bulk solids storage vessels; the design of storage silos for reliable discharge of bulk materials; gravity flow of particulate materials from storage vessels; pneumatic transportation of bulk solids; and the hazards of solid-mater

  6. High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC

    Science.gov (United States)

    Lizcano, M.

    2017-01-01

    High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.

  7. Technical and economic aspects of the transmission of energy at extra high voltages

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1967-01-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. A treatment of the technical and economic problems arising in three phase extra high voltage transmission is presented. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  8. Analyzing randomly occurring voltage breakdowns

    International Nuclear Information System (INIS)

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  9. Advances in high voltage engineering

    CERN Document Server

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  10. High-voltage CMOS detectors

    International Nuclear Information System (INIS)

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  11. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  12. High-voltage CMOS detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  13. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  14. Light-voltage conversion apparatus

    Energy Technology Data Exchange (ETDEWEB)

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  15. Management of transport and handling contracts

    CERN Document Server

    Rühl, I

    2004-01-01

    This paper shall outline the content, application and management strategies for the various contracts related to transport and handling activities. In total, the two sections Logistics and Handling Maintenance are in charge of 27 (!) contracts ranging from small supply contracts to big industrial support contracts. The activities as well as the contracts can generally be divided into four main topics "Vehicle Fleet Management"; "Supply, Installation and Commissioning of Lifting and Hoisting Equipment"; "Equipment Maintenance" and "Industrial Support for Transport and Handling". Each activity and contract requires different approaches and permanent adaptation to the often changing CERN's requirements. In particular, the management and the difficulties experienced with the contracts E072 "Maintenance of lifting and hoisting equipment", F420 "Supply of seven overhead traveling cranes for LHC" and S090/S103 "Industrial support for transport and handling" will be explained in detail.

  16. Travelling cranes for heavy reactor component handling

    International Nuclear Information System (INIS)

    Champeil, M.

    1977-01-01

    Structure and operating machinery of two travelling cranes (600 t and 450 t) used in the Framatome factory for handling heavy reactor components are described. When coupled, these cranes can lift loads up to 1000 t [fr

  17. Remote handling for an ISIS target change

    International Nuclear Information System (INIS)

    Broome, T.A.; Holding, M.

    1989-01-01

    During 1987 two ISIS targets were changed. This document describes the main features of the remote handling aspects of the work. All the work has to be carried out using remote handling techniques. The radiation level measured on the surface of the reflector when the second target had been removed was about 800 mGy/h demonstrating that hands on operations on any part of the target reflector moderator assembly is not practical. The target changes were the first large scale operations in the Target Station Remote Handling Cell and a great deal was learned about both equipment and working practices. Some general principles emerged which are applicable to other active handling tasks on facilities like ISIS and these are discussed below. 8 figs

  18. Aerobot Sampling and Handling System, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Honeybee Robotics proposes to: ?Derive and document the functional and technical requirements for Aerobot surface sampling and sample handling across a range of...

  19. Data handling systems and methods of wiring

    International Nuclear Information System (INIS)

    Grant, J.

    1981-01-01

    An improved data handling system, for monitoring and control of nuclear reactor operations, is described in which time delays associated with scanning are reduced and noise and fault signals in the system are resolved. (U.K.)

  20. Handling of disused radioactive materials in Ecuador

    International Nuclear Information System (INIS)

    Benitez, Manuel

    1999-10-01

    This paper describes the handling of disused radioactive sources. It also shows graphic information of medical and industrial equipment containing radioactive sources. This information was prepared as part of a training course on radioactive wastes. (The author)

  1. Foster parenting, human imprinting and conventional handling ...

    African Journals Online (AJOL)

    p2492989

    Foster parenting, human imprinting and conventional handling affects survival and early .... bird may subsequently direct its sexual attention to those humans on whom it was imprinted (Bubier et al., ..... The mind through chicks' eyes: memory,.

  2. [Development of residual voltage testing equipment].

    Science.gov (United States)

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  3. Higher Education.

    Science.gov (United States)

    Hendrickson, Robert M.

    This chapter reports 1982 cases involving aspects of higher education. Interesting cases noted dealt with the federal government's authority to regulate state employees' retirement and raised the questions of whether Title IX covers employment, whether financial aid makes a college a program under Title IX, and whether sex segregated mortality…

  4. High Voltage GaN Schottky Rectifiers

    Energy Technology Data Exchange (ETDEWEB)

    CAO,X.A.; CHO,H.; CHU,S.N.G.; CHUO,C.-C.; CHYI,J.-I.; DANG,G.T.; HAN,JUNG; LEE,C.-M.; PEARTON,S.J.; REN,F.; WILSON,R.G.; ZHANG,A.P.

    1999-10-25

    Mesa and planar GaN Schottky diode rectifiers with reverse breakdown voltages (V{sub RB}) up to 550V and >2000V, respectively, have been fabricated. The on-state resistance, R{sub ON}, was 6m{Omega}{center_dot} cm{sup 2} and 0.8{Omega}cm{sup 2}, respectively, producing figure-of-merit values for (V{sub RB}){sup 2}/R{sub ON} in the range 5-48 MW{center_dot}cm{sup -2}. At low biases the reverse leakage current was proportional to the size of the rectifying contact perimeter, while at high biases the current was proportional to the area of this contact. These results suggest that at low reverse biases, the leakage is dominated by the surface component, while at higher biases the bulk component dominates. On-state voltages were 3.5V for the 550V diodes and {ge}15 for the 2kV diodes. Reverse recovery times were <0.2{micro}sec for devices switched from a forward current density of {approx}500A{center_dot}cm{sup -2} to a reverse bias of 100V.

  5. 30o inclination in handles of plastic boxes can reduce postural and muscular workload during handling

    Directory of Open Access Journals (Sweden)

    Luciana C. C. B. Silva

    2013-06-01

    Full Text Available BACKGROUND: The handling of materials, which occurs in the industrial sector, is associated with lesions on the lumbar spine and in the upper limbs. Inserting handles in industrial boxes is a way to reduce work-related risks. Although the position and angle of the handles are significant factors in comfort and safety during handling, these factors have rarely been studied objectively. OBJECTIVE: To compare the handling of a commercial box and prototypes with handles and to evaluate the effects on upper limb posture, muscle electrical activity, and perceived acceptability using different grips while handling materials from different heights. METHOD: Thirty-seven healthy volunteers evaluated the handles of prototypes that allowed for changes in position (top and bottom and angle (0°, 15°, and 30°. Wrist, elbow, and shoulder movements were evaluated using electrogoniometry and inclinometry. The muscle electrical activity in the wrist extensors, biceps brachii, and the upper portion of the trapezius was measured using a portable electromyographer. The recorded data on muscle movements and electrical activity were synchronized. Subjective evaluations of acceptability were evaluated using a visual analog scale. RESULTS AND CONCLUSIONS: The prototypes with handles at a 30° angle produced the highest acceptability ratings, more neutral wrist positions, lower levels of electromyographic activity for the upper trapezius, and lower elevation angles for the arms. The different measurement methods were complementary in evaluating the upper limbs during handling.

  6. Regulatory process for material handling equipment

    International Nuclear Information System (INIS)

    Rajendran, S.; Agarwal, Kailash

    2017-01-01

    Atomic Energy (Factories) Rules (AEFR) 1996, Rule 35 states, 'Thorough inspection and load testing of a Crane shall be done by a Competent Person at least once every 12 months'. To adhere to this rule, BARC Safety Council constituted 'Material Handling Equipment Committee (MHEC)' under the aegis of Conventional Fire and Safety Review Committee (CFSRC) to carry out periodical inspection and certification of Material Handling Equipment (MHE), tools and tackles used in BARC Facilities at Trombay, Tarapur and Kalpakkam

  7. Stud bolt handling equipment for reactor vessel

    International Nuclear Information System (INIS)

    Bunyan, T.W.

    1989-01-01

    Reactor vessel stud bolt handling equipment includes means for transferring a stud bolt to a carrier from a parking station, or vice versa. Preferably a number of stud bolts are handled simultaneously. The transfer means may include cross arms rotatable about extendable columns, and the equipment is mounted on a mobile base for movement into and out of position. Each carrier comprises a tubular socket and an expandable sleeve to grip a stud bolt. (author)

  8. Testing of FFTF fuel handling equipment

    International Nuclear Information System (INIS)

    Coleman, D.W.; Grazzini, E.D.; Hill, L.F.

    1977-07-01

    The Fast Flux Test Facility has several manual/computer controlled fuel handling machines which are exposed to severe environments during plant operation but still must operate reliably when called upon for reactor refueling. The test programs for two such machines--the Closed Loop Ex-Vessel Machine and the In-Vessel Handling Machine--are described. The discussion centers on those areas where design corrections or equipment repairs substantiated the benefits of a test program prior to plant operation

  9. Human factors issues in fuel handling

    International Nuclear Information System (INIS)

    Beattie, J.D.; Iwasa-Madge, K.M.; Tucker, D.A.

    1994-01-01

    The staff of the Atomic Energy Control Board wish to further their understanding of human factors issues of potential concern associated with fuel handling in CANDU nuclear power stations. This study contributes to that objective by analysing the role of human performance in the overall fuel handling process at Ontario Hydro's Darlington Nuclear Generating Station, and reporting findings in several areas. A number of issues are identified in the areas of design, operating and maintenance practices, and the organizational and management environment

  10. About brachytherapy for the handling of cancer

    International Nuclear Information System (INIS)

    Campos, Tarcisio P.R.; Silva, Nilton O.; Damaso, Renato S.; Costa, Helder R.; Borges, Paulo H.R.; Mendes, Bruno M.

    2000-01-01

    The technique of brachytherapy is argued in this article. The 'hardware' and 'necessary software' for the handling are summarily presented. Being the macro-dosimetry an important stage in the radiation therapy procedure, a simplified method of doses evaluation in conventional brachytherapy is presented. In an illustrative form, isodoses of a three-dimensional distribution of linear sources are drawn on a digitalized X-ray picture, exemplifying the handling of breast brachytherapy by sources of iridium

  11. Development of standard components for remote handling

    International Nuclear Information System (INIS)

    Taguchi, Kou; Kakudate, Satoshi; Nakahira, Masataka; Ito, Akira

    1998-01-01

    The core of Fusion Experimental Reactor consists of various components such as superconducting magnets and forced-cooled in-vessel components, which are remotely maintained due to intense of gamma radiation. Mechanical connectors such as cooling pipe connections, insulation joints and electrical connectors are commonly used for maintenance of these components and have to be standardized in terms of remote handling. This paper describes these mechanical connectors developed as the standard component compatible with remote handling and tolerable for radiation. (author)

  12. Development of standard components for remote handling

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Kou; Kakudate, Satoshi; Nakahira, Masataka; Ito, Akira [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-04-01

    The core of Fusion Experimental Reactor consists of various components such as superconducting magnets and forced-cooled in-vessel components, which are remotely maintained due to intense of gamma radiation. Mechanical connectors such as cooling pipe connections, insulation joints and electrical connectors are commonly used for maintenance of these components and have to be standardized in terms of remote handling. This paper describes these mechanical connectors developed as the standard component compatible with remote handling and tolerable for radiation. (author)

  13. Safety Training: "Manual Handling" course in September

    CERN Multimedia

    Safety Training, HSE Unit

    2016-01-01

    The next "Manual Handling" course will be given, in French, on 26 September 2016. This course is designed for anyone required to carry out manual handling of loads in the course of their work.   The main objective of this course is to adopt and apply the basic principles of physical safety and economy of effort. There are places available. If you are interested in following this course, please fill an EDH training request via our catalogue. 

  14. Symmetric voltage-controlled variable resistance

    Science.gov (United States)

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  15. Ultra Low-Voltage Energy Harvesting

    Science.gov (United States)

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  16. Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

    Science.gov (United States)

    Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

    2010-11-01

    A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

  17. Specialization and Flexibility in Port Cargo Handling

    Directory of Open Access Journals (Sweden)

    Hakkı KİŞİ

    2016-11-01

    Full Text Available Cargo handling appears to be the fundamental function of ports. In this context, the question of type of equipment and capacity rate need to be tackled with respect to cargo handling principles. The purpose of this study is to discuss the types of equipment to be used in ports, relating the matter to costs and capacity. The question is studied with a basic economic theoretical approach. Various conditions like port location, size, resources, cargo traffic, ships, etc. are given parameters to dictate the type and specification of the cargo handling equipment. Besides, a simple approach in the context of cost capacity relation can be useful in deciding whether to use specialized or flexible equipment. Port equipment is sometimes expected to be flexible to handle various types of cargo as many as possible and sometimes to be specialized to handle one specific type of cargo. The cases that might be suitable for those alternatives are discussed from an economic point of view in this article. Consequently, effectiveness and efficiency criteria play important roles in determining the handling equipment in ports.

  18. Religious Serpent Handling and Community Relations.

    Science.gov (United States)

    Williamson, W Paul; Hood, Ralph W

    2015-01-01

    Christian serpent handling sects of Appalachia comprise a community that has long been mischaracterized and marginalized by the larger communities surrounding them. To explore this dynamic, this article traces the emergence of serpent handling in Appalachia and the emergence of anti-serpent-handling state laws, which eventually failed to curb the practice, as local communities gave serpent handling groups support. We present two studies to consider for improving community relations with serpent handling sects. In study 1, we present data relating the incidence of reported serpent-bite deaths with the rise of anti-serpent-handling laws and their eventual abatement, based on increasing acceptance of serpent handlers by the larger community. Study 2 presents interview data on serpent bites and death that provide explanations for these events from the cultural and religious perspective. We conclude that first-hand knowledge about serpent handlers, and other marginalized groups, helps to lessen suspicion and allows them to be seen as not much different, which are tendencies that are important for promoting inter-community harmony.

  19. Voltage Quality of Grid Connected Wind Turbines

    DEFF Research Database (Denmark)

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  20. Manufacturing technology for practical Josephson voltage normals

    International Nuclear Information System (INIS)

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  1. 49 CFR 234.221 - Lamp voltage.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  2. Bootstrapped Low-Voltage Analog Switches

    DEFF Research Database (Denmark)

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  3. Handling of Polyvinylsiloxane Versus Polyether for Implant Impressions.

    Science.gov (United States)

    Farhan, Daniel; Lauer, Wiebke; Heydecke, Guido; Aarabi, Ghazal; Reissmann, Daniel R

    2016-01-01

    This study compared polyvinylsiloxane with polyether in handling dental impressions. Each participant (N = 39) made four impressions, each a combination of pickup and reseating techniques with polyether or polyvinylsiloxane, of one implant cast representing a specific clinical situation (tooth gaps, limited residual dentition, or edentulous jaw). Handling of impressions was subsequently rated by using a 12-item questionnaire with 100-mm visual analog scales. While mean satisfaction scores were higher for polyvinylsiloxane than for polyether (69.5/63.0, P < .001), differences among subgroups were statistically significant only for pickup technique, limited residual dentition, and edentulous jaw. Implant impressions made with polyvinylsiloxane using a pickup technique seem to be the best option for most clinical situations.

  4. Voltage generators of high voltage high power accelerators

    International Nuclear Information System (INIS)

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  5. Power System Stability Using Decentralized Under Frequency and Voltage Load Shedding

    DEFF Research Database (Denmark)

    Hoseinzadeh, Bakhtyar; Silva, Filipe Faria Da; Bak, Claus Leth

    2014-01-01

    information to shed the loads with higher voltage decay first. Therefore, this approach deals with coordination of voltage and frequency information instead of independent methods. Numerical simulations which are carried out in DigSilent PowerFactory software confirm the efficiency of proposed methodology...

  6. Preoperational checkout of the remote-handled transuranic waste handling at the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    1987-09-01

    This plan describes the preoperational checkout for handling Remote-Handled Transuranic (RH-TRU) Wastes from their receipt at the Waste Isolation Pilot Plant (WIPP) to their emplacement underground. This plan identifies the handling operations to be performed, personnel groups responsible for executing these operations, and required equipment items. In addition, this plan describes the quality assurance that will be exercised throughout the checkout, and finally, it establishes criteria by which to measure the success of the checkout. 7 refs., 5 figs

  7. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    DEFF Research Database (Denmark)

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  8. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    Science.gov (United States)

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  9. Radiological safety aspects of handling plutonium

    International Nuclear Information System (INIS)

    Sundararajan, A.R.

    2016-01-01

    Department of Atomic Energy in its scheme of harnessing the nuclear energy for electrical power generation and strategic applications has given a huge role to utilization of plutonium. In the power production programme, fast reactors with plutonium as fuel are expected to play a major role. This would require establishing fuel reprocessing plants to handle both thermal and fast reactor fuels. So in the nuclear fuel cycle facilities variety of chemical, metallurgical, mechanical operations have to be carried out involving significant inventories of "2"3"9 Pu and associated radionuclides. Plutonium is the most radiotoxic radionuclide and therefore any facility handling it has to be designed and operated with utmost care. Two problems of major concern in the protection of persons working in plutonium handling facilities are the internal exposure to the operating personnel from uptake of plutonium and transplutonic nuclides as they are highly radiotoxic and the radiation exposure of hands and eye lens during fuel fabrication operations especially while handling recycled high burn up plutonium. In view of the fact that annual limit for intake is very small for "2"3"9Pu and its radiation emission characteristics are such that it is a huge challenge for the health physicists to detect Pu in air and in workers. This paper discusses the principles and practices followed in providing radiological surveillance to workers in plutonium handling areas. The challenges in protecting the workers from receiving exposures to hands and eye lens in handling high burn up plutonium are also discussed. The sites having Pu fuel cycle facilities should have trained medical staff to handle cases involving excessive intake of plutonium. (author)

  10. Full scale tests on remote handled FFTF fuel assembly waste handling and packaging

    International Nuclear Information System (INIS)

    Allen, C.R.; Cash, R.J.; Dawson, S.A.; Strode, J.N.

    1986-01-01

    Handling and packaging of remote handled, high activity solid waste fuel assembly hardware components from spent FFTF reactor fuel assemblies have been evaluated using full scale components. The demonstration was performed using FFTF fuel assembly components and simulated components which were handled remotely using electromechanical manipulators, shielding walls, master slave manipulators, specially designed grapples, and remote TV viewing. The testing and evaluation included handling, packaging for current and conceptual shipping containers, and the effects of volume reduction on packing efficiency and shielding requirements. Effects of waste segregation into transuranic (TRU) and non-transuranic fractions also are discussed

  11. Piezo Voltage Controlled Planar Hall Effect Devices.

    Science.gov (United States)

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  12. Application of high voltage electric field (HVEF) drying technology in potato chips

    International Nuclear Information System (INIS)

    Bai, Yaxiang; Shi, Hua; Yang, Yaxin

    2013-01-01

    In order to improve the drying efficiency and qualities of vegetable by high voltage electric field (HVEF), potato chips as a representative of vegetable was dried using a high voltage electric drying systems at 20°C. The shrinkage rate, water absorption and rehydration ratio of dried potato chips were measured. The results indicated that the drying rate of potato chips was significantly improved in the high voltage electric drying systems. The shrinkage rate of potato chips dried by high voltage electric field was 1.1% lower than that by oven drying method. And the rehydration rate of high voltage electric field was 24.6% higher than that by oven drying method. High voltage electric field drying is very advantageous and can be used as a substitute for traditional drying method.

