WorldWideScience

Sample records for han chinese families

  1. Clinical predictors of familial depression in Han Chinese women.

    Science.gov (United States)

    Wang, Lina; Qiao, Dongdong; Li, Yihan; Wang, Liwei; Ren, Jianer; He, Kangmei; Sun, Jing; Wang, Zhoubing; Tian, Tian; Chen, Ce; Yang, Lei; Hu, Jian; Deng, Hong; Wang, Qian; Li, Keqing; Han, Jiyang; Rong, Han; Gan, Zhaoyu; Yang, Hong; Zhou, Pingliang; Pan, Jiyang; Zhou, Cong; Cui, Yanping; Song, Libo; Zhu, Yuzhang; Li, Ying; Wang, Xueyi; Ye, Lanxian; Liang, Wei; Chen, Yunchun; Tang, Qingjun; Guan, Jing; Shi, Shenxun; Kendler, Kenneth S; Flint, Jonathan; Liu, Lanfen

    2012-01-01

    A number of clinical features potentially reflect an individual's familial vulnerability to major depression (MD), including early age at onset, recurrence, impairment, episode duration, and the number and pattern of depressive symptoms. However, these results are drawn from studies that have exclusively examined individuals from a European ethnic background. We investigated which clinical features of depressive illness index familial vulnerability in Han Chinese females with MD. We used lifetime MD and associated clinical features assessed at personal interview in 1,970 Han Chinese women with DSM-IV MD between 30-60 years of age. Odds Ratios were calculated by logistic regression. Individuals with a high familial risk for MD are characterized by severe episodes of MD without known precipitants (such as stress life events) and are less likely to feel irritable/angry or anxious/nervous. The association between family history of MD and the lack of a precipitating stressor, traditionally a characteristic of endogenous or biological depression, may reflect the association seen in other samples between recurrent MD and a positive family history. The symptomatic associations we have seen may reflect a familial predisposition to other dimensions of psychopathology, such as externalizing disorders or anxiety states. © 2011 Wiley-Liss, Inc.

  2. Vision improvement in a Taiwanese (Han Chinese family with Leber's hereditary optic neuropathy

    Directory of Open Access Journals (Sweden)

    Hong-Zin Lin

    2012-12-01

    Full Text Available In this report, we describe a Taiwanese (Han Chinese family with Leber's hereditary optic neuropathy. The family carried a mitochondrial DNA mutation (mtDNA m.14484T>C associated with spontaneous visual improvement. A 15-year-old boy from this family was diagnosed with Leber's hereditary optic neuropathy 6 months after losing his vision. His vision recovered after 8 months of supportive treatment. His mother, older brother, and two sisters also had the same mutation and had previously experienced vision loss. In this family, there was no male predominance.

  3. [ZRS mutations in two Chinese Han families featuring triphalangeal thumbs and preaxial polydactyly].

    Science.gov (United States)

    Zhao, Ximeng; Yang, Wei; Sun, Miao; Zhang, Xue

    2016-06-01

    To identify the causative mutations in two Chinese Han families featuring triphalangeal thumbs (TPT) and preaxial polydactyly (PPD). Blood samples were collected from 9 members (2 affected) from family 1 and 14 members (7 affected) from family 2. After genomic DNA was extracted, the ZPA regulatory sequence (ZRS) region was analyzed with real-time quantitative PCR (qPCR) and Sanger sequencing. For family 1, haplotypes compassing the ZRS were also analyzed with short tandem repeats (STR) and single nucleotide changes. No copy number mutation around the ZRS region was found in both families. Two heterogeneous mutations in the ZRS (406A>G and 105C>G) were found to co-segregate with the TPT/PPD malformation in family 1 and 2, respectively. Neither mutation was detected in 200 healthy individuals. Haplotype analysis and Sanger sequencing of family 1 indicated that the first TPT/PPD patient in the family was both germline and somatic mosaic for the 406A>G mutation. Two pathogenic ZRS mutations, 105C>G and 406A>G, have been identified in two Chinese Han families with TPT/PPD, among which the 406A>G mutation was de novo.

  4. Familial correlation and aggregation of body mass index and blood pressure in Chinese Han population.

    Science.gov (United States)

    Hu, Yang; He, Liu; Wu, Yangfeng; Ma, Guansheng; Li, Liming; Hu, Yonghua

    2013-07-26

    It remains unclear whether the body mass index (BMI) and blood pressure (BP) profile are clustered within families in Chinese Han population. The aim of this study is to explore familial aggregation and parent-offspring correlations of BMI and blood pressure in Chinese Han population. 6,369 Han nucleus families, consisting of parents and at least one biological adult child who were living together, were enrolled from the nation-wide cross-sectional study (China National Nutrition and Health Survey) which was conducted in 2002, with a total number of 19,107 participants aged 18-64 years (6,369 sets of parents, 4,132 sons and 2,237 daughters). Family aggregation (Intra-class correlations, ICCs) and parent-offspring correlations in BMI, systolic BP (SBP) and diastolic BP (DBP) were estimated using linear mixed effect regression models. BMI and BP levels in two generations and ICCs of BMI, SBP and DBP varied across the country. Familial aggregation of overweight/obesity was observed in rural area (ICC=5.4%, p<0.05), and high BP (defined as SBP ≥ 120 mmHg or DBP ≥ 80 mmHg) was more common in low income families (ICC=4.4%, p<0.05) compared to middle income (ICC=1.9%) and high income families (ICC=2.6%). Additionally, offspring with more parents being overweight/obese tend to have higher BMI. The similar trend was found for high BP. However, we did not observe that same-sex parent-offspring correlations of BMI and BP were stronger than the correlations for mother-son or father-daughter. Our study suggested that familial environments, alongside the impact of genetic factors, could be important non-communicable chronic diseases (NCD) risk factors. Family-based intervention taking both mother and father into account might have great potential in NCD prevention for younger generation.

  5. Dynamic mutation analysis of a SCA3 Chinese Han family and prenatal diagnosis

    Directory of Open Access Journals (Sweden)

    LI Jing

    2012-06-01

    Full Text Available Objective To explore the clinical features, genetic characters and the importance of prenatal diagnosis in spinocerebellar ataxia 3 (SCA3 patients. Methods SCA3/ATXN3 gene was determined by using PCR and segmental analysis techniques in 2 patients among a SCA3 Chinese Han family which included 9 patients in four generations. One patient was the proband's fetus. The clinical characters were also documented and analyzed in this family. Results There were 9 patients in this family with autosomal dominant inheritance feature. The initial symptoms in all affected members except the fetus were the gait disorders accompanied by dysphasia. Inability of upward gaze and bilateral Barbinski's signs were noted in proband. The onset age became earlier from generation to generation in this family which was around 50 year-old, 40 to 45 year-old, 28 year-old in generation Ⅰ, Ⅱ and Ⅲ, respectively. CAG repeats in SCA3/ATXN3 allele were 77 in proband, as well as in the fetus, while the normal SCA3/ATXN3 allele CAG repeats were less than 44. Conclusion SCA3 is the most frequent subtype of SCA in Asian. Unsteadiness of gait are first noted in most patients accompanied by other different symptoms and signs. Genetic anticipation was found in SCA3. But gene analysis revealed less dynamic mutation frequence in this family. Since there was no effective treatment in SCA3, hereditary consultation and prenatal diagnosis play an important role in disease prevention and hereditary.

  6. ITIH family genes confer risk to schizophrenia and major depressive disorder in the Han Chinese population.

    Science.gov (United States)

    He, Kuanjun; Wang, Qingzhong; Chen, Jianhua; Li, Tao; Li, Zhiqiang; Li, Wenjin; Wen, Zujia; Qiang, Yu; Wang, Meng; Shen, Jiawei; Song, Zhijian; Ji, Jue; Feng, Guoyin; Qi, Shuguang; Lin, He; Shi, Yongyong; Cheng, Zaohuo

    2014-06-03

    As a major extracellular matrix component, ITIHs played an important role in inflammation and carcinogenesis. Several genome-wide association studies have reported that some positive signals which were derived from the tight linkage disequilibrium region on chromosome 3p21 were associated with both schizophrenia and bipolar disorders in the Caucasian population. To further investigate whether this genomic region is also a susceptibility locus of schizophrenia and major depressive disorder in the Han Chinese population, we conducted this study by recruiting 1235 schizophrenia patients, 1045 major depressive disorder patients and 1235 healthy control subjects in the Han Chinese samples for a case-control study. We genotyped seven SNPs within this region using TaqMan® technology. We found that rs2710322 was significantly associated with schizophrenia (adjusted P(allele) = 0.0018, adjusted P(genotype) = 0.006, OR [95% CI] = 1.278 [1.117-1.462]) while rs1042779 was weakly associated with schizophrenia (adjusted P(allele) = 0.048, OR [95% CI] = 1.164 [1.040-1.303]) and major depressive disorder (adjusted P(allele) = 0.042, OR [95% CI] = 1.178 [1.047-1.326]); it was also our finding that rs3821831 was positively associated with major depressive disorder (adjusted P(allele) = 0.003, adjusted P(genotype) = 0.006, OR [95% CI] = 1.426 [1.156-1.760]). Furthermore, no haplotype was found to be associated with schizophrenia and major depressive disorder. Via the association analysis which combines the schizophrenia and major depressive disorder cases, we also notice that rs1042779 and rs3821831 were significantly associated with combined cases (rs1042779: adjusted P(allele) = 0.012, adjusted P(genotype) = 0.018, OR [95% CI] = 1.171 [1.060-1.292]; rs3821831:adjusted P(genotype) = 0.012, OR [95% CI] = 1.193 [1.010-1.410]). Our results revealed that the shared genetic risk factors of both schizophrenia and major depressive disorder exist in ITIH family genes in the Han Chinese

  7. A genetic risk factor for thrombophilia in a Han Chinese family.

    Science.gov (United States)

    Sun, Guoping; Jia, Yicong; Meng, Jingye; Ou, Minglin; Zhu, Peng; Cong, Shan; Luo, Yadan; Sui, Weiguo; Dai, Yong

    2017-04-01

    Thrombophilia is a multifactorial disorder involving environmental and genetic factors. Well‑known factors that result in predisposition to congenital disorders associated with thrombophilia include antithrombin deficiency, protein C and S deficiency, Factor V Leiden mutation, abnormal prothrombin and antiphospholipid syndrome. The present study revealed an association between a mutation of the F2 gene, which codes for coagulation factor II, thrombin, and the risk of thrombophilia in a Han Chinese family, of which four members (I‑2, II‑2, II‑3 and III‑1) had a history of deep venous thromboembolism. The disease was measured in this family using laboratory measurements and computed tomography angiography. To identify the abnormality underlying the increased thrombophilia risk, whole‑exome sequencing technology was used to analyze two affected individuals (II‑2 and III‑1). An exonic missense F2 mutation, T165M (NM_000506:c.C494T:p.T165M;rs5896), was identified from a total of 2,222 and 2,203 genetic variations observed in the two affected individuals, respectively, which were subsequently filtered and confirmed using Sanger sequencing. I‑2, II‑3 and III‑1 shared this mutation with the proband (II‑2), and II‑6 had a heterozygous form of the mutation. This deleterious mutation was not identified in normal controls. The present study may improve understanding of the function of the F2 gene.

  8. Complex Segregation Analysis Provides Evidence for Autosomal Dominant Transmission in the Chinese Han Families with Ankylosing Spondylitis

    Directory of Open Access Journals (Sweden)

    Yutong Jiang

    2017-01-01

    Full Text Available Introduction. Familial aggregation of ankylosing spondylitis (AS has been frequently noticed. However, the mode of inheritance in AS remains poorly understood. Our aim was to determine the mode of inheritance best fitting the observed transmission pattern of AS families. Methods. Families with 5 or more AS patients diagnosed with 1984 modified New York criteria were recruited. We performed complex segregation analysis for a binary trait in regressive multivariate logistic models. The inheritance models, including sporadic, major gene, environmental, general, and other 9 models, were compared by likelihood ratio tests and Akaike’s Information Criterion. Results. This research included 9 Chinese Han AS families with a total number of 315 persons, including 74 patients. First, familial association was determined. Sporadic with familial association model was rejected when compared with either the general model or the homogeneous general model (p<0.001. The environmental model was also rejected when compared with general models (p<0.02. Mendelian dominate mode fitted best in 5 AS families, while Tau AB free model best explained the mode of inheritance in these AS families. Conclusion. This study provided evidence in support of Mendelian dominant mode and firstly discovered a non-Mendelian mode called tau AB free inheritance mode in AS.

  9. CYP gene family variants as potential protective factors in drug addiction in Han Chinese.

    Science.gov (United States)

    Zhang, Hongxing; Yang, Qi; Zheng, Wenkai; Ouyang, Yongri; Yang, Min; Wang, Fengjiao; Jin, Tianbo; Zhang, Ji; Wang, Zhenyuan

    2016-08-01

    There is growing evidence that genetic factors also contribute to drug addiction. The human cytochrome P450 has shown special interest because of pharmacokinetic variation in different individuals and populations, which is largely determined by the relevant genes. The present study aimed to investigate the polymorphism of the CYP/addicts relationship. We genotyped 13 tag single-nucleotide polymorphisms (tSNPs) from three genes, including 692 cases and 700 controls. Sequenom MassARRAY RS1000 (Sequenom, Inc., San Diego, CA, USA) was used for SNP genotyping. Statistical analysis of the association between tSNPs and drug addiction was performed using the chi-squared test and SNP Stats software (http://bioinfo.iconcologia.net). The T/T genotype of rs2242480 in CYP3A4 was associated with decreased risk in the recessive model (p = 0.0002). Allele frequency at rs3743484 in CYP1A2 showed significant differences between addicts and controls (p = 0.046; odds ratio = 0.80; 95% confidence interval = 0.65-1.00). In genetic model analyses, the minor C allele of rs3743484 in CYP1A2 was associated with a reduced risk of drug addiction based on analysis using codominant and additive models (p = 0.027 dominant model; p =0.038 additive model). Our findings show that at allelic and genotypic level polymorphisms in CYP3A4 and CYP1A2 are significantly associated with a reduced risk of drug addiction in X'ian Han Chinese individuals. However, this result needs to be confirmed in additional studies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Novel mutations of the ATP7B gene in Han Chinese families with pre-symptomatic Wilson's disease.

    Science.gov (United States)

    Yuan, Zhe-Feng; Wu, Wei; Yu, Yong-Lin; Shen, Jue; Mao, Shan-Shan; Gao, Feng; Xia, Zhe-Zhi

    2015-08-01

    Wilson's disease (WD) is an autosomal recessive genetic disorder of copper metabolism, caused by mutations in the ATP7B gene, resulting in copper accumulation in the liver, brain, kidney, and cornea and leading to significant disability or death if untreated. Early diagnosis and proper therapy usually predict a good prognosis, especially in pre-symptomatic WD. Genetic testing is the most accurate and effective diagnostic method for early diagnosis. The clinical and biochemical features of three unrelated Han Chinese families with pre-symptomatic WD were reported. The molecular defects in these families were investigated by polymerase chain reaction and DNA sequencing. Hundred healthy children with the same ethnic background served as controls. Bioinformatic tools (polymorphism phenotyping-2, sorting intolerant from tolerant, protein analysis through evolutionary relationships, and predictor of human deleterious single nucleotide polymorphisms) were combined and used to predict the functional effects of mutations. We identified 2 novel ATP7B mutations (p.Leu692Pro and p.Asn728Ser) and 3 known mutations (p.Met769fs, p.Arg778Leu and p.Val1216Met) in these Chinese WD families. These mutations were not observed in the 100 normal controls. The bioinformatic method showed that p.Leu692Pro and p.Asn728Ser mutations are pathogenic. Our research enriches the mutation spectrum of the ATP7B gene worldwide and provides valuable information for studying the mutation types and mode of inheritance of ATP7B in the Chinese population. Liver function analysis and genetic testing in young children with WD are necessary to shorten the time to the initiation of therapy, reduce damage to the liver and brain, and improve prognosis.

  11. Mutation detection of type II hair cortex keratin gene KRT86 in a Chinese Han family with congenital monilethrix.

    Science.gov (United States)

    Ye, Zhen-zhen; Nan, Xu; Zhao, Hong-shan; Chen, Xue-rong; Song, Qing-hua

    2013-08-01

    Monilethrix is an autosomal dominant hair disorder characterized clinically by alopecia and follicular papules. In this study, we collected a Han monilethrix family to detect the mutations in patients and investigated the correlation between the genotype and phenotype of monilethrix. In this study, we identified a Chinese family with monilethrix through light microscopic and scanning electron microscopic (SEM) examination. Genomic DNA from peripheral blood samples was prepared. DNA samples from controls and monilethrix patients were subject to polymerase chain reaction (PCR) amplification. Two pairs of primers were used to amplify the seventh exon of KRT86. Mutation screening of the PCR products was detected using direct sequencing. Light microscopic examination showed a regular alternate enlargement and narrow area. SEM examination showed that part of the cuticle of the nodules shed and disappeared gradually in the narrow area with granular protrusions on the surface similar to the erosion-like structure. Parallel longitudinal ridge and groovepattern appeared, and the ridges varied in width, like dead wood. A heterozygous transversion mutation c.1204G > A (p.E402K) in the seventh exon of KRT86 was identified in both patients. The mutation of extron 7 of KRT86 identified plays a major role in the pathogenesis of this pedigree with monilethrix, and is a mutation hot spot of KRT86. Further research is needed to explore the relationship between the phenotype and the mutation of the type II hair keratin gene KRT86 of monilethrix.

  12. Recombination analysis of autosomal short tandem repeats in Chinese Han families.

    Science.gov (United States)

    Liu, Qiu-Ling; Luo, Hong; Zhao, Hu; Huang, Xiao-Ling; Cheng, Jian-Ding; Lu, De-Jian

    2014-03-01

    Recombination fractions between forensic STRs can be extrapolated from the International HapMap Project, but the concordance between recombination fractions predicated from genetic maps and derived from observation of STR transmissions in families is still ambiguous for autosomal STRs because of limited family studies. Therefore, the main goal of this study is to compare recombination fractions estimated by pedigree analysis with those derived from HapMap phase SNP data. Genotypes of nine autosomal STR pairs (TPOX-D2S1772, D5S818-CSF1PO, D7S3048-D7S820, D8S1132-D8S1179, TH01-D11S2368, vWA-D12S391, D13S325-D13S317, D18S51-D18S1364, and D21S11-PentaD) from 207 two-generation families with two to five children (the number of families with five, four, three, and two children was 2, 3, 20, and 182, respectively) were used to analyze the recombination. The linkage analysis showed that significant linkage was observed at six STR pairs (D5S818-CSF1PO, D8S1132-D8S1179, TH01-D11S2368, vWA-D12S391, D13S325-D13S317, and D18S51-D18S1364) with genetic distances HapMap. Their recombination fractions calculated from family data were very close to those derived from HapMap. However, three STR pairs of TPOX-D2S1772, D7S3048-D7S820, and D21S11-PentaD showed no significant linkage with genetic distances from 43.38 to 91.49 cM. Our results indicate that recombination fractions extrapolated from HapMap can provide a substitute if empirical data are unavailable for the linkage STR pair with a genetic distance spanned <36.22 cM. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Novel non-synonymous mutation in the transforming growth factor beta binding protein-like (TB) domain of the fibrillin-1 (FBN1) gene in a Han Chinese family with Marfan syndrome (MFS).

    Science.gov (United States)

    Qin, Yingying; Yan, Junhao; Simpson, Joe Leigh; Gu, Harvest F; Wang, Lai-Cheng; Chen, Zi-Jiang

    2007-10-01

    In order to further understand the role of fibrillin-1 (FBN1, OMIM 134797) perturbations in the pathogenesis of Marfan syndrome (MFS, OMIM 154700) we studied a Han Chinese family in which MFS was segregating. In the Chinese family with 5 affected members, mutation screening for FBN1 was performed using direct sequencing. A novel non-synonymous mutation in the transforming growth factor beta binding protein-like (TB) domain of the FBN1 gene was found. The missense mutation c.3022T>C (C1008R) located in exon 24. This mutation was present in the proband and in two other affected family members, but in neither unaffected family members nor unrelated control subjects. The novel non-synonymous mutation, c.3022T>C (C1008R) in the TB domain of FBN1 gene, may be involved in the pathogenesis of MFS in a Han Chinese family.

  14. Mitochondrial tRNAAla C5601T mutation may modulate the clinical expression of tRNAMet A4435G mutation in a Han Chinese family with hypertension.

    Science.gov (United States)

    Zheng, Ping; Li, Shiliang; Liu, Chun; Zha, Zhengbiao; Wei, Xiang; Yuan, Yuan

    2017-12-06

    Mutations in mitochondrial DNA, especially in mitochondrial tRNA (mt-tRNA) genes, are the important causes for maternally inherited hypertension. In this study, we reported the clinical, genetic, and molecular characterization of a Han Chinese family with hypertension. Most strikingly, this family exhibited a high penetrance and expressivity of hypertension. Sequence analysis of the complete mt-tRNA genes showed the presence of tRNAMet A4435G and tRNAAla C5601T mutations. The A4435G had already been reported as a pathogenic mutation associated with hypertension; in addition, the C5601T mutation, which was located at the highly conserved nucleotide of T arm of tRNAAla, created a novel Watson-Crick base pairing and may result in failure of tRNA metabolism. Moreover, bioinformatics analysis indicated that the C5601T mutation altered the secondary structure of tRNAAla. Thus, the mitochondrial dysfunction, caused by the A4435G mutation, may be worsened by the C5601T mutation. Taken together, our data indicated that the co-occurrence of the A4435G and C5601T mutations may account for the high penetrance and expressivity of hypertension in this family. Therefore, our study provided novel insight into the pathophysiology of maternally inherited hypertension.

  15. Evidence for association between Disrupted-in-schizophrenia 1 (DISC1 gene polymorphisms and autism in Chinese Han population: a family-based association study

    Directory of Open Access Journals (Sweden)

    Ruan Yan

    2011-05-01

    Full Text Available Abstract Background Disrupted-in-Schizophrenia 1 (DISC1 gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02. After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism.

  16. The rare intracellular RET mutation p. S891A in a Chinese Han ...

    Indian Academy of Sciences (India)

    We report intracellular RET mutation in a Han Chinese pedigree with familial medullary thyroid carcinoma (FMTC). Direct sequencing of RET proto-oncogene identified a missense c.2671T > G (p.S891A) mutation in 6 of 14 family members. The single nucleotide polymorphisms c. 135A > G (p.A45A), IVS4+48A >G, c. 1296A ...

  17. rs2043211 polymorphism in CARD8 is not associated with Tourette syndrome in a family-based association study in the Chinese Han population.

    Science.gov (United States)

    Yi, Mingji; Shao, Xiaohui; Ma, Jianhua; Tian, Bo; Zhang, Ying; Liu, Shiguo

    2015-01-01

    Previous studies showed that postinfectious autoimmunity and immune deficiency played an important role in the pathogenesis of Tourette syndrome. CARD8 can suppress activity of NF-ΚB activated by inflammatory mediators. To study the association between the rs2043211 polymorphism in CARD8 and susceptibility to Tourette syndrome in Chinese Han population. We recruited 279 patients diagnosed with Tourette syndrome and their parents for the study. Genotyping for CARD8 rs2043211 single-nucleotide polymorphism was performed using predesigned TaqMan single-nucleotide polymorphism genotyping assay. The genetic contribution of this single-nucleotide polymorphism was evaluated using transmission disequilibrium test and haplotype relative risk and the haplotype-based haplotype relative risk. The results of the allelic and genotypic distribution of rs2043211 polymorphism in CARD8 showed that both the Tourette syndrome patients group and the parents group are in Hardy-Weinberg equilibrium. No significant differences were observed in the mutant allele transmission (transmission disequilibrium test = 1.107, df = 1, p = 0.322). Results of haplotype relative risk analysis showed that no statistical significant difference was found in the genotypic frequency (AA/AT/TT) of Tourette syndrome patients passed from parents (haplotype relative risk = 1.152, χ(2 )= 0.494, p = 0.482, 95% CI = 0.777-1.708). Similarly, the analysis of haplotype-based haplotype relative risk was also not to support a statistically significant association in allelic frequency (A/T) of Tourette syndrome patients passed from parents (haplotype-based haplotype relative risk = 1.130, χ(2 )= 1.037, p = 0.308, 95% CI = 0.893-1.429). Our results suggest CARD8 might not play a role in the pathogenesis of Tourette syndrome in Chinese Han population. However, the results still need to be tested in a larger sample and different populations. © The Author(s) 2015 Reprints and

  18. Complete blood count reference intervals for healthy Han Chinese adults.

    Directory of Open Access Journals (Sweden)

    Xinzhong Wu

    Full Text Available Complete blood count (CBC reference intervals are important to diagnose diseases, screen blood donors, and assess overall health. However, current reference intervals established by older instruments and technologies and those from American and European populations are not suitable for Chinese samples due to ethnic, dietary, and lifestyle differences. The aim of this multicenter collaborative study was to establish CBC reference intervals for healthy Han Chinese adults.A total of 4,642 healthy individuals (2,136 males and 2,506 females were recruited from six clinical centers in China (Shenyang, Beijing, Shanghai, Guangzhou, Chengdu, and Xi'an. Blood samples collected in K2EDTA anticoagulant tubes were analyzed. Analysis of variance was performed to determine differences in consensus intervals according to the use of data from the combined sample and selected samples.Median and mean platelet counts from the Chengdu center were significantly lower than those from other centers. Red blood cell count (RBC, hemoglobin (HGB, and hematocrit (HCT values were higher in males than in females at all ages. Other CBC parameters showed no significant instrument-, region-, age-, or sex-dependent difference. Thalassemia carriers were found to affect the lower or upper limit of different RBC profiles.We were able to establish consensus intervals for CBC parameters in healthy Han Chinese adults. RBC, HGB, and HCT intervals were established for each sex. The reference interval for platelets for the Chengdu center should be established independently.

  19. Hereditary Breast Cancer in the Han Chinese Population

    Science.gov (United States)

    Cao, Wenming; Wang, Xiaojia; Li, Ji-Cheng

    2013-01-01

    Breast cancer is the most common malignancy among women and has a strong genetic background. So far, 13 breast cancer susceptibility genes of high or moderate penetrance have been identified. This review summarizes findings on these genes in Han Chinese. BRCA1 and BRCA2 are the 2 most important susceptibility genes. They have a relatively low mutation rate, and the most frequent sites of mutation are in exon 11. Frameshift mutations are the main type of mutation. Founder mutations may also exist, and BRCA-associated breast cancer has specific clinicopathologic characteristics. TP53 and PALB2 are relatively rare susceptibility genes. The relationship between the other 9 genes and breast cancer has not been fully elucidated. At present, the mutation spectrum for these susceptibility genes is not well understood in the Chinese population, and there are few reports on prognosis and clinical intervention in high-risk populations. Therefore, the true value of genetic counseling for breast cancer has yet to be realized. This article reviews studies of hereditary breast cancer in the Han Chinese population, highlights potential inadequacies, and provides a foundation for genetic counseling for breast cancer in China. PMID:23318652

  20. Spinocerebellar ataxia type 13 is an uncommon SCA subtype in the Chinese Han population.

    Science.gov (United States)

    Peng, Lan; Wang, Chunrong; Chen, Zhao; Wang, Jun-Ling; Tang, Bei-Sha; Jiang, Hong

    2013-07-01

    The spinocerebellar ataxias (SCAs) are a clinically and genetically heterogeneous group of neurodegenerative disorders, among which SCA subtype 13 (SCA13) was found associated with mutations in the KCNC3 gene. Among 522 Chinese Han SCA patients (including familial and sporadic) we have collected since 1995, approximately 40% of them have not yet been assigned genotype. To investigate the mutation frequency of KCNC3 in SCA patients from mainland Chinese Han population, we analyzed the KCNC3 gene in 201 unrelated patients diagnosed with dominantly inherited cerebellar ataxia using the denaturing high-performance liquid chromatography (DHPLC) method. All analyzed samples displayed the normal elution profile, which denoted that no disease-related mutation was identified, suggesting that SCA13 be a rare form of SCA in mainland China.

  1. Genome-Wide Association of Heroin Dependence in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Gursharan Kalsi

    Full Text Available Drug addiction is a costly and recurring healthcare problem, necessitating a need to understand risk factors and mechanisms of addiction, and to identify new biomarkers. To date, genome-wide association studies (GWAS for heroin addiction have been limited; moreover they have been restricted to examining samples of European and African-American origin due to difficulty of recruiting samples from other populations. This is the first study to test a Han Chinese population; we performed a GWAS on a homogeneous sample of 370 Han Chinese subjects diagnosed with heroin dependence using the DSM-IV criteria and 134 ethnically matched controls. Analysis using the diagnostic criteria of heroin dependence yielded suggestive evidence for association between variants in the genes CCDC42 (coiled coil domain 42; p = 2.8x10-7 and BRSK2 (BR serine/threonine 2; p = 4.110-6. In addition, we found evidence for risk variants within the ARHGEF10 (Rho guanine nucleotide exchange factor 10 gene on chromosome 8 and variants in a region on chromosome 20q13, which is gene-poor but has a concentration of mRNAs and predicted miRNAs. Gene-based association analysis identified genome-wide significant association between variants in CCDC42 and heroin addiction. Additionally, when we investigated shared risk variants between heroin addiction and risk of other addiction-related and psychiatric phenotypes using polygenic risk scores, we found a suggestive relationship with variants predicting tobacco addiction, and a significant relationship with variants predicting schizophrenia. Our genome wide association study of heroin dependence provides data in a novel sample, with functionally plausible results and evidence of genetic data of value to the field.

  2. Association study of SHANK3 gene polymorphisms with autism in Chinese Han population

    Directory of Open Access Journals (Sweden)

    Ruan Yan

    2009-06-01

    Full Text Available Abstract Background Autism, a heterogeneous disease, is described as a genetic psychiatry disorder. Recently, abnormalities at the synapse are supposed to be important for the etiology of autism.SHANK3 (SH3 and multiple ankyrin repeat domains protein gene encodes a master synaptic scaffolding protein at postsynaptic density (PSD of excitatory synapse. Rare mutations and copy number variation (CNV evidence suggested SHANK3 as a strong candidate gene for the pathogenesis of autism. Methods We performed an association study between SHANK3 gene polymorphisms and autism in Chinese Han population. We analyzed the association between five single nucleotide polymorphisms (SNPs of the SHANK3 gene and autism in 305 Chinese Han trios, using the family based association test (FBAT. Linkage disequilibrium (LD analysis showed the presence of LD between pairwise markers across the locus. We also performed mutation screening for the rare de novo mutations reported previously. Results No significant evidence between any SNPs of SHANK3 and autism was observed. We did not detect any mutations described previously in our cohort. Conclusion We suggest that SHANK3 might not represent a major susceptibility gene for autism in Chinese Han population.

  3. Genetic mutations in nonsyndromic deafness patients of Chinese minority and Han ethnicities in Yunnan, China.

    Science.gov (United States)

    Xin, Feng; Yuan, Yongyi; Deng, Xiaoming; Han, Mingyu; Wang, Guojian; Zhao, Jiandong; Gao, Xue; Liu, Jun; Yu, Fei; Han, Dongyi; Dai, Pu

    2013-12-17

    Each year in China, 30,000 babies are born with congenital hearing impairment. However, the molecular etiology of hearing impairment in the Yunnan Province population where more than 52 minorities live has not been thoroughly investigated. To provide appropriate genetic testing and counseling to these families, we investigated the molecular etiology of nonsyndromic deafness in this population. Unrelated students with hearing loss (n = 235) who attended Kunming Huaxia secondary specialized school in Yunnan enrolled in this study. Three prominent deafness-related genes, GJB2, SLC26A4 and mtDNA 12S rRNA, were analyzed. High-resolution temporal bone computed tomography (CT) scan examinations were performed in 100 cases, including 16 cases with SLC26A4 gene variants, and 37 minorities and 47 Han cases without any SLC26A4 gene mutation. The GJB2 mutation was detected in 16.67% (7/42) of minority patients and 17.62% (34/193) of Chinese Han patients (P > 0.05). 235delC was the hotspot mutation in nonsyndromic hearing loss (NSHL) patients, whereas 35delG was not found. The 431_450del19 mutation was detected for the first time in Han NSHL patients, which resulted in a premature stop codon and changed the protein. The SLC26A4 mutation was found in 9.52% (4/42) of minority patients and 9.84% (19/193) of Han Chinese patients (P > 0.05). The frequencies of mtDNA 12S rRNA mutation in minority and Han Chinese patients were 11.90% (5/42) and 7.77% (15/193; P > 0.05), respectively. Sixteen (16/23, 69.57%) patients with SLC26A4 mutations received temporal bone CT scan, and 14 patients were diagnosed with enlarged vestibular aqueducts (EVAs); the other 2 patients had normal inner ear development. The ratio of EVA in the minorities was 14.63% (6/41). In this study, a total of 35.74% deaf patients showed evidence of genetic involvement, based on either genetic screening or family history; 17.45%, 9.79%, and 8.51% of the patients were determined to have inherited hearing

  4. Clinical, Biochemical, and Genetic Features of 41 Han Chinese Families With Primary Hypertrophic Osteoarthropathy, and Their Therapeutic Response to Etoricoxib: Results From a Six-Month Prospective Clinical Intervention.

    Science.gov (United States)

    Li, Shan-Shan; He, Jin-We; Fu, Wen-Zhen; Liu, Yu-Juan; Hu, Yun-Qiu; Zhang, Zhen-Lin

    2017-08-01

    Primary hypertrophic osteoarthropathy (PHO) is a rare inherited disease caused by genetic defects in the prostaglandin metabolism pathway; disturbed prostaglandin E2 (PGE2 ) catabolism resulting in increased PGE2 level is suggested in the pathogenesis. Forty-three Han Chinese patients with PHO were studied and 41 of them were treated. Mutations in the HPGD gene, causing hypertrophic osteoarthropathy, primary, autosomal recessive 1 (PHOAR1; OMIM 259100), were identified in seven patients, and mutations in the SLCO2A1 gene, causing hypertrophic osteoarthropathy, primary, autosomal recessive 2 (PHOAR2; OMIM 614441), were identified in 36 patients. Clinical phenotypes of PHO varied, ranging from mild isolated finger clubbing to severe pachydermia and disabling joint swelling, even within families. Circulating PGE2 metabolism features of PHOAR2 were different from those of PHOAR1. Different frequency and severity of pachydermia between the subgroups were also indicated. A percentage of PHOAR2 patients suffered from gastrointestinal hemorrhage, but this symptom was not observed in the PHOAR1 subgroup. Clinical evidence highlighted the essential role of sex hormones in prostaglandin transporter regulation with respect to PHOAR2 onset, although no significant associations of urinary PGE2 or PGE-M with sex hormones were identified. Treatment with etoricoxib, a selective cyclooxygenase-2 inhibitor, was proved to be beneficial and safe. We detected its notable efficacy in decreasing urinary PGE2 levels in the majority of the enrolled patients during 6 months of intervention; clinical phenotypes assessed, including pachydermia, finger clubbing, and joint swelling, were improved. We found no visible evidence of a positive effect of etoricoxib on periostosis; however, significant links between urinary PGE2 and serum bone turnover markers indicated a potential role of decreased PGE2 in periostosis management. This is the largest reported cohort of subjects genetically diagnosed

  5. Association of polymorphisms in TNF and GRN genes with ankylosing spondylitis in a Chinese Han population.

    Science.gov (United States)

    Hu, Naiwen; Cui, Yazhou; Yang, Qingrui; Wang, Liya; Yang, Xinglin; Xu, Hongzhi

    2017-12-11

    The aim of this study is to investigate the association of the polymorphisms in tumor necrosis factor (TNF) and granulin (GRN) with ankylosing spondylitis (AS) in a Chinese Han population. Five single nucleotide polymorphisms (SNPs) covering TNF and six SNPs covering GRN were investigated in 861 Chinese Han AS patients and 864 healthy controls. For rs1799964, the C allele was linked to reduced risk of AS (p  0.05). This study indicates that polymorphisms in TNF are related to AS, but polymorphisms in GRN are not related to AS susceptibility in a Chinese Han population.

  6. Characterization of Killer cell immunoglobulin-like receptor (KIR) genotypes and haplotypes in Chinese Han population.

    Science.gov (United States)

    Bao, X; Wang, M; Zhou, H; Wu, X; Yang, L; Xu, C; Yuan, X; Zhang, J; Li, L; Wu, D; He, J

    2013-11-01

    We performed Killer cell immunoglobulin-like receptor (KIR) genotyping on 1271 individuals of Chinese Han origin including 102 families and 965 unrelated individuals. The families (with one child and both parents) were subjected for haplotype analysis. Forty-one different genotypes were identified. The frequencies of the KIR genotypes found in the family panel were confirmed by those found in the unrelated panel. The family study showed segregation of one A haplotype and at least 15 unique B haplotypes. The most commonly observed haplotypes in group B were B1, B2, and B3, present at a frequency of 10.05%, 6.62%, and 4.90%, respectively. On the basis of the combination of KIR genes, six centromeric and seven telomeric gene motifs have been identified. Motif cB02 was the most frequent haplotype B specific centromeric segment while tB01 was the most frequent haplotype B specific telomeric segment. The distinct distribution of KIR haplotypes in each population may reflect the history of directional and balancing selection of different races. The gene combinations of group A and B1/B2/B3 haplotype were the most frequent genotypes named as Bx1, Bx2, and Bx3, present at a frequency of 13.72%, 7.35%, and 4.41% in the family panel, and at a frequency of 15.86%, 10.15%, and 5.80% in the unrelated panel, respectively. Overall, this study showed the diversity of KIR haplotypes and genotypes in Chinese Han population and developed a criterion for distinguish KIR haplotypes/genotypes for the population. KIR genotyping and haplotype analysis should be useful for selection of the most optimum donor grafts with favorable KIR gene content for transplants. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Molecular analysis of RNF213 gene for moyamoya disease in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    Full Text Available BACKGROUND: Moyamoya disease (MMD is an uncommon cerebrovascular disorder characterized by progressive occlusion of the internal carotid artery causing cerebral ischemia and hemorrhage. Genetic factors in the etiology and pathogenesis of MMD are being increasingly recognized. Previous studies have shown that the RNF213 gene was related to MMD susceptibility in the Japanese population. However, there is no large scale study of the association between this gene and MMD in the Chinese Han population. Thus we designed this case-control study to validate the R4810K mutation and to define the further spectrum of RNF213 mutations in Han Chinese. METHODOLOGY/PRINCIPAL FINDINGS: Genotyping of the R4810K mutation in the RNF213 gene was performed in 170 MMD cases and 507 controls from a Chinese Han population. The R4810K mutation was identified in 22 of 170 MMD cases (13%, including 21 heterozygotes and a single familial homozygote. Two of the 507 controls (0.4% were heterozygous R4810K carriers. The R4810K mutation greatly increased the risk for MMD (OR = 36.7, 95% CI: 8.6~156.6, P = 6.1 E-15. The allele frequency of R4810K was significantly different between patients with ischemia and hemorrhage (OR = 5.4, 95% CI: 1.8~16.1, P = 0.001. Genomic sequencing covering RNF213 exon 40 to exon 68 also identified eight other non-R4810K variants; P4007R, Q4367L, A4399T, T4586P, L4631V, E4950D, A5021V and M5136I. Among them A4399T polymorphism was found in 28/170 cases (16.5% and 45/507 controls (8.9% and was associated with MMD (OR = 2.0, 95% CI: 1.2~3.3, P = 0.004, especially with hemorrhage (OR = 2.8, 95% CI: 1.2~6.5, P = 0.014. CONCLUSIONS: RNF213 mutations are associated with MMD susceptibility in Han Chinese. The ischemic type MMD is particularly related to the R4810K mutation. However, A4399T is also a susceptible variant for MMD, primarily associated with hemorrhage. Identification of novel variants in the RNF213 gene further highlights the genetic

  8. Association of NCOA3 polymorphisms with Dyslipidemia in the Chinese Han population

    National Research Council Canada - National Science Library

    Yu, Mingxi; Gilbert, Siame; Li, Yong; Zhang, Huiping; Qiao, Yichun; Lu, Yuping; Tang, Yuan; Zhen, Qing; Cheng, Yi; Liu, Yawen

    2015-01-01

    ...) plays a critical role in lipid metabolism as well as adipogenesis and obesity. The present study aims to investigate the association between NCOA3 SNPs and dyslipidemia in the Chinese Han population...

  9. Population genetics of 30 insertion/deletion polymorphisms in Han Chinese population from Zhejiang Province.

    Science.gov (United States)

    Liu, Xiling; Chen, Fang; Niu, Yong; Bian, Yingnan; Zhang, Suhua; Zhu, Ruxin; Li, Chengtao

    2017-05-01

    Insertion/deletion (InDels) markers can serve as a useful supporting tool to short tandem repeat (STR) typing systems for human identification. The Qiagen DIPplex Investigator kit, which contains 30 biallelic autosomal InDels and amelogenin, has been developed for forensic use. To estimate the genetic diversity of the 30 markers in Han Chinese individuals living in Zhejiang and to further evaluate their applicability in forensic science, 246 unrelated Han Chinese from Zhejiang were genotyped at these loci. No significant departures from Hardy-Weinberg equilibrium were observed at these loci in these participants. The combined power of discrimination was over 0.99999999 and the combined probability of exclusion was over 0.9901. Results demonstrated that the 30 InDel markers could be used as a supporting tool for the human identification of specific Han Chinese individuals from Zhejiang. The genetic differences and phylogenetic relationships among Han Chinese from Zhejiang, Han Chinese from five other areas, nine minority ethnic groups, as well as two other East Asian populations were also investigated. Two InDel markers, HLD39 and HLD40, showed significant allele-frequency differences between Han Chinese from Zhejiang and ethnic minorities. Further analysis can be used to evaluate their role in forensic science. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Comparison of maternal and newborn outcomes of Tibetan and Han Chinese delivering in Lhasa, Tibet

    Science.gov (United States)

    Miller, Suellen; Tudor, Carrie; Thorsten, Vanessa; Nyima; Sonam; Droyoung; Wright, Linda; Varner, Michael

    2009-01-01

    Aim To compare maternal and neonatal outcomes of Tibetan and Han Chinese women delivering vaginally at high altitude (3650 meters) in Lhasa, Tibet Autonomous Region, People’s Republic of China. Method Comparative analysis of data from a prospective observational study of Tibetan (n = 938) and Han Chinese (n = 146) women delivering at three hospitals between January 2004 and May 2005. Results Han Chinese women had higher rates of pre-eclampsia/gestational hypertension than Tibetan women, (10.3% vs 5.9%, P = 0.04). There was no difference in rates of postpartum hemorrhage between Tibetan and Han women (12.8% vs 17.1%, P = 0.15). Han newborns weighed significantly less than Tibetan newborns (P < 0.01), and were twice as likely to be small for gestational age, (24.5% vs 11.6%, P < 0.01). Tibetan newborns were less likely to have poor neonatal outcomes than Han newborns (P < 0.01). Conclusion In high altitude deliveries in Tibet, adverse outcomes were significantly more common among Han Chinese. PMID:19012697

  11. The evidence for association of ATP2B2 polymorphisms with autism in Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Wen Yang

    Full Text Available BACKGROUND: Autism is a neurodevelopmental disorder with a high estimated heritability. ATP2B2, located on human chromosome 3p25.3, encodes the plasma membrane calcium-transporting ATPase 2 which extrudes Ca(2+ from cytosol into extracellular space. Recent studies reported association between ATP2B2 and autism in samples from Autism Genetic Resource Exchange (AGRE and Italy. In this study, we investigated whether ATP2B2 polymorphisms were associated with autism in Chinese Han population. METHODS: We performed a family based association study between five SNPs (rs35678 in exon, rs241509, rs3774180, rs3774179, and rs2278556 in introns in ATP2B2 and autism in 427 autism trios of Han Chinese descent. All SNPs were genotyped using the Sequenom genotyping platform. The family-based association test (FBAT program was used to perform association test for SNPs and haplotype analyses. RESULTS: This study demonstrated a preferential transmission of T allele of rs3774179 to affected offsprings under an additive model (T>C, Z = 2.482, p = 0.013. While C allele of rs3774179 showed an undertransmission from parents to affected children under an additive and a dominant model, respectively (Z = -2.482, p = 0.013; Z = -2.591, p = 0.0096. Haplotype analyses revealed that three haplotypes were significantly associated with autism. The haplotype C-C (rs3774180-rs3774179 showed a significant undertransmission from parents to affected offsprings both in specific and global haplotype FBAT (Z = -2.037, p = 0.042; Global p = 0.03. As for the haplotype constructed by rs3774179 and rs2278556, C-A might be a protective haplotype (Z = -2.206, p = 0.027; Global p = 0.04, while T-A demonstrated an excess transmission from parents to affected offsprings (Z = 2.143, p = 0.032. These results were still significant after using the permutation method to obtain empirical p values. CONCLUSIONS: Our research suggested that ATP2B2

  12. Suicidal risk factors of recurrent major depression in Han Chinese women.

    Directory of Open Access Journals (Sweden)

    Yuzhang Zhu

    Full Text Available The relationship between suicidality and major depression is complex. Socio- demography, clinical features, comorbidity, clinical symptoms, and stressful life events are important factors influencing suicide in major depression, but these are not well defined. Thus, the aim of the present study was to assess the associations between the above-mentioned factors and suicide ideation, suicide plan, and suicide attempt in 6008 Han Chinese women with recurrent major depression (MD. Patients with any suicidality had significantly more MD symptoms, a significantly greater number of stressful life events, a positive family history of MD, a greater number of episodes, a significant experience of melancholia, and earlier age of onset. Comorbidity with dysthymia, generalized anxiety disorder (GAD, social phobia, and animal phobia was seen in suicidal patients. The present findings indicate that specific factors act to increase the likelihood of suicide in MD. Our results may help improve the clinical assessment of suicide risk in depressed patients, especially for women.

  13. Ethnic Stereotypes and Economic Discrepancy: The Illusion of Differences between Han and Uyghur Chinese

    OpenAIRE

    Wanhua Peng; Kaiping Peng

    2010-01-01

    This paper presents a rare study on ethnic identity and perception of psychological differences among different ethnic groups in China. The objective is to offer an empirical test on the long standing stereotypes of cultural differences between Han Chinese, the majority ethnic group in China, and Uyghur Chinese, the Muslim minority in Xinjiang region of China. A total of 1600 students from four Chinese universities have been selected and examined in aspects ranging from self-esteems to desire...

  14. Two novel mutations in myosin binding protein C slow causing distal arthrogryposis type 2 in two large Han Chinese families may suggest important functional role of immunoglobulin domain C2.

    Directory of Open Access Journals (Sweden)

    Xuefu Li

    Full Text Available Distal arthrogryposes (DAs are a group of disorders that mainly involve the distal parts of the limbs and at least ten different DAs have been described to date. DAs are mostly described as autosomal dominant disorders with variable expressivity and incomplete penetrance, but recently autosomal recessive pattern was reported in distal arthrogryposis type 5D. Mutations in the contractile genes are found in about 50% of all DA patients. Of these genes, mutations in the gene encoding myosin binding protein C slow MYBPC1 were recently identified in two families with distal arthrogryposis type 1B. Here, we described two large Chinese families with autosomal dominant distal arthrogryposis type 2(DA2 with incomplete penetrance and variable expressivity. Some unique overextension contractures of the lower limbs and some distinctive facial features were present in our DA2 pedigrees. We performed follow-up DNA sequencing after linkage mapping and first identified two novel MYBPC1 mutations (c.1075G>A [p.E359K] and c.956C>T [p.P319L] responsible for these Chinese DA2 families of which one introduced by germline mosacism. Each mutation was found to cosegregate with the DA2 phenotype in each family but not in population controls. Both substitutions occur within C2 immunoglobulin domain, which together with C1 and the M motif constitute the binding site for the S2 subfragment of myosin. Our results expand the phenotypic spectrum of MYBPC1-related arthrogryposis multiplex congenita (AMC. We also proposed the possible molecular mechanisms that may underlie the pathogenesis of DA2 myopathy associated with these two substitutions in MYBPC1.

  15. Identification of novel mutations in Chinese Hans with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Yu Chaowen

    2011-12-01

    Full Text Available Abstract Background Autosomal dominant polycystic kidney disease (ADPKD is the most common inherited renal disease with an incidence of 1 in 400 to 1000. The disease is genetically heterogeneous, with two genes identified: PKD1 (16p13.3 and PKD2 (4q21. Molecular diagnosis of the disease in at-risk individuals is complicated due to the structural complexity of PKD1 gene and the high diversity of the mutations. This study is the first systematic ADPKD mutation analysis of both PKD1 and PKD2 genes in Chinese patients using denaturing high-performance liquid chromatography (DHPLC. Methods Both PKD1 and PKD2 genes were mutation screened in each proband from 65 families using DHPLC followed by DNA sequencing. Novel variations found in the probands were checked in their family members available and 100 unrelated normal controls. Then the pathogenic potential of the variations of unknown significance was examined by evolutionary comparison, effects of amino acid substitutions on protein structure, and effects of splice site alterations using online mutation prediction resources. Results A total of 92 variations were identified, including 27 reported previously. Definitely pathogenic mutations (ten frameshift, ten nonsense, two splicing defects and one duplication were identified in 28 families, and probably pathogenic mutations were found in an additional six families, giving a total detection level of 52.3% (34/65. About 69% (20/29 of the mutations are first reported with a recurrent mutation rate of 31%. Conclusions Mutation study of PKD1 and PKD2 genes in Chinese Hans with ADPKD may contribute to a better understanding of the genetic diversity between different ethnic groups and enrich the mutation database. Besides, evaluating the pathogenic potential of novel variations should also facilitate the clinical diagnosis and genetic counseling of the disease.

  16. Inner and inter population structure construction of Chinese Jiangsu Han population based on Y23 STR system.

    Directory of Open Access Journals (Sweden)

    Huipin Wang

    Full Text Available In this study, we analyzed the genetic polymorphisms of 23 Y-STR loci from PowerPlex® Y23 system in 916 unrelated healthy male individuals from Chinese Jiangsu Han, and observed 912 different haplotypes including 908 unique haplotypes and 4 duplicate haplotypes. The haplotype diversity reached 0.99999 and the discrimination capacity and match probability were 0.9956 and 0.0011, respectively. The gene diversity values ranged from 0.3942 at DYS438 to 0.9607 at DYS385a/b. Population differentiation within 10 Jiangsu Han subpopulations were evaluated by RST values and visualized in Neighbor-Joining trees and Multi-Dimensional Scaling plots as well as population relationships between the Jiangsu Han population and other 18 Eastern Asian populations. Such results indicated that the 23 Y-STR loci were highly polymorphic in Jiangsu Han population and played crucial roles in forensic application as well as population genetics. For the first time, we reported the genetic diversity of male lineages in Jiangsu Han population at a high-resolution level of 23 Y-STR set and consequently contributed to familial searching, offender tracking, and anthropology analysis of Jiangsu Han population.

  17. A cross-cultural comparison of climacteric symptoms, self-esteem, and perceived social support between Mosuo women and Han Chinese women.

    Science.gov (United States)

    Zhang, Ying; Zhao, Xudong; Leonhart, Rainer; Nadig, Maya; Hasenburg, Annette; Wirsching, Michael; Fritzsche, Kurt

    2016-07-01

    This cross-cultural study aimed to compare climacteric symptoms, self-esteem, and perceived social support between Mosuo and Han Chinese women, and to explore the interaction between culture and climacteric symptoms. Mosuo is a Chinese minority group with a matriarchal structure, and Han Chinese is the majority ethnic group in China with a patriarchal structure. Through convenience sampling, 54 Mosuo women and 52 Han Chinese women between 40 and 60 years of age completed the sociodemographic questionnaire, the Menopause Rating Scale, the Self-Esteem Scale, and the Perceived Social Support Scale. Compared with Han Chinese women, Mosuo women scored lower on the psychological (P psychological symptoms severity. Referring to the severity of all symptoms, predictive variables were: perceived support from family (β = -0.210, P = 0.017); self-esteem (β = 0.320, P < 0.001); previous history of premenstrual syndrome (β = 0.293, P < 0.001); number of family members (β = -0.229, P = 0.003); and family income (β = -0.173, P = 0.028). Differences in climacteric symptoms were found between two groups. Cultural variables such as familial structure, women's self-esteem, and perceived social support were correlated with symptomatology.

  18. A comparison of melancholic and nonmelancholic recurrent major depression in Han Chinese women.

    Science.gov (United States)

    Sun, Ning; Li, Yihan; Cai, Yiyun; Chen, Jing; Shen, Yuan; Sun, Jing; Zhang, Zheng; Zhang, Jiulong; Wang, Lina; Guo, Liyang; Yang, Lei; Qiang, Li; Yang, Yanchun; Wang, Gang; Du, Bo; Xia, Jing; Rong, Han; Gan, Zhaoyu; Hu, Bin; Pan, Jiyang; Li, Chang; Sun, Shufan; Han, Wei; Xiao, Xue; Dai, Lei; Jin, Guixing; Zhang, Yutang; Sun, Lixin; Chen, Yunchun; Zhao, Haiying; Dang, Yamei; Shi, Shenxun; Kendler, Kenneth S; Flint, Jonathan; Zhang, Kerang

    2012-01-01

    Although the diagnosis of melancholia has had a long history, the validity of the current DSM-IV definition remains contentious. We report here the first detailed comparison of melancholic and nonmelancholic major depression (MD) in a Chinese population examining in particular whether these two forms of MD differ quantitatively or qualitatively. DSM-IV criteria for melancholia were applied to 1,970 Han Chinese women with recurrent MD recruited from 53 provincial mental health centers and psychiatric departments of general medical hospitals in 41 cities. Statistical analyses, utilizing Student's t-tests and Pearson's χ(2) , were calculated using SPSS 13.0. Melancholic patients with MD were distinguished from nonmelancholic by being older, having a later age at onset, more episodes of illness and meeting more A criteria. They also had higher levels of neuroticism and rates of lifetime generalized anxiety disorder, panic disorder, and social and agoraphobia. They had significantly lower rates of childhood sexual abuse but did not differ on other stressful life events or rates of MD in their families. Consistent with most prior findings in European and US populations, we find that melancholia is a more clinically severe syndrome than nonmelancholic depression with higher rates of comorbidity. The evidence that it is a more "biological" or qualitatively distinct syndrome, however, is mixed. © 2011 Wiley-Liss, Inc.

  19. Comparison of Genetic Variants in Cancer-Related Genes between Chinese Hui and Han Populations.

    Directory of Open Access Journals (Sweden)

    Chaoyong Tian

    Full Text Available The Chinese Hui population, as the second largest minority ethnic group in China, may have a different genetic background from Han people because of its unique demographic history. In this study, we aimed to identify genetic differences between Han and Hui Chinese from the Ningxia region of China by comparing eighteen single nucleotide polymorphisms in cancer-related genes.DNA samples were collected from 99 Hui and 145 Han people from the Ningxia Hui Autonomous Region in China, and SNPs were detected using an improved multiplex ligase detection reaction method. Genotyping data from six 1000 Genomes Project population samples (99 Utah residents with northern and western European ancestry (CEU, 107 Toscani in Italy (TSI, 108 Yoruba in Ibadan (YRI, 61 of African ancestry in the southwestern US (ASW, 103 Han Chinese in Beijing (CHB, and 104 Japanese in Tokyo (JPT were also included in this study. Differences in the distribution of alleles among the populations were assessed using χ2 tests, and FST was used to measure the degree of population differentiation.We found that the genetic diversity of many SNPs in cancer-related genes in the Hui Chinese in Ningxia was different from that in the Han Chinese in Ningxia. For example, the allele frequencies of four SNPs (rs13361707, rs2274223, rs465498, and rs753955 showed different genetic distributions (p0.000 between the Hui and Han populations.These results suggest that some SNPs associated with cancer-related genes vary among different Chinese ethnic groups. We suggest that population differences should be carefully considered in evaluating cancer risk and prognosis as well as the efficacy of cancer therapy.

  20. Nagashima-type palmoplantar keratosis in a Chinese Han population.

    Science.gov (United States)

    Zhang, Jia; Zhang, Guolong; Ni, Cheng; Cheng, Ruhong; Liang, Jianying; Li, Ming; Yao, Zhirong

    2016-11-01

    Nagashima-type palmoplantar keratosis (NPPK) is an autosomal recessive form of palmoplantar keratoderma (PPK), which is caused by mutations in the SERPINB7 gene. NPPK has only been reported in Japanese and Chinese populations. The present study was conducted on 12 unrelated Chinese patients who were clinically predicted to suffer from NPPK. Mutation screening was performed by direct sequencing of the entire coding regions of SERPINB7, SLURP1, AQP5, CSTA, KRT1 and KRT9 genes. Direct sequencing of SERPINB7 revealed five homozygous founder mutations (c.796C>T) and four compound heterozygous mutations in nine patients, including one novel mutation (c.122_127delTGGTCC). Nine out of the 12 patients were diagnosed with NPPK due to SERPINB7 pathogenic mutations, and the results expanded the known mutation spectrum of NPPK. Taking the other seven reported Chinese patients, who had been definitively diagnosed with NPPK by genetic testing, into account, the present study further demonstrated that NPPK is a common entity in Mainland China, and c.796C>T is the most prevalent mutation and exerts a founder effect. Furthermore, the NPPK cases described in the current study presented a consistently mild phenotype, as compared with the degrees of phenotypic variability associated with other types of relatively severe PPK, including Mal de Meleda and Olmsted syndrome.

  1. Feeling Happy and Sad at the Same Time? Subcultural Differences in Experiencing Mixed Emotions between Han Chinese and Mongolian Chinese

    Science.gov (United States)

    Deng, Xinmei; Ding, Xuechen; Cheng, Chen; Chou, Hiu Mei

    2016-01-01

    Sometimes people experience pleasant and unpleasant emotions at the same time in a single emotional event. Previous cross-cultural studies indicated that such mixed emotions are more prevalent in China and related to the attitudes toward happiness and individual’s regulatory motivation. However, China is a multi-ethnic country and not much is known about subcultural differences in mixed emotions. The aim of this study was to examine the role that implicit attitudes toward happiness and regulatory motivation played in regard of the subcultural differences in mixed emotions between Han (N = 61) and Mongolian Chinese (N = 46). Results indicated that, compared with Mongolian Chinese, Han Chinese showed stronger associations between implicit contra-hedonic attitudes toward happiness and mixed emotions during pleasant emotional events. Also, Han Chinese who reported contra-hedonic motivation during pleasant emotional events had higher levels of mixed emotions than those who had hedonic motivation. No significant differences were found in terms of mixed emotions between Mongolian Chinese who had contra-hedonic and hedonic motivation. These results suggest that the psychological mechanisms underlying differences in mixed emotions also require a more comprehensive understanding from a subcultural perspective. PMID:27833582

  2. Feeling Happy and Sad at the Same Time? Subcultural Differences in Experiencing Mixed Emotions between Han Chinese and Mongolian Chinese.

    Science.gov (United States)

    Deng, Xinmei; Ding, Xuechen; Cheng, Chen; Chou, Hiu Mei

    2016-01-01

    Sometimes people experience pleasant and unpleasant emotions at the same time in a single emotional event. Previous cross-cultural studies indicated that such mixed emotions are more prevalent in China and related to the attitudes toward happiness and individual's regulatory motivation. However, China is a multi-ethnic country and not much is known about subcultural differences in mixed emotions. The aim of this study was to examine the role that implicit attitudes toward happiness and regulatory motivation played in regard of the subcultural differences in mixed emotions between Han ( N = 61) and Mongolian Chinese ( N = 46). Results indicated that, compared with Mongolian Chinese, Han Chinese showed stronger associations between implicit contra-hedonic attitudes toward happiness and mixed emotions during pleasant emotional events. Also, Han Chinese who reported contra-hedonic motivation during pleasant emotional events had higher levels of mixed emotions than those who had hedonic motivation. No significant differences were found in terms of mixed emotions between Mongolian Chinese who had contra-hedonic and hedonic motivation. These results suggest that the psychological mechanisms underlying differences in mixed emotions also require a more comprehensive understanding from a subcultural perspective.

  3. No association between thrombosis and factor V gene polymorphisms in Chinese Han population.

    Science.gov (United States)

    Yanqing, Hu; Fangping, Chen; Qinzhi, Xie; Zaifu, Jian; Guangping, Wang; Xiaoxia, Zuo; Xiaoqun, Pu; Xiaobo

    2003-03-01

    Activated protein C resistance (APCR) is the most common hereditary condition of thrombosis in Western countries. And it is significantly linked to a single nucleotide polymorphisms (SNPs) in the coagulation factor V gene that results in the mutations at R506, R306 and HR2 alleles. To determine the prevalence of APCR and its association with the factor V gene SNPs in Chinese Han thrombotic patients, we investigated a total of 346 Chinese thrombotic patients and 140 normal controls for APCR using the APTT-based assays, according to manufacturer's instructions, APC ratio Chinese Han population. We concluded that APC resistance in the Chinese Han population might not be associated with mutations of factor V at R506, R306 and HR2 polymorphisms. Some other factors might contribute to APC resistance in the Chinese Han population.

  4. Identification of HNF4A Mutation p.T130I and HNF1A Mutations p.I27L and p.S487N in a Han Chinese Family with Early-Onset Maternally Inherited Type 2 Diabetes.

    Science.gov (United States)

    Yang, Ying; Zhou, Tai-Cheng; Liu, Yong-Ying; Li, Xiao; Wang, Wen-Xue; Irwin, David M; Zhang, Ya-Ping

    2016-01-01

    Maturity-onset diabetes of the young (MODY) is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I) and two HNF1A polymorphisms (p.I27L and p.S487N) were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.

  5. Mutation analysis of the WNT4 gene in Han Chinese women with premature ovarian failure

    Directory of Open Access Journals (Sweden)

    Zhou Sirui

    2011-05-01

    Full Text Available Abstract Background The WNT4 gene plays an important role in female sex determination and differentiation. It also contributes to maintaining of the ovaries and the survival of follicles. Methods We sequenced the coding region and splice sites of WNT4 in 145 Han Chinese women with premature ovarian failure (POF and 200 healthy controls. Results Only one novel variation, in Exon 2 (195C > T, was detected among the women with POF. However, this synonymous variation did not result in a change in amino acid sequence (65 Asp > Asp. No further variants were found in any of the samples. Conclusion Although we cannot provide any evidence that it is a possible disease-causing gene, this study is the first attempt to investigate the possible role of WNT4 in Han Chinese women with POF.

  6. Association of AHSG gene polymorphisms with ischemic stroke in a Han Chinese population.

    Science.gov (United States)

    Ma, Shanshan; He, Zhiyi; Zhao, Jie; Li, Lei; Yuan, Liying; Dai, Yingjie; Qiu, Jing

    2013-12-01

    Previous studies have shown associations of fetuin-A (alpha2-Heremans-Schmid glycoprotein, AHSG) with various disorders, including insulin resistance, type 2 diabetes mellitus, metabolic syndrome, and atherosclerosis. In this study, genotype and allele frequencies of the rs4918 SNP in the AHSG gene were examined in 380 patients with ischemic stroke and 350 healthy controls from a Northern Han Chinese population via the PCR-RFLP technique. Frequencies of the GG genotype and the G allele in AHSG (rs4918) were significantly higher in patients with ischemic stroke or atherosclerotic cerebral infarction than those in the control group (P AHSG gene are associated with a risk for ischemic stroke in a Northern Han Chinese population.

  7. Association of rs662799 in APOA5 with CAD in Chinese Han population.

    Science.gov (United States)

    Chen, Hua; Ding, Shifang; Zhou, Mi; Wu, Xiayin; Liu, Xi; Wu, Yun; Liu, Dechao

    2018-01-08

    CAD (Coronary Artery Disease) is a complex disease that influenced by various environmental and genetic factors. Previous studies have found many single nucleotide polymorphisms (SNPs) associated with the risk of CAD occurrence. However, the results are inconsistent. In this study, we aim to investigate genetic etiology in Chinese Han population by analysis of 7 SNPs in lipid metabolism pathway that previously has been reported to be associated with CAD. A total of 631 samples were used in this study, including 435 CAD cases and 196 normal healthy controls. SNP genotyping were conducted via multiplex PCR amplifying followed by NGS (next-generation sequencing). Rs662799 in APOA5 (Apolipoprotein A5) gene was associated with CAD in Chinese Han population (Odds-ratio = 1.374, P-value = 0.03). No significant association was observed between the rest of SNPs and CAD. Stratified association analysis revealed rs5882 was associated with CAD in non-hypertension group (Odds-ratio = 1.593, P-value = 0.023). Rs1800588 was associated with CAD in smoking group (Odds-ratio = 1.603, P-value = 0.035). The minor allele of rs662799 was the risk factor of CAD occurrences in Chinese Han population.

  8. Diacylglycerol kinase κ (DGKK) variants and hypospadias in Han Chinese: association and meta-analysis.

    Science.gov (United States)

    Ma, Qichao; Tang, Yunman; Lin, Houwei; Xu, Maosheng; Xu, Guofeng; Fang, Xiaoliang; Chen, Jianhua; Song, Zhijian; Li, Zhiqiang; Shi, Yongyong; Geng, Hongquan

    2015-10-01

    To investigate whether diacylglycerol kinase κ (DGKK) is a susceptibility gene for hypospadias in the Han Chinese population as has been suggested by previous publications. A case-control study involving 466 patients with hypospadias and 402 healthy subjects was conducted to assess the relationship between DGKK single nucleotide polymorphisms (SNPs) and hypospadias risk in the Han Chinese population. The 466 hypospadias patients were further divided into mild, moderate and severe subgroups for analysis. Six SNPs (rs1934179, rs4143304, rs9969978, rs1934188, rs4826632 and rs4599945) were marginally associated with mild and moderate hypospadias [odds ratios (ORs) > 1, P = 0.05 to P 1, P > 0.1). After correcting for multiple testing, it was determined that neither individual SNPs nor individual haplotypes were associated with hypospadias. To evaluate this relationship in multiple populations, we performed a meta-analysis on six SNPs, using combined data from our present results and those of previous studies of different races (including 1966 patients and 2492 controls). Six SNPs (rs1934179, rs4143304, rs9969978, rs1934188, rs7063116 and rs1934190) were significantly associated with mild/moderate hypospadias (ORs >1, P hypospadias (OR > 1, P hypospadias susceptibility in the Chinese Han population. Our meta-analysis supports the hypothesis that DGKK is a common risk gene for hypospadias, particularly in cases of mild or moderate hypospadias in Caucasian populations. © 2014 The Authors BJU International © 2014 BJU International Published by John Wiley & Sons Ltd.

  9. Interleukin-18 promoter polymorphisms and risk of Parkinson's disease in a Han Chinese population.

    Science.gov (United States)

    Xu, Xiang; Li, Dequan; He, Qing; Gao, Jing; Chen, Biao; Xie, Anmu

    2011-03-24

    The etiology of sporadic Parkinson's disease (PD) is not well established. Interleukin-18 (IL-18), a member of pro-inflammatory cytokines, might influence the risk of sporadic PD occurrence and development. In this study, two DNA polymorphisms at interleukin (IL)-18 promoter, -607C/A (rs1946518) and -137G/C (rs187238), were examined in sporadic PD patients in a Han Chinese population with 290 sporadic PD patients and 200 healthy controls. Direct sequencing was performed in 10% of the samples to validate the genotyping results. The results revealed that for -607C/A polymorphisms, there were significant differences in genotype distribution between PD and control in the total sample (P=0.017) and between LOPD and healthy-matched controls subgroup (P=0.011). For -137G/C polymorphisms, there were no significant differences in genotype distribution and gender and age-related differences between PD and control in the total sample (P=0.610). Results in this study revealed that the IL-18 607C/A polymorphism is a risk factor for sporadic LOPD in Han Chinese population, while IL-18 137G/C polymorphism is not a risk factor for sporadic PD in the Han Chinese population. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Association of NCOA2 gene polymorphisms with obesity and dyslipidemia in the Chinese Han population.

    Science.gov (United States)

    Lu, Yuping; Habtetsion, Tsadik Ghebreamlak; Li, Yong; Zhang, Huiping; Qiao, Yichun; Yu, Mingxi; Tang, Yuan; Zhen, Qing; Cheng, Yi; Liu, Yawen

    2015-01-01

    Nuclear receptor coactivator 2 (NCOA2) gene plays an important role in adipogenesis and lipid metabolism. NCOA2 gene null mice exhibited less fat accumulation and lower serum lipid levels, and were protected against obesity. Few studies are known to have analyzed the association of NCOA2 gene single nucleotide polymorphisms with obesity and serum lipid profile. Our study aimed to evaluate the association of NCOA2 gene polymorphisms with the risk of obesity and dyslipidemia in the Chinese Han population. Two NCOA2 gene polymorphisms (rs41391448 and rs10504473) were selected and genotyped in a Chinese Han cohort with 529 participants. The effect of different genotypes on BMI and serum lipid levels (TG, TC, LDL-C and HDL-C) was performed by the analysis of covariance. Association of NCOA2 polymorphisms with obesity and dyslipidemia was assessed by odds ratios (OR) and 95% confidence intervals (CI) under the unconditional logistic regression analysis. Significant association was observed between rs10504473 polymorphism and obesity under the recessive model (OR = 1.88, 95% CI 1.02-3.45, P = 0.047; adjusted OR = 1.87, 95% CI 1.02-3.44, P = 0.048). However, no association remained significant after Bonferroni correction. Our study suggests a possible association between NCOA2 rs10504473 polymorphism and obesity, and this SNP may influence the susceptibility of obesity in the Chinese Han population.

  11. Arginine vasopressin improves the memory deficits in Han Chinese patients with first-episode schizophrenia.

    Science.gov (United States)

    Geng, Cai-Hong; Wang, Chao; Yang, Jun; Wang, Hua; Ma, Rui-Qing; Liu, Xu; Wang, Chang-Hong

    2017-11-01

    The memory impairment is a core deficit in the first-episode schizophrenia patients. Arginine vasopressin (AVP) in the brain can improve learning and memory. We performed multicentre, randomized, double-blind, placebo-controlled, parallel-group clinical trial to study the cognitive functioning in Han Chinese first-episode schizophrenic patients in a 12-week treatment regime with the intranasal administration of AVP (128 cases) or placebo (131 cases) in addition to the conventional treatment. The methods of positive and negative syndrome scale (PANSS), Wechsler memory scale-4th edition (WMS-IV) and event-related potential (ERP) were used to study the effects of AVP on the cognitive function. The results showed that (1) AVP concentration decreased in cerebrospinal fluid (CSF) of the right-handed Han Chinese first-episode schizophrenic patients comparing with that of the health volunteers (7.1±1.5pg/ml vs 13.3±1.9pg/ml, pmemorizing and extraction of the information although there were many changes of cognitive functions in the right-handed Han Chinese first-episode schizophrenic patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Vitamin D binding protein variants associate with asthma susceptibility in the Chinese Han population.

    Science.gov (United States)

    Li, Fei; Jiang, Lei; Willis-Owen, Saffron A; Zhang, Youming; Gao, Jinming

    2011-08-03

    Asthma is a genetically heterogeneous disease. Polymorphisms of genes encoding components of the vitamin D pathway have been reported to associate with the risk of asthma. We have previously demonstrated that vitamin D status was associated with lung function in Chinese asthma patients. In this study, we tested whether polymorphisms of genes encoding for vitamin D receptor (VDR), vitamin D 25-hydroxylase (CYP2R1) and vitamin D binding protein (GC) were associated with asthma in the Chinese Han population. We sequenced all 8 exons of VDR and all 5 exons of CYP2R1 in a Chinese case-control cohort of asthma consisting of 467 cases and 288 unrelated healthy controls. Two mutations were identified in these regions. These variants were specified as rs2228570 in exon 2 of VDR and rs12794714 in exon 1 of CYP2R1. We also genotyped two common polymorphisms in GC gene (rs4588 and rs7041) by a PCR-restriction fragment length polymorphism (RFLP) method. We analyzed the association between these 4 polymorphisms and asthma susceptibility and asthma-related traits. Polymorphic markers in VDR and CYP2R1 were not associated with asthma in the Chinese Han cohort. Importantly, variants in GC gene, which give rise to the two most common electrophoretic isoforms of the vitamin D binding protein, were associated with asthma susceptibility. Compared with isoform Gc1, Gc2 was significantly associated with the risk of asthma (OR = 1.35, 95% CI = 1.01-1.78 p = 0.006). The results provide supporting evidence for association between GC variants and asthma susceptibility in the Chinese Han population.

  13. Vitamin D binding protein variants associate with asthma susceptibility in the Chinese han population

    Directory of Open Access Journals (Sweden)

    Zhang Youming

    2011-08-01

    Full Text Available Abstract Background Asthma is a genetically heterogeneous disease. Polymorphisms of genes encoding components of the vitamin D pathway have been reported to associate with the risk of asthma. We have previously demonstrated that vitamin D status was associated with lung function in Chinese asthma patients. In this study, we tested whether polymorphisms of genes encoding for vitamin D receptor (VDR, vitamin D 25-hydroxylase (CYP2R1 and vitamin D binding protein (GC were associated with asthma in the Chinese Han population. Methods We sequenced all 8 exons of VDR and all 5 exons of CYP2R1 in a Chinese case-control cohort of asthma consisting of 467 cases and 288 unrelated healthy controls. Two mutations were identified in these regions. These variants were specified as rs2228570 in exon 2 of VDR and rs12794714 in exon 1 of CYP2R1. We also genotyped two common polymorphisms in GC gene (rs4588 and rs7041 by a PCR-restriction fragment length polymorphism (RFLP method. We analyzed the association between these 4 polymorphisms and asthma susceptibility and asthma-related traits. Results Polymorphic markers in VDR and CYP2R1 were not associated with asthma in the Chinese Han cohort. Importantly, variants in GC gene, which give rise to the two most common electrophoretic isoforms of the vitamin D binding protein, were associated with asthma susceptibility. Compared with isoform Gc1, Gc2 was significantly associated with the risk of asthma (OR = 1.35, 95% CI = 1.01-1.78 p = 0.006. Conclusions The results provide supporting evidence for association between GC variants and asthma susceptibility in the Chinese Han population.

  14. Impact of strabismus on the quality of life of Chinese Han teenagers

    Directory of Open Access Journals (Sweden)

    Tu CS

    2016-06-01

    Full Text Available Changsen Tu, Liang Ye, Longfei Jiang, Yuwen Wang, Yingzi Li The Eye Hospital of Wenzhou Medical University, School of Ophthalmology and Optometry, Wenzhou Medical University, Wenzhou, People’s Republic of China Background: Although much research has been conducted on the impact of strabismus on the quality of life (QoL of adults, the effect of this condition on teenagers has not been extensively studied. This study therefore aimed to assess the effect of strabismus on the vision-related QoL of Chinese teenagers.Methods: The Chinese version of the 25-item National Eye Institute Visual Function Questionnaire (NEI-VFQ-25 was self-administered by 1,040 teenagers with strabismus and 1,002 individuals with normal vision. All the participants were from the Chinese Han population. The independent samples t-test was used to compare QoL between teenagers with and without strabismus.Results: The majority of scores on the NEI-VFQ-25 domains were significantly different between the two groups. QoL was significantly lower in individuals with strabismus compared with teenagers with normal vision on all domains, with the exception of social functioning.Conclusion: Statistically significantly lower vision-related QoL scores were found in Chinese Han teenagers with strabismus compared with those without strabismus. Keywords: quality of life, strabismus, NEI-VFQ-25, teenager, HRQoL

  15. [Mode and size of HPA-typed platelet apheresis donor bank in Chinese Han population].

    Science.gov (United States)

    Dai, Yu-Dong

    2010-08-01

    This study was purposed to determine the mode and size of human platelet antigens (HPA) typed platelet apheresis donor bank. The published data of HPA distribution collected from Chinese Han population of 16 provinces were analyzed. The combined data were tested with the Hardy-Weinberg equilibrium. The results showed that the bb homozygote was not detected in HPA-1, -4, -6, -10, and b gene was not found in HPA-7-9, 11-14, -16. There were 648 combined HPA 1-16 genotypes in Chinese Han population, and the cumulative frequency of 42 combinations higher than 0.001 were 0.9763. The highest frequency (0.2012) in combination was HPA-(7-8-9-11-12-13-14-16) aa - (1-4-5-6-10) aa-2aa-3ab-15ab. The probability of HPA dual antigen mismatch in HPA-15, -3 and -2 was higher than the 0.1, and the probability in the HPA-1, -5, and -6 was between 0.01 - 0.1. The probability of full-match in HPA1-16 antigens was 0.3195 in Chinese Han population after the random blood transfusion. According to the curve drawn by donor number (N) versus frequency (F), the regression equation LogN = -0.4394 x Ln (F) +0.4324 was derived at P = 95%. If the derived frequency (product of HPA frequency and ABO frequency) is 0.005, then the N should be 576.07 at least in Chinese Han population. It is concluded that the mode of regional, multi-center database of HPA-typed platelet apheresis donor bank may be acceptable in Chinese Han population, and the suitable number of HPA-typed platelet donor in one bank may be 600. Therefore, the bank can be used to treat the platelet transfusion refractoriness (PTR) caused by HPA-15, 3 and 2 mismatch mainly, and can be expanded effectively in similar genetic background to deal with the low-frequency HPA antigens mismatch. The number of HPA-typed platelet apheresis donor influences not only on the frequency of HPA, but also on the frequency of ABO group.

  16. MC1R variants in Chinese Han patients with sporadic Parkinson's disease.

    Science.gov (United States)

    Shi, Chang-He; Wang, Hui; Mao, Cheng-Yuan; Yang, Jing; Song, Bo; Liu, Yu-Tao; Yang, Zhi-Hua; Luo, Hai-Yang; Zhang, Shu-Yu; Wu, Jun; Xu, Yu-Ming

    2016-06-01

    Recently, a variant p.R160W in the MC1R gene was identified that increased the risk of Parkinson's disease (PD) in Spanish population. To explore whether the MC1R gene variants are associated with sporadic PD in Chinese population, we performed a case-control comparison study for comprehensive MC1R variant screening in 510 Chinese Han patients and 495 healthy controls as ethnically matched controls. We identify 5 nonsynonymous variants, including rs34090186 (p.R67Q), rs2228479 (p.V92M), rs33932559 (p.I120T), rs885479 (p.R163Q), and rs372152373 (p.R223W). However, variants mentioned previously did not show association with PD. Our results suggest that variants in MC1R do not play a major role in PD in the Chinese population. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Genome-wide association study of treatment refractory schizophrenia in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Ying-Jay Liou

    Full Text Available We report the first genome-wide association study of a joint analysis using 795 Han Chinese individuals with treatment-refractory schizophrenia (TRS and 806 controls. Three loci showed suggestive significant association with TRS were identified. These loci include: rs10218843 (P = 3.04 × 10(-7 and rs11265461 (P = 1.94 × 10(-7 are adjacent to signaling lymphocytic activation molecule family member 1 (SLAMF1; rs4699030 (P = 1.94 × 10(-6 and rs230529 (P = 1.74 × 10(-7 are located in the gene nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (NFKB1; and rs13049286 (P = 3.05 × 10(-5 and rs3827219 (P = 1.66 × 10(-5 fall in receptor-interacting serine/threonine-protein kinase 4 (RIPK4. One isolated single nucleotide polymorphism (SNP, rs739617 (P = 3.87 × 10(-5 was also identified to be associated with TRS. The -94delATTG allele (rs28362691 located in the promoter region of NFKB1 was identified by resequencing and was found to associate with TRS (P = 4.85 × 10(-6. The promoter assay demonstrated that the -94delATTG allele had a significant lower promoter activity than the -94insATTG allele in the SH-SY5Y cells. This study suggests that rs28362691 in NFKB1 might be involved in the development of TRS.

  18. Association of E26 Transformation Specific Sequence 1 Variants with Rheumatoid Arthritis in Chinese Han Population.

    Directory of Open Access Journals (Sweden)

    Lin Chen

    Full Text Available E26 transformation specific sequence 1 (ETS-1 belongs to the ETS family of transcription factors that regulate the expression of various immune-related genes. Increasing evidence indicates that ETS-1 could contribute to the pathogenesis of autoimmune disease. Recent research has provided evidence that ETS-1 might correlate with rheumatoid arthritis (RA, but it's not clearly defined. In this study, we aimed to identify whether polymorphisms of ETS-1 play a role in Rheumatoid arthritis (RA susceptibility and development in Chinese Han population.Four single nucleotide polymorphisms (SNPs within ETS-1 were selected based on HapMap data and previous associated studies. Whole blood and serum samples were obtained from 158 patients with RA and 192 healthy subjects. Genotyping was performed with polymerase chain reaction-high resolution melting (PCR-HRM assay and the data was analyzed using SPSS17.0.A significantly positive correlation was observed between the SNP rs73013527 of ETS-1 and RA susceptibility, DAS28 and CRP (P<0.001, P = 0.001, and P = 0.028, respectively. Carriers of the haplotype CCT or TCT for rs4937333, rs11221332 and rs73013527 were associated with decreased risk of RA as compared to controls. No statistical significant difference was observed in the distribution of rs10893872, rs4937333 and rs11221332 genotypes between RA patients and controls.Our data further supports that ETS-1 has a relevant role in the pathogenesis and development of RA. Allele T of rs73013527 plays a protective role in occurrence of RA but a risk factor in the high disease activity. Rs10893872, rs11221332 and rs4937333 are not associated with RA susceptibility and clinical features.

  19. Genetic analysis of MC1R variants in Chinese Han patients with sporadic Parkinson's disease.

    Science.gov (United States)

    He, Sihan; Tan, Ting; Song, Zhi; Yuan, Lamei; Deng, Xiong; Ni, Bin; Chen, Yong; Deng, Hao

    2016-01-12

    Parkinson's disease (PD, OMIM 168600) is a neurodegenerative disorder featured by degeneration of melanin-positive dopaminergic neurons. Epidemiologic studies have suggested that PD and malignant melanoma (MM) might share common genetic components. Recently, the p.R160W variant in the melanocortin 1 receptor gene (MC1R, OMIM 155555), a risk factor for MM, has been identified to be associated with PD in Spanish population. To explore whether the MC1R variants are associated with sporadic PD in Chinese population, we designed a case-control comparison study and studied three variants, including rs3212366 (p.F196L), rs33932559 (p.I120T) and rs34090186 (p.R67Q), in the MC1R gene in 512 Chinese Han patients with sporadic PD and 512 age, gender and ethnicity matched normal controls. For rs3212366, only the TT genotype was identified in both PD and control cohorts. For variants rs33932559 and rs34090186, we did not identify any statistically significant difference in either genotypic distribution or allelic distribution between the PD cohort and control cohort, and in addition, we did not identify any related haplotype that would either increase the risk for PD or play a protective role against PD. Our data suggest that none of the three variants of the MC1R gene and related haplotypes be associated with sporadic form of PD in Chinese Han population from Mainland China. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Genetic variants associated with skin aging in the Chinese Han population.

    Science.gov (United States)

    Gao, Wenshan; Tan, Jingze; Hüls, Anke; Ding, Anan; Liu, Yu; Matsui, Mary S; Vierkötter, Andrea; Krutmann, Jean; Schikowski, Tamara; Jin, Li; Wang, Sijia

    2017-04-01

    The progression and manifestation of human skin aging has a strong genetic basis; however, most of the supporting evidence has been gathered in Caucasian populations. The genetic contribution to the variation in skin aging in non-Caucasian populations is poorly understood. To investigate the genetic risk factors of relevance for skin aging in East Asians, we conducted the first candidate gene study for signs of skin aging in Han Chinese. We collected skin aging and genotype data in 502 female Han Chinese from the Taizhou cohort. We evaluated skin aging by the validated skin aging score SCINEXA™. Confounding factors were assessed through a questionnaire. We obtained the genotype data for 21 candidate SNPs and for a further 509 SNPs from 16 related candidate genes. Associations were tested by linear and logistic regression analyses and adjusted for potential confounders. Our candidate study found a significant association between SNP rs2066853 in exon 10 of the aryl hydrocarbon receptor gene AHR and crow's feet. In addition, we found a significant association between SNP rs10733310 in intron 5 of BNC2 and pigment spots on the arms, and between SNP rs11979919, 3kb downstream of COL1A2, and laxity of eyelids. Our results identified genetic risk factors for signs of skin aging (pigmentation, wrinkles or laxity) in Han Chinese. We also found that the manifestation of skin aging is further modified by anatomical site. Together with previous work, our results also suggest that different genetic variants could be responsible for distinct skin aging signs characteristic of Caucasians compared to East Asians. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Association study of ankylosing spondylitis and polymorphisms in ERAP1 gene in Zhejiang Han Chinese population.

    Science.gov (United States)

    Liu, Yangbo; Li, Liangda; Shi, Shanfen; Chen, Xin; Gao, Jianqing; Zhu, Minyu; Yuan, Jiandong

    2016-02-01

    The susceptibility loci of ERAP1 polymorphisms have been found to be strongly associated with ankylosing spondylitis (AS). The researches in multiple ethnic cohorts suggested that the population attributable risk in ERAP1 polymorphisms is at a high significance level. This study was undertaken to estimate the prevalence and incidence of subsets of AS and investigate the specific variants of ERAP1 polymorphisms in AS susceptibility, in the Han ethnic Chinese population in Zhejiang Province. AS patients were selected, diagnosed, and confirmed by a qualified rheumatologist. The basal clinical and demographic characteristics were compared with all subjects. Genotypes for eight selected single nucleotide polymorphisms (SNPs) in ERAP1 gene (rs27038, rs27037, rs27434, rs27980, rs7711564, rs30187, rs10050860, and rs17482078) were determined by using the Sequenom MassARRAY iPLEX platform in Zhejiang Han Chinese population. Association analyses were performed on the whole genotyped data set in 707 unrelated ankylosing spondylitis cases and 837 ethnically matched controls. We observed the strongest association between AS and HLA-B27, which confers over 90 % of ankylosing spondylitis cases. Moreover, we found three loci of ERAP1 polymorphisms were at a high significance level (rs27037 P = 0.00451; rs27434 P = 0.00012; rs27980 P = 0.00682) with AS in Zhejiang population. We also confirmed polymorphism locus of ERAP1 previously reported association with AS (rs27434; P = 5.3 × 10(-12)). Our results indicated a difference in the mechanism of susceptibility loci in subsets of Zhejiang Han Chinese population and provided further evidence that rs27434 is the key polymorphism associated with AS in ERAP1 gene.

  2. FCRL3 gene polymorphisms confer autoimmunity risk for allergic rhinitis in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Zheng Gu

    Full Text Available Heredity and environmental exposures may contribute to a predisposition to allergic rhinitis (AR. Autoimmunity may also involve into this pathologic process. FCRL3 (Fc receptor-like 3 gene, a novel immunoregulatory gene, has recently been reported to play a role in autoimmune diseases.This study was performed to evaluate the potential association of FCRL3 polymorphisms with AR in a Chinese Han population.Five single-nucleotide polymorphisms of FCRL3, rs945635, rs3761959, rs7522061, rs10489678 and rs7528684 were genotyped in 540 AR patients and 600 healthy controls using a PCR-restriction fragment length polymorphism assay. Allele, genotype and haplotype frequencies were compared between patients and controls using the χ2 test. The online software platform SHEsis was used to analyze their haplotypes.This study identified three strong risk SNPs rs7528684, rs10489678, rs7522061 and one weak risk SNP rs945635 of FCRL3 in Chinese Han AR patients. For rs7528684, a significantly increased prevalence of the AA genotype and A allele in AR patients was recorded. The frequency of the GG genotype and G allele of rs10489678 was markedly higher in AR patients than those in controls. For rs7522061, a higher frequency of the TT genotype, and a lower frequency of the CT genotype were found in AR patients. Concerning rs945635, a lower frequency of the CC genotype, and a higher frequency of G allele were observed in AR patients. According to the analysis of the three strong positive SNPs, the haplotype of AGT increased significantly in AR cases (AR = 38.8%, Controls = 24.3%, P = 8.29 × 10(-14, OR [95% CI] 1.978 [1.652~2.368].This study found a significant association between the SNPs in FCRL3 gene and AR in Chinese Han patients. The results suggest these gene polymorphisms might be the autoimmunity risk for AR.

  3. SNAP25 is associated with schizophrenia and major depressive disorder in the Han Chinese population.

    Science.gov (United States)

    Wang, Qingzhong; Wang, Yanlin; Ji, Weidong; Zhou, Guoquan; He, Kuanjun; Li, Zhiqiang; Chen, Jianhua; Li, Wenjin; Wen, Zujia; Shen, Jiawei; Qiang, Yu; Ji, Jue; Wang, Yujiong; Shi, Yongyong; Yi, Qizhong; Wang, Yonggang

    2015-01-01

    Synaptosomal-associated protein of 25 kDa (SNAP25) is a member of the soluble N-ethylmaleimide-sensitive factor attachment receptor (SNARE) protein complex, which plays essential roles in the modulation of different voltage-gated calcium channels and neurotransmitter release. Many previous studies have reported the SNAP25 gene to be significantly associated with attention-deficit/hyperactivity disorder (ADHD). Recently, shared genetic variants have been demonstrated in 5 major psychiatric disorders, including schizophrenia, major depressive disorder, bipolar disorder, autism spectrum disorders, and ADHD. However, no compelling, convincing evidence has suggested an association between SNAP25 and schizophrenia or major depressive disorder. Thus, we investigated the association between SNAP25 and both schizophrenia and major depressive disorder in the Han Chinese population. We performed a large-scale case-control study to test the association between SNAP25 and 2 major mental disorders, schizophrenia (DSM-IV criteria) and major depressive disorder (DSM-IV criteria), in the Han Chinese population. Seven single-nucleotide polymorphisms (SNPs) were genotyped in 1,330 schizophrenia patients, 1,045 major depressive disorder patients, and 1,520 healthy controls of Han Chinese origin. Two SNPs, rs3787283 and rs3746544, were found to be associated with both schizophrenia (rs3746544, adjusted P = .00257) and major depressive disorder (rs3746544, adjusted P = .0485; rs3787283, adjusted P = .00387) in this study. The AG haplotype consisting of rs3787283 and rs3746544 was also significantly associated with both schizophrenia and major depressive disorder (schizophrenia: adjusted P = .0126; major depressive disorder: adjusted P = .000580). Additionally, we carried out a meta-analysis of the current data and published association results and further confirmed the association between rs3746544 and schizophrenia (Pmeta = .002, ORmeta = 1.213 [95% CI, 1.077-1.367]). Our results

  4. Transcendental in Hans Urs von Balthasar’s theological aesthetics and its significance for Chinese academic aesthetics

    OpenAIRE

    Peng, Sheng-Yu

    2013-01-01

    This thesis begins a dialogue between Hans Urs von Balthasar’s theological aesthetics and Chinese academic aesthetics. We identify a tension between aesthetics and religion in Chinese academic aesthetics, and argue that a dialogue with von Balthasar’s work has the potential to contribute to the development of Chinese academic aesthetics with regard to overcoming that tension. In order to set a ground for the dialogue, von Balthasar’s theological aesthetics is examined in Par...

  5. Association study confirms two susceptibility loci for breast cancer in Chinese Han women.

    Science.gov (United States)

    Xu, Minggui; Xu, Yihui; Chen, Mengyun; Li, Yang; Li, Wei; Zhu, Jun; Zhang, Mingjun; Chen, Zhendong; Zhang, Xuejun; Liu, Jianjun; Zhang, Bo

    2016-10-01

    To date, many loci associated with breast cancer have been identified through genome-wide association studies; most of these studies were conducted using populations of European descent. Thus, it is not clear whether these susceptibility loci are also risk factors for Chinese populations. We selected and genotyped 32 single nucleotide polymorphisms (SNPs) using the Sequenom iPLEX platform in a female Chinese cohort of 3036 breast cancer cases and 3036 healthy controls. A total of 23 SNPs passed the quality control test. The associations of these SNPs with disease susceptibility were assessed using logistic regression, adjusting for age. The Bonferroni correction was used to conservatively account for multiple testing, and the threshold for statistical significance was P associated variants within three reported breast cancer susceptibility loci in a Chinese Han population: 5q11.2 (rs16886181, P = 5.29 × 10(-6), OR = 1.19; rs1017226, P = 5.24 × 10(-4), OR = 1.22; rs16886034, P = 2.00 × 10(-3), OR = 1.21; rs16886113, P = 1.24 × 10(-3), OR = 1.20; rs16886364, P = 9.20 × 10(-4), OR = 1.21; rs16886397, P = 1.17 × 10(-3), OR = 1.20; rs16886448, P = 1.62 × 10(-3,)OR = 1.20; and rs2229882, P = 5.14 × 10(-4), OR = 1.31), 5q14.3 (rs421379, P = 2.83 × 10(-13), OR = 1.83), and 10q26.1 (rs35054928, P = 7.73 × 10(-6), OR = 1.18). The 10q26.1 locus was found to be a susceptibility locus for breast cancer in Chinese Han women in our previous studies. 5q11.2 and 5q14.3 are confirmed here for the first time as susceptibility loci for breast cancer in Chinese Han women. This study reports three breast cancer susceptibility loci that were previously identified in European populations and are also risk factors for Chinese populations. This study may extend the genetic basis of breast cancer in Chinese Han women and highlight the contribution of multiple variants of modest effect.

  6. [Polymorphism of CXCR4 coding region of human immunodeficiency virus-1 in Chinese Han people].

    Science.gov (United States)

    Liu, Ming-xu; Wang, Fu-sheng; Hong, Wei-guo; Wang, Bo; Jin, Lei; Lei, Zhou-yun; Hou, Jing

    2003-06-01

    To study the polymorphism of human immunodeficiency virus (HIV)-1 coreceptor CXCR4 in Chinese Han ethnic group for AIDS prevention and treatment. Totally 48 individuals were enrolled into the study. CXCR4 (cDNA No-AF147204) was cloned by PCR amplification using 2 pairs of primers, then sequenced using sequencing primers. The results of the same sequencing primers were analyzed by DNAstar software to find and identify single nucleotide polymorphism (SNP) sites. Totally 7 SNPs were found in the coding region of CXCR4, among them 3 were synonymous mutation (C-->T at loci 129, 426 and 968), 3 were missense mutation (C-->T at locus 38, A-->T at locus 90, and A-->C at locus 712) and 1 was stop mutation (C-->T at 106, which converted the codon for glutamic acid into stop codon). The polymorphism of CXCR4 coding region in Chinese Han is probably different from that of the other ethnic groups. Six of the 7 SNPs were discovered for the first time. Their influences on AIDS progression are worthy of studying.

  7. Association of a miRNA-137 Polymorphism with Schizophrenia in a Southern Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Guoda Ma

    2014-01-01

    Full Text Available Both genome wide association study (GWAS and biochemical studies of Caucasian populations indicate a robust association between the miR-137 genetic variant rs1625579 and schizophrenia, but inconsistent results have been reported. To assay the association between this variant and schizophrenia, we genotyped 611 schizophrenic patients from Southern Chinese Han population for the risk single nucleotide polymorphism (SNP rs1625579 using the SNaPshot technique and compared the clinical profiles of different genotypes. Additionally, a meta-analysis was performed using the combined sample groups from five case-control publications and the present study. Both the genotype and allele distributions of the rs1625579 SNP were significantly different between patients and controls (P=0.036 and 0.026, SNP. TT genotype carriers showed slightly lower Brief Assessment of Cognition in Schizophrenia- (BACS- derived working memory performance than G carriers (15.58 ± 9.56 versus 19.71 ± 8.18, P=0.045. In the meta-analysis, we observed a significant association between rs1625579 and schizophrenia under different genetic models (all P<0.05. The results of our study and meta-analysis provide convincing evidence that rs1625579 is significantly associated with schizophrenia. Furthermore, the miR-137 polymorphism influences the working memory performance of schizophrenic patients in a Chinese Han population.

  8. Genetic polymorphisms in ALDH2 are associated with drug addiction in a Chinese Han population.

    Science.gov (United States)

    Zhang, Chan; Ding, Heng; Cheng, Yujing; Chen, Wanlu; Li, Qi; Li, Qing; Dai, Run; Luo, Manlin

    2017-01-31

    We investigated the association between single nucleotide polymorphisms (SNPs) in ALDH2, which has been associated with alcohol dependence and several types of diseases, and the risk of drug addiction in a Chinese Han population. In a case-control study that included 692 cases and 700 healthy controls, eight SNPs in ALDH2 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. We determined that rs671 is significantly associated with a 1.551-fold increased drug addiction risk (95% CI = 1.263-1.903; p drug addiction under additive, dominant and recessive models (p drug addiction risk under additive and recessive model, respectively (p drug addiction risk (OR = 1.668; 95% CI, 1.328-2.094, p drug addiction risk (OR = 0.444; 95% CI, 0.281-0.704, p drug addiction in the Chinese Han population.

  9. The relationship between polymorphisms of XRCC5 genes with astrocytoma prognosis in the Han Chinese population

    Science.gov (United States)

    Li, Lei; Zhang, Jiayi; Wu, Ruipeng; Zhang, Yuan; Kang, Longli; Yuan, Dongya; Jin, Tianbo

    2016-01-01

    Background Gliomas are highly malignant with a poor prognosis. Studies have reported that DNA repair genes influence risk for glioma, but its relationship with prognosis is unclear. In this study, we want to explore the relationship between DNA repair genes (XRCC3, XRCC4 and XRCC5) and prognosis of astrocytoma in the Chinese Han population. Materials and Methods 160 astrocytoma cases were recruited in our study. Survival probabilities were estimated by using Kaplan–Meier analysis, and significant differences were analyzed by using the log-rank test. Cox proportional hazards models were used to analyze the associations between genotypes with astrocytoma survival. Hazard ratios (HR) and 95% confidence intervals (CI) were estimated using multivariable models. All tests were two-sided and p astrocytoma prognosis. Further, the “A/A” genotype of rs9288516 in XRCC5 (HR: 1.67, 95%CI: 1.02 - 2.72, p = 0.042) had significantly outcomes after adjusting for potential confounders, patients with poor tumor differentiation and the coexistence of the unfavorable genotypes. Conclusion These results suggest that polymorphisms of XRCC5 play an important role in astrocytoma prognosis in the Chinese Han population which could be used in the determination of astrocytoma prognosis in clinical researches. PMID:27852033

  10. Gender, body mass index, and PPARγ polymorphism are good indicators in hyperuricemia prediction for Han Chinese.

    Science.gov (United States)

    Lee, Ming-Fen; Liou, Tsan-Hon; Wang, Weu; Pan, Wen-Harn; Lee, Wei-Jei; Hsu, Chung-Tan; Wu, Suh-Fen; Chen, Hsin-Hung

    2013-01-01

    Hyperuricemia is closely associated with obesity and metabolic abnormalities, which is also an independent risk factor for cardiovascular diseases. The PPARγ gene, which is linked to obesity and metabolic abnormalities in Han Chinese, might be considered a top candidate gene that is involved in hyperuricemia. This study recruited 457 participants, aged 20-40 years old, to investigate the associations of the PPARγ gene and metabolic parameters with hyperuricemia. Three tag-single nucleotide polymorphisms, rs2292101, rs4684846, and rs1822825, of the PPARγ gene were selected to explore their association with hyperuricemia. Risk genotypes on rs1822825 of the PPARγ gene exhibited statistical significance with hyperuricemia (odds ratio: 1.9; 95% confidence interval: 1.05-3.57). Although gender, body mass index (BMI), serum total cholesterol concentration, or protein intake per day were statistically associated with hyperuricemia, the combination of BMI, gender, and rs1822825, rather than that of age, serum lipid profile, blood pressure, and protein intake per day, satisfied the predictability for hyperuricemia (sensitivity: 69.3%; specificity: 83.7%) in Taiwan-born obese Han Chinese. BMI, gender, and the rs1822825 polymorphism in the PPARγ gene appeared good biomarkers in hyperuricemia; therefore, these powerful indicators may be included in the prediction of hyperuricemia to increase the accuracy of the analysis.

  11. KCNQ1 gene polymorphisms are associated with lipid parameters in a Chinese Han population

    Directory of Open Access Journals (Sweden)

    Chen Zhong

    2010-08-01

    Full Text Available Abstract Background Four single nucleotide polymorphisms (SNPs (rs2237892, rs2237895, rs2237897, and rs2283228 in KCNQ1 are reported to be associated with type 2 diabetes mellitus (T2DM, possibly caused by a reduction in insulin secretion and higher fasting glucose, but the results are inconsistent. We investigated whether these 4 genetic markers are associated with serum lipid metabolism in a middle-aged Chinese Han population. Methods We enrolled 398 consecutive patients, including 180 with premature coronary artery disease (CAD (male KCNQ1. Results The 3 genotypes AA, AC, and CC were present in rs2283228 and rs2237895, and the 3 genotypes CC, CT, and TT were present in rs2237897 and rs2237892. The minor genotypes CC at rs2283228 and TT at rs2237892 were associated with higher levels of TG (P = 0.007 and 0.026, respectively. Furthermore, subjects with the CC genotype at rs2283228 had lower levels of HDL-C and apo A1 than in the other 2 genotype groups (P = 0.052 and 0.055, respectively. No other associations were detected between these 4 SNPs and FBS or other lipid parameters. Conclusions Our data suggest that rs2283228 and rs2237892 in KCNQ1 are associated with lipid metabolism in a middle-aged Chinese Han population.

  12. A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Fuu-Jen Tsai

    2010-02-01

    Full Text Available To investigate the underlying mechanisms of T2D pathogenesis, we looked for diabetes susceptibility genes that increase the risk of type 2 diabetes (T2D in a Han Chinese population. A two-stage genome-wide association (GWA study was conducted, in which 995 patients and 894 controls were genotyped using the Illumina HumanHap550-Duo BeadChip for the first genome scan stage. This was further replicated in 1,803 patients and 1,473 controls in stage 2. We found two loci not previously associated with diabetes susceptibility in and around the genes protein tyrosine phosphatase receptor type D (PTPRD (P = 8.54x10(-10; odds ratio [OR] = 1.57; 95% confidence interval [CI] = 1.36-1.82, and serine racemase (SRR (P = 3.06x10(-9; OR = 1.28; 95% CI = 1.18-1.39. We also confirmed that variants in KCNQ1 were associated with T2D risk, with the strongest signal at rs2237895 (P = 9.65x10(-10; OR = 1.29, 95% CI = 1.19-1.40. By identifying two novel genetic susceptibility loci in a Han Chinese population and confirming the involvement of KCNQ1, which was previously reported to be associated with T2D in Japanese and European descent populations, our results may lead to a better understanding of differences in the molecular pathogenesis of T2D among various populations.

  13. Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

    Directory of Open Access Journals (Sweden)

    Li Sheng-Bin

    2011-10-01

    Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

  14. Association between the COMT Val158Met Genotype and Alzheimer's Disease in the Han Chinese Population

    Directory of Open Access Journals (Sweden)

    Yong Ji

    2014-01-01

    Full Text Available Background: Alzheimer's disease (AD is the leading cause of dementia worldwide and is associated with individual, familial and social burdens. Catechol-O-methyltransferase (COMT may have a prominent role in AD pathophysiology by affecting the metabolism of catecholamine neurotransmitters and estrogen. Although the COMT rs4680 gene polymorphism has been investigated as a susceptibility factor for AD, the results are inconsistent. The aim of this study was to examine the influence of the COMT rs4680 gene polymorphism as a risk factor for AD in the Han Chinese population and its synergistic effect with the apolipoprotein E (APOE gene. Methods: A total of 137 AD patients and 194 healthy controls were analyzed. Clinical criteria and neuropsychological tests were used to establish diagnostic groups. All subjects were analyzed for the COMT rs4680 polymorphism and APOE genotype. Results: No significant differences were observed between AD and control subjects regarding the COMT genotype frequencies of Val/Val, Val/Met and Met/Met, but Met alleles were higher in AD than in control subjects (35.4 and 28.1%, p = 0.045. A minor synergistic effect between the genotypes GG and APOE ε4 was observed in AD patients (OR: 5.707, 95% CI: 2.505-13.002, p APOE ε4 (11.972, 95% CI: 5.534-25.902, p COMT Met allele was an independent risk factor for AD without APOE ε4 allele carriers (OR: 1.806, 95% CI: 1.160-2.810, p = 0.009, especially in men (OR: 4.904, 95% CI: 2.381-10.099, p Conclusion: The COMT (Val158Met polymorphism is not an independent risk factor for AD but shows a synergistic effect between the genotypes GG and APOE ε4 that proves greater in women with AD. The COMT Met allele represents a risk factor in AD without APOE ε4 allele carriers, which is notable in men with AD.

  15. A View of the Chinese Family.

    Science.gov (United States)

    Hallman, Patsy

    1985-01-01

    Describes the current state of and the effect of new policies on Chinese families, in terms of marriage, family planning, housing, income, lifestyle, food practices, clothing, health care, education, religion, status of women, and retirement. (SK)

  16. Variants in GLIS3 and CRY2 are associated with type 2 diabetes and impaired fasting glucose in Chinese Hans.

    Directory of Open Access Journals (Sweden)

    Chen Liu

    Full Text Available Recent genome-wide association studies have identified a number of common variants associated with fasting glucose homeostasis and type 2 diabetes in populations of European origin. This is a replication study to examine whether such associations are also observed in Chinese Hans.We genotyped nine variants in or near MADD, ADRA2A, CRY2, GLIS3, PROX1, FADS1, C2CD4B, IGF1 and IRS1 in a population-based cohort including 3,210 unrelated Chinese Hans from Beijing and Shanghai.We confirmed the associations of GLIS3-rs7034200 with fasting glucose (beta = 0.07 mmol/l, P = 0.03, beta cell function (HOMA-B (beta = -3.03%, P = 0.009, and type 2 diabetes (OR [95%CI]  = 1.27 [1.09-1.49], P = 0.003 after adjustment for age, sex, region and BMI. The association for type 2 diabetes remained significant after adjusting for other diabetes related risk factors including family history of diabetes, lipid profile, medication information, hypertension and life style factors, while further adjustment for HOMA-B abolished the association. The A-allele of CRY2-rs11605924 was moderately associated with increased risk of combined IFG/type 2 diabetes (OR [95%CI]  = 1.15[1.01-1.30], P = 0.04. SNPs in or near MADD, ADRA2A, PROX1, FADS1, C2CD4B, IGF1, and IRS1 did not exhibit significant associations with type 2 diabetes or related glycemic traits (P≥0.10.In conclusion, our results indicate the associations of GLIS3 locus with type 2 diabetes and impaired fasting glucose in Chinese Hans, partially mediated through impaired beta-cell function. In addition, we also found modest evidence for the association of CRY2-rs11605924 with combined IFG/type 2 diabetes.

  17. No association of the insulin gene VNTR polymorphism with polycystic ovary syndrome in a Han Chinese population

    Directory of Open Access Journals (Sweden)

    Gao Guihua

    2009-12-01

    Full Text Available Abstract Background Polycystic ovary syndrome (PCOS is a common endocrine disorder associated with an increased risk of type II diabetes mellitus. The results of previous research about the association of the VNTR polymorphism in 5-prime flanking region of the insulin (INS gene with PCOS have been inconsistent. The present study was to investigate the association of the INS-VNTR polymorphism with PCOS in a Han Chinese population. Methods The -23/HphI polymorphism as a surrogate marker of the INS-VNTR length polymorphism was genotyped by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP in 216 PCOS patients and 192 non-PCOS women as a control group. Allelic and genotypic frequencies were compared between patients and controls, and these results were analyzed in respect to clinical test data. Results No significant differences were observed between the cases and controls groups either in allele (P = 0.996 or genotype (P = 0.802 frequencies of INS-VNTR polymorphism; Regarding anthropometric data and hormone levels, there were no significant differences between INS-VNTR genotypes in the PCOS group, as well as in the non-PCOS group. Conclusion The present study demonstrated for the first time that the INS-VNTR polymorphism is not a key risk factor for sporadic PCOS in the Han Chinese women. Further studies are needed to give a global view of this polymorphism in pathogenesis of PCOS in a large-scale sample, family-based association design or well-defined subgroups of PCOS.

  18. Polygenic risk for severe psychopathology among Europeans is associated with major depressive disorder in Han Chinese women.

    Science.gov (United States)

    Edwards, A C; Docherty, A R; Moscati, A; Bigdeli, T B; Peterson, R E; Webb, B T; Bacanu, S-A; Hettema, J M; Flint, J; Kendler, K S

    2017-10-03

    Previous studies have demonstrated that several major psychiatric disorders are influenced by shared genetic factors. This shared liability may influence clinical features of a given disorder (e.g. severity, age at onset). However, findings have largely been limited to European samples; little is known about the consistency of shared genetic liability across ethnicities. The relationship between polygenic risk for several major psychiatric diagnoses and major depressive disorder (MDD) was examined in a sample of unrelated Han Chinese women. Polygenic risk scores (PRSs) were generated using European discovery samples and tested in the China, Oxford, and VCU Experimental Research on Genetic Epidemiology [CONVERGE (maximum N = 10 502)], a sample ascertained for recurrent MDD. Genetic correlations between discovery phenotypes and MDD were also assessed. In addition, within-case characteristics were examined. European-based polygenic risk for several major psychiatric disorder phenotypes was significantly associated with the MDD case status in CONVERGE. Risk for clinically significant indicators (neuroticism and subjective well-being) was also associated with case-control status. The variance accounted for by PRS for both psychopathology and for well-being was similar to estimates reported for within-ethnicity comparisons in European samples. However, European-based PRS were largely unassociated with CONVERGE family history, clinical characteristics, or comorbidity. The shared genetic liability across severe forms of psychopathology is largely consistent across European and Han Chinese ethnicities, with little attenuation of genetic signal relative to within-ethnicity analyses. The overall absence of associations between PRS for other disorders and within-MDD variation suggests that clinical characteristics of MDD may arise due to contributions from ethnicity-specific factors and/or pathoplasticity.

  19. Analysis of clinical indexes and RUNX3, TBKBP1, PPARGC1B polymorphisms in Chinese Han patients with ankylosing spondylitis.

    Science.gov (United States)

    Liu, Jun; Lian, Zijian; Xiao, Yu; Shi, Lewis L; Chai, Wei; Wang, Yan

    2015-01-01

    Ankylosing spondylitis (AS) is a genetically determined disease. Runt-related transcription factor 3 (RUNX3), tumor necrosis factor family member-associated NF-κB activator binding kinase 1 binding protein (TBKBP1), and peroxisome proliferator-activated receptor-gamma coactivator 1 beta (PPARGC1B) have recently been found to be associated with susceptibility to AS in patients of Western European descent. We hypothesize that these three genes may be related to clinical outcomes of Chinese Han AS patients. Blood samples were drawn from 396 HLA-B27-positive Chinese Han AS patients. Clinical indexes were scored for each patient, including the Bath Ankylosing Spondylitis Functional Index (BASFI), Bath Ankylosing Spondylitis Disease Activity Index (BASDAI), and modified Stoke Ankylosing Spondylitis Spine Score (mSASSS), which measure patients' function of daily life and severity of AS. Twelve tagSNPs were selected from these three genes and genotyped. We analyzed the clinical indexes in different genotyped patients to investigate the relationship between severity of AS and different genotypes. The rs11249215 SNP in RUNX3 and the rs7379457 and rs32579 SNPs in PPARGC1B significantly affect the BASFI score in patients. The rs11249215, rs7551188, and rs1395621 SNPs in RUNX3 significantly affect the BASDAI scores. The two selected single nucleotide polymorphisms (SNPs) in TBKBP1 show no relationship with the clinical outcomes. None of the 12 SNPs is related to mSASSS. In conclusion, RUNX3 is related to both the severity of AS and the function of daily life. PPARGC1B is related to the function of daily life.

  20. Association between polymorphisms of the IKZF3 gene and systemic lupus erythematosus in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Xinze Cai

    Full Text Available OBJECTIVE: It has been reported that IKAROS family of zinc finger 3 (IKZF3-deficient mice spontaneously develop human systemic lupus erythematosus (SLE-like phenotypes and produce anti-dsDNA Ab leading to immune complex-mediated glomerulonephritis. Polymorphism of the IKZF3 gene corresponds with the susceptibility to several immune-related diseases. Our intention was to establish an association between polymorphisms in the IKZF3 gene and SLE in the Chinese Han population. METHODS: The study involved obtaining blood samples for DNA extraction and genotyping the 4 selected single-nucleotide polymorphisms (SNPs in IKZF3, including rs12150079, rs9909593, rs907091, and rs2872507, by performing PCR restriction fragment length polymorphism analysis (PCR-RFLP. A group of 366 SLE patients were compared to 455 healthy controls. RESULTS: A significant decrease in frequencies of the rs907091 CC genotype and C allele appeared in the SLE patients unlike that observed in the controls (p = 0.001 and 0.015, respectively. The frequencies of the rs12150079 genotype and allele were different between the SLE patients and the control individuals, although the significance was only marginal (p = 0.046 and 0.049, respectively. In addition, a significantly low frequency of the GGCG haplotype was observed in the SLE patients, suggesting that it may provide protection against SLE (p = 0.011. CONCLUSION: To the best of our knowledge, this is the first study to demonstrate an important association between polymorphisms in IKZF3 and SLE in the Chinese Han population. A strong association between rs907091 in the IKZF3 gene and SLE was identified.

  1. SCN11A variants may influence postoperative pain sensitivity after gynecological surgery in Chinese Han female patients.

    Science.gov (United States)

    Sun, Jiaoli; Duan, Guangyou; Li, Ningbo; Guo, Shanna; Zhang, Yuhao; Ying, Ying; Zhang, Mi; Wang, Qingli; Liu, Jing Yu; Zhang, Xianwei

    2017-09-01

    Nav1.9, encoded by sodium voltage-gated channel alpha subunit 11 (SCN11A), is one of the main sodium channels involved in pain transmission. Dysfunction of Nav1.9 alters pain sensitivity, resulting in insensitivity to pain or familial episodic pain. Our purpose was to explore the effects of SCN11A single-nucleotide polymorphisms (SNPs) on postoperative pain sensitivity in Chinese Han female patients after gynecological surgery.Here, we combined the methods of tag SNPs and candidate SNPs. The associations between eleven SCN11A SNPs and basic pain sensitivity in female healthy volunteers were analyzed using the Plink software. The SNPs associated with basic pain sensitivity were termed positive SCN11A SNPs. The effect of these positive SNPs on postoperative pain sensitivity was explored in patients undergoing elective gynecological laparoscopic surgery and receiving postoperative patient-controlled analgesia (PCA). We assessed pain intensity using the numeric pain rating scale (NRS) and recorded PCA consumption.Our results suggested that 5 SNPs (rs33985936, rs13080116, rs11720988, rs11709492, and rs11720013) in 11 tag and candidate SNPs were associated with basic pain sensitivity (P  .05). However, among these positive SNPs, the minor alleles of rs33985936 and rs13080116 were significantly associated with increased PCA consumption (P < .01).To our knowledge, this is the first study to report that SCN11A SNPs affect postoperative pain sensitivity in Chinese Han women after gynecological surgery. The SNP rs33985936 and rs13080116 may serve as novel predictors for postoperative pain.

  2. Polymorphisms but Not Mutations of the KCNQ1 Gene Are Associated with Lone Atrial Fibrillation in the Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Hui-min Chu

    2013-01-01

    Full Text Available Background. Recent studies suggest that mutation of the slow delayed rectifier potassium channel (IKs contributes to familial atrial fibrillation (FAF. In the current study, we identified common genetic variants of KCNQ1 and explored the potential association between KCNQ1 polymorphism with lone AF (LAF. Methods. Clinical data and blood samples were collected from 190 Han Chinese patients with sporadic AF and matched healthy controls. Variants of the KCNQ1 gene were identified using single-strand conformational polymorphism (SSCP analysis. A case-control association study in KCNQ1 identified six known single-nucleotide polymorphisms (SNPs during SSCP screening of the 190 LAF patients and 190 healthy controls. Results. One of the SNPs in KCNQ1 was strongly associated with LAF; significant allelic association was detected rs59233444 (P=0.013, OR=1.469, 95% confidence interval (CI: 1.083–1.993. A multiple regression analysis indicated that rs59233444 is an independent risk factor for LAF. Twelve new variants were identified in KCNQ1, including one in the 5′-UTR, two in the 3′-UTR, six in introns, two synonymous substitutions, and one missense substitution. Variants c.1009C>T, c.1860C>T, and c.+2285C>T were not present in the 190 controls, and the others were identified in controls at various frequencies. Conclusions. rs59233444, a common SNP but not mutation in the coding regions of the KCNQ1 gene, is a risk factor for LAF in Chinese Han population.

  3. [The archaic pronunciation of materia medica from Central Plains in the Han dynasty retained in Chinese medicinal business in Taiwan].

    Science.gov (United States)

    Zhang, Xian-Zhe; Cai, Gui-Hua

    2004-10-01

    Chinese traditional medicine took its root in Taiwan together with the culture of Central Plains since our ancestors traveled to Taiwan during the turn of the Ming-Qing dynasties. For 400 years, the profession of Chinese medicine continues to develop through the transmission from fathers to sons, from tutors to disciples. During our contacts with Chinese medicinal businessmen, we found that this routinely closed and time-honored profession retained the archaic pronunciation of materia medica from Central Plains in the Han dynasty. This is a living database for studying ancient Chinese language.

  4. BFH-OSTM, a new predictive screening tool for identifying osteoporosis in elderly Han Chinese males

    Directory of Open Access Journals (Sweden)

    Lin J

    2017-07-01

    Full Text Available JiSheng Lin,1 Yong Yang,1 XiaoDong Zhang,1 Zhao Ma,1 Hao Wu,2 Yongjin Li,3 Xiuquan Yang,4 Qi Fei,1 Ai Guo1 1Department of Orthopedics, Beijing Friendship Hospital, Capital Medical University, Xicheng District, Beijing, People’s Republic of China; 2Fangzhuang Community Health Service Center, Fengtai District, Beijing, People’s Republic of China; 3Tuanjiehu Community Health Service Center, Chaoyang District, Beijing, People’s Republic of China; 4Wangzuo Community Health Service Center, Fengtai District, Beijing, People’s Republic of China Purpose: To develop and validate a new clinical screening tool to identify primary osteoporosis by dual-energy X-ray absorptiometry (DXA in two elderly Han Chinese male populations.Methods: A cross-sectional study was conducted, enrolling 1,870 community-dwelling and 574 hospital-checkup elderly Han Chinese males aged ≥50 years. All subjects completed a structured questionnaire and had their bone mineral density (BMD measured using DXA. Using logistic regression analysis in the 1,870 community-dwelling males, we assessed the ability of numerous potential clinical risk factors to identify male with osteoporosis. Multiple variable regression analysis and item reduction yielded a final tool named the Beijing Friendship Hospital Osteoporosis Self-assessment Tool for Elderly Male (BFH-OSTM. Receiver operating characteristic (ROC curve was generated to compare the validation of the BFH-OSTM and Osteoporosis Self-assessment Tool for Asians (OSTA for identifying elderly male at increased the risk of primary osteoporosis in the 574 hospital-checkup males.Results: In screening the 1,870 community-dwelling subjects with DXA, 14.2% (266/1,870 had osteoporosis, and a further 51.8% (969/1,870 had osteopenia. Of the items screened in the questionnaire, weight, height and previous history of fragility fracture were predictive of osteoporosis. A final tool (BFH-OSTM was based on body weight and fragility fracture

  5. BFH-OST, a new predictive screening tool for identifying osteoporosis in postmenopausal Han Chinese women

    Directory of Open Access Journals (Sweden)

    Ma Z

    2016-08-01

    Full Text Available Zhao Ma, Yong Yang,* JiSheng Lin, XiaoDong Zhang, Qian Meng, BingQiang Wang, Qi Fei* Department of Orthopedics, Beijing Friendship Hospital, Capital Medical University, Beijing, People’s Republic of China *These authors contributed equally to this work Purpose: To develop a simple new clinical screening tool to identify primary osteoporosis by dual-energy X-ray absorptiometry (DXA in postmenopausal women and to compare its validity with the Osteoporosis Self-Assessment Tool for Asians (OSTA in a Han Chinese population.Methods: A cross-sectional study was conducted, enrolling 1,721 community-dwelling postmenopausal Han Chinese women. All the subjects completed a structured questionnaire and had their bone mineral density measured using DXA. Using logistic regression analysis, we assessed the ability of numerous potential risk factors examined in the questionnaire to identify women with osteoporosis. Based on this analysis, we build a new predictive model, the Beijing Friendship Hospital Osteoporosis Self-Assessment Tool (BFH-OST. Receiver operating characteristic curves were generated to compare the validity of the new model and OSTA in identifying postmenopausal women at increased risk of primary osteoporosis as defined according to the World Health Organization criteria.Results: At screening, it was found that of the 1,721 subjects with DXA, 22.66% had osteoporosis and a further 47.36% had osteopenia. Of the items screened in the questionnaire, it was found that age, weight, height, body mass index, personal history of fracture after the age of 45 years, history of fragility fracture in either parent, current smoking, and consumption of three of more alcoholic drinks per day were all predictive of osteoporosis. However, age at menarche and menopause, years since menopause, and number of pregnancies and live births were irrelevant in this study. The logistic regression analysis and item reduction yielded a final tool (BFH-OST based on age

  6. Prediction consistency and clinical presentations of breast cancer molecular subtypes for Han Chinese population

    Directory of Open Access Journals (Sweden)

    Huang Chi-Cheng

    2012-09-01

    Full Text Available Abstract Background Breast cancer is a heterogeneous disease in terms of transcriptional aberrations; moreover, microarray gene expression profiles had defined 5 molecular subtypes based on certain intrinsic genes. This study aimed to evaluate the prediction consistency of breast cancer molecular subtypes from 3 distinct intrinsic gene sets (Sørlie 500, Hu 306 and PAM50 as well as clinical presentations of each molecualr subtype in Han Chinese population. Methods In all, 169 breast cancer samples (44 from Taiwan and 125 from China of Han Chinese population were gathered, and the gene expression features corresponding to 3 distinct intrinsic gene sets (Sørlie 500, Hu 306 and PAM50 were retrieved for molecular subtype prediction. Results For Sørlie 500 and Hu 306 intrinsic gene set, mean-centring of genes and distance-weighted discrimination (DWD remarkably reduced the number of unclassified cases. Regarding pairwise agreement, the highest predictive consistency was found between Hu 306 and PAM50. In all, 150 and 126 samples were assigned into identical subtypes by both Hu 306 and PAM50 genes, under mean-centring and DWD. Luminal B tended to show a higher nuclear grade and have more HER2 over-expression status than luminal A did. No basal-like breast tumours were ER positive, and most HER2-enriched breast tumours showed HER2 over-expression, whereas, only two-thirds of ER negativity/HER2 over-expression tumros were predicted as HER2-enriched molecular subtype. For 44 Taiwanese breast cancers with survival data, a better prognosis of luminal A than luminal B subtype in ER-postive breast cancers and a better prognosis of basal-like than HER2-enriched subtype in ER-negative breast cancers was observed. Conclusions We suggest that the intrinsic signature Hu 306 or PAM50 be used for breast cancers in the Han Chinese population during molecular subtyping. For the prognostic value and decision making based on intrinsic subtypes, further prospective

  7. Influence of Cigarette Smoking on Rheumatoid Arthritis Risk in the Han Chinese Population

    Directory of Open Access Journals (Sweden)

    Jian Yin

    2017-06-01

    Full Text Available ObjectivesCigarette smoking has been shown in European populations to be associated with rheumatoid arthritis (RA susceptibility. This study aims to examine the association of smoking with RA in the Han Chinese population.Methods718 Han Chinese RA patients and 404 healthy controls were studied. The associations of cigarette smoking (current, former or ever vs. never smokers, and pack-years of exposure with RA, anti-cyclic citrullinated peptide antibody (ACPA positive RA, IgM rheumatoid factor (RF positive RA, and baseline radiographic erosions (modified van der Heijde–Sharp scores were assessed. The interaction between smoking and the HLA-DRB1 shared epitope (SE in RA was also examined.ResultsIn this study, 11 (1.53% cases and 6 (1.49% controls were former smokers (p = 0.95, while 95 (13.23% cases and 48 (11.88% controls were current smokers (p = 0.52. Trends toward associations between smoking status (ever vs. never with RA-overall (p = 0.15, OR = 1.44, ACPA-positive RA (p = 0.24, OR = 1.37, RF-positive RA (p = 0.14, OR = 1.46, or the presence of radiographic erosions (p = 0.66, OR = 1.28 were observed although individually here were not statistically significant. There was no evidence of statistical interaction between smoking status (ever vs. never and SE for all RA, ACPA-positive RA, ACPA-negative RA, RF-positive RA, RF-negative RA (p = 0.37, 0.50, 0.24, 0.26, and 0.81 respectively, and the 95% CI for the attributable proportion for all interactions included 0.ConclusionThis is the first study to examine the association of cigarette smoking with RA in the Han Chinese population. This study shows a trend toward an interaction between smoking and SE carriage influencing the risk of RA, though findings were not statistically significant. It is possible that in the presence of universal exposure to heavy air pollution the effect of smoking on RA risk may be obscured.

  8. Morning surge in blood pressure and sympathetic activity in Mongolians and Han Chinese: a multimodality investigation of hypertension and dyssomnia.

    Science.gov (United States)

    Huang, Guanhua; Yang, Xiaoming; Huang, Jing

    2017-01-01

    Hypertension and dyssomnia are increasing significantly in Mongolians, and the related factors of ethnic differences in hypertension and dyssomnia between Mongolians and Han Chinese are unclear. This study examined the relationship of morning surge in blood pressure (MBP) with ethnicity, sleep situation, and sympathetic activity throughout the day. Of 692 hypertensive patients screened, 202 subjects with dyssomnia were selected. They were then divided into Mongolian (n = 87) and Han (n = 115) groups. The differences in dyssomnia, 24-h blood pressure, and urinary catecholamine were analyzed in all subjects; they were then further divided according to the degree of dyssomnia (low, moderate, and severe) to determine the differences in blood pressure and catecholamine. Mongolians had a lower history of smoking, daytime dysfunction, nocturnal heart rates, and dopamine levels, but their body mass index, triglyceride, fasting glucose, morning surge in systolic blood pressure (MSBP), nocturnal systolic blood pressure (NSBP), nocturnal diastolic blood pressure, daytime systolic blood pressure, daytime heart rates, and dopamine level (D-DA) were higher than those of Han Chinese. With the aggravation of dyssomnia, MSBP, NSBP, D-NE, daytime epinephrine, and D-DA of Mongolians and Han Chinese increased gradually, but the rate of increase was faster in the latter (p < 0.05). D-DA was entered into the MSBP regression model of Mongolians (intercept, 157 mmHg), whereas D-DA and D-NE were entered into the MSBP regression model of Han Chinese (intercept, 142 mmHg). Worsened dyssomnia induces higher MSBP and augments sympathetic excitability in Mongolians and Han Chinese. Mongolians with hypertension and dyssomnia had higher MSBP baseline and D-DA but lower N-DA. With an increase in D-DA, MSBP in Han and Mongolian patients increased gradually.

  9. Morning surge in blood pressure and sympathetic activity in Mongolians and Han Chinese: a multimodality investigation of hypertension and dyssomnia

    Directory of Open Access Journals (Sweden)

    Guanhua Huang

    2017-09-01

    Full Text Available Background Hypertension and dyssomnia are increasing significantly in Mongolians, and the related factors of ethnic differences in hypertension and dyssomnia between Mongolians and Han Chinese are unclear. This study examined the relationship of morning surge in blood pressure (MBP with ethnicity, sleep situation, and sympathetic activity throughout the day. Methods Of 692 hypertensive patients screened, 202 subjects with dyssomnia were selected. They were then divided into Mongolian (n = 87 and Han (n = 115 groups. The differences in dyssomnia, 24-h blood pressure, and urinary catecholamine were analyzed in all subjects; they were then further divided according to the degree of dyssomnia (low, moderate, and severe to determine the differences in blood pressure and catecholamine. Results Mongolians had a lower history of smoking, daytime dysfunction, nocturnal heart rates, and dopamine levels, but their body mass index, triglyceride, fasting glucose, morning surge in systolic blood pressure (MSBP, nocturnal systolic blood pressure (NSBP, nocturnal diastolic blood pressure, daytime systolic blood pressure, daytime heart rates, and dopamine level (D-DA were higher than those of Han Chinese. With the aggravation of dyssomnia, MSBP, NSBP, D-NE, daytime epinephrine, and D-DA of Mongolians and Han Chinese increased gradually, but the rate of increase was faster in the latter (p < 0.05. D-DA was entered into the MSBP regression model of Mongolians (intercept, 157 mmHg, whereas D-DA and D-NE were entered into the MSBP regression model of Han Chinese (intercept, 142 mmHg. Conclusion Worsened dyssomnia induces higher MSBP and augments sympathetic excitability in Mongolians and Han Chinese. Mongolians with hypertension and dyssomnia had higher MSBP baseline and D-DA but lower N-DA. With an increase in D-DA, MSBP in Han and Mongolian patients increased gradually.

  10. Sex differences in obesity and cognitive function in a cognitively normal aging Chinese Han population

    Directory of Open Access Journals (Sweden)

    Li W

    2017-09-01

    Full Text Available Wei Li,* Qi Qiu,* Lin Sun, Ling Yue, Tao Wang, Xia Li, Shifu Xiao Alzheimer’s Disease and Related Disorders Center, Shanghai Mental Health Center, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China *These authors contributed equally to this work Background: Sex differences in Alzheimer’s disease and mild cognitive impairment have been well recognized. However, sex differences in cognitive function and obesity in cognitively normal aging Chinese Han population have not attracted much attention. Objective: The aim of this study was to investigate the relationship between sex, obesity, and cognitive function in an elderly Chinese population with normal cognitive function. Subjects and methods: A total of 228 cognitively normal aging participants (males/females =93/135 entered this study. Their general demographic information (sex, age, and education was collected by standardized questionnaire. Apolipoprotein E (APOE genotype and serum lipid levels were measured. The Montreal Cognitive Assessment (MoCA was used to assess participants’ cognitive function. Results: The prevalence of obesity in elderly women (18/133, 13.5% was significantly higher than that in men (5/92, 5.4%, P=0.009. Regression analyses showed that obesity was associated with drinking alcohol (OR =13.695, P=0.045 and triglyceride (OR =1.436, P=0.048 in women and limited to low-density lipoprotein (OR =11.829, P=0.023 in men. Women performed worse on the naming score for MoCA than men (P<0.01. Stepwise linear regression analysis showed that education (t=3.689, P<0.001 and smoking (t=2.031, P=0.045 were related to the score of naming in female, while high-density lipoprotein (t=–2.077, P=0.041 was related to the score of naming in male; however, no correlation was found between body mass index and cognitive function in both male and female (P>0.05. Conclusion: Our finding suggests that there are significant sex differences in obesity and

  11. Characteristics of white coat hypertension in Chinese Han patients with type 2 diabetes mellitus.

    Science.gov (United States)

    Zhou, Jianguang; Liu, Changyun; Shan, Peijia; Zhou, Yingqi; Xu, Erli; Ji, Yufeng

    2014-01-01

    This study documented the prevalence and clinical features of white coat hypertension (WCH) among Chinese Han patients with type 2 diabetes mellitus (T2DM). Clinic and ambulatory blood pressure (BP) measurements were compared in 856 patients with T2DM to determine the frequency of WCH (WCH was defined as clinical blood pressure ≥140/90 mmHg and daytime blood pressure hypertension. Age, course of T2DM, male WC were independent protective factors, whereas female sex, smoking and alcohol consumption were independent risk factors for WCH in T2DM. Non-dippers and reverse dippers made up larger proportion of the WCH group (p hypertension (EH), and WCH patients also exhibit significant differences in clinical parameters.

  12. [Genetic polymorphisms of five STR loci on chromosome 21 in Chinese Han population].

    Science.gov (United States)

    Chen, Zhen-Bin; Zhu, Jin-Ling; Yan, Mei; Liang, Yan; Zhou, Yan; Tan, Shu-Zhen; Xiao, Bai; Liu, Jing-Zhong

    2004-07-01

    To elucidate the genetic polymorphisms of five STR loci on chromosome 21 in Chinese Han population and construct a preliminary database, EDTA-blood specimens were collected from unrelated individuals in Beijing. The DNAs were extracted with Chelex method and were amplified by PCR. The PCR products were analyzed by the PAG electrophoresis or by the approach of the automated fluorescent detection. The five STR loci consist of simple repeat motif and its distributions of genotypes are agreement with Hardy-Weinberg equation. Its polymorphism information content is all over 0.50. The obtained data can not only be used as evidences for genetic diagnosis of Down Syndrome, but also for calculating the probabilities in the paternity test and individual identification.

  13. Genetic association between NRG1 and schizophrenia, major depressive disorder, bipolar disorder in Han Chinese population.

    Science.gov (United States)

    Wen, Zujia; Chen, Jianhua; Khan, Raja Amjad Waheed; Song, Zhijian; Wang, Meng; Li, Zhiqiang; Shen, Jiawei; Li, Wenjin; Shi, Yongyong

    2016-04-01

    Schizophrenia, major depressive disorder, and bipolar disorder are three major psychiatric disorders affecting around 0.66%, 3.3%, and 1.5% of the Han Chinese population respectively. Several genetic linkage analyses and genome wide association studies identified NRG1 as a susceptibility gene of schizophrenia, which was validated by its role in neurodevelopment, glutamate, and other neurotransmitter receptor expression regulation. To further investigate whether NRG1 is a shared risk gene for major depressive disorder, bipolar disorder as well as schizophrenia, we performed an association study among 1,248 schizophrenia cases, 1,056 major depression cases, 1,344 bipolar disorder cases, and 1,248 controls. Totally 15 tag SNPs were genotyped and analyzed, and no population stratification was found in our sample set. Among the sites, rs4236710 (corrected Pgenotye  = 0.015) and rs4512342 (Pallele  = 0.03, Pgenotye  = 0.045 after correction) were associated with schizophrenia, and rs2919375 (corrected Pgenotye  = 0.004) was associated with major depressive disorder. The haplotype rs4512342-rs6982890 showed association with schizophrenia (P = 0.03 for haplotype "TC" after correction), and haplotype rs4531002-rs11989919 proved to be a shared risk factor for both major depressive disorder ("CC": corrected P = 0.009) and bipolar disorder ("CT": corrected P = 0.003). Our results confirmed that NRG1 was a shared common susceptibility gene for major mental disorders in Han Chinese population. © 2016 Wiley Periodicals, Inc.

  14. Genetic variants in MARCO are associated with the susceptibility to pulmonary tuberculosis in Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Mai-Juan Ma

    Full Text Available BACKGROUND: Susceptibility to tuberculosis is not only determined by Mycobacterium tuberculosis infection, but also by the genetic component of the host. Macrophage receptor with a collagenous structure (MARCO is essential components required for toll like receptor-signaling in macrophage response to Mycobacterium tuberculosis, which may contribute to tuberculosis risk. PRINCIPAL FINDINGS: To specifically investigated whether single nucleotide polymorphisms (SNPs in MARCO gene are associated with pulmonary tuberculosis in Chinese Han population. By selecting tagging SNPs in MARCO gene, 17 tag SNPs were identified and genotyped in 923 pulmonary tuberculosis patients and 1033 healthy control subjects using a hospital based case-control association study. Single-point and haplotype analysis revealed an association in intron and exon region of MARCO gene. One SNP (rs17009726 was associated with susceptibility to pulmonary tuberculosis, where the carriers of the G allele had a 1.65 fold (95% CI = 1.32-2.05, p(corrected = 9.27E-5 increased risk of pulmonary tuberculosis. Haplotype analysis revealed that haplotype GC containing G allele of 17009726 and haplotype TGCC (rs17795618T/A, rs1371562G/T, rs6761637T/C, rs2011839C/T were also associated with susceptibility to pulmonary tuberculosis (p(corrected = 0.0001 and 0.029, respectively. CONCLUSIONS: Our study suggested that genetic variants in MARCO gene were associated with pulmonary tuberculosis susceptibility in Chinese Han population, and the findings emphasize the importance of MARCO mediated immune responses in the pathogenesis of tuberculosis.

  15. Genetic Variant in Interleukin-18 Is Associated with Idiopathic Recurrent Miscarriage in Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Jun Yue

    2015-02-01

    Full Text Available Levels of IL-18 were significantly lower in women with recurrent miscarriage (RM than those without idiopathic RM. IL-18 promoter single nucleotide polymorphisms were previously identified to have an impact on IL18 gene transcription activity and influence the level of IL-18 protein production. The aim of this study was to evaluate whether IL-18 gene polymorphisms are risk factors for idiopathic RM in Chinese Han population. Study subjects comprised of 484 idiopathic RM patients and 468 controls. Three polymorphisms (rs360717, rs187238, rs1946518 in IL-18 gene and serum IL-18 concentrations were assessed. rs187238 variant exhibits significant association with RM in additive and recessive genetic model (additive model p = 1.05 × 10−4, dominant model p = 0.025, recessive model p = 2.43 × 10−5. In contrast, rs360717 and rs1946518 are not significantly associated with RM. Serum IL-18 levels are significantly lower in RM cases than in control (111.98 ± 93.13 versus 148.74 ± 130.51 pg/mL, p = 7.42 × 10−7. There are lower levels of serum IL-18 in rs187238 homozygous mutant (CC than homozygous wild-type (GG in this study population, including cases and control groups (98.31 ± 86.46 versus 131.87 ± 115.02 pg/mL, p = 0.015. These results suggest that reduced IL-18 levels and rs187238 variant may contribute to pathogenesis of idiopathic RM in Chinese Han population.

  16. Association of OPG gene polymorphism with susceptibility to rheumatoid arthrits in Chinese Han.

    Science.gov (United States)

    Cai, Yue-ming; Wang, Jing; Wang, Qing-wen; Long, Xia; Wang, Wei-guang; Zhang, Lu; Zeng, Hui-ping; Wu, Zhi-cheng

    2015-06-01

    To investigate the association of osteoproterin (OPG) gene polymorphisms 163A/G (rs3102735), 245T/G (rs3134069) with susceptibility to rheumatoid arthritis (RA) in Chinese Han population. To study the correlation between the disease of rheumatoid arthritis (RA) in Chinese Han group and the association of osteoproterin (OPG) gene polymorphisms 163A/G(rs3102735) and 245T/G (rs3134069). Approaches: 205 RA patients and 171 healthy control subjects were participated into this study. Genotype analysis was conducted by polymerase chain reaction-based restriction fragment length polymorphism and was subsequently confirmed by DNA sequencing. Odd ration (OR) and 95% confidence intervals (95% CI) were calculated for the risk of genotype and allele. OPG gene polymorphisms 163A/G, 245T/G conformed to the Hardy-Weinberg equilibrium. The statistical differences in genotype of AA, AG, GG at 163A/G locus were founded in RA and controls. The G allele was associated with an increased risk of RA, with OR 1.219 (95% CI: 1.066-2.339). According to the observation, there are no significant differences between the RA and control groups with respect to genotype and allele frequencies of OPG gene 245T/G (χ(2)=0.734, 0.518, p>0.05). The OPG gene 163A/G SNP may be associated with the susceptibility of RA, G allele may be the risk factor for the development of RA. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  17. Association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism with ischemic stroke in the Eastern Chinese Han population.

    Science.gov (United States)

    Lv, Q-Q; Lu, J; Sun, H; Zhang, J-S

    2015-04-27

    The association between the MTHFR genetic polymorphism and ischemic stroke has been reported by a number of investigators. However, the results have been controversial and conflicting. The aim of this study was to explore the association between the MTHFR variants C677T and A1298C and the risk of ischemic stroke in an Eastern Chinese Han population. A total of 199 patients with ischemic stroke and 241 controls were recruited. Genotyping of the MTHFR C677T and A1298C polymorphisms was carried out using the Taqman 7900HT Sequence Detection System. The overall estimates (odds ratio: OR) for the allele (C) and genotype (AC+CC) of the A1298C polymorphism were 1.57 [95% confidence interval (CI) = 1.16-2.10], and 2.36 (95%CI = 1.39-4.00), respectively, establishing significant association of the MTHFR A1298C polymorphism with ischemic stroke. In contrast, there were no statistically significant differences compared to controls between MTHFR C677T polymorphic variants in the association ischemic stroke risk. Furthermore, haplotype-based analysis demonstrated that compared with the C-677-A-1298 haplotype, the C-677-C-1298 and T-677-C-1298 haplotypes showed significant increased risk of ischemic stroke (OR = 1.56; 95%CI = 1.07- 2.2; P = 0.02; OR = 1.76; 95%CI = 1.17-2.65; P A1298C polymorphism and the haplotypes C-677-C-1298 and T-677-C-1298 in MTHFR might modulate the risk of ischemic stroke in the Eastern Chinese Han population.

  18. Association between TNFAIP3 Gene Polymorphisms and Risk of Allergic Rhinitis in a Chinese Han Population.

    Science.gov (United States)

    Ke, Xia; Yang, Yinglin; Shen, Yang; Wang, Xiaoqiang; Hong, Suling

    2016-02-01

    Tumor necrosis factor alpha-inducible protein 3 (TNFAIP3) gene polymorphisms have been reported to be associated with the susceptibility to several immune-related diseases. Here we investigated the effect of TNFAIP3 gene polymorphisms on the risk of allergic rhinitis (AR) in a Chinese Han population. The case-control study included 540 AR patients and 524 healthy controls. Genotyping for TNFAIP3 polymorphisms (rs5029928, rs9494885, rs10499194, rs610604, and rs7753873) were performed using restriction fragment length polymorphism analysis and DNA sequencing. Allele and genotype frequencies were compared between patients and controls. The rs9494885 TC genotype (corrected p (p=0.0032); odds ratio (OR)=2.06, 95% confidence intervals (CI): 1.40-3.04) and C allele (p=0.0056; OR=1.94, 95% CI: 1.35-2.76) were more frequent in AR patients compared with controls. The frequencies of the rs9494885 TT genotype (p=0.0029; OR=0.49, 95% CI: 0.33-0.72) and T allele (p= 0.0056; OR=0.52, 95% CI: 0.36-0.74) were lower in AR patients than that in controls. A higher frequency of the rs7753873 AC genotype (p=0.0023; OR=1.96, 95 %CI: 1.38-2.77) and C allele (p=0.0012; OR=1.74, 95% CI: 1.26-2.40) and a lower frequency of the rs7753873 AA genotype (p=0.0040; OR=0.53, 95% CI: 0.38-0.75) and A allele (p=0.0012; OR=0.58, 95% CI: 0.42-0.80) were observed in AR patients. TNFAIP3 gene polymorphisms (rs9494885 and rs7753873) are associated with the susceptibility to AR in the Chinese Han population.

  19. Osteoprotegerin Gene (OPG) Polymorphisms Associated with Peri-implantitis Susceptibility in a Chinese Han Population.

    Science.gov (United States)

    Zhou, Jian; Zhao, Yimin

    2016-11-09

    BACKGROUND The aim of this study was to investigate the association between T950C (rs2073617) and G1181C (rs2073618) polymorphisms of the osteoprotegerin gene (OPG) and the susceptibility of peri-implantitis in the Chinese Han population.  MATERIAL AND METHODS 110 patients with peri-implantitis and 116 healthy persons from the Chinese Han population were included in this study using a case-control design; rs2073617 and rs2073618 in OPG were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The linkage disequilibrium (LD) and haplotype analysis were performed with Haploview software. Hardy-Weinberg equilibrium (HWE) was assessed in the control group based on the genotype distributions of OPG polymorphisms. The genotype, allele, and haplotype distribution differences between the case and control groups were analyzed by chi-square test, and the relative risk of PD was expressed by odds ratio (OR) and 95% confidence interval (CI).  RESULTS The study results showed that people carrying the CC genotype of rs2073618 were more likely to have peri-implantitis than GG genotype carriers (OR=2.18, 95% CI=1.03-4.62, p=0.04). In addition, patients with the C allele had 1.47 times the risk of suffering from peri-implantitis (OR=1.47, 95% CI=1.01-2.13, p=0.04), but not rs2073617 polymorphism. The G-C haplotype frequency of rs2073618-rs2073617 in OPG was significantly correlated to the increased susceptibility of peri-implantitis (OR=2.27, 95% CI=1.20-4.30).  CONCLUSIONS OPG rs2073618 polymorphism may be related to the risk of peri-implantitis, but not rs2073617. Moreover, haplotype is also a non-ignorable risk factor.

  20. Association of RAGE gene polymorphisms with sporadic Parkinson's disease in Chinese Han population.

    Science.gov (United States)

    Gao, Jing; Teng, Jijun; Liu, Hongxin; Han, Xun; Chen, Biao; Xie, Anmu

    2014-01-24

    Previous studies have corroborated receptor for advanced glycation end-products (RAGE) ablation had a protective effect on nigral dopaminergic neurons in the MPTP model of Parkinson's disease (PD). Genetic variation of RAGE gene may be associated with the development of onset of sporadic PD. The present study aimed to explore the possible association of RAGE gene polymorphisms namely -374T/A,-429T/C, and G82S with PD. A total of 285 PD patients and 285 healthy-matched individuals in Chinese Han population were enrolled. Genotype analyses were performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Only the -429T/C polymorphism denoted a significant difference between PD patients and controls (P=0.015) of the three examined single nucleotide polymorphisms (SNPs). Our data also revealed that -429C allele carriers seem to have a decreased risk of PD (OR=0.617, P=0.007). Moreover, there were significant differences in genotype distribution in female PD group and its healthy-matched control subgroup (P=0.014), as well as between late-onset PD (LOPD) and the controls subgroup (P=0.016). However, for -374T/A and 82GS polymorphisms, there was no significant difference in the genotype and allele frequencies between PD patients and the controls, as well as gender- and age-related differences. Our present findings indicate that the RAGE -429T/C polymorphism may be associated with the susceptibility of PD and the CC genotype of -429T/C may be a protective factor for PD in Chinese Han population. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. Glycan Biomarkers for Rheumatoid Arthritis and Its Remission Status in Han Chinese Patients.

    Science.gov (United States)

    Sebastian, Andrea; Alzain, Mohamed Ali; Asweto, Collins Otieno; Song, Haicheng; Cui, Liufu; Yu, Xinwei; Ge, Siqi; Dong, Hao; Rao, Ping; Wang, Hao; Fang, Honghong; Gao, Qing; Zhang, Jie; He, Dian; Guo, Xiuhua; Song, Manshu; Wang, Youxin; Wang, Wei

    2016-06-01

    Rheumatoid arthritis (RA), a systemic, chronic, and progressive inflammatory autoimmune disease, affects up to 1.0% of the world population doubling mortality rate of patients and is a major global health burden. Worrisomely, we lack robust diagnostics of RA and its remission status. Research with the next-generation biomarker technology platforms such as glycomics offers new promises in this context. We report here a clinical case-control study comprising 128 patients suffering from chronic RA (80.22% in remission, 19.78% active clinically) and 195 gender- and age-matched controls, with a view to the putative glycan biomarkers of RA as well as its activity or remission status in Han Chinese RA patients. Hydrophilic interaction liquid chromatography-ultra-performance liquid chromatography (HILIC-UPLC) was used for the analysis of IgG glycans. The regression model identified the glycans that predict RA status, while a receiver operating characteristic (ROC) curve analysis validated the sensitivity and prediction power. Among the total 24 glycan peaks (GP1-GP24), ROC analysis showed only GP1 prediction to be highly sensitive with an area under the curve (AUC) = 0.881. Even though GP21 and GP22 could predict active status among the RA cases (p < 0.05), they had lower sensitivity of prediction with an AUC = 0.658. Taken together, these observations suggest that GP1 might have potential as a putative biomarker for RA in the Han Chinese population, while the change in IgG glycosylation shows association with the RA active and remission states. To the best of our knowledge, this is the first glycomics study with respect to disease activity and remission states in RA.

  2. [The polymorphism of ten STR loci in Chinese Han population in Chengdu].

    Science.gov (United States)

    Luo, Hao; Yan, Jing; Zhang, Lin; Liao, Miao; Li, Ying-Bi; Hou, Yi-Ping; Wu, Jin

    2009-04-01

    To obtain data of polymorphism distribution of 10 short tandem repeat (STR) D1S2145, D3S2433, D5S1507, D5S2502, D8S2319, D9S926, D16S767, D17S2181, GATA140E03, GATA196B10 in Chinese Han population in Chengdu and to evaluate their usefulness in the field of forensic science and their species specificity. DNA of 100 unrelated individuals of Chengdu Han population was extracted with Chelex method, amplified by PCR, then typed with silver staining after polyacrylamide gel electrophoresis(PAGE). Ten different animals were selected as the controls in this study for evaluating the species specificity of the ten STR loci. In the ten STR loci of Chengdu Han population, 6, 5, 8, 5, 6, 7, 7, 5, 7 and 7 alleles were found, respectively. 17, 14, 28, 15, 16, 18, 15, 14, 19 and 21 genotypes were observed in the ten loci, respectively. The allele and genotype frequency distributions of the ten loci were detected no deviation from the Hardy-Weinberg law of equilibrium. By comparison with the data from 10 different animals, the species specificity of D3S2433, D5S1507, D5S2502, D8S2319 and GATA196B10 was good, but part of animals had amplification product at typing field of the other loci. The 10 STR loci mentioned above are highly polymorphic and can be used in the forensic personal identification and paternity testing.

  3. [Studies on the CTA/CTG trinucleotide repeats of ATXN8OS gene in Chinese Hans].

    Science.gov (United States)

    Wang, Junling; Zhang, Shen; Xu, Qian; Li, Xiaohui; Song, Xingwang; Jiang, Hong; Shen, Lu; Yan, Xinxiang; Pan, Qian; Xia, Kun; Tang, Beisha

    2008-10-01

    To study the normal range of (CTA/CTG)n repeats of ATXN8OS gene in Chinese Hans, and the frequency of ATXN8OS (CTA/CTG)n repeat expansion in spinocerebellar ataxia(SCA) patients in Mainland China. The (CTA/CTG)n repeats of ATXN8OS gene were detected using fluorescence-PCR, 8% denaturing polyacrylamide gel and capillary electrophoresis technique in 132 SCA patients in whom CAG expansion at the SCA1, SCA2, SCA3, SCA6, SCA7, SCA12, SCA17 and dentatorubral-pallidoluysian atrophy(DRPLA) loci has been excluded, and 261 healthy controls. There were no obvious abnormal changes of the (CTA/CTG)n repeats of ATXN8OS gene in the 132 SCA patients. Thirty-five SCA patients were homozygotes (26.5%), and the range of CTA/CTG repeat number was 17 to 47 (24.20+/-4.57), among which 18 repeats appeared most frequently. In 261 normal controls, 70 were homozygotes (26.8%), and the range of the CTA/CTG repeat number was from 12 to 43 (24.04+/-4.53), among which 18 repeats was the most frequent. SCA8 is a rare subtype of SCA in Mainland China. The low prevalence of SCA8 seems to be correlated with the low frequency of large (CTA/CTG)n copy number alleles in Chinese population.