  13. Distributed stability control using intelligent voltage-margin relay

    Energy Technology Data Exchange (ETDEWEB)

    Wiszniewski, A.; Rebizant, W. [Wroclaw Univ. of Technology (Poland); Klimek, A. [Powertech Labs Inc., Surrey, BC (Canada)

    2010-07-01

    This paper presented an intelligent relay that operates if the load to source impedance ratio decreases to a level that is dangerously close to the stability limit, which leads to power system blackouts. The intelligent voltage-margin/difference relay installed at receiving substations automatically initiates action if the voltage stability margin drops to a dangerously low level. The relay decides if the tap changing devices are to be blocked and if under-voltage load shedding should be initiated, thereby mitigating an evolving instability. The intelligent relay has two levels of operation. At the first stage, which corresponds to the higher load to source impedance ratio, the relay initiates blocking of the tap changer. At the second stage, corresponding to the lower source to load impedance ratio, load shedding is initiated. The relay operates when the load to source impedance ratio reaches a certain predetermined level, but it does not depend either on the level of the source voltage or on the difference of source and load impedance phase angles. The algorithm for the relay is relatively simple and uses only locally available signals. Consequently, the transformer is well controlled to eliminate the cases of voltage instability. 6 refs., 7 figs.

  14. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    DEFF Research Database (Denmark)

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  15. Voltage-Gated Calcium Channels

    Science.gov (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  16. How Does Bug-Handling Effort Differ Among Different Programming Languages?

    OpenAIRE

    Zhang, Jie; Li, Feng; Hao, Dan; Wang, Meng; Zhang, Lu

    2018-01-01

    Handling bugs is an essential part of software development. The impact of programming language on this task has long been a topic of much debate. For example, some people hold the view that bugs in Python are easy to handle because its code is easy to read and understand, while some others believe the absence of static typing in Python will lead to higher bug-handling effort. This paper presents the first large-scale study to investigate whether the ecosystems of different (categories of) pro...

  17. Effective Teaching Practices in Handling Non Readers

    Directory of Open Access Journals (Sweden)

    Jacklyn S. Dacalos

    2016-08-01

    Full Text Available The study determined the effective teaching practices in handling nonreaders. This seeks to answer the following objectives: describe the adjustments, effective strategies, and scaffolds utilized by teachers in handling nonreaders; differentiate the teachers’ reading adjustments, strategies and scaffolds in teaching nonreaders; analyze the teaching reading efficiency of nonreaders using effective teaching reading strategies; and find significant correlation of nonreaders’ grades and reading teachers’ reading adjustments, strategies and scaffolds. This study utilized mixed methods of research. Case studies of five public schools teachers were selected as primary subjects, who were interviewed in handling nonreaders in the areas of adjustments, strategies, and reading scaffolds. Actual teaching observation was conducted according to the five subjects’ most convenient time. In ascertaining the nonreaders’ academic performance, the students’ grades in English subject was analyzed using T-Test within subject design. Handling nonreaders in order to read and understand better in the lesson is an arduous act, yet; once done with effectiveness and passion, it yielded a great amount of learning success. Effective teaching practices in handling nonreaders comprised the use of teachers’ adjustments, strategies, and scaffolds to establish reading mastery, exposing them to letter sounds, short stories, and the use of follow-up. WH questions enhanced their reading performance significantly. Variations of reading teachers’ nature as: an enabler, a facilitator, a humanist, a behaviorist, and an expert, as regards to their teaching practices, were proven significant to students’ reading effectiveness.

  18. Feasibility of Stochastic Voltage/VAr Optimization Considering Renewable Energy Resources for Smart Grid

    Science.gov (United States)

    Momoh, James A.; Salkuti, Surender Reddy

    2016-06-01

    This paper proposes a stochastic optimization technique for solving the Voltage/VAr control problem including the load demand and Renewable Energy Resources (RERs) variation. The RERs often take along some inputs like stochastic behavior. One of the important challenges i. e., Voltage/VAr control is a prime source for handling power system complexity and reliability, hence it is the fundamental requirement for all the utility companies. There is a need for the robust and efficient Voltage/VAr optimization technique to meet the peak demand and reduction of system losses. The voltages beyond the limit may damage costly sub-station devices and equipments at consumer end as well. Especially, the RERs introduces more disturbances and some of the RERs are not even capable enough to meet the VAr demand. Therefore, there is a strong need for the Voltage/VAr control in RERs environment. This paper aims at the development of optimal scheme for Voltage/VAr control involving RERs. In this paper, Latin Hypercube Sampling (LHS) method is used to cover full range of variables by maximally satisfying the marginal distribution. Here, backward scenario reduction technique is used to reduce the number of scenarios effectively and maximally retain the fitting accuracy of samples. The developed optimization scheme is tested on IEEE 24 bus Reliability Test System (RTS) considering the load demand and RERs variation.

  19. Distribution state estimation based voltage control for distribution networks; Koordinierte Spannungsregelung anhand einer Zustandsschaetzung im Verteilnetz

    Energy Technology Data Exchange (ETDEWEB)

    Diwold, Konrad; Yan, Wei [Fraunhofer IWES, Kassel (Germany); Braun, Martin [Fraunhofer IWES, Kassel (Germany); Stuttgart Univ. (Germany). Inst. fuer Energieuebertragung und Hochspannungstechnik (IEH)

    2012-07-01

    The increased integration of distributed energy units creates challenges for the operators of distribution systems. This is due to the fact that distribution systems that were initially designed for distributed consumption and central generation now face decentralized feed-in. One imminent problem associated with decentralised fee-in are local voltage violations in the distribution system, which are hard to handle via conventional voltage control strategies. This article proposes a new voltage control framework for distribution system operation. The framework utilizes reactive power of distributed energy units as well on-load tap changers to mitigate voltage problems in the network. Using an optimization-band the control strategy can be used in situations where network information is derived from distribution state estimators and thus holds some error. The control capabilities in combination with a distribution state estimator are tested using data from a real rural distribution network. The results are very promising, as voltage control is achieved fast and accurate, preventing a majority of the voltage violations during system operation under realistic system conditions. (orig.)

  20. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  1. Observability of Low Voltage grids

    DEFF Research Database (Denmark)

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  2. Development of tritium-handling technique

    International Nuclear Information System (INIS)

    Ohmura, Hiroshi; Hosaka, Akio; Okamoto, Takahumi

    1988-01-01

    The overview of developing activities for tritium-handling techniques in IHI are presented. To establish a fusion power plant, tritium handling is one of the key technologies. Recently in JAERI, conceptual design of FER (Fusion Experimental Reactor) has been carried out, and the FER system requires a processing system for a large amount of tritium. IHI concentrate on investigation of fuel gas purification, isotope separation and storage systems under contract with Toshiba Corporation. Design results of the systems and each components are reviewed. IHI has been developing fundamental handling techniques which are the ZrNi bed for hydrogen isotope storage and isotope separation by laser. The ZrNi bed with a tritium storage capacity of 1000 Ci has been constructed and recovery capability of the hydrogen isotope until 10 -4 Torr {0.013 Pa} was confirmed. In laser isotope separation, the optimum laser wave length has been determined. (author)

  3. Automated system for handling tritiated mixed waste

    International Nuclear Information System (INIS)

    Dennison, D.K.; Merrill, R.D.; Reitz, T.C.

    1995-03-01

    Lawrence Livermore National Laboratory (LLNL) is developing a semi system for handling, characterizing, processing, sorting, and repackaging hazardous wastes containing tritium. The system combines an IBM-developed gantry robot with a special glove box enclosure designed to protect operators and minimize the potential release of tritium to the atmosphere. All hazardous waste handling and processing will be performed remotely, using the robot in a teleoperational mode for one-of-a-kind functions and in an autonomous mode for repetitive operations. Initially, this system will be used in conjunction with a portable gas system designed to capture any gaseous-phase tritium released into the glove box. This paper presents the objectives of this development program, provides background related to LLNL's robotics and waste handling program, describes the major system components, outlines system operation, and discusses current status and plans

  4. DOE handbook: Tritium handling and safe storage

    International Nuclear Information System (INIS)

    1999-03-01

    The DOE Handbook was developed as an educational supplement and reference for operations and maintenance personnel. Most of the tritium publications are written from a radiological protection perspective. This handbook provides more extensive guidance and advice on the null range of tritium operations. This handbook can be used by personnel involved in the full range of tritium handling from receipt to ultimate disposal. Compliance issues are addressed at each stage of handling. This handbook can also be used as a reference for those individuals involved in real time determination of bounding doses resulting from inadvertent tritium releases. This handbook provides useful information for establishing processes and procedures for the receipt, storage, assay, handling, packaging, and shipping of tritium and tritiated wastes. It includes discussions and advice on compliance-based issues and adds insight to those areas that currently possess unclear DOE guidance

  5. DOE handbook: Tritium handling and safe storage

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The DOE Handbook was developed as an educational supplement and reference for operations and maintenance personnel. Most of the tritium publications are written from a radiological protection perspective. This handbook provides more extensive guidance and advice on the null range of tritium operations. This handbook can be used by personnel involved in the full range of tritium handling from receipt to ultimate disposal. Compliance issues are addressed at each stage of handling. This handbook can also be used as a reference for those individuals involved in real time determination of bounding doses resulting from inadvertent tritium releases. This handbook provides useful information for establishing processes and procedures for the receipt, storage, assay, handling, packaging, and shipping of tritium and tritiated wastes. It includes discussions and advice on compliance-based issues and adds insight to those areas that currently possess unclear DOE guidance.

  6. MHSS: a material handling system simulator

    Energy Technology Data Exchange (ETDEWEB)

    Pomernacki, L.; Hollstien, R.B.

    1976-04-07

    A Material Handling System Simulator (MHSS) program is described that provides specialized functional blocks for modeling and simulation of nuclear material handling systems. Models of nuclear fuel fabrication plants may be built using functional blocks that simulate material receiving, storage, transport, inventory, processing, and shipping operations as well as the control and reporting tasks of operators or on-line computers. Blocks are also provided that allow the user to observe and gather statistical information on the dynamic behavior of simulated plants over single or replicated runs. Although it is currently being developed for the nuclear materials handling application, MHSS can be adapted to other industries in which material accountability is important. In this paper, emphasis is on the simulation methodology of the MHSS program with application to the nuclear material safeguards problem. (auth)

  7. Medication-handling challenges among visually impaired population

    Directory of Open Access Journals (Sweden)

    Ling Zhi-Han

    2017-01-01

    Full Text Available Objective: Visually impaired individuals are particularly at higher risk for experiencing a medication error. The aim of this study is to identify the problems encountered by the visually impaired population when handling their medication. Methods: A cross-sectional survey was conducted using an interviewer-guided questionnaire with 100 visually impaired individuals. The questionnaire comprised a series of questions in medication management. Results: All of the respondents perceived that self-administration of medication was a challenging task. A total of 89% of respondents were unable to read the prescription labels, 75% of respondents did not know the expiry date of their own medication, and 58% of respondents did not know the name of the medication. With regard to storage of medication, 72% of respondents did not practice appropriate methods to store their medication, and 80% of respondents kept the unused medication. All of the respondents disposed leftover medication through household rubbish. A total of 64% of respondents never practice medication review. Most (96% of them did not tell health-care providers when they faced difficulties in handling their medication. Conclusion: Most of the visually impaired individuals did not receive appropriate assistance regarding medicine use and having low awareness in medication management. This can lead to increased risk of medication errors or mismanagement among visually impaired population. Hence, effective strategies, especially in pharmaceutical care services, should be structured to assist this special population in medication handling.

  8. Fuel handling grapple for nuclear reactor plants

    International Nuclear Information System (INIS)

    Rousar, D.L.

    1992-01-01

    This patent describes a fuel handling system for nuclear reactor plants. It comprises: a reactor vessel having an openable top and removable cover and containing therein, submerged in water substantially filling the reactor vessel, a fuel core including a multiplicity of fuel bundles formed of groups of sealed tube elements enclosing fissionable fuel assembled into units, the fuel handling system consisting essentially of the combination of: a fuel bundle handling platform movable over the open top of the reactor vessel; a fuel bundle handling mast extendable downward from the platform with a lower end projecting into the open top reactor vessel to the fuel core submerged in water; a grapple head mounted on the lower end of the mast provided with grapple means comprising complementary hooks which pivot inward toward each other to securely grasp a bail handle of a nuclear reactor fuel bundle and pivot backward away from each other to release a bail handle; the grapple means having a hollow cylindrical support shaft fixed within the grapple head with hollow cylindrical sleeves rotatably mounted and fixed in longitudinal axial position on the support shaft and each sleeve having complementary hooks secured thereto whereby each hook pivots with the rotation of the sleeve secured thereto; and the hollow cylindrical support shaft being provided with complementary orifices on opposite sides of its hollow cylindrical and intermediate to the sleeves mounted thereon whereby the orifices on both sides of the hollow cylindrical support shaft are vertically aligned providing a direct in-line optical viewing path downward there-through and a remote operator positioned above the grapple means can observe from overhead the area immediately below the grapple hooks

  9. Handling of biological specimens for electron microscopy

    International Nuclear Information System (INIS)

    Bullock, G.

    1987-01-01

    There are many different aspects of specimen preparation procedure which need to be considered in order to achieve good results. Whether using the scanning or transmission microscope, the initial handling procedures are very similar and are selected for the information required. Handling procedures and techniques described are: structural preservation; immuno-and histo-chemistry; x-ray microanalysis and autoradiography; dehydration and embedding; mounting and coating specimens for scanning electron microscopy; and sectioning of resin embedded material. With attention to detail and careful choice of the best available technique, excellent results should be obtainable whatever the specimen. 6 refs

  10. Human factors issues in fuel handling

    Energy Technology Data Exchange (ETDEWEB)

    Beattie, J D; Iwasa-Madge, K M; Tucker, D A [Humansystems Inc., Milton, ON (Canada)

    1994-12-31

    The staff of the Atomic Energy Control Board wish to further their understanding of human factors issues of potential concern associated with fuel handling in CANDU nuclear power stations. This study contributes to that objective by analysing the role of human performance in the overall fuel handling process at Ontario Hydro`s Darlington Nuclear Generating Station, and reporting findings in several areas. A number of issues are identified in the areas of design, operating and maintenance practices, and the organizational and management environment. 1 fig., 4 tabs., 19 refs.

  11. Safe handling of plutonium: a panel report

    Energy Technology Data Exchange (ETDEWEB)

    1974-01-01

    This guide results from a meeting of a Panel of Experts held by the International Atomic Energy Agency on 8 to 12 November 1971. It is directed to workers in research laboratories handling plutonium in gram amounts. Contents: aspects of the physical and chemical properties of plutonium; metabolic features of plutonium; facility design features for safe handling of plutonium (layout of facility, working zones, decontamination room, etc.); glove boxes; health surveillance (surveillance of environment and supervision of workers); emergencies; organization. Annexes: types of glove boxes; tables; mobile ..cap alpha.. air sampler; aerosol monitor; bio-assay limits of detection; examples of contamination control monitors.

  12. Apparatus for handling control rod drives

    International Nuclear Information System (INIS)

    Akimoto, A.; Watanabe, M.; Yoshida, T.; Sugaya, Z.; Saito, T.; Ishii, Y.

    1979-01-01

    An apparatus for handling control rod drives (CRD's) attached by detachable fixing means to housings mounted in a reactor pressure vessel and each coupled to one of control rods inserted in the reactor pressure vessel is described. The apparatus for handling the CRD's comprise cylindrical housing means, uncoupling means mounted in the housing means for uncoupling each of the control rods from the respective CRD, means mounted on the housing means for effecting attaching and detaching of the fixing means, means for supporting the housing means, and means for moving the support means longitudinally of the CRD

  13. Control panel handling of a nuclear simulator

    International Nuclear Information System (INIS)

    Martin Polo, F.; Jimenez Fraustro, L.A.; Banuelos Galindo, A.; Diamant Rubinstein, A.

    1985-01-01

    The handling of the control panels for a Nuclear Simulator for operating training is described. The control panels are handled by a set of intelligent controllers, each with at least two processors (8035 - Communications Controller and a 8085 - Master processor). The Controllers are connected to the main computers (Two dual processor Gould concept 32/6780 and a single processor Gould concept 32/6705) via serial asynchronous channels in a multidrop, star-like architecture. The controllers transmit to the main computers only the changes detected and receive the whole set of output variables as computed by the mathematical models of the Nuclear Plant

  14. Recommendations for cask features for robotic handling from the Advanced Handling Technology Project

    International Nuclear Information System (INIS)

    Drotning, W.

    1991-02-01

    This report describes the current status and recent progress in the Advanced Handling Technology Project (AHTP) initiated to explore the use of advanced robotic systems and handling technologies to perform automated cask handling operations at radioactive waste handling facilities, and to provide guidance to cask designers on the impact of robotic handling on cask design. Current AHTP tasks have developed system mock-ups to investigate robotic manipulation of impact limiters and cask tiedowns. In addition, cask uprighting and transport, using computer control of a bridge crane and robot, were performed to demonstrate the high speed cask transport operation possible under computer control. All of the current AHTP tasks involving manipulation of impact limiters and tiedowns require robotic operations using a torque wrench. To perform these operations, a pneumatic torque wrench and control system were integrated into the tool suite and control architecture of the gantry robot. The use of captured fasteners is briefly discussed as an area where alternative cask design preferences have resulted from the influence of guidance for robotic handling vs traditional operations experience. Specific robotic handling experiences with these system mock-ups highlight a number of continually recurring design principles: (1) robotic handling feasibility is improved by mechanical designs which emphasize operation with limited dexterity in constrained workspaces; (2) clearances, tolerances, and chamfers must allow for operations under actual conditions with consideration for misalignment and imprecise fixturing; (3) successful robotic handling is enhanced by including design detail in representations for model-based control; (4) robotic handling and overall quality assurance are improved by designs which eliminate the use of loose, disassembled parts. 8 refs., 15 figs

  15. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  16. SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION

    Directory of Open Access Journals (Sweden)

    A. G. Stryzhniou

    2014-01-01

    Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of  harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.