  4. The Association of IL-12b Polymorphisms with Systemic Lupus Erythematosus in Chinese Han Population

    Science.gov (United States)

    Shao, Yong; Zhang, Jie; Chen, Yuewen; Wu, Qi; Guan, Ming; Yu, Bo; Wan, Jun; Zhang, Wei

    2012-01-01

    Background. Systemic lupus erythematosus (SLE) is a complex immune disease. The genetic variation in the IL-12b gene was found to associate with SLE in Caucasian population. In this study, we examined this association in Chinese Han population by a recently developed method, unlabeled probe-based high resolution melting analysis. Methods. A total of 297 SLE patients and 351 controls were recruited. Unlabeled probe-based high resolution melting analysis (HRMA) was used in genotyping. Results. Statistically significant differences were observed in both genotype and allele frequencies for rs6887695 in the SLE patients as compared with the controls. Minor allele (C) of rs6887695 (P = 0.031, OR 0.78, [95% CI 0.63-0.98]) was found to be protective against SLE. The association of SNP rs6887695 with the diagnostic criteria of SLE was also examined. Minor allele (C) exerts protective effect on the incidence of arthritis (P = 0.013, OR = 0.65, 95% CI = 0.47-0.92) and abnormalities of antinuclear antibody (P = 0.022, OR = 0.68, 95% CI = 0.49–0.95). IL-12b SNPs were irrelevant to other diagnostic criteria of SLE. Summary. Polymorphisms of rs6887695 in IL-12b gene were associated with disease risk, as well as arthritis and antinuclear antibody synthesis, of systemic lupus erythematosus in Chinese population. PMID:22666261

  5. Han ethnicity-specific type 2 diabetic treatment from traditional Chinese medicine?

    Science.gov (United States)

    Chen, Kuan-Chung; Chang, Su-Sen; Tsai, Fuu-Jen; Chen, Calvin Yu-Chian

    2013-01-01

    Insulin-degrading enzyme (IDE) gene is one of the type 2 diabetes mellitus susceptibility genes specific to the Han Chinese population. IDE, a zinc-metalloendopeptidase, is a potential target for controlling insulin degradation. Potential lead compounds for IDE inhibition were identified from traditional Chinese medicine (TCM) through virtual screening and evaluation of their pharmacokinetic properties of absorption, distribution, metabolism, excretion, and toxicity. Molecular dynamics (MD) simulation was performed to validate the stability of complexes from docking simulation. The top three TCM compounds, dihydrocaffeic acid, isopraeroside IV, and scopolin, formed stable H-bond interactions with key residue Asn139, and were linked to active pocket residues His108, His112, and Glu189 through zinc. Torsion angle trajectories also indicated some stable interactions for each ligand with IDE. Molecular level analysis revealed that the TCM candidates might affect IDE through competitive binding to the active site and steric hindrance. Structural feature analysis reveals that high amounts of hydroxyl groups and carboxylic moieties contribute to anchor the ligand within the complex. Hence, we suggest the top three TCM compounds as potential inhibitor leads against IDE protein to control insulin degradation for type 2 diabetes mellitus. An animated interactive 3D complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:29.

  6. Association study of genetic variants in eight genes/loci with type 2 diabetes in a Han Chinese population

    Directory of Open Access Journals (Sweden)

    Ma Shi

    2010-06-01

    Full Text Available Abstract Background At least twenty genes/loci were shown to be associated with type 2diabetes in European original populations. Five of these genes were shown to be associated with type 2 diabetes (T2D in Chinese populations. The purpose of this study was to replicate the association of genetic vairants in the eight diabetes-related genes/loci with type 2 diabetes in a Han Chinese cohort from western part of China. Nineteen single nucleotide polymorphisms (SNPs from the eight genes/loci including TCF7L2, HHEX, CDKAL1, SLC30A8, PPARG, IGF2BP2, KCNJ11, and CDKN2A/CDKN2B were genotyped in 1,529 cases and 1,439 controls in a Han Chinese population using the ABI SNaPshot method. The meta-analysis of the association between rs7903146 in TCF7L2 gene and T2D in the Han Chinese was performed. Results Among the eight genes/loci examined, we found that four were significantly associated with T2D. Although previous studies showed that the association between the SNP rs7903146 in the TCF7L2 gene and T2D was controversial within the Han Chinese population, we have confirmed the significant association between the SNP rs7903146 in the TCF7L2 gene and T2D in both this study and the meta-analysis in the population. In addition, we also confirmed that three SNPs (rs1111875, rs7923837 and rs5015480 in HHEX , one SNP (rs10946398 in CDKAL1, and three SNPs (rs13266634, rs3802177 and rs11558471 in SLC30A8 were significantly associated with T2D in the population being studied. Conclusions We demonstrated that the variants in TCF7L2, CDKAL1, HHEX, and SLC30A8 genes are associated with T2D in a Han Chinese population.

  7. Cyclooxygenase-2 -765 G/C polymorphisms and susceptibility to hepatitis B-related liver cancer in Han Chinese population.

    Science.gov (United States)

    He, Jianhong; Zhang, Quanbao; Ren, Zhijian; Li, Yumin; Li, Xun; Zhou, Wence; Zhang, Hui; Meng, Wenbo; Yan, Jun; He, Wenting

    2012-04-01

    To investigate the relationship of cyclooxygenase-2 (COX-2) polymorphisms [COX-2 -765 G/C (rs 20417)] and susceptibility to hepatitis B-related liver cancer in Han Chinese population. The polymorphisms of COX-2 -765 G/C was detected by polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) in 300 patients with hepatitis B, 300 patients with cirrhosis, 300 patients with primary liver carcinoma and 300 health controls. The COX-2 -765 G/C genotypes were GG, GC and CC. There frequencies in the hepatitis B patients were 80.33, 17.67 and 2.00%; in the cirrhosis patients were 77.67, 18.00 and 4.33%; in the patients with primary liver carcinoma were 65.67, 28.33 and 6.00% and in the heathy controls were 87.00, 12.33 and 0.67%, respectively, COX-2 -765 C allele carriers had an increased risk of hepatitis B-related liver cancer. COX-2 -765 C allele carriers having drinking history or family history of liver cancer had higher risk for HCC. COX-2 -765 C allele genotype, drinking history and family history of liver cancer may increase the susceptibility to hepatitis B-related liver cancer in Gansu province, China.

  8. Association of pregnancy-associated plasma protein-A gene polymorphism with ischemic stroke in northern Chinese Han population.

    Science.gov (United States)

    Zhu, Ruixia; Liu, Xu; He, Zhiyi

    2014-02-01

    The pregnancy-associated plasma protein-A (PAPP-A), belonging to the metalloproteinase superfamily, plays an important role in destabilization of atherosclerotic plaques. The aim of this study is to evaluate whether PAPP-A gene polymorphism is associated with the risk of ischemic stroke (IS) in northern Chinese Han populations. A total of 368 patients with IS and 374 aged-matched healthy controls in a Chinese Han population were included in the case-control study. The single-nucleotide polymorphism (SNP) IVS6+95 (rs13290387) in the PAPP-A gene was analyzed by the polymerase chain reaction-ligation detection reaction (PCR-LDR) method. Compared with the GG+CG genotype, the frequencies of the CC genotype of IVS6+95 (rs13290387) in the patients with IS were significantly higher than those in the controls (P  =  0·026). After adjusting the confounding risk factors of IS (age, gender, smoking, alcohol drinking, hypertension, diabetes mellitus, and hyperlipidemia) by the multivariate logistic analysis, this significant correlation still remained (P  =  0·010). The CC genotype of IVS6+95 (rs13290387) was associated with increased incidence of IS in northern Chinese Han populations. This is an initial study to indicate that PAPP-A (rs13290387) might contribute to IS susceptibility in northern Chinese Han populations.

  9. The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

    Science.gov (United States)

    Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

    2014-11-01

    Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

  10. PDCD1 genes may protect against extraocular manifestations in Chinese Han patients with Vogt-Koyanagi-Harada syndrome

    NARCIS (Netherlands)

    Meng, Q.L.; Liu, X.L.; Yang, P.Z.; Hou, S.P.; Du, L.P.; Zhou, H.Y.; Kijlstra, A.

    2009-01-01

    Purpose: To analyze the potential association of programmed cell death 1 (PDCD1) with Vogt-Koyanagi-Harada (VKH) syndrome in a Chinese Han population. Methods: Three single nucleotide polymorphism (SNPs), PD-1.3G/A, PD-1.5C/T, and PD-1.6G/A, were genotyped in 247 VKH patients and 289 age-, sex-, and

  11. Analysis of the MRPL3, DNAJC13 and OFCC1 variants in Chinese Han patients with TS-CTD.

    Science.gov (United States)

    Guo, Yi; Deng, Xiong; Zhang, Jie; Su, Linyan; Xu, Hongbo; Luo, Ziqiang; Deng, Hao

    2012-05-23

    Tourette syndrome/chronic tic phenotype (TS-CTD) is a neurological disorder manifested particularly by motor and vocal tics and associated with a variety of behavioral abnormalities. Recently, the mitochondrial ribosomal protein L3 gene (MRPL3) S75N, the DnaJ (Hsp40) homolog subfamily C member 13 gene (DNAJC13) A2057S, the orofacial cleft 1 candidate 1 gene (OFCC1) R129G and c.-5A>G variants are reported to be associated with Tourette syndrome/chronic tic phenotype (TS-CTD) in patients of European ancestry. To evaluate whether these variants are associated with TS-CTD in Chinese Han patients, we screened 132 Chinese Han patients from Mainland China. None of the 132 samples from patients with TS-CTD showed the MRPL3 S75N, DNAJC13 A2057S, OFCC1 R129G and c.-5A>G variants, and these variants probably are a rare cause of TS-CTD in a Chinese Han ethnic group. Genetic heterogeneity of TS should be considered and tests designed to detect these variants in Chinese Han ethnic group probably will not have a diagnostic utility in clinical practice. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  12. A genome-wide association study confirms previously reported loci for type 2 diabetes in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Bin Cui

    Full Text Available BACKGROUND: Genome-wide association study (GWAS has identified more than 30 loci associated with type 2 diabetes (T2D in Caucasians. However, genomic understanding of T2D in Asians, especially Han Chinese, is still limited. METHODS AND PRINCIPAL FINDINGS: A two-stage GWAS was performed in Han Chinese from Mainland China. The discovery stage included 793 T2D cases and 806 healthy controls genotyped using Illumina Human 660- and 610-Quad BeadChips; and the replication stage included two independent case-control populations (a total of 4445 T2D cases and 4458 controls genotyped using TaqMan assay. We validated the associations of KCNQ1 (rs163182, p = 2.085×10(-17, OR 1.28 and C2CD4A/B (rs1370176, p = 3.677×10(-4, OR 1.124; rs1436953, p = 7.753×10(-6, OR 1.141; rs7172432, p = 4.001×10(-5, OR 1.134 in Han Chinese. CONCLUSIONS AND SIGNIFICANCE: Our study represents the first GWAS of T2D with both discovery and replication sample sets recruited from Han Chinese men and women residing in Mainland China. We confirmed the associations of KCNQ1 and C2CD4A/B with T2D, with the latter for the first time being examined in Han Chinese. Arguably, eight more independent loci were replicated in our GWAS.

  13. [Analysis of normal pelvis morphometry of modern Chinese southern Han female and its correlation with age].

    Science.gov (United States)

    Liu, Ping; Yu, Yan-Hong; Chen, Chun-Lin; Tang, Yi-Xin; Wang, Li; Mao, Dong-Rui; Xu, Yi-Kai; Chen, Lan

    2013-07-01

    To analyze the normal pelvis morphometry of Chinese southern Han female and its correlation with age. From August 2009 to September 2011, 289 Han nationality females who received pelvis CT scan at Nanfang Hospital of Southern Medical University were eligible for the study. Their mean age was 43.5 years, with normal body development and no pelvic abnormality. The patients were divided into 3 age groups: 25 to 40 (n = 109), 41 to 50 (n = 115), and >50 years (n = 65). After constructing a three-dimensional digital model of the pelvis, the following parameters were measured, including transverse inlet diameter, posterior sagittal diameter of pelvic inlet, sagittal inlet, diagonal conjugate, biischial diameter, posterior sagittal diameter of midpelvis, sagittal midpelvic diameter, intertuberous distance, posterior sagittal diameter of outlet, angle of pubic arch, sagittal outlet, penal height, sacrum length and sacrum curvature. The relationship between all parameters and age was analyzed. (1) The posterior sagittal diameters of pelvic inlet of the 25 to 40 age group, 41 to 50 age group, >50 years age group were (53 ± 8), (51 ± 7), (48 ± 6) mm. The sagittal inlet of the three groups were (122 ± 8), (120 ± 9), (114 ± 8) mm. And the diagonal conjugate of the three groups were (135 ± 10), (132 ± 9), (127 ± 9) mm. All had significant differences among the three groups (P 0.05). (3) The intertuberous distance of the three groups were (122 ± 11), (121 ± 10), (117 ± 11) mm, and the posterior sagittal diameter of outlet of the three groups were (56 ± 9), (58 ± 8), (57 ± 9) mm. There was no significant difference among the three groups (P > 0.05) .(4) Penal height of three groups were (31 ± 3), (33 ± 3), (34 ± 3) mm, there was with significant differences (P pelvis became deeper. Mid pelvis and the pelvic outlet was almost unchanged, and showed no correlation with age.

  14. Common Variants in the TBX5 Gene Associated with Atrial Fibrillation in a Chinese Han Population.

    Science.gov (United States)

    Zhang, Rongfeng; Tian, Xiaochen; Gao, Lianjun; Li, Huihua; Yin, Xiaomeng; Dong, Yingxue; Yang, Yanzong; Xia, Yunlong

    2016-01-01

    PR interval variations have recently been associated with an increased risk of long-term atrial fibrillation (AF), heart block and all-cause mortality. Genome-wide association studies have linked the PR interval with several common variants in the TBX5 gene. Several variants in the TBX5 gene, including rs7312625 and rs883079, have been associated with AF. The purpose of this study was to determine the association of single-nucleotide polymorphisms (SNPs) in the TBX5 gene, rs7312625 and rs883079, with AF in Chinese Han patients. In this case-control association study, large cohorts of AF patients (n = 1132) and controls (n = 1206) were recruited from different hospitals. The genotyping was performed using a Rotor-Gene TM 6000 high-resolution melt system. Rs7312625, rs3825214 and rs883079 were analyzed. We found that SNP 3825214 was significantly associated with AF (P-obs = 0.002, odds ratio [OR] = 0.82), and lone AF (P-obs = 6.77x10-5, odds ratio [OR] = 0.71). SNP rs7312625 was significantly associated with lone AF (P-obs = 0.015, odds ratio [OR] = 1.27), although its association with AF was not significant. No significant association of SNP rs883079 with AF or lone AF was observed. Thus, we analyzed the interaction among these three loci. We demonstrated significant interaction among rs3825214, rs7312625 and rs883079. Four-locus risk alleles showed the highest odds ratio in combined rs3825214 and rs7312625 (P-obsSix-locus risk alleles showed the highest odds ratio in combined rs3825214, rs7312625 and rs 883079(P-obs<0.0001, odds ratio [OR] = 2.35). Significance was established with the trend test (P<0.0001). For the first time, we report the strong association of SNP rs3825214 in the TBX5 gene with AF and lone AF in a Chinese Han population. Rs7312625 was significantly associated with lone AF, and snp-snp interaction increased the risk of atrial fibrillation. Our data might provide new insights into understanding AF pathogenesis and designing novel genetic

  15. Common Variants in the TBX5 Gene Associated with Atrial Fibrillation in a Chinese Han Population.

    Directory of Open Access Journals (Sweden)

    Rongfeng Zhang

    Full Text Available PR interval variations have recently been associated with an increased risk of long-term atrial fibrillation (AF, heart block and all-cause mortality. Genome-wide association studies have linked the PR interval with several common variants in the TBX5 gene. Several variants in the TBX5 gene, including rs7312625 and rs883079, have been associated with AF. The purpose of this study was to determine the association of single-nucleotide polymorphisms (SNPs in the TBX5 gene, rs7312625 and rs883079, with AF in Chinese Han patients.In this case-control association study, large cohorts of AF patients (n = 1132 and controls (n = 1206 were recruited from different hospitals. The genotyping was performed using a Rotor-Gene TM 6000 high-resolution melt system. Rs7312625, rs3825214 and rs883079 were analyzed. We found that SNP 3825214 was significantly associated with AF (P-obs = 0.002, odds ratio [OR] = 0.82, and lone AF (P-obs = 6.77x10-5, odds ratio [OR] = 0.71. SNP rs7312625 was significantly associated with lone AF (P-obs = 0.015, odds ratio [OR] = 1.27, although its association with AF was not significant. No significant association of SNP rs883079 with AF or lone AF was observed. Thus, we analyzed the interaction among these three loci. We demonstrated significant interaction among rs3825214, rs7312625 and rs883079. Four-locus risk alleles showed the highest odds ratio in combined rs3825214 and rs7312625 (P-obs<0.0001, odds ratio [OR] = 2.21. Six-locus risk alleles showed the highest odds ratio in combined rs3825214, rs7312625 and rs 883079(P-obs<0.0001, odds ratio [OR] = 2.35. Significance was established with the trend test (P<0.0001.For the first time, we report the strong association of SNP rs3825214 in the TBX5 gene with AF and lone AF in a Chinese Han population. Rs7312625 was significantly associated with lone AF, and snp-snp interaction increased the risk of atrial fibrillation. Our data might provide new insights into understanding AF

  16. Interaction of Wnt pathway related variants with type 2 diabetes in a Chinese Han population

    Directory of Open Access Journals (Sweden)

    Jian-Bo Zhou

    2015-10-01

    Full Text Available Aims. Epistasis from gene set based on the function-related genes may confer to the susceptibility of type 2 diabetes (T2D. The Wnt pathway has been reported to play an important role in the pathogenesis of T2D. Here we applied tag SNPs to explore the association between epistasis among genes from Wnt and T2D in the Han Chinese population. Methods. Variants of fourteen genes selected from Wnt pathways were performed to analyze epistasis. Gene–gene interactions in case-control samples were identified by generalized multifactor dimensionality reduction (GMDR method. We performed a case-controlled association analysis on a total of 1,026 individual with T2D and 1,157 controls via tag SNPs in Wnt pathway. Results. In single-locus analysis, SNPs in four genes were significantly associated with T2D adjusted for multiple testing (rs7903146C in TCF7L2, p = 3.21∗10−3, OR = 1.39, 95% CI [1.31–1.47], rs12904944G in SMAD3, p = 2.51∗10−3, OR = 1.39, 95% CI [1.31–1.47], rs2273368C in WNT2B, p = 4.46∗10−3, OR = 1.23, 95% CI [1.11–1.32], rs6902123C in PPARD, p = 1.14∗10−2, OR = 1.40, 95% CI [1.32–1.48]. The haplotype TGC constructed by TCF7L2 (rs7903146, DKK1 (rs2241529 and BTRC (rs4436485 showed a significant association with T2D (OR = 0.750, 95% CI [0.579–0.972], P = 0.03. For epistasis analysis, the optimized combination was the two locus model of WNT2B rs2273368 and TCF7L2rs7903146, which had the maximum cross-validation consistency. This was 9 out of 10 for the sign test at 0.0107 level. The best combination increased the risk of T2D by 1.47 times (95% CI [1.13–1.91], p = 0.0039. Conclusions. Epistasis between TCF7L2 and WNT2B is associated with the susceptibility of T2D in a Han Chinese population. Our results were compatible with the idea of the complex nature of T2D that would have been missed using conventional tools.

  17. Common single nucleotide polymorphisms and keratoconus in the Han Chinese population.

    Science.gov (United States)

    Wang, Yani; Jin, Tianbo; Zhang, Xuehui; Wei, Wei; Cui, Yan; Geng, Tingting; Liu, Qianping; Gao, Jing; Liu, Ming; Chen, Chao; Zhang, Changning; Zhu, Xiuping

    2013-09-01

    To investigate whether the tag single nucleotide polymorphisms (tSNPs) in VSX1, COL4A3, COL4A4, IL1A and IL1B genes were associated with keratoconus (KTCN) in the Han Chinese population. Ninety-seven KTCN patients and 101 healthy controls were enrolled in this study. All cases were diagnosed on the basis of clinical examination. Twenty-one tSNPs were selected for association study in five genes. SNP genotyping was performed by Sequenom MassARRAY RS1000. Sequenom Typer 4.0 Software, PLINK, Haploview and SHEsis software platform were used to perform data management and analyses. Three tSNPs in the VSX1 gene were observed to be associated with KTCN risk at a 5% level by χ(2) test (rs56157240 and rs12480307, p = 0.0499, OR: 6.42, 95% CI: 0.77-53.78; rs6050307, p = 1.22 × 10(-7), OR: 0.05, 95% CI: 0.01-0.23). Rs2071376 in the IL1A gene was also associated with KTCN (p = 0.0487, OR: 1.51, 95% CI: 1.00-2.26). Three haplotypes in the VSX1 gene were found to be associated with risk of KTCN (p < 0.05). Our findings confirmed previous reports that polymorphisms of VSX1 and IL1A genes were associated with risk of KTCN in the Chinese population, suggesting an important determinant of KTCN development by VSX1 and IL1A genes.

  18. Genetic variation of ITGB3 is associated with asthma in Chinese Han children.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available Previous studies have demonstrated that integrins are involved in the aetiology of asthma. Several single-nucleotide polymorphisms (SNPs in the integrin β3 (ITGB3 gene are significantly associated with asthma in Western populations. Given the important roles of environmental exposures in the development of asthma, we evaluated the associations between six SNPs in ITGB3 and asthma in Chinese Han children. A total of 321 unrelated Chinese children with asthma and 315 healthy children were recruited for the study. SNP genotyping was performed by high-resolution melting analysis (HRM. The selected SNPs were well genotyped by HRM, and SNP rs3809865 in the 3' untranslated region (3'UTR of ITGB3 was found to be strongly associated with asthma (adjusted p = 0.004. The minor allele of rs3809865 showed a protective effect against asthma (OR: 0.59; 95% CI: 0.43-0.8. The seed regions of two miRNAs (hsa-mir-124 and hsa-mir-506 were predicted to bind to the sequence containing rs3809865 by TargetScan and PITA. Luciferase reporter assays demonstrated that the T allele of rs3809865 was more efficiently targeted by hsa-mir-124 than was the A allele, which suggested that rs3809865 could affect the binding of hsa-mir-124 to ITGB3. Furthermore, the transfection of A549 cells with hsa-mir-124 resulted in the downregulation of ITGB3 expression. Our results revealed that rs3809865 was significantly associated with asthma due to its effect on the binding of hsa-mir-124 to ITGB3.

  19. Vitamin D receptor gene polymorphism and its association with Parkinson's disease in Chinese Han population.

    Science.gov (United States)

    Han, Xun; Xue, Li; Li, Yongsheng; Chen, Biao; Xie, Anmu

    2012-09-06

    Vitamin D plays an important role in neurodegenerative disorders as a crucial neuro-immunomodulator, and accumulating data have provided evidence for that vitamin D receptor (VDR) gene is a candidate gene for susceptibility to Parkinson's disease (PD). In this study, we performed a case-control study to demonstrate whether the risk for the development of onset of sporadic PD might be influenced by VDR gene polymorphisms in a Chinese cohort. Two hundred and sixty PD patients and 282 matched-healthy controls were genotyped for two representative single nucleotide polymorphisms (SNPs) in VDR gene (FokI C/T and BsmI G/A) by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis in. Results from our study revealed that FokI C allele carriers were likely to associate with an increased risk of PD (P=0.004) as well as early-onset PD (EOPD) (P=0.010). Moreover, the frequency of FokI C allele was significantly increased in PD group and late-onset PD (LOPD) group relative to the control groups respectively (P=0.023 and P=0.033, respectively). For BsmI polymorphisms, no significant difference in genotype or allele distribution was found between PD patients and the controls, as well as gender- and age-related differences between PD patients and the controls subgroup. This study demonstrated a possible association between the VDR FokI T/C polymorphism and PD, indicating that VDR polymorphisms may well change genetic susceptibility to sporadic PD in a Han Chinese population. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. A sex-specific association of common variants of neuroligin genes (NLGN3 and NLGN4X with autism spectrum disorders in a Chinese Han cohort

    Directory of Open Access Journals (Sweden)

    Li Hui

    2011-05-01

    Full Text Available Abstract Background Synaptic genes, NLGN3 and NLGN4X, two homologous members of the neuroligin family, have been supposed as predisposition loci for autism spectrum disorders (ASDs, and defects of these two genes have been identified in a small fraction of individuals with ASDs. But no such rare variant in these two genes has as yet been adequately replicated in Chinese population and no common variant has been further investigated to be associated with ASDs. Methods 7 known ASDs-related rare variants in NLGN3 and NLGN4X genes were screened for replication of the initial findings and 12 intronic tagging single nucleotide polymorphisms (SNPs were genotyped for case-control association analysis in a total of 229 ASDs cases and 184 control individuals in a Chinese Han cohort, using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF mass spectrometry. Results We found that a common intronic variant, SNP rs4844285 in NLGN3 gene, and a specific 3-marker haplotype XA-XG-XT (rs11795613-rs4844285-rs4844286 containing this individual SNP were associated with ASDs and showed a male bias, even after correction for multiple testing (SNP allele: P = 0.048, haplotype:P = 0.032. Simultaneously, none of these 7 known rare mutation of NLGN3 and NLGN4X genes was identified, neither in our patients with ASDs nor controls, giving further evidence that these known rare variants might be not enriched in Chinese Han cohort. Conclusion The present study provides initial evidence that a common variant in NLGN3 gene may play a role in the etiology of ASDs among affected males in Chinese Han population, and further supports the hypothesis that defect of synapse might involvement in the pathophysiology of ASDs.

  1. Identification of Tau and SOD1 gene mutation in a small Chinese Han pedigree of adult amyotrophic lateral sclerosis.

    Science.gov (United States)

    Xu, Renshi; Shao, Bei; Wu, Chengsi; Yang, Yunzhu; Wang, Hanmin; Yang, Rongwei; Zhang, Xiong; Yi, Juan; Liu, Jingjing

    2013-01-01

    We report the clinical profile, and a brief investigation of SOD1 and Tau gene mutation from a small Chinese Han pedigree of adults with amyotrophic lateral sclerosis (ALS), which consisted of 32 familial members with 6 affected individuals spanning five generations, and presenting autosomal dominant genetic mode. The mean age of onset was 36.6 ± 15.9 years, and disease duration was 6 months to more than 5 years, the average survival was 16.1 ± 8.2 months. There were 5 patients with an early disease onset, rapid progressive course and short survival, and 1 patient with late onset, slow progressive course and long survival in the kindred. ALS patients began to suffer with weakness and muscle atrophy in one side of a lower extremity, which then spread to the upper extremity, the opposite side and bulbar muscles. All patients had spinal onset type. Muscle stretch reflexes were absent or weak in the upper limbs and accentuation in the lower limbs; pathological signs in the lower limbs were positive. Electromyography disclosed ongoing denervation muscle potentials in the four extremities. Brain and spinal MRI did not show any abnormal signal. A 5 exons mutation of SOD1 in all affected individuals was identified using SSCP. Polymorphisms of partial risk regions in 3',5' UTR, and in introns 9, 10, 11, 12 of the Tau gene in the affected and normal family members and in 70 healthy controls were examined by DNA sequencing. Routine exons mutation of SOD1 was not detected, but one single nucleotide polymorphism of A to G at 138278 at 3' UTR of the Tau gene was shown to significantly over-express in fALS familial members.

  2. Genetic variation of FYN contributes to the molecular mechanisms of coping styles in healthy Chinese-Han participants.

    Science.gov (United States)

    Zhao, Xiaofeng; Li, Jingying; Huang, Yinglin; Jin, Qiu; Ma, Hui; Wang, Yuan; Wu, Lijuan; Li, Jun; Zhu, Gang

    2013-10-01

    Genetic factors can influence specific human coping styles. Polymorphisms in the Src family tyrosine kinase FYN gene have been associated with several personality traits, but no studies have examined the possible relationship between FYN alleles and coping styles. To this end, we examined the association between three single nucleotide polymorphisms of FYN (rs706895, rs3730353, and rs6916861) and coping styles as measured by the Simplified Coping Style Questionnaire in 488 healthy Chinese-Han individuals. In the total sample population, there were no significant differences in the scores for active coping and passive coping among the genotypes of these three polymorphisms. In sex-specific analyses, however, both rs3730353 and rs6916861 polymorphisms showed a significant relationship with passive coping scores in female participants (rs3730353: χ(2)=8.08, P=0.018; rs6916861: χ(2)=7.78, P=0.020). Our results provided suggestive evidence that the FYN gene contributes toward the variance in human coping styles.

  3. Mitochondrial DNA copy number, but not haplogroup is associated with keratoconus in Han Chinese population.

    Science.gov (United States)

    Hao, Xiao-Dan; Chen, Peng; Wang, Ye; Li, Su-Xia; Xie, Li-Xin

    2015-03-01

    Oxidative stress may play a role in the pathogenesis of keratoconus (KC). Mitochondrial DNA (mtDNA) is closely related to mitochondrion function, and variations may affect the generation of reactive oxygen species (ROS) and be involved in the pathogenesis of KC. To test whether mtDNA background and copy number confer genetic susceptibility to KC in the Han Chinese population, we performed this association study. We analyzed mtDNA sequence variations in 210 KC patients and 309 matched individuals from China, and classified each subject by haplogroup. Mitochondrial DNA copy number was measured in a subset of these subjects (193 patients and 103 controls). Comparison of matrilineal components of the cases and control populations revealed no significant difference. However, measurement of mtDNA copy number showed that KC patients had significantly lower mtDNA copy numbers than controls (P = 0.0002), even when age, gender, and mtDNA background were considered. Our results suggest that mtDNA copy number, but not haplogroup, is associated with keratoconus, and may contribute to its pathogenesis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Association between vitamin D receptor gene polymorphism and ankylosing spondylitis in Han Chinese.

    Science.gov (United States)

    Zhang, Pingping; Li, Qiuxia; Qi, Jun; Lv, Qing; Zheng, Xuqi; Wu, Xinyu; Gu, Jieruo

    2017-10-01

    To investigate whether vitamin D receptor (VDR) gene polymorphisms confer susceptibility to aankylosing spondylitis (AS) and study its polymorphisms in Han Chinese. We screened single nucleotide polymorphisms (SNPs) in the VDR region through genome-wide genotyping chips in AS cases and healthy controls, then used the exome sequencing result to analyze all the potential AS-associated SNPs in the VDR gene. Thirty-two SNPs were found in the VDR gene in the genome-wide genotyping chips and the logistic regression result showed no significant difference between AS cases and controls. A total of 46 SNPs in the VDR region were genotyped through exome sequencing, including four functional SNPs (rs731236 [TaqI], rs2228570 [FokI], rs7975232 [ApaI], rs1544410 [BsmI]) and two newly discovered SNPs (12:48259222 and 12:48276730). To note, rs731236 and rs2228570 locate in the exons of VDR, which cause synonymous and missense mutation. The association test showed there was no significant difference between AS cases and controls in the allele frequency distribution, but haplotype analysis of rs11168266-rs11168267 show nominal significance (P = 0.01268). Our preliminary study indicates the haplotypes (TG) of rs11168266-rs11168267 in the VDR gene confers susceptibility to AS, which is worth further research. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  5. Frequency distribution of apolipoprotein e genotypes in elderly han chinese population and relationship with senile dementia.

    Science.gov (United States)

    Huang, W; Chen, M; Zhang, Y; Zhao, P; Yao, G; Zhou, H

    2014-12-23

    The aim of the study was to determine the relationship between Apo Eε4 genotype and senile dementia (SD) by analyzing the Apo E allelic frequency distributions among the elderly Han Chinese population. For this purpose, a total of 316 Chongqing residents, aged ≥60yrs, were classified as SD or control groups following the criteria of National Institute of Neurological and Communicative Disorders and Stroke--Alzheimer's Disease and Related Disorders Association. Genomic DNA was isolated from the peripheral blood lymphocytes and exon 4 of the ApoE gene with polymorphism sites was amplified by PCR and genotypes determined by restriction fragment length polymorphism (RFLP). We found that the most prevalent genotype was Apo Eε3/3, followed in order by Apo Eε3/4 and Apo Eε2/2. The estimated ApoE allelic frequencies in individuals with SD were 0.095, 0.560, and 0.345 for ε2, ε3, and ε4, respectively. In controls, the corresponding Apo E allelic frequencies were 0.146, 0.699, and 0.155. The percentage of ε4 allele carriers in SD group was significantly higher than that in control group (Psenile dementia.

  6. Common variants of OPA1 conferring genetic susceptibility to leprosy in Han Chinese from Southwest China.

    Science.gov (United States)

    Xiang, Yang-Lin; Zhang, Deng-Feng; Wang, Dong; Li, Yu-Ye; Yao, Yong-Gang

    2015-11-01

    Leprosy is an ancient chronic infection caused by Mycobacterium leprae. Onset of leprosy was highly affected by host nutritional condition and energy production, (partially) due to genomic loss and parasitic life style of M. leprae. The optic atrophy 1 (OPA1) gene plays an essential role in mitochondria, which function in cellular energy supply and innate immunity. To investigate the potential involvement of OPA1 in leprosy. We analyzed 7 common genetic variants of OPA1 in 1110 Han Chinese subjects with and without leprosy, followed by mRNA expression profiling and protein-protein interaction (PPI) network analysis. We observed positive associations between OPA1 variants rs9838374 (Pgenotypic=0.003) and rs414237 (Pgenotypic=0.002) with lepromatous leprosy. expression quantitative trait loci (eQTL) analysis showed that the leprosy-related risk allele C of rs414237 is correlated with lower OPA1 mRNA expression level. Indeed, we identified a decrease of OPA1 mRNA expression in both with patients and cellular model of leprosy. In addition, the PPI analysis showed that OPA1 protein was actively involved in the interaction network of M. leprae induced differentially expressed genes. Our results indicated that OPA1 variants confer risk of leprosy and may affect OPA1 expression, mitochondrial function and antimicrobial pathways. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Association between ADAMTS-4 gene polymorphism and lumbar disc degeneration in Chinese Han population.

    Science.gov (United States)

    Liu, Sen; Wu, Nan; Liu, Jiaqi; Liu, Hao; Su, Xinlin; Liu, Zhenlei; Zuo, Yuzhi; Chen, Weisheng; Liu, Gang; Chen, Yixin; Ming, Yue; Yuan, Tangmi; Li, Xiao; Chen, Jun; Xia, Zenan; Wang, Shengru; Chen, Jia; Liu, Tao; Yang, Xu; Ma, Yufen; Zhang, Jianguo; Shen, Jianxiong; Li, Shugang; Wang, Yipeng; Zhao, Hong; Yu, Keyi; Zhao, Yu; Huang, Shishu; Weng, Xisheng; Qiu, Guixing; Wan, Chao; Zhou, Guangqian; Wu, Zhihong

    2016-05-01

    Low back pain (LBP) is a common health problem and many LBP are caused by lumbar disc degeneration (LDD). ADAMTS-4 (a disintegrin and metalloprotease with thrombospondin motifs-4), also known as aggrecanse-1, plays a core role in degeneration of extracellular matrix in LDD. To investigate the association between ADAMTS-4 genetic polymorphism and LDD, we genotyped SNPs in and around ADAMTS-4. We recruited 482 sporadic cases of LDD and 496 healthy controls from Chinese Han population. Five SNPs were selected and phenotyped by the Sequenom MassARRAY system. Allelic, genotypic, and haplotypic association was performed. Rs4233367 (c.1877 C>T), which located in exon of ADAMTS-4 showed significant association with LDD. The T allele conferred a lower risk of LDD with an OR of 0.69 and TT genotype is at nearly one-fifth of the risk compared to CC genotype. Other tested SNPs didn't show significant difference between the case and control groups. The SNP rs4233367 in the exon of ADAMTS-4 gene may be associated with lumbar disc degeneration. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:860-864, 2016. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  8. The common variant rs11646213 is associated with preeclampsia in Han Chinese women.

    Directory of Open Access Journals (Sweden)

    Ji-peng Wan

    Full Text Available BACKGROUND: Preeclampsia, characterized by hypertension and proteinuria, is a multifactorial disease caused by complex interactions between environmental and genetic factors. A recent genome-wide association study of blood pressure reported an association between hypertension and rs11646213. This study evaluated the association between preeclampsia and rs11646213. METHODS: A total of 454 cases and 460 controls were recruited to participate in this study. The single nucleotide polymorphism (SNP rs11646213 was genotyped by polymerase chain reaction (PCR and direct sequencing. RESULTS: The allele frequency of rs11646213 was significantly different between the preeclampsia and control groups (P = 0.017, OR = 1.36, 95% CI = 1.06-1.76. Differences were particularly significant in the severe preeclampsia subgroup (P = 0.002, OR = 1.54, 95% CI = 1.17-2.03 and the early-onset preeclampsia subgroup (P = 0.004, OR = 1.57, 95% CI = 1.16-2.13. Genotyping analysis showed that the T allele of rs11646213 could confer a risk for preeclampsia, severe preeclampsia and early-onset preeclampsia. CONCLUSIONS: Rs11646213 upstream of the CDH13 gene is associated with preeclampsia in Han Chinese women.

  9. Affect recognition across manic and euthymic phases of bipolar disorder in Han-Chinese patients.

    Science.gov (United States)

    Pan, Yi-Ju; Tseng, Huai-Hsuan; Liu, Shi-Kai

    2013-11-01

    Patients with bipolar disorder (BD) have affect recognition deficits. Whether affect recognition deficits constitute a state or trait marker of BD has great etiopathological significance. The current study aims to explore the interrelationships between affect recognition and basic neurocognitive functions for patients with BD across different mood states, using the Diagnostic Analysis of Non-Verbal Accuracy-2, Taiwanese version (DANVA-2-TW) as the index measure for affect recognition. To our knowledge, this is the first study examining affect recognition deficits of BPD across mood states in the Han Chinese population. Twenty-nine manic patients, 16 remitted patients with BD, and 40 control subjects are included in the study. Distinct association patterns between affect recognition and neurocognitive functions are demonstrated for patients with BD and control subjects, implicating alternations in emotion associated neurocognitive processing. Compared to control subjects, manic patients but not remitted subjects perform significantly worse in the recognition of negative emotions as a whole and specifically anger, after adjusting for differences in general intellectual ability and basic neurocognitive functions. Affect recognition deficit may be a relatively independent impairment in BD rather than consequences arising from deficits in other basic neurocognition. The impairments of manic patients in the recognition of negative emotions, specifically anger, may further our understanding of core clinical psychopathology of BD and have implications in treating bipolar patients across distinct mood phases. © 2013 Elsevier B.V. All rights reserved.

  10. Genome-wide association analysis identifies three new risk loci for gout arthritis in Han Chinese

    Science.gov (United States)

    Li, Changgui; Li, Zhiqiang; Liu, Shiguo; Wang, Can; Han, Lin; Cui, Lingling; Zhou, Jingguo; Zou, Hejian; Liu, Zhen; Chen, Jianhua; Cheng, Xiaoyu; Zhou, Zhaowei; Ding, Chengcheng; Wang, Meng; Chen, Tong; Cui, Ying; He, Hongmei; Zhang, Keke; Yin, Congcong; Wang, Yunlong; Xing, Shichao; Li, Baojie; Ji, Jue; Jia, Zhaotong; Ma, Lidan; Niu, Jiapeng; Xin, Ying; Liu, Tian; Chu, Nan; Yu, Qing; Ren, Wei; Wang, Xuefeng; Zhang, Aiqing; Sun, Yuping; Wang, Haili; Lu, Jie; Li, Yuanyuan; Qing, Yufeng; Chen, Gang; Wang, Yangang; Zhou, Li; Niu, Haitao; Liang, Jun; Dong, Qian; Li, Xinde; Mi, Qing-Sheng; Shi, Yongyong

    2015-01-01

    Gout is one of the most common types of inflammatory arthritis, caused by the deposition of monosodium urate crystals in and around the joints. Previous genome-wide association studies (GWASs) have identified many genetic loci associated with raised serum urate concentrations. However, hyperuricemia alone is not sufficient for the development of gout arthritis. Here we conduct a multistage GWAS in Han Chinese using 4,275 male gout patients and 6,272 normal male controls (1,255 cases and 1,848 controls were genome-wide genotyped), with an additional 1,644 hyperuricemic controls. We discover three new risk loci, 17q23.2 (rs11653176, P=1.36 × 10−13, BCAS3), 9p24.2 (rs12236871, P=1.48 × 10−10, RFX3) and 11p15.5 (rs179785, P=1.28 × 10−8, KCNQ1), which contain inflammatory candidate genes. Our results suggest that these loci are most likely related to the progression from hyperuricemia to inflammatory gout, which will provide new insights into the pathogenesis of gout arthritis. PMID:25967671

  11. The NVL gene confers risk for both major depressive disorder and schizophrenia in the Han Chinese population.

    Science.gov (United States)

    Wang, Meng; Chen, Jianhua; He, Kuanjun; Wang, Qingzhong; Li, Zhiqiang; Shen, Jiawei; Wen, Zujia; Song, Zhijian; Xu, Yifeng; Shi, Yongyong

    2015-10-01

    NVL (nuclear VCP (valosin containing protein)/p97-Like), a member of the AAA-ATPase (ATPases associated with various cellular activities) family, encodes a novel hTERT (human telomerase reverse transcriptase)-interacting protein NVL2 which is a telomerase component essential for holoenzyme assembly. Previous researches have reported the impacts of telomerase activity on mental illness and the potential association between NVL and major depressive disorder. To validate the susceptibility of NVL to major depressive disorder, and to investigate the overlapping risk conferred by NVL for both major depressive disorder and schizophrenia, we analyzed 9 tag single nucleotide polymorphisms (tag SNPs) using TaqMan® technology, in 1045 major depressive disorder patients, 1235 schizophrenia patients and 1235 normal controls of Han Chinese origin. We found that rs10916583 (P(allele) = 0.020, P(genotype) = 0.028, OR = 1.156) and rs16846649 (adjusted P(allele) = 0.014, P(genotype) = 0.007, OR = 0.718) were associated with major depressive disorder, while rs10916583 (adjusted P(allele) = 1.08E-02, OR = 1.213), rs16846649 (adjusted P(allele) = 7.40E-06, adjusted P(genotype) = 8.07E-05, OR = 0.598) and rs10799541 (adjusted P(allele) = 8.10E-03, adjusted P(genotype) = 0.049, OR= 0.826) showed statistically significant association with schizophrenia after Bonferroni correction. Furthermore, rs10916583 (adjusted P(allele) = 9.00E-03, adjusted P(genotype) = 3.15E-02, OR = 1.187) and rs16846649 (adjusted P(allele) = 8.92E-06, adjusted P(genotype) = 8.84E-05, OR = 0.653) remained strongly associated with the analysis of combined cases of major depressive disorder and schizophrenia after Bonferroni correction. Our results indicated that the NVL gene may contain overlapping common genetic risk factors for major depressive disorder and schizophrenia in the Han Chinese population. The roles of NVL in telomerase biogenesis were also highlighted in psychiatric pathogenesis. The study on

  12. Mitochondrial tRNA(Ser(UCN)) variants in 2651 Han Chinese subjects with hearing loss.

    Science.gov (United States)

    Tang, Xiaowen; Zheng, Jing; Ying, Zhengbiao; Cai, Zhaoyang; Gao, Yinglong; He, Zheyun; Yu, Han; Yao, Juan; Yang, Yaling; Wang, Hui; Chen, Ye; Guan, Min-Xin

    2015-07-01

    Mutations in the mitochondrial DNA have been associated with hearing loss. However, the prevalence and spectrum of mitochondrial tRNA mutations in hearing-impaired subjects are poorly understood. In this report, we have investigated the prevalence and spectrum of mitochondrial tRNA(Ser(UCN)) mutations in a large cohort of 2651 Han Chinese subjects with hearing loss. The clinical evaluation showed that 744 subjects (432 males and 312 females) had a history of exposure to aminoglycosides and other probands exhibited nonsyndromic hearing loss. Mutational analysis of tRNA(Ser(UCN)) gene identified 9 (8 known and 1 novel) variants. The prevalence of the known deafness-associated 7511T>C, 7505T>C and 7445A>C mutations was 0.04%, 0.04% and 0.04%, respectively. Other variants were evaluated by the evolutionary conservation, allelic frequency of Chinese controls, potential structural and functional alterations and pedigree analysis. Three variants were polymorphisms, while the 7444G>A, 7471DelG and 7496A>G variants were putative deafness-associated mutations. These putative deafness-associated variants accounted for 0.68% cases of hearing-impaired subjects in this cohort. The low penetrance of hearing loss in pedigrees carrying one of these putative deafness-associated mutations indicated that the mutation(s) is necessary but itself insufficient to produce a clinical phenotype. Other genetic or environmental factor(s) may influence the phenotypic manifestation of these tRNA(Ser(UCN)) mutations. Moreover, mtDNAs in 20 probands carrying one of the putative deafness-associated mutations were widely dispersed among 8 Eastern Asian haplogroups. In particular, the occurrences of haplogroups D4a, M22, and H2 in patients carrying the deafness-associated variants were higher than those in Chinese controls. These data further support that the mitochondrial tRNA(Ser(UCN)) gene is the hot spot for mutations associated with hearing loss. Thus, our findings may provide valuable

  13. Genetic distribution and association analysis of DRD2 gene polymorphisms with major depressive disorder in the Chinese Han population.

    Science.gov (United States)

    He, Mei; Yan, Hong; Duan, Zhao-Xia; Qu, Wei; Gong, Hai-Yan; Fan, Zheng-Li; Kang, Jian-Yi; Li, Bing-Cang; Wang, Jian-Min

    2013-01-01

    Dopamine D2 receptor is involved in reward-mediating mesocorticolimbic pathways. It plays an important role in major depressive disorder (MDD). Three gene polymorphisms Taq1A, C957T and -141C ins/del, were identified in the DRD2 gene among the Western population. These variants in the DRD2 gene might be associated with the susceptibility of MDD patients through affecting the bioeffects of endogenous dopamine neurotransmission. However, little is known about their occurrence in Chinese population and their association with the susceptibility of patients with major depressive disorder. In this study, a total of 338 unrelated adult Chinese Han population, including 224 healthy volunteers and 114 patients with major depressive disorder, were recruited. DRD2 polymorphisms (Taq1A and -141C ins/del) were detected using restriction fragment length polymorphism (RFLP) analysis and the C957T were detected by sequencing directly. As a result, three polymorphisms were identified in Chinese Han population and all were common SNP. However, we could detect no evidence of genetic association between 3 markers in DRD2 and major depressive disorder in the Chinese Han population. To conclude, this result suggests that Taq1A, C957T and -141C ins/del of DRD2 gene may not be associated with major depressive disorder, also may be the sample sizes too small to allow a meaningful test.

  14. Relationship between polymorphisms in vitamin D metabolism-related genes and the risk of rickets in Han Chinese children.

    Science.gov (United States)

    Zhang, Yuling; Yang, Shufen; Liu, Ye; Ren, Lihong

    2013-09-30

    Vitamin D deficiency rickets is common in China. Genetic factors may play an important role in the susceptibility to rickets. Our study aimed to identify the relationship between three vitamin D-related genes (group specific component [GC], cytochrome P450, family 2, subfamily R, polypeptide 1 (CYP2R1), and 7-dehydrocholesterol reductase/nicotinamide-adenine dinucleotide synthetase 1 (DHCR7/NADSYN1) and rickets in Han Chinese children from northeastern China. A total of 506 Han children from northeastern China were enrolled in the current study. Twelve SNPs in three candidate genes were genotyped using the SNaPshot assay. Linear regression was used to examine the effect of 12 single-nucleotide polymorphisms (SNPs) on the risk of rickets. In our case-control cohort, six alleles of the 12 SNPs conferred a significantly increased risk of rickets in GC (rs4588 C, P = 0.003, OR: 0.583, 95% CI: 0.412-0.836; rs222020 C, P = 0.009, OR: 1.526, 95% CI: 1.117-2.0985; rs2282679 A, P = 0.010, OR: 0.636, 95% CI: 0.449-0.900; and rs2298849 C, P = 0.001, OR: 1.709, 95% CI: 1.250-2.338) and in CYP2R1 (rs10741657 G, P = 0.019, OR: 1.467, 95% CI: 1.070-2.011; and rs2060793 G, P = 0.023, OR: 0.689, 95% CI: 0.502-0.944). The results remained significant after adjustment for sex and body mass index. We further analyzed the effect of genotypes under three different genetic models. After using Bonferroni's method for multiple corrections, rs4588, rs2282679, and rs2298849 of the GC gene were significantly associated with rickets under the dominant (P =0.003 for rs4588, P =0.024 for rs2282679, and P =0.005 for rs2298849) and additive models (P = 0.006 for rs4588, P = 0.024 for rs2282679, and P = 0.005 for rs2298849). Haplotype analysis showed that the CAT haplotype of the GC gene (P = 0.005) and the GAA haplotype of the CYP2R1 gene (P = 0.026) were associated with susceptibility to rickets. This case-control study confirmed the strong effect of GC

  15. Compound heterozygous MYO7A mutations segregating Usher syndrome type 2 in a Han family.

    Science.gov (United States)

    Zong, Ling; Chen, Kaitian; Wu, Xuan; Liu, Min; Jiang, Hongyan

    2016-11-01

    Identification of rare deafness genes for inherited congenital sensorineural hearing impairment remains difficult, because a large variety of genes are implicated. In this study we applied targeted capture and next-generation sequencing to uncover the underlying gene in a three-generation Han family segregating recessive inherited hearing loss and retinitis pigmentosa. After excluding mutations in common deafness genes GJB2, SLC26A4 and the mitochondrial gene, genomic DNA of the proband of a Han family was subjected to targeted next-generation sequencing. The candidate mutations were confirmed by Sanger sequencing and subsequently analyzed with in silico tools. An unreported splice site mutation c.3924+1G > C compound with c.6028G > A in the MYO7A gene were detected to cosegregate with the phenotype in this pedigree. Both mutations, located in the evolutionarily conserved FERM domain in myosin VIIA, were predicted to be pathogenic. In this family, profound sensorineural hearing impairment and retinitis pigmentosa without vestibular disorder, constituted the typical Usher syndrome type 2. Identification of novel mutation in compound heterozygosity in MYO7A gene revealed the genetic origin of Usher syndrome type 2 in this Han family. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Obesity-related genomic loci are associated with type 2 diabetes in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Xiaomu Kong

    Full Text Available Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population.We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance were analyzed using logistic and linear regression models, respectively.Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI = 1.14 (1.06, 1.22 for the A allele of rs12970134, P = 4.75×10(-4; OR (95% CI = 1.10 (1.03, 1.17 for the G allele of rs10938397, P = 4.54×10(-3. When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10(-2 and that of GNPDA2 was attenuated (P = 1.26×10(-1, suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10(-2. In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05.This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population.

  17. Linear dimensions of normal upper airway structure by magnetic resonance imaging in Chinese Han infants and preschool children.

    Science.gov (United States)

    Yi, Xiaoli; Yao, Linyin; Yuan, Xinyu; Wei, Yongxiang; Wang, Zhenchang

    2017-09-01

    To establish normative data of upper airway structure in Chinese Han infants and preschool children. Magnetic resonance imaging (MRI) scans of 521 Chinese Han infants and preschool children (225 girls, 296 boys) aged from 1 day to 72 months were selected from the children who underwent head MRI at the Capital Institute of Pediatrics Affiliated Children Hospital, Beijing, China. No subjects had sleep-disordered breathing or associated conditions that may have affected the upper airway anatomy. The upper airway dimensions and surrounding soft tissue sizes were measured along the mid-sagittal and axial images. On images from the mid-sagittal image, the normative values of the following were obtained for all age group: thickness of the adenoid and nasopharyngeal area, length and thickness of the soft palate, length and height of the tongue, length of upper airway, distance between the mental spine and clivus, and the adenoid oblique width, soft palate oblique width, and tongue oblique width along the mental spine-clivus line. Normative values of the mean tonsillar width and intertonsillar space on the axial images were also obtained. There were no differences in any measurements between boys and girls in either infants or preschool children. Older children had larger airway dimensions, as expected. Normative values for upper airway structure in Chinese Han infants and preschool children assessed by MRI were established. The upper airway dimension and surrounding soft tissues size, including soft palate, adenoid, tongue, and tonsils, were increased with age. There were no gender differences during the first six years of life. These data may prove useful when studying airway disease in Chinese Han children. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. The Clinical Features of Infantile Hypertrophic Pyloric Stenosis in Chinese Han Population: Analysis from 1998 to 2010

    OpenAIRE

    Feng, Zhiqiang; Nie, Yuqiang; Zhang, Youxiang; Li, Qingning; Xia, HuiMing; Gong, SiTang; Huang, Hai

    2014-01-01

    OBJECTIVE: To investigate clinical features of infantile hypertrophic pyloric stenosis (IHPS) in Chinese Han population. METHODS: Three hundred and sixteen hospitalized patients with IHPS from January 1998 to February 2010 were retrospectively reviewed, and data including patient's sex, onset age, other coexisting congenital defects, pyloric circular muscle thickness evaluated by ultrasonograph, serum electrolytes concentration, and results of arterial blood gas analysis on admission were col...

  19. Neck circumference might predict gestational diabetes mellitus in Han Chinese women: A nested case?control study

    OpenAIRE

    He, Fang; He, Hua; Liu, Wenqi; Lin, Junyu; Chen, Bingjun; Lin, Yucong; Zhao, Yitao; Tao, Wen; Xia, Xuefeng

    2016-01-01

    Abstract Aims/Introduction A large neck circumference might be an indicator of metabolic syndrome and its components, and for certain patients is more practical as an index than waist circumference. The demarcation value for neck circumference that suggests metabolic syndrome appears to vary by ethnic group. Gestational diabetes mellitus is considered a component of metabolic syndrome in pregnant women. We investigated whether neck circumference in Han Chinese women is associated with gestati...

  20. Common variants explain a large fraction of the variability in the liability to psoriasis in a Han Chinese population

    OpenAIRE

    Yin, Xianyong; Wineinger, Nathan E; Cheng, Hui; Cui, Yong; Zhou, Fusheng; Zuo, Xianbo; Zheng, Xiaodong; Yang, Sen; Schork, Nicholas J; Zhang, Xuejun

    2014-01-01

    Background Psoriasis is a common inflammatory skin disease with a known genetic component. Our previously published psoriasis genome-wide association study identified dozens of novel susceptibility loci in Han Chinese. However, these markers explained only a small fraction of the estimated heritable component of psoriasis. To better understand the unknown yet likely polygenic architecture in psoriasis, we applied a linear mixed model to quantify the variation in the liability to psoriasis exp...

  1. No seasonal variation in physical activity of Han Chinese living in Beijing.

    Science.gov (United States)

    Wang, Guanlin; Li, Baoguo; Zhang, Xueying; Niu, Chaoqun; Li, Jianbo; Li, Li; Speakman, John R

    2017-04-17

    Physical activity (PA) is widely acknowledged to be beneficial to health and wellbeing, and is potentially influenced by a variety of environmental factors such as ambient temperature, weather conditions and air pollution levels. Since these factors vary seasonally, physical activity participation may also respond seasonally. Current population studies to profile physical activity often sample individuals only once, and this may result in biased estimates if there is strong seasonal variation. We conducted a study of 40 Han Chinese adults living in Beijing using GT3X accelerometers. We measured PA levels every two months across a complete year, while simultaneously monitoring ambient temperatures and air pollution levels. Average hourly vector magnitude (VM) and percentage time spent at each PA intensity (sedentary to light, moderate, vigorous and very vigorous) were measured. General Linear models (GLMs) were used to explore the effects of time of day, temperature and PM 2.5 levels on PA. One way ANOVA was used to test whether there were seasonal differences in body weight and body fatness. The main factors influencing activity levels were the time of day and individual characteristics including age and body fatness, but there was no significant difference between the months. In addition, there was no significant impact of either ambient temperature or air pollution levels (PM2.5). There were also no significant differences over the year in the time spent at sedentary-light, moderate and very vigorous PA levels, but for vigorous PA level which occupied less than 0.5% daily physical activity, both month and individual were significant factors. The relatively constant pattern of urban daily life, independent of time of year, may override the potential impacts of environmental factors that would be anticipated to impact PA levels. These subjects did not specifically avoid activity coincident with elevated air pollution levels (PM2.5). Single week long measurements of

  2. Common and rare exonic MUC5B variants associated with type 2 diabetes in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Guanjie Chen

    Full Text Available Genome-wide association studies have identified over one hundred common genetic risk variants associated with type 2 diabetes (T2D. However, most of the heritability of T2D has not been accounted for. In this study, we investigated the contribution of rare and common variants to T2D susceptibility by analyzing exome array data in 1,908 Han Chinese genotyped with Affymetrix Axiom® Exome Genotyping Arrays. Based on the joint common and rare variants analysis of 57,704 autosomal SNPs within 12,244 genes using Sequence Kernel Association Tests (SKAT, we identified significant associations between T2D and 25 variants (9 rare and 16 common in MUC5B, p-value 1.01×10-14. This finding was replicated (p = 0.0463 in an independent sample that included 10,401 unrelated individuals. Sixty-six of 1,553 possible haplotypes based on 25 SNPs within MUC5B showed significant association with T2D (Bonferroni corrected p values < 3.2×10-5. The expression level of MUC5B is significantly higher in pancreatic tissues of persons with T2D compared to those without T2D (p-value = 5×10-5. Our findings suggest that dysregulated MUC5B expression may be involved in the pathogenesis of T2D. As a strong candidate gene for T2D, MUC5B may play an important role in the mechanisms underlying T2D etiology and its complications.

  3. Sequencing ASMT identifies rare mutations in Chinese Han patients with autism.

    Directory of Open Access Journals (Sweden)

    Lifang Wang

    Full Text Available Melatonin is involved in the regulation of circadian and seasonal rhythms and immune function. Prior research reported low melatonin levels in autism spectrum disorders (ASD. ASMT located in pseudo-autosomal region 1 encodes the last enzyme of the melatonin biosynthesis pathway. A previous study reported an association between ASD and single nucleotide polymorphisms (SNPs rs4446909 and rs5989681 located in the promoter of ASMT. Furthermore, rare deleterious mutations were identified in a subset of patients. To investigate the association between ASMT and autism, we sequenced all ASMT exons and its neighboring region in 398 Chinese Han individuals with autism and 437 healthy controls. Although our study did not detect significant differences of genotypic distribution and allele frequencies of the common SNPs in ASMT between patients with autism and healthy controls, we identified new rare coding mutations of ASMT. Among these rare variants, 4 were exclusively detected in patients with autism including a stop mutation (p.R115W, p.V166I, p.V179G, and p.W257X. These four coding variants were observed in 6 of 398 (1.51% patients with autism and none in 437 controls (Chi-Square test, Continuity Correction p = 0.032, two-sided. Functional prediction of impact of amino acid showed that p.R115W might affect protein function. These results indicate that ASMT might be a susceptibility gene for autism. Further studies in larger samples are needed to better understand the degree of variation in this gene as well as to understand the biochemical and clinical impacts of ASMT/melatonin deficiency.

  4. Genetic Variant of Kalirin Gene Is Associated with Ischemic Stroke in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Hong Li

    2017-01-01

    Full Text Available Introduction. Ischemic stroke is a complex disorder resulting from the interplay of genetic and environmental factors. Previous studies showed that kalirin gene variations were associated with cardiovascular disease. However, the association between this gene and ischemic stroke was unknown. We performed this study to confirm if kalirin gene variation was associated with ischemic stroke. Methods. We enrolled 385 ischemic stroke patients and 362 controls from China. Three SNPs of kalirin gene were genotyped by means of ligase detection reaction-PCR method. Data was processed with SPSS and SHEsis platform. Results. SNP rs7620580 (dominant model: OR = 1.590, p = 0.002 and adjusted OR = 1.662, p = 0.014; additive model: OR = 1.490, p = 0.002 and adjusted OR = 1.636, p = 0.005; recessive model: OR = 2.686, p = 0.039 and SNP rs1708303 (dominant model: OR = 1.523, p = 0.007 and adjusted OR = 1.604, p = 0.028; additive model: OR = 1.438, p = 0.01 and adjusted OR = 1.476, p = 0.039 were associated with ischemic stroke. The GG genotype and G allele of SNP rs7620580 were associated with a risk for ischemic stroke with an adjusted OR of 3.195 and an OR of 1.446, respectively. Haplotype analysis revealed that A–T–G,G-T-A, and A-T-A haplotypes were associated with ischemic stroke. Conclusions. Our results provide evidence that kalirin gene variations were associated with ischemic stroke in the Chinese Han population.

  5. Association of VEGF gene polymorphisms with sporadic Parkinson's disease in Chinese Han population.

    Science.gov (United States)

    Wu, Yubin; Zhang, Yingying; Han, Xun; Li, Xiaoyuan; Xue, Li; Xie, Anmu

    2016-12-01

    Recent evidence indicates that vascular endothelial growth factor (VEGF) is capable of protecting dopaminergic (DA) neurons. Parkinson's disease (PD) is a progressive neurodegenerative disease caused by the degeneration of nigrostriatal dopaminergic neurons. To evaluate the role of VEGF single nucleotide polymorphisms (SNPs) and haplotypes in PD, we performed a case-control study including 400 PD patients and 400 healthy-matched controls. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis and DNA sequencing were used to detect the rs699947, rs2010963 and rs3025039 polymorphisms of the VEGF gene in cases and controls. Our study revealed that T allelic frequency of rs3025039 polymorphism was significantly higher in PD subjects (OR 1.497, 95 % CI 1.099-2.040, P = 0.013) than that in controls. Significant association for rs3025039 could be found in additive model (TT vs. CT vs. CC: OR 1.489, 95 % CI 1.018-2.177, P = 0.040) and dominant model (TT + CT vs. CC: OR 1.538, 95 % CI 1.068-2.216, P = 0.021). Subgroup analyses performed by gender suggested that this association could be found in male, but not in female. Moreover, it also demonstrated a significant association in the subgroup of late-onset PD (LOPD). However, for rs699947 and rs2010963 polymorphisms, genotype or allele frequencies did not differ between groups. No significant association could be found between rs699947 and rs2010963 polymorphism and PD risk. None of the observed haplotypes showed significant association with PD. Therefore, these results suggested that the VEGF gene might be associated with risk of developing sporadic PD in Han Chinese and the rs3025039 polymorphism may be a risk factor for sporadic PD.

  6. The Family Career Development Project in Chinese Canadian Families.

    Science.gov (United States)

    Young, Richard A.; Ball, Jessica; Valach, Ladislav; Turkel, Hayley; Wong, Yuk Shuen

    2003-01-01

    Six Chinese-Canadian parent-adolescent pairs were monitored over 6 months, revealing characteristics of family involvement in adolescent career development: importance of parental agenda, adolescents' involvement, parent communication of reasoning, and adolescent withholding/withdrawing response. Family career development was central to other…

  7. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

    Science.gov (United States)

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2014-12-01

    Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  8. [Association of adipocytokines with obesity and insulin resistance in Korean-Chinese and Han nationality pupils of Yanbian area].

    Science.gov (United States)

    Jing, Yongzhe; Jin, Shanji; Qiao, Ranzhuo; Fang, Jinnü

    2015-07-01

    To investigate the different types of obesity, insulin resistance (IR) and its related adipocytokines, and to analyze the association of adipocytokines with obesity and insulin resistance in Korean-Chinese and Han nationality pupils of Yanbian area. A total of 3879 elementary school students (2011 of Korean-Chinese and 1868 of Han nationality) aged 8-12 years old were selected. Using epidemiological investigation. Combined with laboratory measurement, the body mess index ( BMI), waist circumference (WC) and fasting blood glucose (FBG), insulin, adiponectin, leptin and tumor necrosis factor-alpha (TNF-α) levels were measured. The homeostasis model assessment (HOMA) method was used to estimate the human IR (HOMA-IR). (1) The levels of adiponctin and TNF-α in Korean-Chinese pupils was lower than that in Han nationality pupils (P obesity, HOMA-IR and its related adipocytokines between two nationality pupils of Yanbian area. BMI, WC and HOMA-IR have different association in the different adipocytokines, and the association of BMI and WC in leptin is stronger than that of HOMA-IR, and that of HOMA-IR in TNF-α and adiponectin is stronger than that of BMI and WC.

  9. The Association between NOS3 Gene Polymorphisms and Hypoxic-Ischemic Encephalopathy Susceptibility and Symptoms in Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Yongqin Wu

    2016-01-01

    Full Text Available Endothelial NOS (NOS3 has a potential role in the prevention of neuronal injury in hypoxic-ischemic encephalopathy (HIE. Thus, we aimed to explore the association between NOS3 gene polymorphisms and HIE susceptibility and symptoms in a Chinese Han population. Three single nucleotide polymorphisms (SNPs in the NOS3 gene, rs1800783, rs1800779, and rs2070744, were detected in 226 children with HIE and 212 healthy children in a Chinese Han population. Apgar scores and magnetic resonance image scans were used to estimate the symptoms and brain damage. The association analyses were conducted by using SNPStats and SPSS 18.0 software. The genotype and allele distributions of rs1800779 and rs1799983 displayed no significant differences between the patients and the controls, while the rs2070744 allele distribution was significantly different (corrected P=0.009. For clinical characteristics, the rs2070744 genotype distribution was significantly different in patients with different Apgar scores (≤5, TT/TC/CC = 6/7/5; 6~7, TT/TC/CC = 17/0/0; 8~9, TT/TC/CC = 6/2/0; 10, TT/TC/CC = 7/1/0; corrected P=0.006 in the 1001 to 1449 g birth weight subgroup. The haplotype test did not show any associations with the risk and clinical characteristics of HIE. The results suggest that NOS3 gene SNP rs2070744 was significantly associated with HIE susceptibility and symptom expression in Chinese Han population.

  10. Common genetic variations in Patched1 (PTCH1) gene and risk of hirschsprung disease in the Han Chinese population.

    Science.gov (United States)

    Wang, Yang; Wang, Jun; Pan, Weihua; Zhou, Ying; Xiao, Yongtao; Zhou, Kejun; Wen, Jie; Yu, Tingxi; Cai, Wei

    2013-01-01

    Hirschsprung disease (HSCR) is the most frequent genetic cause of congenital intestinal obstruction with an incidence of 1:5000 live births. In a pathway-based epistasis analysis of data generated by genome-wide association study on HSCR, specific genotype of Patched 1 (PTCH1) has been linked to an increased risk for HSCR. The aim of the present study is to examine the contribution of genetic variants in PTCH1 to the susceptibility to HSCR in Han Chinese. Accordingly, we assessed 8 single nucleotide polymorphisms (SNPs) within PTCH1 gene in 104 subjects with sporadic HSCR and 151 normal controls of Han Chinese origin by the Sequenom MassArray technology (iPLEX GOLD). Two of the eight genetic markers were found to be significantly associated with Hirschsprung disease (rs357565, allele P = 0.005; rs2236405, allele P = 0.002, genotype P = 0.003). Both the C allele of rs357565 and the A allele of rs2236405 served as risk factors for HSCR. During haplotype analysis, one seven-SNP-based haplotype was the most significant, giving a global P = 0.0036. Our results firstly suggest common variations of PTCH1 may be involved in the altered risk for HSCR in the Han Chinese population, providing potential molecular markers for early diagnosis of Hirschsprung disease.

  11. Common genetic variations in Patched1 (PTCH1 gene and risk of hirschsprung disease in the Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Yang Wang

    Full Text Available Hirschsprung disease (HSCR is the most frequent genetic cause of congenital intestinal obstruction with an incidence of 1:5000 live births. In a pathway-based epistasis analysis of data generated by genome-wide association study on HSCR, specific genotype of Patched 1 (PTCH1 has been linked to an increased risk for HSCR. The aim of the present study is to examine the contribution of genetic variants in PTCH1 to the susceptibility to HSCR in Han Chinese. Accordingly, we assessed 8 single nucleotide polymorphisms (SNPs within PTCH1 gene in 104 subjects with sporadic HSCR and 151 normal controls of Han Chinese origin by the Sequenom MassArray technology (iPLEX GOLD. Two of the eight genetic markers were found to be significantly associated with Hirschsprung disease (rs357565, allele P = 0.005; rs2236405, allele P = 0.002, genotype P = 0.003. Both the C allele of rs357565 and the A allele of rs2236405 served as risk factors for HSCR. During haplotype analysis, one seven-SNP-based haplotype was the most significant, giving a global P = 0.0036. Our results firstly suggest common variations of PTCH1 may be involved in the altered risk for HSCR in the Han Chinese population, providing potential molecular markers for early diagnosis of Hirschsprung disease.

  12. High resolution human leukocyte antigen class I allele frequencies and HIV-1 infection associations in Chinese Han and Uyghur cohorts.

    Directory of Open Access Journals (Sweden)

    Yanhou Liu

    Full Text Available Host immunogenetic factors such as HLA class I polymorphism are important to HIV-1 infection risk and AIDS progression. Previous studies using high-resolution HLA class I profile data of Chinese populations appeared insufficient to provide information for HIV-1 vaccine development and clinical trial design. Here we reported HLA class I association with HIV-1 susceptibility in a Chinese Han and a Chinese Uyghur cohort.Our cohort included 327 Han and 161 Uyghur ethnic individuals. Each cohort included HIV-1 seropositive and HIV-1 seronegative subjects. Four-digit HLA class I typing was performed by sequencing-based typing and high-resolution PCR-sequence specific primer. We compared the HLA class I allele and inferred haplotype frequencies between HIV-1 seropositive and seronegative groups. A neighbor-joining tree between our cohorts and other populations was constructed based on allele frequencies of HLA-A and HLA-B loci. We identified 58 HLA-A, 75 HLA-B, and 32 HLA-Cw distinct alleles from our cohort and no novel alleles. The frequency of HLA-B*5201 and A*0301 was significantly higher in the Han HIV-1 negative group. The frequency of HLA-B*5101 was significantly higher in the Uyghur HIV-1 negative group. We observed statistically significant increases in expectation-maximization (EM algorithm predicted haplotype frequencies of HLA-A*0201-B*5101 in the Uyghur HIV-1 negative group, and of Cw*0304-B*4001 in the Han HIV-1 negative group. The B62s supertype frequency was found to be significantly higher in the Han HIV-1 negative group than in the Han HIV-1 positive group.At the four-digit level, several HLA class I alleles and haplotypes were associated with lower HIV-1 susceptibility. Homogeneity of HLA class I and Bw4/Bw6 heterozygosity were not associated with HIV-1 susceptibility in our cohort. These observations contribute to the Chinese HLA database and could prove useful in the development of HIV-1 vaccine candidates.

  13. [Factors affecting burden of caregivers for the elderly of Han Chinese and the Korean minority living in a community in northeast China].

    Science.gov (United States)

    Ken, Kaizen; Okuno, Junko; Fukasaku, Takako; Tomura, Shigeo; Yanagi, Hisako

    2010-09-01

    Objective In the People's Republic of China (China), caregivers carry a large burden because of the rapid aging of the population, the one-child policy and the uncertainty of the social security system. The situation is further complicated by the fact of 56 ethnic groups in the country. Few studies on caregiver burden in different ethnic groups have been reported, although different customs, cultures and methods of caring for the elderly do certainly exist. The aim of the present study was to compare the caregiver burden for the elderly among Han Chinese and the Korean Minority living in a community and to examine the factors affecting this burden. An investigation was conducted using a questionnaire for 76 pairs of elderly people and their caregivers in Yanji City, China (Korean Minority pairs 52, Han pairs 24). The questionnaires for the elderly included their characteristics, economic conditions, ADL, behavioral disturbances associated with dementia, etc. For the caregivers, their characteristics, the state of their health, daily length of care time, social support, intent to continue home care, and Zarit Caregiver Burden Interview (ZBI) score were investigated. The rate (70.8%) of caregivers with a "high caregiver burden," i.e., those with a median ZBI total score of 33 or more, and the personal strain scores of the Han Chinese were significantly higher than in the Korean Minority. As for who was a suitable caregiver, a high percentage of Han caregivers answered the "children" of the elderly, while Korean Minority caregivers answered the "spouses". When the caregiver was a child of the elderly receiving care, the Hans' ZBI score was higher than that for the Korean Minority. Factors most affecting caregiver burden in the Korean Minority were behavioral disturbances associated with dementia of the elderly, ADL, and degree of life independence of the elderly, along with disorders, sex and health state of the caregivers, relations, length of daily care time, number

  14. Mothers' Self-Reported Emotional Expression in Mainland Chinese, Chinese American and European American Families

    Science.gov (United States)

    Camras, Linda; Kolmodin, Karen; Chen, Yinghe

    2008-01-01

    This study compared Mainland Chinese, Chinese American and European American mothers' self-reported emotional expression within the family. Mothers of 3-year-old European American (n = 40), Chinese American (n = 39) and Mainland Chinese (n = 36) children (n = 20 girls per group) completed the Self-Expressiveness in the Family Questionnaire (SEFQ),…

  15. Involvement of tryptophan hydroxylase 2 gene polymorphisms in susceptibility to tic disorder in Chinese Han population

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2013-01-01

    Full Text Available Abstract Background Tryptophan hydroxylase-2 (TPH2 is a potential candidate gene for screening tic disorder (TD. Methods A case–control study was performed to examine the association between the TPH2 gene and TD. The Sequenom® Mass ARRAY iPLEX GOLD System was used to genotype two single nucleotide polymorphisms (SNPs of the TPH2 gene in 149 TD children and in 125 normal controls. Results For rs4565946, individuals with the TT genotype showed a significantly higher risk of TD than those with TC plus CC genotypes [odds ratio (OR =3.077, 95% confidence interval (CI: 1.273–7.437; P = 0.009], as did male TD children with the TT genotype (OR = 3.228, 95% CI: 1.153–9.040; P = 0.020. The G allele of rs4570625 was significantly more frequent in TD children with higher levels of tic symptoms (Yale Global Tic Severity Scale, YGTSS than those in controls among the male children (OR = 1.684, 95%: 1.097–2.583; P = 0.017]. TD children with severe tic symptoms had significantly higher frequencies of rs4546946 TT genotype than did normal controls in boys (OR = 3.292, 95% CI: 1.139–9.513; P = 0.022. We also found that genotype distributions of both SNPs were different between the Asian and European populations. Conclusions Our results indicated that the TT genotype of rs4565946 is a potential genetic risk factor for TD, and the allele G of rs4570625 might be associated with the severity of tic symptoms in boys. These polymorphisms might be susceptibility loci for TD in the Chinese Han population. Because of the confounding of co-existing attention deficit hyperactivity disorder (ADHD,these findings need to be confirmed by studies in much larger samples.

  16. [Current situation of sleeping duration in Chinese Han students in 2010].

    Science.gov (United States)

    Song, Yi; Zhang, Bing; Hu, Peijin; Ma, Jun

    2014-07-01

    To analyze the characteristics of sleep duration in Chinese primary and middle school students. The data was collected from 30 provinces (Autonomous regions, Municipalities) in 165 363 Han Primary school students above 4 grade, the junior and senior high school students who participated in 2010 National Physical Fitness and Health Surveillance by using stratified random cluster sampling method, and the questionnaire of sleep duration, insufficient sleep and commuting way from school was conducted at the same time.χ² test and χ² linear-by-linear test were used to analyze the difference between the different groups, and logistic regression was used to analyze the factors of insufficient sleep. Nationwide in 2010, 39.09% (64 646/165 363) of students reported they had more than 8 hours sleep duration per day, the prevalence was lower among urban (37.06% (30 767/83 027)) than rural (41.15% (33 879/82 336)) students (χ² = 290.53, P day in 9-12 years group, 13-15 years group and 16-18 years group was 70.24% (43 934/62 549), 31.31% (16 166/51 652) and 8.89% (546/51 162), respectively, and decreased with the age increasing (χ² linear-by-linear = 50 617.75, P students, the prevalence was higher among urban (94.94% (78 829/83 027)) than rural students (92.32% (76 009/82 336)) (χ² = 479.14, P < 0.01), and lower among boys (92.65% (76 408/82 466) than girls 94.61% (78 430/82 897) (χ² = 265.79, P < 0.01). The prevalence of insufficient sleep in 9-12 years group, 13-15 years group and 16-18 years group was 96.42% (60 310/62 549), 92.76% (47 912/51 562) and 91.11% (46 616/51 162), respectively. A multivariate logistic regression analysis (OR (95% CI)) revealed that the insufficient sleep was significantly associated with being urban (1.58 (1.51-1.65)), being girls (1.39 (1.34-1.45)), being 9-12 years group (2.77 (2.62-2.93)), living in the middle (1.19 (1.13-1.25)) or western (1.08 (1.03-1.13)) of China, and commuting from school by bicycle (1.21 (1.14-1.28)), bus

  17. Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

    Directory of Open Access Journals (Sweden)

    Fang Hu

    2014-10-01

    Full Text Available AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

  18. Verification of pharmacogenetics-based warfarin dosing algorithms in Han-Chinese patients undertaking mechanic heart valve replacement.

    Science.gov (United States)

    Zhao, Li; Chen, Chunxia; Li, Bei; Dong, Li; Guo, Yingqiang; Xiao, Xijun; Zhang, Eryong; Qin, Li

    2014-01-01

    To study the performance of pharmacogenetics-based warfarin dosing algorithms in the initial and the stable warfarin treatment phases in a cohort of Han-Chinese patients undertaking mechanic heart valve replacement. We searched PubMed, Chinese National Knowledge Infrastructure and Wanfang databases for selecting pharmacogenetics-based warfarin dosing models. Patients with mechanic heart valve replacement were consecutively recruited between March 2012 and July 2012. The predicted warfarin dose of each patient was calculated and compared with the observed initial and stable warfarin doses. The percentage of patients whose predicted dose fell within 20% of their actual therapeutic dose (percentage within 20%), and the mean absolute error (MAE) were utilized to evaluate the predictive accuracy of all the selected algorithms. A total of 8 algorithms including Du, Huang, Miao, Wei, Zhang, Lou, Gage, and International Warfarin Pharmacogenetics Consortium (IWPC) model, were tested in 181 patients. The MAE of the Gage, IWPC and 6 Han-Chinese pharmacogenetics-based warfarin dosing algorithms was less than 0.6 mg/day in accuracy and the percentage within 20% exceeded 45% in all of the selected models in both the initial and the stable treatment stages. When patients were stratified according to the warfarin dose range, all of the equations demonstrated better performance in the ideal-dose range (1.88-4.38 mg/day) than the low-dose range (mechanic heart valve replacement.

  19. Association of genetic polymorphisms with chronic obstructive pulmonary disease in the Chinese Han population: a case–control study

    Directory of Open Access Journals (Sweden)

    Guo Yi

    2012-12-01

    Full Text Available Abstract Background Chronic obstructive pulmonary disease (COPD is influenced by both environmental and genetic factors. Few gene studies of the Chinese population have focused on COPD. We investigated candidate genes associated with susceptibility to COPD in the Chinese Han population. Methods A total of 331 COPD patients and 213 control subjects were recruited for this study. Nighty-seven single-nucleotide polymorphisms (SNPs of 46 genes were selected for genotyping. Genotypes were determined using multiplex polymerase chain reaction (PCR. Results Significant differences between patients and healthy controls were observed in the allele frequencies of seven SNPs: rs1205 C, rs2353397 C, rs20541 T, rs2070600 G, rs10947233 G, rs1800629 G, and rs2241712 A. After Bonferroni correction, rs2353397 C was most strongly associated with susceptibility to COPD. Haplotype analysis showed that the frequencies of the GC, GT haplotypes of rs2241718 (TGF-β1 gene, and rs6957 (CDC97 gene were significantly higher in the control group than in the COPD case group (p=1.88×10-9; the frequencies of the TT haplotype of rs1205 and rs2808630 (CRP gene were significantly higher in the control group (p=0.0377. Conclusion Our study suggests some genetic variants associated with the susceptibility of COPD in the Chinese Han population.

  20. Polymorphisms in NRGN are associated with schizophrenia, major depressive disorder and bipolar disorder in the Han Chinese population.

    Science.gov (United States)

    Wen, Zujia; Chen, Jianhua; Khan, Raja Amjad Waheed; Wang, Meng; Song, Zhijian; Li, Zhiqiang; Shen, Jiawei; Li, Wenjin; Shi, Yongyong

    2016-04-01

    The NRGN gene locates on 11q24 and encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. In a previous genome-wide association study of schizophrenia in the Caucasian population, rs12807809 of NRGN was found to be significantly associated with schizophrenia, moreover, it was further found to be associated with bipolar disorder. We recruited 1248 schizophrenia cases, 1344 bipolar disorder cases, 1056 major depressive disorder cases, and 1248 healthy controls from Han Chinese population. Rs12807809 and another two tag SNPs of NRGN were genotyped and analyzed in three diseases respectively. A meta-analysis of rs12807809 was also conducted to verify its association with schizophrenia in Han Chinese population. Rs7113041 was associated with bipolar disorder (odds ratio, 95% confidence interval (OR, 95% CI)=1.194, 1.032-1.383; Pgenotype=0.0126), and rs12278912 was associated with major depressive disorder (OR, 95% CI=0.789, 0.673-0.924; Pallele=0.0102, Pgenotype=0.0399) after Bonferroni correction. The "GA" haplotype of rs7113041-rs12278912 was significantly associated with schizophrenia, major depressive disorder and bipolar disorder (corresponding P values were 2.85E-04, 3.00E-03, and 5.40E-04 after Bonferroni correction). Despite the association between NRGN and psychoses we have found, we failed to validate the positive variant rs12807809, which was reported in the Caucasian genome-wide association study both in our single site association test and the meta-analysis. Functional studies are needed to illuminate the role of NRGN in the pathogenesis of these mental disorders. Our findings prove that NRGN is a shared susceptibility gene of schizophrenia, major depression and bipolar disorder in Han Chinese, and this might provide a new target for the diagnosis and treatment of these mental disorders. Copyright © 2016. Published by Elsevier B.V.

  1. No association of PTPN22 polymorphisms with susceptibility to ocular Behcet's disease in two Chinese Han populations.

    Directory of Open Access Journals (Sweden)

    Qi Zhang

    Full Text Available BACKGROUND: Behcet's disease is known as a recurrent, multisystem inflammation and immune-related disease. Protein tyrosine phosphatase non-receptor 22 (PTPN22 is a key negative regulator of T lymphocytes and polymorphisms of the PTPN22 gene have been shown to be associated with various immune-related diseases. The present study was performed to assess the association between PTPN22 polymorphisms and Behcet's disease in two Chinese Han populations. METHODOLOGY/PRINCIPAL FINDINGS: A total of 516 patients with ocular Behcet's disease and 690 healthy controls from two Chinese Han populations were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for three single nucleotide polymorphisms (SNPs. Hardy-Weinberg equilibrium was tested using the χ(2 test. Genotype frequencies were estimated through direct counting. Allele and genotype frequencies were compared between patients and controls using logistic regression analysis. The results revealed that there was no association between the tested three PTPN22 SNPs (rs2488457, rs1310182 and rs3789604 and ocular Behcet's disease (p>0.05. Categorization analysis according to the clinical features did not show any association of these three polymorphisms with these parameters (p>0.05. CONCLUSIONS/SIGNIFICANCE: The investigated PTPN22 gene polymorphisms (rs2488457, rs1310182 and rs3789604 were not associated with ocular Behcet's disease in two Chinese Han populations, and showed that it may be different from other classical autoimmune diseases. More studies are needed to confirm these findings for Behcet's disease in other ethnic backgrounds.

  2. Identification of novel susceptibility Loci for kawasaki disease in a Han chinese population by a genome-wide association study.

    Directory of Open Access Journals (Sweden)

    Fuu-Jen Tsai

    Full Text Available Kawasaki disease (KD is an acute systemic vasculitis syndrome that primarily affects infants and young children. Its etiology is unknown; however, epidemiological findings suggest that genetic predisposition underlies disease susceptibility. Taiwan has the third-highest incidence of KD in the world, after Japan and Korea. To investigate novel mechanisms that might predispose individuals to KD, we conducted a genome-wide association study (GWAS in 250 KD patients and 446 controls in a Han Chinese population residing in Taiwan, and further validated our findings in an independent Han Chinese cohort of 208 cases and 366 controls. The most strongly associated single-nucleotide polymorphisms (SNPs detected in the joint analysis corresponded to three novel loci. Among these KD-associated SNPs three were close to the COPB2 (coatomer protein complex beta-2 subunit gene: rs1873668 (p = 9.52×10⁻⁵, rs4243399 (p = 9.93×10⁻⁵, and rs16849083 (p = 9.93×10⁻⁵. We also identified a SNP in the intronic region of the ERAP1 (endoplasmic reticulum amino peptidase 1 gene (rs149481, p(best = 4.61×10⁻⁵. Six SNPs (rs17113284, rs8005468, rs10129255, rs2007467, rs10150241, and rs12590667 clustered in an area containing immunoglobulin heavy chain variable regions genes, with p(best-values between 2.08×10⁻⁵ and 8.93×10⁻⁶, were also identified. This is the first KD GWAS performed in a Han Chinese population. The novel KD candidates we identified have been implicated in T cell receptor signaling, regulation of proinflammatory cytokines, as well as antibody-mediated immune responses. These findings may lead to a better understanding of the underlying molecular pathogenesis of KD.

  3. [Textual research on Han-Chinese formulae collected in Tubo medical manuscript unearthed in 'Bum-pa-Che Tower].

    Science.gov (United States)

    Liu, Y H; Nong, H C

    2016-11-28

    A Tibetan manuscript with title of Sman-dpyad gces-pa grub-pa kun-'dus-pa in the Collection of Practiced Medical Quintessence, was found in the basement of a Buddhist tower named 'Bum-pa-che in Lhokha (Shannan), Tibet. It contains a purgative recipe of TCM with its title "Powder of Han Region" and several ingredients in Chinese transliteration. Based upon the rule of medieval Chinese system of pronunciation with reference of related texts and studies, a textual research identifies it as a kind of Maren (seed of Cannabis sativa L. ) wan in TCM. Although no identical formulae of its kind has been found in extant literature of TCM prior to the Song Dynasty(960 AD), yet its ingredients, pharmaceutical preparation and efficacy are very similar to the Modified maren wan, the variant formulae of Maren wan in Wai tai mi yao (Arcane Essentials from the Imperial Library) of the Tang Dynasty.

  4. Analysis of 24 Y chromosomal STR haplotypes in a Chinese Han population sample from Henan Province, Central China.

    Science.gov (United States)

    Shi, Meisen; Liu, Yaju; Zhang, Juntao; Bai, Rufeng; Lv, Xiaojiao; Ma, Shuhua

    2015-07-01

    We analyzed haplotypes for 24 Y chromosomal STRs (Y-STRs), including 17 Yfiler loci (DYS19, DYS385a/b, DYS389I/II, DYS390, DYS391, DYS392, DYS393, DYS437, DY438, DYS439, DYS448, DYS456, DYS458, DYS635 and Y-GATA-H4) and 7 additional STRs (DYS388, DYS444, DYS447, DYS449, DYS522 and DYS527a/b) in 1100 unrelated Chinese Han individuals from Henan Province using AGCU Y24 STR kit systems. The calculated average gene diversity (GD) values ranged from 0.4105 to 0.9647 for the DYS388 and DYS385a/b loci, respectively. The discriminatory capacity (DC) was 72.91% with 802 observed haplotypes using 17 Yfiler loci, by the addition of 7 Y-STRs to the Yfiler system, the DC was increased to 79.09% while showing 870 observed haplotypes. Among the additional 7 Y-STRs, DYS449, DYS527a/b, DYS444 and DYS522 were major contributors to enhancing discrimination. In the analysis of molecular variance, the Henan Han population clustered with Han origin populations and showed significant differences from other Non-Han populations. In the present study, we report 24 Y-STR population data in Henan Han population, and we emphasize the need for adding additional markers to the commonly used 17 Yfiler loci to achieve more improved discriminatory capacity in a population with low genetic diversity. Copyright © 2015. Published by Elsevier Ireland Ltd.

  5. Beijing's policies for managing Han and ethnic-minority chinese communities abroad

    OpenAIRE

    James To

    2012-01-01

    The overseas Chinese (OC) form a vast network of powerful interest groups and important political actors capable of shaping the future of China from abroad by transmitting values back to their ancestral homeland (Tu 1991). While the Chinese Communist Party (CCP) welcomes and actively seeks to foster relations with the OC in order to advance China’s national interests, some cohorts may be hostile to the regime. In accordance with their distinct demographic and ethnic pro-files, the C...

  6. Quantitative Analysis of Intestinal Flora of Uygur and Han Ethnic Chinese Patients with Ulcerative Colitis.

    Science.gov (United States)

    Yao, Ping; Cui, Min; Wang, Haikun; Gao, Hongliang; Wang, Lei; Yang, Tao; Cheng, Yongbo

    2016-01-01

    Aim. To study the correlation between intestinal flora and ulcerative colitis by analyzing the abundance of Bacteroides, Fusobacterium, Clostridium, Bifidobacterium spp., and Faecalibacterium prausnitzii in the intestinal of ulcerative colitis (UC) patients and healthy controls with Uygur and Han ethnic. Methods. Bacterial genomic DNA was extracted from fecal samples and analyzed with real-time fluorescence quantitative polymerase chain reaction (PCR) to identify the abundance of Bacteroides, Fusobacterium, Clostridium, Bifidobacterium spp., and Faecalibacterium prausnitzii. Results. The samples from UC patients, Uygur and Han ethnic combined, had higher abundance of Bacteroides (P = 0.026) but lower Clostridium (P = 0.004), Bifidobacterium spp. (P = 0.009), and Faecalibacterium prausnitzii (P = 0.008) than those from healthy controls. Among UC patients, Bacteroides population was raised in acute UC patients (P ≤ 0.05), while the abundance of Clostridium, Bifidobacterium spp., Fusobacterium, and Faecalibacterium prausnitzii decreased (P ≤ 0.05) compared with the remission. In both UC patients group and control group, no difference was observed in the abundance of these 5 bacteria between the Han and the Uygur group. Conclusions. Variations in the abundance of these five bacterial strains in intestines may be associated with the occurrence of UC in Uygur and Han populations; however, these variations were not associated with ethnic difference.

  7. The CMYA5 gene confers risk for both schizophrenia and major depressive disorder in the Han Chinese population.

    Science.gov (United States)

    Wang, Qingzhong; He, Kuanjun; Li, Zhiqiang; Chen, Jianhua; Li, Wenjin; Wen, Zujia; Shen, Jiawei; Qiang, Yu; Ji, Jue; Wang, Yujiong; Shi, Yongyong

    2014-09-01

    A recent genome-wide association study (GWAS) of the European population implicated the CMYA5 gene in schizophrenia. Previous functional studies showed that the CMYA5 protein can interact with DTNBP1 and PKA, providing further support for a role of CMYA5 in the pathogenesis of schizophrenia. However, this association requires additional validation in independent populations. To validate the association between CMYA5 and schizophrenia and major depressive disorder, we genotyped 16 SNPs within the CMYA5 gene and performed case-control studies in 1330 schizophrenia patients, 1045 patients with major depressive disorder, and 1235 normal controls. All patients were of Han Chinese origin. rs6883197 and rs259127 were significantly associated with schizophrenia, and rs12514461, rs259127, and rs7343 were associated with major depressive disorder. Additionally, one risk haplotype of rs16877109-rs3828611 (G-G) was associated with both schizophrenia (P = 0.0000784, after correction) and major depressive disorder (P = 0.00230, after correction). Our findings support the idea that specific alleles and haplotype in the CMYA5 confer genetic risk for both schizophrenia and major depressive disorder in the Han Chinese population.

  8. The association between a novel polymorphism (rs1062577) in ESR1 and breast cancer susceptibility in the Han Chinese women.

    Science.gov (United States)

    Chen, Li; Kang, Hui; Jin, Guo-Jiang; Chen, Xin; Zhang, Qing-Yang; Lao, Wen-Ting; Li, Rui

    2016-07-01

    The aim of the present study was to analyze the genetic association between the three estrogen receptor 1 (ESR1) single nucleotide polymorphisms (SNPs; rs1062577, rs2881766, and rs9479118) and breast cancer risk in Han Chinese women. To investigate the possible association of genetic polymorphisms of any of the three ESR1 SNPs in breast cancer patients (n = 198) and healthy controls (n = 218) collected from the college hospital, peripheral blood mononuclear cells samples were analyzed by high-resolution melt-polymerase chain reaction. Odds ratios and 95% confidence intervals were used to evaluate the association between the ESR1 SNPs and breast cancer. Patients genotyped AA for ESR1 rs1062577 showed increased breast cancer risk (p = 0.005). In the menarche at ≤ 13-year-old group, there were significant differences in alleles A versus T at rs1062577 and alleles G versus T at rs2881766 between the breast cancer group and the control group. In the > 13-year-old group, the AA genotype at rs1062577, the GG genotype at rs2881766, and the CC genotype at rs9479118 increased breast cancer susceptibility. These results showed that the ESR1 rs1062577 polymorphism increased breast cancer risk in Han Chinese women, which might be used as a new SNP marker.

  9. Genetic polymorphisms of the TYMS gene are not associated with congenital cardiac septal defects in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Jian-Yuan Zhao

    Full Text Available BACKGROUND: Clinical research indicates that periconceptional administration of folic acid can reduce the occurrence of congenital cardiac septal defects (CCSDs. The vital roles of folate exhibits in three ways: the unique methyl donor for DNA expression regulation, the de novo biosynthesis of purine and pyrimidine for DNA construction, and the serum homocysteine removal. Thymidylate synthase (TYMS is the solo catalysis enzyme for the de novo synthesis of dTMP, which is the essential precursor of DNA biosynthesis and repair process. To examine the role of TYMS in Congenital Cardiac Septal Defects (CCSDs risk, we investigated whether genetic polymorphisms in the TYMS gene associated with the CCSDs in a Han Chinese population. METHOD: Polymorphisms in the noncoding region of TYMS were identified via direct sequencing in 32 unrelated individuals composed of half CCSDs and half control subjects. Nine SNPs and two insertion/deletion polymorphisms were genotyped from two independent case-control studies involving a total of 529 CCSDs patients and 876 healthy control participants. The associations were examined by both single polymorphism and haplotype tests using logistic regression. RESULT: We found that TYMS polymorphisms were not related to the altered CCSDs risk, and even to the changed risk of VSDs subgroup, when tested in both studied groups separately or in combination. In the haplotype analysis, there were no haplotypes significantly associated with risks for CCSDs either. CONCLUSION: Our results show no association between common genetic polymorphisms of the regulatory region of the TYMS gene and CCSDs in the Han Chinese population.

  10. Stature estimation based on the length of tibia and fibula measured by digital X-ray in Chinese Han teenagers.

    Science.gov (United States)

    Wang, Yu-Zhuo; Huang, Yun; Zhou, Xiao-Rong; Deng, Zhen-Hua

    2012-12-01

    To derive regression formulae for stature estimation using forensic radiography from the tibia and fibula of Chinese Han teenagers in Sichuan Province. To construct equations, measurements were conducted on the training sample (412 adults, 201 males and 211 females). The whole length of the fibula and four measurements of tibia were determined using CR radiography, rectified through theoretical magnification. The regression formulae were relatively constructed to the real stature measured in an erect position. Through using the testing sample (40 adults) for the regression formulae, the reliability of the regression formulae was assessed. The range of correlation coefficients of four measurements for tibia was 0.880-0.895 in the sex-unknown group, 0.869-0.893 in the male, and 0.845-0.855 in the female. The five measurements were found to be better correlated with stature in the male than in the female. The digital X-ray of the tibia and fibula for stature estimation is proved to be effective in forensic individual identification; therefore, these equations can be of great assistance to the stature estimation of the contemporary Chinese Han teenagers.

  11. Association of the leptin gene with knee osteoarthritis susceptibility in a Han Chinese population: a case-control study.

    Science.gov (United States)

    Qin, Jianghui; Shi, Dongquan; Dai, Jin; Zhu, Lunqing; Tsezou, Aspasia; Jiang, Qing

    2010-10-01

    Previous studies have suggested that leptin works as a key regulator in the pathogenesis of osteoarthritis (OA), and genetic factors modulate OA. This study assessed the contribution of leptin gene (LEP) polymorphism(s) to knee OA among Han Chinese. Three tag single-nucleotide polymorphisms (SNPs) covering all those LEP SNPs of which the minor allele frequencies were over 10% were selected. Study subjects (697 patients and 699 controls) were divided into four groups (underweight, normal weight, overweight and obese) by body mass index (BMI). Allele and genotype frequencies in the three tag SNPs were significantly different in the normal weight and overweight groups. In the normal weight, overweight and obese groups, BMI (P=4.3 × 10(-5), 0.012 and 0.009, respectively) and gender (P=3.5 × 10(-22), 5.1 × 10(-23) and 2.1 × 10(-8), respectively) were effective factors. Age was an independent effective factor in the overweight group (P=0.009). Haplotypes were associated with OA in the normal weight group (CAT, P=0.015) and the overweight group (AGC, P=0.015). Our results suggest an association between LEP and knee OA in the normal weight and overweight groups among Han Chinese.

  12. Association of polymorphisms in AGTR1 and AGTR2 genes with primary aldosteronism in the Chinese Han population.

    Science.gov (United States)

    Wu, Zhun; Huang, Chao; Zhou, Tingting; Lin, Jinglai; Zhang, Kaiyan; Li, Wei; Zheng, Jiaxin; Chen, Bin; Wang, Baojun; Zhang, Xu; Xing, Jinchun

    2015-12-01

    Polymorphisms in angiotensin II type-1/2 receptor genes (AGTR1/AGTR2) may be involved in the pathogenesis of primary aldosteronism. The present study aims to reveal some loci susceptible to the disease on the genes in a group of Chinese Han nationality. A case-control study was conducted in 202 patients and 188 controls. Ten tagging SNPs on AGTR1/AGTR2 were genotyped for all subjects via the method of multiplex PCR-ligase detection reaction. Statistical analysis was performed with chi-square test and logistic regression analysis. rs3772616 on the AGTR1 gene was a factor for susceptibility to primary aldosteronism (p<0.001), and the TT genotype significantly decreased the risk of primary aldosteronism compared with the CC homozygote (p=0.008, adjusted OR=0.13; 95%CI: 0.03-0.59). The rs3772616 polymorphism was associated with primary aldosteronism under the additive and dominant models. The female carriers of the G allele in rs5193 showed a significant difference compared with the T allele. The AGTR1 rs3772616 polymorphism can be considered as a hereditary marker for primary aldosteronism, and in the Chinese Han population the rs5193 G allele seems to predispose to it only in women. © The Author(s) 2014.

  13. Association study between vitamin D receptor gene polymorphisms and asthma in the chinese han population: a case-control study

    Directory of Open Access Journals (Sweden)

    Gong Yaoqin

    2009-07-01

    Full Text Available Abstract Background Modulation of the immune system is one of the principal roles of Vitamin D, for which the effects are exerted via the vitamin D receptor (VDR. Importantly, variants in the VDR gene have been susceptible in the past to raise the risk of asthma in several populations. These effects of VDR allelic markers remain speculative in the Chinese Han population. Results A case-control study of 1090 individuals including 567 asthmatic patients was realized on five SNPs within the VDR gene. Only rs7975232 (ApaI marker showed a significant association with asthma (P = 0.009. Haplotype analysis of the five VDR polymorphisms showed a significant association with asthma (global-p value = 0.012. Conclusion Although the susceptibility of VDR gene variants with asthma could not be confirmed for all SNPs tested in this study, the significant association obtained for rs7975232 provides evidence for a previously unknown report about the Chinese Han population and may raise the susceptibility of VDR to be a candidate gene for asthma.

  14. Association of P2X7 receptor gene polymorphisms with sporadic Parkinson's disease in a Han Chinese population.

    Science.gov (United States)

    Liu, Hongxin; Han, Xun; Li, Yongsheng; Zou, Haiqiang; Xie, Anmu

    2013-06-24

    Previous studies have indicated that genetic polymorphisms in the P2X7 receptors may influence the occurrence and development of sporadic Parkinson's diseases (PD). In our study, two DNA polymorphisms at P2X7 receptor gene: 1513A>C (rs3751143) and 1729T>A (rs1653624) were examined by PCR-RFLP analysis in 285 sporadic patients and 285 healthy controls in Han Chinese population. For 1513A>C polymorphism, there were significant differences in genotype distribution in PD group and late-onset PD (LOPD) group relative to the control groups respectively (P=0.015 and P=0.032, respectively), as well as between male PD and the controls subgroup (P=0.031). However, there were no significant differences in the genotype and allele frequencies of 1729T>A polymorphism between groups. Our study revealed that the P2X7 receptors 1513A>C polymorphism is a risk factor for sporadic PD, LOPD and male PD in Han Chinese population, while 1729T>A polymorphism is not significantly associated with Parkinson's disease. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  15. Association of Canonical Wnt/β-Catenin Pathway and Type 2 Diabetes: Genetic Epidemiological Study in Han Chinese

    Directory of Open Access Journals (Sweden)

    Jinjin Wang

    2015-06-01

    Full Text Available We aimed to investigate the associations of polymorphisms in Canonical Wnt/β-catenin pathway (WNT signaling genes (including low-density lipoprotein-related protein 5 [LRP5] and transcription factor 7-like 2 [TCF7L2] gene and the downstream gene glucagon (GCG and risk of type 2 diabetes mellitus (T2DM in a Han Chinese population. We genotyped the single nucleotide polymorphisms (SNPs for LRP5, TCF7L2 and GCG gene were genotyped in 1842 patients with T2DM and 7777 normal glucose-tolerant healthy subjects. We used multifactor dimensionality reduction (MDR and multiplicative logistic regression adjusting for sex, age, anthropometric measurements and lipid levels to investigate the gene-gene interactions for the risk of T2DM. Among the five SNPs in LRP5, the recessive model of rs7102273 and the haplotype GCTCC were associated with T2DM risk; the haplotype GCTTC was associated with decreased risk. For TCF7L2, the rs11196218 genotype GA and the haplotype CCG, TTG, TTA were associated with T2DM risk; whereas, the haplotype CTG and TCG were associated with decreased risk. Both MDR and multiplicative logistic regression revealed potential gene–gene interactions among LRP5, TCF7L2, and GCG associated with T2DM. The WNT signaling pathway may play a significant role in risk of T2DM in Han Chinese people.

  16. Contribution of DNA repair xeroderma pigmentosum group D genotypes to pancreatic cancer risk in the Chinese Han population

    Directory of Open Access Journals (Sweden)

    Dong Yan

    2017-12-01

    Full Text Available Abstract This study aimed to determine the association between the polymorphisms and haplotypes in the xeroderma pigmentosum group D (XPD gene and the risk of pancreatic cancer in the Chinese Han population. SNaPshot was used for genotyping six SNP sites of the XPD gene. Comparisons of the correlations between different genotypes in combination with smoking and the susceptibility to pancreatic cancer were performed. Individual pancreatic cancer risk in patients who carry mutant C alleles (AC, CC, and AC+CC at rs13181 increased (p < 0.05. Taking non-smoking individuals who carry the AA genotype as a reference, and non-smoking individuals who carry mutant allele C (AC+CC, the risk of pancreatic cancer increased by 3.343 times in individuals who smoked ≥ 20 cigarettes daily, 3.309 times in individuals who smoked ≥ 14 packs per year, 5.011 times in individuals who smoked ≥ 24 packs per year, and 4.013 times in the individuals who smoked ≥ 37 packs per year (P < 0.05. In addition, haplotype analysis revealed that haplotype AGG, which comprised rs13181, rs3916874 and rs238415, was associated with a 1.401-fold increase in pancreatic cancer risk (p < 0.05. We conclude that the polymorphism of XPD Lys751Gln (rs13181 in combination with smoking contributes to increased risk of pancreatic cancer in the Chinese Han population. Haplotype AGG might be a susceptibility haplotype for pancreatic cancer.

  17. Genetic polymorphism of interleukin-6 influences susceptibility to HBV-related hepatocellular carcinoma in a male Chinese Han population.

    Science.gov (United States)

    Tang, Shengli; Yuan, Yufeng; He, Yueming; Pan, Dingyu; Zhang, Yongxi; Liu, Yuanyuan; Liu, Quanyan; Zhang, Zhonglin; Liu, Zhisu

    2014-04-01

    As a multifunctional cytokine, interleukin-6 (IL-6) plays a key role in chronic inflammation as well as tumor growth and progression of hepatitis B virus (HBV) infection. Recent studies have implicated that single nucleotide polymorphism (SNP) -572C>G (rs1800796) located within the promoter region of IL-6 gene was associated with susceptibility to several diseases. Here, a case-control study was undertaken to investigate the association between this polymorphism and HBV-related hepatocellular carcinoma (HCC) susceptibility in a Chinese Han population. A total of 900 patients with chronic HBV infection, including 505 HBV-related HCC patients and 395 HBV infected patients without HCC were enrolled, and rs1800796 polymorphism was genotyped by the TaqMan method and DNA sequencing technology. The results indicated no significant association between rs1800796 polymorphism and the risk of HBV-related HCC in all subjects; however, a significant difference was identified in male subjects. Under the dominant model, male subjects with the G allele (CG/GG) have higher susceptibility to HBV-related HCC than those with CC genotype after adjusting confounding factors (P=0.012, odds ratio [OR] 1.68, 95% confidence interval [95% CI] 1.15-2.42). Our results suggested that rs1800796 polymorphism of IL-6 gene was associated with susceptibility to HBV-related HCC in a male Chinese Han population. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  18. Association of BCL2-938C>A genetic polymorphism with glioma risk in Chinese Han population.

    Science.gov (United States)

    Li, Wei; Qian, Chunfa; Wang, Linxiong; Teng, Hong; Zhang, Li

    2014-03-01

    Glioma is the most common type of primary brain malignancy in adults. The anti-apoptotic protein B-cell lymphoma 2 (BCL2) has been implicated in the pathogenesis of glioma. This study aimed to evaluate the potential association between BCL2-938C>A genetic polymorphism and glioma susceptibility. This case-control study was conducted in Chinese Han populations consisting of 248 glioma cases and 252 cancer-free controls. The BCL2-938C>A genetic polymorphism was detected by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and verified using DNA sequencing methods. Our data suggested that the genotype/allele of BCL2-938C>A polymorphism were statistically associated with the increased risk of glioma where the risk of glioma for genotype AA or allele A is significantly higher than wild genotype CC (odds ratio (OR) = 2.23, 95% confidence interval (CI) 1.21-4.10, p = 0.009) or allele C (OR = 1.39, 95% CI 1.06-1.82, p = 0.016), respectively. In addition, the BCL2-938AA genotype was significantly more common in patients with glioblastoma and in patients with grade IV glioma. Our findings indicate that the BCL2-938C>A polymorphism is associated with the susceptibility to glioma in Chinese Han populations and might be used as molecular markers for evaluating glioma risk.

  19. Acquired melanocytic naevus phenotypes and MC1R genotypes in Han Chinese: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Xiaohong Li

    2017-12-01

    Full Text Available Background Early detection and treatment are the most important elements in reducing the incidence of melanoma deaths. Acquired melanocytic naevi (AMN are well-known precursors of melanoma but most of our knowledge on the clinico-dermoscopic phenotypes of AMN is based on studies in European-background populations, particularly American and Australian populations. There has been little research in Chinese Han populations on clinico-dermoscopic variability of naevi or how naevi are affected by melanoma-linked variants of the melanocortin 1 receptor (MC1R gene. Methods Clinical and dermoscopic features of 448 AMN in 115 patients from the Han ethnic group in mainland China were described. Germline polymorphisms in MC1R were determined for 98 of these patients. Results AMN were predominantly found on the head and neck. Dermoscopic patterns observed were nonspecific, reticular, globular, and parallel furrow, with most AMN having a nonspecific pattern. There were no associations between MC1R polymorphisms and clinical or dermoscopic features of AMN. Discussion Our results provide evidence that AMN in the Han population in China have similar dermoscopic patterns to those in European populations, but are present in much lower numbers. As there were no associations between clinical or dermoscopic features of AMN and MC1R polymorphisms, further studies should focus on candidate gene associations with AMN features and the risk of melanoma, with larger sample sizes and comparisons to AMN in other populations.

  20. [Analysis of genotype and phenotype correlation of MYH7-V878A mutation among ethnic Han Chinese pedigrees affected with hypertrophic cardiomyopathy].

    Science.gov (United States)

    Wang, Bo; Guo, Ruiqi; Zuo, Lei; Shao, Hong; Liu, Ying; Wang, Yu; Ju, Yan; Sun, Chao; Wang, Lifeng; Zhang, Yanmin; Liu, Liwen

    2017-08-10

    To analyze the phenotype-genotype correlation of MYH7-V878A mutation. Exonic amplification and high-throughput sequencing of 96-cardiovascular disease-related genes were carried out on probands from 210 pedigrees affected with hypertrophic cardiomyopathy (HCM). For the probands, their family members, and 300 healthy volunteers, the identified MYH7-V878A mutation was verified by Sanger sequencing. Information of the HCM patients and their family members, including clinical data, physical examination, echocardiography (UCG), electrocardiography (ECG), and conserved sequence of the mutation among various species were analyzed. A MYH7-V878A mutation was detected in five HCM pedigrees containing 31 family members. Fourteen members have carried the mutation, among whom 11 were diagnosed with HCM, while 3 did not meet the diagnostic criteria. Some of the fourteen members also carried other mutations. Family members not carrying the mutation had normal UCG and ECG. No MYH7-V878A mutation was found among the 300 healthy volunteers. Analysis of sequence conservation showed that the amino acid is located in highly conserved regions among various species. MYH7-V878A is a hot spot among ethnic Han Chinese with a high penetrance. Functional analysis of the conserved sequences suggested that the mutation may cause significant alteration of the function. MYH7-V878A has a significant value for the early diagnosis of HCM.

  1. Association between oxytocin and receptor genetic polymorphisms and aggression in a northern Chinese Han population with alcohol dependence.

    Science.gov (United States)

    Yang, Ling; Wang, Fan; Wang, Meiling; Han, Mei; Hu, Lufeng; Zheng, Minghua; Ma, Ji; Kang, Yimin; Wang, Pengxiang; Sun, Hongqiang; Zuo, Wei; Xie, Longteng; Wang, Aiju; Yu, Dongsheng; Liu, Yanlong

    2017-01-01

    Alcohol dependence (AD) is a common chronic brain disorder precipitated by complex interactions between biological, genetic, and environmental risk factors. Aggression often occurs in the context of AD. Previous studies have shown that Oxytocin (OXT) and OXT receptor (OXTR) are involved in the regulation of aggression. The present study investigated whether variations and interactions of OXT and OXTR genes were associated with AD-related aggression in a genetically homogeneous northern Chinese Han population. Three hundred and twenty-four male AD patients and 510 male healthy controls (HCs) were recruited. A Chinese version of the Buss-Perry Aggression Questionnaire was used as a subjective measurement of aggressive behavior. Three variations, rs2254298, rs53576, and rs6133010 were genotyped using TaqMan and ligase detection reaction for all subjects. Generalized Multifactor Dimensionality Reduction was used to detect interactions between genetic attributes and environmental attributes. The frequencies of alleles and genotypes of rs6133010 were significantly different between AD patients and HCs (paggression was significantly stronger than that of genotype AA and AG (p=0.001 and p=0.004, respectively), and the subjects with the interaction combination of rs6133010AA×rs2254298GG×rs53576AG exhibited significant effect on physical aggression (p=0.0107). The present study found that rs6133010 in the OXT gene is associated with AD in the northern Chinese Han population. The polymorphisms of OXT/R may play a key role in the susceptibility of AD-related aggression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Association of KIF6 Variant with Lipid Level and Angiographic Coronary Artery Disease Events Risk in the Han Chinese Population

    Directory of Open Access Journals (Sweden)

    Ge Wu

    2012-09-01

    Full Text Available KIF6 is a class of molecular motor from the kinesin superfamily. Recently, multiple large studies consisting mainly of Europeans have shown that KIF6 Trp719Arg SNP may be a new predictive factor for coronary artery disease (CAD event risk. The allelic frequency distribution of rs20455 is different in various populations, yet studies among the Han population, one of the largest ethnic groups in the World, have not been conducted. This study is aimed to evaluate the association of KIF6 Trp719Arg variant with angiographic CAD and serum lipid levels in the Han population from northern China. In this case-controlled study, peripheral blood samples were collected from 356 patients and 568 controls of Han Chinese origin. Genotyping was performed by a high-resolution melting curve. The impact of rs20455 on CAD and non-fatal MI was evaluated in a dominant genetic model with stepwise multiple regression analysis. There were no significant differences of genotypes and allele frequency between angiographic CAD and control groups (p > 0.05; however, that of MI and non-MI subgroups were significant differences (p < 0.05. After adjusting for significant risk factors, angiographic CAD risk was not significantly increased in 719Arg allele carriers compared with non-carriers. Further analysis revealed that the non-fatal MI risk and triglyceride levels were significantly higher in 719Arg allele carriers than non-carriers. In conclusion, KIF6 719Arg allele was not an independent risk factor for angiographic CAD susceptibility in Han populations from northern China. However, it was associated with a significantly higher TG level, which may indicate an increased myocardial infarction risk in angiographic CAD patients.

  3. Reference Equations for the Six-Minute Walk Distance in the Healthy Chinese Han Population, Aged 18-30 Years.

    Science.gov (United States)

    Zou, He; Zhang, Jia; Chen, Xiaoshu; Wang, Yi; Lin, Wei; Lin, Jianfeng; Chen, Hao; Pan, Jingye

    2017-08-29

    The six-minute walk test (6MWT) is a safe, simple, inexpensive tool for evaluating the functional exercise capacity. However, there is a lack of standard reference equations for the six-minute walk distance (6MWD) in the healthy Chinese Han population with an age of 18-30 years. The aims of the present study were as follows: 1) to measure the anthropometric data and the walking distance in a sample of healthy Chinese Han population, aged 18-30 years; 2) to construct reference equations for the 6MWD; 3) to compare the measured 6MWD of our cohort with previously published equations. The anthropometric data, demographic, lung function and the walking distance of Chinese Han population, aged 18-30 years, were prospectively measured using a standardized protocol. Informed consent was obtained from each participant and the approval was obtained from the ethics committee of Wenzhou People's Hospital. The 6MWT was performed twice and the longer 6MWD was used for further analysis. A total of 355 subjects (176 female and 179 male) completed the 6MWT, and the average walking distance was 627.3 ± 52.88 m. The walking distance was achieved by females compared with males (607.4 ± 51.00 m vs. 646.9 ± 47.15 m; p equations from Caucasian, Canadian and Chilean populations tend to overestimate the walking distance in our subjects, while Brazilian and Arabian equations tend to underestimate the walking distance. There was no significant difference in the walking distance between Korean equations and the current study. In summary, height and difference in heart rate before and after the walk test were the most significant predictors of the 6MWD, and the regression equations could explain approximately 38% and 31% of the distance variance in the female and male groups, respectively.

  4. Beijing’s Policies for Managing Han and Ethnic-Minority Chinese Communities Abroad

    Directory of Open Access Journals (Sweden)

    James To

    2012-01-01

    Full Text Available The overseas Chinese (OC form a vast network of powerful interest groups and important political actors capable of shaping the future of China from abroad by transmitting values back to their ancestral homeland (Tu 1991. While the Chinese Communist Party (CCP welcomes and actively seeks to foster relations with the OC in order to advance China’s national interests, some cohorts may be hostile to the regime. In accordance with their distinct demographic and ethnic pro-files, the CCP’s qiaowu (侨务, OC affairs infrastructure serves to entice, co-opt, or isolate various OC groupings. This article summarises the policies for managing different subsets of OC over the past three dec-ades, and argues that through qiaowu, the CCP has successfully unified cooperative groups for China’s benefit, while preventing discordant ones from eroding its grip on power.

  5. Estimation of stature by using the dimensions of the right hand and right foot in Han Chinese adults.

    Science.gov (United States)

    Zhang, Xinghua; Wei, Yu; Zheng, Lianbin; Yu, Keli; Zhao, Dapeng; Bao, Jinping; Li, Yonglan; Lu, Shunhua; Xi, Huanjiu; Xu, Guochang; Wen, Youfeng

    2017-01-01

    The Han Chinese people are the main ethnic group in China and the largest ethnic group in the world. The dimensions of the hands and feet have been successfully used for the estimation of stature. A total of 26,927 healthy adult subjects, comprising 13,221 men and 13,706 women, were recruited. The survey samples were chosen through random cluster sampling. The mean values were significantly higher in men than those in women for all measurements (Pstature (Pstature because it had the lowest standard error of estimate. The use of multiple regression equations yielded better results than did the use of linear regression equations. The accuracy of stature prediction ranged from ±4.81 to ±6.39 cm. The present study was of great importance with regards to improving the physical anthropology database of ethnic groups in China.

  6. Cultivating Morality in Chinese Families--Past, Present, and Future

    Science.gov (United States)

    Wang, Xiao-lei

    2017-01-01

    This article examines past and present moral education practices in Chinese families. It begins with a brief overview of Confucian thought on moral education and its lasting influence on Chinese moral ethos. It then identifies the types of moral values emphasised by Chinese parents, as well as the kinds of moral education literature they use for…

  7. Severe myopic anisometropia in a Chinese family.

    Science.gov (United States)

    Feng, Lei; Candy, T Rowan; Yang, Yabo

    2012-04-01

    The aim of this study is to describe a Chinese four-generation family with severe myopic anisometropia and to explore the possible pathogenesis for this disease. Eighteen individuals of a four-generation family participated in the study, including a pair of monozygotic (MZ) twins. A detailed family history and clinical data were recorded. All participants were subjected to ophthalmologic examinations including refractive error, slitlamp, and fundus examination. B-scan and A-scan ultrasonography were additionally ordered for each affected patient for further evaluation. Optical refractive correction was prescribed, and full-time occlusion therapy of 6 days weekly in right eye and 1 day weekly in left eye was prescribed for the MZ twins. Five individuals were affected with severe myopic anisometropia within this family, including the pair of MZ twins. In all affected individuals, the right eyes were more myopic than the left eyes, and axial length and anterior chamber depth measurements in the more myopic eyes were longer. After 6 months of therapy, the best corrected visual acuity in the amblyopic eye of the MZ twins improved significantly. The co-occurrence of severe myopic anisometropia in five individuals of the family supports a genetic basis for the disease. The successful therapeutic effect on anisometropic amblyopia highlights the importance of early detection and timely treatment.

  8. The GSK3B gene confers risk for both major depressive disorder and schizophrenia in the Han Chinese population.

    Science.gov (United States)

    Chen, Jianhua; Wang, Meng; Waheed Khan, Raja Amjad; He, Kuanjun; Wang, Qingzhong; Li, Zhiqiang; Shen, Jiawei; Song, Zhijian; Li, Wenjin; Wen, Zujia; Jiang, Yiwen; Xu, Yifeng; Shi, Yongyong; Ji, Weidong

    2015-10-01

    Glycogen synthease kinase-3B is a key gene encoding a protein kinase which is abundant in brain, and is involved in signal transduction cascades of neuronal cell development and energy metabolism. Previous researches proposed GSK3B as a potential region for schizophrenia. To validate the susceptibility of GSK3B to major depressive disorder, and to investigate the overlapping risk conferred by GSK3B for mental disorders, we performed a large-scale case-control study, analyzed 6 tag single nucleotide polymorphisms using TaqMan® technology in 1,045 major depressive disorder patients, 1,235 schizophrenia patients and 1,235 normal controls of Han Chinese origin. We found rs334535 (Pallele=2.79E-03, Pgenotype=5.00E-03, OR=1.429) and rs2199503 (Pallele=0.020, Pgenotype= 0.040, OR=1.157) showed association with major depressive disorder before Bonferroni correction. rs6771023 (adjusted Pallele=1.64E-03, adjusted Pgenotype=6.00E-03, OR=0.701) and rs2199503 (adjusted Pallele=0.001, adjusted Pgenotype=0.002, OR=1.251) showed significant association with schizophrenia after Bonferroni correction. rs2199503 (adjusted Pallele=1.70E-03, adjusted Pgenotype=0.006, OR=1.208) remained to be significant in the combined cases of major depressive disorder and schizophrenia after Bonferroni correction. Further validations of our findings in samples with larger scale are suggested, and functional genomic study is needed to elucidate the role of GSK3B in signal pathway and psychiatric disorders. Our results provide evidence that the GSK3B gene could be a promising region which contains genetic risk for both major depressive disorder and schizophrenia in the Han Chinese population. The study on variants conferring overlapping risk for multiple psychiatric disorders could be tangible pathogenesis support and clinical or diagnostic references. Copyright © 2015. Published by Elsevier B.V.

  9. The clinical features of infantile hypertrophic pyloric stenosis in Chinese Han population: analysis from 1998 to 2010.

    Directory of Open Access Journals (Sweden)

    Zhiqiang Feng

    Full Text Available OBJECTIVE: To investigate clinical features of infantile hypertrophic pyloric stenosis (IHPS in Chinese Han population. METHODS: Three hundred and sixteen hospitalized patients with IHPS from January 1998 to February 2010 were retrospectively reviewed, and data including patient's sex, onset age, other coexisting congenital defects, pyloric circular muscle thickness evaluated by ultrasonograph, serum electrolytes concentration, and results of arterial blood gas analysis on admission were collected. The patients were divided into two groups: the duration between first onset and admission less than or equal to 10 days (early onset group, and more than 10 days (late onset group. The results of arterial blood gas and serum electrolyte concentration were compared between the two groups. RESULTS: There were 271 males and 45 females in 316 patients; the onset age ranged between 1 and 351 (26.5±26.6 days. The birth weight ranged between 1.6 and 4.5 (3.23±0.44 kilograms; coexisting congenital defects were found in 65 cases (20.6%. Pyloric circular muscle thickness was 4-8 (5.4±1.0 millimetres (mm. For the early onset group, the rates of hypokalemia, hypochloraemia and hypercapnia were significantly lower than those in the late onset group (18.67% VS 50%, P<0.0001; 46.03% VS 71.01%, P = 0.003; 56.58% VS 83.44%, P = 2.17×10(-5; respectively. CONCLUSIONS: The symptom duration in Chinese Han population was longer than that in other populations. And as the prolongation of symptom duration, the incidence of acid-base imbalance increased significantly. Infants with persistent vomiting at the age of 3∼5 weeks after birth should be considered IHPS, and go to hospital as soon as possible in order to reduce the incidence of hypokalemia, hypochloraemia and hypercapnia, and avoid deterioration.

  10. Regression equations for calculation of z scores for echocardiographic measurements of right heart structures in healthy Han Chinese children.

    Science.gov (United States)

    Wang, Shan-Shan; Zhang, Yu-Qi; Chen, Shu-Bao; Huang, Guo-Ying; Zhang, Hong-Yan; Zhang, Zhi-Fang; Wu, Lan-Ping; Hong, Wen-Jing; Shen, Rong; Liu, Yi-Qing; Zhu, Jun-Xue

    2017-06-01

    Clinical decision making in children with congenital and acquired heart disease relies on measurements of cardiac structures using two-dimensional echocardiography. We aimed to establish z-score regression equations for right heart structures in healthy Chinese Han children. Two-dimensional and M-mode echocardiography was performed in 515 patients. We measured the dimensions of the pulmonary valve annulus (PVA), main pulmonary artery (MPA), left pulmonary artery (LPA), right pulmonary artery (RPA), right ventricular outflow tract at end-diastole (RVOTd) and at end-systole (RVOTs), tricuspid valve annulus (TVA), right ventricular inflow tract at end-diastole (RVIDd) and at end-systole (RVIDs), and right atrium (RA). Regression analyses were conducted to relate the measurements of right heart structures to 4body surface area (BSA). Right ventricular outflow-tract fractional shortening (RVOTFS) was also calculated. Several models were used, and the best model was chosen to establish a z-score calculator. PVA, MPA, LPA, RPA, RVOTd, RVOTs, TVA, RVIDd, RVIDs, and RA (R 2  = 0.786, 0.705, 0.728, 0.701, 0.706, 0.824, 0.804, 0.663, 0.626, and 0.793, respectively) had a cubic polynomial relationship with BSA; specifically, measurement (M) = β0 + β1 × BSA + β2 × BSA 2  + β3 × BSA. 3 RVOTFS (0.28 ± 0.02) fell within a narrow range (0.12-0.51). Our results provide reference values for z scores and regression equations for right heart structures in Han Chinese children. These data may help interpreting the routine clinical measurement of right heart structures in children with congenital or acquired heart disease. © 2016 Wiley Periodicals, Inc. J Clin Ultrasound 45:293-303, 2017. © 2017 Wiley Periodicals, Inc.

  11. Vitamin D Receptor Genetic Polymorphism Is Significantly Associated with Risk of Type 2 Diabetes Mellitus in Chinese Han Population.

    Science.gov (United States)

    Jia, Jian; Ding, Haixia; Yang, Keming; Mao, Lina; Zhao, Hailong; Zhan, Yiyang; Shen, Chong

    2015-10-01

    We investigated the effect of vitamin D receptor (VDR) gene polymorphism on the risk of type 2 diabetes mellitus (T2DM) in a Chinese Han population. Three tagSNPs (rs11574129, rs2228570 and rs739837) were genotyped using TaqMan assays in a case-control study including 669 cases with T2DM, 1084 individuals with impaired fasting glucose (IFG) and 1,961 controls with normal fasting glucose. Multiple logistic regression was applied to analyze the association of SNPs and the risk of diabetes by adjusting for covariates including age, sex, body mass index (BMI) and smoking. General linear model (GLM) was applied to compare fasting blood glucose levels between genotypes and adjusted for confounding factors. The results showed that rs739837 was significantly associated with increased risk of T2DM in additive model (OR = 1.166, 95% CI 1.017-1.337, p = 0.028) and dominant (OR = 1.166, 95% CI 1.017-1.337, p = 0.002) model. Stratified analysis showed that rs739837 and rs2228570 were, respectively, correlated with T2DM in females and males. Significant associations were found between three SNPs and T2DM in the population analysis indicated that the CC group of rs2228570 has lower fasting glucose than TT/TC genotype group in controls. This study provides further evidence that rs739837 in the VDR gene is associated with increased risk of T2DM in a Chinese Han population. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  12. A functional polymorphism in the SPINK5 gene is associated with asthma in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Li Huaichen

    2009-06-01

    Full Text Available Abstract Background Mutation in SPINK5 causes Netherton syndrome, a rare recessive skin disease that is accompanied by severe atopic manifestations including atopic dermatitis, allergic rhinitis, asthma, high serum IgE and hypereosinophilia. Recently, single nucleotide polymorphism (SNP of the SPINK5 was shown to be significantly associated with atopy, atopic dermatitis, asthma, and total serum IgE. In order to determine the role of the SPINK5 in the development of asthma, a case-control study including 669 asthma patients and 711 healthy controls in Han Chinese was conducted. Methods Using PCR-RFLP assay, we genotyped one promoter SNP, -206G>A, and four nonsynonymous SNPs, 1103A>G (Asn368Ser, 1156G>A (Asp386Asn, 1258G>A (Glu420Lys, and 2475G>T (Glu825Asp. Also, we analyzed the functional significance of -206G>A using the luciferase reporter assay and electrophoresis mobility shift assay. Results we found that the G allele at SNP -206G>A was associated with increased asthma susceptibility in our study population (p = 0.002, odds ratio 1.34, 95% confidence interval 1.11–1.60. There was no significant association between any of four nonsynonymous SNPs and asthma. The A allele at -206G>A has a significantly higher transcriptional activity than the G allele. Electrophoresis mobility shift assay also showed a significantly higher binding efficiency of nuclear protein to the A allele compared with the G allele. Conclusion Our findings indicate that the -206G>A polymorphism in the SPINK5 is associated with asthma susceptibility in a Chinese Han population.

  13. 4q22.1 contributes to bone mineral density and osteoporosis susceptibility in postmenopausal women of Chinese Han population.

    Science.gov (United States)

    Yang, Haojie; Zhang, Bo; Zhu, Jialin; Liu, Dan; Guan, Fanglin; He, Xijing

    2013-01-01

    Osteoporosis is a multifactorial disease in which genetic determinants are modulated by hormonal, environmental and nutritional factors. An important clinical risk factor in the pathogenesis of osteoporosis is the presence of genetics polymorphism in/around susceptibility genes/regions. This study explored whether the region of 4q22.1, which confers risk of developing osteoporosis in some populations, associated with bone mineral density and osteoporosis susceptibility in postmenopausal women of Han Chinese. We investigated 32 SNPs with minor allele frequencies ≥0.05 between 20 kb upstream and 20 kb downstream (40 kb window) of rs6532023, mapping in the 4q22.1 region, which was reported to be significantly associated with osteoporosis in previous studies. We found that rs6532023 was significantly associated with bone mineral density and osteoporosis (corrected p = 0.015) in our sample, including 440 cases and 640 controls, and allele G was supposed as a risk factor while T worked as a protective factor. Further genotype association analyses suggested a similar pattern (corrected p = 0.040). Additionally, analyses by haplotypes indicated that a haplotype block rs7683315-rs6532023-rs1471400-rs1471403 in the region associated with bone mineral density and osteoporosis (global p = 0.032), and risk haplotype A-G-G-C had almost 1.5-fold increased in the cases. To our knowledge, this is the first report to examine 4q22.1 region polymorphisms and osteoporosis in Han Chinese. Our results provide further evidence for an effect of the region of 4q22.1 on the etiology of osteoporosis and suggest that 4q22.1 may be a genetic risk factor for bone mineral density and osteoporosis.

  14. Interleukin-6 Promoter Polymorphisms and Susceptibility to Atrial Fibrillation in Elderly Han Chinese Patients with Essential Hypertension

    Science.gov (United States)

    Li, Jing; Song, Jie; Jiang, Min-Hui; Zheng, Jin-Guo; Gao, Shu-Ping; Zhu, Jian-Hua

    2012-01-01

    There is an accumulating body of evidence indicating a strong association between inflammation and the pathogenesis of atrial fibrillation (AF). Interleukin-6 (IL-6) is a pleiotropic cytokine, functions as a mediator of inflammatory response, and has both proinflammatory and anti-inflammatory properties. The aim of the present study was to investigate the association of the −634C/G polymorphism of the IL-6 gene with AF in elderly Han Chinese patients with essential hypertension (EH). A total of 169 elderly patients with EH were eligible for this study. Patients with AF (n=75) were allocated to the AF group, and 94 subjects without AF to the control group. The polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP) technique was used to assess the genotype frequencies. The distribution of the IL-6 −634C/G genotypes (CC, CG, and GG) was 67.02%, 30.85%, and 2.13% in the controls, and 50.67%, 40.00%, and 9.33% in AF subjects, respectively (P=0.0312). The frequency of the G allele in the AF group was significantly higher than that in the control group (29.33% vs. 17.55%, P=0.0103). Compared with the CC and CG genotypes, the GG homozygote had a 4.7353-fold increased risk of AF [95% confidence interval (CI)=0.9537–23.5116, P=0.0382]. These findings suggest that the IL-6 −634C/G polymorphism is associated with AF, and the G allele has increased risk of AF in elderly Han Chinese patients with EH. PMID:22924939

  15. Association between vitamin D insufficiency and elevated serum uric acid among middle-aged and elderly Chinese Han women.

    Directory of Open Access Journals (Sweden)

    Hao Peng

    Full Text Available BACKGROUND: Association between vitamin D insufficiency and hyperuricemia has not been reported so far. We aimed to study the association of vitamin D insufficiency with elevated serum uric acid among middle-aged and elderly Chinese Han women. METHODS: We collected data from participants residing in Jinchang district of Suzhou from January to May, 2010. Serum uric acid, 25-hydroxy vitamin D and other traditional biomarkers including fasting plasma glucose and blood lipids were determined in 1726 women aged above 30 years. Association between vitamin D insufficiency and elevated uric acid was analyzed in premenopausal and postmenopausal women, respectively. RESULTS: Among postmenopausal women, 25-hydroxy vitamin D level of participants with elevated uric acid was lower than that of those with normal uric acid (median [interquartile range]: 35[28-57] vs 40[32-58], µg/L; P = 0.006. Elevated uric acid was more prevalent in participants with vitamin D insufficiency compared to those without vitamin D insufficiency (16.50% vs 8.08%; P<0.001. Association between vitamin D insufficiency and elevated uric acid was not significant among premenopausal women. However, participants with vitamin D insufficiency were more likely to have elevated uric acid compared with those without vitamin D insufficiency among postmenopausal women (OR, 95% CI: 2.38, 1.47-3.87. Moreover, after excluding individuals with diabetes and/or hypertension, the association of vitamin D insufficiency with elevated uric acid was still significant (OR, 95% CI: 2.48, 1.17-5.44. CONCLUSIONS: Vitamin D insufficiency was significantly associated with elevated uric acid among postmenopausal Chinese Han women. This study suggested that a clinical trial should be conducted to confirm the association of vitamin D insufficiency with hyperuricemia.

  16. Lack of an association of PD-1 and its ligand genes with Behcet's disease in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Qianli Meng

    Full Text Available BACKGROUND: Behcet's disease is a chronic, multi-systemic autoimmune disease. Programmed cell death 1 (PD-1 gene is one of non-human leucocyte antigen genes. It has been demonstrated to be associated with several autoimmune diseases. However, only a few studies have addressed the association of ligand genes of PD-1, PD-L1 and PD-L2 with autoimmune disease. The purpose of this study was to analyze the potential association of the PD-1 and its ligand genes with Behcet's disease in a Chinese Han population. METHODOLOGY/PRINCIPAL FINDINGS: Four single-nucleotide polymorphism (SNPs rs2227981 and rs10204525 of PD-1, rs1970000 of PD-L1 and rs7854303 of PD-L2 were genotyped in 405 Behcet's patients and 414 age-, sex-, ethnic-matched healthy controls using polymerase chain reaction-restriction fragment length polymorphism assay. The results revealed that there were no significant differences in the genotype and allele frequencies of PD-1 rs2227981 and rs10204525 between the Behcet's patients and controls. A similar result was found for PD-L1 rs1970000 versus healthy controls. Only the C allele and the CC genotype of PD-L2 rs7854303 were identified in patients and controls. Stratification analysis based on gender and clinical findings did not show any associations between PD-1 or its ligand polymorphisms and Behcet's disease. CONCLUSIONS/SIGNIFICANCE: None of the currently studied SNPs, PD-1 rs2227981 and rs10204525, PD-L1 rs1970000 and PD-L2 rs7854303, are associated with the susceptibility to Behcet's disease in a Chinese Han population. More studies are needed to confirm these findings in Behcet's patients with other ethnic backgrounds.

  17. The Association Study between Twenty One Polymorphisms in Seven Candidate Genes and Coronary Heart Diseases in Chinese Han Population.

    Directory of Open Access Journals (Sweden)

    Barrak F Alobeidy

    Full Text Available Previous genome-wide association studies (GWAS in multiple populations identified several genetic loci for coronary heart diseases (CHD. Here we utilized a 2-stage candidate gene association strategy in Chinese Han population to shed light on the putative association between several metabolic-related candidate genes and CHD. At the 1(st stage, 190 patients with CHD and 190 controls were genotyped through the MassARRAY platform. At the 2(nd stage, a larger sample including 400 patients and 392 controls was genotyped by the High Resolution Melt (HRM method to confirm or rule out the associations with CHD. MLXIP expression level was quantified by the real time PCR in 65 peripheral blood samples. From the 21 studied single nucleotide polymorphisms (SNPs of seven candidate genes: MLXIPL, MLXIP, MLX, ADIPOR1, VDR, SREBF1 and NR1H3, only one tag SNP rs4758685 (T→C was found to be statistically associated with CHD (P-value = 0.02, Odds ratio (OR of 0.83. After adjustment for the age, sex, lipid levels and diabetes, the association remained significant (P-value = 0.03. After adjustment for the hypertension, P-value became 0.20 although there was a significant difference in the allele distribution between the CHD patients with hypertension and the controls (P-value = 0.04, 406 vs 582. In conclusion, among the 21 tested SNPs, we identified a novel association between rs4758685 of MLXIP gene and CHD. The C allele of common variant rs4758685 interacted with hypertension, and was found to be protective against CHD in both allelic and genotypic models in Chinese Han population.

  18. Major depressive disorder and suicide risk among adult outpatients at several general hospitals in a Chinese Han population.

    Science.gov (United States)

    Li, Haiyan; Luo, Xinni; Ke, Xiaoyin; Dai, Qing; Zheng, Wei; Zhang, Chanjuan; Cassidy, Ryan M; Soares, Jair C; Zhang, XiangYang; Ning, Yuping

    2017-01-01

    Somatic complaints are often the presenting symptoms of major depressive disorder (MDD) in the outpatient context, because this may go unrecognized. It is well understood that MDD carries an increased risk of suicide. This study aimed to identify the risk factors and association with both MDD and suicidality among Han Chinese outpatients. A multicenter study was carried out in 5189 outpatient adults (≥18 years old) in four general hospitals in Guangzhou, China. The 1392 patients who had the Patient Health Questionnaire-9 (PHQ-9) score ≥ 5, indicating depressive symptoms were offered an interview with a psychiatrist by the Mini International Neuropsychiatric Interview (MINI); 819 patients consented and completed the MINI interview. MINI module B was used to assess suicidality. Stepwise binary logistic models were used to estimate the relationship between a significant risk factor and suicide or MDD. According to with or without MDD, the secondary analysis was performed using the logistic regression model for the risk of suicidility. The current prevalence of MDD and the one month prevalence of suicidality were 3.7% and 2.3% respectively. The odds ratio of suicidality in women was more than twice that in men (OR = 2.62; 95% CI 1.45-4.76). Other risk factors which were significantly associated with suicidality were: living alone, higher education, self-reported depression, getting psychiatric diagnoses (MDD, anxiety disorders, and bipolar disorders). Significant risk factors for MDD were also noticed, such as comorbid anxiety disorders, self-reported anxiety, insomnia, suicidal ideation. It's a cross-sectional study in outpatient clinics using self-report questionnaires. This study provides valuable data about the risk factors and association of MDD and suicide risk in adult outpatients in Han Chinese. Those factors allow better the employment of preventative measures.

  19. Best anthropometric and atherogenic predictors of metabolic syndrome in the Chinese Han population in Xinjiang: the Cardiovascular Risk Survey.

    Science.gov (United States)

    Chen, Bang-Dang; He, Chun-Hui; Ma, Yi-Tong; Yang, Yi-Ning; Liu, Fen; Pan, Shuo; Ma, Xiang; Li, Xiao-Mei; Fu, Zhen-Yan; Xie, Xiang; Zheng, Ying-Ying

    2014-01-01

    This study aimed to identify the best predictor of metabolic syndrome (MetS) by comparing the predicting ability of various anthropometric and atherogenic parameters in the Chinese Han population in Xinjiang. A representative, cross-sectional sample of 5,757 Chinese Han adults were selected from the Cardiovascular Risk Survey conducted from October 2007 to March 2010. MetS prevalence, area under the curve (AUC), distance on the receiver operating characteristic curve and the cut-offs of each variable were compared for the presence of MetS. According to the criteria of the International Diabetes Federation (IDF), the Joint Interim Statement (JIS) and the Third Adult Treatment Panel (ATPIII), 32.1, 48.5, 39.3% of men and 38.0, 45.1, 44.9% of women had MetS in Xinjiang. According to the IDF criteria, the waist-to-height ratio (WHtR) had the highest AUC value in men (0.836) and women (0.837), with the optimal cut-off of 0.54 in men and 0.53 in women. According to both the JIS and ATPIII criteria, triglycerides/high-density lipoprotein cholesterol TG/HDL-C had the highest AUC value in men (0.830 and 0.833, respectively) and women (0.832 and 0.827, respectively), with the optimal cut-offs being 1.6 and 1.2 in men and 1.1 and 1.1 in women, respectively. WHtR was the best predictor of MetS according to the IDF criteria while TG/HDL-C was the best predictor of MetS according to the JIS and ATPIII criteria.

  20. Neck circumference might predict gestational diabetes mellitus in Han Chinese women: A nested case-control study.

    Science.gov (United States)

    He, Fang; He, Hua; Liu, Wenqi; Lin, Junyu; Chen, Bingjun; Lin, Yucong; Zhao, Yitao; Tao, Wen; Xia, Xuefeng

    2017-03-01

    A large neck circumference might be an indicator of metabolic syndrome and its components, and for certain patients is more practical as an index than waist circumference. The demarcation value for neck circumference that suggests metabolic syndrome appears to vary by ethnic group. Gestational diabetes mellitus is considered a component of metabolic syndrome in pregnant women. We investigated whether neck circumference in Han Chinese women is associated with gestational diabetes mellitus in early pregnancy, and determined a predictive demarcation value. A nested case-control study was carried out with 255 women aged 18-35 years. Gestational diabetes mellitus was diagnosed according to the criteria of the American Diabetes Association through a 2-h, 75-g oral glucose tolerance test. Of the total population, 41 (16%) women developed gestational diabetes mellitus by 24-28 weeks of gestation. Neck circumference at gestational week 16 positively correlated with pre-pregnancy waist circumference, bodyweight and body mass index, and maternal age (P = 0.029) and hemoglobin A1c at gestational week 24 (P ≤ 0.001). By binary logistic regression, neck circumference was an independent predictor of gestational diabetes mellitus (odds ratio 1.840, 95% confidence interval 1.040-3.254; P = 0.036). According to the receiver operating characteristic curve, for predicting gestational diabetes mellitus the optimal demarcation for neck circumference at gestational week 16 was 35.15 cm. Neck circumference is a viable tool to screen for gestational diabetes mellitus. In this population of pregnant Han Chinese women, a neck circumference of ≥35.15 cm was a predictor of gestational diabetes mellitus. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  1. TNF-α-308 polymorphism determines clinical manifestations and therapeutic response of ankylosing spondylitis in Han Chinese.

    Science.gov (United States)

    Ma, Hai-Jun; Yin, Qing-Feng; Wu, Yin; Guo, Ming-Hao

    2017-12-20

    There is ongoing debate as to whether tumor necrosis factor alpha (TNF-α)-308 is associated with ankylosing spondylitis (AS). The aim of the present study was to determine whether TNF-α-308 is involved into genetic susceptibility, clinical features and therapeutic response of AS in Han Chinese. Two hundred and sixty AS patients with 260 ethnically matched healthy blood donors were enrolled into the present study. TNF-α-308 promoter polymorphism was identified using polymerase chain reaction amplification with restriction fragment length polymorphism assay. Population genetic analysis showed that the prevalence of allele A and G/A genotype was equally infrequent in both AS patients (3.85% and 7.69%) and healthy subjects (4.23% and 8.46%). Compared with the carriers of G/G genotype, remarkably elevated erythrocyte sedimentation rate and serum C-reactive protein were observed in AS patients with G/A variant (87.06±49.40 vs. 55.53±42.99mm/h, P=.0126; 54.95±27.77 vs. 34.36±36.13mg/dl, P=.0116, respectively), and they always presented with inflammatory spinal pain (70.00% vs. 43.33%, P=0.0214) and suffered relatively mild sacroiliitis (65.00% vs. 41.67%, P=0.0431). The allele G and G/G genotype were more frequent in good responders to anti-TNF-α treatment (96.55% vs. 73.53%, P=.0032; 93.10% vs. 47.06%, P=.0015), whereas there was no obvious superiority of them in predicting therapeutic response of conventional medications for AS. Our data suggest that TNF-α-308 polymorphism may influence the clinical features rather than susceptibility to AS in our Han Chinese. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  2. Association between common variants near LBX1 and adolescent idiopathic scoliosis replicated in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Wenjie Gao

    Full Text Available BACKGROUND: Adolescent idiopathic scoliosis (AIS is one of the most common spinal deformities found in adolescent populations. Recently, a genome-wide association study (GWAS in a Japanese population indicated that three single nucleotide polymorphisms (SNPs, rs11190870, rs625039 and rs11598564, all located near the LBX1 gene, may be associated with AIS susceptibility [1]. This study suggests a novel AIS predisposition candidate gene and supports the hypothesis that somatosensory functional disorders could contribute to the pathogenesis of AIS. These findings warrant replication in other populations. METHODOLOGY/PRINCIPAL FINDINGS: First, we conducted a case-control study consisting of 953 Chinese Han individuals from southern China (513 patients and 440 healthy controls, and the three SNPs were all found to be associated with AIS predisposition. The ORs were observed as 1.49 (95% CI 1.23-1.80, P = 5.09E-5, 1.70 (95% CI 1.42-2.04, P = 1.17E-8 and 1.52 (95% CI 1.27-1.83, P = 5.54E-6 for rs625039, rs11190870 and rs11598564, respectively. Second, a case-only study including a subgroup of AIS patients (N = 234 was performed to determine the effects of these variants on the severity of the condition. However, we did not find any association between these variants and the severity of curvature. CONCLUSION: This study shows that the genetic variants near the LBX1 gene are associated with AIS susceptibility in Chinese Han population. It successfully replicates the results of the GWAS, which was performed in a Japanese population.

  3. Genome-wide scans reveal variants at EDAR predominantly affecting hair straightness in Han Chinese and Uyghur populations.

    Science.gov (United States)

    Wu, Sijie; Tan, Jingze; Yang, Yajun; Peng, Qianqian; Zhang, Manfei; Li, Jinxi; Lu, Dongsheng; Liu, Yu; Lou, Haiyi; Feng, Qidi; Lu, Yan; Guan, Yaqun; Zhang, Zhaoxia; Jiao, Yi; Sabeti, Pardis; Krutmann, Jean; Tang, Kun; Jin, Li; Xu, Shuhua; Wang, Sijia

    2016-11-01

    Hair straightness/curliness is one of the most conspicuous features of human variation and is particularly diverse among populations. A recent genome-wide scan found common variants in the Trichohyalin (TCHH) gene that are associated with hair straightness in Europeans, but different genes might affect this phenotype in other populations. By sampling 2899 Han Chinese, we performed the first genome-wide scan of hair straightness in East Asians, and found EDAR (rs3827760) as the predominant gene (P = 4.67 × 10-16), accounting for 3.66 % of the total variance. The candidate gene approach did not find further significant associations, suggesting that hair straightness may be affected by a large number of genes with subtle effects. Notably, genetic variants associated with hair straightness in Europeans are generally low in frequency in Han Chinese, and vice versa. To evaluate the relative contribution of these variants, we performed a second genome-wide scan in 709 samples from the Uyghur, an admixed population with both eastern and western Eurasian ancestries. In Uyghurs, both EDAR (rs3827760: P = 1.92 × 10-12) and TCHH (rs11803731: P = 1.46 × 10-3) are associated with hair straightness, but EDAR (OR 0.415) has a greater effect than TCHH (OR 0.575). We found no significant interaction between EDAR and TCHH (P = 0.645), suggesting that these two genes affect hair straightness through different mechanisms. Furthermore, haplotype analysis indicates that TCHH is not subject to selection. While EDAR is under strong selection in East Asia, it does not appear to be subject to selection after the admixture in Uyghurs. These suggest that hair straightness is unlikely a trait under selection.

  4. A TagSNP in SIRT1 gene confers susceptibility to myocardial infarction in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Jie Cheng

    Full Text Available SIRT1 exerts protective effects against endothelial cells dysfunction, inflammation and atherosclerosis, indicating an important role on myocardial infarction (MI pathogenesis. Nonetheless, the effects of SIRT1 variants on MI risk remain poorly understood. Here we aimed to investigate the influence of SIRT1 polymorphisms on individual susceptibility to MI. Genotyping of three tagSNPs (rs7069102, rs3818292 and rs4746720 in SIRT1 gene was performed in a Chinese Han population, consisting of 287 MI cases and 654 control subjects. In a logistic regression analysis, we found that G allele of rs7069102 had increased MI risk with odds ratio (OR of 1.57 [95% confidence interval (CI = 1.15-2.16, Bonferroni corrected P (Pc = 0.015] after adjustment for conventional risk factors compared to C allele. Similarly, the combined CG/GG genotypes was associated with the increased MI risk (OR = 1.64, 95% CI = 1.14-2.35, Pc = 0.021 compared to the CC genotype. Further stratified analysis revealed a more significant association with MI risk among younger subjects (≤ 55 years old. Consistent with these results, the haplotype rs7069102G-rs3818292A-rs4746720T containing the rs7069102 G allele was also associated with the increased MI risk (OR = 1.41, 95% CI = 1.09-1.84, Pc = 0.040. However, we did not detect any association of rs3818292 and rs4746720 with MI risk. Our study provides the first evidence that the tagSNP rs7069102 and haplotype rs7069102G-rs3818292A-rs4746720T in SIRT1 gene confer susceptibility to MI in the Chinese Han population.

  5. Association of genetic variants with isolated fasting hyperglycaemia and isolated postprandial hyperglycaemia in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Xiaomu Kong

    Full Text Available Though multiple single nucleotide polymorphisms (SNPs associated with type 2 diabetes have been identified, the genetic bases of isolated fasting hyperglycaemia (IFH and isolated postprandial hyperglycaemia (IPH were still unclear. In present study, we aimed to investigate the association of genome-wide association study-validated genetic variants and IFH or IPH in Han Chinese.We genotyped 27 validated SNPs in 6,663 unrelated individuals comprising 341 IFH, 865 IPH, 1,203 combined fasting hyperglycaemia and postprandial hyperglycaemia, and 4,254 normal glycaemic subjects of Han ancestry. The distributions of genotype frequencies of FTO, CDKAL1 and GCKR were significant different between individuals with IFH and those with IPH (SNP(ptrend : rs8050136(0.0024, rs9939609(0.0049, rs7756992(0.0122, rs780094(0.0037. Risk allele of FTO specifically increased the risk of IFH (rs8050136: OR 1.403 [95% CI 1.125-1.750], p = 0.0027; rs9939609: 1.398 [1.120-1.744], p = 0.0030. G allele of CDKAL1 specifically increased the risk of IPH (1.217 [1.092-1.355], p = 0.0004. G allele of GCKR increased the risk of IFH (1.167 [0.999-1.362], p = 0.0513, but decreased the risk of IPH (0.891 [0.801-0.991], p = 0.0331. In addition, TCF7L2 and KCNQ1 increased the risk of both IFH and IPH. When combined, each additional risk allele associated with IFH increased the risk for IFH by 1.246-fold (p<0.0001, while each additional risk allele associated with IPH increased the risk for IPH by 1.190-fold (p<0.0001.Our results indicate that genotype distributions of variants from FTO, GCKR, CDKAL1 were different between IPH and IFH in Han Chinese. Variants of genes modulating insulin sensitivity (FTO, GCKR contributed to the risk of IFH, while variants of genes related to beta cell function (CDKAL1 increase the risk of IPH.

  6. The prevalence, clinical correlates and structure of phobic fears in Han Chinese women with recurrent major depression.

    Science.gov (United States)

    Yang, Fuzhong; Qiu, Jianyin; Zhao, Hongsu; Wang, Zhoubing; Tao, Danhong; Xiao, Xue; Niu, Qihui; Wang, Qian; Li, Yajuan; Guo, Liyang; Li, Jianying; Li, Kan; Xia, Jing; Wang, Lina; Shang, Xiaofang; Sang, Wenhua; Gan, Zhaoyu; He, Kangmei; Zhao, Xiaochuan; Tian, Tian; Xu, Dan; Gu, Danhua; Weng, Xiaoqin; Li, Haimin; Tian, Jing; Yang, Lijun; Li, Qiang; Yang, Qingzhen; Wang, Hui; Dang, Yamei; Dai, Lei; Cui, Yanping; Ye, Dong; Cao, Juling; Guo, Li; Kang, Zhen; Liu, Jimeng; Chen, Bin; Liu, Jinhua; Zhang, Jinling; Yang, Donglin; Jiao, Bin; Yu, Fengyu; Geng, Feng; Li, Ling; Yang, Haiying; Dai, Hong; Wang, Hongli; Liu, Caixing; Liu, Haijun; Peng, Longyan; Wang, Xiaoping; Wei, Shaojun; Liu, Xiaojuan; Li, Chang; Liu, Zhengrong; Zhang, Qiwen; Di, Dongchuan; Shi, Shenxun; Flint, Jonathan; Kendler, Kenneth S

    2014-03-01

    Phobic fears are common in the general population and among individuals with major depression (MD). We know little about the prevalence, clinical correlates, and structure of phobic fears in Chinese women with MD. We assessed 22 phobic fears in 6017 Han Chinese women with MD. We used exploratory factor analysis to examine the structure of these phobic fears. We examined the relationship between individual phobic fears and the severity of MD, neuroticism, comorbid panic disorder, generalized anxiety disorder and dysthymia using logistic regression models. The frequency of phobic fears ranged from 3.0% (eating in public) to 36.0% (snakes). Phobic fears were significantly associated with more severe MD, high neuroticism, and co-morbid panic disorder, generalized anxiety disorder and dysthymia. Our factor analysis suggested four underlying subgroups of phobic fears which differed in their clinical correlates, severity and patterns of comorbidity. Data were collected retrospectively through interview and recall bias may have affected the results. Phobic fears are correlated with comorbid MD and more severe MD. These phobic fears clearly subdivide into four subgroups that differ meaningfully from each other. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Associations of Polymorphisms in WNT9B and PBX1 with Mayer-Rokitansky-Kuster-Hauser Syndrome in Chinese Han.