  17. High voltage load resistor array

    Science.gov (United States)

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  18. Theoretical analysis of magnetic sensor output voltage

    International Nuclear Information System (INIS)

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  19. Voltage-Controlled Floating Resistor Using DDCC

    Directory of Open Access Journals (Sweden)

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  20. Impact of distributed generators on the power loss and voltage profile of sub-transmission network

    Directory of Open Access Journals (Sweden)

    A.S.O. Ogunjuyigbe

    2016-05-01

    Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

  1. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    DEFF Research Database (Denmark)

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  2. Personal ways of handling everyday life

    DEFF Research Database (Denmark)

    Jensen, Lasse Meinert

    at variations in everyday life pursuits:  How does a person's pursuit of goals and concerns lead him/her to experience and handle breaks, interruptions, and variation in everyday activities?  The research project so far holds quantitative data.  A convenient sample of 217 persons were administered...

  3. Confluence Modulo Equivalence in Constraint Handling Rules

    DEFF Research Database (Denmark)

    Christiansen, Henning; Kirkeby, Maja Hanne

    2015-01-01

    Previous results on confluence for Constraint Handling Rules, CHR, are generalized to take into account user-defined state equivalence relations. This allows a much larger class of programs to enjoy the advantages of confluence, which include various optimization techniques and simplified...

  4. 9 CFR 3.142 - Handling.

    Science.gov (United States)

    2010-01-01

    ... Warmblooded Animals Other Than Dogs, Cats, Rabbits, Hamsters, Guinea Pigs, Nonhuman Primates, and Marine... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Handling. 3.142 Section 3.142 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE ANIMAL...

  5. WISE TECHNOLOGY FOR HANDLING BIG DATA FEDERATIONS

    NARCIS (Netherlands)

    Valentijn, E; Begeman, Kornelis; Belikov, Andrey; Boxhoorn, Danny; Verdoes Kleijn, Gijs; McFarland, John; Vriend, Willem-Jan; Williams, Owen; Soille, P.; Marchetti, P.G.

    2014-01-01

    The effective use of Big Data in current and future scientific missions requires intelligent data handling systems which are able to interface the user to complicated distributed data collections. We review the WISE Concept of Scientific Information Systems and the WISE solutions for the storage and

  6. 340 Waste Handling Facility interim safety basis

    International Nuclear Information System (INIS)

    Bendixsen, R.B.

    1995-01-01

    This document establishes the interim safety basis (ISB) for the 340 Waste Handling Facility (340 Facility). An ISB is a documented safety basis that provides a justification for the continued operation of the facility until an upgraded final safety analysis report is prepared that complies with US Department of Energy (DOE) Order 5480.23, Nuclear Safety Analysis Reports. The ISB for the 340 Facility documents the current design and operation of the facility. The 340 Facility ISB (ISB-003) is based on a facility walkdown and review of the design and operation of the facility, as described in the existing safety documentation. The safety documents reviewed, to develop ISB-003, include the following: OSD-SW-153-0001, Operating Specification Document for the 340 Waste Handling Facility (WHC 1990); OSR-SW-152-00003, Operating Limits for the 340 Waste Handling Facility (WHC 1989); SD-RE-SAP-013, Safety Analysis Report for Packaging, Railroad Liquid Waste Tank Cars (Mercado 1993); SD-WM-TM-001, Safety Assessment Document for the 340 Waste Handling Facility (Berneski 1994a); SD-WM-SEL-016, 340 Facility Safety Equipment List (Berneski 1992); and 340 Complex Fire Hazard Analysis, Draft (Hughes Assoc. Inc. 1994)

  7. 7 CFR 985.8 - Handle.

    Science.gov (United States)

    2010-01-01

    ... the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE MARKETING ORDER REGULATING THE HANDLING OF...: Provided, That: (a) The preparation for market of salable oil by producers who are not dealers or users, (b...

  8. Handling system for nuclear fuel pellet inspection

    International Nuclear Information System (INIS)

    Nyman, D.H.; McLemore, D.R.; Sturges, R.H.

    1978-11-01

    HEDL is developing automated fabrication equipment for fast reactor fuel. A major inspection operation in the process is the gaging of fuel pellets. A key element in the system has been the development of a handling system that reliably moves pellets at the rate of three per second without product damage or excessive equipment wear

  9. Combating wear in bulk solids handling plants

    Energy Technology Data Exchange (ETDEWEB)

    1986-01-01

    A total of five papers presented at a seminar on problems of wear caused by abrasive effects of materials in bulk handling. Topics of papers cover the designer viewpoint, practical experience from the steel, coal, cement and quarry industries to create an awareness of possible solutions.

  10. Emergency handling of radiation accident cases: firemen

    International Nuclear Information System (INIS)

    Procedures for the emergency handling of persons exposed to radiation or radioactive contamination are presented, with emphasis on information needed by firemen. The types of radiation accident patients that may be encountered are described and procedures for first aid, for preventing the spread of radioactive contamination, and for reporting the accident are outlined

  11. 340 waste handling facility interim safety basis

    Energy Technology Data Exchange (ETDEWEB)

    VAIL, T.S.

    1999-04-01

    This document presents an interim safety basis for the 340 Waste Handling Facility classifying the 340 Facility as a Hazard Category 3 facility. The hazard analysis quantifies the operating safety envelop for this facility and demonstrates that the facility can be operated without a significant threat to onsite or offsite people.

  12. 7 CFR 981.16 - To handle.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false To handle. 981.16 Section 981.16 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... in any other way to put almonds grown in the area of production into any channel of trade for human...

  13. Ergonomics intervention in manual handling of oxygen

    Directory of Open Access Journals (Sweden)

    M Motamedzadeh

    2013-05-01

    Conclusion: With the implementation of ergonomic intervention is casting unit, the risk of exposure to musculoskeletal disorders caused by manual handling of oxygen cylinders was eliminated and safety of employees against the risk of explosion of the cylinders in comparison with before the intervention was improved.

  14. PREPD O and VE remote handling system

    International Nuclear Information System (INIS)

    Theil, T.N.

    1985-01-01

    The Process Experimental Pilot Plant (PREPP) at the Idaho National Engineering Laboratory is designed for volume reduction and packaging of transuranic (TRU) waste. The PREPP opening and verification enclosure (O and VE) remote handling system, within that facility, is designed to provide examination of the contents of various TRU waste storage containers. This remote handling system will provide the means of performing a hazardous operation that is currently performed manually. The TeleRobot to be used in this system is a concept that will incorporate and develop man in the loop operation (manual mode), standardized automatic sequencing of end effector tools, increased payload and reach over currently available computer-controlled robots, and remote handling of a hazardous waste operation. The system is designed within limited space constraints and an operation that was originally planned, and is currently being manually performed at other plants. The PREPP O and VE remote handling system design incorporates advancing technology to improve the working environment in the nuclear field

  15. Intertextuality for Handling Complex Environmental Issues

    Science.gov (United States)

    Byhring, Anne Kristine; Knain, Erik

    2016-01-01

    Nowhere is the need for handling complexity more pertinent than in addressing environmental issues. Our study explores students' situated constructs of complexity in unfolding discourses on socio-scientific issues. Students' dialogues in two group-work episodes are analysed in detail, with tools from Systemic Functional Linguistics. We identify…

  16. 7 CFR 996.4 - Handle.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Handle. 996.4 Section 996.4 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... consumption channels of commerce: Provided, That this term does not include sales or deliveries of peanuts by...

  17. 7 CFR 982.7 - To handle.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false To handle. 982.7 Section 982.7 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... hazelnuts, inshell or shelled, into the channels of trade either within the area of production or from such...

  18. Exploring Reflective Means to Handle Plagiarism

    Science.gov (United States)

    Dalal, Nikunj

    2016-01-01

    Plagiarism has become widespread in the university teaching environment. This article presents practical wisdom from several years of experience handling plagiarism in two Information Systems (IS) courses with the exploratory use of reflective means such as dialogues and essays. There has been very little work on the use of reflective approaches…

  19. Remote technologies for handling spent fuel

    International Nuclear Information System (INIS)

    Ramakumar, M.S.

    1999-01-01

    The nuclear programme in India involves building and operating power and research reactors, production and use of isotopes, fabrication of reactor fuel, reprocessing of irradiated fuel, recovery of plutonium and uranium-233, fabrication of fuel containing plutonium-239, uranium-233, post-irradiation examination of fuel and hardware and handling solid and liquid radioactive wastes. Fuel that could be termed 'spent' in thermal reactors is a source for second generation fuel (plutonium and uranium-233). Therefore, it is only logical to extend remote techniques beyond handling fuel from thermal reactors to fuel from fast reactors, post-irradiation examination etc. Fabrication of fuel containing plutonium and uranium-233 poses challenges in view of restriction on human exposure to radiation. Hence, automation will serve as a step towards remotisation. Automated systems, both rigid and flexible (using robots) need to be developed and implemented. Accounting of fissile material handled by robots in local area networks with appropriate access codes will be possible. While dealing with all these activities, it is essential to pay attention to maintenance and repair of the facilities. Remote techniques are essential here. There are a number of commonalities in these requirements and so development of modularized subsystems, and integration of different configurations should receive attention. On a long-term basis, activities like decontamination, decommissioning of facilities and handling of waste generated have to be addressed. While robotized remote systems have to be designed for existing facilities, future designs of facilities should take into account total operation with robotic remote systems. (author)

  20. 21 CFR 820.140 - Handling.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Handling. 820.140 Section 820.140 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES... manufacturer shall establish and maintain procedures to ensure that mixups, damage, deterioration...

  1. Guidance Counsellor Strategies for Handling Bullying

    Science.gov (United States)

    Power-Elliott, Michleen; Harris, Gregory E.

    2012-01-01

    The purpose of this exploratory-descriptive study was to examine how guidance counsellors in the province of Newfoundland and Labrador would handle a specific verbal-relational bullying incident. Also of interest was guidance counsellor involvement and training in bullying programmes and Positive Behaviour Supports. Data for this study was…

  2. Handling and disposing of radioactive waste

    International Nuclear Information System (INIS)

    Trauger, D.B.

    1983-01-01

    Radioactive waste has been separated by definition into six categories. These are: commercial spent fuel; high-level wastes; transuranium waste; low-level wastes; decommissioning and decontamination wastes; and mill tailings and mine wastes. Handling and disposing of these various types of radioactive wastes are discussed briefly

  3. Biodiesel Handling and Use Guide (Fifth Edition)

    Energy Technology Data Exchange (ETDEWEB)

    Alleman, T.L.; McCormick, R.L.; Christensen, E.D.; Fioroni, G.; Moriarty. K.; Yanowitz, J.

    2016-11-08

    This document is a guide for those who blend, distribute, and use biodiesel and biodiesel blends. It provides basic information on the proper and safe use of biodiesel and biodiesel blends in engines and boilers, and is intended to help fleets, individual users, blenders, distributors, and those involved in related activities understand procedures for handling and using biodiesel fuels.

  4. Instrumentation to handle thermal polarized neutron beams

    NARCIS (Netherlands)

    Kraan, W.H.

    2004-01-01

    In this thesis we investigate devices needed to handle the polarization of thermal neutron beams: Ï/2-flippers (to start/stop Larmor precession) and Ï-flippers (to reverse polarization/precession direction) and illustrate how these devices are used to investigate the properties of matter and of the

  5. Confluence Modulo Equivalence in Constraint Handling Rules

    DEFF Research Database (Denmark)

    Christiansen, Henning; Kirkeby, Maja Hanne

    2014-01-01

    Previous results on confluence for Constraint Handling Rules, CHR, are generalized to take into account user-defined state equivalence relations. This allows a much larger class of programs to enjoy the ad- vantages of confluence, which include various optimization techniques and simplified...

  6. 340 waste handling facility interim safety basis

    International Nuclear Information System (INIS)

    VAIL, T.S.

    1999-01-01

    This document presents an interim safety basis for the 340 Waste Handling Facility classifying the 340 Facility as a Hazard Category 3 facility. The hazard analysis quantifies the operating safety envelop for this facility and demonstrates that the facility can be operated without a significant threat to onsite or offsite people

  7. Remote-handled transuranic system assessment appendices. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-11-01

    Volume 2 of this report contains six appendices to the report: Inventory and generation of remote-handled transuranic waste; Remote-handled transuranic waste site storage; Characterization of remote-handled transuranic waste; RH-TRU waste treatment alternatives system analysis; Packaging and transportation study; and Remote-handled transuranic waste disposal alternatives.

  8. Remote-handled transuranic system assessment appendices. Volume 2

    International Nuclear Information System (INIS)

    1995-11-01

    Volume 2 of this report contains six appendices to the report: Inventory and generation of remote-handled transuranic waste; Remote-handled transuranic waste site storage; Characterization of remote-handled transuranic waste; RH-TRU waste treatment alternatives system analysis; Packaging and transportation study; and Remote-handled transuranic waste disposal alternatives

  9. A Novel Quasi-SEPIC High-Voltage Boost DC-DC Converter

    DEFF Research Database (Denmark)

    Siwakoti, Yam Prasad; N. Soltani, Mohsen; Blaabjerg, Frede

    2017-01-01

    This paper proposes a modified coupled-inductor SEPIC dc-dc converter for low power and high voltage gain applications such as for piezoelectric drive systems. The converter uses the same components as of SEPIC converter with an additional diode. Compared to conventional topologies with similar...... voltage gain expression, the proposed topology uses less components to achieve same or even higher voltage gain. This helps to design a very compact and light weight converter with higher power density at lower cost. Due to brevity, the principle of operation, theoretical analysis and comparison supported...

  10. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    OpenAIRE

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  11. Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

    Science.gov (United States)

    Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

    2017-10-23

    The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

  12. Maximum permissible voltage of YBCO coated conductors

    Energy Technology Data Exchange (ETDEWEB)

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  13. Microprocessor-controlled, programmable ramp voltage generator

    International Nuclear Information System (INIS)

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  14. Low-Voltage Switched-Capacitor Circuits

    DEFF Research Database (Denmark)

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  15. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  16. Differences in Muscle Activity During Cable Resistance Training Are Influenced by Variations in Handle Types.

    Science.gov (United States)

    Rendos, Nicole K; Heredia Vargas, Héctor M; Alipio, Taislaine C; Regis, Rebeca C; Romero, Matthew A; Signorile, Joseph F

    2016-07-01

    Rendos, NK, Heredia Vargas, HM, Alipio, TC, Regis, RC, Romero, MA, and Signorile, JF. Differences in muscle activity during cable resistance training are influenced by variations in handle types. J Strength Cond Res 30(7): 2001-2009, 2016-There has been a recent resurgence in the use of cable machines for resistance training allowing movements that more effectively simulate daily activities and sports-specific movements. By necessity, these devices require a machine/human interface through some type of handle. Considerable data from material handling, industrial engineering, and exercise training studies indicate that handle qualities, especially size and shape, can significantly influence force production and muscular activity, particularly of the forearm muscles, which affect the critical link in activities that require object manipulation. The purpose for this study was to examine the influence of three different handle conditions: standard handle (StandH), ball handle with the cable between the index and middle fingers (BallIM), and ball handle with the cable between the middle and ring fingers (BallMR), on activity levels (rmsEMG) of the triceps brachii lateral and long heads (TriHLat, TriHLong), brachioradialis (BR), flexor carpi radialis (FCR), extensor carpi ulnaris, and extensor digitorum (ED) during eight repetitions of standing triceps pushdown performed from 90° to 0° elbow flexion at 1.5 s per contractile stage. Handle order was randomized. No significant differences were seen for triceps or BR rmsEMG across handle conditions; however, relative patterns of activation did vary for the forearm muscles by handle condition, with more coordinated activation levels for the FCR and ED during the ball handle conditions. In addition, the rmsEMG for the ED was significantly higher during the BallIM than any other condition and during the BallMR than the StandH. These results indicate that the use of ball handles with the cable passing between different fingers

  17. Excitation of voltage oscillations in an induction voltage adder

    Directory of Open Access Journals (Sweden)

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  18. How Farm Animals React and Perceive Stressful Situations Such As Handling, Restraint, and Transport

    Directory of Open Access Journals (Sweden)

    Temple Grandin

    2015-12-01

    Full Text Available An animal that has been carefully acclimated to handling may willingly re-enter a restrainer. Another animal may have an intense agitated behavioral reaction or refuse to re-enter the handling facility. Physiological measures of stress such as cortisol may be very low in the animal that re-enters willingly and higher in animals that actively resist restraint. Carefully acclimating young animals to handling and restraint can help improve both productivity and welfare by reducing fear stress. Some of the topics covered in this review are: How an animal perceives handling and restraint, the detrimental effects of a sudden novel event, descriptions of temperament and aversion tests and the importance of good stockmanship.

  19. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  20. ALTERATIONS IN ELECTROCARDIOGRAMS OF LABRADOR RETRIEVER DOGS DURING HANDLING WITH AND WITHOUT GLOVES

    Directory of Open Access Journals (Sweden)

    Swagat Mohapatra

    2016-12-01

    Full Text Available Healthy male Labrador Retriever dogs (n=8 aged between one to three years constituted the study material. The study was carried out to peruse the alterations in electrocardiograms, when the attendant restrained the dogs with bare hands and when the dogs were restrained by the attendant wearing gloves. The mean amplitude of P wave was higher in dogs handled with gloves. Similarly, the amplitudes of QRS complex and T wave were higher in the electrocardiograms of dogs handled with insulated hands. Meanwhile, the duration of T wave and Q-T interval were higher in the electrocardiograms recorded without gloves in hands. However, no alterations were perceived with respect to the duration of P wave, duration of T wave, the P-R interval, R-R interval and the heart rate. Except for the amplitude of P wave, no other differences were statistically significant. The study reported the alterations in the electrocardiogram while handling the animals with bare hands.

  1. Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam

    Science.gov (United States)

    Andreev, Andrey

    2005-10-01

    The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.

  2. A Three-Level Quasi-Two-Stage Single-Phase PFC Converter with Flexible Output Voltage and Improved Conversion Efficiency

    DEFF Research Database (Denmark)

    Tang, Yi; Zhu, Dexuan; Jin, Chi

    2015-01-01

    voltages, and it will be very suitable for high-power applications where the output voltage can be either lower or higher than the peak ac input voltage, e.g., plug-in hybrid electric vehicle charging systems. Moreover, the involved dc/dc buck conversion stage may only need to process partial input power...