    Directory of Open Access Journals (Sweden)

    Wenqing Ma

    Full Text Available Mayer-Rokitansky-Küster-Hauser (MRKH syndrome is a rare syndrome that is characterized by congenital aplasia of the uterus and the upper portion (2/3 of the vagina. Previous attempts to identify causal mutations of MRKH syndrome have primarily resulted in negative outcomes. We investigated whether these reported variants are associated with MRKH syndrome (types I and II in a relatively large sample size of Chinese Han patients, and whether any gene-gene epistatic interactions exist among these variants.This study included 182 unrelated Chinese women with MRKH syndrome (155 with type I and 27 with type II and 228 randomized female controls. Seventeen candidate loci in the AMH, PBX1, WNT4, WNT7A, WNT9B, HOXA10, HOXA11, LHXA1 and GALT genes were genotyped using the Sequenom MassARRAY iPLEX platform. Single-marker association, additive effects and multifactor interactions were investigated.The gene frequency distributions of MRKH type 1 and type 2 were similar. Rs34072914 in WNT9B was found to be associated with MRKH syndrome (P = 0.024, OR = 2.65, 95%CI = 1.14-6.17. The dominant models of rs34072914 and rs2275558 in WNT9B and PBX1, respectively, were significantly associated with MRKH syndrome risk in the Chinese Han patients. Additive gene-gene interaction analyses indicated a significant synergetic interaction between WNT9B and PBX1 (RERI = 1.397, AP = 0.493, SI = 4.204. Multifactor dimensionality reduction (MDR analysis revealed novel dimensional epistatic four-gene effects (AMH, PBX1, WNT7A and WNT9B in MRKH syndrome.This association study successfully identified two susceptibility SNPs (WNT9B and PBX1 associated with MRKH syndrome risk, both separately and interactively. The discovery of a four-gene epistatic effect (AMH, PBX1, WNT7A and WNT9B in MRKH syndrome provides novel information for the elucidation of the genetic mechanism underlying the etiology of MRKH syndrome.

  8. The mutational spectrum in a cohort of Charcot-Marie-Tooth disease type 2 among the Han Chinese in Taiwan.

    Directory of Open Access Journals (Sweden)

    Kon-Ping Lin

    Full Text Available BACKGROUND: Charcot-Marie-Tooth disease type 2 (CMT2 is a clinically and genetically heterogeneous group of inherited axonal neuropathies. The aim of this study was to extensively investigate the mutational spectrum of CMT2 in a cohort of patients of Han Chinese. METHODOLOGY AND PRINCIPAL FINDINGS: Genomic DNA from 36 unrelated Taiwanese CMT2 patients of Han Chinese descent was screened for mutations in the coding regions of the MFN2, RAB7, TRPV4, GARS, NEFL, HSPB1, MPZ, GDAP1, HSPB8, DNM2, AARS and YARS genes. Ten disparate mutations were identified in 14 patients (38.9% of the cohort, including p.N71Y in AARS (2.8%, p.T164A in HSPB1 (2.8%, and p.[H256R]+[R282H] in GDAP1 (2.8% in one patient each, three NEFL mutations in six patients (16.7% and four MFN2 mutations in five patients (13.9%. The following six mutations were novel: the individual AARS, HSPB1 and GDAP1 mutations and c.475-1G>T, p.L233V and p.E744M mutations in MFN2. An in vitro splicing assay revealed that the MFN2 c.475-1G>T mutation causes a 4 amino acid deletion (p.T159_Q162del. Despite an extensive survey, the genetic causes of CMT2 remained elusive in the remaining 22 CMT2 patients (61.1%. CONCLUSIONS AND SIGNIFICANCE: This study illustrates the spectrum of CMT2 mutations in a Taiwanese CMT2 cohort and expands the number of CMT2-associated mutations. The relevance of the AARS and HSPB1 mutations in the pathogenesis of CMT2 is further highlighted. Moreover, the frequency of the NEFL mutations in this study cohort was unexpectedly high. Genetic testing for NEFL and MFN2 mutations should, therefore, be the first step in the molecular diagnosis of CMT2 in ethnic Chinese.

  9. Reference Intervals of Serum Sodium, Potassium, and Chlorine in Chinese Han Population and Comparison of Two ISE Methods.

    Science.gov (United States)

    Jia, Keke; Zhang, Chuanbao; Huang, Xianzhang; Wang, Lanlan; Hao, Xiaoke; Mu, Runqing; Pan, Baishen; Zhang, Jie; Chen, Wenxiang; Xu, Ning; Li, Guixing; Ma, Yueyun; Ma, Ming; Guo, Wei; Shang, Hong

    2015-05-01

    Currently there are no reference intervals (RIs) of sodium (Na), potassium (K), and chlorine (Cl) on Chinese population. Two kinds of ion-selective electrode (ISE) methods were commonly used to determine K, Na, and Cl levels in China, the difference between these two methods needs to be evaluated. A total of 4,524 healthy participants (1,916 males and 2,608 females) between 20-79 years old from six cities in China were selected by strict criteria. Serum K, Na, and CL were tested on Roche Modular analyzers in six assigned laboratories. According to EP-9A2, using Roche Modular analyzer (indirect ISE) as comparative method, Olympus AU 5400 analyzer (indirect ISE) and Johnson&Johnson Fusion 5.1 analyzer (direct ISE) were evaluated. In Chinese population, the RIs for K, Na, and CL are 3.6-5.2, 136-146, and 99-110 mmol/l, respectively. Compared to the Roche indirect ISE method, Johnson direct ISE method showed a positive bias; and Olympus indirect ISE method just showed a very slight bias. The RIs of K, Na, and Cl of Han Chinese healthy adult population were found to be smaller than those provided by the manufacturer. By a criteria of biological variations for CV, the differences of Na and K between Roche analyzer and Johnson analyzer were not acceptable for clinical application, while the differences of Na, K, and Cl between Roche and Olympus analyzers were acceptable for clinical application. © 2014 Wiley Periodicals, Inc.

  10. Chinese American Family Food Systems: Impact of Western Influences

    Science.gov (United States)

    Lv, Nan; Brown, J. Lynne

    2010-01-01

    Objective: To investigate the family food system in first-generation Chinese American families. Design: Qualitative interviews using reciprocal determinism constructs to understand influences on food choices. Setting: Weekend Chinese schools in Pennsylvania. Participants: Twenty couples with at least 1 child aged 5 or older enrolled in a Chinese…

  11. Evaluating the Association between Keratoconus and Reported Genetic Loci in a Han Chinese Population.

    Science.gov (United States)

    Hao, Xiao-Dan; Chen, Peng; Chen, Zhao-Li; Li, Su-Xia; Wang, Ye

    2015-06-01

    Keratoconus (KC) is a complex degenerative disorder of the cornea. Genetic, environmental, and lifestyle factors may all contribute to the pathogenesis of KC. Most of the reported KC-associated SNPs have been detected in Caucasians and Australians. To investigate whether the reported associated SNPs can be found in a Chinese population, we performed a replication study of the significantly associated SNPs. A total of 210 unrelated Chinese KC patients and 191 unrelated controls were included in the present study. SNPs rs4954218 (Near RAB3GAP1 (5')), rs4894535 (FNDC3B), rs2956540 (LOX), rs3735520 (Near HGF (5')), rs1324183 (MPDZ-NF1B), rs1536482 (RXRA-COL5A1), rs7044529 (COL5A1), rs2721051 (Near FOXO1 (3')), rs9938149 (BANP-ZNF469) and rs6050307 (VSX1) were assessed for their association with KC. The genotype of each SNP was detected using the Sequenom MassARRAY-Assay. SNP rs1324183 located in MPDZ-NF1B was associated with an increased risk of KC (OR=3.108, 95% CI=1.366-7.072, p=0.005), and SNP rs2956540 in the LOX gene may confer a reduced risk of KC with a borderline p value in our population (OR=0.664, 95% CI=0.447-0.986, p=0.042). No significant difference was observed between patients and controls in the other eight SNP genotypes and allele frequencies. The replication association of rs1324183 (MPDZ-NF1B) with KC in our population and the results, which are identical to those in different populations, suggest that rs1324183 (MPDZ-NF1B) is a common genetic risk for KC and should be further investigated.

  12. RAGE gene three polymorphisms with Crohn's disease susceptibility in Chinese Han population.

    Science.gov (United States)

    Wang, Zheng-Ting; Hu, Jia-Jia; Fan, Rong; Zhou, Jie; Zhong, Jie

    2014-03-07

    To investigate the association of three polymorphisms in the receptor for advanced glycation end product (RAGE) gene with Crohn's disease (CD) risk in a Chinese population. A hospital-based case-control association study involving 312 CD patients and 479 healthy controls was conducted. Peripheral blood samples were collected from 791 study subjects, and genomic DNA was extracted. Genotyping was performed using polymerase chain reaction-ligase detection reaction method. The association between polymorphic genotype and CD predisposition was determined using odds ratio and 95% confidence interval (CI). Data were analyzed using Haplo.stats program. Significant differences were observed between patients and controls in allele/genotype distributions of rs1800624 (P(allele)=0.012; P(genotype)=0.005) and in allele distributions of rs2070600 (P=0.02). The risk for CD associated with the rs1800624-A mutant allele decreased by 36% (95%CI: 0.47-0.88, P = 0.005) under the additive model and by 35% (95%CI: 0.46-0.91, P=0.013) under the dominant model. Carriers of rs2070600-A mutant allele showed a 37% (95%CI: 1.02-1.83, P=0.036) increased risk of developing CD relative to the GG genotype carriers. In haplotype analysis, haplotype T-A-G (in the order rs1800625, rs1800624, and rs2070600) decreased the odds of CD by 33% (95%CI: 0.49-0.94, P=0.018). CD is an immune-related disease with genetic predisposition. Genetic defects in the RAGE gene are strongly associated with CD in Chinese population.

  13. Association of the IL-4R Q576R polymorphism and asthma in the Chinese Han population: a meta-analysis.

    Science.gov (United States)

    Huang, Z Y; Cheng, B J; Cai, G J; Zhang, B F

    2015-03-31

    The IL-4R Q576R polymorphism has been reported to increase susceptibility to asthma, but the results are controversial. Thus, we performed a meta-analysis to evaluate the association of the IL-4R Q576R polymorphism and asthma risk in the Chinese Han population. A total of sixteen eligible case-control studies that evaluated the relationship between the IL-4R Q576R polymorphism and asthma in the Chinese Han population were obtained by comprehensive literature search incorporating electronic databases, and included 2077 asthma cases and 1589 controls. Our analysis detected a significant association between the IL-4R Q576R polymorphism and the risk of asthma in the Chinese Han population (Allelic model: OR = 1.481, 95%CI = 1.134-1.935, P = 0.004; Dominant model: OR = 1.542, 95%CI = 1.194-1.990, P = 0.001; Recessive model: OR = 1.695, 95%CI = 1.170-2.456, P = 0.005, Additive model: OR = 1.897, 95%CI = 1.299-2.771, P = 0.005). The year of publication and size of total sample might be sources of between-study heterogeneity. Upon subgroup analysis by size of total sample of each study, the significant association only remained in a subgroup with a small sample size. In summary, our meta-analysis suggested that the IL-4R Q576R polymorphism is associated with asthma in the Chinese Han population.

  14. Internalized stigma and stigma resistance among patients with mental illness in Han Chinese population.

    Science.gov (United States)

    Lien, Yin-Ju; Kao, Yu-Chen; Liu, Yia-Ping; Chang, Hsin-An; Tzeng, Nian-Sheng; Lu, Chien-Wen; Loh, Ching-Hui

    2015-06-01

    Research suggests that accurate measurement is essential in evaluating internalized stigma and abilities to combat with stigma for treatment compliances and outcomes in individuals with mental illness. The purpose of this study was to assess the reliability and validity of the Chinese version of the Internalized Stigma of Mental Illness Scale (ISMIS-C), which is one of the few tools available to measure internalized stigma and stigma resistance (SR) simultaneously. A total of 160 outpatients with (n = 103) and without (n = 57) psychotic disorders were administrated with the ISMIS-C, and measures of self-esteem, self-efficacy, depression, and hopelessness. Overall, the 29-item ISMIS-C was presented to be internal reliable (Cronbach's alpha = 0.90), and reliable over time (intraclass correlation coefficients = 0.36-0.73). The construct validity of the ISMIS-C derived from the factor analysis was nearly identical to the original version. ISMIS-C dimension scores were well correlated with each other and measures of self-esteem, self-efficacy, depression, and hopelessness. Our data also demonstrated that psychotic patients experienced higher internalized stigma scores than those without psychotic diagnoses, but endorsed indifferently on SR scores. This scale can be used as an informative device when investigating "internalized stigma" and "SR" among individuals with or without psychotic disorders.

  15. Comprehensive mutation analysis by whole-exome sequencing in 41 Chinese families with Leber congenital amaurosis.

    Science.gov (United States)

    Chen, Yabin; Zhang, Qingyan; Shen, Tao; Xiao, Xueshan; Li, Shiqiang; Guan, Liping; Zhang, Jianguo; Zhu, Zhihong; Yin, Ye; Wang, Panfeng; Guo, Xiangming; Wang, Jun; Zhang, Qingjiong

    2013-06-26

    Leber congenital amaurosis (LCA) is a genetically heterogeneous disease with, to date, 19 identified causative genes. Our aim was to evaluate the mutations in all 19 genes in Chinese families with LCA. LCA patients from 41 unrelated Chinese families were enrolled, including 25 previously unanalyzed families and 16 families screened previously by Sanger sequencing, but with no identified mutations. Genetic variations were screened by whole-exome sequencing and then validated using Sanger sequencing. A total of 41 variants predicted to affect protein coding or splicing was detected by whole-exome sequencing, and 40 were confirmed by Sanger sequencing. Bioinformatic and segregation analyses revealed 22 potentially pathogenic variants (17 novel) in 15 probands, comprised of 3 of 16 previously analyzed families and 12 of 25 (48%) previously unanalyzed families. In the latter 12 families, mutations were found in CEP290 (three probands); GUCY2D (two probands); and CRB1, CRX, RPE65, IQCB1, LCA5, TULP1, and IMPDH1 (one proband each). Based on the results from 87 previously analyzed probands and 25 new cases, GUCY2D, CRB1, RPGRIP1, CEP290, and CRX were the five most frequently mutated genes, which was similar to the results from studies in Caucasian subjects. Whole-exome sequencing detected mutations in the 19 known LCA genes in approximately half of Chinese families with LCA. These results, together with our previous results, demonstrate the spectrum and frequency of mutations of the 19 genes responsible for LCA in Han Chinese individuals. Whole-exome sequencing is an efficient method for detecting mutations in highly heterogeneous hereditary diseases. Chinese Abstract.

  16. Han Chinese polycystic ovary syndrome risk variants in women of European ancestry: relationship to FSH levels and glucose tolerance.

    Science.gov (United States)

    Saxena, R; Georgopoulos, N A; Braaten, T J; Bjonnes, A C; Koika, V; Panidis, D; Welt, C K

    2015-06-01

    Are PCOS risk variants identified in women of Han Chinese ethnicity also associated with risk of PCOS or the phenotypic features of PCOS in European women? One variant, rs2268361-T, in the intron of FSHR was associated with PCOS and lower FSH levels, while another variant rs705702-G near the RAB5B and SUOX genes was associated with insulin and glucose levels after oral glucose testing in women with PCOS of European ethnicity. Three of the eleven variants associated with PCOS in the Han Chinese genome-wide association studies were also associated with PCOS in at least one European population when corrected for multiple testing (DENND1A, THADA and YAP1). However, additional replication is needed to establish the importance of these variants in European women and to determine the relationship to PCOS phenotypic traits. The study was a case-control examination in a discovery cohort of women with PCOS (n = 485) and controls (n = 407) from Boston (Boston 1). Replication was performed in women from Greece (cases n = 884 and controls n = 311) and an additional cohort from Boston (Boston electronic medical record (EMR); n = 350 cases and n = 1258 controls). Women had PCOS defined by the National Institutes of Health criteria in Boston 1 and Greece (n = 783), with additional subjects fulfilling the Rotterdam criteria (hyperandrogenism, polycystic ovary morphology and regular menses) in Greece (n = 101). Controls in Boston and Greece had regular menstrual cycles and no hyperandrogenism. The second cohort from Boston was defined using the EMR and natural language processing. Allele frequencies for variants associated with PCOS in Han Chinese women were examined in PCOS cases and controls, along with the relationship to quantitative traits. A variant rs2268361-T in an intron of FSHR was associated with PCOS (0.84 [0.76-0.93], OR [95% CI]; P = 0.002). The rs2268361-T was associated with lower FSH levels (-0.15 ± 0.05; P = 0.0029). A variant rs705702-G near RAB5B and SUOX was

  17. CHRNA3 Polymorphism Modifies Lung Adenocarcinoma Risk in the Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Ping He

    2014-03-01

    Full Text Available Recent genome-wide association studies (GWASs have identified 15q25.1 as a lung cancer susceptibility locus. Here, we sought to explore the direct carcinogenic effects of genetic variants in this region on the risk of developing lung adenocarcinoma (ADC. Five common SNPs (rs8034191, rs16969968, rs1051730, rs938682, and rs8042374 spanning the 15q25.1 locus were assayed in a case-control study examining a cohort of 301 lung ADCs and 318 healthy controls. Stratification analysis by gender, smoking status, and tumor, node, metastasis (TNM classification, was performed. In addition, sections from ADC tissue and normal tissue adjacent to tumors were stained with an anti-CHRNA3 (cholinergic receptor nicotinic α3 antibody by immunohistochemistry in 81 cases. Our results demonstrate that rs8042374, a variant of the CHRNA3 gene, is associated with an increased risk of ADC with an OR of 1.76 (95% CI: 1.17–2.65, p = 0.024. This variant was linked to a greater risk of ADC in female nonsmokers (OR (95% CI: 1.81 (1.05–3.12, p = 0.032 and female stage I + II cases (OR (95% CI: 1.92 (1.03–3.57, p = 0.039. Although located within the same gene, rs938682 showed protective effects for smokers, stage III + IV cases, and male stage III + IV cases. Additionally, the CHRNA3 protein level in ADC tissue was slightly higher than in the surrounding normal lung tissue, based on immunohistochemical analysis. Our results suggest that the CHRNA3 polymorphism functions as a genetic modifier of the risk of developing lung ADC in the Chinese population, particularly in nonsmoking females.

  18. Associations of educational attainment, occupation, social class and major depressive disorder among Han Chinese women.

    Science.gov (United States)

    Shi, Jianguo; Zhang, Yan; Liu, Feihu; Li, Yajuan; Wang, Junhui; Flint, Jonathan; Gao, Jingfang; Li, Youhui; Tao, Ming; Zhang, Kerang; Wang, Xumei; Gao, Chengge; Yang, Lijun; Li, Kan; Shi, Shenxun; Wang, Gang; Liu, Lanfen; Zhang, Jinbei; Du, Bo; Jiang, Guoqing; Shen, Jianhua; Zhang, Zhen; Liang, Wei; Sun, Jing; Hu, Jian; Liu, Tiebang; Wang, Xueyi; Miao, Guodong; Meng, Huaqing; Li, Yi; Hu, Chunmei; Li, Yi; Huang, Guoping; Li, Gongying; Ha, Baowei; Deng, Hong; Mei, Qiyi; Zhong, Hui; Gao, Shugui; Sang, Hong; Zhang, Yutang; Fang, Xiang; Yu, Fengyu; Yang, Donglin; Liu, Tieqiao; Chen, Yunchun; Hong, Xiaohong; Wu, Wenyuan; Chen, Guibing; Cai, Min; Song, Yan; Pan, Jiyang; Dong, Jicheng; Pan, Runde; Zhang, Wei; Shen, Zhenming; Liu, Zhengrong; Gu, Danhua; Wang, Xiaoping; Liu, Xiaojuan; Zhang, Qiwen; Li, Yihan; Chen, Yiping; Kendler, Kenneth S

    2014-01-01

    The prevalence of major depressive disorder (MDD) is higher in those with low levels of educational attainment, the unemployed and those with low social status. However the extent to which these factors cause MDD is unclear. Most of the available data comes from studies in developed countries, and these findings may not extrapolate to developing countries. Examining the relationship between MDD and socio economic status in China is likely to add to the debate because of the radical economic and social changes occurring in China over the last 30 years. We report results from 3,639 Chinese women with recurrent MDD and 3,800 controls. Highly significant odds ratios (ORs) were observed between MDD and full time employment (OR = 0.36, 95% CI = 0.25-0.46, logP = 78), social status (OR = 0.83, 95% CI = 0.77-0.87, logP = 13.3) and education attainment (OR = 0.90, 95% CI = 0.86-0.90, logP = 6.8). We found a monotonic relationship between increasing age and increasing levels of educational attainment. Those with only primary school education have significantly more episodes of MDD (mean 6.5, P-value = 0.009) and have a clinically more severe disorder, while those with higher educational attainment are likely to manifest more comorbid anxiety disorders. In China lower socioeconomic position is associated with increased rates of MDD, as it is elsewhere in the world. Significantly more episodes of MDD occur among those with lower educational attainment (rather than longer episodes of disease), consistent with the hypothesis that the lower socioeconomic position increases the likelihood of developing MDD. The phenomenology of MDD varies according to the degree of educational attainment: higher educational attainment not only appears to protect against MDD but alters its presentation, to a more anxious phenotype.

  19. PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

    Science.gov (United States)

    Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

    2011-01-01

    Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

  20. Validation of Type 2 Diabetes Risk Variants Identified by Genome-Wide Association Studies in Northern Han Chinese

    Directory of Open Access Journals (Sweden)

    Ping Rao

    2016-08-01

    Full Text Available Background: More than 60 genetic susceptibility loci associated with type 2 diabetes mellitus (T2DM have been established in populations of Asian and European ancestry. Given ethnic differences and environmental factors, validation of the effects of genetic risk variants with reported associations identified by Genome-Wide Association Studies (GWASs is essential. The study aims at evaluating the associations of T2DM with 29 single nucleotide polymorphisms (SNPs from 19 candidate genes derived from GWASs in a northern Han Chinese population. Method: In this case-control study, 461 T2DM-diagnosed patients and 434 controls were recruited at the Jidong oil field hospital (Hebei, China from January 2009 to October 2013. A cumulative genetic risk score (cGRS was calculated by summation of the number of risk alleles, and a weight GRS (wGRS was calculated as the sum of risk alleles at each locus multiplied by their effect sizes for T2DM, using the independent variants selected. Result: The allelic frequency of the “A” allele at rs17106184 (Fas-associated factor 1, FAF1 was significantly higher in the T2DM patients than that of the healthy controls (11.7% vs. 6.4%, p < 0.001. Individuals in the highestquartile of wGRS had an over three-fold increased risk for developing T2DM compared with those in the lowest quartile (odds ratio = 3.06, 95% CI = 1.92–4.88, p < 0.001 adjusted for age, sex, BMI, total cholesterol (TC, triglycerides (TG, low-density lipoprotein cholesterol (LDL-C, systolic blood pressure (SBP and diastolic blood pressure (DBP. The results were similar when analyzed with the cGRS. Conclusions: We confirmed the association between rs17106184 (FAF1 and T2DM in a northern Han Chinese population. The GRS calculated based on T2DM susceptibility variants may be a useful tool for predicting the T2DM susceptibility.

  1. Association of MDR1 gene polymorphisms with the risk of hepatocellular carcinoma in the Chinese Han population

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Jian [Tianjin Medical University, Tianjin (China)

    2013-03-15

    The multidrug resistance 1 gene (MDR1) is an important candidate gene for influencing susceptibility to hepatocellular carcinoma (HCC). The objective of the present study was to evaluate the association of MDR1 polymorphisms with the risk of HCC in the Chinese Han population. A total of 353 HCC patients and 335 healthy subjects were enrolled in the study. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), created restriction site-PCR (CRS-PCR) and DNA sequencing methods were used to identify MDR1 gene polymorphisms. Two allelic variants (c.335T>C and c.3073A>C) were detected. The CC genotype of the c.335T>C polymorphism was associated with an increased risk of developing HCC compared to the TT genotype (OR = 2.161, 95%CI = 1.350-3.459, χ{sup 2} = 10.55, P = 0.0011). The risk of HCC was significantly higher for the CC genotype in the c.3073A>C polymorphism compared to the AA genotype in the studied populations (CC vs AA: OR = 2.575, 95%CI = 1.646-4.028, χ{sup 2} = 17.64, P < 0.0001). The C allele of the c.335T>C and c.3073A>C variants may contribute to the risk of HCC (C vs T of c.335T>C: OR = 1.512, 95%CI = 1.208-1.893, χ{sup 2} = 13.07, P = 0.0003, and C vs A of c.3073A>C: OR = 1.646, 95%CI = 1.322-2.049, χ{sup 2} = 20.03, P < 0.0001). The c.335T>C and c.3073A>C polymorphisms of the MDR1 gene were associated with the risk of occurrence of HCC in the Chinese Han population. Further investigations are needed to confirm these results in larger different populations.

  2. The Association between Polymorphism of CARD8 rs2043211 and Susceptibility to Arteriosclerosis Obliterans in Chinese Han Male Population.

    Science.gov (United States)

    Zhang, Kun; Song, Wei; Li, Dalin; Yan, Jingqiang; Chen, Yunhui; Qi, Haoshan; Jin, Xing; Zhao, Juncheng

    2017-01-01

    Cholesterol crystals have been shown to cause inflammation. As a response to cholesterol crystal accumulation, the NLRP3 inflammasome is activated to produce IL-1β which eventually leads to atherosclerotic lesions. As a part of innate immunity, CARD8 is involved in the modulation of above mentioned inflammatory activities. The primary objective of this study was to investigate the association between polymorphism of CARD8 rs2043211 and susceptibility to arteriosclerosis obliterans (ASO) in Chinese Han male population. 758 male arteriosclerosis obliterans patients and 793 male controls were genotyped for rs2043211 with the TaqMan allele assays. Fasting blood-glucose (FBG), total cholesterol (TC), triglycerides (TG), urea nitrogen, creatinine, Serum uric acid, high density lipoprotein, low density lipoprotein, ALT, AST, and IL-1β in the blood were detected for all subjects. Clinical data were recorded to analyze the genotype-phenotype. Independent samples t-test was used to perform the comparisons between two groups. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated to measure the strength of relationship in the genotype distribution and allele frequencies between patients and controls. The analysis of variance was used for a genotype-phenotype analysis of the ASO patients. The genotypic and allelic frequencies in the ASO group were significantly different from that in the control group (P = 0.014 by genotype, P = 0.003 by allele). Those carrying the genotype TT had a higher risk for ASO than those carrying the genotype AA (OR = 1.494, 95%CI1.131-1.974, P = 0.005).The difference was also significant after the adjustment for the history of smoking, TC, LDL, fasting blood glucose, systolic blood pressure and BMI(OR = 1.525, 95%CI1.158-2.009, P = 0.003). Our finding suggests that the polymorphism of CARD8 rs2043211 is probably associated with the development of ASO in Chinese Han male population. © 2017 The Author(s) Published by S. Karger AG

  3. The Association between Polymorphism of CARD8 rs2043211 and Susceptibility to Arteriosclerosis Obliterans in Chinese Han Male Population

    Directory of Open Access Journals (Sweden)

    Kun Zhang

    2017-01-01

    Full Text Available Background and aims: Cholesterol crystals have been shown to cause inflammation. As a response to cholesterol crystal accumulation, the NLRP3 inflammasome is activated to produce IL-1β which eventually leads to atherosclerotic lesions. As a part of innate immunity, CARD8 is involved in the modulation of above mentioned inflammatory activities. The primary objective of this study was to investigate the association between polymorphism of CARD8 rs2043211 and susceptibility to arteriosclerosis obliterans (ASO in Chinese Han male population. Methods: 758 male arteriosclerosis obliterans patients and 793 male controls were genotyped for rs2043211 with the TaqMan allele assays. Fasting blood-glucose (FBG, total cholesterol (TC, triglycerides (TG, urea nitrogen, creatinine, Serum uric acid, high density lipoprotein, low density lipoprotein, ALT, AST, and IL-1β in the blood were detected for all subjects. Clinical data were recorded to analyze the genotype-phenotype. Independent samples t-test was used to perform the comparisons between two groups. Odds ratios (ORs with 95% confidence intervals (CIs were calculated to measure the strength of relationship in the genotype distribution and allele frequencies between patients and controls. The analysis of variance was used for a genotype-phenotype analysis of the ASO patients. Results: The genotypic and allelic frequencies in the ASO group were significantly different from that in the control group (P = 0.014 by genotype, P = 0.003 by allele. Those carrying the genotype TT had a higher risk for ASO than those carrying the genotype AA (OR = 1.494, 95%CI1.131-1.974, P = 0.005.The difference was also significant after the adjustment for the history of smoking, TC, LDL, fasting blood glucose, systolic blood pressure and BMI(OR = 1.525, 95%CI1.158-2.009, P = 0.003. Conclusion: Our finding suggests that the polymorphism of CARD8 rs2043211 is probably associated with the development of ASO in Chinese Han male

  4. Genetic polymorphism in hOGG1 is associated with triple-negative breast cancer risk in Chinese Han women.

    Science.gov (United States)

    Xie, Hui; Xia, Kai; Rong, Hui; Chen, Xiaoxiang

    2013-10-01

    8-hydroxy-2'-deoxyguanine (8-OHdG), a typical product of oxidative stress-induced DNA damage, can cause a G-T transversion during DNA replication if it is not removed. Human 8-oxoguanine glycosylase 1 (hOGG1), a key DNA repair gene, recognizes and excises 8-OHdG from damaged DNA accurately; however, a c.977C>G (Ser326Cys) polymorphism in hOGG1 can inhibit the gene's ability to remove 8-OHdG. The aim of present study was to investigate the association between the c.977C>G polymorphism in hOGG1 and the risk of breast cancer in Chinese Han women. We used high-resolution melting and sequencing to analyze the genotypes of 630 patients with sporadic breast cancer patients and 777 healthy controls. We also performed risk-stratified subgroup analyses to determine the association between the c.977C>G polymorphism and other characteristics of breast cancer subgroups. Breast cancer patients and healthy controls did not have significantly different of c.977C/G genotypes (odds ratio [OR] = 1.10, 95% confidence interval [CI] = 0.82-1.49, p = 0.57) and c.977G/G genotypes (OR = 1.34, 95% CI = 0.97-1.84, p = 0.09). However, the c.977G/G genotype was especially prevalent in breast cancer patients who were younger than 55 years (OR = 1.58, 95% CI = 1.05-2.39, p = 0.04), were premenopausal status (OR = 1.87, 95% CI = 1.14-3.06, p = 0.02), had triple-negative disease (OR = 2.14, 95% CI = 1.06-4.29, p = 0.04), or p53-positive disease (OR = 1.56, 95% CI = 1.14-2.12, p = 0.005). These findings suggest that the c.977C>G polymorphism in hOGG1 is associated with an increased risk of breast cancer in Chinese Han women who are younger than 55 years, premenopausal, triple-negative, or p53-positive subgroups. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Association analysis of single nucleotide polymorphisms at five loci: comparison between atopic dermatitis and asthma in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Hua-Yang Tang

    Full Text Available Atopic diseases, such as atopic dermatitis (AD and asthma, are closely related to clinical phenotypes with hypersensitivity, and often share some similar genetic and pathogenic bases. Our recent GWAS identified three susceptibility gene/loci FLG (rs11204971 and rs3126085, 5q22.1 (rs10067777, rs7701890, rs13360927 and rs13361382 and 20q13.33 (rs6010620 to AD. The effect of these AD associated polymorphisms in asthma is so far unknown. To investigate whether AD relevant genetic variants is identical to asthma and reveal the differences in genetic factors between AD and asthma in Chinese Han population, seven AD associated single nucleotide polymorphisms (SNPs as well as 3 other SNPs (rs7936562 and rs7124842 at 11q13.5 and rs4982958 at 14q11.2 from our previous AD GWAS were genotyped in 463 asthma patients and 985 controls using Sequenom MassArray system. We found rs4982958 at 14q11.2 was significantly associated with asthma (P = 3.04×10(-4, OR = 0.73. We also detected one significant risk haplotype GGGA from the 4 SNPs (rs10067777, rs7701890, rs13360927 and rs13361382 at 5q22.1 in AD cases (P(correction = 3.60×10(-10, OR = 1.26, and the haplotype was suggestive of risk in asthma cases in this study (P = 0.014, P(correction = 0.084, OR = 1.38. These SNPs (rs11204971, rs3126085, rs7936562, rs712484 and rs6010620 at AD susceptibility genes/loci FLG, 11q13.5 and 20q13.33 were not associated with asthma in this study. Our results further comfirmed that 14q11.2 was an important candidate locus for asthma and demonstrated that 5q22.1 might be shared by AD and asthma in Chinese Han population.

  6. Associations of HLA-DP Variants with Hepatitis B Virus Infection in Southern and Northern Han Chinese Populations: A Multicenter Case-Control Study

    Science.gov (United States)

    Li, Jin; Yang, Daguo; He, Yongwen; Wang, Mengyi; Wen, Zirong; Liu, Lifeng; Yao, Jinjian; Matsuda, Koichi; Nakamura, Yusuke; Yu, Jinling; Jiang, Xiaorui; Sun, Shuzhen; Liu, Qing; Jiang, Xiang; Song, Qilong; Chen, Man; Yang, Hong; Tang, Feng; Hu, Xiaowen; Wang, Jing; Chang, Ying; He, Xingxing; Chen, Yuan; Lin, Jusheng

    2011-01-01

    Background Human leukocyte antigen DP (HLA-DP) locus has been reported to be associated with hepatitis B virus (HBV) infection in populations of Japan and Thailand. We aimed to examine whether the association can be replicated in Han Chinese populations. Methodology/Principal Findings Two HLA-DP variants rs2395309 and rs9277535 (the most strongly associated SNPs from each HLA-DP locus) were genotyped in three independent Han cohorts consisting of 2 805 cases and 1 796 controls. By using logistic regression analysis, these two SNPs in the HLA-DPA1 and HLA-DPB1 genes were significantly associated with HBV infection in Han Chinese populations (P = 0.021∼3.36×10−8 at rs2395309; P = 8.37×10−3∼2.68×10−10 at rs9277535). In addition, the genotype distributions of both sites (rs2395309 and rs9277535) were clearly different between southern and northern Chinese population (P = 8.95×10−5 at rs2395309; P = 1.64×10−9 at rs9277535). By using asymptomatic HBV carrier as control group, our study showed that there were no associations of two HLA-DP variants with HBV progression (P = 0.305∼0.822 and 0.163∼0.881 in southern Chinese population, respectively; P = 0.097∼0.697 and 0.198∼0.615 in northern Chinese population, respectively). Conclusions Our results confirmed that two SNPs (rs2395309 and rs9277535) in the HLA-DP loci were strongly associated with HBV infection in southern and northern Han Chinese populations, but not with HBV progression. PMID:21904616

  7. Associations of HLA-DP variants with hepatitis B virus infection in southern and northern Han Chinese populations: a multicenter case-control study.

    Directory of Open Access Journals (Sweden)

    Jin Li

    Full Text Available BACKGROUND: Human leukocyte antigen DP (HLA-DP locus has been reported to be associated with hepatitis B virus (HBV infection in populations of Japan and Thailand. We aimed to examine whether the association can be replicated in Han Chinese populations. METHODOLOGY/PRINCIPAL FINDINGS: Two HLA-DP variants rs2395309 and rs9277535 (the most strongly associated SNPs from each HLA-DP locus were genotyped in three independent Han cohorts consisting of 2 805 cases and 1 796 controls. By using logistic regression analysis, these two SNPs in the HLA-DPA1 and HLA-DPB1 genes were significantly associated with HBV infection in Han Chinese populations (P = 0.021∼3.36×10(-8 at rs2395309; P = 8.37×10(-3∼2.68×10(-10 at rs9277535. In addition, the genotype distributions of both sites (rs2395309 and rs9277535 were clearly different between southern and northern Chinese population (P = 8.95×10(-5 at rs2395309; P = 1.64×10(-9 at rs9277535. By using asymptomatic HBV carrier as control group, our study showed that there were no associations of two HLA-DP variants with HBV progression (P = 0.305∼0.822 and 0.163∼0.881 in southern Chinese population, respectively; P = 0.097∼0.697 and 0.198∼0.615 in northern Chinese population, respectively. CONCLUSIONS: Our results confirmed that two SNPs (rs2395309 and rs9277535 in the HLA-DP loci were strongly associated with HBV infection in southern and northern Han Chinese populations, but not with HBV progression.

  8. Effects of antiepileptic drugs on reproductive endocrine function, sexual function and sperm parameters in Chinese Han men with epilepsy.

    Science.gov (United States)

    Xiaotian, Xu; Hengzhong, Zhang; Yao, Xu; Zhipan, Zhao; Daoliang, Xu; Yumei, Wu

    2013-11-01

    The effects of the antiepileptic drugs sodium valproate (VPA) and levetiracetam (LEV) on reproductive endocrine function, sexual function, and spermatozoa were explored, together with their possible etiological mechanisms, in Chinese Han men with epilepsy. Following VPA treatment (n=32), luteinizing hormone and follicle-stimulating hormone levels were significantly lower than in controls (n=30). The bioactive testosterone/luteinizing hormone ratio and the prolactin level were significantly elevated in the VPA treatment group. There were no significant differences in these hormones between the LEV treatment (n=20) and control groups. The rates of sperm morphologic abnormality (head, body, and tail) were significantly higher in the VPA treatment group than the control group but did not differ significantly between the LEV treatment and control groups. The sperm motility rate was significantly lower in the VPA treatment group (grade A sperm motility rate <25%, grade A+B sperm motility rate <50%) than in controls, as well as in the LEV treatment group (grade A sperm motility rate <25%). Patients in the VPA and LEV treatment groups had lower scores on questions 1, 2 and 3 of a simplified International Index of Erectile Function Scale than controls, but no significant difference on questions 4 or 5. The total International Index of Erectile Function Scale scores were significantly lower in the VPA and LEV treatment groups. We conclude that treatment with VPA adversely affects reproductive endocrine function, sperm parameters and sexual function to varying degrees in Chinese men with epilepsy. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  9. Novel Mutation of LRP6 Identified in Chinese Han Population Links Canonical WNT Signaling to Neural Tube Defects.

    Science.gov (United States)

    Shi, Zhiwen; Yang, Xueyan; Li, Bin-Bin; Chen, Shuxia; Yang, Luming; Cheng, Liangping; Zhang, Ting; Wang, Hongyan; Zheng, Yufang

    2017-09-29

    Neural tube defects (NTDs), the second most frequent cause of human congenital abnormalities, are debilitating birth defects due to failure of neural tube closure. It has been shown that noncanonical WNT/planar cell polarity (PCP) signaling is required for convergent extension (CE), the initiation step of neural tube closure (NTC). But the effect of canonical WNT//β-catenin signaling during NTC is still elusive. LRP6 (low density lipoprotein receptor related proteins 6) was identified as a co-receptor for WNT/β-catenin signaling, but recent studies showed that it also can mediate WNT/PCP signaling. In this study, we screened mutations in the LRP6 gene in 343 NTDs and 215 ethnically matched normal controls of Chinese Han population. Three rare missense mutations (c.1514A>G, p.Y505C); c.2984A>G, p.D995G; and c.4280C>A, p.P1427Q) of the LRP6 gene were identified in Chinese NTD patients. The Y505C mutation is a loss-of-function mutation on both WNT/β-catenin and PCP signaling. The D995G mutation only partially lost inhibition on PCP signaling without affecting WNT/β-catenin signaling. The P1427Q mutation dramatically increased WNT/β-catenin signaling but only mildly loss of inhibition on PCP signaling. All three mutations failed to rescue CE defects caused by lrp6 morpholino oligos knockdown in zebrafish. Of interest, when overexpressed, D995G did not induce any defects, but Y505C and P1427Q caused more severe CE defects in zebrafish. Our results suggested that over-active canonical WNT signaling induced by gain-of-function mutation in LRP6 could also contribute to human NTDs, and a balanced WNT/β-catenin and PCP signaling is probably required for proper neural tube development. Birth Defects Research, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. The association of metabolic syndrome with left ventricular mass and geometry in community-based hypertensive patients among Han Chinese

    Directory of Open Access Journals (Sweden)

    Shuxia Wang

    2015-01-01

    Full Text Available Background: The association of metabolic syndrome (MS with left ventricular (LV hypertrophy is controversial. The objective of our study was to investigate the influence of MS on LV mass and geometry in community-based hypertensive patients among Han Chinese. Materials and Methods: This study included 1733 metabolic syndrome patients according to the International Diabetes Federation (IDF definition and 2373 non-MS hypertension patients. LV hypertrophy was diagnosed by the criteria of LV mass ≥49.2 g/m 2.7 for men and 46.7 g/m 2.7 for women. LV geometric patterns (normal, concentric remodeling, concentric or eccentric hypertrophy were calculated according to LV hypertrophy and relative wall thickness. Logistic regression analysis was used to determine odds ratio (OR and 95% confidence interval (CI of MS for LV hypertrophy and LV geometry abnormality. Results: The LV mass and LV mass index were higher in the MS group than in the non-MS group. In multiple adjusted models. LV mass index, LV mass, interventricular septum, and post wall were raised with the increased number of MS disorders. MS was associated with increased LV hypertrophy risk (unadjusted OR 1.38; 95% CI 1.21-1.57; age, sex, and blood pressure (BP; adjusted OR 1.39; 95% CI 1.22-1.59. MS was also associated with increased risk of eccentric hypertrophy in male and female patients. MS was only associated with increased risk of concentric hypertrophy in female patients; and MS was not associated with concentric remodeling. Conclusion: LV mass and LV mass index were associated with the increased number of MS disorders in the Chinese community-based hypertensive population. MS was not only associated with increased LV hypertrophy risk, but also associated with concentric and eccentric LV geometry abnormality, especially in females.

  11. Associations of educational attainment, occupation, social class and major depressive disorder among Han Chinese women.

    Directory of Open Access Journals (Sweden)

    Jianguo Shi

    Full Text Available The prevalence of major depressive disorder (MDD is higher in those with low levels of educational attainment, the unemployed and those with low social status. However the extent to which these factors cause MDD is unclear. Most of the available data comes from studies in developed countries, and these findings may not extrapolate to developing countries. Examining the relationship between MDD and socio economic status in China is likely to add to the debate because of the radical economic and social changes occurring in China over the last 30 years.We report results from 3,639 Chinese women with recurrent MDD and 3,800 controls. Highly significant odds ratios (ORs were observed between MDD and full time employment (OR = 0.36, 95% CI = 0.25-0.46, logP = 78, social status (OR = 0.83, 95% CI = 0.77-0.87, logP = 13.3 and education attainment (OR = 0.90, 95% CI = 0.86-0.90, logP = 6.8. We found a monotonic relationship between increasing age and increasing levels of educational attainment. Those with only primary school education have significantly more episodes of MDD (mean 6.5, P-value = 0.009 and have a clinically more severe disorder, while those with higher educational attainment are likely to manifest more comorbid anxiety disorders.In China lower socioeconomic position is associated with increased rates of MDD, as it is elsewhere in the world. Significantly more episodes of MDD occur among those with lower educational attainment (rather than longer episodes of disease, consistent with the hypothesis that the lower socioeconomic position increases the likelihood of developing MDD. The phenomenology of MDD varies according to the degree of educational attainment: higher educational attainment not only appears to protect against MDD but alters its presentation, to a more anxious phenotype.

  12. Haplotype-based analysis of ulcerative colitis risk loci identifies both IL2 and IL21 as susceptibility genes in Han Chinese.

    Science.gov (United States)

    Shi, Jihua; Zhou, Lu; Zhernakova, Alexandra; Qian, Jiaming; Zhu, Feng; Sun, Gang; Zhu, Liming; Ma, Xuejun; Dijkstra, Gerard; Wijmenga, Cisca; Faber, Klaas Nico; Lu, Xinghua; Weersma, Rinse K

    2011-12-01

    The incidence of ulcerative colitis (UC) varies between Western and Eastern ethnicities. A distinct genetic background may play a role in the differences. Until now, very little was known of the UC genetics in Asian populations. Here we performed a haplotype-based analysis of six known UC susceptibility loci in Han Chinese patients. In all, 245 UC patients and 300 healthy controls of Han Chinese descent were genotyped for 27 single nucleotide polymorphisms (SNPs), which cover the major haplotypes of the chromosome regions containing IL10, IL2/IL21, MYO9B, ECM1, MST1, and IL23R in Han Chinese. In contrast to the tight linkage disequilibrium (LD) block of the IL2/IL21 region in Caucasians, IL2 and IL21 reside in two independent LD blocks in Han Chinese. The IL2 SNP rs2069762 (P = 7.0 × 10(-4) , odds ratio [OR] = 1.54, 95% confidence interval [CI] 1.20-1.99) and the IL21 SNP rs2055979 (P = 1.2 × 10(-4) , OR = 1.50, 95% CI 1.17-1.92) were independently associated with UC. We identified one risk haplotype in IL2 and another independent risk haplotype in IL21. In addition to the IL2/IL21 locus, we observed association of the TT genotype of SNP rs1545620 in MYO9B with UC (P = 0.0169; OR = 0.29, 95% CI 0.11-0.78) and association of rs17375018 in IL23R with pancolitis in Chinese UC patients (P = 0.002; OR = 2.38, 95% CI 1.41-4.02). Our study confirmed the association of the IL2/IL21 region with UC in Han Chinese patients, and further implied both IL2 and IL21 as genetic risk factors for UC. Han Chinese UC patients share part of their genetic susceptibility with Caucasian patients. Copyright © 2011 Crohn's & Colitis Foundation of America, Inc.

  13. Development of the Chinese Family Support Scale in a Sample of Chinese Patients with Hypertension

    Science.gov (United States)

    Li, Gang; Hu, Huanhuan; Dong, Zhong; Arao, Takashi

    2013-01-01

    Background Despite strong recommendations to involve family social support in hypertension control, few questionnaires have been designed to measure family support in Chinese patients. The Chinese Family Support Scale is a self-rated questionnaire that assesses family support over a 6-month period. Methods A total of 282 patients with hypertension participated in this study and 136 of them completed the questionnaire twice within an interval of two to three weeks. Exploratory factor analysis was conducted to assess the structural validity of the scale. Concurrent validity was determined by measuring the correlation between the Chinese Family Support Scale, and Hospital Anxiety and Depression Scale using the Sperman’s Correlation Coefficient. Cronbach’s alpha and intraclass correlation coefficients were employed to evaluate the internal and test-retest reliability of the scale. Results Exploratory factor analysis revealed a three-factor solution accounting for 62% of the total variance. The three underlying sub-scale dimensions were kinship, nuclear family, and social resources. Significant correlation (r=-0.266; psupport perceived by the patients as measured by the Chinese Family Support Scale. The Chinese Family Support Scale had an acceptable internal consistency (Cronbach’s alpha = 0.84) and test-retest reliability (intraclass correlation coefficient = 0.82). Conclusion The study provides preliminary evidence that the12-item Chinese Family Support Scale is acceptable, valid and reliable for measuring the perceived family support in hypertension patients. It is a promising tool which can be easily incorporated into epidemiological surveys. PMID:24376892

  14. Association between polymorphism of SMAD3 gene and risk of sporadic intracranial arterial aneurysms in the Chinese Han population.

    Science.gov (United States)

    Liao, Mao-Fan; Gong, Qiu-Wen; Liu, Liang; Xiong, Xiao-Yi; Zhang, Qin; Gong, Chang-Xiong; Yang, Qing-Wu

    2018-01-01

    Intracranial arterial aneurysms (IAAs) are locally abnormal dilations of the cerebral arteries and often result in subarachnoid hemorrhages (SAH). Genetic, molecular and cellular mechanisms of sporadic IAAs forms are poorly understood. In this study, we investigate the association between mothers against decapentaplegic homolog 3 (SMAD3) genotypes and the risk of sporadic intracranial arterial aneurysms among the Chinese Han population. A case-control study was conducted examining 330 IAA patients and 313 controls. There were eight single nucleotide polymorphisms of SMAD3 selected and genotyped using the polymerase chain reaction-ligase detection reaction (PCR-LDR) method. Our results indicated that SMAD3 rs1065080 polymorphism was associated with a risk of IAAs in a codominant model (GA vs GG, OR=1.433; 95% CI 1.030-1.994; P=0.032). In summary, we observed that SMAD3 rs1065080 single nucleotide gene polymorphisms were significantly associated with patient susceptibility to IAAs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Association of Polymorphisms of the Receptor for Advanced Glycation Endproducts Gene with Schizophrenia in a Han Chinese Population

    Directory of Open Access Journals (Sweden)

    Jiawu Fu

    2017-01-01

    Full Text Available Receptor for Advanced Glycation Endproducts (RAGE is a member of the immunoglobulin superfamily that binds diverse ligands involved in the development of inflammatory damage and diverse chronic diseases including schizophrenia. Here, three single-nucleotide polymorphisms (SNPs (G82S, -374T/A, and -429T/C in the RAGE gene were genotyped in 923 patients with schizophrenia and 874 healthy-matched controls in a Han Chinese population using the SNaPshot technique. Additionally, we investigated the association among aforementioned SNPs with the clinical psychotic symptoms of the patients and neurocognitive function. Our study demonstrated that the frequencies of the TC + CC genotypes and the C allele in the -429T/C polymorphism were significantly lower in the patients compared with the controls (p=0.031 and p=0.034, resp.. However, the significant effect disappeared when using Bonferroni correction (p=0.093 and p=0.102, resp.. And there were no significant differences in the genotype and allele frequencies between the patients and the controls for G82S and -374T/A polymorphisms. Additionally, the -429T/C C allele carriers had marginally higher Symbol coding scores than the subjects with the TT genotypes [p=0.031 and p (corr = 0.093]. Our data indicate that the RAGE -429T/C polymorphism may be associated with the susceptibility of schizophrenia.

  16. Short bowel syndrome presenting with re-feeding syndrome in a Han Chinese patient: a case report

    Directory of Open Access Journals (Sweden)

    Xie Ying

    2012-05-01

    Full Text Available Abstract Introduction Re-feeding syndrome is common in patients with long-term starvation. To the best of our knowledge this case is the first to report a patient with short bowel syndrome developing re-feeding syndrome 12 years after the bowel resection. Case presentation A 33-year-old Chinese Han man underwent small bowel resection leaving only 40 cm of bowel, without an ileocecal valve, 12 years previously. At that time he was weaned from total parenteral nutrition and had a normal diet. He later developed features of severe malnutrition, and when parenteral nutrition was given, he developed re-feeding syndrome. Conclusion Although re-feeding syndrome is a common complication in patients with any kind of nutritional support, and known to us for many years, high risk patients still need more attention and monitoring. Re-feeding syndrome in this case was not only a macronutrients deficiency but also a micronutrient deficient, and prompt supplement therapy and organ function support proved to be successful.

  17. Systematic functional study of cytochrome P450 2D6 promoter polymorphisms in the Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Xueli Gong

    Full Text Available The promoter polymorphisms of drug-metabolizing genes can lead to interindividual differences in gene expression, which may result in adverse drug effects and therapeutic failure. Based on the database of CYP2D6 gene polymorphisms in the Chinese Han population established by our group, we functionally characterized the single nucleotide polymorphisms (SNPs of the promoter region and corresponding haplotypes in this population. Using site-directed mutagenesis, all the five SNPs identified and ten haplotypes with a frequency equal to or greater than 0.01 in the population were constructed on a luciferase reporter system. Dual luciferase reporter systems were used to analyze regulatory activity. The activity produced by Haplo3(-2183G>A, -1775A>G, -1589G>C, -1431C>T, -1000G>A, -678A>G, Haplo8(-2065G>A, -2058T>G, -1775A>G, -1589G>C, -1235G>A, -678A>G and MU3(-498C>A was 0.7-, 0.7-, 1.2- times respectively compared with the wild type in human hepatoma cell lines(p<0.05. These findings might be useful for optimizing pharmacotherapy and the design of personalized medicine.

  18. Association of maternal KIR and fetal HLA-C genes with the risk of preeclampsia in the Chinese Han population.

    Science.gov (United States)

    Long, W; Shi, Z; Fan, S; Liu, L; Lu, Y; Guo, X; Rong, C; Cui, X; Ding, H

    2015-04-01

    This study is to investigate the distribution of inhibitory and activating killer-cell immunoglobulin-like receptors (KIRs) and the combination of KIR/human leukocyte antigen (HLA)-C in women with preeclampsia in the Chinese Han population. A total of 271 patients and 295 controls were enrolled in our study. The inhibitory/activating KIR and HLA-C genes were detected using the PCR-SSP (polymerase chain reaction with sequence-specific primers) method. Our result showed that decreased numbers of individual activating KIR genes (2DS2, 2DS3, and 2DS5) were observed in women with preeclampsia. Furthermore, the gene frequency of total activating KIRs was significantly lower in patients compared with that of the controls (P = 0.03). The frequency of the KIR2DL1 gene was increased in women with preeclampsia when a homozygous HLA-C2 allele appeared in the fetus. The results suggest that a KIR genetic variation might influence the risk of preeclampsia. The lack of activating KIRs could possibly lower uterine natural killer (uNK) cell activation, thereby contributing to the pathogenesis of preeclampsia. Moreover, the imbalance of the inhibitory or activating signals at the maternal-fetal interface seems to play a regulatory role in the occurrence of preeclampsia. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Analysis of Single Nucleotide Polymorphisms within ADAM12 and Risk of Knee Osteoarthritis in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Lin Wang

    2015-01-01

    Full Text Available Objective. Osteoarthritis (OA is a complex arthritic condition in which the genetic factor plays a major role. One of the candidate genes of is the ADAM12 gene, but no consistency has been reached till now. This study aims to investigate the potential role of four single nucleotide polymorphisms (SNPs of the ADAM12 gene in susceptibility to knee OA and its progression in Chinese Han population. Methods. The rs1278279, rs3740199, rs1044122, and rs1871054 polymorphisms were genotyped and compared in a population based cohort consisting of 164 OA subjects and 200 age- and gender-matched controls. Results. The SNP rs1871054 was found with increased risk of OA susceptibility in comparing the genotype frequencies between the case and control groups no matter for which model of comparison (allele level, dominant model, recessive model, and extreme genotype model. Additionally, the SNP rs1871054 was found associated with increased OA severity according to the K/L grade. Conclusion. In summary, we have identified that the rs1871054 variant within the ADAM12 gene is a risk factor for increased osteoarthritis susceptibility and severity.

  20. MOG-antibody associated demyelinating disease of the CNS: A clinical and pathological study in Chinese Han patients.

    Science.gov (United States)

    Zhou, Lei; Huang, Yongheng; Li, Haiqing; Fan, Jie; Zhangbao, Jingzi; Yu, Hai; Li, Yuxin; Lu, Jiahong; Zhao, Chongbo; Lu, Chuanzhen; Wang, Min; Quan, Chao

    2017-04-15

    We aim to evaluate the clinical relevance of MOG-ab in a cohort of Chinese Han adults with CNS inflammatory demyelinating diseases (IDDs). MOG-ab and AQP4-ab were examined through a fixed cell based indirect immune-fluorescence assay in 86 patients with CNS-IDDs. MOG-ab was positive in 12 patients, while AQP4-ab was positive in 31 patients; none double positives. Optic neuritis (ON) was the most frequent symptom at onset (75.0%) or during the whole disease course (83.3%) of MOG-ab associated IDDs (MOG-IDDs); 79.5% of the episodes involved only the optic nerve in MOG-IDDs. MOG-ab related ON (MOG-ON) usually caused severe visual impairment, longitudinally extensive optic nerve lesion with anterior enhancement and perineural soft tissue enhancement, responded well to steroid, but still could leave remarkable thinning of retinal nerve fiber layer (RNFL) and ganglion cell complex (GCC). MOG-IDDs had less spinal cord involvement compared to AQP4-ab mediated NMO/SD. Heterogeneous brain lesions existed in 66.7% of the patients with MOG-IDDs. Large, edematous white matter lesions were observed with the pathological feature of obvious demyelination yet preservation of astrocyte and axon, fundamentally different from the astrocytopathy typically seen in NMO/SD. Our investigations suggest that MOG-ab mediates a distinct disease entity separate from NMO/SD. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Peripheral SLC6A4 Gene Expression in Obsessive-Compulsive Disorder in the Han Chinese Population.

    Science.gov (United States)

    Wang, Xuemei; Zhao, Qing; Chen, Wen; Yu, Shunying; Wang, Zhen; Xiao, Zeping

    2017-06-25

    Serotonergic system dysfunction has been implicated in obsessive-compulsive disorder (OCD). This study examined peripheral SLC6A4 gene expression in OCD patients and healthy controls to explore the relationship between SLC6A4 and OCD. Participants included 50 first episode OCD patients and 60 age and gender-matched healthy controls. Relative SLC6A4 gene expression were examined by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) in peripheral leukocytes of all the subjects. The Yale-Brown Obsessive Compulsive Scale (Y-BOCS) was used to assess the severity and subtype of OCD. SLC6A4 gene expression, normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were not significantly different between the OCD patients and healthy controls(z=-0.79, p=0.428). Male OCD patients showed a tendency of low gene expression of SLC6A4 in peripheral blood (z=-1.66, p=0.096). We did not find a significant correlation between SLC6A4 expression and the severity and subtype of OCD. There is no correlation between SLC6A4 expression levels and the severity and subtype of OCD, but male OCD patients showed a tendency of low gene expression of SLC6A4 in peripheral blood. These results suggest that gene expression of SLC6A4 in peripheral blood may not be a useful biomarker of OCD in the Han Chinese population.

  2. Association of ADIPOQ variants with type 2 diabetes mellitus susceptibility in ethnic Han Chinese from northeast China.

    Science.gov (United States)

    Yao, Meidong; Wu, Yanhui; Fang, Qingxiao; Sun, Lulu; Li, Tingting; Qiao, Hong

    2016-11-01

    To investigate the association between two single nucleotide polymorphisms (SNPs; rs3774261 and rs822393) in the ADIPOQ gene and type 2 diabetes mellitus in Han Chinese from northeast China. The present study comprised 993 type 2 diabetes mellitus patients and 966 unrelated controls from northeastern China. Two SNPs were sequenced using SNPscan. The distribution of genotype frequencies of the two SNPs in ADIPOQ between cases and controls, and in subgroups stratified based on body mass index, were compared using logistic regression analysis. Linear regression was used to analyze the association between each SNP and clinical indicators. The GG genotype of rs3774261 increased the risk of type 2 diabetes mellitus compared with the AA genotype in participants with a body mass index 24 (P = 0.021; odds ratio 1.636, 95% CI 1.708-2.484). Rs822393 was correlated with glycosylated hemoglobin (P = 0.043) in controls. Rs3774261 had an association with diastolic blood pressure (P = 0.017) in controls, and in controls with a body mass index 24; rs3774261 also had an association with both systolic blood pressure (P = 0.025) and diastolic blood pressure (P = 0.043). The present results confirm the association between ADIPOQ variants and type 2 diabetes mellitus in northeastern China. However, additional larger replication studies are required to validate these findings. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  3. Association of Complement C5 Gene Polymorphisms with Proliferative Diabetic Retinopathy of Type 2 Diabetes in a Chinese Han Population.

    Science.gov (United States)

    Xu, Dengfeng; Yi, Hong; Yu, Shizhi; Li, Xiaosong; Qiao, Yanbin; Deng, Weiwei

    2016-01-01

    To investigate the association of C5 SNPs with proliferative diabetic retinopathy (PDR) of type 2 diabetes (T2D). A total of four C5 SNPs including rs2269067, rs7040033, rs1017119 and rs7027797 were genotyped in 400 PDR patients with T2D (cases) and 600 non- proliferative diabetic retinopathy PDR (NPDR) with T2D patients (controls) by using PCR-RFLP method. mRNA expression was examined by real-time PCR. Cytokine production was detected by ELISA. The frequency of GG genotype of C5 rs2269067 was significantly increased in cases compared with controls (Pc = 3.4 × 10(-5), OR = 1.87). And C5 mRNA expression was significantly increased in rs2269067 GG cases as compared with CG or CC cases (P = 0.003, P = 0.001, respectively). Moreover, the production of IL-6 was significantly increased in rs2269067 GG cases compared to CG cases or CC cases (P = 0.002, P = 0.001, respectively). C5 rs2269067 GG genotype confers risk for PDR of T2D in Chinese han population and is associated with an elevated C5 mRNA expression and an increased IL-6 production.

  4. Mutational analysis of 33 autosomal short tandem repeat (STR) loci in southwest Chinese Han population based on trio parentage testing.

    Science.gov (United States)

    Jin, Bo; Su, Qin; Luo, Haibo; Li, Yingbi; Wu, Jin; Yan, Jing; Hou, Yiping; Liang, Weibo; Zhang, Lin

    2016-07-01

    Mutation rates and 95% CI of 33 short tandem repeat (STR) loci (D1S2142, D2S1338, D2S441, D3S1358, D3S1754, D5S818, D6S1043, D7S3048, D7S820, D8S1132, D8S1179, D10S1248, D11S2368, D12S391, D13S1492, D13S317, D13S325, D14S306, D15S659, D16S539, D18S1364, D18S51, D19S433, D20S161, D21S11, D22GATA198B05, CSF1PO, FGA, Penta D, Penta E, TH01, TPOX, and vWA) were investigated through more than 424,000 parent-child meiotic transfers obtained from 10636 trios parentage testing cases in southwest Chinese Han population. Overall, 297, including 292 single-step, 4 double-step and 1 triple-step mutation events were observed. The average mutation rate was 0.70×10(-3). Most of the locus-specific mutation rates (varied from 0.20×10(-3) to 1.96×10(-3)) were lower than the other datasets (pstrict inclusion criteria of large-sized parents/child-trio cases. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Association of Polymorphisms in STRA6 and RARRES2 Genes with Type 2 Diabetes in Southern Han Chinese

    Directory of Open Access Journals (Sweden)

    Han-Wei Huang

    2016-01-01

    Full Text Available Stimulated by retinoic acid gene homolog 6 (STRA6 and retinoic acid receptor responder 2 (RARRES2 are candidate genes involved in the pathogenesis of type 2 diabetes mellitus (T2DM. Three tag-SNPs in STRA6 and one in RARRES2 gene were selected and genotyped with TaqMan or PCR-RFLP method in 603 populations (571 patients with T2D versus 632 control subjects in Southern Han Chinese. We estimated the interactions between T2DM risk and genetic variants in the STRA6 and RARRES2 genes using polymerase chain reaction. Rs736118 in STRA6 gene were significantly associated with T2DM occurrence in the recessive genetic model. The genotype of rs974456 was significantly associated with T2DM in the dominant genetic model correlated to sex, MBI, and triglyceride. However, the association of other SNPs with T2DM was not found. Furthermore, smoking history and other factors may be independent risk factors for the incidence of T2DM. This study suggested that a role of STRA6 polymorphism could also be of value in predicting the risk of T2DM while RARRES2 polymorphism could not predict the risk of T2DM.

  6. A variant of CLEC16A gene confers protection for Vogt-Koyanagi-Harada syndrome but not for Behcet's disease in a Chinese Han population.

    Science.gov (United States)

    Li, Ke; Hou, Shengping; Qi, Jian; Kijlstra, Aize; Yang, Peizeng

    2015-03-01

    Vogt-Koyanagi-Harada (VKH) syndrome and Behcet's disease (BD) are two common form of uveitis in China. The aim of this study was to investigate the association of C-type lectin domain family 16, member A (CLEC16A) gene polymorphisms with Vogt-Koyanagi-Harada syndrome and Behcet's disease in a Chinese Han population. A two-stage association study was carried out in 988 VKH syndrome patients,400 BD patients and 976 healthy controls. Eight single nucleotide polymorphisms of CLEC16A gene were determined with the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The data were analyzed by χ(2) test or Fisher's exact test and corrected for multiple comparisons by the Bonferroni method. The first stage study showed that the frequency of the A allele of rs6498169 was significantly decreased in VKH syndrome patients (Pc = 1.1 × 10(-2), OR = 0.7, 95%CI = 0.6-0.9). No significant association was observed in the other 7 SNPs between VKH syndrome patients and controls. No association was found with BD for the 8 SNPs tested. We further confirmed the association of single nucleotide polymorphism rs6498169 with VKH syndrome in another cohort. Consistent with the first stage study, the combined study showed significantly lower frequencies of the AA genotype and the A allele of rs6498169 in VKH syndrome patients (Pc = 3.5 × 10(-4), OR = 0.6, 95%CI = 0.5-0.7; Pc = 8.2 × 10(-4), OR = 0.8, 95%CI = 0.7-0.9, respectively). In conclusion, the study suggested that a CLEC16A polymorphism may be protective against VKH syndrome in a Chinese Han population. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Genotypes and polymorphisms of mutant CCR5-delta 32, CCR2-64I and SDF1-3' a HIV-1 resistance alleles in indigenous Han Chinese.

    Science.gov (United States)

    Wang, F; Jin, L; Lei, Z; Shi, H; Hong, W; Xu, D; Jiang, J; Wang, Y; Zhang, B; Liu, M; Li, Y

    2001-11-01

    To evaluate the frequencies and polymorphisms of CCR5-delta 32, CCR2-64I and SDF1-3' A alleles conferring resistance to HIV-1 infection in Chinese population from Han ethnic origin. This cohort was comprised of 1251 subjects (915 men and 336 women) aged 15-80 years and none was HIV-1 positive. Genotyping of allelic CCR5-delta 32, CCR2-64I and SDF1-3' A variants was performed using PCR or PCR/RFLP assay, and further confirmed by direct DNA sequencing. Our finding shows that the delta 32 deletion mutation in the CCR5 gene does occur in this population and can be inherited in a Mendelian fashion in indigenous Han Chinese at a very low frequency of 0.00119 (n = 1254). The frequencies of mutant CCR2-64I and SDF1-3' A alleles were 0.20023 (n = 1251) and 0.2873 (n = 893), in this population, which are higher than those found in American Caucasians. Furthermore the polymorphisms of CCR2-64I and SDF1-3' A alleles in the Han Chinese population were different from those in American Caucasians. Statistical analysis showed that the genotype distribution of CCR5-delta 32, CCR2-64I and SDF1-3' A alleles was in equilibrium according to the Hardy-Weinberg equation. The CCR5-delta 32 mutation may not be a major resistant factor against HIV-1 infection in indigenous Han Chinese. The significance of higher frequencies of CCR2-641 and SDF1-3' A alleles (0.20023 and 0.2791) in the Han population remains to be clarified in HIV-1-positive carriers and AIDS patients.

  8. Common variants on 2p16.1, 6p22.1 and 10q24.32 are associated with schizophrenia in Han Chinese population.

    Science.gov (United States)

    Yu, H; Yan, H; Li, J; Li, Z; Zhang, X; Ma, Y; Mei, L; Liu, C; Cai, L; Wang, Q; Zhang, F; Iwata, N; Ikeda, M; Wang, L; Lu, T; Li, M; Xu, H; Wu, X; Liu, B; Yang, J; Li, K; Lv, L; Ma, X; Wang, C; Li, L; Yang, F; Jiang, T; Shi, Y; Li, T; Zhang, D; Yue, W

    2017-07-01

    Many schizophrenia susceptibility loci have been identified through genome-wide association studies (GWASs) in European populations. However, until recently, schizophrenia GWASs in non-European populations were limited to small sample sizes and have yielded few loci associated with schizophrenia. To identify genetic risk variations for schizophrenia in the Han Chinese population, we performed a two-stage GWAS of schizophrenia comprising 4384 cases and 5770 controls, followed by independent replications of 13 single-nucleotide polymorphisms in an additional 4339 schizophrenia cases and 7043 controls of Han Chinese ancestry. Furthermore, we conducted additional analyses based on the results in the discovery stage. The combined analysis confirmed evidence of genome-wide significant associations in the Han Chinese population for three loci, at 2p16.1 (rs1051061, in an exon of VRK2, P=1.14 × 10 -12 , odds ratio (OR)=1.17), 6p22.1 (rs115070292 in an intron of GABBR1, P=4.96 × 10 -10 , OR=0.77) and 10q24.32 (rs10883795 in an intron of AS3MT, P=7.94 × 10 -10 , OR=0.87; rs10883765 at an intron of ARL3, P=3.06 × 10 -9 , OR=0.87). The polygenic risk score based on Psychiatric Genomics Consortium schizophrenia GWAS data modestly predicted case-control status in the Chinese population (Nagelkerke R 2 : 1.7% ~5.7%). Our pathway analysis suggested that neurological biological pathways such as GABAergic signaling, dopaminergic signaling, cell adhesion molecules and myelination pathways are involved in schizophrenia. These findings provide new insights into the pathogenesis of schizophrenia in the Han Chinese population. Further studies are needed to establish the biological context and potential clinical utility of these findings.

  9. TERT promoter mutations and TERT mRNA but not FGFR3 mutations are urinary biomarkers in Han Chinese patients with urothelial bladder cancer.

    Science.gov (United States)

    Wang, Kun; Liu, Tiantian; Liu, Cheng; Meng, Yan; Yuan, Xiaotian; Liu, Li; Ge, Nan; Liu, Jikai; Wang, Chang; Ren, Hongbo; Yan, Keqiang; Hu, Sanyuan; Xu, Zhonghua; Fan, Yidong; Xu, Dawei

    2015-03-01

    The TERT promoter and FGFR3 gene mutations are two of the most common genetic events in urothelial bladder cancer (UBC), and these mutation assays in patient urine have been shown to be promising biomarkers for UBC diagnosis and surveillance. These results were obtained mainly from studies of patients with UBC in Western countries, and little is known about such information in Han Chinese patients with UBC. In the present study, we addressed this issue by analyzing tumors from 182 Han Chinese patients with UBC and urine samples from 102 patients for mutations in the TERT promoter and FGFR3 and TERT mRNA expression in tumors and/or urine. TERT promoter and FGFR3 mutations were identified in 87 of 182 (47.8%) and 7 of 102 (6.7%) UBC cases, respectively. In 46 urine samples from patients with TERT promoter mutation-carrying tumors, the mutant promoter was detected in 24 (52%) prior to operation and disappeared in most examined urine samples (80%) taken 1 week after operation. TERT mRNA was detected in urine derived from 46 of 49 patients (94%) that was analyzed before operation independently of the presence of TERT promoter mutations. Collectively, FGFR3 mutations occur at a very low rate in Han Chinese UBC and cannot serve as diagnostic markers for Chinese patients. Han Chinese patients with UBC have relatively low TERT promoter mutation frequency compared with patients in Western countries, and simultaneous detection of both mutant TERT promoter and TERT mRNA improves sensitivity and specificity of urine-based diagnosis. ©AlphaMed Press.

  10. Association between ABO blood types and sporadic pancreatic neuroendocrine tumors in the Chinese Han population.

    Science.gov (United States)

    Ben, Qiwen; Liu, Jun; Wang, Weiyi; Guo, Fang; Yao, Weiyan; Zhong, Jie; Yuan, Yaozong

    2017-08-15

    Although the relationship between non-O blood types and the risk of exocrine pancreatic cancer has been demonstrated, the association between ABO blood types and sporadic pancreatic neuroendocrine tumor (PNET) has not been reported thus far. This hospital-based, case-control study included 387 patients with PNET and 542 age- and sex-matched controls. Unconditional multivariable logistic regression analysis was performed to estimate the adjusted odds ratios (AORs) and 95% confidence intervals (CIs). The relationship between ABO blood types and clinicopathologic features was also analyzed. After adjusting for age, sex, smoking status, alcohol drinking, and first-degree family history of any cancer, the AORs (95% CI) of functional PNET were 0.87 (0.59-1.28) for blood type A, 0.86 (0.58-1.28) for blood type B, and 0.71 (0.39-1.26) for blood type AB compared with subjects with blood type O. A similar ABO blood-type distribution was observed among cases with non-functional PNETs compared with controls. On comparing blood type B with non-B blood type, cases with non-functional PNETs had marginally higher rates of lymph node invasion (P = 0.047), distant metastasis (P = 0.044), and advanced European Neuroendocrine Tumor Society Stage (P = 0.040). There is no association between the ABO blood group and the development of functional and non-functional PNETs. The ABO blood types are not associated with the clinicopathologic features in patients with functional and non-functional PNETs.

  11. Methylation Status of the Serotonin Transporter Promoter CpG Island Is Associated With Major Depressive Disorder in Chinese Han Population: A Case-Control Study.

    Science.gov (United States)

    Shi, Mei; Sun, Hongli; Xu, Ye; Wang, Zhenhua; Cui, Hongyu; Wang, Chengmin; Liu, Wei; An, Ganghui; Hu, Jian

    2017-08-01

    This study was aimed to investigate the relationship between the methylation status of serotonin transporter (5-HTT) and major depressive disorder (MDD) in Chinese Han population. A total of 96 patients with MDD and 55 healthy volunteers were recruited, and the methylation index (MtI) at six positions in the cytosine-phosphate-guanosine island of 5-HTT gene was measured for each subject using bisulfite pyrosequencing. MtIs at positions 5 and 6 were higher in patients with MDD than those in controls. According to the multivariable logistic regression analysis, MtIs at positions 4 and 5 were significantly associated with MDD. Besides, depression education was an independent risk factor, whereas higher educational levels were protective factors for MDD. In addition, positions 1 and 4 were negatively correlated with weight and diurnal variation. Therefore, 5-HTT methylation might be closely related with MDD in Chinese Han population because of the correlation with diurnal variation and weight.

  12. Family functioning of Chinese families in an impoverished neighborhood in Hong Kong.

    Science.gov (United States)

    Yeung, Jerf W K; Chan, Yuk-Chung

    2010-12-01

    Consonant with the family stress model, in this study family economic disadvantage, concomitant with cumulative family stressors, concurrently contributed to poor family functioning of 504 Chinese families in an impoverished neighborhood in Hong Kong, in which the latter factor appeared to be more pronounced. Implications were briefly discussed.

  13. The Ties That Bind. The Chinese American Family in Transnational Chinese Cinema

    NARCIS (Netherlands)

    Han, Q.

    2014-01-01

    The primary research question raised in the thesis is how have films been able to construct the identity of ethnic Chinese in the United States? This question is addressed through three sub-questions. First, why is the family narrative so characteristic of films about Chinese Americans in

  14. A Weighted Polygenic Risk Score Using 14 Known Susceptibility Variants to Estimate Risk and Age Onset of Psoriasis in Han Chinese

    OpenAIRE

    Yin, Xianyong; Cheng, Hui; Lin, Yan; Wineinger, Nathan E.; Zhou, Fusheng; Sheng, Yujun; Yang, Chao; Li, Pan; Li, Feng; Shen, Changbing; Yang, Sen; Schork, Nicholas J.; Zhang, Xuejun

    2015-01-01

    With numbers of common variants identified mainly through genome-wide association studies (GWASs), there is great interest in incorporating the findings into screening individuals at high risk of psoriasis. The purpose of this study is to establish genetic prediction models and evaluate its discriminatory ability in psoriasis in Han Chinese population. We built the genetic prediction models through weighted polygenic risk score (PRS) using 14 susceptibility variants in 8,819 samples. We found...

  15. Genome-wide association study of young-onset hypertension in the Han Chinese population of Taiwan.

    Directory of Open Access Journals (Sweden)

    Hsin-Chou Yang

    Full Text Available Young-onset hypertension has a stronger genetic component than late-onset counterpart; thus, the identification of genes related to its susceptibility is a critical issue for the prevention and management of this disease. We carried out a two-stage association scan to map young-onset hypertension susceptibility genes. The first-stage analysis, a genome-wide association study, analyzed 175 matched case-control pairs; the second-stage analysis, a confirmatory association study, verified the results at the first stage based on a total of 1,008 patients and 1,008 controls. Single-locus association tests, multilocus association tests and pair-wise gene-gene interaction tests were performed to identify young-onset hypertension susceptibility genes. After considering stringent adjustments of multiple testing, gene annotation and single-nucleotide polymorphism (SNP quality, four SNPs from two SNP triplets with strong association signals (-log(10(p>7 and 13 SNPs from 8 interactive SNP pairs with strong interactive signals (-log(10(p>8 were carefully re-examined. The confirmatory study verified the association for a SNP quartet 219 kb and 495 kb downstream of LOC344371 (a hypothetical gene and RASGRP3 on chromosome 2p22.3, respectively. The latter has been implicated in the abnormal vascular responsiveness to endothelin-1 and angiotensin II in diabetic-hypertensive rats. Intrinsic synergy involving IMPG1 on chromosome 6q14.2-q15 was also verified. IMPG1 encodes interphotoreceptor matrix proteoglycan 1 which has cation binding capacity. The genes are novel hypertension targets identified in this first genome-wide hypertension association study of the Han Chinese population.

  16. Indications of clinical and genetic predictors for aromatase inhibitors related musculoskeletal adverse events in Chinese Han women with breast cancer.

    Directory of Open Access Journals (Sweden)

    Jingxuan Wang

    Full Text Available BACKGROUND: Women with breast cancer treated with aromatase inhibitors (AIs may experience musculoskeletal symptoms that lead to discontinuation of effective therapy. The purpose of the current study is to evaluate the clinical and genetic predictors for AIs-related musculoskeletal adverse events(MS-AEs. METHODOLOGY AND PRINCIPAL FINDINGS: We recruited 436 postmenopausal Chinese Han women receiving adjuvant AIs therapy for early-stage hormone-sensitive breast cancer. Patients completed a self-administered questionnaire assessing the presence of musculoskeletal symptoms that started or worsened after initiating AIs. 27 single nucleotide polymorphisms (SNP of ESR1, ESR2 and PGR were analyzed by Sequenom MassARRAY assays and /or PCR-based TaqMan assays.Of the 436 enrolled women, 206 cases experienced musculoskeletal symptoms.Patients who received taxane chemotherapy were more than two times more likely than other patients to have AIs-related MS-AEs. Genetic assay had showed that only two ESR1 SNPs, rs2234693 and rs9340799 were associated with AIs-related MS-AEs.TT genotype and the T allele in rs2234693 was statistically significantly lower in AIs-Related MS-AEs group than controls (P = 0.001; P = 9.49E-7. The frequency of AA genotype and the A allele in rs9340799 was higher (P = 2.20E-5; P = 3.09E-4. CONCLUSIONS AND SIGNIFICANCE: Our results suggested that prior taxane-based chemotherapy was the clinical predictor, while rs2234693 and rs9340799 were the genetic predictors for AIs-related MS-AEs.

  17. Association of the FADS gene cluster with coronary artery disease and plasma lipid concentrations in the northern Chinese Han population.

    Science.gov (United States)

    Wu, Yixia; Zeng, Lixin; Chen, Xueyan; Xu, Yang; Ye, Lin; Qin, Ling; Chen, Liping; Xie, Lin

    2017-02-01

    We investigated the association of single nucleotide polymorphisms (SNPs) in the fatty acid desaturase (FADS) gene cluster with coronary artery disease (CAD) in a case-control study and evaluated the possible influence of genetic variation on total cholesterol (TC) and triglyceride concentrations in the controls. In total, 497 CAD patients and 495 unrelated controls were genotyped for eight SNPs in the FADS gene cluster, and the blood lipid levels of subjects were measured. Three genetic models, including codominant, dominant and recessive, were used to analyze the genotypic relationship with CAD and plasma lipid levels. Single locus genotypic analysis revealed that rs1000778 in FADS3 under a recessive model (AA vs. GG-GA) was significantly associated with CAD adjusted for risk factors. The rs1000778 minor allele AA was associated with a lower risk of CAD (OR =0.37, 95% CI: 0.15-0.89, P=0.025). In the control group, there were significant differences in TC concentrations under a recessive genetic model for rs174575 (C/G) in FADS2 and for rs174450 (A/C) and rs7115739 (G/T) in FADS3 (P=0.053, 0.016 and 0.018, respectively). The rs1000778-G variant in FADS3 may contribute to the susceptibility of CAD, but the result needs to be further confirmed because of small sample size in our study. Genetic variations in FADS2 and FADS3 influence TC concentration in the northern Chinese Han population. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. IL23R gene confers susceptibility to ankylosing spondylitis concomitant with uveitis in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Hongtao Dong

    Full Text Available PURPOSE: The interleukin-23 receptor (IL-23R has been shown to be associated with ankylosing spondylitis (AS in many different populations. This study examined whether IL-23R polymorphisms were associated with susceptibility to this disease in a Chinese Han population. METHODS: Three single-nucleotide polymorphisms (SNP, rs7517847, rs11209032, and rs17375018, were genotyped in 291 AS patients and 312 age-, sex-, and ethnically matched healthy controls using a polymerase chain reaction (PCR restriction fragment length polymorphism (RFLP assay. RESULTS: The genotype and allele frequencies of rs17375018, rs7517847, and rs11209032 were not different between the patients with AS and the healthy controls. On the one hand, stratification analysis indicated that the rs17375018 GG genotype and the G allele were increased in AS patients who were HLA-B27 positive (corrected p = 0.024, odds ratio [OR] 2.35, 95% CI 1.30-4.24; p c = 0.006, OR 1.98, 95% CI 1.28-3.07, respectively. On the other hand, the analysis according to clinical characteristics showed a significantly increased prevalence of the homozygous rs17375018 GG genotype and the G allele in patients with AS and uveitis compared with the controls (p c = 0.024 and p c = 0.024, respectively. In addition, haplotype analysis performed with the SHEsis platform revealed no significant difference concerning the haplotypes between AS patients and healthy controls. CONCLUSIONS: In this study, the results suggested that the rs17375018 of IL23R was positively associated with HLA-B27-positive AS and that the rs17375018 GG of IL-23R was associated with AS concomitant with uveitis. We found no evidence for an association between the other two SNPs of IL-23R and AS.

  19. Genetic association between Interleukin-17A gene polymorphisms and the pathogenesis of Graves' disease in the Han Chinese population.

    Science.gov (United States)

    Qi, Yicheng; Zheng, Huan; Liu, Nan; Guo, Ting; Zhu, Wei; Wang, Shu; Cui, Bin; Ning, Guang

    2015-01-19

    Graves' disease, one of the commonest autoimmune disorders, has a complex genetic basis. Interleukin-17A (IL-17A) is an important cytokine involved in innate and adaptive immune responses. This case-control study sought to investigate genetic association between the IL-17A gene and the process of Graves' disease (GD). Our pilot study was performed on a cohort from Shanghai, which included 713 patients with GD and 756 healthy controls. A replicate cohort was from Xiamen, recruiting 444 patients with GD and 427 healthy subjects. Six single nucleotide polymorphisms (SNPs) (rs4711998, rs3819024, rs2275913, rs8193037, rs3819025 and rs3748067) within the IL-17A gene were genotyped by the SNPstream Genotyping Systems and Taqman PCR method. In Shanghai cohorts, the frequencies of rs8193037 alleles were strongly different between patients with Graves' disease (G, 87·6% and A, 12·4%) and healthy controls (G, 91·4% and A, 8·6%) (P = 0·00067). The A carriers were associated with increased Graves' disease risks when compared with the G carriers (OR = 1·51, 95%CI = 1·19-1·92). In replicate cohorts, the proportion of individuals carrying the A allele of rs8193037 was significantly higher in patients with Graves' disease than in controls [Graves' disease vs control, 14·3% vs 9·1%, OR = 1·66 (95% CI: 1·23-2·24), Pallele  = 0·0082]. In addition, rs8193037 and rs3748067 were found to be different in both genotype and allele distributions in Graves' disease-associated ophthalmopathy patients and controls in Shanghai cohorts. Haplotype association analysis also identified five main haplotypes of those six SNPs. These results suggested that the polymorphism of IL-17A rs8193037 was strongly associated with Graves' disease susceptibility in the Chinese Han population.z. © 2015 John Wiley & Sons Ltd.

  20. Lobar pneumonia caused by Ralstonia pickettii in a sixty-five-year-old Han Chinese man: a case report

    Directory of Open Access Journals (Sweden)

    Dong Mei

    2011-08-01

    Full Text Available Abstract Introduction Ralstonia pickettii is a gram-negative, oxidase-positive bacillus and is an emerging pathogen found in infections described in hospital settings. The cases reported in the literature mostly are nosocomial infections due to contaminated blood products, sterile water, saline, treatment fluids and venous catheters. Human infection unrelated to contaminated solutions is rare. We report a case of lobar pneumonia and pulmonary abscess caused by Ralstonia pickettii in an older patient. Case presentation A sixty-five-year old Han Chinese man presented having had cough, expectoration, chest pain and fever lasting for twenty days. His medical history was notable for hypertension over the previous ten years, and the habit of smoking for forty years. A thoracic computed tomography scan supported the diagnosis of right-sided lobar pneumonia. A lung biopsy was done and pathological analysis confirmed lobar pneumonia. Two lung biopsy specimens from separate sites grew Ralstonia pickettii. After six days, a repeat thoracic scan revealed a right-sided abscess. A thoracentesis was performed and the purulent fluid grew Ralstonia pickettii. The chest tube remained inserted to rinse the cavity with sterile sodium chloride. He received an antibiotic course of intravenous cefoperazone sodium-sulbactam sodium for eighteen days and imipenem-cilastatin for twelve days. A repeat chest X-ray revealed resolution of the pulmonary abscess and improvement of pneumonia. He remained afebrile and free of respiratory symptoms after treatments. Conclusion This case demonstrates a Ralstonia pickettii infection in the absence of an obvious nosocomial source. It is possible that such cases will become common in the future. Therefore, further studies are needed to evaluate its sensitivity to common antibiotics.

  1. Association between Ghrelin gene (GHRL polymorphisms and clinical response to atypical antipsychotic drugs in Han Chinese schizophrenia patients

    Directory of Open Access Journals (Sweden)

    Yang Yongfeng

    2012-02-01

    Full Text Available Abstract Background Ghrelin (GHRL is a pivotal peptide regulator of food intake, energy balance, and body mass. Weight gain (WG is a common side effect of the atypical antipsychotics (AAPs used to treat schizophrenia (SZ. Ghrelin polymorphisms have been associated with pathogenic variations in plasma lipid concentrations, blood pressure, plasma glucose, and body mass index (BMI. However, it is unclear whether GHRL polymorphisms are associated with WG due to AAPs. Furthermore, there is no evidence of an association between GHRL polymorphisms and SZ or the therapeutic response to AAPs. We explored these potential associations by genotyping GHRL alleles in SZ patients and controls. We also examined the relation between these SNPs and changes in metabolic indices during AAP treatment in SZ subgroups distinguished by high or low therapeutic response. Methods Four SNPs (Leu72Met, -501A/C, -604 G/A, and -1062 G > C were genotyped in 634 schizophrenia patients and 606 control subjects. Results There were no significant differences in allele frequencies, genotype distributions, or the distributions of two SNP haplotypes between SZ patients and healthy controls (P > 0.05. There was also no significant difference in symptom reduction between genotypes after 8 weeks of AAP treatment as measured by positive and negative symptom scale scores (PANSS. However, the -604 G/A polymorphism was associated with a greater BMI increase in response to AAP administration in both APP responders and non-responders as distinguished by PANSS score reduction (P P Conclusions These four GHRL gene SNPs were not associated with SZ in this Chinese Han population. The -604 G/A polymorphism was associated with significant BW and BMI increases during AAP treatment. Patients exhibiting higher WG showed greater improvements in positive and negative symptoms than patients exhibiting lower weight gain or weight loss.

  2. Clinical features of patients with dysthymia in a large cohort of Han Chinese women with recurrent major depression.

    Directory of Open Access Journals (Sweden)

    Wenqing Wu

    Full Text Available Dysthymia is a form of chronic mild depression that has a complex relationship with major depressive disorder (MDD. Here we investigate the role of environmental risk factors, including stressful life events and parenting style, in patients with both MDD and dysthymia. We ask whether these risk factors act in the same way in MDD with and without dysthymia.We examined the clinical features in 5,950 Han Chinese women with MDD between 30-60 years of age across China. We confirmed earlier results by replicating prior analyses in 3,950 new MDD cases. There were no significant differences between the two data sets. We identified sixteen stressful life events that significantly increase the risk of dysthymia, given the presence of MDD. Low parental warmth, from either mother or father, increases the risk of dysthymia. Highly threatening but short-lived threats (such as rape are more specific for MDD than dysthymia. While for MDD more severe life events show the largest odds ratio versus controls, this was not seen for cases of MDD with or without dysthymia.There are increased rates of stressful life events in MDD with dysthymia, but the impact of life events on susceptibility to dysthymia with MDD differs from that seen for MDD alone. The pattern does not fit a simple dose-response relationship, suggesting that there are moderating factors involved in the relationship between environmental precipitants and the onset of dysthymia. It is possible that severe life events in childhood events index a general susceptibility to chronic depression, rather than acting specifically as risk factors for dysthymia.

  3. Association study of tryptophan hydroxylase 1 and arylalkylamine N-acetyltransferase polymorphisms with adolescent idiopathic scoliosis in Han Chinese.

    Science.gov (United States)

    Wang, Hai; Wu, Zhihong; Zhuang, Qianyu; Fei, Qi; Zhang, Jianguo; Liu, Yong; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2008-09-15

    A genetic association study of tryptophan hydroxylase 1 gene (TPH1) and arylalkylamine N-acetyltransferase gene(AANAT) with adolescent idiopathic scoliosis (AIS) in Han Chinese. To access whether TPH1 and AANAT polymorphisms are associated with the predisposition, gender, and/or severity of AIS. Studies have shown that AIS is a multifactorial inheritance disease, but the etiology is still unknown. In addition, several lines of evidence show that melatonin deficiency is closely associated with AIS, although there are still doubts and debates. Some polymorphisms in TPH1 and AANAT, the genes of 2 critical enzymes involved in melatonin biosynthesis, may contribute to variability of melatonin production in pineal glands. We genotyped 16 reported single nuclear polymorphisms (SNPs) present in TPH1 and AANAT in 103 AIS patients and 108 controls with matched sex and age. The data of 6 SNPs with minor allele frequence (MAF) above 5% were analyzed by the allelic and genotypic association analysis, the genotype-phenotype (gender and Cobb angle) association analysis, and the haplotype analysis. The single SNP analysis showed that rs10488682, located in the promoter region of TPH1, was related with the occurrence of AIS (P < 0.05). No SNP was found to be correlated with gender or Cobb angle. Two makers (rs8176799 and rs2108977) in TPH1 were found to be in strong LD [ D' = 1.0 (95% CI, 0.9-1.0), gamma = 0.501, LOD = 18.93] in the controls. Both global haplotype analysis and individual haplotype analysis showed that there was no haplotype significantly associated with AIS in this LD block. TPH1 polymorphisms were associated with AIS but not with gender and Cobb angle in AIS patients. AANAT polymorphisms were not associated with AIS. These results suggested that TPH1 was an AIS predisposition gene, and there was a close relationship between the dyssynthesis of melatonin and AIS.

  4. A longitudinal study of the association of adiponectin gene rs1501299 with depression in Chinese Han adolescents after Wenchuan earthquake.

    Science.gov (United States)

    Wang, Qian; Zhu, Xing Chun; Liu, Hui; Ran, Mao Sheng; Fang, Ding Zhi

    2015-04-01

    Previous studies showed inconsistent results of the association between plasma adiponectin and depression. The aim of this study is to longitudinally investigate the association of adiponectin rs1501299 with depression in Chinese Han adolescents who experienced the 2008 Wenchuan earthquake. Variants of adiponectin rs1501299 were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. Depressive symptoms were assessed by Beck Depression Inventory (BDI) among 746 high school students at 6, 12 and 18 months after the earthquake. The female T allele carriers of adiponectin rs1501299 had lower prevalence of depression (p=0.008) and BDI scores (p=0.024) than the female GG homozygotes at 18 months, but not at 6 or 12 months after the earthquake, which were significantly reduced (p=0.022 for the prevalence and pearthquake when compared with those at 12 months. In addition, the major predictors of depression for the GG homozygotes were gender and age at 6, 12 and 18 months after earthquake. On the other hand, the major predictor for the T allele carriers was gender at 6, 12 and 18 months after earthquake. There were some limitations in the present study. First, adiponectin expressions including serum adiponectin and mRNA in adipose tissues were not measured. Second, the effect of body mass index was not evaluated. The adiponectin T allele is associated with reduced prevalence of depression and lower BDI scores of female adolescents in the later stage of rehabilitation of depression. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Mitochondrial ND6 T14502C variant may modulate the phenotypic expression of LHON-associated G11778A mutation in four Chinese families.

    Science.gov (United States)

    Zhang, Juanjuan; Zhou, Xiangtian; Zhou, Jian; Li, Chengwu; Zhao, Fuxin; Wang, Yan; Meng, Yanzi; Wang, Jiying; Yuan, Meixia; Cai, Wanshi; Tong, Yi; Sun, Yan-Hong; Yang, Li; Qu, Jia; Guan, Min-Xin

    2010-09-03

    We report here the clinical, genetic, and molecular evaluations of four Han Chinese families with Leber's hereditary optic neuropathy. Thirty-one (20 males/11 females) of 83 matrilineal relatives in these families exhibited the variable severity and age-at-onset in visual impairment. The average age-of-onset of vision loss was 22years old. Strikingly, these penetrances of visual impairment in these Chinese families were higher than those in other 11 Chinese pedigrees carrying the only ND4 G11778A mutation. Molecular analysis identified the known G11778A mutation and distinct sets of variants belonging to the Asian haplogroups M10a and M7c2. Of these, the T14502C mutation caused the substitution of a highly conserved isoleucine for valine at position 58 in ND6. This mutation has been associated with LHON in other Chinese families with very low penetrance of LHON. Thus, the deficient activities of complex I, caused by G11778A mutation, would be worsened by the T14502C mutation in these four Chinese families. As a result, mitochondrial dysfunctions would lead to the high penetrance and expressivity of visual loss in these Chinese families carrying both G11778A and T14502C mutations than other 11 Chinese families carrying only G11778A mutation. These data suggested that the T14502C variant may modulate the phenotypic manifestation of the G11778A mutation in these Chinese pedigrees. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Musical Memories: Snapshots of a Chinese Family in Singapore

    Science.gov (United States)

    Lum, Chee-Hoo

    2009-01-01

    This paper examines music in the home of a Chinese family in Singapore with specific attention to the children (aged five and seven) of the household: an exploration of what constitutes the lived 'musical' memory of a family enmeshed in the technology and media of a globalised world. The study is part of a larger ethnographic study on the musical…

  7. MICB polymorphism in a southern Chinese Han population: the identification of two new MICB alleles, MICB*005:06 and MICB*026.

    Science.gov (United States)

    Liu, XueXiang; Li, LiXin; Pan, FengHua; Tian, Wei

    2012-08-01

    In this study, we investigated the major histocompatibility complex (MHC) class I chain-related gene B (MICB) allelic variation by sequence-based typing (SBT) in 201 healthy, unrelated Han subjects from Hunan province, southern China. Eleven MICB alleles were observed, among which MICB(∗)005:02 predominated with a frequency of 64.93%. Significant linkage disequilibrium (LD) was observed for 5 HLA-B-MICB and 6 MICA-MICB haplotypes. Compared with a northern Chinese Han population, several MICB-containing haplotypes appeared to be highly specific to this southern Chinese Han population. Two new MICB alleles, MICB(∗)005:06 and MICB(∗)026, were identified. Aligned with MICB(∗)005:02, MICB(∗)005:06 has a synonymous T replacement at nucleotide 762 in exon 4; MICB(∗)026 has probably arisen from MICB(∗)004:01 through a single nucleotide substitution from G to A at position 826 in exon 4, leading to an amino acid change from glutamic acid to lysine at codon 253. HLA-A(∗)02-C(∗)01-B(∗)46-MICA(∗)010-MICB(∗)005:02-DRB1(∗)09 was the most prevalent six-locus haplotype with a frequency of 8.49%. HLA-A(∗)30-C(∗)06-B(∗)13:02-MICA(∗)008:01-MICB(∗)005:02-DRB1(∗)07 appeared to be a conserved extended haplotype. Our results provide new information about MICB genetic polymorphism in Chinese Han populations, and will inform future studies of the potential role of MICB in allogeneic organ transplantation and disease susceptibility in related ethnic groups. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. Methylenetetrahydrofolate reductase genotypes and haplotypes associated with susceptibility to colorectal cancer in an eastern Chinese Han population.

    Science.gov (United States)

    Li, H; Xu, W L; Shen, H L; Chen, Q Y; Hui, L L; Long, L L; Zhu, X L

    2011-12-14

    Methylenetetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. The two common functional polymorphisms of MTHFR, C677T and A1298C have been associated with several diseases, including cancer. We made a case-control study to analyze a possible association of MTHFR gene polymorphisms C677T and A1298C with risk for colorectal cancer in an eastern Chinese Han population of 137 patients with a confirmed histopathological diagnosis of CRC and 145 age- and gender-matched controls with no history of cancer. DNA was isolated from peripheral blood samples and the genotypes were determined by PCR-RFLP. The concentrations of folate in plasma were measured by chemiluminescence immunoassay. The MTHFR 677TT genotype had a protective effect against colorectal cancer, with an odds ratio (OR) = 0.467 (95% confidence interval (CI) = 0.225-0.966). The 1298CC genotype was significantly correlated with a reduced risk of colorectal cancer (OR = 0.192; 95%CI = 0.040-0.916). Compared with the MTHFR 677CC and MTHFR 1298 AA genotypes, for individuals who carried both MTHFR 677CC and 1298CC genotypes, the OR of colorectal cancer was 0.103 (95%CI = 0.012-0.900); among individuals who carried both MTHFR 677TT and 1298AC genotypes, the OR for risk of colorectal cancer was 0.169 (95%CI = 0.044-0.654). MTHFR 677TT+CT genotypes had a significantly lower plasma folate concentration than those with the MTHFR 677CC genotype. MTHFR 1298AC+CC genotypes had a lower plasma folate concentration than those with the MTHFR 1298AA genotype (P < 0.05). In conclusion, subjects with the MTHFR 677TT and MTHFR 1298CC genotypes appeared to have a significantly lower risk for colorectal cancer. MTHFR haplotypes 677CC/1298CC and 677TT/1298AC were less common in cases than in controls. These haplotypes, when compared to the most common haplotype 677CC/1298AA, were associated with a decreased risk for colorectal cancer. We

  9. Association of CD40 gene polymorphisms with sporadic breast cancer in Chinese Han women of Northeast China.

    Directory of Open Access Journals (Sweden)

    Chen Shuang

    0.0430, respectively. CONCLUSIONS AND SIGNIFICANCE: Our findings primarily show that CD40 gene polymorphisms contribute to sporadic breast cancer risk and have a significant association with clinicopathological features among Chinese Han women from the Heilongjiang Province.

  10. Lipoprotein ratios are better than conventional lipid parameters in predicting coronary heart disease in Chinese Han people.

    Science.gov (United States)

    Zhu, Li; Lu, Zhan; Zhu, Liren; Ouyang, Xiaoxiao; Yang, Yang; He, Wenfeng; Feng, Yanping; Yi, Fang; Song, Yongyan

    2015-01-01

    Dyslipidaemia is the main risk factor for coronary heart disease (CHD). Plasma lipid levels are conven-tionally used to predict coronary risk globally, but further studies are required to investigate whether the lipoprotein ratios are superior to conventional lipid parameters as predictors for CHD. A hospital-based case-control study consisting of 738 CHD patients and 157 control subjects was conducted in a Chinese Han population. Demographic characteristics and plasma lipid or apolipoprotein data were collected. Univariate and multivariate logistic regression analyses were carried out to examine the relationship between the lipoprotein ratios and CHD risk. The CHD group had significantly higher age, non-high-density lipoprotein cholesterol (non-HDL-C), lipoprotein (a) [Lp(a)], triglyceride (TG)/HDL-C, total cholesterol (TC)/HDL-C, low-density lipoprotein cholesterol (LDL-C)/HDL-C, non-HDL-C/HDL-C, very low-density lipoprotein cholesterol (VLDL-C)/HDL-C, and apolipoprotein B100/apolipoprotein AI (apoB100/apoAI) than the control group (p smoking, and hypertension in the CHD group was significantly higher than in the control group. The results from univariate logistic regression analysis showed that the ratios of TC/HDL-C (OR 1.135, 95% CI 1.019-1.265), LDL-C/HDL-C (OR 1.216, 95% CI 1.033-1.431), non-HDL-C/HDL-C (OR 1.135, 95% CI 1.019-1.265), and apoB100/apoAI (OR 1.966, 95% CI 1.013-3.817) significantly increased the risk for CHD. By multivariate logistic regression analysis, the results were not materially altered and each of the four ratios was independently associated with CHD after adjustment for non-lipid coronary risk factors. ApoB100/apoAI showed the strongest association with CHD in both the univariate and multivariate logistic regression analyses. Our data indicate that the lipoprotein ratios are superior to conventional lipid parameters as predictors for CHD. Of the ratios, apoB100/apoAI is the best to predict CHD risk.

  11. Chinese family management of chronic childhood conditions: a cluster analysis.

    Science.gov (United States)

    Zhang, Ying; Wei, Min; Zhang, Yaqing; Shen, Nanping

    2014-01-01

    This study compared the management of chronic childhood conditions in Chinese families and identified predictors of management style. A survey was conducted in 2008-2009 on a convenience sample of 387 caregivers of children with chronic conditions. Six family management styles (FMSs) were identified: accomplished, uncertain managing, joint managing, managing with difficulty, struggling, and competent managing. The FMSs were related to the functioning of the family and the child. Changes in parents' employment, geographic location, and diagnosis predicted family placement in a cluster. Understanding Chinese FMSs will further aid in providing culturally appropriate family-centered care. Awareness of the predictors of FMSs can assist nurses in detecting which families need more help. © 2013, Wiley Periodicals, Inc.

  12. VEGFA SNPs and transcriptional factor binding sites associated with high altitude sickness in Han and Tibetan Chinese at the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Buroker, Norman E; Ning, Xue-Han; Zhou, Zhao-Nian; Li, Kui; Cen, Wei-Jun; Wu, Xiu-Feng; Zhu, Wei-Zhong; Scott, C Ronald; Chen, Shi-Han

    2013-05-01

    Mountain sickness (MS) occurs among humans visiting or inhabiting high altitude environments. We conducted genetic analyses of seven single nucleotide polymorphisms (SNPs) in the promoter region of VEGFA gene for lowland (Han) and highland (Tibetan) Chinese. The seven SNPs were evaluated in Han and Tibetan patients with acute (A) and chronic (C) MS. We compared 64 patients with AMS with 64 Han unaffected with MS, as well as 48 CMS patients with 32 unaffected Tibetans. The SNPs studied are rs699947, rs34357231, rs79469752, rs13207351, rs28357093, rs1570360, and rs2010963 which are found in the promoter ranging from -2,578 to -634 bp from the transcriptional start site (TSS), respectively. Direct sequencing was used to identify individual genotypes for these SNPs. Arterial oxygen saturation of hemoglobin (SaO2) was found to be significantly associated with the rs699947, rs34357231, rs13207351, and rs1570360 SNPs in Han patients with AMS, while the rs2010963 SNP was found to approach significance in the AMS study group, but found to be significantly associated in the normal Tibetan study group. The Han and Tibetan control groups were found to diverge significantly for the rs28357093 and rs2010963 SNPs, as measured by genetic distances of 0.073 and 0.054, respectively. All the SNPs are found in transcriptional factor binding sites (TFBS), and their possible role in gene regulation was evaluated with regard to MS. MS was found to be significantly associated with these SNPs compared with their Han and Tibetan control groups, indicating that these nucleotide substitutions result in TFBS changes which apparently have a physiological effect on the development of high altitude sickness.

  13. Evaluation of regulatory genetic variants in POU5F1 and risk of congenital heart disease in Han Chinese

    Science.gov (United States)

    Lin, Yuan; Ding, Chenyue; Zhang, Kai; Ni, Bixian; da, Min; Hu, Liang; Hu, Yuanli; Xu, Jing; Wang, Xiaowei; Chen, Yijiang; Mo, Xuming; Cui, Yugui; Shen, Hongbing; Sha, Jiahao; Liu, Jiayin; Hu, Zhibin

    2015-10-01

    OCT4 is a transcription factor of the POU family, which plays a key role in embryonic development and stem cell pluripotency. Previous studies have shown that Oct4 is required for cardiomyocyte differentiation in mice and its depletion could result in cardiac morphogenesis in embryo. However, whether the genetic variations in OCT4 coding gene, POU5F1, confer the predisposition to congenital heart disease (CHD) is unclear. This study sought to investigate the associations between low-frequency (defined here as having minor allele frequency (MAF) between 0.1%-5%) and rare (MAF below 0.1%) variants with potential function in POU5F1 and risk of CHD. We conducted association analysis in a two-stage case-control study with a total of 2,720 CHD cases and 3,331 controls in Chinese. The low-frequency variant rs3130933 was observed to be associated with a significantly increased risk of CHD [additive model: adjusted odds ratio (OR) = 2.15, adjusted P = 3.37 × 10-6]. Furthermore, luciferase activity assay showed that the variant A allele led to significantly lower expression levels as compared to the G allele. These findings indicate for the first time that low-frequency functional variant in POU5F1 may contribute to the risk of congenital heart malformations.

  14. Associations of single nucleotide polymorphisms of PTPN22 and Ctla4 genes with the risk of allergic rhinitis in a Chinese Han population.

    Science.gov (United States)

    Ke, Xia; Song, Shanghua; Wang, Xiaoqiang; Shen, Yang; Kang, Houyong; Hong, Suling

    2017-02-01

    Allergic rhinitis (AR) is an inflammatory disorder of the upper airway. Protein tyrosine phosphatase non-receptor 22 encoded by PTPN22 gene and cytotoxic T-lymphocyte associated 4 encoded by Ctla4 gene are associated with autoimmune diseases. This study was performed to evaluate the potential association of PTPN22 and Ctla4 single nucleotide polymorphisms (SNPs) with AR in a Chinese Han population. A case-control study was performed in 783 Chinese AR patients and 811 healthy controls. Three SNPs in PTPN22 gene (rs2488457, rs1310182, and rs3789604) and 6 SNPs in Ctla4 gene (rs3087243, rs231779, rs11571302, rs11571315, rs231725, and rs35219727) were detected using a polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP). For PTPN22 gene, a significantly decreased prevalence of the rs2488457 CC genotype and C allele was found in AR patients. The frequencies of the rs1310182 CC genotype, CT genotype, and C allele were significantly associated with the risk of AR. For Ctla4 gene, a significantly increased prevalence of the rs11571302 AA genotype, CA genotype and A allele was noted in AR patients. SNPs of PTPN22 and Ctla4 genes are significantly associated with the risk of AR in the Chinese Han population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  15. Serum reference interval of ARCHITECT alpha-fetoprotein in healthy Chinese Han adults: Sub-analysis of a prospective multi-center study.

    Science.gov (United States)

    Yan, Cunling; Yang, Jia; Wei, Lianhua; Hu, Jian; Song, Jiaqi; Wang, Xiaoqin; Han, Ruilin; Huang, Ying; Zhang, Wei; Soh, Andrew; Beshiri, Agim; Fan, Zhuping; Zheng, Yijie; Chen, Wei

    2017-11-10

    Alpha-fetoprotein (AFP) has been widely used in clinical practice for decades. However, large-scale survey of serum reference interval for ARCHITECT AFP is still absent in Chinese population. This study aimed to measure serum AFP levels in healthy Chinese Han subjects, which is a sub-analysis of an ongoing prospective, cross-sectional, multi-center study (ClinicalTrials.gov Identifier: NCT03047603). This analysis included a total of 530 participants (41.43±12.14years of age on average, 48.49% males), enrolled from 5 regional centers. Serum AFP level was measured by ARCHITECT immunoassay. Statistical analysis was performed using SAS 9.4 and R software. AFP distribution did not show significant correlation with age or sex. The overall median and interquartile range of AFP was 2.87 (2.09, 3.83) ng/mL. AFP level did not show a trend of increasing with age. The new reference interval was 2.0-7.07ng/mL (LOQ- 97.5th percentiles). The reference interval for ARCHITECT AFP is updated with the data of adequate number of healthy Han adults. This new reference interval is more practical and applicable in Chinese adults. Copyright © 2017. Published by Elsevier Inc.

  16. Family quality of life of Chinese families of children with intellectual disabilities.

    Science.gov (United States)

    Hu, X; Wang, M; Fei, X

    2012-01-01

    The concepts of quality of life and family quality of life (FQOL) are increasingly being studied in the field of intellectual disabilities (ID) in China as important frameworks for: (1) assessing families' need for supports and services; (2) guiding organisational and service delivery system changes; and (3) evaluating quality family outcomes. The present study focused on exploring the perceptions of Chinese families who have a child with an ID regarding FQOL as well as examining the factor structure of FQOL concept from Chinese families. The Chinese version of the Family Quality of Life Scale was used to survey Chinese families living in the urban and suburban areas of Beijing who have a child with ID. A total of 442 families participated in this study. Confirmatory factor analysis was used to test the factor structure of FQOL. Multivariate analysis was also used to examine group differences among families in terms of family demographic variables. A five-factor structure of the FQOL construct was found in the Chinese sample, suggesting a similar factor structure found from US families in the literature. Different living conditions (e.g. housing and transportation) tended to affect significantly families' satisfaction ratings of their FQOL. It is also found that family income and severity of disability of the child are predictors of families' satisfaction ratings of FQOL. The preliminary findings of this study suggest a cross-cultural factor structure comparability of FQOL between samples in the USA and China. Results call for further examination of the family-centred service and support as a mediator on the interactive relationship between family characteristics, family needs and FQOL outcomes. © 2011 The Authors. Journal of Intellectual Disability Research © 2011 Blackwell Publishing Ltd.

  17. Interaction of CARD14, SENP1 and VEGFA polymorphisms on susceptibility to high altitude polycythemia in the Han Chinese population at the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2016-03-01

    High altitude polycythemia (HAPC) is a serious public health problem among Han Chinese immigrants to the Qinghai-Tibetan Plateau. This study aims to explore the genetic basis of HAPC in the Han Chinese population. 484 male subjects (234 patients and 250 controls) were enrolled in this study. Genotyping was performed for polymorphisms of I/D in ACE, C1772T and G1790A in exon 12 of HIF-1α, rs2567206 in CYP1B1, rs726354 in SENP1, rs3025033 in VEGFA, rs7251432 in HAMP, rs2075800 in HSPA1L and rs8065364 in CARD14. Gene-gene interaction was assessed by multifactor dimensionality reduction. A significant association was seen between CARD14 polymorphism rs8065364 and risk of HAPC development in male Han Chinese, and the C allele of rs8065364 was a risk factor (odds ratio (OR)=1.59, 95% confidence interval (95% CI)=1.21-2.08). Gene-gene interaction analysis indicated that a synergistic relationship existed between rs3025033 and rs8065364 (1.00%), rs3025033 and rs726354 (0.18%), and rs726354 and rs8065364 (0.17%). The combination of rs8065364 in CARD14, rs3025033 in VEGFA and rs726354 in SENP1 was the best model to predict HAPC development in this study (testing accuracy=0.6183, p=0.0010, cross-validated consistency=10/10). Genetic interactions of SNPs in CARD14, SENP1 and VEGFA might represent a functional mechanism in the pathogenesis of HAPC. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Single nucleotide polymorphisms in the toll-like receptor 2 (TLR2) gene are associated with sporadic Parkinson's disease in the North-eastern Han Chinese population.

    Science.gov (United States)

    Li, Xiaoyuan; Xue, Li; Sun, Jinfang; Sun, Yanping; Xie, Anmu

    2017-08-24

    Growing evidences suggested that inflammatory process played a critical role in the pathogenesis of Parkinson's disease (PD). Given that TLR2 has been implicated in the perpetuation of inflammatory responses in the central nervous system (CNS), we investigated the association between two genetic variants (rs3804099 and rs3804100) of TLR2 and sporadic PD in Han Chinese population. 395 Han Chinese sporadic PD patients and 413 healthy age and gender-matched controls were genotyped using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The sporadic PD patients showed a higher T allele frequency than the healthy-matched control (p=0.019). Furthermore rs3804099 dominate model TT versus (vs.) TC+CC increase the risk of sporadic PD (OR=1.376, 95%CI=1.043-1.814, p=024). From the subgroup analysis, the variant allele T of rs3804099 was higher in sporadic PD cases (73.1%) than in controls (67.4%) in the late-onset cohort. Meanwhile rs3804099 revealed significant association in dominant model: Subjects with TT genotypes vs. those with TC+CC genotype showed evident significant in late-onset cohort (LOPD OR=1.417, 95%CI=1.051-1.911, p=022). In contrast, allele frequencies at rs3804100 were similar between patients and controls. Taken together, this study reveals that polymorphism of TLR2 locus is associated with risk of sporadic PD in the North-eastern part of Han Chinese population. Further studies are required to evaluate the association. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. [Relationship between factor VIII inhibitor development and polymorphisms of TNFα and CTLA-4 gene in Chinese Han patients with hemophilia A].

    Science.gov (United States)

    Zhang, Lu-lu; Yu, Zi-qiang; Zhang, Wei; Cao, Li-juan; Su, Jian; Bai, Xia; Ruan, Chang-geng

    2011-03-01

    To investigate the potential association between factor VIII inhibitor development and polymorphisms of tumor necrosis factor-α (TNF-α)-308 and cytotoxic T-lymphocyte associated protein-4 gene in Chinese Han patients with hemophilia A (HA). The single base change polymorphism in TNF-α and CTLA-4 gene was analyzed in 140 Chinese Han patients with hemophilia A who have been treated with plasma-derived FVIII concentrates and 108 normal controls by using PCR-restrictive fragment length polymorphism (RFLP). All of the HA patients' plasma samples were measured by modified-Nijmegen assay simultaneously. In HA patients, G/G genotype, G/A genotype and A/A genotype were detected in 118 (84.3%), 18 (12.8%) and 4 cases (2.9%) respectively; C/C genotype, C/T genotype and T/T genotype were detected in 108 (77.2%), 30 (21.4%) and 2 cases (1.4%) respectively. The difference in the genotype frequencies between HA patients and controls was nonsignificant (P > 0.05). Patients who were carriers of homozygotes for A allele had a higher risk of inhibitor development compared with those who were not (OR = 7.519, 95% CI = 3.168 - 17.844). Severe HA patients who were carriers of homozygotes for A allele had a higher risk of inhibitor development compared with those who were not (OR = 8.163, 95% CI = 2.521 - 26.434). There was no statistical difference in the risk of inhibitor development between the patients who were carriers or not (OR = 1.586, 95% CI = 0.729 - 3.450). TNF-α-308 gene polymorphism is significantly associated with inhibitor development in Chinese Han patients with severe hemophilia A. TNF-α gene may be a useful marker and potential modulator of the immune response to replacement therapy for hemophilia A patients.

  20. Genetic Polymorphism of Epidermal Growth Factor rs4444903 Influences Susceptibility to HCV-Related Liver Cirrhosis and Hepatocellular Carcinoma in a Chinese Han Population.

    Science.gov (United States)

    Zhang, Shitian; Qiao, Kunyan; Trieu, Congdoanh; Huo, Zhixiao; Dai, Qinghai; Du, Yanan; Lu, Wei; Hou, Wei

    2017-04-01

    Genetic polymorphism in the epidermal growth factor (EGF, rs4444903) gene has been demonstrated to be associated with the clinical deterioration in hepatitis C virus (HCV)-related liver cirrhosis (LC) and the development of hepatocellular carcinoma (HCC). Whether this single nucleotide polymorphism (SNP) influences susceptibility to HCV-related LC and HCC in the Chinese Han population is largely unknown. In this case-control study, a total of 187 Chinese Han patients with chronic HCV infection were enrolled, including 62 HCV-related LC patients, 46 HCV-related HCC patients, and 79 chronic hepatitis C (CHC) patients without LC and HCC, and the genetic polymorphism was genotyped via a matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) assay. The logistical regression analysis was employed to determine the correlation between the genetic polymorphism and risk of HCV-related LC and HCC. The distribution of EGF rs4444903 genotypes and alleles significantly differed between LC patients and CHC subjects (p = 0.045, p = 0.043, respectively). Under the recessive model, the GG genotype was significantly associated with a two-fold risk of HCV-related LC compared to the AA+AG genotype after an adjustment for age, gender, body mass index (BMI), duration of HCV infection, and HCV RNA level (OR = 2.188; 95% CI = 1.072 - 4.465; p = 0.031). Significant association was observed as well between the GG genotype and increased HCV-related HCC risk (OR = 3.104; 95% CI = 1.319 - 7.307; p = 0.010). The EGF rs4444903 GG genotype is associated with higher susceptibility to HCV-related LC and HCC in the Chinese Han population. Screening of host genetic polymorphisms might be helpful in designing effective and efficient LC and HCC surveillance programs for chronic HCV-infected patients.

  1. Generation of a human control PBMC derived iPS cell line TUSMi001-A from a healthy male donor of Han Chinese genetic background

    Directory of Open Access Journals (Sweden)

    Ying Wang

    2017-12-01

    Full Text Available A 59-year old healthy man of Han Chinese genetic background donated his peripheral blood mononuclear cells (PBMC. The non-integrating episomal vector system was used to reprogram his PBMCs with the human OSKM (Oct4, Sox2, Kl4 and c-Myc transcription factors. The pluripotency of transgene-free iPSCs was confirmed by immunocytochemistry for pluripotency markers and by the ability of the iPSCs to differentiate spontaneously into 3 germ layers in vitro. In addition, the iPSC line displayed a normal karyotype. In the studies of disease mechanism, the iPSC line can be used as a control.

  2. Generation of a human induced pluripotent stem cell line from a 65-year old healthy female donor with Chinese Han genetic background.

    Science.gov (United States)

    Wang, Ying; Zhang, Jing; Zhang, Yue; Huang, Danyi; Zhao, Jian; Li, Gang; Lei, Ying

    2017-10-01

    Peripheral blood mononuclear cells (PBMC) were collected from a 65-year old healthy woman with Chinese Han genetic background. The PBMCs were reprogrammed with the human OKSM transcription factors using the non-integrating episomal vector system. The transgene-free iPSC showed pluripotency verified by immunocytochemistry for pluripotency markers and differentiated spontaneously toward the 3 germ layers in vitro. Furthermore, the iPSC line showed normal karyotype. The iPSC line can be used as control in disease mechanism studies. Resource table. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Generation of a human induced pluripotent stem cell line from a 65-year old healthy female donor with Chinese Han genetic background

    Directory of Open Access Journals (Sweden)

    Ying Wang

    2017-10-01

    Full Text Available Peripheral blood mononuclear cells (PBMC were collected from a 65-year old healthy woman with Chinese Han genetic background. The PBMCs were reprogrammed with the human OKSM transcription factors using the non-integrating episomal vector system. The transgene-free iPSC showed pluripotency verified by immunocytochemistry for pluripotency markers and differentiated spontaneously toward the 3 germ layers in vitro. Furthermore, the iPSC line showed normal karyotype. The iPSC line can be used as control in disease mechanism studies.

  4. Short communication: SDF1-3'A gene mutation is correlated with increased susceptibility to HIV type 1 infection by sexual transmission in Han Chinese.

    Science.gov (United States)

    Wang, Yueyun; Wang, Xiaohui; Peng, Ji; Chen, Lin; Cheng, Jinquan; Nie, Shaofa; Feng, Tiejian; Zhao, Guanglu; Zhao, Jin; Shi, Xiangdong

    2008-11-01

    Limited information is available on host genetic polymorphisms that confer resistance to HIV-1 infection in Han Chinese who persistently remain seronegative (HEPS) despite high exposure to HIV-1 through unprotected sexual activity with known HIV-1-seropositive spouses or long-term sexual partners. The aim of this study was to investigate the correlation of CCR5-Delta32, CCR2b-64I, and SDF1-3'A polymorphisms with susceptibility to HIV-1 infection through sexual transmission in Han Chinese. A cross-sectional study was used to analyze the differences in allelic frequencies of CCR5-Delta32, CCR2b-64I, and SDF1-3'A among HEPS, healthy HIV-unexposed individuals, and HIV-1-seropositive individuals. Restriction fragment length polymorphism (RFLP) analysis was used for genotype determination. The CCR5-Delta32 mutation was not detected in the three groups (n = 260). The allelic frequencies of CCR2b-64I were 21.57%, 21.63%, and 22.12% in the three groups, respectively. There was no significant difference among the three groups in CCR2b-64I distribution. The allelic frequencies of SDF1-3'A were 20.19%, 28.37%, and 29.33% in the three groups, respectively. There was a significant difference in the allelic distribution of SDF1-3'A between HEPS and healthy HIV-unexposed individuals (p = 0.023), as well as between HEPS and HIV-1-seropositive individuals (p = 0.049). Statistical analysis showed that the allelic distributions on CCR2b-64I and SDF1-3'A were in equilibrium according to the Hardy-Weinberg equation. The mutant genotypes of CCR5-Delta32 and CCR2b-64I were not correlated with HIV-1 infection through sexual transmission in Han Chinese. SDF1- 3'A was associated with a high risk of HIV-1 infection through sexual transmission in Han Chinese.

  5. Variants of Interleukin-7/Interleukin-7 Receptor Alpha are Associated with Both Neuromyelitis Optica and Multiple Sclerosis Among Chinese Han Population in Southeastern China

    Directory of Open Access Journals (Sweden)

    Jing-Cong Zhuang

    2015-01-01

    Full Text Available Background: Neuromyelitis optica (NMO and multiple sclerosis (MS are autoimmune demyelinating diseases of the central nerve system. Interleukin-7 (IL-7 and interleukin-7 receptor alpha (IL-7Rα were proved to be important in the pathogenesis of both diseases because of the roles they played in the differentiations of autoimmune lymphocytes. The variants of both genes had been identified to be associated with MS susceptibility in Caucasian, Japanese and Korean populations. However, the association of these variants with NMO and MS has not been well studied in Chinese Southeastern Han population. Here, we aimed to evaluate the association of six IL-7 variants (rs1520333, rs1545298, rs4739140, rs6993386, rs7816065, and rs2887502 and one variant of IL-7RA (rs6897932 with NMO and MS among Chinese Han population in southeastern China. Methods: Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MassARRAY system and Sanger sequencing were used to determine the variants of IL-7 and IL-7RA in 167 NMO patients, 159 MS patients and 479 healthy controls among Chinese Han population in southeastern China. Samples were excluded if the genotyping success rate <90%. Results: Statistical differences were observed in the genotypes of IL-7 rs1520333 in MS patients and IL-7RA rs6897932 in NMO patients, compared with healthy controls (P = 0.035 and 0.034, respectively. There was a statistically significant difference in the genotypes of IL-7 rs2887502 between MS and NMO patients (P = 0.014. And there were statistically significant differences in the rs6897932 genotypes (P = 0.004 and alleles (P = 0.042 between NMO-IgG positive patients and healthy controls. Conclusions: The study suggested that among Chinese Han population in southeastern China, the variant of IL-7RA (rs6897932 was associated with NMO especially NMO-IgG positive patients while the variant of IL-7 (rs1520333 with MS patients. And the genotypic differences of IL-7 rs2887502

  6. Hexanucleotide Repeat Expansion in C9ORF72 Is Not Detected in the Treatment-Resistant Schizophrenia Patients of Chinese Han.

    Directory of Open Access Journals (Sweden)

    Xijia Xu

    Full Text Available Hexanucleotide (GGGGCC repeat expansion in C9ORF72 (HRE causes frontotemporal lobar degeneration, frontotemporal dementia-amyotrophic lateral sclerosis, and amyotrophic lateral sclerosis. HRE was also seen in the genomes of patients suffering from several other degenerative diseases. However, whether it is present in the treatment-resistant schizophrenia patients remains unknown. Genotyping 386 patients suffering from treatment-resistant schizophrenia using the method of Repeat-Primed PCR, we reported here that no HRE was detected in the patients of Chinese Han.

  7. Cumulative effect and predictive value of genetic variants associated with type 2 diabetes in Han Chinese: a case-control study.

    Directory of Open Access Journals (Sweden)

    Yun Qian

    Full Text Available Genome-wide association studies (GWAS have identified dozens of single nucleotide polymorphisms (SNPs associated with type 2 diabetes risk. We have previously confirmed the associations of genetic variants in HHEX, CDKAL1, VEGFA and FTO with type 2 diabetes in Han Chinese. However, the cumulative effect and predictive value of these GWAS identified SNPs on the risk of type 2 diabetes in Han Chinese are largely unknown.We conducted a two-stage case-control study consisting of 2,925 cases and 3,281 controls to examine the association of 30 SNPs identified by GWAS with type 2 diabetes in Han Chinese. Significant associations were found for proxy SNPs at KCNQ1 [odds ratio (OR = 1.41, P = 9.91 × 10-16 for rs2237897], CDKN2A/CDKN2B (OR = 1.30, P = 1.34 × 10-10 for rs10811661, CENTD2 (OR = 1.28, P = 9.88 × 10-4 for rs1552224 and SLC30A8 (OR = 1.19, P = 1.43 × 10-5 for rs13266634. We further evaluated the cumulative effect on type 2 diabetes of these 4 SNPs, in combination with 5 SNPs at HHEX, CDKAL1, VEGFA and FTO reported previously. Individuals carrying 12 or more risk alleles had a nearly 4-fold increased risk for developing type 2 diabetes compared with those carrying less than 6 risk alleles [adjusted OR = 3.68, 95% confidence interval (CI: 2.76-4.91]. Adding the genetic factors to clinical factors slightly improved the prediction of type 2 diabetes, with the area under the receiver operating characteristic curve increasing from 0.76 to 0.78. However, the difference was statistically significant (P < 0.0001.We confirmed associations of SNPs in KCNQ1, CDKN2A/CDKN2B, CENTD2 and SLC30A8 with type 2 diabetes in Han Chinese. The utilization of genetic information may improve the accuracy of risk prediction in combination with clinical characteristics for type 2 diabetes.

  8. Testing the applicability of the family management style framework to chinese families.

    Science.gov (United States)

    Zhang, Ying; Wei, Min; Han, Hae-Ra; Zhang, Yaqing; Shen, Nanping

    2013-08-01

    Family management is an important concept in caring for chronically ill children. The purpose of this study is to determine the applicability of the Family Management Style Framework for Chinese families with a child who has a chronic condition. The children ranged in age from 6 to 16 years. The structural equation modeling approach was utilized to examine the relationships among the contextual variables, the family management, the child, and the family functioning. A total of 538 caregivers from seven hospitals in China were included in this study. The final model adequately fitted the data. The predictor variables accounted for 23%, 26%, 7.8%, and 12% of the variance in the easy and the challenging parts of family management and the child and family unit, respectively. These findings indicated that the framework is applicable to Chinese families. This result reinforces the importance of interventions designed to enable caregivers to improve family management.

  9. Lack of Association between Missense Variants in GRHL3 (rs2486668 and rs545809 and Susceptibility to Non-Syndromic Orofacial Clefts in a Han Chinese Population.

    Directory of Open Access Journals (Sweden)

    Miao He

    Full Text Available Grainyhead-like-3 (GRHL3 was recently identified as the second gene that, when mutated, can leads to Van der Woude syndrome, which is characterized by orofacial clefts (OFC and lower lip pits. In addition, a missense variant (rs41268753 in GRHL3 confers risk for non-syndromic cleft palate cases of European ancestry. Together with interferon regulatory factor 6 (IRF6, GRHL3 may be associated with the risk of NSOFC which awaits for being verified across different ethnic populations.The aim of this study was to investigate the possible relationship between common functional variants in GRHL3 and susceptibility to NSOFC, especially cleft palate cases, in a Han Chinese population, one of the ethnic groups with the highest birth prevalence of orofacial clefting.Because the allele frequency for rs41268753 minor alleles was zero in our Chinese population, we selected functional single nucleotide polymorphisms (SNPs spanning GRHL3 with minor allele frequencies (MAFs > 5% in the Han Chinese population. Two SNPs which meet the above criteria were then genotyped in a case-control cohort comprising 1145 individuals using the TaqMan 5'-exonuclease allelic discrimination assay.SNPs rs2486668 and rs545809 were used in this study. Overall genotype and allele distributions of both SNPs in general and stratified genotyping analyses revealed no statistically significant differences between cases and controls. Further logistic regression analyses using different genetic models failed to reveal any evidence that these markers influence risk to NSOFC.The variant rs41268753 in GRHL3 increases the risk for cleft palate in European population, but our findings failed to detect the link between two GRHL3 SNPs (rs2486668 and rs545809 and risk to NSOFC in the Han Chinese cohort. Although the present study did not provide any evidence that common functional variants in GRHL3 may contribute to NSOFC etiology in this Chinese population, further studies with a larger sample

  10. EPAS1 and EGLN1 associations with high altitude sickness in Han and Tibetan Chinese at the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Buroker, Norman E; Ning, Xue-Han; Zhou, Zhao-Nian; Li, Kui; Cen, Wei-Jun; Wu, Xiu-Feng; Zhu, Wei-Zhong; Scott, C Ronald; Chen, Shi-Han

    2012-08-15

    High altitude sickness (HAS) occurs among humans visiting or inhabiting high altitude environments. Genetic differences in the EPAS1 and EGLN1 genes have been found between lowland (Han) and highland (Tibetan) Chinese. Three SNPs within EPAS1 and EGLN1 were evaluated in Han and Tibetan patients with acute mountain sickness (AMS) and chronic mountain sickness (CMS). We compared 85 patients with AMS to 79 Han unaffected with mountain sickness (MS) as well as 45 CMS patients to 34 unaffected Tibetan subjects. The three SNPs studied were EPAS1 [ch2: 46441523 (hg18], EGLN1 (rs480902) and (rs516651). Direct sequencing was used to identify individual genotypes for the three SNPs. Age was found to be significantly associated with the EPAS1 SNP in the CMS patients while heart rate (HR) and oxygen saturation level of hemoglobin (SaO(2)) were found to be significantly associated with the EGLN1 (rs480902) SNP in the Han patients with AMS. The individuals with CMS were found to diverge significantly for the EPAS1 SNP compared to their Tibetan control group as measured by genetic distance (0.123) indicating positive selection of the EPAS-G allele with age and illness. The EGLN1 (rs480902) SNP had a significant correlation with hematocrit (HCT), HR and SaO(2) in AMS patients. AMS and CMS were found to be significantly associated with the EPAS1 and EGLN1 SNPs compared to their Han and Tibetan control groups, respectively, indicating these nucleotide alterations have a physiological effect for the development of high altitude sickness. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Hans Bertram, Birgit Bertram: Familie, Sozialisation und die Zukunft der Kinder. Opladen u.a.: Verlag Barbara Budrich 2009.

    Directory of Open Access Journals (Sweden)

    Ulrike Zartler

    2010-07-01

    Full Text Available Hans und Birgit Bertram präsentieren einen umfassenden Einblick in eine Vielzahl an Themen der Familien- und Kindheitsforschung und bieten einen fundierten Überblick über die Sozialisationsforschung. Sie halten ein faktenreich unterlegtes Plädoyer für eine kritische Betrachtung der klassischen Sozialisationstheorien und plädieren für eine sozial-ökologische Sichtweise der Familienentwicklung. Das Buch liefert wichtige Argumente für eine neue Perspektive in der – seit Jahrzehnten geführten – Debatte über die Zukunft der Familie und überzeugt trotz einiger formaler Schwächen als umfassendes, gut lesbares Werk, das auch in der Lehre sinnvoll einsetzbar ist. Es fasst wissenschaftliche Debatten und Erkenntnisse der vergangenen Jahrzehnte zusammen und ergänzt so auch die öffentlichen Diskussionen.Hans and Birgit Bertram offer comprehensive insight into a multiplicity of themes related to research on the family and childhood, thus providing an overview of the research into socialization that is based solidly in facts. They construct a claim for the critical examination of classical socialization theories that is rich in underlying facts and therefore plead for a social-ecological perspective on the decade-old debate over the future of the family. The study is convincing as a comprehensive and accessible work, despite some formal weaknesses. It is also appropriate for application to teaching. It summarizes scientific debates and insights of the past decades and thus adds to public discussions.

  12. Identification of a missense mutation in the tyrosinase gene in a Chinese family with oculocutaneous albinism type 1.

    Science.gov (United States)

    Lu, Qian; Yuan, Lamei; Xu, Hongbo; Huang, Xiangjun; Yang, Zhijian; Yi, Junhui; Ni, Bin; Chen, Yong; Deng, Hao

    2017-03-01

    Oculocutaneous albinism (OCA) is a group of heterogeneous and autosomal recessive disorders characterized by a reduction or complete loss of melanin biosynthesis in melanocytes. OCA type 1 (OCA1) is the most severe and common form of OCA, and is caused by mutations in the tyrosinase gene (TYR). The present study aimed to identify the genetic cause of OCA1 in a four‑generation consanguineous Chinese Han family. Complete physical examinations were performed and blood samples were collected from five members of the family and 100 unrelated healthy controls. Exome sequencing was conducted in the proband, followed by verification in other family members, using Sanger sequencing. Patients in the family presented with typical OCA1 features, including hypopigmentation of the skin and hair, and distinctive ocular changes. A homozygous missense variant, c.896G>A (p.R299H), in the TYR gene was identified in two patients, which co‑segregated with disease in the family. This variant was not present in the 100 healthy controls. These results expand the number of mutations identified to be responsible for OCA1 in the Chinese Han population, and may have implications for genetic counseling and clinical management of the disease.

  13. Genetic risk of TNFSF4 and FAM167A-BLK polymorphisms in children with asthma and allergic rhinitis in a Han Chinese population.

    Science.gov (United States)

    Liu, Yun; Ke, Xia; Kang, Hou-Yong; Wang, Xiao-Qiang; Shen, Yang; Hong, Su-Ling

    2016-08-01

    Asthma and allergic rhinitis (AR) frequently occur as comorbid diseases of the upper airways. Single-nucleotide polymorphisms (SNPs) in the TNFSF4 and FAM167A-BLK genes have recently been shown to be associated with various immune-related disorders. Our aim was to determine whether TNFSF4 or FAM167A-BLK polymorphisms confer genetic susceptibility to asthma and AR in a Han Chinese population. We performed a case-control study of 290 asthmatic children and 252 healthy controls. Nine SNPs in the TNFSF4 region (rs1234313, rs1234314, rs1234315, rsl 2039904, rs844648 and rsl 0912580) and the FAM167A-BLK region (rs2254546, rs13277113 and rs1600249) were detected using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. This study revealed that three SNPs in TNFSF4 (rsl 234313, rsl 234314 and rsl 234315) and two SNPs in FAM167A-BLK (rs2254546 and rsl 600249) were significantly correlated with asthma and AR, while SNP rsl600249 was associated with asthma without allergic rhinitis as a risk factor. Further, we demonstrated synergistic effects between the TNFSF4 and FAM167A-BLK SNPs. This study supports that the SNPs in TNFSF4 and FAM167A-BLK may be involved in asthma and AR gene risk in the Han Chinese cohort.

  14. Applications of the method of high resolution melting analysis for diagnosis of Leber's disease and the three primary mutation spectrum of LHON in the Han Chinese population.

    Science.gov (United States)

    Cui, Guanglin; Ding, Hu; Xu, Yujun; Li, Bin; Wang, Dao Wen

    2013-01-01

    Current screening methods, such as single strand conformational polymorphism (SSCP), denaturing high performance liquid chromatography (dHPLC) and direct DNA sequencing that are used for detecting mutation in Leber's hereditary optic neuropathy (LHON) subjects are time consuming and costly. Here we tested high-resolution melt (HRM) analysis for mtDNA primary mutations in LHON patients. In this study, we applied the high resolution melting (HRM) technology to screen mtDNA primary mutations in 50 LHON patients from their peripheral blood. In order to evaluate the reliability of this technique, we compared the results obtained by HRM and direct mtDNA sequencing. We also investigated the spectrum of three most common mtDNA mutations implicated in LHON in the Han Chinese population. The results showed HRM analysis differentiated all of the mtDNA primary mutations and identified 4 additional mtDNA mutations from 50 patients in the blind study. The prevalence of three primary mutations were 11778G>A (87.9%), 14484T>C (6.5%) and 3460G>A (1.7%) in the Han Chinese population. In conclusion, HRM analysis is a rapid, reliable, and low-cost tool for detecting mtDNA primary mutations and has practical applications in molecular genetics. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Replication Study Confirms the Association of the Common rs1800629 Variant of the TNF Gene with Postmenopausal Osteoporosis Susceptibility in the Han Chinese Population.

    Science.gov (United States)

    Jin, Xiaona; Zhou, Baozhen; Zhang, Dangfeng

    2018-02-26

    Previous studies have suggested that tumor necrosis factor a (TNF-a), encoded by TNF gene, can increase osteoclast formation, and that specific alleles of the TNF gene are associated with postmenopausal osteoporosis susceptibility in some populations; however, the exact molecular mechanism remains unknown. To investigate the potential association of nineteen polymorphisms of the TNF gene with postmenopausal osteoporosis and bone mineral density (BMD) traits in a sample of 1288 postmenopausal women from the Han Chinese population. A total of 437 postmenopausal osteoporosis patients and 851 unrelated age-matched healthy women were recruited in the study. Single marker and haplotype based analyses were conducted to evaluate the association of nineteen single nucleotide polymorphisms (SNPs) in both patient and control groups. The SNP rs1800629 was identified as being highly significantly associated with postmenopausal osteoporosis after accounting for age and body mass index (p = 0.000087). In addition, the GG genotype of this SNP was associated with significantly lower measures of femoral neck BMD and lumbar spine BMD. Moreover, haplotype based analyses suggested significant association signals between the haplotype block, including rs1800629 with postmenopausal osteoporosis (p osteoporosis and BMD in the female Han Chinese population. Additional sequencing-based studies are needed to investigate the genetic architecture of this genomic region and its relationship with osteoporosis-related phenotypes.

  16. JARID1A, JMY, and PTGER4 polymorphisms are related to ankylosing spondylitis in Chinese Han patients: a case-control study.

    Directory of Open Access Journals (Sweden)

    Wei Chai

    Full Text Available Susceptibility to ankylosing spondylitis (AS is largely genetically determined. JARID1A, JMY and PTGER4 have recently been found to be associated with AS in patients of western European descent. We aim to examine the influence of JARID1A, JMY, and PTGER4 polymorphisms on the susceptibility to and the severity of ankylosing spondylitis in Chinese ethnic majority Han population. This work can lead the clinical doctors to intervene earlier. Blood samples were drawn from 396 AS patients and 404 unrelated healthy controls. Both the AS patients and the controls are Han Chinese. The AS patients are classified based on the severity of the disease. Thirteen tag single nucleotide polymorphisms (tagSNPs in JARID1A, JMY and PTGER4 are selected and genotyped. Frequencies of different genotypes and alleles are analyzed among the different severity AS patients and the controls. The rs2284336 SNP in JARID1A, the rs16876619 and rs16876657 SNPs in JMY are associated with susceptibility of AS. The rs11062357 SNP in JARID1A, the rs2607142 SNP in JMY and rs10440635 in PTGER4 are related to severity of AS. Haplotype analyses indicate PTGER4 is related to susceptibility to AS; JARID1A and JMY are related to severity of AS.

  17. Genetic polymorphism of NOS3 with susceptibility to deep vein thrombosis after orthopedic surgery: a case-control study in Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Jizheng Qin

    Full Text Available Deep vein thrombosis is one of the common complications of orthopedic surgery. Studies indicated that genetic factors played a considerable role in the pathogenesis of deep vein thrombosis. Endothelial nitric oxide synthase which encoded by nitric oxide synthase 3 (NOS3, can generate nitric oxide in endothelial cells. As a predominant regulator for vascular homeostasis, nitric oxide might be involved in the pathogenesis of thrombosis. It had been proved that the NOS3 polymorphism (rs1799983 was associated with the development of cardiovascular diseases. Our objective was to evaluate the association between the NOS3 polymorphism (rs1799983 and deep vein thrombosis after orthopedic surgery in Chinese Han population. The polymorphism was genotyped in 224 subjects with deep vein thrombosis after orthopedic surgery and 580 controls. Allele and genotype frequencies were compared between subjects with deep vein thrombosis and control subjects. The allele and genotype frequencies of the NOS3 polymorphism (rs1799983 were significantly different between subjects with deep vein thrombosis and control subjects. There were also significant differences when the subjects were stratified by gender, surgery type and hypertension status. These findings suggested that the NOS3 polymorphism (rs1799983 was associated with susceptibility to the deep vein thrombosis after orthopedic surgery in Chinese Han population, and NOS3 might play a role in the development of deep vein thrombosis after orthopedic surgery.

  18. [Discovery of a novel A2 allel in ABO blood group system and investigation of its distribution in Han population of Chinese Fujian province].

    Science.gov (United States)

    Zhang, Ai; Chi, Quan; Ren, Ben-Chun

    2012-10-01

    This study was aimed to investigate the distribution of A2 subgroup in Han Population of Chinese Fujian province and its molecular mechanisms. One individual with serologic ABO blood grouping discrepancy was identified with commercially available monoclonal and polyclonal antibodies and lectin: anti-A, anti-B, anti-AB, anti-A1, and anti-H reagents according to the routine laboratory methods. DNA sequences of exon 6, 7 and intron 6 of ABO gene were analyzed by polymerase chain reaction using genomic DNA and direct DNA sequencing or sequencing after gene cloning. Red cells of 3 176 A or AB unrelated individuals were tested with anti-A1. The results showed that this individual was identified as A2 subgroup by serological technology, sequencing analysis indicated the A2 subgroup with novel A variant allele, the novel A allele being different from the allele A101 by 467C > T and 607G > A missense mutation in exon 7, no A2 subgroup was identified from the 3 176 individuals by using standard serological technology. It is concluded that a novel A allele responsible for A2 subgroup composing of 467C > T and 607G > A has been firstly confirmed, and the A2 subgroup is very rare in Chinese Fujian Han population.

  19. Associations of the single-nucleotide polymorphisms of the Mina gene with the development of asthma in Chinese Han children: a case-control study.

    Science.gov (United States)

    Chen, Yun; Yang, Xiqiang; Huang, Ying; Liu, Enmei; Wang, Lijia

    2011-01-01

    The single-nucleotide polymorphisms (SNPs) of the Mina gene in animals are associated with the development of Th2-mediated diseases. However, there is no information whether the association occurs in humans. This case-control study aimed at examining the potential association of the SNP of the Mina gene with the development of asthma in Chinese Han children. The DNA genotypes and serum immunoglobulin E and interleukin-4 levels of 202 asthmatic patients and 191 nonasthmatic subjects were determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry method and enzyme-linked immunosorbent assay, respectively. We found that the frequency of the T allele of rs4857304, but not rs832081, rs832078, rs9879532, and rs17374916, in the Mina gene in asthmatic patients was significantly higher than that of controls (p = 0.0199). Using a recessive model, we found that the percentage of patients with TT homozygous rs4857304 was significantly higher than that of controls (p = 0.0282, odds ratio=1.568, 95% confidence interval=1.048-2.346). Further, the mean levels of serum immunoglobulin E and interleukin-4 in the patients with TT genotype of rs4857304 were significantly higher than that of patients with the G allele (p = 0.000 and p = 0.03, respectively). Apparently, the T allele of rs4857304 of the Mina gene may be associated with increased risk for the development of asthma in Chinese Han children.

  20. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and coronary artery disease in the Chinese Han population: a meta-analysis.

    Science.gov (United States)

    Li, Yan-yan

    2012-01-01

    The polymorphism of plasminogen activator inhibitor-1 (PAI-1) 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD) susceptibility, but study results are still debatable. The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR) for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI) was assessed by the random effect model. The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004). The heterogeneity test was also significant (P5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD.

  1. Association of interleukin-1 receptor-associated kinase (IRAK1) gene polymorphisms (rs3027898, rs1059702) with systemic lupus erythematosus in a Chinese Han population.

    Science.gov (United States)

    Zhai, Yu; Xu, Ke; Leng, Rui-Xue; Cen, Han; Wang, Wei; Zhu, Yan; Zhou, Mo; Feng, Chen-Chen; Ye, Dong-Qing

    2013-06-01

    The purpose of this study was to examine the association of interleukin-1 receptor-associated kinase (IRAK1) polymorphisms (rs3027898, rs1059702) with systemic lupus erythematosus (SLE) in a Chinese Han population. A total of 667 SLE patients and 667 healthy controls were collected in this study. The genotyping of polymorphisms (rs3027898, rs1059702) was determined by TaqMan allele discrimination assay on the 7300 real-time polymerase chain reaction system. The statistical analysis was conducted by chi square test or Fisher's exact test. The frequency of C allele for rs3027898 in patients was significantly higher than in controls (C versus A: OR = 1.438, 95 % CI = 1.180-1.753, p oral ulcers. However, no significant difference was detected in IRAK1 rs1059702 polymorphism and the clinical manifestations. Our data demonstrate that the polymorphisms rs3027898 and rs1059702 of IRAK1 gene are associated with SLE in the Chinese Han population.

  2. Association between the c.3073A>C genetic polymorphism of the MDR1 gene and susceptibility to gastric cancer in the Chinese Han population.

    Science.gov (United States)

    Zhou, Xiaojun; Xu, Lu; Yin, Jun

    2014-01-01

    Gastric cancer is one of the most common malignancies in the world. The multidrug resistance 1 gene (MDR1) is an important candidate gene for influencing the susceptibility to gastric cancer. The objective of this study was to find out the association of MDR1 genetic variants with gastric cancer susceptibility in the Chinese Han population. In total, 375 gastric cancer patients and 378 cancer-free controls were included. The c.3073A>C genetic polymorphism of the MDR1 gene was genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. We found that the genotypes/alleles from c.3073A>C genetic polymorphisms were statistically associated with gastric cancer risk. The risk of gastric cancer was significantly higher for the CC genotype as compared to the AA wild genotype (odds ratio [OR]=1.85, 95% confidence interval [CI] 1.15-2.97, p=0.010). The allele C may contribute to the susceptibility to gastric cancer (OR=1.37, 95% CI 1.10-1.70, p=0.005). These preliminary results indicate that the c.3073A>C genetic polymorphism of the MDR1 gene is potentially related to the susceptibility to gastric cancer in the Chinese Han population.

  3. Polymorphisms of COL4A1 gene are associated with arterial pulse wave velocity in healthy Han Chinese and Uygur subjects

    Science.gov (United States)

    Adi, Dilare; Xie, Xiang; Xiang, Yang; Ma, Yi-Tong; Yang, Yi-Ning; Fu, Zhen-Yan; Li, Xiao-Mei; Liu, Fen; Chen, Bang-Dang

    2015-01-01

    Pulse wave velocity (PWV) is a noninvasive index of arterial stiffness and an independent predictor of cardiovascular outcomes. Type IV collagen is an important structural component of the vascular basement membrane, thus it is important for the integrity and functions of basement membrane. However, the relationship between genetic polymorphisms of COL4A1 gene and PWV in healthy Han Chinese and Uygur subjects remains unclear. We aimed to investigate the association between PWV and COL4A1 genetic polymorphisms in healthy Han Chinese and Uygur subjects. A total of 1533 subjects (909 Han, 624 Uygur) were selected from the Cardiovascular Risk Survey (CRS) study. Two SNPs (rs605143 and rs565470) were genotyped by using the polymerase chain reaction-restriction fragment length (PCR-RFLP) method. In the Uygur population, the two SNPs (rs605143 and rs565470) were associated with PWV by analyses of a recessive model (p = 0.002, p = 0.008, respectively), and the difference remained significant after multivariate adjustment (p = 0.004, p = 0.001, respectively); the AA genotype of rs605143 was associated with increased PWV value compared with the AG or GG genotype (1543.36 ± 324.79 cm/s vs. 1530.45 ± 314.24 cm/s and 1522.93 ± 316.00 cm/s); and the CC genotype of rs565470 was associated with increased PWV value compared with the CT or TT genotype (1647.90 ± 553.27 cm/s vs. 1506.8 ± 357.35 cm/s and 1488.4 ± 344.32 cm/s). But for healthy Han Chinese subjects, this association was not observed in rs605143 and rs565470 before and after multivariate adjustment. Both rs605143 and rs565470 in the COL4A1 gene are associated with PWV in healthy Uygur subjects, indicating that carriers of the A allele of rs605143 and the C allele of rs565470 have a high risk of Arterial stiffness. PMID:25932222

  4. Combined genetic and imaging diagnosis for two large Chinese families affected with Pelizaeus-Merzbacher disease.

    Science.gov (United States)

    Lv, Y; Cao, L H; Pang, H; Lu, L N; Li, J L; Fu, Y; Qi, S L; Luo, Y; Li-Ling, J

    2012-08-06

    Pelizaeus-Merzbacher disease (PMD) is a rare X-linked recessive disorder characterized by nystagmus, impaired motor development, ataxia, and progressive spasticity. Genetically defective or altered levels of proteolipid protein (PLP1) or gap-junction alpha protein 12 gene have been found to be a common cause. Here we report on two large Han Chinese families affected with this disease. The probands of both families had produced sons featuring cerebral palsy that had never been correctly diagnosed. PMD was suspected after careful analysis of family history and clinical features. Three rounds of molecular testing, including RT-PCR, genetics linkage and SRY sequence analyses, in combination with fetal ultrasound and magnetic resonance imaging, confirmed the diagnosis. In Family 1, in addition to two patients, three carriers were identified, including one who was not yet married. Genetic testing indicated that a fetus did not have the disease. A healthy girl was born later. In Family 2, two patients and two carriers were identified, while a fetus was genetically normal. A healthy girl was born later. We concluded that by combining genetic testing and imaging, awareness of the symptoms of PMD and understanding of its molecular biology, there is great benefit for families that are at risk for producing offspring affected with this severe disease.

  5. Prediction of warfarin maintenance dose in Han Chinese patients using a mechanistic model based on genetic and non-genetic factors.

    Science.gov (United States)

    Lu, Yuan; Yang, Jinbo; Zhang, Haiyan; Yang, Jin

    2013-07-01

    Many attempts have been made to predict the warfarin maintenance dose in patients beginning warfarin therapy using a descriptive model based on multiple linear regression. Here we report the first attempt to develop a comprehensive mechanistic model integrating in vitro-in vivo extrapolation (IVIVE) with a pharmacokinetic-pharmacodynamic model to predict the warfarin maintenance dose in Han Chinese patients. The model incorporates demographic factors [sex, age, body weight (BW)] and the genetic polymorphisms of cytochrome P450 (CYP) 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1). Information on the various factors, mean warfarin daily dose and International Normalized Ratio (INR) was available for a cohort of 197 Han Chinese patients. Based on in vitro enzyme kinetic parameters for S-warfarin metabolism, demographic data for Han Chinese and some scaling factors, the S-warfarin clearance (CL) was predicted for patients in the cohort with different CYP2C9 genotypes using IVIVE. The plasma concentration of S-warfarin after a single oral dose was simulated using a one-compartment pharmacokinetic model with first-order absorption and a lag time and was combined with a mechanistic coagulation model to simulate the INR response. The warfarin maintenance dose was then predicted based on the demographic data and genotypes of CYP2C9 and VKORC1 for each patient and using the observed steady-state INR (INRss) as a target value. Finally, sensitivity analysis was carried out to determine which factor(s) affect the warfarin maintenance dose most strongly. The predictive performance of this mechanistic model is not inferior to that of our previous descriptive model. There were significant differences in the mean warfarin daily dose in patients with different CYP2C9 and VKORC1 genotypes. Using IVIVE, the predicted mean CL of S-warfarin for patients with CYP2C9*1/*3 (0.092 l/h, n = 11) was 57 % less than for those with wild-type *1/*1 (0.215 l/h, n

  6. Acculturative Family Distancing (AFD) and Depression in Chinese American Families

    Science.gov (United States)

    Hwang, Wei-Chin; Wood, Jeffrey J.; Fujimoto, Ken

    2010-01-01

    Objective: Knowledge of acculturative processes and their impact on immigrant families remains quite limited. Acculturative family distancing (AFD) is the distancing that occurs between immigrant parents and their children and is caused by breakdowns in communication and cultural value differences. It is a more proximal and problem-focused…

  7. AKT3, ANGPTL4, eNOS3, and VEGFA associations with high altitude sickness in Han and Tibetan Chinese at the Qinghai-Tibetan Plateau.