  3. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  4. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    DEFF Research Database (Denmark)

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  5. Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

    DEFF Research Database (Denmark)

    Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

    2014-01-01

    This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

  6. On-site voltage measurement with capacitive sensors on high voltage systems

    NARCIS (Netherlands)

    Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

    2011-01-01

    In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

  7. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    Science.gov (United States)

    2011-11-22

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

  8. Modeling and Simulation of Low Voltage Arcs

    NARCIS (Netherlands)

    Ghezzi, L.; Balestrero, A.

    2010-01-01

    Modeling and Simulation of Low Voltage Arcs is an attempt to improve the physical understanding, mathematical modeling and numerical simulation of the electric arcs that are found during current interruptions in low voltage circuit breakers. An empirical description is gained by refined electrical

  9. Reduced Voltage Scaling in Clock Distribution Networks

    Directory of Open Access Journals (Sweden)

    Khader Mohammad

    2009-01-01

    Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.

  10. The LMF triaxial MITL voltage adder system

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  11. Time isolation high-voltage impulse generator

    International Nuclear Information System (INIS)

    Chodorow, A.M.

    1975-01-01

    Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation

  12. High-voltage engineering and testing

    CERN Document Server

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  13. Improving transition voltage spectroscopy of molecular junctions

    DEFF Research Database (Denmark)

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...

  14. Reducing Ripple In A Switching Voltage Regulator

    Science.gov (United States)

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  15. Wide-range voltage modulation

    International Nuclear Information System (INIS)

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  16. GECM-Based Voltage Stability Assessment Using Wide-Area Synchrophasors

    Directory of Open Access Journals (Sweden)

    Heng-Yi Su

    2017-10-01

    Full Text Available Voltage instability is a crucial issue in the secure operation of power grids. Several methods for voltage stability assessment were presented. Some of them are highly computationally intensive, while others are reported not to work properly under all circumstances. This paper proposes a new methodology based on the generator equivalent circuit model (GECM and the phasor measurement unit (PMU technology for online voltage stability monitoring of a power grid. First, the proposed methodology utilizes synchronized phasor (synchrophasor measurements to determine the impedance parameters of a transmission grid by means of the recursive least squares (RLS algorithm. Furthermore, it incorporates the dynamic models of generators to handle the cases with generator reactive power limit violations. After that, an enhanced voltage stability index with GECMs incorporated is developed for reliable and accurate voltage stability assessment. The proposed methodology was first demonstrated on several standard IEEE power systems, and then applied to a practical power system, the Taiwan power (Taipower system. The test results demonstrate the flexibility and effectiveness of the proposed methodology.

  17. Methodology for the assessment of possible damages in low voltage equipment due to lightning surges

    Energy Technology Data Exchange (ETDEWEB)

    Matsuo, Nelson M.; Kagan, Nelson [University of Sao Paulo (USP), SP (Brazil)], Emails: matsuonm@usp.br, nelsonk@pea.usp.br; Domingues, Ivo T. [AES Eletropaulo, SP (Brazil); Jesus, Nelson C. de [AES Sul, Porto Alegre, RS (Brazil); Silva, Marcelo H.I. da [Grupo Rede, Sao Paulo, SP (Brazil); Takauti, Edson H. [Bandeirante, Sao Paulo, SP (Brazil)

    2007-07-01

    This paper deals with the development of a methodology to assess the possibility of equipment damages in low voltage customers due to lightning surges. The main objective is to incorporate this methodology in a computation system that supports distribution companies to determine the possible causes of equipment damages claimed by customers and to decide whether the claims are to be reimbursed or not. The proposed methodology determines whether a specific customer could be affected by a lightning strike according to his/her location and to the lightning main parameters, by using data from a lightning detection system and from the specific equipment surge withstand capability. A specific study using ATP (Alternative Transients Program) was carried out to assess the propagation of lightning surges in electric power distribution systems and their impact over low voltage customers. On the other hand, the withstand capability of the main household appliances was determined by a series of tests carried out in the University's power quality laboratory. The paper details the modeling used for simulation, such as network configuration, grounding points, and modelling of insulator flashover, distribution transformer, low voltage loads. It also presents some results regarding the evaluation of over voltages in low voltage customers installations. A practical method is proposed for assessing the possibility of equipment damage and describes how the existing uncertainties were handled. Also, some issues regarding the withstand capability of electric household appliances to lightning surges are discussed and some results of the laboratory tests are presented. (author)

  18. Influence of water trees on breakdown voltage of polymeric cables insulations

    Energy Technology Data Exchange (ETDEWEB)

    Stancu, Cristina [INCDIE ICPE CA, Bucharest (Romania); Notingher, Petru V.; Plopeanu, Mihai Gabriel [Politehnica University of Bucharest, Bucharest (Romania)

    2011-07-01

    In a previous paper was shown that water trees development modifies considerably the electric field repartition, which increases significantly in the vicinity of treed areas. In order to find the water trees influence on the breakdown voltage, in the present paper, an experimental study on model cables insulated with low density polyethylene is done. In insulation samples, water trees with various dimensions and densities were developed. For the reduction of the test duration, an electric field with a higher frequency (3-5 kHz) was used. For breakdown voltage measurement an automatic setup was realized. For each value of the ageing time the dimensions and densities of water trees and breakdown voltage were measured and the dependency of the breakdown voltage with these quantities were analysed. The results show a significant reduction of the breakdown voltage of treed cables insulations compared to un-treed ones. Key words: polyethylene, water treeing, electric field, breakdown, power cables.

  19. High voltage generator circuit with low power and high efficiency applied in EEPROM

    International Nuclear Information System (INIS)

    Liu Yan; Zhang Shilin; Zhao Yiqiang

    2012-01-01

    This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

  20. Effect of anodizing voltage on the sorption of water molecules on porous alumina

    Energy Technology Data Exchange (ETDEWEB)

    Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)

    2012-05-01

    The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).

  1. Development of liquid handling techniques in microgravity

    Science.gov (United States)

    Antar, Basil N.

    1995-01-01

    A large number of experiments dealing with protein crystal growth and also with growth of crystals from solution require complicated fluid handling procedures including filling of empty containers with liquids, mixing of solutions, and stirring of liquids. Such procedures are accomplished in a straight forward manner when performed under terrestrial conditions in the laboratory. However, in the low gravity environment of space, such as on board the Space Shuttle or an Earth-orbiting space station, these procedures sometimes produced entirely undesirable results. Under terrestrial conditions, liquids usually completely separate from the gas due to the buoyancy effects of Earth's gravity. Consequently, any gas pockets that are entrained into the liquid during a fluid handling procedure will eventually migrate towards the top of the vessel where they can be removed. In a low gravity environment any folded gas bubble will remain within the liquid bulk indefinitely at a location that is not known a priori resulting in a mixture of liquid and vapor.

  2. Fission reactor recycling pump handling device

    International Nuclear Information System (INIS)

    Togasawa, Hiroshi; Komita, Hideo; Susuki, Shoji; Endo, Takio; Yamamoto, Tetsuzo; Takahashi, Hideaki; Saito, Noboru.

    1991-01-01

    This invention provides a device for handling a recycling pump in a nuclear reactor upon periodical inspections in a BWR type power plant. That is, in a handling device comprising a support for supporting components of a recycling pump, and a lifter for vertically moving the support below a motor case disposed passing through a reactor pressure vessel, a weight is disposed below the support. Then, the center of gravity of the components, the support and the entire weight is substantially aligned with the position for the support. With such a constitution, the components can be moved vertically to the motor case extremely safely, to remarkably suppress vibrations. Further, the operation safety can remarkably be improved by preventing turning down upon occurrence of earthquakes. Further, since vibration-proof jigs as in a prior art can be saved, operation efficiency can be improved. (I.S.)

  3. Experience of Data Handling with IPPM Payload

    Science.gov (United States)

    Errico, Walter; Tosi, Pietro; Ilstad, Jorgen; Jameux, David; Viviani, Riccardo; Collantoni, Daniele

    2010-08-01

    A simplified On-Board Data Handling system has been developed by CAEN AURELIA SPACE and ABSTRAQT as PUS-over-SpaceWire demonstration platform for the Onboard Payload Data Processing laboratory at ESTEC. The system is composed of three Leon2-based IPPM (Integrated Payload Processing Module) computers that play the roles of Instrument, Payload Data Handling Unit and Satellite Management Unit. Two PCs complete the test set-up simulating an external Memory Management Unit and the Ground Control Unit. Communication among units take place primarily through SpaceWire links; RMAP[2] protocol is used for configuration and housekeeping. A limited implementation of ECSS-E-70-41B Packet Utilisation Standard (PUS)[1] over CANbus and MIL-STD-1553B has been also realized. The Open Source RTEMS is running on the IPPM AT697E CPU as real-time operating system.

  4. Process & Quality procedures for transport & handling activities

    CERN Document Server

    Böttcher, O

    2002-01-01

    To respect the detailed and complex planning of the LHC installation project it is essential to reduce possible faults in every technical service that can cause delays in the schedule. In order to ensure proper execution of transport and handling activities it is important to get detailed information from the clients as early as possible in order to do the planning and the organisation of the required resources. One procedure that requires greater focus in the future is the preparation of the resources. The goal is to prevent equipment breakdowns and accidents while executing transport and handling activities. In the LEP dismantling project multiple breakdowns of important cranes caused serious problems in the project schedule. For the LHC installation project similar incidents in the reliability of the equipment cannot be accepted because of the high sensitivity of the whole schedule. This paper shall outline the efforts and methods that are put in place in order to meet the LHC installation requirements.

  5. Trends in remote handling device development

    International Nuclear Information System (INIS)

    Raimondi, T.

    1991-01-01

    A brief review is given of studies on layouts and methods for handling some major components requiring remote maintenance in future fusion reactors: Neutral sources and beam lines, the blanket, divertor plates, armour tiles and vacuum pumps. Comparison is made to problems encountered in JET, methods and equipment used and development work done there. Areas requiring development and research are outlined. These include topics which are the subject of papers presented here, such as dynamic studies and control of transporters, improvements to the man-machine interface and hot cell equipment. A variety of other topics where effort is needed are also mentioned: Environmental tolerance of components and equipment, TV viewing and compensation of viewing difficulties with aids such as computer graphics and image processing, safety assessment, computer aids for remote manipulation, remote cutting and welding techniques, routine in-vessel inspection methods and selection of connectors and flanges for remote handling. (orig.)

  6. Fission reactor recycling pump handling device

    Energy Technology Data Exchange (ETDEWEB)

    Togasawa, Hiroshi; Komita, Hideo; Susuki, Shoji; Endo, Takio; Yamamoto, Tetsuzo; Takahashi, Hideaki; Saito, Noboru

    1991-06-24

    This invention provides a device for handling a recycling pump in a nuclear reactor upon periodical inspections in a BWR type power plant. That is, in a handling device comprising a support for supporting components of a recycling pump, and a lifter for vertically moving the support below a motor case disposed passing through a reactor pressure vessel, a weight is disposed below the support. Then, the center of gravity of the components, the support and the entire weight is substantially aligned with the position for the support. With such a constitution, the components can be moved vertically to the motor case extremely safely, to remarkably suppress vibrations. Further, the operation safety can remarkably be improved by preventing turning down upon occurrence of earthquakes. Further, since vibration-proof jigs as in a prior art can be saved, operation efficiency can be improved. (I.S.).

  7. Adaptive control of manipulators handling hazardous waste

    International Nuclear Information System (INIS)

    Colbaugh, R.; Glass, K.

    1994-01-01

    This article focuses on developing a robot control system capable of meeting hazardous waste handling application requirements, and presents as a solution an adaptive strategy for controlling the mechanical impedance of kinematically redundant manipulators. The proposed controller is capable of accurate end-effector impedance control and effective redundancy utilization, does not require knowledge of the complex robot dynamic model or parameter values for the robot or the environment, and is implemented without calculation of the robot inverse transformation. Computer simulation results are given for a four degree of freedom redundant robot under adaptive impedance control. These results indicate that the proposed controller is capable of successfully performing important tasks in robotic waste handling applications. (author) 3 figs., 39 refs

  8. Handling construction waste of building demolition

    Directory of Open Access Journals (Sweden)

    Vondráčková Terezie

    2018-01-01

    Full Text Available Some building defects lead to their demolition. What about construction and demolition waste? According to the Waste Act 185/2001 Coll. and its amendment 223/2015 Coll., which comes into force on January 1, 2017, the production of waste has to be reduced because, as already stated in the amendment to Act No. 229/2014 Coll., the ban on landfilling of waste will apply from 2024 onwards. The main goals of waste management can thus be considered: Preventing or minimizing waste; Waste handling to be used as a secondary raw material - recycling, composting, combustion and the remaining waste to be dumped. Company AZS 98 s. r. o. was established, among other activities, also for the purpose of recycling construction and demolition waste. It operates 12 recycling centers throughout the Czech Republic and therefore we have selected it for a demonstration of the handling of construction and demolition waste in addressing the defects of the buildings.

  9. Chromosome analyses of nurses handling cytostatic agents

    International Nuclear Information System (INIS)

    Waksvik, H.; Klepp, O.; Brogger, A.

    1981-01-01

    A cytogenetic study of ten nurses handling cytostatic agents (average exposure, 2150 hours) and ten female hospital clerks revealed an increased frequency of chromosome gaps and a slight increase in sister chromatid exchange frequency among the nurses. The increase may be due to exposure to cytostatic drugs and points to these agents as a possible occupational health hazard. A second group of 11 nurses handling cytostatic agents for a shorter period of time (average exposure, 1078 hours), and three other groups (eight nurses engaged in therapeutic and diagnostic radiology, nine nurses engaged in anesthesiology, and seven nurses in postoperative ward) did not differ from the office personnel, except for an increased frequency of chromosome gaps in the radiology group

  10. Robotic requirements for plutonium handling automation

    International Nuclear Information System (INIS)

    Heywood, A.C.; Armantrout, G.A.

    1990-01-01

    While over 200,000 robots are in manufacturing service worldwide, only two are in use for the handling of plutonium in a glovebox. The difficulties of applying robotics to the glovebox environment include limited access for service and maintenance, radiation damage to electronics and insulators, and abrasion damage to bearings and sliding surfaces. The limited volume of the glovebox environment, and the need to handle heavy workloads, and the need to maximize work volume dictates the use of an overhead gantry system. This paper discusses how the application of such a system will require a robot with extensive safety features, a high degree of flexibility to perform a variety of tasks, and high reliability coupled with an easily serviced design. Substantial challenges exist in control system design, sensor and operator integration, and programming to achieve these goals

  11. Player-Specific Conflict Handling Ontology

    Directory of Open Access Journals (Sweden)

    Charline Hondrou

    2014-09-01

    Full Text Available This paper presents an ontology that leads the player of a serious game - regarding conflict handling - to the educative experience from which they will benefit the most. It provides a clearly defined tree of axioms that maps the player’s visually manifested affective cues and emotional stimuli from the serious game to conflict handling styles and proposes interventions. The importance of this ontology lies in the fact that it promotes natural interaction (non-invasive methods and at the same time makes the game as player-specific as it can be for its educational goal. It is an ontology that can be adapted to different educational theories and serve various educational purposes.

  12. Remote Inspection, Measurement and Handling for LHC

    CERN Document Server

    Kershaw, K; Coin, A; Delsaux, F; Feniet, T; Grenard, J L; Valbuena, R

    2007-01-01

    Personnel access to the LHC tunnel will be restricted to varying extents during the life of the machine due to radiation, cryogenic and pressure hazards. The ability to carry out visual inspection, measurement and handling activities remotely during periods when the LHC tunnel is potentially hazardous offers advantages in terms of safety, accelerator down time, and costs. The first applications identified were remote measurement of radiation levels at the start of shut-down, remote geometrical survey measurements in the collimation regions, and remote visual inspection during pressure testing and initial machine cool-down. In addition, for remote handling operations, it will be necessary to be able to transmit several real-time video images from the tunnel to the control room. The paper describes the design, development and use of a remotely controlled vehicle to demonstrate the feasibility of meeting the above requirements in the LHC tunnel. Design choices are explained along with operating experience to-dat...

  13. A Perspective on Remote Handling Operations and Human Machine Interface for Remote Handling in Fusion

    International Nuclear Information System (INIS)

    Haist, B.; Hamilton, D.; Sanders, St.

    2006-01-01

    A large-scale fusion device presents many challenges to the remote handling operations team. This paper is based on unique operational experience at JET and gives a perspective on remote handling task development, logistics and resource management, as well as command, control and human-machine interface systems. Remote operations require an accurate perception of a dynamic environment, ideally providing the operators with the same unrestricted knowledge of the task scene as would be available if they were actually at the remote work location. Traditional camera based systems suffer from a limited number of viewpoints and also degrade quickly when exposed to high radiation. Virtual Reality and Augmented Reality software offer great assistance. The remote handling system required to maintain a tokamak requires a large number of different and complex pieces of equipment coordinating to perform a large array of tasks. The demands on the operator's skill in performing the tasks can escalate to a point where the efficiency and safety of operations are compromised. An operations guidance system designed to facilitate the planning, development, validation and execution of remote handling procedures is essential. Automatic planning of motion trajectories of remote handling equipment and the remote transfer of heavy loads will be routine and need to be reliable. This paper discusses the solutions developed at JET in these areas and also the trends in management and presentation of operational data as well as command, control and HMI technology development offering the potential to greatly assist remote handling in future fusion machines. (author)

  14. Handling of wet residues in industry

    DEFF Research Database (Denmark)

    Villanueva, Alejandro

    is fundamental in most disposal routes for clarifying the possibility of treating the residue. The better the characterisation from the start is, the easier the assessment of the feasible disposal alternatives becomes. The decision about the handling/disposal solution for the residue is a trade-off between......, and can depend on factors such as the investment capacity, the relationships with the stakeholders, or the promotion of its environmental profile....

  15. Safe handling of plutonium in research laboratories

    International Nuclear Information System (INIS)

    1976-01-01

    The training film illustrates the main basic requirements for the safe handling of small amounts of plutonium. The film is intended not only for people setting up plutonium research laboratories but also for all those who work in existing plutonium research laboratories. It was awarded the first prize in the category ''Protection of Workers'' at the international film festival organized by the 4th World Congress of the International Radiation Protection Association (IRPA) in Paris in April 1977

  16. Development of spent fuel remote handling technology

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Sup; Park, B S; Park, Y S; Oh, S C; Kim, S H; Cho, M W; Hong, D H

    1997-12-01

    Since the nation`s policy on spent fuel management is not finalized, the technical items commonly required for safe management and recycling of spent fuel - remote technologies of transportation, inspection, maintenance, and disassembly of spent fuel - are selected and pursued. In this regards, the following R and D activities are carried out : collision free transportation of spent fuel assembly, mechanical disassembly of spent nuclear fuel and graphical simulation of fuel handling / disassembly process. (author). 36 refs., 16 tabs., 77 figs

  17. Repository waste-handling operations, 1998

    International Nuclear Information System (INIS)

    Cottam, A.E.; Connell, L.