    Science.gov (United States)

    Buroker, Norman E; Ning, Xue-Han; Zhou, Zhao-Nian; Li, Kui; Cen, Wei-Jun; Wu, Xiu-Feng; Zhu, Wei-Zhong; Scott, C Ronald; Chen, Shi-Han

    2012-08-01

    Mountain sickness (MS) occurs among humans visiting or inhabiting high altitude environments. We conducted genetic analyses of the AKT3, ANGPTL4, eNOS3 and VEGFA genes in lowland (Han) and highland (Tibetan) Chinese. Ten single nucleotide polymorphisms (SNPs) were evaluated in Han and Tibetan patients with acute (A) and chronic (C) MS. We compared 74 patients with AMS to 79 Han unaffected with MS, as well as 48 CMS patients to 31 unaffected Tibetans. The ten SNPs studied are AKT3 (rs4590656, rs2291409), ANGPTL4 (rs1044250), eNOS3 (rs1007311, rs1799983) and VEGFA (rs79469752, rs13207351, rs28357093, rs1570360, rs3025039). Direct sequencing was used to identify individual genotypes for these SNPs. Hemoglobin (Hb), hematocrit (Hct), and red blood cell count (RBC) were found to be significantly associated with the AKT3 SNP (rs4590656), Hb was found to be associated with the eNOS3 SNP (rs1007311), and RBC was found to be significantly associated with the VEGFA SNP (rs1570360) in Tibetan patients with CMS. CMS patients were found to diverge significantly for both eNOS3 SNPs as measured by genetic distance (0.042, 0.047) and for the VEGFA SNP (rs28357093) with a genetic distance of 0.078 compared to their Tibetan control group. Heart rate (HR) was found to be significantly associated with the eNOS3 SNP (rs1799983) and arterial oxygen saturation of hemoglobin (SaO2) was found to be significantly associated with the VEGFA SNPs (rs13207351, rs1570360) in Han patients with AMS. The Han and Tibetan control groups were found to diverge significantly for the ANGPTL4 SNP and VEGFA SNP (rs28357093), as measured by genetic distances of 0.049 and 0.073, respectively. Seven of the SNPs from non-coding regions are found in the transcriptional factor response elements and their possible role in gene regulation was evaluated with regard to MS. AMS and CMS were found to be significantly associated with the four genes compared to their Han and Tibetan control groups, respectively

  8. Novel NR5A1 missense mutation in premature ovarian failure: detection in han chinese indicates causation in different ethnic groups.

    Directory of Open Access Journals (Sweden)

    Xue Jiao

    Full Text Available BACKGROUND: The etiology of most premature ovarian failure (POF cases is usually elusive. Although genetic causes clearly exist and a likely susceptible region of 8q22.3 has been discovered, no predominant explanation exists for POF. More recently, evidences have indicated that mutations in NR5A1 gene could be causative for POF. We therefore screened for mutations in the NR5A1 gene in a large cohort of Chinese women with non-syndromic POF. METHODS: Mutation screening of NR5A1 gene was performed in 400 Han Chinese women with well-defined 46,XX idiopathic non-syndromic POF and 400 controls. Subsequently, functional characterization of the novel mutation identified was evaluated in vitro. RESULTS: A novel heterozygous missense mutation [c.13T>G (p.Tyr5Asp] in NR5A1 was identified in 1 of 384 patients (0.26%. This mutation impaired transcriptional activation on Amh, Inhibin-a, Cyp11a1 and Cyp19a1 gene, as shown by transactivation assays. However, no dominant negative effect was observed, nor was there impact on protein expression and nuclear localization. CONCLUSIONS: This novel mutation p.Tyr5Asp, in a novel non-domain region, is presumed to result in haploinsufficiency. Irrespectively, perturbation in NR5A1 is not a common explanation for POF in Chinese.

  9. No relationship between 2',3'-cyclic nucleotide 3'-phosphodiesterase and schizophrenia in the Chinese Han population: an expression study and meta-analysis

    Directory of Open Access Journals (Sweden)

    Zhang Zhao

    2009-04-01

    Full Text Available Abstract Background 2',3'-Cyclic nucleotide 3'-phosphodiesterase (CNP, one of the promising candidate genes for schizophrenia, plays a key part in the oligodendrocyte function and in myelination. The present study aims to investigate the relationship between CNP and schizophrenia in the Chinese population and the effect of different factors on the expression level of CNP in schizophrenia. Methods Five CNP single nucleotide polymorphisms (SNPs were investigated in a Chinese Han schizophrenia case-control sample set (n = 180 using direct sequencing. The results were included in the following meta-analysis. Quantitative real-time polymerase chain reaction (PCR was conducted to examine CNP expression levels in peripheral blood lymphocytes. Results Factors including gender, genotype, sub-diagnosis and antipsychotics-treatment were found not to contribute to the expression regulation of the CNP gene in schizophrenia. Our meta-analysis produced similar negative results. Conclusion The results suggest that the CNP gene may not be involved in the etiology and pathology of schizophrenia in the Chinese population.

  10. Familial Idiopathic Cranial Neuropathy in a Chinese Family.

    Science.gov (United States)

    Zhang, Li; Liang, Jianfeng; Yu, Yanbing

    Cranial neuropathy is usually idiopathic and familial cases are uncommon. We describe a family with 5 members with cranial neuropathy over 3 generations. All affected patients were women, indicating an X-linked dominant or an autosomal dominant mode of inheritance. Our cases and a review of the literature suggest that familial idiopathic cranial neuropathy is a rare condition which may be related to autosomal dominant vascular disorders (e.g. vascular tortuosity, sclerosis, elongation or extension), small posterior cranial fossas, anatomical variations of the posterior circulation, hypersensitivity of cranial nerves and other abnormalities. Moreover, microvascular decompression is the treatment of choice because vascular compression is the main factor in the pathogenesis. To the best of our knowledge, this is the first report of familial cranial neuropathy in China.

  11. PVRL1 as a Candidate Gene for Nonsyndromic Cleft Lip With or Without Cleft Palate: No Evidence for the Involvement of Common or Rare Variants in Southern Han Chinese Patients

    Science.gov (United States)

    Cheng, Hong-Qiu; Huang, En-Min; Xu, Ming-Yan; Shu, Shen-You

    2012-01-01

    The poliovirus receptor related-1 (PVRL1) gene encodes nectin-1, a cell–cell adhesion molecule (OMIM #600644), and is mutated in the cleft lip with or without cleft palate/ectodermal dysplasia-1 syndrome (CLPED1, OMIM #225000). In addition, PVRL1 mutations have been associated with nonsyndromic cleft lip with or without a cleft palate (NSCL/P) in studies of multiethnic samples. To investigate the possible involvement of this gene in southern Han Chinese NSCL/P patients, we performed (i) a case–control association study, and (ii) a resequencing study. A set of 470 patients with NSCL/P and 693 controls were recruited, and a total of 45 tagging single-nucleotide polymorphisms (SNPs) were genotyped by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. In the resequencing study, the coding regions of the PVRL1 α isoform were direct sequenced in 45 trios from multiply affected families. One (rs7128327) of the 45 tested SNPs showed a trend toward statistical significance in the genotypic-level chi-square test (p=0.009567). However, this result did not withstand correction for multiple testing. Likewise, sliding window haplotype analyses consisting of two, three, or four SNPs failed to detect any positive association. Resequencing analysis also failed to identify any novel rare sequence variants. In conclusion, the present study provided no support for the hypothesis that common or rare variants in PVRL1 play a significant role in NSCL/P development in the southern Han Chinese population. This is the first study that has used tagging SNPs covering all the coding and noncoding regions to search for common NSCL/P-associated mutations of PVRL1. PMID:22455396

  12. Raising Children in Chinese Immigrant Families: Evidence from the Research Literature

    Science.gov (United States)

    Guo, Karen

    2006-01-01

    Children of Chinese culture are raised differently from children of other cultural groups. There is research evidence which contends that, regardless of where they live, the child-rearing practices within Chinese immigrant families are still influenced by Chinese traditional culture. Some studies also point out that Chinese immigrant parents…

  13. Association between the biochemical profiles in blood and bone mineral density in Chinese Han population: findings from a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Chen HX

    2016-11-01

    Full Text Available Hong-Xia Chen,1,2,* Li-Bing Wu,3,* Zhong-Ji Meng1 1Institute of Biomedicine, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei Province, People’s Republic of China; 2Department of Environmental, Agricultural, & Occupational Health, College of Public Health, University of Nebraska Medical Center, Omaha, NE, USA; 3Department of Nuclear Medicine, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei Province, People’s Republic of China *These authors contributed equally to this work. Abstract: This study investigated the possible correlation between blood biochemical profiles and bone mineral density (BMD in the Chinese Han population. We conducted a cross-sectional analysis using participants randomly selected from the Health Screening Center of Taihe Hospital, Hubei University of Medicine, which included a total of 285 individuals, varied in ages from 31 years to 63 years. The height, weight, and body mass index (BMI of each subject were measured, as well as fasting blood glucose (FBG, triglycerides, total cholesterol, blood uric acid (UA, blood urea nitrogen, and blood creatinine. We evaluated BMD at the wrist (grams per centimeter square using a dual-energy X-ray absorptiometry scan. The mean ages of female and male groups were 45.32±8.24 years and 46.76±9.01 years, respectively. The mean age of the study population was 46.14±8.79 years, which is similar to the general population. The mean BMI values were 22.08±2.38 kg/m2 and 24.50±2.67 kg/m2 in the female and male population, respectively, representing a statistically significant difference (P<0.05. No significant differences in levels of FBG total cholesterol, or triglycerides were seen among the male and female population. Multiple linear regression analysis was performed using BMD as outcome variables and BMI, blood UA, FBG, total cholesterol, triglycerides, urea nitrogen, and blood creatinine as covariates, and the regression equation was established as Y=0

  14. Plasminogen activator inhibitor-1 4G/5G gene polymorphism and coronary artery disease in the Chinese Han population: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yan-yan Li

    Full Text Available BACKGROUND: The polymorphism of plasminogen activator inhibitor-1 (PAI-1 4G/5G gene has been indicated to be correlated with coronary artery disease (CAD susceptibility, but study results are still debatable. OBJECTIVE AND METHODS: The present meta-analysis was performed to investigate the association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population. A total of 879 CAD patients and 628 controls from eight separate studies were involved. The pooled odds ratio (OR for the distribution of the 4G allele frequency of PAI-1 4G/5G gene and its corresponding 95% confidence interval (CI was assessed by the random effect model. RESULTS: The distribution of the 4 G allele frequency was 0.61 for the CAD group and 0.51 for the control group. The association between PAI-1 4G/5G gene polymorphism and CAD in the Chinese Han population was significant under an allelic genetic model (OR = 1.70, 95% CI = 1.18 to 2.44, P = 0.004. The heterogeneity test was also significant (P<0.0001. Meta-regression was performed to explore the heterogeneity source. Among the confounding factors, the heterogeneity could be explained by the publication year (P = 0.017, study region (P = 0.014, control group sample size (P = 0.011, total sample size (P = 0.011, and ratio of the case to the control group sample size (RR (P = 0.019. In a stratified analysis by the total sample size, significantly increased risk was only detected in subgroup 2 under an allelic genetic model (OR = 1.93, 95% CI = 1.09 to 3.35, P = 0.02. CONCLUSIONS: In the Chinese Han population, PAI-1 4G/5G gene polymorphism was implied to be associated with increased CAD risk. Carriers of the 4G allele of the PAI-1 4G/5G gene might predispose to CAD.

  15. FGFR1OP tagSNP but not CCR6 polymorphisms are associated with Vogt-Koyanagi-Harada syndrome in Chinese Han.

    Directory of Open Access Journals (Sweden)

    Xianglong Yi

    Full Text Available BACKGROUND: Polymorphisms of the CC chemokine receptor 6 (CCR6 and FGFR10P tagSNP (locus close to CCR6 at 6q27 have recently been reported to be associated with the susceptibility to several immune-related diseases. This study was designed to determine the association of CCR6 and FGFR10P (tagSNPs with Vogt-Koyanagi-Harada (VKH syndrome, an autoimmune disease directed against melanocytes, in two independent Chinese Han populations. METHODOLOGY/PRINCIPAL FINDINGS: A total of 601 VKH patients and 725 healthy controls from two Chinese Han populations were genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. Hardy-Weinberg equilibrium was tested using the χ(2 test. Genotype frequencies were estimated by direct counting. Allele and genotype frequencies were compared between patients and controls using the χ(2 test. The frequency of the A allele of rs2301436 was significantly higher both in Cohort 1 and Cohort 2 as compared with two separate controls (P = 0.044; P = 0.049, respectively. The significance was lost after Bonferroni correction in both cohorts (Pc = 0.516; Pc = 0.392, respectively. The frequency of the A allele was significantly higher in the combined patient group as compared with all controls before and after Bonferroni correction (P = 0.005, Pc = 0.025. The genotype and allele frequencies of rs3093024, rs6902119, rs3093023 and rs968334 were not different between patients with VKH and healthy controls based on analysis either for both cohorts or for the patients and controls in total. Analysis according to extra ocular clinical findings including headache, alopecia and poliosis, vitiligo and tinnitus did not show any association of the five polymorphisms with these parameters. CONCLUSION: These results suggest that the rs2301436 tagSNP of FGFR10P is positively associated with susceptibility to VKH syndrome in the tested Chinese Han populations. No association was found for

  16. Association of germline variation in CCNE1 and CDK2 with breast cancer risk, progression and survival among Chinese Han women.

    Directory of Open Access Journals (Sweden)

    Ji-Yuan Han

    Full Text Available BACKGROUND: Somatic alterations of cyclin-dependent kinase 2 (CDK2-cyclin E complex have been shown to contribute to breast cancer (BC development and progression. This study aimed to explore the effects of single nucleotide polymorphisms (SNPs in CDK2 and CCNE1 (a gene encoding G1/S specific cyclin E1 protein, formerly called cyclin E on BC risk, progression and survival in a Chinese Han population. METHODOLOGY/PRINCIPAL FINDINGS: We herein genotyped 6 haplotype-tagging SNPs (htSNPs of CCNE1 and 2 htSNPs of CDK2 in 1207 BC cases and 1207 age-matched controls among Chinese Han women, and then reconstructed haplotype blocks according to our genotyping data and linkage disequilibrium status of these htSNPs. For CCNE1, the minor allele homozygotes of three htSNPs were associated with BC risk (rs3218035: adjusted odds ratio [aOR] = 3.35, 95% confidence interval [CI] = 1.69-6.67; rs3218038: aOR = 1.81, 95% CI = 1.22-2.70; rs3218042: aOR = 2.64, 95% CI = 1.31-5.34, and these three loci showed a dose-dependent manner in increasing BC risk (P(trend = 0.0001. Moreover, the 5-SNP haplotype CCGTC, which carried none of minor alleles of the 3 at-risk SNPs, was associated with a favorable event-free survival (hazard ratio [HR] = 0.53, 95% CI = 0.32-0.90. Stratified analysis suggested that the minor-allele homozygote carriers of rs3218038 had a worse event-free survival among patients with aggressive tumours (in tumour size>2 cm group: HR = 2.06, 95% CI = 1.06-3.99; in positive lymph node metastasis group: HR = 2.41, 95% CI = 1.15-5.03; in stage II-IV group: HR = 2.03, 95% CI = 1.09-3.79. For CDK2, no significant association was found. CONCLUSIONS/SIGNIFICANCE: This study indicates that genetic variants in CCNE1 may contribute to BC risk and survival in Chinese Han population. They may become molecular markers for individual evaluation of BC susceptibility and prognosis. Nevertheless, further validation studies are needed.

  17. Family Impacts on Self-Esteem in Chinese College Freshmen.

    Science.gov (United States)

    Shi, Jingyu; Wang, Lu; Yao, Yuhong; Su, Na; Zhao, Xudong; Chen, Fazhan

    2017-01-01

    This study examined the impact of family function and family-related factors, such as being an only child, grandparenting, income, and family relationship on the self-esteem in college students who are in the transitional period from late adolescence to emerging adulthood. The participants were 2001 Chinese college freshmen with the age from 16 to 20 years. Data were collected by using the family assessment device (FAD), the Rosenberg Self-esteem Scale, and self-report of family information. Comparison analysis indicated that the students from one child families, harmonious families, from families with higher income, or raised by their parents without the experience of grandparenting are more likely to show high self-esteem than their counterparts. Moreover, a multiple regression showed that dimensions of FAD such as role, communication, behavioral control, and problem solving predicted level of self-esteem of the college students, ranging from 13.2 to 17.9% variance. The results of this study showed that the self-esteem of the college freshmen is highly correlated with their family's performance. Therefore, the program focusing on improving family functioning is needed, in order to enhance the self-esteem of the young people and hence contribute to promoting the mental health of them.

  18. Burden of Chinese stroke family caregivers: the Hong Kong experience.

    Science.gov (United States)

    Tang, Wai-Kwong; Lau, Chieh G; Mok, Vincent; Ungvari, Gabor S; Wong, Ka-Sing

    2011-09-01

    To ascertain the clinical and sociodemographic factors associated with family caregivers' burden in Chinese patients with stroke in Hong Kong. Cross-sectional design. Stroke Clinic. Patients (N=123) from a stroke clinic and their family caregivers. Not applicable. Predictive factors of family caregivers' burden in Chinese stroke patients in Hong Kong. Caregivers' burden was assessed with the Caregiving Burden Scale (CBS). Patients' and caregivers' sociodemographic data and clinical characteristics were recorded. Physical and psychological conditions were measured and rated with the following instruments: Cumulative Illness Rating Scale, Geriatric Depression Scale (GDS), Barthel Index, Instrumental Activities of Daily Living, Mini-Mental State Examination, Lubben Social Network Scale, Modified Life Event Scale (MLES), Hospital Anxiety and Depression Scale (HADS), and a single question about fatigue. In the univariate analysis, the CBS score had significant correlations with certain characteristics of caregivers (sex, GDS, HADS, depressive symptoms, fatigue, and MLES) and those of patients' (sex, age, education, GDS). Regression analysis revealed that caregivers' GDS and patients' education were the independent correlates of the CBS. The severity of depressive symptoms in Chinese stroke caregivers and patients' education are independent factors associated with the caregivers' burden. Further studies evaluating interventions on caregivers' burden should include the assessment and management of mood disorders. Copyright © 2011 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  19. Polymorphisms in the IL-17 Gene (rs2275913 and rs763780) Are Associated with Hepatitis B Virus Infection in the Han Chinese Population.

    Science.gov (United States)

    Ren, Wei; Wu, Zehua; Ma, Ruixin; Liu, Zhen; Wang, Yingying; Wu, Liqun; Liu, Shiguo; Wang, Zusen

    2017-05-01

    Interleukin-17 (IL-17) can accelerate the release of many pro-inflammatory cytokines. The purpose of our study was to investigate the potential association between polymorphisms in the IL-17 gene and susceptibility to hepatitis B virus (HBV) infection in the Han Chinese population. We recruited 596 HBV-infected patients and 612 ethnically matched controls, who were then genotyped for the IL-17A and IL-17F polymorphisms, rs2275913 and rs763780, respectively, by using TaqMan probe-based real-time polymerase chain reaction. The frequencies of the alleles and genotypes in patients and controls were compared by the χ 2 test. Statistically significant differences in genotypic and allelic frequencies were revealed at both polymorphic sites between HBV-positive patients and controls (rs2275913: genotype χ 2  = 37.74, p IL-17 polymorphisms in relation to an enhanced risk of HBV infection.

  20. Family Impacts on Self-Esteem in Chinese College Freshmen

    Directory of Open Access Journals (Sweden)

    Jingyu Shi

    2017-12-01

    Full Text Available This study examined the impact of family function and family-related factors, such as being an only child, grandparenting, income, and family relationship on the self-esteem in college students who are in the transitional period from late adolescence to emerging adulthood. The participants were 2001 Chinese college freshmen with the age from 16 to 20 years. Data were collected by using the family assessment device (FAD, the Rosenberg Self-esteem Scale, and self-report of family information. Comparison analysis indicated that the students from one child families, harmonious families, from families with higher income, or raised by their parents without the experience of grandparenting are more likely to show high self-esteem than their counterparts. Moreover, a multiple regression showed that dimensions of FAD such as role, communication, behavioral control, and problem solving predicted level of self-esteem of the college students, ranging from 13.2 to 17.9% variance. The results of this study showed that the self-esteem of the college freshmen is highly correlated with their family’s performance. Therefore, the program focusing on improving family functioning is needed, in order to enhance the self-esteem of the young people and hence contribute to promoting the mental health of them.

  1. Family Impacts on Self-Esteem in Chinese College Freshmen

    Science.gov (United States)

    Shi, Jingyu; Wang, Lu; Yao, Yuhong; Su, Na; Zhao, Xudong; Chen, Fazhan

    2017-01-01

    This study examined the impact of family function and family-related factors, such as being an only child, grandparenting, income, and family relationship on the self-esteem in college students who are in the transitional period from late adolescence to emerging adulthood. The participants were 2001 Chinese college freshmen with the age from 16 to 20 years. Data were collected by using the family assessment device (FAD), the Rosenberg Self-esteem Scale, and self-report of family information. Comparison analysis indicated that the students from one child families, harmonious families, from families with higher income, or raised by their parents without the experience of grandparenting are more likely to show high self-esteem than their counterparts. Moreover, a multiple regression showed that dimensions of FAD such as role, communication, behavioral control, and problem solving predicted level of self-esteem of the college students, ranging from 13.2 to 17.9% variance. The results of this study showed that the self-esteem of the college freshmen is highly correlated with their family’s performance. Therefore, the program focusing on improving family functioning is needed, in order to enhance the self-esteem of the young people and hence contribute to promoting the mental health of them. PMID:29312013

  2. Identification of genetic variations of a Chinese family with paramyotonia congenita via whole exome sequencing.

    Science.gov (United States)

    Li, Jinxin; Huang, Qinghai; Ge, Liang; Xu, Jing; Shi, Xingjuan; Xie, Wei; Liu, Xiang; Liu, Xiangdong

    2015-06-01

    Paramyotonia congenita (PC) is a rare autosomal dominant neuromuscular disorder characterized by juvenile onset and development of cold-induced myotonia after repeated activities. The disease is mostly caused by genetic mutations of the sodium channel, voltage-gated, type IV, alpha subunit (SCN4A) gene. This study intended to systematically identify the causative genetic variations of a Chinese Han PC family. Seven members of this PC family, including four patients and three healthy controls, were selected for whole exome sequencing (WES) using the Illumina HiSeq platform. Sequence variations were identified using the SoftGenetics program. The mutation R1448C of SCN4A was found to be the only causative mutation. This study applied WES technology to sequence multiple members of a large PC family and was the first to systematically confirm that the genetic change in SCN4A is the only causative variation in this PC family and the SCN4A mutation is sufficient to lead to PC.

  3. HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population.

    Science.gov (United States)

    Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

    2014-05-01

    Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04-2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population.

  4. Ankle-brachial index and brachial-ankle pulse wave velocity are associated with albuminuria in community-based Han Chinese.

    Science.gov (United States)

    Xu, Xiqi; He, Jinggui; Wang, Shuxia; Zhu, Ping; Chen, Qian; Zhang, Xiujin; Tao, Tao; Wang, Hao; Liu, Jianfeng; Wang, Haijun; Li, Xiaoying

    Our study aimed to explore whether the ankle-brachial index (ABI) and brachial-ankle pulse wave velocity (baPWV) were associated with albuminuria in community-based Han Chinese. Total 2127 subjects (860 men and 1267 women) aged 60 years and over were recruited in Beijing. Albuminuria was assessed by the urinary albumin-to-creatinine ratio (UACR) of ≥30 mg/g. BaPWV was divided by quartile. The logistic regression was used to determine the odds ratio (OR) and 95% confidence intervals (CIs) of ABI and baPWV with albuminuria. ABI was associated with albuminuria in the interaction model (OR 0.89, 95% CI 0.81-0.99 by every 0.1 unit increase of ABI), especially in hypertension (OR 0.82, 95% CI 0.73-0.92) and diabetes (OR 0.83, 95% CI 0.68-0.98) groups. BaPWV groups were also significantly associated with albuminuria, ORs of having albuminuria for baPWV quartile II, III, and IV were 1.02(0.65-1.52), 1.05(0.72-1.61), and 1.18(1.04-1.47) in the interaction model. For hypertension and diabetes patients, only the baPWV quartile IV group had higher OR. ABI and baPWV were associated with albuminuria after adjusting for other risk factors in Chinese community-based elderly Han population. The association of ABI with albuminuria was stronger in hypertension and diabetes patients.

  5. There is no association between microRNA gene polymorphisms and risk of triple negative breast cancer in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Fei Ma

    Full Text Available Triple-negative breast cancer (TNBC is defined by the lack of the expression of estrogen receptor (ER, progesterone receptor (PR and human epidermal growth factor receptor 2 (HER2. It is characterized by aggressive behavior, poor prognosis and lack of targeted therapies. MicroRNA (miRNA as a novel modulator of gene expression has played an important regulatory role in the malignancy. Dysregulation and/or mutation of the miRNAs may also contribute to the TNBC susceptibility since it is associated with the expression of ER, PR and HER2. Single nucleotide polymorphisms (SNPs in miRNAs may be extremely relevant for TNBC. We tried to validate the hypothesis that genetic variations in miRNA are associated with TNBC development, and identify candidate biomarkers for TNBC susceptibility and clinical treatment. We screened the genetic variants in all miRNA genes listed in the public database miRBase and NCBI. A total of 23 common SNPs in 22 miRNAs, which tagged the known common variants in the Chinese Han people with a minor allele frequency greater than 0.05, were genotyped. This case-control study involved 191 patients with TNBC and 192 healthy female controls. Frequencies of SNPs were compared between cases and controls to identify the SNPs associated with TNBC susceptibility. No significant association was found between TNBC risk and the SNPs in the miRNA genes in the Chinese Han people (P>0.05, but this warrants further studies.

  6. Fibroblast growth factor 23 (FGF23) gene polymorphisms are associated with essential hypertension risk and blood pressure levels in Chinese Han population.

    Science.gov (United States)

    Cai, Peng; Peng, Yan; Li, Li; Chu, Wei; Wang, Xukai

    2018-01-16

    In this case-control study, 246 EH patients and 157 healthy controls were selected from Chinese Han population to explore the associations between the fibroblast growth factor 23 (FGF23) gene polymorphisms and essential hypertension (EH).The SequenomMassarray system was used for the genotyping of three FGF23 gene Tag single-nucleotide polymorphisms, namely rs7955866, rs13312756, and rs3812822. The primers were designed by Assay Designer 3.1 software, and then the samples were added to a 384-well plate for the polymerase chain reaction amplification, shrimp alkaline phosphatase reaction, and desalting after extension. The distributions of the alleles, genotypes, and haplotypes were compared between the two groups. Confounding factors (sex, age, BMI, smoking, and drinking) were adjusted in the non-logistic regression, and the results showed that rs7955866 and rs3812822 polymorphisms were independently associated with the risk of developing EH (P control group showed that carrying rs7955866 A allele (P = 0.031) and rs3812822 C allele (P = 0.025) was associated with the increase of systolic blood pressure (SBP). The insulin (INS) level in the peripheral blood was significantly different between the case and control groups (P = 0.014). After confounding factors were excluded, the results showed that the serum INS level was also an independent risk factor of developing EH (P = 0.044; OR = 1.604, 95%CI: 1.014-2.539). In summary, our results suggest that FGF23 gene polymorphisms are associated with the risk of developing EH in Chinese Han population.

  7. Lack of association between the CALM1 core promoter polymorphism (-16C/T and susceptibility to knee osteoarthritis in a Chinese Han population

    Directory of Open Access Journals (Sweden)

    Chen Dongyang

    2008-10-01

    Full Text Available Abstract Background CALM1 gene encodes calmodulin (CaM, an important and ubiquitous eukaryotic Ca2+-binding protein. Several studies have indicated that a deficient CaM function is likely to be involved in the pathogenesis of osteoarthritis (OA. Using a convincing genome-wide association study, a Japanese group has recently demonstrated a genetic association between the CALM1 core promoter polymorphism (-16C/T transition SNP, rs12885713 and OA susceptibility. However, the subsequent association studies failed to provide consistent results in OA patients of differently selected populations. The present study is to evaluate the association of the -16C/T polymorphism with knee OA in a Chinese Han population. Methods A case-control association study was conducted. The polymorphism was genotyped in 183 patients who had primary symptomatic knee OA with radiographic confirmation and in 210 matched controls. Allelic and genotypic frequencies were compared between patients and control subjects. Results No significant difference was detected in genotype or allele distribution between knee OA and control groups (all P > 0.05. The association was also negative even after stratification by sex. Furthermore, no association between the -16C/T SNP genotype and the clinical variables age, sex, BMI (body mass index and K/L (Kellgren/Lawrence score was observed in OA patients. Conclusion The present study suggests that the CALM1 core promoter polymorphism -16C/T is not a risk factor for knee OA susceptibility in the Chinese Han population. Further studies are needed to give a global view of this polymorphism in pathogenesis of OA.

  8. Genetic polymorphisms of the CASP8 gene promoter may not be associated with colorectal cancer in Han Chinese from southwest China.

    Directory of Open Access Journals (Sweden)

    Mei-Sheng Xiao

    Full Text Available PURPOSE: Caspase 8 (CASP8 plays a critical role in the apoptotic pathway and aberrant regulation of this pathway causes many diseases including cancers. Genetic variants rs3834129 (CTTACT/- and rs3769821 (T/C in the promoter region of the CASP8 gene were documented to be associated with multiple solid cancers and non-Hodgkin's lymphoma (NHL, respectively, despite of some controversies. We aimed to discern potential association of these two variants and rs113686495 (CTGTCATT/-, as well as CASP8 mRNA and protein expression levels with colorectal cancer (CRC in Han Chinese. METHODS: We genotyped CASP8 genetic variants in 305 CRC patients and 342 healthy individuals from Kunming, Southwest China. Expression levels of CASP8 mRNA and protein were quantified in paired cancerous and paracancerous normal tissues by using real-time quantitative PCR and western blot, respectively. We compared the frequencies of alleles, genotypes, and haplotypes between the cases and controls. Correlation of CASP8 mRNA and protein expression levels in paired cancerous and paracancerous normal tissues from patients with different genotypes and clinical expression were also evaluated. RESULTS: There was no association of the CASP8 genetic variants with CRC in our case-control study. The CASP8 gene mRNA expression levels in cancerous and paracancerous normal tissues were similar and there was no significant difference between subjects with different genotypes and clinical features. However, we found that CASP8 protein level was significantly lower in cancerous tissues than in paired paracancerous normal tissues. CONCLUSIONS: Our results suggest that the three CASP8 genetic variants may not be associated with CRC risk in Han Chinese from southwest China. Aberrant CASP8 protein expression may play a role in the pathogenesis of CRC.

  9. Association of a TNIP1 polymorphism with Vogt-Koyanagi-Harada syndrome but not with ocular Behcet's disease in Han Chinese.

    Directory of Open Access Journals (Sweden)

    Yanyun Shi

    Full Text Available OBJECTIVES: The aim of the study was to investigate the association of TNFα-induced protein 3 interacting with protein 1 (TNIP1 gene polymorphisms with Vogt-Koyanagi-Harada (VKH syndrome and Behcet's disease (BD in a Han Chinese population. METHODS: A total of 656 BD patients, 961 VKH syndrome patients and 1534 healthy controls were included in this two-stage case control study. Seven SNPs, including rs17728338, rs7708392, rs10036748, rs3762999, rs999556, rs4958881 and rs3792783, belonging to TNIP1 were genotyped and analyzed by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method. The data were analyzed by using the χ2 or Fisher's exact test and corrected for multiple comparisons by the Bonferroni method. RESULTS: A significantly increased frequency of the GG genotype and a decreased frequency of the AG genotype of rs17728338 were found in VKH patients (Pc = 0.038 OR = 1.934, 95% CI  = 1.438 ∼ 2.601. No significant difference was noted in allele or genotype frequencies of rs7708392, rs10036748, rs3762999, rs999556, rs4958881 and rs3792783, between VKH patients and healthy controls (Pc>0.05. No significant difference was noted in allele or genotype frequencies of the tested 7 SNPs between BD patients and healthy controls. Analysis of extraocular clinical findings, did not reveal an association of the TNIP1 gene polymorphisms with BD or VKH syndrome subgroups. CONCLUSION: A TNIP1 polymorphism may be a risk factor for VKH syndrome in Han Chinese.

  10. Investigation into the association between P2RX7 gene polymorphisms and susceptibility to primary gout and hyperuricemia in a Chinese Han male population.

    Science.gov (United States)

    Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao

    2017-04-01

    The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P  .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P  .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for primary gout.

  11. Prediction of metabolic syndrome by non-alcoholic fatty liver disease in northern urban Han Chinese population: a prospective cohort study.

    Science.gov (United States)

    Zhang, Tao; Zhang, Yongyuan; Zhang, Chengqi; Tang, Fang; Li, Hongkai; Zhang, Qian; Lin, Haiyan; Wu, Shuo; Liu, Yanxun; Xue, Fuzhong

    2014-01-01

    To explore the relationship between non-alcoholic fatty liver disease (NAFLD) and the metabolic syndrome (MetS), and evaluate the value of NAFLD as a marker for predicting the risk of MetS in a large scale prospective cohort from northern urban Han Chinese population. A total of 17,920 MetS-free at baseline cohort members was included in the current study between 2005 and 2011. The baseline characteristics of the cohort were compared by NAFLD status at baseline, MetS status after follow-up. Cox proportional hazards models were used to estimate the unadjusted or adjusted hazard ratios (HRs) for NAFLD at baseline predicting the risk of MetS. 2,183 (12.18%) new cases of MetS occurred between 2005 and 2011. In unadjusted model, HRs (95% CIs) for NAFLD predicting MetS was 3.65 (3.35, 3.97). After adjusting the confounding factors of age, gender, the metabolic factors, smoke and exercise, the HRs (95% CIs) was 1.70 (1.55, 1.87). Gender difference was observed, adjusted HRs (95% CIs) of NAFLD for predicting MetS were 2.06(1.72, 2.46) and 1.55(1.39, 1.72) in female and male population, respectively. Moreover, 163 participants developed MetS among participants without any MetS component at baseline, and its adjusted HRs was still significant, 1.87 (1.12, 3.13). The present study indicates that NAFLD is an independent risk factor for predicting the risk of MetS in northern urban Han Chinese population, and the people with NAFLD should initiate weight and dietary control to prevent the occurrence of MetS.

  12. A Functional Variant at the miR-214 Binding Site in the Methylenetetrahydrofolatereductase Gene Alters Susceptibility to Gastric Cancer in a Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Qiaoyun Chen

    2015-05-01

    Full Text Available Background and Aims: Single nucleotide polymorphisms in miRNA binding sites, which are located in mRNA 3' untranslated regions (3'-UTRs, were recently found to influence microRNA-target interactions. Specifically, such polymorphisms can modulatebinding affinity or create or destroy miRNA-binding sites; such variants have also been found to be associated with cancer risk. In this study, we explored the effect of a functional variant at the miR-214 binding site in the methylenetetrahydrofolate reductase gene (rs114673809 on gastric cancer (GC risk in a hospital-based case-control study in a Chinese Han population. Methods and Results: We genotyped the rs114673809 polymorphism in 345 gastric cancer patients and 376 cancer-free controls using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP technique. The functions of rs114673809 were investigated using a luciferase activity assay and validated by immunoblotting. We found that participants carrying the rs114673809 AA genotype or A allele had a significantly increased risk of gastric cancer (OR = 1.667, 95% CI = 1.044-2.660, P = 0.034; OR = 1.261, 95% CI = 1.017-1.563, P = 0.037, respectively compared to those carrying the GG genotype and G allele. In addition, rs114673809 modified the binding of hsa-miR-214 to MTHFR as well as MTHFR protein levels in gastric cancer patients. Conclusion: Our data suggested that rs114673809, which is located at the miR-214 binding site in the 3'-UTR of MTHFR, may play an important role in the development of gastric cancer in a Chinese Han population.

  13. Genetic variants of OCT1 influence glycemic response to metformin in Han Chinese patients with type-2 diabetes mellitus in Shanghai.

    Science.gov (United States)

    Zhou, Yong; Ye, Weiwei; Wang, Yi; Jiang, Zhikui; Meng, Xiangying; Xiao, Qian; Zhao, Qian; Yan, Jian

    2015-01-01

    Genetic variation in OCT1 can influence the glycemic response to metformin. We evaluated the effects of the OCT1 single-nucleotide polymorphisms (SNPs), rs1867351, rs4709400, rs628031, and rs2297374, on metformin efficacy in type-2 diabetes mellitus (DM) patients. We performed a single-center prospective analysis of the distributions of these SNPs in a cohort of Han Chinese subjects in Shanghai, China (HCS), and evaluated the effects of each SNP on glycemic control in HCS DM patients following 3 months of incident metformin treatment. The allele frequencies of rs4709400 and rs628031 in our HCS control group differed from those previously reported for Han Chinese subjects in Beijing (HCB), as well as those previously reported for Caucasians and Africans, whereas the allele frequencies of rs1867351 and rs2297374 were more similar to those in HCB subjects. The DM patients with the rs1867351 T/T or rs4709400 G/G genotype exhibited greater reductions in postprandial plasma glucose (PPG), compared to those with different genotypes of these SNPs. The DM patients with the rs2297374 C/T, rs4709400 G/G, or rs628031 G/G genotype exhibited greater reductions in fasting plasma glucose (FPG), and those with the rs1867351 T/T, rs628031 A/A, or rs2297374 C/T genotype exhibited greater reductions in HbA1c , compared to those with different genotypes of these SNPs. Conclusions /interpretation: The rs1867351, rs4709400, rs628031, and rs2297374 SNPs of OCT1 have selective effects on FPG, PPG, and HbA1c in HCS DM patients in response to metformin treatment. Future studies of these SNPs in larger samples of HCS DM patients are warranted.

  14. -173G/C polymorphism in the promoter of MIF is associated with hepatitis B virus infection in a Chinese Han population.

    Science.gov (United States)

    Wang, Z S; Yin, C C; Han, S; Jiang, F L; Guo, W G; Wu, L Q; Liu, S H

    2015-07-28

    In addition to the host immune response, genetic and environmental factors play crucial roles in the manifestation of hepatitis B virus (HBV) infection. The macrophage migration inhibitory factor (MIF) -173G/C polymorphism (rs755622), located in the promoter region of MIF, may play integral roles in diverse processes, including the immune response. Thus, the MIF -173G/C polymorphism may influence the immune response to HBV during natural infection. We investigated whether the MIF -173G/C polymorphism was associated with susceptibility to HBV infection in a Chinese Han population. A total of 596 HBV infection cases and 612 age-matched controls were recruited for the study. Genotyping of the MIF -173G/C polymorphism was performed using the allele-specific polymerase chain reaction method. The frequencies of the alleles and genotypes in patients and controls were compared using the χ(2) test. Carriers of the variant C allele in MIF -173 G/C were at significantly higher risk of HBV infection than carriers of the wild-type allele (P = 0.032, odds ratio = 0.799, 95% confidence interval = 0.651-0.981). However, there was no significant difference in the distribution of MIF -173G/C genotypes between case and control groups in either population (P = 0.096, degrees of freedom = 2). Our findings indicate that the G to C base change in MIF -173 G/C confers an increased risk of development of HBV infection by altering the expression of MIF in our Chinese Han population.

  15. An investigation of a set of DIP-STR markers to detect unbalanced DNA mixtures among the southwest Chinese Han population.

    Science.gov (United States)

    Tan, Yu; Wang, Li; Wang, Hui; Tian, Huan; Li, Zhilong; Wang, Qian; Jian, Hui; Cao, Shuqiang; Liang, Weibo; Zhang, Lin

    2017-08-14

    The resolution of DNA mixtures is still a difficult problem that is worthy of further study. A common method applied for analysing mixtures is the use of autosomal STR markers as well as related calculation software based on genotypes; however, these markers have a limitation in detecting minor DNA in unbalanced mixtures if major DNA constitutes over 95% of the stain. Novel biomarkers, such as Y-STR, DIP-STR and SNP-STR, have been shown to perform well in distinguishing DNA donors in this type of mixture. DIP-STR can successfully target minor DNA in 1000-fold background DNA using two separate allele-specific primers. However, whether this method can successfully detect minor DNA primarily depends on the distribution of the DIPs in a population. Until now, only Swiss population data have been reported; therefore in this study, we selected 10 DIP-STR markers that performed well in the Swiss population and investigated whether these markers were also useful among the southwest Chinese Han population. The allele frequencies were estimated based on 152 samples, and six of the ten DIP-STR makers had a relatively high probability of informative markers (I value), which indicated their potential usefulness in the southwest Chinese Han population. A comparative study of DIP-STR markers and autosomal STR markers demonstrated that DIP-STR markers detected minor DNA at a ratio of 1:1000, while autosomal STR markers often failed to genotype minor DNA because of strong background noises caused by large amount of major DNA. However, the discrimination power was not high enough using these six DIPs alone. Therefore, we suggest that development of a panel with more loci is imperative and that a panel combined with DIP-STR and SNP-STR markers may be a possible way to achieve better discrimination power. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Joint effect of CENTD2 and KCNQ1 polymorphisms on the risk of type 2 diabetes mellitus among Chinese Han population.

    Science.gov (United States)

    Qian, Yun; Dong, Meihua; Lu, Feng; Li, Huizhang; Jin, Guangfu; Hu, Zhibin; Shen, Chong; Shen, Hongbing

    2015-05-15

    Genome-wide association studies (GWAS) in populations of European ancestry have identified nine single nuclear polymorphisms (SNP) on chromosome 11 related to type 2 diabetes (T2D) susceptibility. Herein, we further evaluate the association of these SNPs and T2D in a Chinese Han population. We performed a case-control study of 2925 T2D cases and 3281 controls to evaluate the association of five SNPs of KCNJ11, MTNR1B, CENTD2 and LOC387761 and T2D in addition to the previously reported four SNPs of KCNQ1. Multiple logistic regression was used to evaluate SNP's effect by adjustment for confounding factor age, sex and BMI. In the first stage, SNPs rs1552224 at CENTD2 were significantly associated with T2D and the association was statistically significant in the whole study population (P = 0.001) although it was not replicated in the second stage. rs1552224 and rs2237897 of KCNQ1 showed significant joint effect on T2D and there was a significant decreased risk of T2D with the number increase of risk alleles (P for trend = 3.81 × 10(-17)). Compared to those without carrying any risk allele, individuals carrying one, two, and three or four risk alleles had a 30.7%, 44.8% and 62.0% decreased risk for developing T2D, respectively. Our finding suggests that genetic variant rs1552224 of CENTD2 on chromosome 11 contributes to an independent effect as well as joint cumulative effect with rs2237897 of KCNQ1 on the risk of T2D in Chinese Han population, and further functional research would be warranted. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Relationship between human LTA4H polymorphisms and extra-pulmonary tuberculosis in an ethnic Han Chinese population in Eastern China.

    Science.gov (United States)

    Yang, Jinghui; Chen, Jin; Yue, Jun; Liu, Lirong; Han, Min; Wang, Hongxiu

    2014-12-01

    Two single nucleotide polymorphisms in Leukotriene A4 hydrolase (LTA4H) gene were reported to be associated with protection from pulmonary tuberculosis in Vietnamese population. But these associations were not found in the Russians. To investigate the association of LTA4H polymorphisms with tuberculosis in a Han Chinese population in Eastern China, we genotyped 5 SNPs of LTA4H gene in 743 of pulmonary tuberculosis patients, 372 of extra-pulmonary tuberculosis patients and 888 of healthy controls individuals. The CC and TT homozygotes of rs1978331 and rs2540474 were identified to have higher rates (P tuberculosis (OR = 1.412; 95% CI = 1.104-1.804 and(OR = 1.380; 95% CI = 1.080-1.764). However, no significant association was found between any of the SNPs and pulmonary tuberculosis. In the extra-pulmonary tuberculosis subgroups. LTA4H gene were significantly associated with tuberculous meningitis, lymph node tuberculosis, bone tuberculosis and other extra-pulmonary tuberculosis except for pleural tuberculosis. The present findings suggest that polymorphisms in the LTA4H gene may affect susceptibility to extra-pulmonary tuberculosis and change the risk of developing the disease in the Han nationality in the East China. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Genetic and environmental influences on blood pressure and body mass index in Han Chinese : a twin study

    NARCIS (Netherlands)

    Wu, Ting; Snieder, Harold; Li, Liming; Cao, Weihua; Zhan, Siyan; Lv, Jun; Gao, Wenjing; Wang, Xiaoling; Ding, Xiuhua; Hu, Yonghua

    The familial aggregation of blood pressure (BP) may be partly due to the familial aggregation of obesity, caused by genetic and/or environmental factors that influence both. Gene-obesity interactions are expected to result in different heritability estimates for BP at different obesity levels.

  19. Association of single nucleotide polymorphisms in TCF2 with type 2 diabetes susceptibility in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Xuelong Zhang

    Full Text Available Hepatocyte nuclear factor 1β (HNF1β, a transcription factor encoded by the transcription factor 2 gene (TCF2, plays a critical role in pancreatic cell formation and glucose homeostasis. It has been suggested that single nucleotide polymorphisms (SNPs of TCF2 are associated with susceptibility to type 2 diabetes (T2D. However, published results are inconsistent and inclusive. To further investigate the role of these common variants, we examined the association of TCF2 polymorphisms with the risk of T2D in a Han population in northeastern China. We genotyped five SNPs in 624 T2D patients and 630 healthy controls by using a SNaPshot method, and evaluated the T2D risk conferred by individual SNPs and haplotypes. In the single-locus analysis, we found that rs752010, rs4430796 and rs7501939 showed allelic differences between T2D patients and healthy controls, with an OR of 1.26 (95% CI 1.08-1.51, P = 0.003, an OR of 1.23 (95% CI 1.06-1.55, P = 0.001 and an OR of 1.28 (95% CI 1.10-1.61, P = 0.001, respectively. Genotype association analysis of each locus also revealed that the homozygous carriers of the at-risk allele had a significant increased T2D risk compared to homozygous carriers of the other allele (OR 1.78, 95% CI 1.20-2.64 for rs752010; OR 1.82, 95% CI 1.24-2.67 for rs4430796; OR 1.95, 95% CI 1.31-2.90 for rs7501939, even after Bonferroni correction for multiple comparisons. Besides, the haplotype-based analysis demonstrated that AGT in block rs752010-rs4430796-rs7501939 was associated with about 30% increase in T2D risk (OR 1.31, 95% CI 1.09-1.57, P = 0.01. Our findings suggested that TCF2 variants may be involved in T2D risk in a Han population of northeastern China. Larger studies with ethnically diverse populations are warranted to confirm the results reported in this investigation.

  20. Association of an oestrogen receptor gene polymorphism in Chinese Han women with endometriosis and endometriosis-related infertility.

    Science.gov (United States)

    Wang, Wenwen; Li, Yan; Maitituoheti, Mayinuer; Yang, Runfeng; Wu, Zhangying; Wang, Tian; Ma, Ding; Wang, Shixuan

    2013-01-01

    Endometriosis is a steroid-dependent complex disease. The oestrogen receptor plays an important role by mediating oestrogen action and eutopic or ectopic endometrium development. This study investigated whether single-nucleotide polymorphisms in the genes for oestrogen receptor 1 (ESR1) and oestrogen receptor 2 (ESR2) are associated with endometriosis and endometriosis-related infertility. The participants included 157 infertile and 155 fertile endometriosis women as well as 92 women with primary infertility and 265 fertile women as controls. The iPLEX Gold system (MassARRAY system, Sequenom) was used for genotyping of ESR1 and ESR2. Statistical analysis showed that ESR1 (rs3798573 A/G) was significantly associated with endometriosis and endometriosis-related infertility (P=0.011, P=0.009). No association was found with ESR1 (rs1159327 A/G, rs3020348 A/C) and ESR2 (rs17179740 A/G) either for endometriosis or endometriosis-related infertility. According to the revised American Fertility Society classification, all of the detected single-nucleotide polymorphisms had no association with endometriosis in stage I-II or in stage III-IV. The results suggest that the ESR1 polymorphism rs3798573 A/G is associated with increased risk of endometriosis and endometriosis-related infertility in Han women from central China. Endometriosis is an oestrogen-dependent complex disease, which is one of the most common causes of infertility. Oestrogen receptors (ESR), which mediate oestrogen actions, are considered to play an essential role in the pathogenesis of endometriosis. Therefore, ESR may also play an important role in endometriosis-related infertility. To investigate the association between ESR and endometriosis or endometriosis-related infertility, detection of ESR polymorphisms have been carried out in several populations by other researchers; however, the results remain controversial. In a previous study of ours, through a pooling-based genome-wide scan of endometriosis and

  1. Family Mastery Enhances Work Engagement in Chinese Nurses: A Cross-Lagged Analysis

    Science.gov (United States)

    Lu, Chang-qin; Siu, Oi-ling; Chen, Wei-qing; Wang, Hai-jiang

    2011-01-01

    Based on Greenhaus and Powell's (2006) theory of work-family enrichment and the job demands-resources (JD-R) model of work engagement (Bakker & Demerouti, 2008), this study focused on the family-to-work enrichment process by investigating the effect of family mastery on work engagement in a Chinese context. A sample of 279 Chinese female…

  2. Population genetics and new insight into range of CAG repeats of spinocerebellar ataxia type 3 in the Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Shi-Rui Gan

    Full Text Available Spinocerebellar ataxia type 3 (SCA3, also called Machado-Joseph disease (MJD, is one of the most common SCAs worldwide and caused by a CAG repeat expansion located in ATXN3 gene. Based on the CAG repeat numbers, alleles of ATXN3 can be divided into normal alleles (ANs, intermediate alleles (AIs and expanded alleles (AEs. It was controversial whether the frequency of large normal alleles (large ANs is related to the prevalence of SCA3 or not. And there were huge chaos in the comprehension of the specific numbers of the range of CAG repeats which is fundamental for genetic analysis of SCA3. To illustrate these issues, we made a novel CAG repeat ladder to detect CAG repeats of ATXN3 in 1003 unrelated Chinese normal individuals and studied haplotypes defined by three single nucleotide polymorphisms (SNPs closed to ATXN3. We found that the number of CAG repeats ranged from 13 to 49, among them, 14 was the most common number. Positive skew, the highest frequency of large ANs and 4 AIs which had never been reported before were found. Also, AEs and large ANs shared the same haplotypes defined by the SNPs. Based on these data and other related studies, we presumed that de novo mutations of ATXN3 emerging from large ANs are at least one survival mechanisms of mutational ATXN3 and we can redefine the range of CAG repeats as: ANs≤44, 45 ≤AIs ≤49 and AEs≥50.

  3. An association study of the m6A genes with major depressive disorder in Chinese Han population.

    Science.gov (United States)

    Du, Tingfu; Rao, Shuquan; Wu, Lin; Ye, Ning; Liu, Zeyue; Hu, Huiling; Xiu, Jianbo; Shen, Yan; Xu, Qi

    2015-09-01

    Major depressive disorder (MDD) is a common, chronic and recurrent mental disease but the precise mechanism behind this disorder remains unknown. FTO is one of the N6-methyladenosine (m6A) modification genes and has recently been found to be associated with depression. N6-methyladenosine (m6A) is the most abundant internal modification on RNA, which is highly enriched within the brain. There are five genes involved in m6A modification including FTO, but whether these m6A modification genes could confer a risk of MDD is still unclear. This study aimed to investigate the genetic influence of the m6A modification genes on risk of MDD. We genotyped 23 SNPs in 5 modification genes among 738 patients with MDD and 1098 controls. The UNPHASED program was applied to analyze the genotyping data for allelic and genotypic association with MDD. Of the 23 SNPs selected, rs12936694 from the m6A demethylase gene ALKBH5 showed allelic association (χ(2)=11.19, p=0.0008, OR=1.491, 95%CI 1.179-1.887) and genotypic association (χ(2)=12.26, df=2, p=0.0022) with MDD. Replication and functional study are required to draw a firm conclusion. The ALKBH5 gene may play a role in conferring risk of MDD in the Chinese population. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Association Study of Single-Nucleotide Polymorphisms of STAT2/STAT3/IFN-γ Genes in Cervical Cancer in Southern Chinese Han Women.

    Science.gov (United States)

    Yuan, Yuan; Fan, Jie-Lin; Yao, Fang-Ling; Wang, Kang-Tao; Yu, Ying; Carlson, Jennifer; Li, Ming

    2015-01-01

    Interferon-γ (IFN-γ) and signal transducers and activators of transcription (STATs) each play an important role in carcinogenesis associated with viral infection. Cervical cancer is almost invariably associated with infection by human papillomavirus (HPV), and previous studies suggested that dysregulation of the signal pathway involved in IFN-γ and STATs is associated. Our objective was to evaluate the association of SNPs in STAT2, STAT3, and IFN-γ with cervical cancer susceptibility in Chinese Han women in Hunan province. Genomic DNA was extracted from peripheral blood samples of 234 cervical cancer patients and 216 healthy female controls. STAT2 and STAT3 genotyping was performed using polymerase chain reaction-restriction enzyme (PCR-RE) analysis. IFN-γ genotyping was detected by PCR-amplification of specific allele (PASA). For STAT2 rs2066807 polymorphisms, there was no significant difference of genotype distribution (P=0.827) and allele frequencies (P=0.830, OR=1.09, 95% CI: 0.51-2.31) between cases and controls. For STAT3 rs957970 polymorphisms, there was no significant difference of genotype distribution (P=0.455) and allele frequencies (P=0.560, OR=0.92, 95% CI: 0.71-1.20) between cases and controls. For IFN-γ +874A/T polymorphisms, there was no significant difference of genotype distribution (P=0.652) and allele frequencies (P=0.527, OR=1.12, 95% CI: 0.79-1.59) between cases and controls. These results suggest that polymorphisms in STAT2, STAT3 and IFN-γ genes are not likely to be strong predictors of cervical cancer in Han women in southern China.

  5. Mitochondrial haplotypes may modulate the phenotypic manifestation of the LHON-associated ND1 G3460A mutation in Chinese families.

    Science.gov (United States)

    Ji, Yanchun; Liang, Min; Zhang, Juanjuan; Zhang, Minglian; Zhu, Jinping; Meng, Xiangjuan; Zhang, Sai; Gao, Min; Zhao, Fuxin; Wei, Qi-Ping; Jiang, Pingping; Tong, Yi; Liu, Xiaoling; Qin Mo, Jun; Guan, Min-Xin

    2014-03-01

    To investigate the pathophysiology of Leber's hereditary optic neuropathy (LHON), a cohort of 1164 Han Chinese subjects with LHON were screened for ND1 G3460A mutation. A total of 295 subjects from 16 Han Chinese families carrying the G3460A mutation underwent a clinical and genetic evaluation and molecular analysis of mitochondrial (mt)DNA. The incidence of G3460A mutation was 1.4% in this cohort of Chinese subjects with LHON. Twenty-seven (20 males/7 females) of 109 matrilineal relatives among 10 Chinese pedigrees carrying this mutation exhibited a wide range of severity and age-at-onset in visual impairment. Penetrances of optic neuropathy ranged from 7.1% to 50%, with the average of 24.5%. The age-at-onset of 27 affected matrilineal relatives varied from 10 to 40 years, with the average of 22 years. Molecular analysis identified the homoplasmic G3460A mutation and distinct sets of variants belonging to eight haplogroups. Haplogroup M with G3460A mutation was of higher frequency than those in controls. The penetrances of visual loss in families carrying mitochondrial DNA haplogroups A, B and M were higher than those in other families. Furthermore, haplogroup-specific variants tRNA(Ser(AGY)) A12223G, tRNA(Thr) G15927A and tRNA(Glu) A14693G may enhance the penetrance of visual loss in these families. The G3460A mutation occurred through recurrent origins and founder events in Chinese population. Mitochondrial modifiers may modulate the penetrance and expressivity of optic neuropathy among Chinese pedigrees carrying the G3460A mutation. Thus, our findings may provide new insights into the understanding of pathophysiology and valuable information on the management of LHON.

  6. Association between the CYP4A11 T8590C variant and essential hypertension: new data from Han Chinese and a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Hua-Cheng Yan

    Full Text Available OBJECTIVE: CYP4A11 oxidizes endogenous arachidonic acid to 20-hydroxyeicosatetraenoic acid, a renal vasoconstrictor and natriuretic in humans. Previous studies demonstrated an association between a functional variant (T8590C of CYP4A11 and essential hypertension, though with conflicting results. To elucidate this relationship, a case-control study and meta-analysis were performed to assess the possible association of essential hypertension with CYP4A11 genetic variations. METHODS: Associations between the T8590C polymorphism and essential hypertension were examined in 328 unrelated cases and 297 age-matched controls in Han Chinese individuals. High-resolution melting was used to identify the CYP4A11 variant. To further investigate the association, we conducted a meta-analysis including eight studies published previously in July 2012. RESULTS: The frequency of the CYP4A11 T8590C polymorphism showed no significant difference between cases and controls (all P>0.05. However, the meta-analysis showed that the CYP4A11 T8590C polymorphism may increase the risk of essential hypertension in an additive model (OR: 1.15, 95% CI: 1.02-1.29, P = 0.02, a dominant model (OR: 1.06, 95% CI: 1.01-1.32, P = 0.03, a recessive model (OR: 1.52, 95% CI: 1.15-2.02, P = 0.003 and a homozygote contrast (OR: 1.38, 95% CI: 1.07-1.78, P = 0.01. Also, a significant relationship was observed among Caucasians in the additive model, the homozygote contrast, the recessive model and the dominant model (all P0.05. CONCLUSIONS: This meta-analysis suggests there is a significant association between the CYP4A11 T8590C variant and essential hypertension, especially in Caucasians. The case-control study did not find a significant association among the Han Chinese population, but the controls were poorly matched and meaningful conclusions cannot therefore be made. Further large-scale studies are needed to clarify whether the CYP4A11 T8590C polymorphism is associated with

  7. Clinical and genetic characteristics of Leber congenital amaurosis with novel mutations in known genes based on a Chinese eastern coast Han population.

    Science.gov (United States)

    Wang, Shiyuan; Zhang, Qi; Zhang, Xiang; Wang, Zhaoyang; Zhao, Peiquan

    2016-11-01

    To study the genotype-phenotype characteristics of Leber congenital amaurosis (LCA) in the Chinese eastern coast Han population. Children with strictly defined LCA with novel mutations of known LCA genes identified by targeted next-generation sequencing (NGS) and a prediction of pathogenicity (in silico) were included in this study (2013-2015). Mutations were confirmed using Sanger sequencing and segregation analysis. The clinical findings were recorded, including visual function, refractive error, fundus changes, and electroretinograms (ERGs). Spectral-domain optical coherence tomography (SD-OCT) examination, fundus fluorescein angiography (FFA), and ultra-wide field scanning laser ophthalmoscopy (UWF SLO) were performed on children when available. A total of 65 patients underwent NGS for mutation screening and 45 patients were identified as carrying known LCA genes. Of these, 36(80 %) children harbored novel mutations, and they were all from the eastern coast of China. A total of 50 novel variants were identified, which covered 15 known LCA genes. GUCY2D (17 %), CEP290 (14 %), NMNAT1 (14 %), AIPL1 (11 %) and RPGRIP1 (11 %) were the five most frequently mutated genes with novel mutations. A total of four (11 %) patients with AIPL1 mutations harbored the same novel mutated allele (c.C241T p.Q81X), which was homozygous in patients 1 and 2. Unusual manifestations were detected in patient 16 who had novel mutations in CRB1 with a dense proliferative membrane adhering to the posterior retina of the right eye with numerous fine glistening crystals spreading over the retina of both eyes. Ten (40 %) of the 25 available patients who underwent SD-OCT showed a normal macular appearance using fundus photography but an abnormal macular structure using OCT imaging, most of whom presented with a thickened fovea with maldevelopment of the inner and outer retinal laminae. There may be a high frequency of AIPL1 novel mutations and a founder mutation of p.Q81X in the Chinese

  8. The association between gene polymorphism of TCF7L2 and type 2 diabetes in Chinese Han population: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Haoying Dou

    Full Text Available In recent years, it has been widely accepted that transcription factor 7-like 2 (TCF7L2 is associated with type 2 diabetes mellitus (T2DM in multiple ethnic groups, especially its single nucleotide polymorphisms of rs7903146C/T, rs12255372G/T and rs290487T/C. However, the results previously obtained in Chinese Han population are often inconsistent. For clearing this issue, herein we performed meta-analysis based on the reports that can be found to assess the association. In the meta-analysis, Odds ratio (OR and 95% confidence interval (95% CI were calculated with random-effect model or fixed-effect model based on the heterogeneity analysis. The quality of included studies was evaluated by using the Newcastle-Ottawa Scale. The sensitivity analysis was used to confirm the reliability and stability of the meta-analysis. In total, 20 case-control studies with 9122 cases of T2DM and 8017 controls were included. Among these case-control studies, we selected 13 ones on rs7903146 C/T, 5 ones on rs12255372 G/T, 8 ones on rs290487 T/C. The results indicated that rs7903146C/T polymorphism was significantly associated with T2DM (T vs. C, OR = 1.73, 95% CI = 1.39-2.16. There was no evidence that rs12255372G/T and rs290487T/C polymorphisms increased T2DM risk (T vs. G, OR = 1.77, 95% CI = 0.88-3.56; C vs. T, OR = 1.08, 95% CI = 0.93-1.25. Subgroup analysis of different regions proved the relationship between rs7903146C/T polymorphism and T2DM risk in both the northern and the southern China. The association of rs290487 with T2DM was affected by body mass index, whereas the association of rs7903146 and rs290487 with T2DM was influenced neither by age nor by sex. In conclusion, this study indicated that the rs7903146C/T polymorphism of the TCF7L2 gene had a significant effect on T2DM risk in Chinese Han population, with rs12255372G/T and rs290487T/C polymorphisms showing no significant effect.

  9. Influence of weight status on 24-hour urine composition in adults without urolithiasis: A nationwide study based on a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Tuo Deng

    Full Text Available This study sought to explore the influence of different body weight statuses on 24-hour urine compositions in adults without urolithiasis based on a nationwide study of a Chinese Han population.Twenty-four-hour urine samples from 584 Chinese Han adults without urolithiasis in six cities were analyzed. The participants were divided into four body weight status types according to their body mass indices (BMIs according to WHO guidelines. The baseline characteristics and 24-hour urine compositions of the standard weight group were compared with those of the underweight, overweight and obese groups. The influences of different body weight statuses on the 24-hour urine compositions were explored using univariate and multivariate logistic regressions.The numbers of participants in the underweight, standard weight, overweight and obese status groups were 24, 376, 149 and 35, respectively. The overweight and obese groups suffered significantly higher risks of hypertension and diabetes mellitus than the standard weight group. In the univariate analyses, compared with the standard weight group, the overweight group had significantly higher levels of urine citrate (mean difference [MD] = 0.51 mmol, 95% confidence interval [CI]: 0.15-0.87, P = 0.001, potassium (MD = 6.63 mmol, 95% CI: 1.13-12.14, P = 0.01 and magnesium (MD = 0.38 mmol, 95% CI: 0.08-0.69, P = 0.014. Significant increases in urine citrate (MD = 0.85 mmol, 95% CI: 0.01-1.68, P = 0.046, magnesium (MD = 0.69 mmol, 95% CI: 0.13-1.25, P = 0.016 and phosphate (MD = 2.28 mmol, 95% CI: 0.03-4.54, P = 0.047 were found in the obese group. No significant differences were detected between the standard weight and underweight groups. In the multivariate logistic regression analyses, we only observed significantly higher levels of urine potassium (odds ratio [OR] = 1.02, 95% CI: 1.00-1.04, P = 0.03 in the overweight group and phosphate (OR = 1.32, 95% CI: 1.05-1.66, P = 0.018 in the obese group when

  10. Preschool Predictors of Dyslexia Status in Chinese First Graders with High or Low Familial Risk

    Science.gov (United States)

    Ho, Connie Suk-han

    2014-01-01

    The present 4-year longitudinal study examined preschool predictors of Grade 1 dyslexia status in a Chinese population in Hong Kong where children started learning to read at the age of three. Seventy-five and 39 Chinese children with high and low familial risk respectively were tested on Chinese word reading, oral language skills, morphological…

  11. Molecular genetics of a Chinese family with spinocerebellar ataxia

    Directory of Open Access Journals (Sweden)

    Dan-dan WU

    2015-10-01

    Full Text Available Objective To study the genotype of the members of a Chinese family with spinocerebellar ataxia (SCA. Methods The peripheral blood samples of 6 patients and 40 asymptomatic people belonged to the family were collected. Referring to the clinical manifestations of the proband and second-generation sequencing results, the CAG trinucleotide repeats of the pathogenic gene ATXN2 were amplified by polymerase chain reaction (PCR. The repeated times of the trinucleotide in normally and abnormally amplified alleles were defined by agarose gel electrophoresis and PCR products sequencing. Results Autosomal dominant heredity was the cause of the SCA in this family. Six out of 46 in the fourth-generation were SCA2 patients, 7 were the carriers of pathogenic allele. The repeated times of CAG trinucleotide were within the normal range in one of the two alleles of ATXN2, but they were in abnormal range in the another one. The repeated times of CAG trinucleotide were 40-46 in abnormal alleles of patients. Conclusion Autosomal dominant heredity SCA2 has been diagnosed in this family caused by the dynamic nutation of CAG trinucleotide repeats, and 7 pathogenic allele carriers in this family were confirmed by genetic diagnosis. DOI: 10.11855/j.issn.0577-7402.2015.08.07

  12. The Association between Language Maintenance and Family Relations: Chinese Immigrant Children in Australia.

    Science.gov (United States)

    Tannenbaum, Michal; Howie, Pauline

    2002-01-01

    Investigated the relevance of emotional and familial factors to language maintenance in immigrant families. Information on the family relations of 40 children from Chinese-speaking immigrant families in Sydney, Australia. Analysis revealed that children likely to use their parents' mother tongue were those who perceived their family to be more…

  13. Rewriting the history of Chinese families in nineteenth-century Australia.

    Science.gov (United States)

    Bagnall, Kate

    2011-01-01

    The nineteenth-century Chinese population in Australia was made up mostly of men, drawing many commentators to the conclusion these men faced an absence of family life, resulting in prostitution, gambling, opium use and other so-called vices. Recent research has, however, expanded and complicated our knowledge of Chinese families in New South Wales and Victoria, particularly concerning the extent to which Chinese men and white Australian women formed intimate relationships. This article traces the origins of the misconceptions about Chinese families in nineteenth-century Australia, and considers how new directions in scholarship over the past decade are providing methods for enlarging our knowledge. It argues that instead of being oddities or exceptions, Chinese-European families were integral to the story of Australia's early Chinese communities.

  14. FADS gene polymorphisms confer the risk of coronary artery disease in a Chinese Han population through the altered desaturase activities: based on high-resolution melting analysis.

    Directory of Open Access Journals (Sweden)

    Si-Wei Li

    Full Text Available OBJECTIVE: We explored the desaturase activities and the correlation of fatty acid desaturases (FADS gene single nucleotide polymorphisms (SNPs with plasma fatty acid in coronary artery disease (CAD patients in a Chinese Han population. METHODS: Plasma fatty acids were measured by gas chromatography in CAD patients (n = 505 and a control group (n = 510. Five SNPs in the FADS gene were genotyped with high-resolution melting (HRM methods. RESULTS: After adjustment, D6D activity, assessed as arachidonic acid (AA, C20:4n-6/linoleic acid (LA, C18:2n-6, was higher in CAD patients (pT and rs174460 C>T were different between the two groups. The rs174537 T allele was associated with a lower risk of CAD [OR 0.743, 95% CI (0.624, 0.884, p = 0.001]. Carriers of the rs174460 C allele were associated with a higher risk of CAD [OR 1.357, 95% CI (1.106, 1.665, p = 0.003]. CONCLUSIONS: We firstly report that the rs174460 C allele is associated with a higher risk of CAD, and confirm that the rs174537 T allele is associated with a lower risk of CAD. Our results indicate that FADS gene polymorphisms are likely to influence plasma fatty acid concentrations and desaturase activities.

  15. FADS gene polymorphisms confer the risk of coronary artery disease in a Chinese Han population through the altered desaturase activities: based on high-resolution melting analysis.

    Science.gov (United States)

    Li, Si-Wei; Lin, Kun; Ma, Pei; Zhang, Zhen-Lu; Zhou, Yi-Dan; Lu, Shuang-Yan; Zhou, Xin; Liu, Song-Mei

    2013-01-01

    We explored the desaturase activities and the correlation of fatty acid desaturases (FADS) gene single nucleotide polymorphisms (SNPs) with plasma fatty acid in coronary artery disease (CAD) patients in a Chinese Han population. Plasma fatty acids were measured by gas chromatography in CAD patients (n = 505) and a control group (n = 510). Five SNPs in the FADS gene were genotyped with high-resolution melting (HRM) methods. After adjustment, D6D activity, assessed as arachidonic acid (AA, C20:4n-6)/linoleic acid (LA, C18:2n-6), was higher in CAD patients (pT and rs174460 C>T were different between the two groups. The rs174537 T allele was associated with a lower risk of CAD [OR 0.743, 95% CI (0.624, 0.884), p = 0.001]. Carriers of the rs174460 C allele were associated with a higher risk of CAD [OR 1.357, 95% CI (1.106, 1.665), p = 0.003]. We firstly report that the rs174460 C allele is associated with a higher risk of CAD, and confirm that the rs174537 T allele is associated with a lower risk of CAD. Our results indicate that FADS gene polymorphisms are likely to influence plasma fatty acid concentrations and desaturase activities.

  16. [Relationship between Gene Polymorphism of HLA-A(*)/-B(*)-DRB1(*) and Aplastic Anemia in Chinese Han Population of Northwestern Plateau].

    Science.gov (United States)

    Yang, Ke; Guo, Xiao-Yu; Han, Xiao; Ou, Jian-Feng; Bai, Hai; Wang, Cun-Bang; Pan, Yao-Zhu

    2016-06-01

    To investigate the correlation between the HLA genes and pathogenesis of aplastic anemia (AA), so as to find the susceptible AA genes. Polymerase chain reaction with specific sequence primers (PCR-SSP) method was used to detect the HLA typing of 50 AA patients and 183 normal healthy individuals as controls in Chinese Han population of northwestern plateau. The frequency of HLA-A* 0201 (45.0%), B* 1501 (11.0%), B* 5501 (9.0%) and DRB1* 0901 (19.0%) gene frequences in AA patients were significantly higher than those in controls (Odds Ratio: OR=1.657, 2.138, 2.314 and 1.932, x2=4.882, 3.876, 3.863 and 4.473 (Pgene frequency (4.0%) in AA was significantly lower than that in controls, OR=0.349, x2=4.154 (PHLA-A* 0201 gene frequency was lower than that in female (38.2% vs 59.4%), and the difference was statistically significant (PHLA-A* 0201, B* 1501, B* 5501 and DRB1* 0901 genes may be considered as the risk markers while A* 0301 gene as a protective marker of AA, the HLA-A* 0201 also shows the sex differences.

  17. A meta-analysis of the association between TNF-α -308G>A polymorphism and type 2 diabetes mellitus in Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Zheng-hui Liu

    Full Text Available OBJECTIVE: A meta-analysis was applied to evaluate the associations between tumor necrosis factor-α (TNF-α -308G>A (rs1800629 polymorphism and type 2 diabetes mellitus (T2DM. METHODS: Hardy-Weinberg equilibrium (HWE was employed to test genetic equilibrium among the genotypes of the selected literature. Power analysis was performed with the Power and Sample Size Calculation (PS program. A fixed or random effect model was used on the basis of heterogeneity. Publication bias was quantified and examined with the Begg's funnel plot test and Egger's linear regression test. The meta-analysis was performed with Review Manager 5.1 and Stata 11.0. RESULTS: There were 10 studies including 1425 T2DM patients and 1116 healthy control subjects involved in this meta-analysis. No significant publication bias was found in the studies. The pooled ORs (95% CIs for TNF-α -308G>A of A vs. G allele and GA+AA vs. GG genotype were 1.63 (1.17-2.25 and 1.47 (1.17-1.85, respectively. CONCLUSION: This meta-analysis result suggested that TNF-α -308G>A polymorphism was strongly associated with T2DM risk, and A allele at this locus might be a susceptibility allele for the development of T2DM in Han Chinese population.

  18. Associations between apolipoprotein E genotypes and serum levels of glucose, cholesterol, and triglycerides in a cognitively normal aging Han Chinese population.

    Science.gov (United States)

    Tao, Qing-Qing; Chen, Yan; Liu, Zhi-Jun; Sun, Yi-Min; Yang, Ping; Lu, Shen-Ji; Xu, Miao; Dong, Qin-Yun; Yang, Jia-Jun; Wu, Zhi-Ying

    2014-01-01

    To determine the associations between apolipoprotein E (APOE) genotypes and serum levels of glucose, total cholesterol, and triglycerides in a cognitively normal aging Han Chinese population. There were 1,003 cognitively normal aging subjects included in this study. APOE genotypes were analyzed and biochemical parameters were tested. All the subjects were divided into three groups according to APOE genotypes: (1) E2/2 or E2/3 (APOE E2); (2) E3/3 (APOE E3); and (3) E2/4, E3/4, or E4/4 (APOE E4). Correlations of serum levels of glucose, total cholesterol, and triglycerides with APOE genotypes were assessed. E2, E3, and E4 allele frequencies were found to be 6.2%, 82.1%, and 11.7%, respectively. Serum levels of total cholesterol were higher in the APOE E4 group (Ptriglycerides (adjusted odds ratio 1.042, 95% confidence interval 0.759-1.429, P=0.800). A higher serum level of total cholesterol was significantly correlated with APOE E4 status in a cognitively normal, nondiabetic aging population. However, there was no correlation between APOE genotypes and serum levels of glucose or total triglycerides.

  19. Physiological responses and evaluation of effects of BMI, smoking and drinking in high altitude acclimatization: a cohort study in Chinese Han young males.

    Directory of Open Access Journals (Sweden)

    Qian-Qian Peng

    Full Text Available High altitude acclimatization is a series of physiological responses taking places when subjects go to altitude. Many factors could influence these processes, such as altitude, ascending speed and individual characteristics. In this study, based on a repeated measurement design of three sequential measurements at baseline, acute phase and chronic phase, we evaluated the effect of BMI, smoking and drinking on a number of physiological responses in high altitude acclimatization by using mixed model and partial least square path model on a sample of 755 Han Chinese young males. We found that subjects with higher BMI responses were reluctant to hypoxia. The effect of smoking was not significant at acute phase. But at chronic phase, red blood cell volume increased less while respiratory function increased more for smoking subjects compared with nonsmokers. For drinking subjects, red blood cell volume increased less than nondrinkers at both acute and chronic phases, while blood pressures increased more than nondrinkers at acute phase and respiratory function, red blood cell volume and oxygen saturation increased more than nondrinkers at chronic phase. The heavy and long-term effect of smoking, drinking and other factors in high altitude acclimatization needed to be further studied.

  20. Association of the OAS3 rs1859330 G/A genetic polymorphism with severity of enterovirus-71 infection in Chinese Han children.

    Science.gov (United States)

    Tan, Yuxia; Yang, Tingting; Liu, Peipei; Chen, Liping; Tian, Qingwu; Guo, Ya; He, Hongfang; Liu, Yedan; Chen, Zongbo

    2017-08-01

    The 2'5'-oligoadenylate synthetase (OAS) is an interferon (IFN)-induced protein that plays an important role in the antiviral action of IFN, with OAS3 being one of the four OAS classes (OAS1, OAS2, OAS3, OASL). The effect of OAS on several infectious viral diseases has been reported; however, a study of the effect of OAS3 on enterovirus 71 (EV71) is lacking. The purpose of this study was to evaluate the association of the OAS3 rs1859330 G/A genetic polymorphism with susceptibility and severity of EV71 infection. We investigated 370 Chinese Han children with hand-foot-mouth disease (HFMD) (214 of which were mild cases while 156 were severe). An improved multiplex ligation detection reaction (iMLDR) technique was carried out to examine the genotype. The AA genotype distribution (p = 0.002) and A allele frequency (OR = 1.83, 95% CI 1.32-2.52, p polymorphism is associated with the severity of EV-71 infection, and that the A allele is a risk factor for the development of severe EV71 infection.