    1986-04-01

    The Civilian Radioactive Waste Management Program Mission Plan and the Generic Requirements for a Mined Geologic Disposal System state that beginning in 1998, commercial spent fuel not exceeding 70,000 metric tons of heavy metal, or a quantity of solidified high-level radioactive waste resulting from the reprocessing of such a quantity of spent fuel, will be shipped to a deep geologic repository for permanent storage. The development of a waste-handling system that can process 3000 metric tons of heavy metal annually will require the adoption of a fully automated approach. The safety and minimum exposure of personnel will be the prime goals of the repository waste handling system. A man-out-of-the-loop approach will be used in all operations including the receipt of spent fuel in shipping casks, the inspection and unloading of the spent fuel into automated hot-cell facilities, the disassembly of spent fuel assemblies, the consolidation of fuel rods, and the packaging of fuel rods into heavy-walled site-specific containers. These containers are designed to contain the radionuclides for up to 1000 years. The ability of a repository to handle more than 6000 pressurized water reactor spent-fuel rods per day on a production basis for approximately a 23-year period will require that a systems approach be adopted that combines space-age technology, robotics, and sophisticated automated computerized equipment. New advanced inspection techniques, maintenance by robots, and safety will be key factors in the design, construction, and licensing of a repository waste-handling facility for 1998

  18. Means for attaching remote handling tongs

    International Nuclear Information System (INIS)

    Kearney, A.S.

    1982-01-01

    A remote handling tong has a replaceable slave head assembly provided with a spring biased latch which engages a recess in a barrel member of the tong. The latch bolt extends transverse to the barrel member, and has studs which project at each end beyond the body of the slave head assembly so as to engage respective linear cam surfaces at a station for parking the slave head assembly. (author)

  19. Inert gas handling in ion plating systems

    International Nuclear Information System (INIS)

    Goode, A.R.; Burden, M.St.J.

    1979-01-01

    The results of an investigation into the best methods for production and monitoring of the inert gas environment for ion plating systems are reported. Work carried out on Pirani gauges and high pressure ion gauges for the measurement of pressures in the ion plating region (1 - 50mtorr) and the use of furnaces for cleaning argon is outlined. A schematic of a gas handling system is shown and discussed. (UK)

  20. Development of spent fuel remote handling technology

    International Nuclear Information System (INIS)

    Yoon, Ji Sup; Park, B. S.; Park, Y. S.; Oh, S. C.; Kim, S. H.; Cho, M. W.; Hong, D. H.

    1997-12-01

    Since the nation's policy on spent fuel management is not finalized, the technical items commonly required for safe management and recycling of spent fuel - remote technologies of transportation, inspection, maintenance, and disassembly of spent fuel - are selected and pursued. In this regards, the following R and D activities are carried out : collision free transportation of spent fuel assembly, mechanical disassembly of spent nuclear fuel and graphical simulation of fuel handling / disassembly process. (author). 36 refs., 16 tabs., 77 figs

  1. Powder handling for automated fuel processing

    International Nuclear Information System (INIS)

    Frederickson, J.R.; Eschenbaum, R.C.; Goldmann, L.H.

    1989-01-01

    Installation of the Secure Automated Fabrication (SAF) line has been completed. It is located in the Fuel Cycle Plant (FCP) at the Department of Energy's (DOE) Hanford site near Richland, Washington. The SAF line was designed to fabricate advanced reactor fuel pellets and assemble fuel pins by automated, remote operation. This paper describes powder handling equipment and techniques utilized for automated powder processing and powder conditioning systems in this line. 9 figs

  2. Safe handling of plutonium in research laboratories

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1977-12-31

    The training film illustrates the main basic requirements for the safe handling of small amounts of plutonium. The film is intended not only for people setting up plutonium research laboratories but also for all those who work in existing plutonium research laboratories. It was awarded the first prize in the category ``Protection of Workers`` at the international film festival organized by the 4th World Congress of the International Radiation Protection Association (IRPA) in Paris in April 1977

  3. Statistical methods for handling incomplete data

    CERN Document Server

    Kim, Jae Kwang

    2013-01-01

    ""… this book nicely blends the theoretical material and its application through examples, and will be of interest to students and researchers as a textbook or a reference book. Extensive coverage of recent advances in handling missing data provides resources and guidelines for researchers and practitioners in implementing the methods in new settings. … I plan to use this as a textbook for my teaching and highly recommend it.""-Biometrics, September 2014

  4. Practical considerations in voltage stability assessment

    Energy Technology Data Exchange (ETDEWEB)

    Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)

    1994-12-31

    This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.

  5. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  6. Non-contact current and voltage sensor

    Science.gov (United States)

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.

  7. Coordinated Voltage Control of Active Distribution Network

    Directory of Open Access Journals (Sweden)

    Xie Jiang

    2016-01-01

    Full Text Available This paper presents a centralized coordinated voltage control method for active distribution network to solve off-limit problem of voltage after incorporation of distributed generation (DG. The proposed method consists of two parts, it coordinated primal-dual interior point method-based voltage regulation schemes of DG reactive powers and capacitors with centralized on-load tap changer (OLTC controlling method which utilizes system’s maximum and minimum voltages, to improve the qualified rate of voltage and reduce the operation numbers of OLTC. The proposed coordination has considered the cost of capacitors. The method is tested using a radial edited IEEE-33 nodes distribution network which is modelled using MATLAB.

  8. Uranium hexafluoride: Handling procedures and container descriptions

    International Nuclear Information System (INIS)

    1987-09-01

    The US Department of Energy (DOE) guidelines for packaging, measuring, and transferring uranium hexafluoride (UF 6 ) have been undergoing continual review and revision for several years to keep them in phase with developing agreements for the supply of enriched uranium. Initially, K-1323 ''A Brief Guide to UF 6 Handling,'' was issued in 1957. This was superceded by ORO-651, first issued in 1966, and reissued in 1967 to make editorial changes and to provide minor revisions in procedural information. In 1968 and 1972, Revisions 2 and 3, respectively, were issued as part of the continuing effort to present updated information. Revision 4 issued in 1977 included revisions to UF 6 cylinders, valves, and methods to use. Revision 5 adds information dealing with pigtails, overfilled cylinders, definitions and handling precautions, and cylinder heel reduction procedures. Weighing standards previously presented in ORO-671, Vol. 1 (Procedures for Handling and Analysis of UF 6 ) have also been included. This revision, therefore, supercedes ORO-671-1 as well as all prior issues of this report. These guidelines will normally apply in all transactions involving receipt or shipment of UF 6 by DOE, unless stipulated otherwise by contracts or agreements with DOE or by notices published in the Federal Register. Any questions or requests for additional information on the subject matter covered herein should be directed to the United States Department of Energy, P.O. Box E, Oak Ridge, Tennessee 37831, Attention: Director, Uranium Enrichment Operations Division. 33 figs., 12 tabs

  9. Vestibule and Cask Preparation Mechanical Handling Calculation

    International Nuclear Information System (INIS)

    Ambre, N.

    2004-01-01

    The scope of this document is to develop the size, operational envelopes, and major requirements of the equipment to be used in the vestibule, cask preparation area, and the crane maintenance area of the Fuel Handling Facility. This calculation is intended to support the License Application (LA) submittal of December 2004, in accordance with the directive given by DOE correspondence received on the 27th of January 2004 entitled: ''Authorization for Bechtel SAIC Company L.L.C. to Include a Bare Fuel Handling Facility and Increased Aging Capacity in the License Application, Contract Number DE-AC--28-01R W12101'' (Ref. 167124). This correspondence was appended by further correspondence received on the 19th of February 2004 entitled: ''Technical Direction to Bechtel SAIC Company L.L. C. for Surface Facility Improvements, Contract Number DE-AC--28-01R W12101; TDL No. 04-024'' (Ref. 16875 1). These documents give the authorization for a Fuel Handling Facility to be included in the baseline. The limitations of this preliminary calculation lie within the assumptions of section 5 , as this calculation is part of an evolutionary design process

  10. Remote handling systems for the Pride application

    International Nuclear Information System (INIS)

    Kim, K.; Lee, J.; Lee, H.; Kim, S.; Kim, H.

    2010-10-01

    In this paper is described the development of remote handling systems for use in the pyro processing technology development. Remote handling systems mainly include a BDSM (Bridge transported Dual arm Servo-Manipulator) and a simulator, all of which will be applied to the Pride (Pyro process integrated inactive demonstration facility) that is under construction at KAERI. BDMS that will traverse the length of the ceiling is designed to have two pairs of master-slave manipulators of which each pair of master-slave manipulators has a kinematic similarity and a force reflection. A simulator is also designed to provide an efficient means for simulating and verifying the conceptual design, developments, arrangements, and rehearsal of the pyro processing equipment and relevant devices from the viewpoint of remote operation and maintenance. In our research is presented activities and progress made in developing remote handling systems to be used for the remote operation and maintenance of the pyro processing equipment and relevant devices in the Pride. (Author)

  11. Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

    Directory of Open Access Journals (Sweden)

    Perić Dragoslav M.

    2015-01-01

    Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

  12. Comparative Study of Breakdown Voltage of Mineral, Synthetic and Natural Oils and Based Mineral Oil Mixtures under AC and DC Voltages

    Directory of Open Access Journals (Sweden)

    Abderrahmane Beroual

    2017-04-01

    Full Text Available This paper deals with a comparative study of AC and DC breakdown voltages of based mineral oil mixtures with natural and synthetic esters mainly used in high voltage power transformers. The goal was to analyze the performances of oil mixtures from the dielectric withstand point of view and to predict the behavior of transformers originally filled with mineral oil and re-filled with synthetic or natural ester oils when emptied for maintenance. The study concerns mixtures based on 20%, 50%, and 80% of natural and synthetic ester oils. AC breakdown voltages were measured using a sphere-sphere electrode system according to IEC 60156 specifications; the same specification was adopted for DC measurements since there is no standard specifications for this voltage waveform. A statistical analysis of the mean values, standard deviations, and histograms of breakdown voltage data was carried out. The Normal and Weibull distribution functions were used to analyze the experimental data and the best function that the data followed was used to estimate the breakdown voltage with risk of 1%, 10%, and 50% probability. It was shown that whatever the applied voltage waveforms, ester oils always have a significantly higher breakdown voltage than mineral oil. The addition of only 20% of natural or synthetic ester oil was sufficient to considerably increase the breakdown voltage of mineral oil. The dielectric strength of such a mixture is much higher than that of mineral oil alone and can reach that of ester oils. From the point of view of dielectric strength, the mixtures constitute an option for improving the performance of mineral oil. Thus, re-filling of transformers containing up to 20% mineral oil residues with ester oils, does not present any problem; it is even advantageous when considering only the breakdown voltage. Under AC, the mixtures with natural ester always follow the behavior of vegetable oil alone. With the exception of the 20% mixture of natural

  13. Influence of the voltage polarity on the properties of a nanosecond surface barrier discharge in atmospheric-pressure air

    International Nuclear Information System (INIS)

    Nudnova, M. M.; Aleksandrov, N. L.; Starikovskii, A. Yu.

    2010-01-01

    The properties of a surface barrier discharge in atmospheric-pressure air at different polarities of applied voltage were studied experimentally. The influence of the voltage polarity on the spatial structure of the discharge and the electric field in the discharge plasma was determined by means of spectroscopic measurements. It is found that the energy deposited in the discharge does not depend on the voltage polarity and that discharges of positive polarity are more homogenous and the electric fields in them are higher.

  14. CANISTER HANDLING FACILITY CRITICALITY SAFETY CALCULATIONS

    Energy Technology Data Exchange (ETDEWEB)

    C.E. Sanders

    2005-04-07

    This design calculation revises and updates the previous criticality evaluation for the canister handling, transfer and staging operations to be performed in the Canister Handling Facility (CHF) documented in BSC [Bechtel SAIC Company] 2004 [DIRS 167614]. The purpose of the calculation is to demonstrate that the handling operations of canisters performed in the CHF meet the nuclear criticality safety design criteria specified in the ''Project Design Criteria (PDC) Document'' (BSC 2004 [DIRS 171599], Section 4.9.2.2), the nuclear facility safety requirement in ''Project Requirements Document'' (Canori and Leitner 2003 [DIRS 166275], p. 4-206), the functional/operational nuclear safety requirement in the ''Project Functional and Operational Requirements'' document (Curry 2004 [DIRS 170557], p. 75), and the functional nuclear criticality safety requirements described in the ''Canister Handling Facility Description Document'' (BSC 2004 [DIRS 168992], Sections 3.1.1.3.4.13 and 3.2.3). Specific scope of work contained in this activity consists of updating the Category 1 and 2 event sequence evaluations as identified in the ''Categorization of Event Sequences for License Application'' (BSC 2004 [DIRS 167268], Section 7). The CHF is limited in throughput capacity to handling sealed U.S. Department of Energy (DOE) spent nuclear fuel (SNF) and high-level radioactive waste (HLW) canisters, defense high-level radioactive waste (DHLW), naval canisters, multicanister overpacks (MCOs), vertical dual-purpose canisters (DPCs), and multipurpose canisters (MPCs) (if and when they become available) (BSC 2004 [DIRS 168992], p. 1-1). It should be noted that the design and safety analyses of the naval canisters are the responsibility of the U.S. Department of the Navy (Naval Nuclear Propulsion Program) and will not be included in this document. In addition, this calculation is valid for

  15. CANISTER HANDLING FACILITY CRITICALITY SAFETY CALCULATIONS

    International Nuclear Information System (INIS)

    C.E. Sanders

    2005-01-01

    This design calculation revises and updates the previous criticality evaluation for the canister handling, transfer and staging operations to be performed in the Canister Handling Facility (CHF) documented in BSC [Bechtel SAIC Company] 2004 [DIRS 167614]. The purpose of the calculation is to demonstrate that the handling operations of canisters performed in the CHF meet the nuclear criticality safety design criteria specified in the ''Project Design Criteria (PDC) Document'' (BSC 2004 [DIRS 171599], Section 4.9.2.2), the nuclear facility safety requirement in ''Project Requirements Document'' (Canori and Leitner 2003 [DIRS 166275], p. 4-206), the functional/operational nuclear safety requirement in the ''Project Functional and Operational Requirements'' document (Curry 2004 [DIRS 170557], p. 75), and the functional nuclear criticality safety requirements described in the ''Canister Handling Facility Description Document'' (BSC 2004 [DIRS 168992], Sections 3.1.1.3.4.13 and 3.2.3). Specific scope of work contained in this activity consists of updating the Category 1 and 2 event sequence evaluations as identified in the ''Categorization of Event Sequences for License Application'' (BSC 2004 [DIRS 167268], Section 7). The CHF is limited in throughput capacity to handling sealed U.S. Department of Energy (DOE) spent nuclear fuel (SNF) and high-level radioactive waste (HLW) canisters, defense high-level radioactive waste (DHLW), naval canisters, multicanister overpacks (MCOs), vertical dual-purpose canisters (DPCs), and multipurpose canisters (MPCs) (if and when they become available) (BSC 2004 [DIRS 168992], p. 1-1). It should be noted that the design and safety analyses of the naval canisters are the responsibility of the U.S. Department of the Navy (Naval Nuclear Propulsion Program) and will not be included in this document. In addition, this calculation is valid for the current design of the CHF and may not reflect the ongoing design evolution of the facility

  16. Cyberbullying in Higher Education: Implications and Solutions

    Science.gov (United States)

    Smith, Gina S.; Minor, Maria A.; Brashen, Henry M.

    2014-01-01

    Cyberbullying exists in all levels of education, from kindergarten to postsecondary. Few studies have been conducted to examine the impact of cyberbullying in higher education. Minor, Smith, and Brashen (2013) identified the need for colleges and universities to set policies and standards on how to handle faculty being cyberbullying by students.…

  17. Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

    Science.gov (United States)

    Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

    2017-10-01

    Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  19. Epidemiological study of health hazards among workers handling engineered nanomaterials

    International Nuclear Information System (INIS)

    Liou, Saou-Hsing; Tsou, Tsui-Chun; Wang, Shu-Li; Li, Lih-Ann; Chiang, Hung-Che; Li, Wan-Fen; Lin, Pin-Pin; Lai, Ching-Huang; Lee, Hui-Ling; Lin, Ming-Hsiu; Hsu, Jin-Huei; Chen, Chiou-Rong; Shih, Tung-Sheng; Liao, Hui-Yi; Chung, Yu-Teh

    2012-01-01

    The aim of this study was to establish and identify the health effect markers of workers with potential exposure to nanoparticles (20–100 nm) during manufacturing and/or application of nanomaterials. For this cross-sectional study, we recruited 227 workers who handled nanomaterials and 137 workers for comparison who did not from 14 plants in Taiwan. A questionnaire was used to collect data on exposure status, demographics, and potential confounders. The health effect markers were measured in the medical laboratory. Control banding from the Nanotool Risk Level Matrix was used to categorize the exposure risk levels of the workers. The results showed that the antioxidant enzyme, superoxide dismutase (SOD) in risk level 1 (RL1) and risk level 2 (RL2) workers was significantly (p RL1 > RL2). Another antioxidant, glutathione peroxidase (GPX), was significantly lower only in RL1 workers than in the control workers. The cardiovascular markers, fibrinogen and ICAM (intercellular adhesion molecule), were significantly higher in RL2 workers than in controls and a significant dose–response with an increasing trend was found for these two cardiovascular markers. Another cardiovascular marker, interleukin-6, was significantly increased among RL1 workers, but not among RL2 workers. The accuracy rate for remembering 7-digits and reciting them backwards was significantly lower in RL2 workers (OR = 0.48) than in controls and a significantly reversed gradient was also found for the correct rate of backward memory (OR = 0.90 for RL1, OR = 0.48 for RL2, p < 0.05 in test for trend). Depression of antioxidant enzymes and increased expression of cardiovascular markers were found among workers handling nanomaterials. Antioxidant enzymes, such as SOD and GPX, and cardiovascular markers, such as fibrinogen, ICAM, and interluekin-6, are possible biomarkers for medical surveillance of workers handling engineered nanomaterials.

  20. Total Quality Management in Higher Education: Applying Deming's Fourteen Points.

    Science.gov (United States)

    Masters, Robert J.; Leiker, Linda

    1992-01-01

    This article presents guidelines to aid administrators of institutions of higher education in applying the 14 principles of Total Quality Management. The principles stress understanding process improvements, handling variation, fostering prediction, and using psychology to capitalize on human resources. (DB)

  1. Unified analytical threshold voltage model for non-uniformly doped dual metal gate fully depleted silicon-on-insulator MOSFETs

    Science.gov (United States)

    Rao, Rathnamala; Katti, Guruprasad; Havaldar, Dnyanesh S.; DasGupta, Nandita; DasGupta, Amitava

    2009-03-01

    The paper describes the unified analytical threshold voltage model for non-uniformly doped, dual metal gate (DMG) fully depleted silicon-on-insulator (FDSOI) MOSFETs based on the solution of 2D Poisson's equation. 2D Poisson's equation is solved analytically for appropriate boundary conditions using separation of variables technique. The solution is then extended to obtain the threshold voltage of the FDSOI MOSFET. The model is able to handle any kind of non-uniform doping, viz. vertical, lateral as well as laterally asymetric channel (LAC) profile in the SOI film in addition to the DMG structure. The analytical results are validated with the numerical simulations using the device simulator MEDICI.

  2. Voltage-sensing phosphatase modulation by a C2 domain

    Directory of Open Access Journals (Sweden)

    Paul M. Castle

    2015-04-01

    Full Text Available The voltage-sensing phosphatase (VSP is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD, the inter-domain linker, the cytosolic catalytic domain and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate (PI(4,5P2 (Kalli et al., 2014. Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

  3. Voltage-sensing phosphatase modulation by a C2 domain.

    Science.gov (United States)

    Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

    2015-01-01

    The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in

  4. Novel Voltage limiting concept for avalance breakdown protection

    NARCIS (Netherlands)

    Ruijs, L.C.H.; Bezooijen, van A.; Mahmoudi, R.; Roermund, van A.H.M.

    2006-01-01

    Destructive over-voltage breakdown of cellular phone power transistors is prevented by using a new voltage-limiting concept. The output voltage is detected by an avalanche-based detector, and limited by decreasing the output power when needed. The voltage detector contains a low voltage bipolar NPN

  5. Combined application of Product Lifecycle and Software Configuration Management systems for ITER remote handling

    International Nuclear Information System (INIS)

    Muhammad, Ali; Esque, Salvador; Aha, Liisa; Mattila, Jouni; Siuko, Mikko; Vilenius, Matti; Jaervenpaeae, Jorma; Irving, Mike; Damiani, Carlo; Semeraro, Luigi

    2009-01-01

    The advantages of Product Lifecycle Management (PLM) systems are widely understood among the industry and hence a PLM system is already in use by International Thermonuclear Experimental Reactor (ITER) Organization (IO). However, with the increasing involvement of software in the development, the role of Software Configuration Management (SCM) systems have become equally important. The SCM systems can be useful to meet the higher demands on Safety Engineering (SE), Quality Assurance (QA), Validation and Verification (V and V) and Requirements Management (RM) of the developed software tools. In an experimental environment, such as ITER, the new remote handling requirements emerge frequently. This means the development of new tools or the modification of existing tools and the development of new remote handling procedures or the modification of existing remote handling procedures. PLM and SCM systems together can be of great advantage in the development and maintenance of such remote handling system. In this paper, we discuss how PLM and SCM systems can be integrated together and play their role during the development and maintenance of ITER remote handling system. We discuss the possibility to investigate such setup at DTP2 (Divertor Test Platform 2), which is the full scale mock-up facility to verify the ITER divertor remote handling and maintenance concepts.

  6. Alterations in welding process voltage affect the generation of ultrafine particles, fume composition, and pulmonary toxicity.

    Science.gov (United States)

    Antonini, James M; Keane, Michael; Chen, Bean T; Stone, Samuel; Roberts, Jenny R; Schwegler-Berry, Diane; Andrews, Ronnee N; Frazer, David G; Sriram, Krishnan

    2011-12-01

    The goal was to determine if increasing welding voltage changes the physico-chemical properties of the fume and influences lung responses. Rats inhaled 40 mg/m³ (3 h/day × 3 days) of stainless steel (SS) welding fume generated at a standard voltage setting of 25 V (regular SS) or at a higher voltage (high voltage SS) of 30 V. Particle morphology, size and composition were characterized. Bronchoalveolar lavage was performed at different times after exposures to assess lung injury. Fumes collected from either of the welding conditions appeared as chain-like agglomerates of nanometer-sized primary particles. High voltage SS welding produced a greater number of ultrafine-sized particles. Fume generated by high voltage SS welding was higher in manganese. Pulmonary toxicity was more substantial and persisted longer after exposure to the regular SS fume. In summary, a modest raise in welding voltage affected fume size and elemental composition and altered the temporal lung toxicity profile.

  7. Bottlenecks reduction using superconductors in high voltage transmission lines

    Directory of Open Access Journals (Sweden)

    Daloub Labib

    2016-01-01

    Full Text Available Energy flow bottlenecks in high voltage transmission lines known as congestions are one of the challenges facing power utilities in fast developing countries. Bottlenecks occur in selected power lines when transmission systems are operated at or beyond their transfer limits. In these cases, congestions result in preventing new power supply contracts, infeasibility in existing contracts, price spike and market power abuse. The “Superconductor Technology” in electric power transmission cables has been used as a solution to solve the problem of bottlenecks in energy transmission at high voltage underground cables and overhead lines. The increase in demand on power generation and transmission happening due to fast development and linked to the intensive usage of transmission network in certain points, which in turn, lead to often frequent congestion in getting the required power across to where it is needed. In this paper, a bottleneck in high voltage double overhead transmission line with Aluminum Conductor Steel Reinforced was modeled using conductor parameters and replaced by Gap-Type Superconductor to assess the benefit of upgrading to higher temperature superconductor and obtain higher current carrying capacity. This proved to reduce the high loading of traditional aluminum conductors and allow more power transfer over the line using superconductor within the same existing right-of-way, steel towers, insulators and fittings, thus reducing the upgrade cost of building new lines.

  8. Fuel Cell/Electrochemical Cell Voltage Monitor

    Science.gov (United States)

    Vasquez, Arturo

    2012-01-01

    A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

  9. High voltage, fast turn-on and turn-off switch: Final report for period September 2, 1998 - March 17, 1999

    International Nuclear Information System (INIS)

    Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan

    1999-01-01

    The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 micros (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract

  10. High voltage, fast turn-on and turn-off switch: Final report for period September 2, 1998 - March 17, 1999

    Energy Technology Data Exchange (ETDEWEB)

    Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan

    1999-04-10

    The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 {micro}s (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract.

  11. Electrophysiological properties and calcium handling of embryonic stem cell-derived cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Jae Boum Youm

    2016-03-01

    Full Text Available Embryonic stem cell-derived cardiomyocytes (ESC-CMs hold great interest in many fields of research including clinical applications such as stem cell and gene therapy for cardiac repair or regeneration. ESC-CMs are also used as a platform tool for pharmacological tests or for investigations of cardiac remodeling. ESC-CMs have many different aspects of morphology, electrophysiology, calcium handling, and bioenergetics compared with adult cardiomyocytes. They are immature in morphology, similar to sinus nodal-like in the electrophysiology, higher contribution of trans-sarcolemmal Ca2+ influx to Ca2+ handling, and higher dependence on anaerobic glycolysis. Here, I review a detailed electrophysiology and Ca2+ handling features of ESC-CMs during differentiation into adult cardiomyocytes to gain insights into how all the developmental changes are related to each other to display cardinal features of developing cardiomyocytes.

  12. Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

    DEFF Research Database (Denmark)

    Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

    1999-01-01

    bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

  13. High voltage electricity installations a planning perspective

    CERN Document Server

    Jay, Stephen Andrew

    2006-01-01

    The presence of high voltage power lines has provoked widespread concern for many years. High Voltage Electricity Installations presents an in-depth study of policy surrounding the planning of high voltage installations, discussing the manner in which they are percieved by the public, and the associated environmental issues. An analysis of these concerns, along with the geographical, environmental and political influences that shape their expression, is presented. Investigates local planning policy in an area of the energy sector that is of highly topical environmental and public concern Cover

  14. Investigation of voltage swell mitigation using STATCOM

    International Nuclear Information System (INIS)

    Razak, N A Abdul; Jaafar, S; Hussain, I S

    2013-01-01

    STATCOM is one of the best applications of a self commutated FACTS device to control power quality problems in the distribution system. This project proposed a STATCOM model with voltage control mechanism. DQ transformation was implemented in the controller system to achieve better estimation. Then, the model was used to investigate and analyse voltage swell problem in distribution system. The simulation results show that voltage swell could contaminate distribution network with unwanted harmonic frequencies. Negative sequence frequencies give harmful effects to the network. System connected with proposed STATCOM model illustrates that it could mitigate this problems efficiently.

  15. Analysis of NSTX TF Joint Voltage Measurements

    International Nuclear Information System (INIS)

    Woolley R

    2005-01-01

    This report presents findings of analyses of recorded current and voltage data associated with 72 electrical joints operating at high current and high mechanical stress. The analysis goal was to characterize the mechanical behavior of each joint and thus evaluate its mechanical supports. The joints are part of the toroidal field (TF) magnet system of the National Spherical Torus Experiment (NSTX) pulsed plasma device operating at the Princeton Plasma Physics Laboratory (PPPL). Since there is not sufficient space near the joints for much traditional mechanical instrumentation, small voltage probes were installed on each joint and their voltage monitoring waveforms have been recorded on sampling digitizers during each NSTX ''shot''

  16. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  17. TECHNIQUES WITH POTENTIAL FOR HANDLING ENVIRONMENTAL SAMPLES IN CAPILLARY ELECTROPHORESIS

    Science.gov (United States)

    An assessment of the methods for handling environmental samples prior to capillary electrophoresis (CE) is presented for both aqueous and solid matrices. Sample handling in environmental analyses is the subject of ongoing research at the Environmental Protection Agency's National...

  18. Effects of handling on fear reactions in young Icelandic horses

    DEFF Research Database (Denmark)

    Marsbøll, Anna Feldberg; Christensen, Janne Winther

    2015-01-01

    To investigate the effect of a short-term standardised handling procedure on reactions of young horses in 2 types of fear tests (including and excluding human handling). Study design An experimental study with 3-year-old Icelandic horses (n = 24). Methods Handled horses (n = 12) were trained according...... to a standardised handling procedure whereas controls (n = 12) remained untrained. Behavioural and heart rate responses in a novel object test and 2 handling fear tests (HFTs) were measured. The HFTs were conducted with both an unknown (HFT-unknown) and a known handler (HFT-known). Results There was no effect...... correlated significantly between tests. Conclusions Previous handling may affect the behavioural fear response of horses when handled by their usual handler, whereas this effect did not apply to an unknown handler. Heart rates appeared unaffected by handling and may be a more reliable indicator...

  19. A combined constraint handling framework: an empirical study

    DEFF Research Database (Denmark)

    Si, Chengyong; Hu, Junjie; Lan, Tian

    2017-01-01

    This paper presents a new combined constraint handling framework (CCHF) for solving constrained optimization problems (COPs). The framework combines promising aspects of different constraint handling techniques (CHTs) in different situations with consideration of problem characteristics. In order...

  20. Remote handling and automation in back end of fuel cycle

    International Nuclear Information System (INIS)

    Nair, K.N.S.

    2010-01-01

    Full text: Indian nuclear programme is readying for a quantum leap and it is essential that technology is available for building advanced fuel recycle plants in the back end and for sustained operation of such plants. Remote technology and automation plays a big role to achieve this goal. With the introduction of advanced fuel cycles in indigenous programme and scenario of international cooperation it is essential to be ready with indigenous technology for meeting all challenges. Work has been progressing to develop locally support technology for remote handling and automation with good success. Essential RH tools such as master slave manipulators, power manipulators and hot cell viewing systems have been developed and commercial production has been established. Customised RH requirements for back end plants have been met and the designs have proven to be worthy for hot operations over the years. In the last few years stress has been on development of equipment and technology to meet the increasing demands of higher throughput plants. Substantial progress has been achieved in the head end and reconversion laboratory systems of reprocessing plants. Similarly successful efforts have also been made for establishing Thoria processing cells and also the RH in the reconversion operations. Custom designed equipment has been developed for decommissioning of ceramic melter, used glove boxes etc. Efforts are on hand to develop automated RH equipment for material handling in underground repositories. This paper aims at bringing out the theme based on some of our own experiences and some reports from plants in operation abroad. (author)

  1. Implication of human handling on packaged sausage rolls during sale

    Directory of Open Access Journals (Sweden)

    Coolborn AKHARAIYI FRED

    2016-08-01

    Full Text Available In other to identify the implication of human handling of packaged sausage rolls after production, a microbiological safety evaluation was carried out on sausage rolls sold on street and in shops. Among the sausage rolls, gala purchased from street vendors has the highest bacterial load of 2.82 × 104 CFU/g and 4.3 × 106 spore/g of fungal load, followed by meaty with bacterial load of 1.71 × 104 CFU/g and fungal load of 1.6 × 105 spore/g and was least in rite sausage roll with 1.46 × 104 CFU/g and 1 × 105 spore/g bacterial and fungal loads respectively. Seventeen bacteria species were isolated from both street vended and shop sold sausage rolls, the isolates identified including: Bacillus cereus, Acinetobacter calcoaceticus, Alcaligenes faecalis, Citrobacter freundii, Klebsiella ozaenae, Staphylococcus epidermidis, Enterobacter aerogenes, Staphylococcus aureus, Aeromonas hydrophila, Plesiomonas shigelloides, Moraxella catarhalis, Bacillus substilis, Escherichia coli, Salmonella typhi, Aeromonas anaerogenes, Aerococcus viridans and Azomonas agilis. Five fungi species were isolated from street vended sausage rolls only. The fungal species are Penicillium notatum, Aspergillus parasiticus, Aspergillus flavus, Penicillium italicum and Gliocephalis spp. From this study, street vended samples have higher microbial contamination than shop sold sausage rolls due to improper handling during sales.

  2. Optimization of the JET Beryllium tile profile for power handling

    International Nuclear Information System (INIS)

    Nunes, I.; Vries, P. de; Lomas, P.J.; Loarte, A.

    2006-01-01

    The primary objective of the ITER-like wall project is to install a beryllium main wall and a tungsten divertor. From the point of view of plasma operations, the power handling properties of the new Be tiles may affect the operational space. The tiles design has to be such that it allows routine plasma operation for ITER relevant scenarios, i.e., 3-5 MA ELMy H-modes with high power input (P in > 30 MW) for lengths of time of ∼ 10 s. Due to the constrains imposed by heat conductivity, eddy current and stress torques on a Be tile, a single Be tile must be an assembly of castellated slices [Thompson V. et al, this conference]. From the point of view of plasma operations, the power handling properties of the new Be tiles can restrict the operational space of JET, if considerable melting of the tiles is to be avoided. This paper describes the power handling studies for the beryllium wall tiles and the optimisation of their design to achieve the operation goal described above. The melting temperature for Be is 1289 o C, corresponding to a energy limit of 60 MJ/m 2 for 10 s [Thompson V. et al, this conference]. For low field line angles, the power density on the toroidally facing surfaces is several times higher than the power density on the tile face requiring these to be shadowed. Furthermore the poloidally facing surfaces also have to be shadowed from assembly to assembly due to the large gap between assemblies. The tiles have been designed taking into account these limits and with a geometrical design such as to avoid exposed surfaces at high angles to the magnetic field being melted due to the expected loads. This has been achieved after detailed studies of the power handling of the various limiters and protections, including the effect of the curvature of the flux surfaces, shadowing and tolerance to misalignment. The surface of the tiles is defined such that, when possible, there is an even distribution of power density over the entire tile surface, and that

  3. VVER NPPs fuel handling machine control system

    International Nuclear Information System (INIS)

    Mini, G.; Rossi, G.; Barabino, M.; Casalini, M.

    2002-01-01

    In order to increase the safety level of the fuel handling machine on WWER NPPs, Ansaldo Nucleare was asked to design and supply a new Control System. Two Fuel Handling Machine (FHM) Control System units have been already supplied for Temelin NPP and others supply are in process for the Atommash company, which has in charge the supply of FHMs for NPPs located in Russia, Ukraine and China.The computer-based system takes into account all the operational safety interlocks so that it is able to avoid incorrect and dangerous manoeuvres in the case of operator error. Control system design criteria, hardware and software architecture, and quality assurance control, are in accordance with the most recent international requirements and standards, and in particular for electromagnetic disturbance immunity demands and seismic compatibility. The hardware architecture of the control system is based on ABB INFI 90 system. The microprocessor-based ABB INFI 90 system incorporates and improves upon many of the time proven control capabilities of Bailey Network 90, validated over 14,000 installations world-wide.The control system complies all the former designed sensors and devices of the machine and markedly the angular position measurement sensors named 'selsyn' of Russian design. Nevertheless it is fully compatible with all the most recent sensors and devices currently available on the market (for ex. Multiturn absolute encoders).All control logic were developed using standard INFI 90 Engineering Work Station, interconnecting blocks extracted from an extensive SAMA library by using a graphical approach (CAD) and allowing and easier intelligibility, more flexibility and updated and coherent documentation. The data acquisition system and the Man Machine Interface are implemented by ABB in co-operation with Ansaldo. The flexible and powerful software structure of 1090 Work-stations (APMS - Advanced Plant Monitoring System, or Tenore NT) has been successfully used to interface the

  4. Laboratory biosafety for handling emerging viruses

    Directory of Open Access Journals (Sweden)

    I. Made Artika

    2017-05-01

    Full Text Available Emerging viruses are viruses whose occurrence has risen within the past twenty years, or whose presence is likely to increase in the near future. Diseases caused by emerging viruses are a major threat to global public health. In spite of greater awareness of safety and containment procedures, the handling of pathogenic viruses remains a likely source of infection, and mortality, among laboratory workers. There is a steady increase in both the number of laboratories and scientist handling emerging viruses for diagnostics and research. The potential for harm associated to work with these infectious agents can be minimized through the application of sound biosafety concepts and practices. The main factors to the prevention of laboratory-acquired infection are well-trained personnel who are knowledgable and biohazard aware, who are perceptive of the various ways of transmission, and who are professional in safe laboratory practice management. In addition, we should emphasize that appropriate facilities, practices and procedures are to be used by the laboratory workers for the handling of emerging viruses in a safe and secure manner. This review is aimed at providing researchers and laboratory personnel with basic biosafety principles to protect themselves from exposure to emerging viruses while working in the laboratory. This paper focuses on what emerging viruses are, why emerging viruses can cause laboratory-acquired infection, how to assess the risk of working with emerging viruses, and how laboratory-acquired infection can be prevented. Control measures used in the laboratory designed as such that they protect workers from emerging viruses and safeguard the public through the safe disposal of infectious wastes are also addressed.

  5. Recent fuel handling experience in Canada

    International Nuclear Information System (INIS)

    Welch, A.C.

    1991-01-01

    For many years, good operation of the fuel handling system at Ontario Hydro's nuclear stations has been taken for granted with the unavailability of the station arising from fuel handling system-related problems usually contributing less than one percent of the total unavailability of the stations. While the situation at the newer Hydro stations continues generally to be good (with the specific exception of some units at Pickering B) some specific and some general problems have caused significant loss of availability at the older plants (Pickering A and Bruce A). Generally the experience at the 600 MWe units in Canada has also continued to be good with Point Lepreau leading the world in availability. As a result of working to correct identified deficiencies, there were some changes for the better as some items of equipment that were a chronic source of trouble were replaced with improved components. In addition, the fuel handling system has been used three times as a delivery system for large-scale non destructive examination of the pressure tubes, twice at Bruce and once at Pickering and performing these inspections this way has saved many days of reactor downtime. Under COG there are several programs to develop improved versions of some of the main assemblies of the fuelling machine head. This paper will generally cover the events relating to Pickering in more detail but will describe the problems with the Bruce Fuelling Machine Bridges since the 600 MW 1P stations have a bridge drive arrangement that is somewhat similar to Bruce

  6. "Home Away from Home"? How International Students Handle Difficult and Negative Experiences in American Higher Education

    Science.gov (United States)

    Yan, Lu; Pei, Shaohua

    2018-01-01

    International students attending American universities often receive confusing messages: on one hand, for their contribution to the U.S. economy and fostering of domestic students' multicultural awareness; on the other, they are often targets of hostility and bias on and off campus. This qualitative phenomenological study examined 12 international…

  7. System for handling and storing radioactive waste

    Science.gov (United States)

    Anderson, John K.; Lindemann, Paul E.

    1984-01-01

    A system and method for handling and storing spent reactor fuel and other solid radioactive waste, including canisters to contain the elements of solid waste, storage racks to hold a plurality of such canisters, storage bays to store these racks in isolation by means of shielded doors in the bays. This system also includes means for remotely positioning the racks in the bays and an access tunnel within which the remotely operated means is located to position a rack in a selected bay. The modular type of these bays will facilitate the construction of additional bays and access tunnel extension.

  8. Remote handling equipment for CANDU retubing

    International Nuclear Information System (INIS)

    Crawford, G.S.; Lowe, H.

    1993-01-01

    Numet Engineering Ltd. has designed and supplied remote handling equipment for Ontario Hydro's retubing operation of its CANDU reactors at the Bruce Nuclear Generating Station. This equipment consists of ''Retubing Tool Carriers'' an'' Worktables'' which operate remotely or manually at the reactor face. Together they function to transport tooling to and from the reactor face, to position and support tooling during retubing operations, and to deliver and retrieve fuel channels and channel components. This paper presents the fundamentals of the process and discusses the equipment supplied in terms of its design, manufacturing, components and controls, to meet the functional and quality requirements of Ontario Hydro's retubing process. (author)

  9. Remote filter handling machine for Sizewell B

    International Nuclear Information System (INIS)

    Barker, D.

    1993-01-01

    Two Filter Handling machines (FHM) have been supplied to Nuclear Electric plc for use at Sizewell B Power Station. These machines have been designed and built following ALARP principles with the functional objective being to remove radioactive filter cartridges from a filter housing and replace them with clean filter cartridges. Operation of the machine is achieved by the prompt of each distinct task via an industrial computer or the prompt of a full cycle using the automatic mode. The design of the machine features many aspects demonstrating ALARP while keeping the machine simple, robust and easy to maintain. (author)

  10. CLASSIFICATION OF THE MGR MUCK HANDLING SYSTEM

    International Nuclear Information System (INIS)

    R. Garrett

    1999-01-01

    The purpose of this analysis is to document the Quality Assurance (QA) classification of the Monitored Geologic Repository (MGR) muck handling system structures, systems and components (SSCs) performed by the MGR Safety Assurance Department. This analysis also provides the basis for revision of YMP/90-55Q, Q-List (YMP 1998). The Q-List identifies those MGR SSCs subject to the requirements of DOE/RW-0333P, ''Quality Assurance Requirements and Description (QARD) (DOE 1998). This QA classification incorporates the current MGR design and the results of the ''Preliminary Preclosure Design Basis Event Calculations for the Monitored Geologic Repository (CRWMS M and O 1998a)

  11. The remote handling systems for ITER

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Isabel, E-mail: mir@isr.ist.utl.pt [Institute for Systems and Robotics/Instituto Superior Tecnico, Lisboa (Portugal); Damiani, Carlo [Fusion for Energy, Barcelona (Spain); Tesini, Alessandro [ITER Organization, Cadarache (France); Kakudate, Satoshi [ITER Tokamak Device Group, Japan Atomic Energy Agency, Ibaraki (Japan); Siuko, Mikko [VTT Systems Engineering, Tampere (Finland); Neri, Carlo [Associazione EURATOM ENEA, Frascati (Italy)

    2011-10-15

    The ITER remote handling (RH) maintenance system is a key component in ITER operation both for scheduled maintenance and for unexpected situations. It is a complex collection and integration of numerous systems, each one at its turn being the integration of diverse technologies into a coherent, space constrained, nuclearised design. This paper presents an integrated view and recent results related to the Blanket RH System, the Divertor RH System, the Transfer Cask System (TCS), the In-Vessel Viewing System, the Neutral Beam Cell RH System, the Hot Cell RH and the Multi-Purpose Deployment System.

  12. Handling of sodium for the FFTF

    International Nuclear Information System (INIS)

    Ballif, J.L.; Meadows, G.E.

    1978-06-01

    Based on the High Temperature Sodium Facility (HTSF) experience and the extensive design efforts for FFTF, procedures are in place for the unloading of the tank cars and for the fill of the FFTF reactor. Special precautions have been taken to provide safe handling and to accommodate contingencies in operation. These contingencies include special protective suits allowing personnel to enter and correct conditions arising from fill operations in the course of moving 7.71 x 10 5 kg (1.7 x 10 6 lbs) of sodium from the tank cars into the reactor vessel and its loop system

  13. Tire, accident, handling, and roadway safety

    International Nuclear Information System (INIS)

    Logan, R.W.

    1994-01-01

    The authors are developing technology for an integrated package for the analysis of vehicle handling and impact into roadside features and into other vehicles. The program involves the development and use of rigid-body algorithms and Lawrence Livermore National Laboratory's DYNA and NIKE finite-element codes. The goal is a tool for use by engineers in industry and at federal and state Departments of Transportation, allowing good quantitative results at the workstation level. At the same time, the work enhances the authors' competency in furthering the development of DYNA and NIKE, and their expertise in spaceframe design for impact and crashworthiness

  14. DISPOSAL CONTAINER HANDLING SYSTEM DESCRIPTION DOCUMENT

    Energy Technology Data Exchange (ETDEWEB)

    E. F. Loros

    2000-06-30

    The Disposal Container Handling System receives and prepares new disposal containers (DCs) and transfers them to the Assembly Transfer System (ATS) or Canister Transfer System (CTS) for loading. The system receives the loaded DCs from ATS or CTS and welds the lids. When the welds are accepted the DCs are termed waste packages (WPs). The system may stage the WP for later transfer or transfer the WP directly to the Waste Emplacement/Retrieval System. The system can also transfer DCs/WPs to/from the Waste Package Remediation System. The Disposal Container Handling System begins with new DC preparation, which includes installing collars, tilting the DC upright, and outfitting the container for the specific fuel it is to receive. DCs and their lids are staged in the receipt area for transfer to the needed location. When called for, a DC is put on a cart and sent through an airlock into a hot cell. From this point on, all processes are done remotely. The DC transfer operation moves the DC to the ATS or CTS for loading and then receives the DC for welding. The DC welding operation receives loaded DCs directly from the waste handling lines or from interim lag storage for welding of the lids. The welding operation includes mounting the DC on a turntable, removing lid seals, and installing and welding the inner and outer lids. After the weld process and non-destructive examination are successfully completed, the WP is either staged or transferred to a tilting station. At the tilting station, the WP is tilted horizontally onto a cart and the collars removed. The cart is taken through an air lock where the WP is lifted, surveyed, decontaminated if required, and then moved into the Waste Emplacement/Retrieval System. DCs that do not meet the welding non-destructive examination criteria are transferred to the Waste Package Remediation System for weld preparation or removal of the lids. The Disposal Container Handling System is contained within the Waste Handling Building System

  15. Solution for remote handling in accelerator installations

    International Nuclear Information System (INIS)

    Burgerjon, J.J.; Ekberg, E.L.; Grisham, D.L.; Horne, R.A.; Meyer, R.E.; Flatau, C.R.; Wilson, K.B.

    1977-01-01

    A description is given of a remote-handling system designed for the Los Alamos Clinton P. Anderson Meson Physics Facility (LAMPF), versatile enough to be used in a variety of situations found around particle accelerators. The system consists of a bilateral (force-reflecting) servomanipulator installed on an articulated hydraulic boom. The boom also carries the necessary tools and observation devices. The whole slave unit can be moved by crane or truck to the area of operation. A control cable connects the slave unit with the control station, located at a safe distance in a trailer. Various stages of development as well as some operating experience are discussed

  16. WASTE HANDLING BUILDING SHIELD WALL ANALYSIS

    International Nuclear Information System (INIS)

    Padula, D.

    2000-01-01

    The scope of this analysis is to estimate the shielding wall, ceiling or equivalent door thicknesses that will be required in the Waste Handling Building to maintain the radiation doses to personnel within acceptable limits. The shielding thickness calculated is the minimum required to meet administrative limits, and not necessarily what will be recommended for the final design. The preliminary evaluations will identify the areas which have the greatest impact on mechanical and facility design concepts. The objective is to provide the design teams with the necessary information to assure an efficient and effective design

  17. A physical workload index to evaluate a safe resident handling program for nursing home personnel.

    Science.gov (United States)

    Kurowski, Alicia; Buchholz, Bryan; Punnett, Laura

    2014-06-01

    The aim of this study was to obtain a comprehensive analysis of the physical workload of clinical staff in long-term care facilities, before and after a safe resident handling program (SRHP). Ergonomic exposures of health care workers include manual handling of patients and many non-neutral postures. A comprehensive assessment requires the integration of loads from these varied exposures into a single metric. The Postures, Activities, Tools, and Handling observational protocol, customized for health care, was used for direct observations of ergonomic exposures in clinical jobs at 12 nursing homes before the SRHP and 3, 12, 24, and 36 months afterward. Average compressive forces on the spine were estimated for observed combinations of body postures and manual handling and then weighted by frequencies of observed time for the combination. These values were summed to obtain a biomechanical index for nursing assistants and nurses across observation periods. The physical workload index (PWI) was much higher for nursing assistants than for nurses and decreased more after 3 years (-24% versus -2.5%). Specifically during resident handling, the PWI for nursing assistants decreased by 41% of baseline value. Spinal loading was higher for nursing assistants than for nurses in long-term care centers. Both job groups experienced reductions in physical loading from the SRHP, especially the nursing assistants and especially while resident handling. The PWI facilitates a comprehensive investigation of physical loading from both manual handling and non-neutral postures. It can be used in any work setting to identify high-risk tasks and determine whether reductions in one exposure are offset by increases in another.

  18. Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility

    OpenAIRE

    STORK, Milan

    2014-01-01

    Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...

  19. Effects of tetracaine on insulin release and calcium handling by rat pancreatic islets

    International Nuclear Information System (INIS)

    Abdel El Motal, S.M.A.; Pian-Smith, M.C.M.; Sharp, G.W.G.

    1987-01-01

    The effects of tetracaine on insulin release and 45 Ca 2+ handling by rat pancreatic islets have been studied under basal, glucose-stimulated, and 3-isobutyl-1-methylxanthine (IBMX)-stimulated conditions. Islets were isolated by the use of collagenase and used either directly (freshly isolated islets) or after a period under tissue culture conditions. Tetracaine was found to stimulate insulin release under basal conditions, to inhibit glucose-stimulated insulin release, and to potentiate insulin release stimulated by IBMX. In studies on the mechanisms underlying these effects, tetracaine was found to decrease glucose-stimulated net retention of 45 Ca 2+ (by an action to block the voltage-dependent Ca channels) and to mobilize Ca 2+ from intracellular stores. These two actions form the basis for the inhibition of glucose-stimulated insulin release, which depends heavily on Ca 2+ entry via the voltage-dependent channels and the synergism with IBMX to potentiate release. No inhibition of IBMX-stimulated release occurs because IBMX does not use the voltage-dependent channels to raise intracellular Ca 2+

  20. Materials Handling. Module SH-01. Safety and Health.

    Science.gov (United States)

    Center for Occupational Research and Development, Inc., Waco, TX.

    This student module on materials handling is one of 50 modules concerned with job safety and health. It presents the procedures for safe materials handling. Discussed are manual handling methods (lifting and carrying by hand) and mechanical lifting (lifting by powered trucks, cranes or conveyors). Following the introduction, 15 objectives (each…

  1. Execution Constraint Verification of Exception Handling on UML Sequence Diagrams

    NARCIS (Netherlands)

    Ciraci, S.; Sözer, Hasan; Aksit, Mehmet; Havinga, W.K.

    2011-01-01

    Exception handling alters the control flow of the program. As such, errors introduced in exception handling code may influence the overall program in undesired ways. To detect such errors early and thereby decrease the programming costs, it is worthwhile to consider exception handling at design

  2. Automation of 3D micro object handling process

    DEFF Research Database (Denmark)

    Gegeckaite, Asta; Hansen, Hans Nørgaard

    2007-01-01

    Most of the micro objects in industrial production are handled with manual labour or in semiautomatic stations. Manual labour usually makes handling and assembly operations highly flexible, but slow, relatively imprecise and expensive. Handling of 3D micro objects poses special challenges due to ...

  3. Getting to grips with remote handling and robotics

    Energy Technology Data Exchange (ETDEWEB)

    Mosey, D [Ontario Hydro, Toronto (Canada)

    1984-12-01

    A report on the Canadian Nuclear Society Conference on robotics and remote handling in the nuclear industry, September 1984. Remote handling in reactor operations, particularly in the Candu reactors is discussed, and the costs and benefits of use of remote handling equipment are considered. Steam generator inspection and repair is an area in which practical application of robotic technology has made a major advance.

  4. 21 CFR 58.107 - Test and control article handling.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Test and control article handling. 58.107 Section... GOOD LABORATORY PRACTICE FOR NONCLINICAL LABORATORY STUDIES Test and Control Articles § 58.107 Test and control article handling. Procedures shall be established for a system for the handling of the test and...

  5. Design and Control of a Dynamic Voltage Restorer

    DEFF Research Database (Denmark)

    Nielsen, John Godsk

    voltage until the energy storage is completely drained or the voltages have returned to normal voltage levels. The control of the HV-DVR is a combined feedforward and feedback control to have a fast response time and load independent voltages. The control is implemented in a rotating dq-reference frame...... electric consumers against voltage dips and surges in the medium and low voltage distribution grid. The thesis first gives an introduction to relevant power quality issues for a DVR and power electronic controllers for voltage dip mitigation. Thereafter the operation and the elements in a DVR are described...... of symmetrical and non-symmetrical voltage dips. In most cases the DVR is capable of restoring the load voltages within 2 ms. During the transition phases load voltage oscillations can be generated and during the return of the supply voltages short time over-voltages can be generated by the DVR. Both...

  6. Fiber-optic voltage measuring system

    Science.gov (United States)

    Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

    1993-09-01

    A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

  7. Constant potential high-voltage generator

    International Nuclear Information System (INIS)

    Resnick, T.A.; Dupuis, W.A.; Palermo, T.

    1980-01-01

    An X-ray tube voltage generator with automatic stabilization circuitry is disclosed. The generator includes a source of pulsating direct current voltage such as from a rectified 3 phase transformer. This pulsating voltage is supplied to the cathode and anode of an X-ray tube and forms an accelerating potential for electrons within that tube. The accelerating potential is stabilized with a feedback signal which is provided by a feedback network. The network includes an error signal generator which compares an instantaneous accelerating potential with a preferred reference accelerating potential and generates an error function. This error function is transmitted to a control tube grid which in turn causes the voltage difference between X-ray tube cathode and anode to stabilize and thereby reduce the error function. In this way stabilized accelerating potentials are realized and uniform X-ray energy distributions produced. (Auth.)

  8. Nested high voltage generator/particle accelerator

    International Nuclear Information System (INIS)

    Adler, R.J.

    1992-01-01

    This patent describes a modular high voltage particle accelerator having an emission axis and an emission end, the accelerator. It comprises: a plurality of high voltage generators in nested adjacency to form a nested stack, each the generator comprising a cup-like housing having a base and a tubular sleeve extending from the base, a primary transformer winding encircling the nested stack; a secondary transformer winding between each adjacent pair of housings, magnetically linked to the primary transformer winding through the gaps; a power supply respective to each of the secondary windings converting alternating voltage from its respective secondary winding to d.c. voltage, the housings at the emission end forming a hollow throat for particle acceleration, a vacuum seal at the emission end of the throat which enables the throat to be evacuated; a particle source in the thrond power means to energize the primary transformer winding

  9. Low voltage arc formation in railguns

    Science.gov (United States)

    Hawke, R.S.

    1985-08-05

    A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.

  10. Voltage, Temperature, Frequency Margin Test Report

    DEFF Research Database (Denmark)

    Denver, Troelz

    1999-01-01

    The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation......The purpose of the tests is to establish the camera functionality when it is exposed to an extreme environment for prolonged periods, thus simulating the end of life performance. This environment covers temperature, input clock frequency and supply voltage variation...

  11. Detecting Faults In High-Voltage Transformers

    Science.gov (United States)

    Blow, Raymond K.

    1988-01-01

    Simple fixture quickly shows whether high-voltage transformer has excessive voids in dielectric materials and whether high-voltage lead wires too close to transformer case. Fixture is "go/no-go" indicator; corona appears if transformer contains such faults. Nests in wire mesh supported by cap of clear epoxy. If transformer has defects, blue glow of corona appears in mesh and is seen through cap.

  12. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  13. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  14. Modular high voltage power supply for chemical analysis

    Science.gov (United States)

    Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

    2008-07-15

    A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

  15. Recent advances in remote handling at LAMPF

    International Nuclear Information System (INIS)

    Lambert, J.E.; Grisham, D.L.

    1985-01-01

    The Clinton P. Anderson Meson Physics Facility (LAMPF) has operated at beam currents above 200 microamperes since 1976. As a result, the main experimental beam line (Line A) has become increasingly radioactive over the years. Since 1976 the radiation levels have steadily increased from 100 mR/hr to levels that exceed 10,000 R/hr in the components near the pion production targets. During this time the LAMPF remote handling system, Monitor, has continued to operate successfully in the ever-increasing radiation levels, as well as with more complex remote-handling situations. This paper briefly describes the evolution of Monitor and specifically describes the complete rebuild of the A-6 target area, which is designated as the beam stop, but also includes isotope production capabilities and a primitive neutron irradiation facility. The new facility includes not only the beam stop and isotope production, but also facilities for proton irradiation and a ten-fold expansion in neutron irradiation facilities

  16. Safe handling of radioactive isotopes. Handbook 42

    International Nuclear Information System (INIS)

    1949-09-01

    With the increasing use of radioactive isotopes by industry, the medical profession, and research laboratories, it is essential that certain minimal precautions be taken to protect the users and the public. The recommendations contained in this handbook represent what is believed to be the best available opinions on the subject as of this date. As our experience with radioisotopes broadens, we will undoubtedly be able to improve and strengthen the recommendations for their safe handling and utilization. Through the courtesy of the National Research Council about a year ago, several hundred draft copies of this report were circulated to all leading workers and authorities in the field for comment and criticism. The present handbook embodies all pertinent suggestions received from these people. Further comment will be welcomed by the committee. One of the greatest difficulties encountered in the preparation of this handbook lay in the uncertainty regarding permissible radiation exposure levels - particularly for ingested radioactive materials. The establishment of sound figures for such exposure still remains a problem of high priority for many conditions and radioactive substances. Such figures as are used in this report represent the best available information today. If, in the future, these can be improved upon, appropriate corrections will be issued. The subject will be under continuous study by the two subcommittees mentioned above. The present Handbook has been prepared by the Subcommittee on the Handling of Radioactive Isotopes and Fission Products

  17. Safe handling of radioactive isotopes. Handbook 42

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1949-09-15

    With the increasing use of radioactive isotopes by industry, the medical profession, and research laboratories, it is essential that certain minimal precautions be taken to protect the users and the public. The recommendations contained in this handbook represent what is believed to be the best available opinions on the subject as of this date. As our experience with radioisotopes broadens, we will undoubtedly be able to improve and strengthen the recommendations for their safe handling and utilization. Through the courtesy of the National Research Council about a year ago, several hundred draft copies of this report were circulated to all leading workers and authorities in the field for comment and criticism. The present handbook embodies all pertinent suggestions received from these people. Further comment will be welcomed by the committee. One of the greatest difficulties encountered in the preparation of this handbook lay in the uncertainty regarding permissible radiation exposure levels - particularly for ingested radioactive materials. The establishment of sound figures for such exposure still remains a problem of high priority for many conditions and radioactive substances. Such figures as are used in this report represent the best available information today. If, in the future, these can be improved upon, appropriate corrections will be issued. The subject will be under continuous study by the two subcommittees mentioned above. The present Handbook has been prepared by the Subcommittee on the Handling of Radioactive Isotopes and Fission Products.

  18. Radioactivity, shielding, radiation damage, and remote handling

    International Nuclear Information System (INIS)

    Wilson, M.T.

    1975-01-01

    Proton beams of a few hundred million electron volts of energy are capable of inducing hundreds of curies of activity per microampere of beam intensity into the materials they intercept. This adds a new dimension to the parameters that must be considered when designing and operating a high-intensity accelerator facility. Large investments must be made in shielding. The shielding itself may become activated and require special considerations as to its composition, location, and method of handling. Equipment must be designed to withstand large radiation dosages. Items such as vacuum seals, water tubing, and electrical insulation must be fabricated from radiation-resistant materials. Methods of maintaining and replacing equipment are required that limit the radiation dosages to workers.The high-intensity facilities of LAMPF, SIN, and TRIUMF and the high-energy facility of FERMILAB have each evolved a philosophy of radiation handling that matches their particular machine and physical plant layouts. Special tooling, commercial manipulator systems, remote viewing, and other techniques of the hot cell and fission reactor realms are finding application within accelerator facilities. (U.S.)

  19. Decontamination manual of RI handling laboratory

    International Nuclear Information System (INIS)

    Wadachi, Yoshiki

    2004-01-01

    Based on experiences in Japan Atomic Energy Research Institute (JAERI), the essential and practical knowledge of radioactive contamination and its decontamination, and the method and procedure of floor decontamination are described for researcher and managing person in charge of handling radioisotopes (RI) in RI handling laboratories. Essential knowledge concerns the uniqueness of solid surface contamination derived from RI half lives and quantities, surface contamination density limit, and mode/mechanism of contamination. The principle of decontamination is a single conduct with recognition of chemical form of the RI under use. As the practical knowledge, there are physical and chemical methods of solid surface decontamination. The latter involves use of inorganic acids, chelaters and surfactants. Removal and replacement of contaminated solid like floor material are often effective. Distribution mapping of surface contamination can be done by measuring the radioactivity in possibly contaminated areas, and is useful for planning of effective decontamination. Floor surface decontamination is for the partial and spread areas of the floor. It is essential to conduct the decontamination with reagent from the highly to less contaminated areas. Skin decontamination with either neutral detergent or titanium oxide is also described. (N.I.)

  20. Robotic liquid handling and automation in epigenetics.

    Science.gov (United States)

    Gaisford, Wendy

    2012-10-01

    Automated liquid-handling robots and high-throughput screening (HTS) are widely used in the pharmaceutical industry for the screening of large compound libraries, small molecules for activity against disease-relevant target pathways, or proteins. HTS robots capable of low-volume dispensing reduce assay setup times and provide highly accurate and reproducible dispensing, minimizing variation between sample replicates and eliminating the potential for manual error. Low-volume automated nanoliter dispensers ensure accuracy of pipetting within volume ranges that are difficult to achieve manually. In addition, they have the ability to potentially expand the range of screening conditions from often limited amounts of valuable sample, as well as reduce the usage of expensive reagents. The ability to accurately dispense lower volumes provides the potential to achieve a greater amount of information than could be otherwise achieved using manual dispensing technology. With the emergence of the field of epigenetics, an increasing number of drug discovery companies are beginning to screen compound libraries against a range of epigenetic targets. This review discusses the potential for the use of low-volume liquid handling robots, for molecular biological applications such as quantitative PCR and epigenetics.

  1. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  2. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J

    2004-01-01

    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at http://vkcdb.biology.ualberta.ca.

  3. Beam induced rf cavity transient voltage

    International Nuclear Information System (INIS)

    Kramer, S.L.; Wang, J.M.

    1998-10-01

    The authors calculate the transient voltage induced in a radio frequency cavity by the injection of a relativistic bunched beam into a circular accelerator. A simplified model of the beam induced voltage, using a single tone current signal, is generated and compared with the voltage induced by a more realistic model of a point-like bunched beam. The high Q limit of the bunched beam model is shown to be related simply to the simplified model. Both models are shown to induce voltages at the resonant frequency ω r of the cavity and at an integer multiple of the bunch revolution frequency (i.e. the accelerating frequency for powered cavity operation) hω ο . The presence of two nearby frequencies in the cavity leads to a modulation of the carrier wave exp(hω ο t). A special emphasis is placed in this paper on studying the modulation function. These models prove useful for computing the transient voltage induced in superconducting rf cavities, which was the motivation behind this research. The modulation of the transient cavity voltage discussed in this paper is the physical basis of the recently observed and explained new kinds of longitudinal rigid dipole mode which differs from the conventional Robinson mode

  4. Prediction of breakdown voltages in novel gases for high voltage insulation

    Energy Technology Data Exchange (ETDEWEB)

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  5. Prediction of breakdown voltages in novel gases for high voltage insulation

    International Nuclear Information System (INIS)

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  6. Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

    Directory of Open Access Journals (Sweden)

    Chaichana Amornchai

    2017-01-01

    Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

  7. A study of glucose handling by Buddhist monks.

    Science.gov (United States)

    Aung, T; Myint, H; Thein, M

    1988-04-01

    Fourteen Buddhist monks and comparable male subjects were studied in relation to their handling of glucose after a meal (consisting of 1190 kcal, 29 g protein, 21 g fat and 221 g carbohydrate) and afterwards subjected to an oral glucose tolerance test (oGTT). The time course of blood glucose levels after the meal indicated that the monks had enhanced absorption and utilization of glucose. The monks were also found to have increased tolerance to glucose on oGTT. In addition the mean total serum cholesterol level in the monks (157.2 +/- 5.53 mg/dl) was found to be significantly higher than that of the control subjects (117.4 +/- 2.85 mg/dl).

  8. Experience of safety and performance improvement for fuel handling equipment

    International Nuclear Information System (INIS)

    Gyoon Chang, Sang; Hee Lee, Dae

    2014-01-01

    The purpose of this study is to provide experience of safety and performance improvement of fuel handling equipment for nuclear power plants in Korea. The fuel handling equipment, which is used as an important part of critical processes during the refueling outage, has been improved to enhance safety and to optimize fuel handling procedures. Results of data measured during the fuel reloading are incorporated into design changes. The safety and performance improvement for fuel handling equipment could be achieved by simply modifying the components and improving the interlock system. The experience provided in this study can be useful lessons for further improvement of the fuel handling equipment. (authors)

  9. High Input Voltage Discharge Supply for High Power Hall Thrusters Using Silicon Carbide Devices

    Science.gov (United States)

    Pinero, Luis R.; Scheidegger, Robert J.; Aulsio, Michael V.; Birchenough, Arthur G.

    2014-01-01

    A power processing unit for a 15 kW Hall thruster is under development at NASA Glenn Research Center. The unit produces up to 400 VDC with two parallel 7.5 kW discharge modules that operate from a 300 VDC nominal input voltage. Silicon carbide MOSFETs and diodes were used in this design because they were the best choice to handle the high voltage stress while delivering high efficiency and low specific mass. Efficiencies in excess of 97 percent were demonstrated during integration testing with the NASA-300M 20 kW Hall thruster. Electromagnet, cathode keeper, and heater supplies were also developed and will be integrated with the discharge supply into a vacuum-rated brassboard power processing unit with full flight functionality. This design could be evolved into a flight unit for future missions that requires high power electric propulsion.

  10. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  11. Voltage scheduling for low power/energy

    Science.gov (United States)

    Manzak, Ali

    2001-07-01

    Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

  12. A fuzzy genetic approach for network reconfiguration to enhance voltage stability in radial distribution systems

    Energy Technology Data Exchange (ETDEWEB)

    Sahoo, N.C. [Faculty of Engineering and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia); Prasad, K. [Faculty of Information Science and Technology, Multimedia University, Jalan Ayer Keroh Lama, Bukit Beruang, 75450 Melaka (Malaysia)

    2006-11-15

    This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration. (author)

  13. A fuzzy genetic approach for network reconfiguration to enhance voltage stability in radial distribution systems

    International Nuclear Information System (INIS)

    Sahoo, N.C.; Prasad, K.

    2006-01-01

    This paper presents a fuzzy genetic approach for reconfiguration of radial distribution systems (RDS) so as to maximize the voltage stability of the network for a specific set of loads. The network reconfiguration involves a mechanism for selection of the best set of branches to be opened, one from each loop, such that the reconfigured RDS possesses desired performance characteristics. This discrete solution space is better handled by the proposed scheme, which maximizes a suitable optimizing function (computed using two different approaches). In the first approach, this function is chosen as the average of a voltage stability index of all the buses in the RDS, while in the second approach, the complete RDS is reduced to a two bus equivalent system and the optimizing function is the voltage stability index of this reduced two bus system. The fuzzy genetic algorithm uses a suitable coding and decoding scheme for maintaining the radial nature of the network at every stage of genetic evolution, and it also uses a fuzzy rule based mutation controller for efficient search of the solution space. This method, tested on 69 bus and 33 bus RDSs, shows promising results for the both approaches. It is also observed that the network losses are reduced when the voltage stability is enhanced by the network reconfiguration

  14. WWER NPPs fuel handling machine control system

    International Nuclear Information System (INIS)

    Mini, G.; Rossi, G.; Barabino, M.; Casalini, M.

    2001-01-01

    In order to increase the safety level of the fuel handling machine on WWER NPPs, Ansaldo Nucleare was asked to design and supply a new Control System. Two FHM Control System units have been already supplied for Temelin NPP and others supplies are in process for the Atommash company, which has in charge the supply of FHMs for NPPs located in Russia, Ukraine and China. The Fuel Handling Machine (FHM) Control System is an integrated system capable of a complete management of nuclear fuel assemblies. The computer-based system takes into account all the operational safety interlocks so that it is able to avoid incorrect and dangerous manoeuvres in the case of operator error. Control system design criteria, hardware and software architecture, and quality assurance control, are in accordance with the most recent international requirements and standards, and in particular for electromagnetic disturbance immunity demands and seismic compatibility. The hardware architecture of the control system is based on ABB INFI 90 system. The microprocessor-based ABB INFI 90 system incorporates and improves upon many of the time proven control capabilities of Bailey Network 90, validated over 14,000 installations world-wide. The control system complies all the former designed sensors and devices of the machine and markedly the angular position measurement sensors named 'selsyn' of Russian design. Nevertheless it is fully compatible with all the most recent sensors and devices currently available on the market (for ex. Multiturn absolute encoders). All control logic components were developed using standard INFI 90 Engineering Work Station, interconnecting blocks extracted from an extensive SAMA library by using a graphical approach (CAD) and allowing an easier intelligibility, more flexibility and updated and coherent documentation. The data acquisition system and the Man Machine Interface are implemented by ABB in co-operation with Ansaldo. The flexible and powerful software structure

  15. Remote Handling behind port plug in ITER

    International Nuclear Information System (INIS)

    Bede, O.; Neuberger, H.

    2006-01-01

    Different Test Blanket Modules (TBM) will be used in succession in the same equatorial ports of ITER. The remote handling operations for connection/disconnection of an interface between the port plug of the EU-HCPB-TBM and the port cell equipment are investigated with the goal to reach a quick and simple TBM exchange procedure. This paper describes the operations and systems which are required for connection of the TBM to its supply lines at this interface. The interface is located inside the free space of the port plug flange between the port plug shield and the bioshield of the port cell behind. The approach of the operation place is only available through a narrow gate in the bioshield opened temporarily during maintenance periods. This gate limits the dimensions of the whole system and its tools. The current design of the EU-HCPB-TBM foresees up to 9 supply lines which have to be connected inside the free space of one half of the port plug flange. The connection operations require positioning and adjustment of the tools for each pipe separately. Despite the strict circumstances it is still possible to find such an industrial jointed-arm robot with sufficient payload, which can penetrate into the working area. A mechanical system is necessary to move the robot from its storing place in the hot cell to the port plug on 6 m distance. Each operation requires different end-of-arm tools. The most special one is a pipe positioner tool, which can position and pull the pipe ends to each other and align the tool before welding and hold them in proper position during the welding process. Weld seams can be made by orbital welding tool. The pipe positioner tool has to provide place for welding tool. Using of inbore tool is impossible because pipes have no open ends where the tool could leave it. Orbital tool must be modified to meet requirements of remote handling because it is designed for human handling. The coolant is helium, so for eliminating the leak of helium it is

  16. On the Distribution of Lightning Current among Interconnected Grounding Systems in Medium Voltage Grids

    Directory of Open Access Journals (Sweden)

    Guido Ala

    2018-03-01

    Full Text Available This paper presents the results of a first investigation on the effects of lightning stroke on medium voltage installations’ grounding systems, interconnected with the metal shields of the Medium Voltage (MV distribution grid cables or with bare buried copper ropes. The study enables us to evaluate the distribution of the lightning current among interconnected ground electrodes in order to estimate if the interconnection, usually created to reduce ground potential rise during a single-line-to-ground fault, can give place to dangerous situations far from the installation hit by the lightning stroke. Four different case studies of direct lightning stroke are presented and discussed: (1 two secondary substations interconnected by the cables’ shields; (2 two secondary substations interconnected by a bare buried conductor; (3 a high voltage/medium voltage station connected with a secondary substation by the medium voltage cables’ shields; (4 a high voltage/medium voltage station connected with a secondary substation by a bare buried conductor. The results of the simulations show that a higher peak-lowering action on the lighting-stroke current occurs due to the use of bare conductors as interconnection elements in comparison to the cables’ shields.

  17. Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography

    International Nuclear Information System (INIS)

    Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.

    1998-01-01

    The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured

  18. The influence of ergonomic devices on mechanical load during patient handling activities in nursing homes.

    Science.gov (United States)

    Koppelaar, Elin; Knibbe, Hanneke J J; Miedema, Harald S; Burdorf, Alex

    2012-07-01

    shower chairs with a shorter duration of awkward back postures (38%), and an anti-embolism stockings slide with a lower frequency of forces exerted (95%). In wards in nursing homes with a higher number of staff less awkward back postures as well as forceful lifting were observed during patient handling activities. The use of ergonomic devices was high and associated with less forceful movements and awkward back postures. Both aspects will most likely contribute to the prevention of low back pain among nurses.

  19. Experiences with decontaminating tritium-handling apparatus

    International Nuclear Information System (INIS)

    Maienschein, J.L.; Garcia, F.; Garza, R.G.; Kanna, R.L.; Mayhugh, S.R.; Taylor, D.T.

    1992-01-01

    Tritium-handling apparatus has been decontaminated as part of the downsizing of the LLNL Tritium Facility. Two stainless-steel glove boxes that had been used to process lithium deuteride-tritide (LiDT) slat were decontaminated using the Portable Cleanup System so that they could be flushed with room air through the facility ventilation system. In this paper the details on the decontamination operation are provided. A series of metal (palladium and vanadium) hydride storage beds have been drained of tritium and flushed with deuterium, in order to remove as much tritium as possible. The bed draining and flushing procedure is described, and a calculational method is presented which allows estimation of the tritium remaining in a bed after it has been drained and flushed. Data on specific bed draining and flushing are given

  20. ITER - TVPS remote handling critical design issues

    International Nuclear Information System (INIS)

    1990-09-01

    This report describes critical design issues concerning remote maintenance of the ITER Torus Vacuum Pumping System (TVPS). The key issues under investigation are the regeneration/isolation valve seal and seal mechanism replacement; impact of inert gas operation; impact of remote handling (RH) on the building configuration and RH equipment requirements. Seal exchange concepts are developed and their impact on the valve design identified. Concerns regarding the design and operation of RH equipment in an inert gas atmosphere are also explored. The report compares preliminary RH equipment options, pumping equipment maintenance frequency and their impact on the building design, and makes recommendations where a conflict exists between pumping equipment and the building layout. (51 figs., 11 refs.)