  1. A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

    Science.gov (United States)

    Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

    2016-05-01

    Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,Pautism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

  2. Family Factors and Primary Students' Reading Attainment: A Chinese Community Perspective

    Science.gov (United States)

    Ko, Hwa Wei; Chan, Yi Ling

    2009-01-01

    This study examined the relationship between students' reading attainment scores and key family environmental factors in Chinese and non-Chinese communities. Six family environmental factors were considered: parents' evaluation of their offspring's early literacy skills, early home literacy activities (EHLA), reading activities involving parents…

  3. Cosegregation of the ND4 G11696A mutation with the LHON-associated ND4 G11778A mutation in a four generation Chinese family.

    Science.gov (United States)

    Qu, Jia; Li, Ronghua; Zhou, Xiangtian; Tong, Yi; Yang, Li; Chen, Jie; Zhao, Fuxing; Lu, Chunjie; Qian, Yaping; Lu, Fan; Guan, Min-Xin

    2007-01-01

    We report here the characterization of a four-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON). This Chinese family exhibited a variable severity and age-at-onset of visual loss. Notably, the average age-at-onset of vision impairment changed from 26 years (generation III) to 14 years (generation IV), with the average of 18 years in this family. In addition, 30% and 50% of matrilineal relatives in generation III and IV of this family developed visual loss with a variability of severity, ranging from blindness to normal vision. Sequence analysis of the complete mitochondrial DNA in this pedigree revealed the presence of the homoplasmic ND4 G11778A mutation and 33 other variants, belonging to the Asian haplogroup D4. Of other variants, the homoplasmic G11696A mutation in the ND4 gene is of special interest as it was implicated to be associated with LHON in a large Dutch family and five Chinese pedigrees with extremely penetrance of visual loss. In fact, the G11696A mutation caused the substitution of an isoleucine for valine at amino acid position 313, located in a predicted transmembrane region of ND4. These imply that the G11696A mutation may act in synergy with the primary LHON-associated G11778A mutation in this Chinese pedigree.

  4. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  5. Associations of perceived interparental relationship, family harmony and family happiness with smoking intention in never-smoking Chinese children and adolescents: a cross-sectional study

    National Research Council Canada - National Science Library

    Tzu Tsun Luk; Man Ping Wang; Lok Tung Leung; Yongda Wu; Jianjiu Chen; Tai Hing Lam; Sai Yin Ho

    2017-01-01

    Objective To examine the associations of perceived interparental relationship, family harmony and family happiness with smoking intention in never-smoking Chinese children and adolescents in Hong Kong...

  6. Family influence on volunteering intention and behavior among Chinese adolescents in Hong Kong.

    Science.gov (United States)

    Law, Ben M F; Shek, Daniel T L

    2009-01-01

    Based on the responses of 5,946 adolescents (mean age = 14.77), the relationships among family influence, adolescents' volunteering intention, and volunteering behavior in a Chinese context were examined. A 9-item Chinese Family Influence on Adolescent Volunteerism Scale (C-FIAV) was used to measure nine kinds of influence of the family (such as family support) which could be subsumed under two underlying domains (positive family influence and extrinsic family influence). Results showed that family support, family belief, and family modeling were positively associated with both intention and behavior. Family reward and coercion were negatively associated with both intention and behavior. Family belief in volunteerism was the most critical factor. Grade and gender differences were found only in the associations between family influence and volunteering intention. Path models showed that positive and extrinsic family influence had an effect on volunteering behavior directly or via the mediation of volunteering intention. Implications and limitations are discussed.

  7. Familial progressive hyper- and hypopigmentation: a report on a Chinese family and evidence for genetic heterogeneity.

    Science.gov (United States)

    Xiao-Kai, Fang; Yue-Xi, He; Yan-Jia, Li; Li-Rong, Chen; He-Peng, Wang; Qing, Sun

    2017-01-01

    Familial progressive hyper- and hypopigmentation (FPHH) is a rare genodermatosis that is characterized by diffuse hyper- and hypopigmented spots on the skin and mucous membranes. It is caused by a pathogenic mutation of the KITLG gene. To investigate the clinical features and mutation of the KITLG gene in a Chinese family with FPHH. Histopathological and immunohistochemical analysis of lesions from the proband was performed. The KITLG gene was screened for the presence of mutations. A Chinese family containing 14 individuals with FPHH was described, and the proband was a 5-year-old girl showing diffuse hyper- and hypopigmented lesions on her extremities and trunk. Histopathological and immunohistochemical staining for S100 and HMB45 of skin biopsy specimens from the hyperpigmented areas showed a striking increase in melanin throughout the epidermis, especially in the basal cell layer, and staining of hypopigmented area specimens displayed lower levels of melanin in the epidermis. Mutation analysis of the KITLG gene was performed, but no mutation was found. The new pathogenic gene was not found. A family with FPHH was described. Analysis revealed that its members did not have any mutations of the KITLG gene, which provided evidence for genetic heterogeneity of this genodermatosis.

  8. Novel ATPase Cu(2+ transporting beta polypeptide mutations in Chinese families with Wilson's disease.

    Directory of Open Access Journals (Sweden)

    Shaojuan Gu

    Full Text Available Wilson's disease (WD is an autosomal recessive inherited disorder caused by mutations in the ATPase Cu(2+ transporting beta polypeptide gene (ATP7B. The detailed metabolism of copper-induced pathology in WD is still unknown. Gene mutations as well as the possible pathways involved in the ATP7B deficiency were documented. The ATP7B gene was analyzed for mutations in 18 Chinese Han families with WD by direct sequencing. Cell viability and apoptosis analysis of ATP7B small interfering RNA (siRNA-treated human liver carcinoma (HepG2 cells were measured by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT assay and Hoechst 33342 staining. Finally, the expression of B-cell CLL/lymphoma 2 (BCL2, BCL2-associated X protein (BAX, sterol regulatory element binding protein 1 (SREBP1, and minichromosome maintenance protein 7 (MCM7 of ATP7B siRNA-treated cells were tested by real-time polymerase chain reaction (real-time PCR and Western blot analysis. Twenty different mutations including four novel mutations (p.Val145Phe, p.Glu388X, p.Thr498Ser and p.Gly837X in the ATP7B gene were identified in our families. Haplotype analysis revealed that founder effects for four mutations (p.Arg778Leu, p.Pro992Leu, p.Ile1148Thr and p.Ala1295Val existed in these families. Transfection of HepG2 cells with ATP7B siRNA resulted in decreased mRNA expression by 86.3%, 93.1% and 90.8%, and decreased protein levels by 58.5%, 85.5% and 82.1% at 24, 48 and 72 hours, respectively (All P<0.01. In vitro study revealed that the apoptotic, cell cycle and lipid metabolism pathway may be involved in the mechanism of WD. Our results revealed that the genetic cause of 18 Chinese families with WD and ATP7B deficiency-induce apoptosis may result from imbalance in cell cycle and lipid metabolism pathway.

  9. Gender-specific interactions of MTHFR C677T and MTRR A66G polymorphisms with overweight/obesity on serum lipid levels in a Chinese Han population.

    Science.gov (United States)

    Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

    2016-10-28

    Little is known regarding the interactions of methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase reductase (MTRR) A66G polymorphisms with overweight/obesity on serum lipid profiles. The aim of the current study was to explore interactions between the two polymorphisms and overweight/obesity on four common lipid levels in a Chinese Han population and further to evaluate whether these interactions exhibit gender-specificity. A total of 2239 participants (750 females and 1489 males) were enrolled into this study. The genotypes of the MTHFR C677T and MTRR A66G were determined by a TaqMan assay. Overweight and obesity were defined as a body mass index between 24 and 27.99 and ≥ 28 kg/m(2), respectively. The interactions were examined by factorial design covariance analysis, and further multiple comparisons were conducted by Bonferroni correction. There was no significant difference in the genotypic and allelic frequencies between females and males (MTHFR 677 T allele: 54.47 % for females and 54.40 % for males; MTRR 66G allele: 24.73 % for females and 24.71 % for males). Interaction between the MTHFR C677T polymorphism and overweight/obesity on serum triglyceride levels, and interaction between the MTRR A66G polymorphism and overweight/obesity on serum high-density lipoprotein cholesterol levels were detected in women (P = 0.015 and P = 0.056, respectively). For female subjects with overweight/obesity, the serum triglyceride levels in MTHFR 677TT genotype [1.09 (0.78-1.50) mmol/L] were significantly higher as compared with MTHFR 677CC genotype [0.90 (0.60-1.15) mmol/L, P = 0.007], and the MTRR 66GG genotype carriers had higher serum high-density lipoprotein cholesterol levels than those with MTRR 66AG genotype (1.46 ± 0.50 vs. 1.19 ± 0.31 mmol/L, P = 0.058). Furthermore, in male subjects with overweight/obesity, the MTHFR 677CT genotype carriers had higher low-density lipoprotein cholesterol levels than those

  10. The Pro12Ala Polymorphism of PPAR-γ Gene Is Associated with Sepsis Disease Severity and Outcome in Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Guoda Ma

    2014-01-01

    Full Text Available Peroxisome proliferator-activated receptor-γ (PPAR-γ is a ligand-binding nuclear receptor, and its activation plays a prominent role in regulating the inflammatory response. Therefore, PPAR-γ has been suggested as a candidate gene for sepsis. In the present study, we investigated the association between the Pro12Ala polymorphism of PPAR-γ and sepsis in a Han Chinese population. A total of 308 patients with sepsis and 345 healthy controls were enrolled in this study. Genotyping was performed using the polymerase chain reaction-ligation detection reaction (PCR-LDR method. No significant differences were detected in the allele and genotype distributions of the PPAR-γ Pro12Ala SNP between septic patients and controls (P=0.622 for genotype; P=0.629 for allele. However, stratification by subtypes (sepsis, septic shock, and severe sepsis revealed a statistically significant difference in the frequency of the Ala allele and Ala-carrier genotype between the patients with the sepsis subtype and the healthy controls (P=0.014 for allele and P=0.012, for genotype. Moreover, significant differences were found in the frequency of the Ala allele and genotype between the sepsis survivors and nonsurvivors (all P=0.002. In the survivors, the PPAR-γ Pro12Ala genotype was significantly associated with decreased disease severity and recovery time (all P<0.001. Thus, genetic polymorphism is thought to play a role in the development and outcome of sepsis.

  11. The association between Toxoplasma gondii infection and hypertensive disorders in T2DM patients: a case-control study in the Han Chinese population.

    Science.gov (United States)

    Han, Yajing; Nie, Lihong; Ye, Xiaohong; Zhou, Zixing; Huang, Shiqi; Zeng, Chengli; Guo, Congcong; Ou, Meiling; Xiao, Di; Zhang, Baohuan; Huang, Chuican; Ye, Xingguang; Jing, Chunxia; Yang, Guang

    2018-01-18

    Type 2 diabetes mellitus (T2DM) is a major global health problem. The rate of infection with Toxoplasma gondii (T. gondii) is more than one-third of the total world population. The effects of T. gondii infection on the risk of diabetic complications and comorbidities are unclear. This study aims to determine the relationship between T. gondii infection and complications of T2DM in the Han Chinese population. We collected 1580 blood samples from T2DM patients and measured the levels of specific IgG antibodies against T. gondii in the sera of these patients using an ELISA assay. A logistic regression analysis was performed to estimate the effect of T. gondii infection on the complications of T2DM, while adjusting for age, gender, and triglyceride level (TG). We applied the multifactor dimensionality reduction (MDR) method to detect the interactions between T. gondii infections, demographic indexes and biochemical indicators among the different complications. Gender (the odds ratio (OR) = 0.63, 95%CI =0.45-0.89, P = 0.008) and TG level (OR = 0.64, 95%CI =0.45-0.89, P = 0.009) were influencing factors in T. gondii infections. T2DM patients who were infected with T. gondii had a 2.34 times risk of developing hypertension than those patients without T. gondii infection (OR = 2.34, 95%CI = 1.12-4.88, P = 0.024). The multiplicative interaction analysis and the additive interaction analysis did not reveal any evidence of interactive effects on diabetic complications and comorbidities. T. gondii might be a factor associated with hypertension in T2DM patients.

  12. Genotype GG of rs895819 Functional Polymorphism Within miR-27a Might Increase Genetic Susceptibility to Colorectal Cancer in Han Chinese Population.

    Science.gov (United States)

    Jiang, Yu; Lin, Dong-Hong; Xu, Jian-Ping; Chen, Wen-Xu; Zheng, Shu-Jian; Song, Lin

    2016-07-01

    MicroRNA-27a (miR-27a) is supposed to be an oncogene in various types of cancers, and genetic variation of miR-27a might result in aberrant expression and abnormal second structure of mature-miR-27a, contributing to elevated genetic risk and poor prognosis for colorectal cancer (CRC). In order to explore the possible association between rs895819 within miR-27a and CRC in Han Chinese population, we investigated the genotype distributions of rs895819 in 508 CRC cases and 562 healthy check-up controls using TaqMan genotype discrimination system, and analyzed the possible association between them. Odds ratio (OR) and 95% confidential interval (95% CI) were used to assess the strength between allele and genotype of the locus and risk of CRC. In our study, we found that genotype GG of rs895819 was significantly associated with an increased risk for CRC (17.1% vs. 11.6%, adjusted OR = 1.546, 95% CI = 1.070-2.236), and allele A carrier (AA/AG) was significantly associated with a decreased risk for CRC (82.9% vs. 89.4%, adjusted OR = 0.63, 95% CI = 0.446-0.893). In addition, a significant association was observed between genotype GG and larger tumor size (>5 cm; P GG within rs895819 might be a genetic susceptible factor for CRC. Further multicentral, large sample size, and well-designed epidemiological study as well as functional study are warrant to verify our findings. © 2015 Wiley Periodicals, Inc.

  13. Genetic Variation in the REL Gene Increases Risk of Behcet's Disease in a Chinese Han Population but That of PRKCQ Does Not.

    Directory of Open Access Journals (Sweden)

    Feilan Chen

    Full Text Available Genome-wide association studies (GWAS and candidate gene studies have identified the REL and PRKCQ genes as risk loci for various autoimmune diseases. The purpose of the present study was to investigate the association of the REL and PRKCQ genes with Behcet's disease (BD in a Chinese Han population. A case-control study was conducted on three single nucleotide polymorphisms (SNPs, rs13031237, rs702873, and rs842647 of the REL gene and three SNPs (rs4750316, rs11258747, and rs947474 of the PRKCQ gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP in a total of 623 BD patients and 1,074 healthy controls. Multiple variables were assessed, including age, sex distribution, and extra-ocular findings. In the present study, the frequencies of rs842647 GG genotypes and rs842647 G alleles were significantly higher in patients than in controls and those of the rs842647 AG genotypes were lower in patients than in controls [GG genotype: Bonferroni corrected P-value for gender adjustment (Pc(a = 0.0074, odds ratio (OR = 1.63; G allele: Pc(a = 0.0072, OR = 1.57; AG genotype: Pc(a = 0.024, OR = 0.63, respectively]. No statistically significant differences in the frequencies of rs702873, rs13031237, rs4750316, rs11258747, and rs947474 between BD patients and controls were observed. Stratification analysis indicated that the REL rs842647 polymorphism was associated with BD patients with skin lesions. No significant association of the other five SNPs between BD patients with other extra-ocular findings, including genital ulcer, arthritis, and positive pathergy test results was found. The REL rs842647 polymorphism may be a susceptibility factor for BD pathogenesis and skin lesions, which indicate that c-Rel may be involved in the pathogenesis and skin lesions of BD through the NF-κB pathway.

  14. Gender-specific association between serotonin transporter polymorphisms (5-HTTLPR and rs25531) and neuroticism, anxiety and depression in well-defined healthy Han Chinese.

    Science.gov (United States)

    Chang, Chuan-Chia; Chang, Hsin-An; Fang, Wen-Hui; Chang, Tieh-Ching; Huang, San-Yuan

    2017-01-01

    A tri-allelic serotonin transporter promoter polymorphism (5-HTTLPR/rs25531) more effectively determines the levels of transcriptional efficacy than that with the bi-allelic 5-HTTLPR polymorphism in vitro. Both are reportedly associated with personality traits of negative emotionality, but with conflicting findings. One explanation for this is that a gender difference may play a role in genetic contribution. Here, we hypothesized that the tri-allelic genotype of the serotonin transporter is more closely linked to neuroticism, an anxiety- and depression-related trait, than the bi-allelic variation, particularly in a gender-dependent way. The genotypes of the 5-HTTLPR and rs25531 loci were determined in 1139 well-defined physically and mentally healthy Han Chinese (550 men, 589 women; mean age 38.3±10.3 years). All participants completed the neuroticism measure of the short-form Maudsley Personality Inventory (MPI). The levels of anxiety and depression were assessed by the Beck Anxiety Inventory (BAI) and the Beck Depression Inventory (BDI), respectively. A significant tri-allelic genotype-by-gender interaction effect was found in the MPI-neuroticism measure. S'S' homozygotes were associated with higher neuroticism than L' allele carriers in men. Also, both the BAI and BDI scores were higher in the S'S' homozygotic men. In the bi-allelic analyses, however, there was only an association between SS genotype and MPI-neuroticism in men. Sub-analyses by gender-stratification may reduce the statistical power. Our findings confirm that gender differences exist in the genetic contributions of the serotonin transporter in human neuroticism, and anxiety/depression. Our data provide further support for rs25531, strengthening the effects of 5-HTTLPR. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Heterogeneity of Breast Cancer Associations with Common Genetic Variants in FGFR2 according to the Intrinsic Subtypes in Southern Han Chinese Women

    Directory of Open Access Journals (Sweden)

    Huiying Liang

    2015-01-01

    Full Text Available GWAS have identified variation in the FGFR2 locus as risk factors for breast cancer. Validation studies, however, have shown inconsistent results by ethnics and pathological characteristics. To further explore this inconsistency and investigate the associations of FGFR2 variants with breast cancer according to intrinsic subtype (Luminal-A, Luminal-B, ER−&PR−&HER2+, and triple negative among Southern Han Chinese women, we genotyped rs1078806, rs1219648, rs2420946, rs2981579, and rs2981582 polymorphisms in 609 patients and 882 controls. Significant associations with breast cancer risk were observed for rs2420946, rs2981579, and rs2981582 with OR (95% CI per risk allele of 1.19 (1.03–1.39, 1.24 (1.07–1.43, and 1.17 (1.01–1.36, respectively. In subtype specific analysis, above three SNPs were significantly associated with increased Luminal-A risk in a dose-dependent manner Ptrend<0.01; however, only rs2981579 was associated with Luminal-B, and none were linked to ER−&PR− subtypes (ER−&PR−&HER2+ and triple negative. Haplotype analyses also identified common haplotypes significantly associated with luminal-like subtypes (Luminal-A and Luminal-B, but not with ER−&PR− subtypes. Our results suggest that associations of FGFR2 SNPs with breast cancer were heterogeneous according to intrinsic subtype. Future studies stratifying patients by their intrinsic subtypes will provide new insights into the complex genetic mechanisms underlying breast cancer.

  16. Association of Tag SNPs and Rare CNVs of the MIR155HG/miR-155 Gene with Epilepsy in the Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Hua Tao

    2015-01-01

    Full Text Available Background. miR-155 likely acts as an important modulator in the inflammatory mechanism of epilepsy, and this study investigated its association with epilepsy from the perspective of molecular genetics. Methods. This study enrolled 249 epileptic patients and 289 healthy individuals of the Chinese Han population; 4 tag single-nucleotide polymorphisms (SNPs: rs969885, rs12483428, rs987195, and rs4817027 of the MIR155HG/miR-155 gene were selected, and their association with epilepsy was investigated. Additionally, this study determined the copy numbers of the MIR155HG/miR-155 gene. Results. The TCA haplotype (rs12483428-rs987195-rs4817027 and the AA genotype at rs4817027 conferred higher vulnerability to epilepsy in males. Stratification by age of onset revealed that the CC haplotype (rs969885-rs987195 was a genetic susceptibility factor for early-onset epilepsy. Further stratification by drug-resistant status indicated the CC haplotype (rs969885-rs987195 and the AA genotype at rs4817027 were genetic susceptibility factors for drug-resistant epilepsy (DRE but the CG haplotype (rs987195-rs969885 was a genetically protective factor against DRE. Besides, 3 epileptic patients with copy number variants of the MIR155HG/miR-155 gene were observed. Conclusions. This study first demonstrates the association of MIR155HG/miR-155 tag SNPs with epilepsy and shows that rare CNVs were found exclusively in epileptic patients, clarifying the genetic role of miR-155 in epilepsy.

  17. Critical Roles of Xirp Proteins in Cardiac Conduction and Their Rare Variants Identified in Sudden Unexplained Nocturnal Death Syndrome and Brugada Syndrome in Chinese Han Population.

    Science.gov (United States)

    Huang, Lei; Wu, Kuo-Ho; Zhang, Liyong; Wang, Qinchuan; Tang, Shuangbo; Wu, Qiuping; Jiang, Pei-Hsiu; Lin, Jim Jung-Ching; Guo, Jian; Wang, Lin; Loh, Shih-Hurng; Cheng, Jianding

    2018-01-06

    Sudden unexplained nocturnal death syndrome (SUNDS) remains an autopsy negative entity with unclear etiology. Arrhythmia has been implicated in SUNDS. Mutations/deficiencies in intercalated disc components have been shown to cause arrhythmias. Human cardiomyopathy-associated 1 (XIRP1) and 3 (XIRP2) are intercalated disc-associated, Xin repeats-containing proteins. Mouse Xirp1 is necessary for the integrity of intercalated disc and for the surface expression of transient outward and delayed rectifier K+ channels, whereas mouse Xirp2 is required for Xirp1 intercalated disc localization. Thus, XIRP1 and XIRP2 may be potentially causal genes for SUNDS. We genetically screened XIRP genes in 134 sporadic SUNDS victims and 22 Brugada syndrome (BrS) cases in a Chinese Han population. We identified 16 rare variants (6 were in silico predicted as deleterious) in SUNDS victims, including a novel variant, XIRP2-E215K. There were also four rare variants (2 were in silico predicted as deleterious) detected in BrS cases, including a novel variant, XIRP2-L2718P. Interestingly, among these 20 variants, we detected 2 likely pathogenic variants: a nonsense variant (XIRP2-Q2875*) and a frameshift variant (XIRP2-T2238QfsX7). Analyzing available Xirp2 knockout mice, we further found that mouse hearts without Xirp2 exhibited prolonged PR and QT intervals, slow conduction velocity, atrioventricular conduction block, and an abnormal infranodal ventricular conduction system. Whole-cell patch-clamp detected altered ionic currents in Xirp2-/- cardiomyocytes, consistent with the observed association between Xirp2 and Nav1.5/Kv1.5 in co-immunoprecipitation. This is the first report identifying likely pathogenic XIRP rare variants in arrhythmogenic disorders such as SUNDS and Brugada syndrome, and showing critical roles of Xirp2 in cardiac conduction. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  18. Genome-wide pathway-based association study implicates complement system in the development of Kashin-Beck disease in Han Chinese.

    Science.gov (United States)

    Zhang, Feng; Wen, Yan; Guo, Xiong; Zhang, Yingang; Wang, Sen; Yang, Tielin; Shen, Hui; Chen, Xiangding; Tan, Lijun; Tian, Qing; Deng, Hong-Wen

    2015-02-01

    Kashin-Beck disease (KBD) is a chronic osteochondropathy. The pathogenesis of KBD remains unknown. To identify relevant biological pathways for KBD, we conducted a genome-wide pathway-based association study (GWPAS) following by replication analysis, totally using 2743 Chinese Han adults. A modified gene set enrichment algorithm was used to detect association between KBD and 963 biological pathways. Cartilage gene expression analysis and serum complement measurement were performed to evaluate the functional relevance of identified pathway with KBD. We found that the Complement and Coagulation Cascades (CACC) pathway was significantly associated with KBD (P value=3.09×10(-5), false-discovery rate=0.042). Within the CACC pathway, the most significant association was observed at rs1656966 (P value=1.97×10(-4)) of KNG1 gene. Further replication study observed that rs1656966 (P value=0.037) was significantly associated with KBD in an independent validation sample of 1026 subjects. Gene expression analysis observed that CFD (ratio=3.39±2.68), A2M (ratio=3.67±5.63), C5 (ratio=2.65±2.52) and CD46 (ratio=2.29±137) genes of the CACC pathway were up-regulated in KBD articular cartilage compared to healthy articular cartilage. The serum level of complement C5 in KBD patients were significantly higher than that in healthy controls (P value=0.038). Our study is the first to suggest that complement system-related CACC pathway contributed to the development of KBD. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Variant rs2237892 of KCNQ1 Is Potentially Associated with Hypertension and Macrovascular Complications in Type 2 Diabetes Mellitus in A Chinese Han Population

    Directory of Open Access Journals (Sweden)

    Wanlin Zhang

    2015-12-01

    Full Text Available KCNQ1 has been identified as a susceptibility gene of type 2 diabetes mellitus (T2DM in Asian populations through genome-wide association studies. However, studies on the association between gene polymorphism of KCNQ1 and T2DM complications remain unclear. To further analyze the association between different alleles at the single nucleotide polymorphism (SNP rs2237892 within KCNQ1 and TD2M and its complications, we conducted a case-control study in a Chinese Han population. The C allele of rs2237892 variant contributed to susceptibility to T2DM (odds ratio [OR], 1.45; 95% confidence interval [CI], 1.20–1.75. Genotypes CT (OR, 1.97; 95% CI, 1.24–3.15 and CC (OR, 2.49; 95% CI, 1.57–3.95 were associated with an increased risk of T2DM. Multivariate regression analysis was performed with adjustment of age, gender, and body mass index. We found that systolic blood pressure (P = 0.015, prevalence of hypertension (P = 0.037, and risk of macrovascular disease (OR, 2.10; CI, 1.00–4.45 were significantly higher in subjects with the CC genotype than in the combined population with genotype either CT or TT. Therefore, our data support that KCNQ1 is associated with an increased risk for T2DM and might contribute to the higher incidence of hypertension and macrovascular complications in patients with T2DM carrying the risk allele C though it needs further to be confirmed in a larger population.

  20. Variant rs2237892 of KCNQ1 Is Potentially Associated with Hypertension and Macrovascular Complications in Type 2 Diabetes Mellitus in A Chinese Han Population.

    Science.gov (United States)

    Zhang, Wanlin; Wang, Hailing; Guan, Xiaomin; Niu, Qing; Li, Wei

    2015-12-01

    KCNQ1 has been identified as a susceptibility gene of type 2 diabetes mellitus (T2DM) in Asian populations through genome-wide association studies. However, studies on the association between gene polymorphism of KCNQ1 and T2DM complications remain unclear. To further analyze the association between different alleles at the single nucleotide polymorphism (SNP) rs2237892 within KCNQ1 and TD2M and its complications, we conducted a case-control study in a Chinese Han population. The C allele of rs2237892 variant contributed to susceptibility to T2DM (odds ratio [OR], 1.45; 95% confidence interval [CI], 1.20-1.75). Genotypes CT (OR, 1.97; 95% CI, 1.24-3.15) and CC (OR, 2.49; 95% CI, 1.57-3.95) were associated with an increased risk of T2DM. Multivariate regression analysis was performed with adjustment of age, gender, and body mass index. We found that systolic blood pressure (P=0.015), prevalence of hypertension (P=0.037), and risk of macrovascular disease (OR, 2.10; CI, 1.00-4.45) were significantly higher in subjects with the CC genotype than in the combined population with genotype either CT or TT. Therefore, our data support that KCNQ1 is associated with an increased risk for T2DM and might contribute to the higher incidence of hypertension and macrovascular complications in patients with T2DM carrying the risk allele C though it needs further to be confirmed in a larger population. Copyright © 2015 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  1. Associations of Genetic Variants at Nongenic Susceptibility Loci with Breast Cancer Risk and Heterogeneity by Tumor Subtype in Southern Han Chinese Women

    Directory of Open Access Journals (Sweden)

    Huiying Liang

    2016-01-01

    Full Text Available Current understanding of cancer genomes is mainly “gene centric.” However, GWAS have identified some nongenic breast cancer susceptibility loci. Validation studies showed inconsistent results among different populations. To further explore this inconsistency and to investigate associations by intrinsic subtype (Luminal-A, Luminal-B, ER−&PR−&HER2+, and triple negative among Southern Han Chinese women, we genotyped five nongenic polymorphisms (2q35: rs13387042, 5p12: rs981782 and rs4415084, and 8q24: rs1562430 and rs13281615 using MassARRAY IPLEX platform in 609 patients and 882 controls. Significant associations with breast cancer were observed for rs13387042 and rs4415084 with OR (95% CI per-allele 1.29 (1.00–1.66 and 0.83 (0.71–0.97, respectively. In subtype specific analysis, rs13387042 (per-allele adjusted OR = 1.36, 95% CI = 1.00–1.87 and rs4415084 (per-allele adjusted OR = 0.82, 95% CI = 0.66–1.00 showed slightly significant association with Luminal-A subtype; however, only rs13387042 was associated with ER−&PR−&HER2+ tumors (per-allele adjusted OR = 1.55, 95% CI = 1.00–2.40, and none of them were linked to Luminal-B and triple negative subtype. Collectively, nongenic SNPs were heterogeneous according to the intrinsic subtype. Further studies with larger datasets along with intrinsic subtype categorization should explore and confirm the role of these variants in increasing breast cancer risk.

  2. Family involvement in preschoolers' bilingual heritage language development: a cultural-historical study of Chinese-Australian families' everyday practices

    OpenAIRE

    Li, Liang

    2017-01-01

    In Australia many Chinese families send their preschool-aged children to learn Mandarin at weekend Chinese schools in the expectation that their children master Mandarin as a heritage language in the predominantly English-speaking community. Family involvement in bilingual development may be considered as an important factor in acquiring Mandarin (Esch-Harding & Riley, 2003; McCollum & Russo, 1993). Immigrant parents face the challenge of contributing to their children’s heritage language dev...

  3. Dopamine receptor D2 and catechol-O-methyltransferase gene polymorphisms associated with anorexia nervosa in Chinese Han population: DRD2 and COMT gene polymorphisms were associated with AN.

    Science.gov (United States)

    Peng, Sufang; Yu, Shunying; Wang, Qian; Kang, Qing; Zhang, Yanxia; Zhang, Ran; Jiang, Wenhui; Qian, Yiping; Zhang, Haiyin; Zhang, Mingdao; Xiao, Zeping; Chen, Jue

    2016-03-11

    Dopamine receptor D2 (DRD2) and catechol-O-methyltransferase (COMT) are important in dopamine system which is proved to be associated with food-anticipatory behavior, food restriction, reward and motivation. This has made them good candidates for anorexia nervosa (AN). The aim of this work is to explore the roles of DRD2 (rs1800497) and COMT (rs4680, rs4633, rs4818) gene polymorphisms in the susceptibility of AN within the Chinese Han population. We recruited 260AN patients with DSM-IV diagnosis criteria, and 247 unrelated, normal weight controls. DRD2 (rs1800497) and COMT (rs4680, rs4633, rs4818) were genotyped in all subjects. We found rs1800497 and rs4633 were associated with the susceptibility of AN within the Chinese Han sample, and allele C of rs1800497 was a protective factor. There was a gene-gene interaction between rs1800497 of DRD2 gene and rs4633 of COMT gene. We concluded that rs1800497 and rs4633 play important roles in the AN susceptibility with respect to the Chinese Han population. The gene-gene interaction between DRD2 and COMT contributes to the risk of AN. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Parents' Perceived Discrimination and Adolescent Adjustment in Chinese American Families: Mediating Family Processes.

    Science.gov (United States)

    Hou, Yang; Kim, Su Yeong; Hazen, Nancy; Benner, Aprile D

    2017-01-01

    Parental discriminatory experiences can have significant implications for adolescent adjustment. This study examined family processes linking parental perceived discrimination to adolescent depressive symptoms and delinquent behaviors by using the family stress model and incorporating family systems theory. Participants were 444 Chinese American adolescents (Mage.wave1  = 13.03) and their parents residing in Northern California. Testing of actor-partner interdependent models showed a significant indirect effect from earlier paternal (but not maternal) perceived discrimination to later adolescent adjustment through paternal depressive symptoms and maternal hostility toward adolescents. The results highlight the importance of including both parents and examining actor and partner effects to provide a more comprehensive understanding of how maternal and paternal perceived discrimination differentially and indirectly relate to adolescent adjustment. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

  5. Treatment Efficacy of Multiple Family Therapy for Chinese Families of Children with Attention Deficit Hyperactivity Disorder.

    Science.gov (United States)

    Ma, Joyce L C; Lai, Kelly Y C; Xia, Lily Li Li

    2017-05-30

    The treatment efficacy of multiple family therapy (MFT) for Chinese families of children with attention deficit hyperactivity disorder (ADHD) has not been studied in the past. In this paper, the effect of MFT on different aspects of the lives of the parents in the experimental group (n = 61) was compared with the effect of only the psychoeducational talks on parents in the control group (n = 53). The results of a MANOVA have shown that by the time they reached the posttreatment phase, the parents who had completed the full 42 hours of the MFT program perceived their children's ADHD symptoms as being less serious and less pathological than they had originally thought compared to the parents in the control group. The effect of MFT on parent-child relationships, parenting stress, parental efficacy, hope, and perceived social support was statistically insignificant. Contributions and limitations of our study are discussed. © 2017 Family Process Institute.

  6. Whole-exome sequencing identify a new mutation of MYH7 in a Chinese family with left ventricular noncompaction.

    Science.gov (United States)

    Yang, Jing; Zhu, Meng; Wang, Yao; Hou, Xiaofeng; Wu, Hongping; Wang, Daowu; Shen, Hongbing; Hu, Zhibin; Zou, Jiangang

    2015-03-01

    Left ventricular noncompaction (LVNC) is a genetic cardiomyopathy results from the failure of myocardial development during embryogenesis. Previous reports show that defects in TAZ, SCN5A, TPM1, YWHAE, MYH7, ACTC1 and TNNT2 are associated with LVNC. Sequencing of individuals using family-based design is a powerful approach for hereditary disease. In this study, we used whole-exome sequencing to screen potentially novel causal mutations in a Chinese Han family with LVNC. DNA from 3 individuals belonging to the same family was extracted and sequenced based on standard whole-exome sequencing protocol. The exome sequence data was analyzed using BWA, PICARD and Genome Analysis Toolkit (GATK v2.8). Non-silent single nucleotide variants (SNVs) were further selected if they exist in both LVNC patients and not in the health control. A web-based software Snv Prioritization via the INtegration of Genomic data (SPRING), was used to prioritize the causal SNV by calculating a q-value which indicates the statistical significance that a variant is causative for a query disease. From the LVNC family in which the mother and son were affected, a novel single nucleotide variant c.C1492G in exon 15 of MYH7 was identified probably to be the causal SNV of the family with P-value of 3.45E-05 and q-value of 4.65E-03 by SPRING. The SNV was predicted as deleterious in SIFT, PolyPhe2 and MutatioTaster database. Another 12 SNVs were also identified with P-value less than 0.05 by SPRING. A novel genetic variant in the coding regions of MYH7 gene was identified in a Chinese LVNC-family. The results support the previous evidence that MYH7 is a pathogenic gene for LVNC. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. [Analysis of PAX6 gene mutations in a Chinese family affected with congenital aniridia].

    Science.gov (United States)

    Chen, Jing; Zhu, Jianfang

    2016-08-01

    To investigate the mutation of PAX6 gene in a Chinese family affected with congenital aniridia. Blood samples were drawn from family members, and DNA was analyzed by direct sequencing. A heterozygous mutation (c.151 G>A) was identified in the PAX6 gene in the proband and other patients from the family. The same mutation was not found among unaffected family members and 160 unrelated healthy controls. A novel mutation in the PAX6 gene has been identified in a Chinese family affected with aniridia.

  8. Individual and Familial Factors Influencing the Educational and Career Plans of Chinese Immigrant Youths

    Science.gov (United States)

    Ma, Pei-Wen Winnie; Yeh, Christine J.

    2010-01-01

    The authors explore how individual and familial factors predict educational and career aspirations, plans, and vocational outcome expectations of urban, Chinese immigrant youths. Participants were 265 Chinese immigrant high school students in New York City. The results indicated that higher self-reported English language fluency and career-related…

  9. Autosomal recessive non-syndromic hearing loss is caused by novel compound heterozygous mutations in TMC1 from a Tibetan Chinese family.

    Science.gov (United States)

    Lin, Fangzhu; Li, Dejun; Wang, Ping; Fan, Dongyan; De, Ji; Zhu, Wei

    2014-12-01

    Hearing loss is the most common sensory disorder worldwide. Biallelic mutations in 42 different genes have been identified as associated with autosomal recessive non-syndromic hearing loss (ARNSHL). One of the common genes responsible for ARNSHL is TMC1. TMC1 mutations have been reported to cause non-syndromic hearing loss in a variety of populations. The current study is designed to investigate mutations prevalent among Chinese ethnic groups with ARNSHL. Targeted exome sequencing (TES) was employed to study the genetic causes of two siblings with ARNSHL in a Tibetan Chinese family. Variants identified by TES were further confirmed by Sanger sequencing. We identified two distinct variants in the TMC1 gene in two deaf siblings of one Tibetan Chinese family using TES. Both siblings inherited a paternal allele containing a deletion of c.1396_1398AAC (p.Asn466del) and a maternal allele containing an insertion of c.2210_2211insCT (p.Glu737HisfsX2). The former disrupts a highly conserved residue in the large intracellular loop domain adjacent to the fourth transmembrane domain, and the latter causes a truncation of a portion of the C-terminal domain. These variants were compound heterzygous and segregated with the hearing impairment in this family. The novel compound heterozygous mutant alleles of TMC1 identified in this study were responsible for the ARNSHL in this Tibetan Chinese family. Although compound heterozygous mutations in TMC1 occurring in different TMC1 domains have been previously described in Han Chinese; this result suggests that the TMC1 variants contributing to hereditary deafness in Chinese populations may be more complex than initially assumed and that sequence-based diagnostics will be required for a comprehensive evaluation of ARNSHL. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. Stresses and Coping Strategies of Chinese Families with Children with Autism and Other Developmental Disabilities

    Science.gov (United States)

    Wang, Peishi; Michaels, Craig A.; Day, Matthew S.

    2011-01-01

    Data from 368 families of children with autism and other developmental disabilities in the People's Republic of China were gathered to understand the stresses that families experience and the coping strategies they employ. Chinese families of children with developmental disabilities perceived high levels of stress related to pessimism, child…

  11. Family Stress, Parenting Styles, and Behavioral Adjustment in Preschool-Age Adopted Chinese Girls

    Science.gov (United States)

    Tan, Tony Xing; Camras, Linda A.; Deng, Huihua; Zhang, Minghao; Lu, Zuhong

    2012-01-01

    This study seeks to extend previous research on family stress, parenting, and child adjustment to families with adopted Chinese children. In doing so, we also seek to strengthen inferences regarding the experiential underpinnings of previously obtained relationships among these variables by determining if they also occur in families where parents…

  12. Association between the autophagy-related gene ULK1 and ankylosing spondylitis susceptibility in the Chinese Han population: a case-control study.

    Science.gov (United States)

    Zhang, Xu; Han, Renfang; Wang, Mengmeng; Li, Xiaona; Yang, Xiao; Xia, Qing; Liu, Rui; Yuan, Yaping; Hu, Xingxing; Chen, Mengya; Jiang, Guangming; Ma, Yubo; Yang, Jiajia; Xu, Shengqian; Xu, Jianhua; Shuai, Zongwen; Pan, Faming

    2017-12-01

    Ankylosing spondylitis (AS), inflammatory bowel disease and Crohn's disease (CD) often coexist in the same patient and these diseases have remarkably strong overlaps in genetic association. The association between Unc51like kinase 1 (ULK1) gene polymorphisms and CD has been reported, and the aim of the current study was to investigate whether ULK1 polymorphisms are also associated with susceptibility to AS in the Chinese Han population. Five tagging single nucleotide polymorphisms in the ULK1 gene (rs9652059, rs11616018, rs12303764, rs4964879 and rs7300908) were genotyped by the improved multiplex ligase detection reaction method in a cohort of patients with AS (n=649) and controls (n=628). Various genetic models were performed and haplotypes were constructed after linkage disequilibrium analysis. A statistically significant difference was found in the dominant model of the rs9652059 polymorphism (OR (95% CI) = 0.796 (0.638 to 0.994), χ2 = 4.064, p= 0.044). Haplotypes were conducted between rs9652059 and rs11616018, rs11616018 and rs4964879, rs9652059 and rs4964879 based on D' ≥0.9 and r2 ≥ 0.6. Ht5 (rs9652059C-rs4964879G) haplotype was associated with AS (OR (95% CI) = 0.834 (0.706 to 0.985), χ2=4.555, p= 0.0328) and other two haplotypes were marginally correlated with AS (ht2 (rs9652059C-rs11616018T): OR (95% CI) = 0.846 (0.717 to 1.000), χ2= 3.864, p= 0.0493); ht3 (rs9652059T-rs11616018T): OR (95% CI) = 1.440 (0.999 to 2.076), χ2 = 3.849, p = 0.0498). Our findings suggest that rs9652059 variation (C→T) could increase AS susceptibility and haplotypes of rs9652059C-rs4964879G, rs9652059C-rs11616018T and rs9652059T-rs11616018T may be associatd with AS. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. Childhood Abuse Experiences and the COMT and MTHFR Genetic Variants Associated With Male Sexual Orientation in the Han Chinese Populations: A Case-Control Study.

    Science.gov (United States)

    Qin, Jia-Bi; Zhao, Guang-Lu; Wang, Feng; Cai, Yu-Mao; Lan, Li-Na; Yang, Lin; Feng, Tie-Jian

    2018-01-01

    variants could be positively associated with the development of homosexuality. However, it remains unknown how these factors jointly play a role in the development of homosexuality, and more studies in different ethnic populations and with a larger sample and a prospective design are required to confirm our findings. Qin J-B, Zhao G-L, Wang F, et al. Childhood Abuse Experiences and the COMT and MTHFR Genetic Variants Associated With Male Sexual Orientation in the Han Chinese Populations: A Case-Control Study. J Sex Med 2018;15:29-42. Copyright © 2017 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

  14. Gendered power in eating habits: insight into childhood obesity in a Chinese family context

    National Research Council Canada - National Science Library

    Wong, Oi Ling

    2011-01-01

    In this article an attempt is made to understand how power and control issues between genders manifest themselves in eating habits in a Chinese family context, which contribute to the child's obesity problems...

  15. Association between Cognitive Distortion, Type D Personality, Family Environment, and Depression in Chinese Adolescents

    OpenAIRE

    Yong Zhang; Hengfen Li; Shaohong Zou

    2011-01-01

    Purpose. Depression prevalence and risk increase among adolescents are related to biological, psychosocial, and cultural factors. Little is known about the association between cognitive distortion, type D personality, family environment, and depression. The aim of this paper was to examine the relationships of cognitive distortion, type D personality, family environment, and depression in a sample of Chinese adolescents. Methods. A sample of Chinese adolescents with depression and the con...

  16. Association between Cognitive Distortion, Type D Personality, Family Environment, and Depression in Chinese Adolescents.

    Science.gov (United States)

    Zhang, Yong; Li, Hengfen; Zou, Shaohong

    2011-01-01

    Purpose. Depression prevalence and risk increase among adolescents are related to biological, psychosocial, and cultural factors. Little is known about the association between cognitive distortion, type D personality, family environment, and depression. The aim of this paper was to examine the relationships of cognitive distortion, type D personality, family environment, and depression in a sample of Chinese adolescents. Methods. A sample of Chinese adolescents with depression and the controls were investigated cross-sectionally with life orientation test-revised (LOT-R), type D personality Scale-14 (DS14), family environment scale (FES), and Zung self-depression scale (SDS); respectively, all scales were administered in Chinese. Results. Chinese-depressed adolescents showed more cognitive distortion, type D personality, and adverse family environment than control groups. Furthermore, lower level of Optimism, negative affectivity, and poor family cohesion may increase the risk of depression in Chinese adolescents. Conclusions. Our study indicates that lower level of Optimism, Negative Affectivity, and poor Family Cohesion factors were implicated to contribute to depression in Chinese adolescents. Lower level of optimism and negative affectivity may be crucial associated factors of depression among these samples. our findings pointed to the importance of broad screening and intervention of vulnerable population.

  17. The familial context of adolescent language brokering within immigrant Chinese families in Canada.

    Science.gov (United States)

    Hua, Josephine M; Costigan, Catherine L

    2012-07-01

    Language brokering, whereby children of immigrants provide informal translation and interpretation for others, is considered commonplace. However, the research evidence remains inconsistent concerning how language brokering relates to the psychological health of child language brokers and their relationships with their parents. Furthermore, few studies have examined the familial context as an explanation source. This study evaluated the moderating effects of adolescents' support of family obligation values and their perceptions of parental psychological control on relationships between language brokering frequency and both adolescent psychological health and parent-child relationship quality. Adolescents from 182 immigrant Chinese families residing in Canada (average age 15 years, 52% females) reported the frequency with which they translated or interpreted various materials for their parents. More frequent language brokering was associated with poorer psychological health for adolescents who held strong family obligation values or who perceived parents as highly psychologically controlling. More frequent language brokering was also associated with more parent-child conflict. Contrary to some past findings, language brokering frequency was not significantly positively associated with self-esteem or with parent-child congruence (i.e., levels of understanding and satisfaction with parent-child relationships). The findings are discussed in relation to their support for theories of parent-child role reversals or independent-interdependent scripts in language brokering.

  18. Familial risk of allergic rhinitis and atopic dermatitis among Chinese families in Singapore.

    Science.gov (United States)

    Lee, J T; Lam, Z C M; Lee, W T; Kuo, L C T; Jayant, V; Singh, G; Lee, J

    2004-01-01

    This study aims to determine the familial risk of atopic dermatitis (AD) and allergic rhinitis (AR) in Chinese children. A cross-sectional study was conducted in a housing estate in Singapore. Data was collected using an interviewer-administered questionnaire. Participants included 257 Chinese families. Prevalence rate ratios (PRRs) and 95% confidence interval (CI) were calculated. For AD in all children, an increasing trend was found with PRRs of 1.9 (95% CI, 0.3 to 11.8) and 1.5 (95% CI, 0.4 to 5.5) for only father and only mother affected, respectively, to 2.3 (95% CI, 0.4 to 13.7) for both parents affected. In AR, a PRR of 2.7 (95% CI, 1.8 to 3.9) and 2.2 (95% CI, 1.5 to 3.2) for only father and only mother affected, respectively, and 4.5 (95% CI, 3.3 to 6.1) for both affected was found. The PRR (2.2; 95% CI, 1.4 to 3.7) of the first child developing AR when paternal or maternal history was positive was similar. This rose to 3.4 (95% CI, 2.2 to 5.1) when both parents also had AR. The PRR of the second child developing AR was 3.9 (95% CI, 1.7 to 8.9) when the first child alone was positive for AR and 7.0 (95% CI, 3.5 to 13.9) when both parents and the eldest child had AR. A positive family history increases the risk of developing AD and AR with increasing risk dependent on number of relatives affected. The second child's risk of AR is also associated with AR in the first child, suggesting mechanisms of incomplete penetrance.

  19. Chinese Families' Level of Participation and Experiences in IEP Meetings

    Science.gov (United States)

    Lo, Lusa

    2008-01-01

    The author investigated the level of participation and experiences of 5 Chinese parents of children with disabilities in individualized education program (IEP) meetings through observations and interviews. Results of the study suggested that the Chinese parents were dissatisfied with 12 of 15 observed IEP meetings. The level of parental…

  20. Intergenerational Transmission of Tridimensional Cultural Orientations in Chinese American Families: The Role of Bicultural Socialization

    Science.gov (United States)

    Kim, Su Yeong; Hou, Yang

    2016-01-01

    It is important to understand the acculturation process of ethnic minority youth: To which cultures do they orient, and how do their cultural orientations develop? The present study tests a tridimensional acculturation model in Chinese American families and examines a potential mechanism through which parental cultural orientations may relate to adolescent cultural orientations. Participants were 350 Chinese American adolescents (Mage =17.04, 58% female) and their parents in Northern California. Results support the tridimensional acculturation model by demonstrating moderate associations among Chinese American orientation, Chinese orientation, and American orientation; our findings also point to a unique effect of parental Chinese American orientation on parental bicultural socialization beliefs. Most importantly, we identified an indirect pathway from parental to adolescents’ Chinese American orientation through adolescents’ internalization of parental bicultural socialization beliefs. PMID:26781739

  1. Cultural and family challenges to managing type 2 diabetes in immigrant Chinese Americans.

    Science.gov (United States)

    Chesla, Catherine A; Chun, Kevin M; Kwan, Christine M L

    2009-10-01

    Although Asians demonstrate elevated levels of type 2 diabetes, little attention has been directed to their unique cultural beliefs and practices regarding diabetes. We describe cultural and family challenges to illness management in foreign-born Chinese American patients with type 2 diabetes and their spouses. This was an interpretive comparative interview study with 20 foreign-born Chinese American couples (n = 40) living with type 2 diabetes. Multiple (six to seven) semistructured interviews with each couple in individual, group, and couple settings elicited beliefs about diabetes and narratives of care within the family and community. Interpretive narrative and thematic analysis were completed. A separate respondent group of 19 patients and spouses who met the inclusion criteria reviewed and confirmed the themes developed from the initial couples. Cultural and family challenges to diabetes management within foreign-born Chinese American families included how 1) diabetes symptoms challenged family harmony, 2) dietary prescriptions challenged food beliefs and practices, and 3) disease management requirements challenged established family role responsibilities. Culturally nuanced care with immigrant Chinese Americans requires attentiveness to the social context of disease management. Patients' and families' disease management decisions are seldom made independent of their concerns for family well-being, family face, and the reciprocal responsibilities required by varied family roles. Framing disease recommendations to include cultural concerns for balance and significant food rituals are warranted.

  2. Stereoselective metabolism of donepezil and steady-state plasma concentrations of S-donepezil based on CYP2D6 polymorphisms in the therapeutic responses of Han Chinese patients with Alzheimer's disease.

    Science.gov (United States)

    Lu, Jin; Wan, Lili; Zhong, Yuan; Yu, Qi; Han, Yonglong; Chen, Pengguo; Wang, Beiyun; Li, Wei; Miao, Ya; Guo, Cheng

    2015-11-01

    The therapeutic response rates of patients to donepezil vary from 20% to 60%, one of the reasons is their genetic differences in donepezil-metabolizing enzymes, which directly influence liver metabolism. However, the mechanism of donepezil metabolism and that of its enantiomers is unknown. This study evaluated CYP2D6 polymorphisms to elucidate the stereoselective metabolism of donepezil and to confirm the association between the steady-state plasma concentrations of the pharmaco-effective S-donepezil and the therapeutic responses of Han Chinese patients with Alzheimer's disease. The in vitro study of the stereoselective metabolism demonstrated that CYP2D6 is the predominant P450 enzyme that metabolizes donepezil and that different CYP2D6 alleles differentially affect donepezil enantiomers metabolism. A total of 77 Han Chinese patients with Alzheimer's disease were recruited to confirm these results, by measuring their steady-state plasma concentrations of S-donepezil. The related CYP2D6 genes were genotyped. Plasma concentrations of S-donepezil (based on CYP2D6 polymorphisms) were significantly associated with therapeutic responses. This finding suggests that plasma concentrations of S-donepezil influence therapeutic outcomes following treatment with donepezil in Han Chinese patients with Alzheimer's disease. Therefore, determining a patient's steady-state plasma concentration of S-donepezil in combination with their CYP2D6 genotype might be useful for clinically monitoring the therapeutic efficacy of donepezil. Copyright © 2015 Japanese Pharmacological Society. Production and hosting by Elsevier B.V. All rights reserved.

  3. Human prion disease with a G114V mutation and epidemiological studies in a Chinese family: a case series

    Directory of Open Access Journals (Sweden)

    Ye Jing

    2008-10-01

    Full Text Available Abstract Introduction Transmissible spongiform encephalopathies are a group of neurodegenerative diseases of humans and animals. Genetic Creutzfeldt-Jakob diseases, in which mutations in the PRNP gene predispose to disease by causing the expression of abnormal PrP protein, include familial Creutzfeldt-Jakob disease, Gerstmann-Straussler-Scheinker syndrome and fatal familial insomnia. Case presentation A 47-year-old Han-Chinese woman was hospitalized with a 2-year history of progressive dementia, tiredness, lethargy and mild difficulty in falling asleep. On neurological examination, there was severe apathy, spontaneous myoclonus of the lower limbs, generalized hyperreflexia and bilateral Babinski signs. A missense mutation (T to G was identified at the position of nt 341 in one PRNP allele, leading to a change from glycine (Gly to valine (Val at codon 114. PK-resistant PrPSc was detected in brain tissues by Western blotting and immunohistochemical assays. Information on pedigree was collected notably by interviews with family members. A further four suspected patients in five consecutive generations of the family have been identified. One of them was hospitalized for progressive memory impairment at the age of 32. On examination, he had impairment of memory, calculation and comprehension, mild ataxia of the limbs, tremor and a left Babinski sign. He is still alive. Conclusion This family with G114V inherited prion disease is the first to be described in China and represents the second family worldwide in which this mutation has been identified. Three other suspected cases have been retrospectively identified in this family, and a further case with suggestive clinical manifestations has been shown by gene sequencing to have the causal mutation.

  4. Mitochondrial haplotypes may modulate the phenotypic manifestation of the LHON-associated m.14484T>C (MT-ND6) mutation in Chinese families.

    Science.gov (United States)

    Zhang, Juanjuan; Zhao, Fuxin; Fu, Qun; Liang, Min; Tong, Yi; Liu, Xiaoling; Lin, Bei; Mi, Hui; Zhang, Minglian; Wei, Qi-Ping; Xue, Ling; Jiang, Pingping; Zhou, Xiangtian; Mo, Jun Qin; Huang, Taosheng; Qu, Jia; Guan, Min-Xin

    2013-11-01

    Mitochondrial m.14484T>C (MT-ND6) mutation has been associated with Leber's hereditary optic neuropathy. Previous investigations revealed that the m.14484T>C mutation is a primary factor underlying the development of optic neuropathy but is not sufficient to produce a clinical phenotype. However, mitochondrial haplogroups have been proposed to modulate the phenotypic manifestation of the m.14484T>C mutation. Here, we performed the clinical, genetic evaluation and complete mitochondrial genome sequence analysis of 41 Han Chinese pedigrees carrying the m.14484T>C mutation. These families exhibited a wide range of penetrances and expressivities of optic neuropathy. The average ratio between affected male/female matrilineal relatives from 41 families was 2:1. The penetrance of optic neuropathy in these Chinese pedigrees ranged from 5.6% to 100%, with the average of 23.8%. Furthermore, the age-of-onset for optic neuropathy varied from 4 to 44 years, with the average of 19.3 years. Sequence analysis of their mitochondrial genomes identified distinct sets of polymorphisms belonging to ten Eastern Asian haplogroups, indicating that the m.14484T>C mutation occurred through recurrent origins and founder events. We showed that mitochondrial haplogroups M9, M10 and N9 increased the penetrance of optic neuropathy in these Chinese families. In particular, these mitochondrial haplogroup specific variants: m.3394T>C (MT-ND1), m.14502T>C (MT-ND4) and m.14693A>G (MT-TE) enhanced the penetrance of visual loss in these Chinese families. These data provided the direct evidence that mitochondrial modifiers modulate the variable penetrance and expressivity of optic neuropathy among Chinese pedigrees carrying the m.14484T>C mutation. Copyright © 2013 Elsevier B.V. and Mitochondria Research Society. All rights reserved. All rights reserved.

  5. Association of TNF-α, TNFRSF1A and TNFRSF1B gene polymorphisms with the risk of sporadic breast cancer in northeast Chinese Han women.

    Directory of Open Access Journals (Sweden)

    Fengyan Xu

    Full Text Available BACKGROUND: The interaction of tumor necrosis factor-α (TNF-α with its receptors: TNFRSF1A and TNFRSF1B is critical for the promotion of tumor growth, invasion and metastasis. To better understand the roles of single nucleotide polymorphisms (SNPs in the TNF-α, TNFRSF1A and TNFRSF1B genes in the development of breast cancer, we explored the associations between SNPs in these three genes and breast cancer susceptibility in northeast Chinese Han women. METHODOLOGY/PRINCIPAL FINDINGS: This case-control study was conducted among 1016 breast cancer patients and 806 age-matched healthy controls. Seven SNPs in the TNF-α (rs1800629, rs361525, TNFRSF1A (rs767455, rs4149577 and rs1800693 and TNFRSF1B (rs1061622 and rs1061624 genes were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method. In TNFRSF1B, the rs1061622 GT genotype and the G allele conferred a reduced susceptibility to breast cancer (P = 0.000662, OR = 0.706, 95% CI: 0.578-0.863; P = 0.002, OR = 0.769, 95% CI; 0.654-0.905, respectively. Moreover, the AG genotype, the AA genotype and the A allele in rs1061624 conferred an increased risk of breast cancer (P = 0.007, OR = 1.470, 95% CI:1.112-1.943; P = 0.00109, OR = 1.405 95% CI:1.145-1.724; P = 0.001, OR = 1.248 95% CI:1.092-1.426, respectively. These two SNPs also had associations with breast cancer risk under the dominant model. In haplotype analysis, the CTA (rs767455 C-rs4149577 T-rs1800693 A haplotype in TNFRSF1A and the TA (rs1061622 T-rs1061624 A haplotype in TNFRSF1B had higher frequencies in breast cancer patients (P = 0.00324; P = 0.000370, respectively, but the frequency of GG (rs1061622 G-rs1061624 G haplotype in TNFRSF1B was lower in breast cancer patients (P = 0.000251. The associations of the three haplotypes remained significant after correcting for multiple testing. In addition, significant associations were also observed between

  6. Exploring Family Support for Older Chinese Singaporean Women in a Confucian Society.

    Science.gov (United States)

    Chang, Leanne; Basnyat, Iccha

    2017-05-01

    This study investigated the functions of family support in older Chinese Singaporean women's daily health management in a Confucian cultural context, wherein family solidarity and women's caregiving responsibilities are emphasized. Thirty-eight interviews were conducted with ethnic Chinese women above the age of 60 in Singapore. Our thematic analysis showed that older women played dual roles as support providers and recipients in the family. Their caregiver identity and intent to preserve tradition resulted in a downward transmission of informational and physical support and their hesitance to accept resources provided by younger family members. The asymmetrical flow of family support generated mixed impacts on the women's daily health management. In their transition between tradition and modernity, older women fulfilled their family responsibilities but did not require their children to do so. Our findings suggested an integration of familial and institutional resources to meet older women's support needs and help them enhance their health behavior.

  7. Variations in IL-1R1 Gene Influence Risk for Hepatitis B Virus Infection of Children in a Han Chinese population.

    Science.gov (United States)

    Fan, Jie; Cai, Yiling; Huang, Xin; Wang, Yan; Mu, Lihong; Zhou, Li

    2017-02-01

    Host genetic factors play an important role in the pathogenesis of hepatitis B virus (HBV) infection. However, the role of Interleukin1Receptor, Type I (IL-1R1) gene in HBV infection and breakthrough infection in children remains unclear. The aim of this study was to investigate the association between SNPs in IL-1 family and HBV infection and breakthrough infection in children. A total of 627 Chinese children (274 HBV infected children and 353 controls) ages 6 months to 12 years were recruited from October 2013 to May 2015.Six SNPs were genotyped in IL-1R1, Interleukin-1beta (IL-1B) and Interleukin-18 (IL-18) genes. A statistically significant association was found between genotype AA in rs3917267 (IL-1R1) and HBV infection in children (OR, 1.740; 95%CI, 1.091-2.774; p=0.020), which was also found at allele A (OR, 1.316;95%CI, 1.050-1.648; p=0.017). Furthermore, rs3917267 was also significantly associated with breakthrough infection of HBV in children born of hepatitis B surface antigen (HBsAg) positive mothers (OR,3.675; 95%CI, 1.160-11.646; P=0.027). Our study confirmed that genetic variant in IL-1R1(rs3917267) has significant association with HBV infection and HBV breakthrough infection in children, which provides new clues for the study of pathogenesis of chronic HBV infection in children. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Perspectives on Family Health, Happiness and Harmony (3H) among Hong Kong Chinese People: A Qualitative Study

    Science.gov (United States)

    Lam, W. W. T.; Fielding, R.; McDowell, I.; Johnston, J.; Chan, Sophia; Leung, G. M.; Lam, T. H.

    2012-01-01

    Family harmony, an important Confucian ideal in Chinese society is believed to determine family happiness and therefore health, but is this accurate? This is a qualitative study of 41 Hong Kong Chinese family members. Individual recorded interviews were thematically analysed describing perceived interactions between harmony, happiness and health.…

  9. Language Choices of CEOs of Chinese Family Business in Sarawak, Malaysia

    Science.gov (United States)

    Ting, Su-Hie

    2017-01-01

    The study investigated the language choices of Chief Executive Officers (CEOs) of Chinese family business and the factors guiding their choices. Interviews were conducted with 17 CEOs of family businesses located in Sarawak, some of whom are the sons and grandsons of the founder of the business. The results showed that all the CEOs can speak their…

  10. Bridging Home and Host Country: Educational Predispositions of Chinese and Indian Recent Immigrant Families

    Science.gov (United States)

    Gordon, June A.; Liu, Xiangyan

    2015-01-01

    This research focuses on the predispositions that recent Chinese and Indian immigrant families bring with them to the United States and how these are reinforced by the communities in which they locate. The findings draw from 144 interviews in California. Three themes dominate: positioning through schooling, transnational family, and extended…

  11. Perceived Self-Efficacy, Cultural Values, and Coping Styles among Chinese Families of Children with Autism

    Science.gov (United States)

    Huang, Mary; Zhou, Zheng

    2016-01-01

    Autism spectrum disorder (ASD) is a pervasive developmental disorder that has grown in prevalence over the past few decades and has a tremendous impact on families that struggle with adjustment to this disorder. Initial exposure to such a disorder may be a significant source of stress and tribulation for Chinese families who are not accustomed to…

  12. The experiences and perceptions of family planning of female Chinese asylum seekers living in the UK.

    Science.gov (United States)

    Verran, Alice; Evans, Sarah; Lin, Daniel J; Griffiths, Frances

    2015-04-01

    Chinese family planning policy is unique. There is limited sex education and the state is highly influential. This has resulted in extremely wide coverage of contraception with long-acting methods being favoured. The Chinese constitute a large proportion of asylum applicants to the UK. This study examines how their experiences and decisions about family planning in the UK are shaped by their cultural background. Data were drawn from 10 semi-structured qualitative interviews with female Chinese asylum seekers recruited through a family planning clinic in the UK. The increased autonomy provided by the UK system was appreciated by the participants. Choice of contraceptive method was influenced by traditional cultural beliefs and values, and the effect of hormonal contraception on menstruation was particularly concerning. Women arrived from China with little knowledge of contraception. Friends from a similar background were the most trusted source of advice. When transitioning from China to the UK unwanted pregnancies had occurred amongst unmarried women who had missed out on sex education while living in China. Chinese societal and cultural practices continue to influence family planning decisions made within the UK. Culturally competent health strategies are needed to ensure Chinese immigrant women fully benefit from family planning within the UK. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Neighborhood characteristics, parenting styles, and children's behavioral problems in Chinese American immigrant families

    OpenAIRE

    Lee, EH; Zhou, Q; Ly, J; Main, A; Tao, A; Chen, SH

    2014-01-01

    Using data from a socioeconomically diverse sample of Chinese American children (n = 258, aged 6-9 years) in immigrant families, we examined the concurrent relations among neighborhood economic disadvantage and concentration of Asian residents, parenting styles, and Chinese American children's externalizing and internalizing problems. Neighborhood characteristics were measured with 2000 U.S. Census tract-level data, parents (mostly mothers) rated their own parenting styles, and parents and te...

  14. Genetic variation and forensic characteristic analysis of 25 STRs of a novel fluorescence co-amplification system in Chinese Southern Shaanxi Han population

    Science.gov (United States)

    Liu, Yao-Shun; Chen, Jian-Gang; Mei, Ting; Guo, Yu-Xin; Meng, Hao-Tian; Li, Jian-Fei; Wei, Yuan-Yuan; Jin, Xiao-Ye; Zhu, Bo-Feng; Zhang, Li-Ping

    2017-01-01

    We analyzed the genetic polymorphisms of 15 autosomal and 10 Y-chromosomal STR loci in 214 individuals of Han population from Southern Shaanxi of China and studied the genetic relationships between Southern Shaanxi Han and other populations. We observed a total of 150 alleles at 15 autosomal STR loci with the corresponding allelic frequencies ranging from 0.0023 to 0.5210, and the combined power of discrimination and exclusion for the 15 autosomal STR loci were 0.99999999999999998866 and 0.999998491, respectively. For the 10 Y-STR loci, totally 100 different haplotypes were obtained, of which 94 were unique. The discriminatory capacity and haplotype diversity values of the 10 Y-STR loci were 0.9259 and 0.998269, respectively. The results demonstrated high genetic diversities of the 25 STR loci in the population for forensic applications. We constructed neighbor-joining tree and conducted principal component analysis based on 15 autosomal STR loci and conducted multidimensional scaling analysis and constructed neighbor-joining tree based on 10 Y-STR loci. The results of population genetic analyses based on both autosomal and Y-chromosome STRs indicated that the studied Southern Shaanxi Han population had relatively closer genetic relationship with Eastern Han population, and distant relationships with Croatian, Serbian and Moroccan populations. PMID:28903432

  15. A significant association between rs8067378 at 17q12 and invasive cervical cancer originally identified by a genome-wide association study in Han Chinese is replicated in a Japanese population.

    Science.gov (United States)

    Miura, Kiyonori; Mishima, Hiroyuki; Yasunami, Michio; Kaneuchi, Masanori; Kitajima, Michio; Abe, Shuhei; Higashijima, Ai; Fuchi, Naoki; Miura, Shoko; Yoshiura, Koh-Ichiro; Masuzaki, Hideaki

    2016-09-01

    In this study, associations between invasive cervical cancer and four cervical cancer susceptibility loci (rs13117307 at 4q12, rs8067378 at 17q12, and rs4282438 and rs9277952 at 6p21.32) in the Han Chinese population were investigated in a Japanese population. Human leukocyte antigen (HLA)-DPB1 alleles were also investigated for their association with cervical cancer risk in the Japanese population. After receiving written informed consent, 214 unrelated Japanese women with invasive cervical cancer and 288 cancer-free Japanese women were recruited, and DNA samples were obtained (study protocol approved by Institutional Review Board of Nagasaki University). Of the four single-nucleotide polymorphisms, rs8067378 showed a significant association with invasive cervical cancer (P=0.0071). Under a recessive model, the minor allele G of rs8067378 contributed to the risk of invasive cervical cancer (odds ratio=2.92, 95% confidence interval=1.40-6.36; P=0.0021). No association was detected between HLA-DPB1 alleles and cervical cancer risk in the Japanese population. In conclusion, we show for the first time, to the best of our knowledge, that an association between increased risk of invasive cervical cancer and rs8067378 in the Han Chinese population is replicated in a Japanese population. In addition, Japanese women with the GG genotype of rs8067378 are a candidate high-risk group for invasive cervical carcinoma.

  16. Association study of tumor necrosis factor receptor type 2 M196R and toll-like receptor 2 Arg753Gln polymorphisms with acne vulgaris in a Chinese Han ethnic group.

    Science.gov (United States)

    Tian, Li-Ming; Xie, Hong-Fu; Yang, Ting; Hu, Yao-Hua; Li, Ji; Wang, Wei-Zhen

    2010-01-01

    Inflammatory cytokines such as tumor necrosis factor receptor 2 (TNFR2) and Toll-like receptor 2 (TLR2) are the main responsible mediators of inflammatory acne. Factors affecting their production may possibly influence the degree of inflammatory response and hence may account for the clinical severity of acne. However, the roles of TNFR2 and TLR2 in the pathophysiology of acne vulgaris are poorly understood. We therefore investigated the relationship between acne vulgaris susceptibility and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. A total of 93 acne vulgaris patients and 90 healthy subjects from the Chinese Han ethnic group were enrolled in the study. The polymerase chain reaction restriction fragment length polymorphism technique was adopted to analyze the single-nucleotide polymorphisms of the TNFR2 M196R and TLR2 Arg753Gln gene, and to examine the association between acne vulgaris and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. The relationship between different genotypes and the susceptibility to acne vulgaris was analyzed. There is a significant difference in the frequency of TNFR2 M196R genetic polymorphisms between the moderate-acne to severe-acne subgroups and the control group (p acne subgroup and control group (p acne vulgaris in Chinese Han patients, further supporting the contribution of inflammatory cytokines to the pathogenesis of acne.

  17. Across Cultural and National Borders: Diasporic Chinese Family in Pushing Hands

    Directory of Open Access Journals (Sweden)

    Qijun Han

    2011-08-01

    Full Text Available Being embedded in the interdisciplinary area of media and culture studies, this articlel explores the family melodrama in transnational Chinese cinema drawing upon theoretical discussions with regard to the historical emergence of melodrama in correspondence to, as Th. Elsaesser says, “periods of intense social and ideological crisis”. While serving as a reflection on the tension between tradition and modernity displayed in the domestic domain, Ang Lee’s Chinese-characterized family melodrama also illustrates the differences between Chinese and Hollywood family melodrama. Linked to the ongoing debate about “melodrama as a cross-cultural form”, in the process of analyzing the film text, our perceptions of generic dislocation or displacement, transcultural entanglements and globalization in light of contemporary cultural practices will be furthermore complicated.  

  18. The impact of the International Association of Diabetes and Pregnancy Study Groups (IADPSG) fasting glucose diagnostic criterion on the prevalence and outcomes of gestational diabetes mellitus in Han Chinese women.

    Science.gov (United States)

    Liao, S; Mei, J; Song, W; Liu, Y; Tan, Y-D; Chi, S; Li, P; Chen, X; Deng, S

    2014-03-01

    The International Association of Diabetes and Pregnancy Study Groups (IADPSG) proposed that a one-time value of fasting plasma glucose of 5.1 mmol/l or over at any time of the pregnancy is sufficient to diagnose gestational diabetes. We evaluated the repercussions of the application of this threshold in pregnant Han Chinese women. This is a retrospective study of 5360 (72.3% of total) consecutively recruited pregnant Han Chinese women in one centre from 2008 to 2011. These women underwent a two-step gestational diabetes diagnostic protocol according to the previous American Diabetes Association criteria. The IADPSG fasting plasma glucose criterion was used to reclassify these 5360 women. The prevalence, clinical characteristics and obstetric outcomes were compared among the women classified as having gestational diabetes by the previous American Diabetes Association criteria (approximately 90% were treated), those reclassified as having gestational diabetes by the single IADPSG fasting plasma glucose criterion (untreated), but not as having gestational diabetes by the previous American Diabetes Association criteria, and those with normal glucose tolerance. There were 626 cases of gestational diabetes defined by the previous American Diabetes Association criteria (11.7%) and these cases were associated with increased risks of maternal and neonatal outcomes when compared with the women with normal glucose tolerance. With the IADPSG fasting plasma glucose criterion, another 1314 (24.5%) women were reclassified as having gestational diabetes. Gestational diabetes classified by the IADPSG fasting plasma glucose criterion was associated with gestational hypertension (P = 0.0094) and neonatal admission to nursery (P = 0.035) prior to adjustment for maternal age and BMI, but was no longer a predictor for adverse pregnancy outcomes after adjustment. The simple IADPSG fasting plasma glucose criterion increased the Chinese population with gestational diabetes by 200%. The

  19. Apolipoprotein B is associated with metabolic syndrome in Chinese families with familial combined hyperlipidemia, familial hypertriglyceridemia and familial hypercholesterolemia.

    Science.gov (United States)

    Pei, Wei-dong; Sun, Yu-hua; Lu, Bin; Liu, Qun; Zhang, Chao-yang; Zhang, Jian; Jia, Yu-he; Lu, Zong-liang; Hui, Ru-tai; Liu, Li-sheng; Yang, Yue-jin

    2007-03-20

    There is a paucity of data concerning the metabolic syndrome (MetS) in families with familial combined hyperlipidemia (FCHL), familial hypertriglyceridemia (FHTG), familial hypercholesterolemia (FH) and normolipidemic families in China. This study investigated the prevalence of MetS in these families and explored potential factors relevant to MetS. We recruited 70 families with 560 individuals > or = 20 years of age, including 43 FCHL families with 379 individuals, 3 FHTG families with 30 individuals, 16 FH families with 102 individuals and 8 normolipidemic families with 49 individuals. The definition of MetS is determined using modified criteria of National Cholesterol Education Program substituting body mass index for waist circumference. MetS is identified in 60.7% of FCHL patients and 71.4% of FHTG patients. The prevalence of MetS in family members is 36.7% for FCHL, 33.3% for FHTG, 17.6% for FH and 16.3% for normolipidemic families, with an odds ratio (OR) of 2.97 (95% CI 1.29-7.07, P=0.007) in FCHL families compared with normolipidemic families. Apolipoprotein B (apoB) is associated with MetS by multiple logistic analysis with an OR of 1.05 (1.03-1.07, Pfamilies, OR of 1.26 (1.03-1.55, P=0.026) in FHTG and OR of 1.07 (1.01-1.12, P=0.014) in FH families, independent of variables including age, gender, apolipoprotein A1, and low density lipoprotein cholesterol. Apolipoprotein A1 provided an OR of 0.95 (0.94-0.97, Pfamilies and OR of 0.94 (0.90-0.97, P=0.011) in FH families, but neither in FHTG nor in normolipidemic families (both P>0.05). Thus, apoB may be regarded as a relevant factor in the assessment of MetS in FCHL, FHTG and FH families. However, this finding needs to be verified by prospective studies in diverse ethnicities and warrants additional studies to elucidate possible mechanisms linking apoB to MetS.

  20. Intergenerational and Urban-Rural Health Habits in Chinese Families

    Science.gov (United States)

    Li, Li; Lin, Chunqing; Cao, Haijun; Lieber, Eli

    2009-01-01

    Objective: To explore intergenerational health habits and compare differences between urban and rural families. Methods: A total of 2500 families with children ages 6-18 in China were surveyed regarding their health habits. Results: Urban families reported significantly greater food variety and more time exercising (for fathers and children) than…

  1. Correlation analysis of the HLA-DPB1*05:01 and BTNL2 genes within the histocompatibility complex region with a clinical phenotype of psoriasis vulgaris in the Chinese Han population.

    Science.gov (United States)

    Guo, Huimin; Huang, Yong; Wu, Juan; Zheng, Xiaodong; Ye, Lei; Huang, Hequn; Wang, Wenjun; Zhen, Qi; Wu, Jing; Qian, Wenjun; Cheng, Hui; Fan, Xing; Zhang, Xuejun

    2017-09-01

    The human major histocompatibility complex (MHC) is known to be highly polymorphic and has been identified to be associated with numerous diseases. The HLA-DPB1 and BTNL2 genes were associated with psoriasis for the first time. The present study aims to investigate the relevance of the HLA-DPB1 and BTNL2 genes with respect to clinical phenotypes of psoriasis vulgaris (PV). To investigate whether the HLA-DPB1 and BTNL2 polymorphisms were associated with clinical phenotypes of PV in Chinese Han population, we conducted an analysis in case-controls and case-only subjects (9906 controls and 8744 cases) via MHC targeted sequencing stratified analysis. In cases and controls, analysis showed that the genotype of HLA-DPB1*05:01 was associated with type of guttate [p = 3.914 × 10-2 , odds ratio (OR = 0.9335)] and northern region (p = 1.182 × 10-3 , OR = 0.9108). In the case-only analysis, the genotype of HLA-DPB1*05:01 was significantly correlated with geographical region (p = 1.36 × 10-3 , OR = 1.134). In cases and controls, analysis showed that the genotype of BTNL2 (rs 41355746) was associated with being male (p = 2.563 × 10-2 , OR = 0.8897), early-onset (p = 9.399 × 10-3 , OR = 0.8856), guttate (p = 2.469 × 10-2 , OR = 0.8558) and family history (p = 1.51 × 10-4 , OR = 0.772). In the case-only analysis, the genotype of BTNL2 (rs41355746) was significantly correlated with family history (p = 1.768 × 10-3 , OR = 0.757) and age of onset (p = 3.818 × 10-2 , OR = 1.195). The results of the present study indicate that the HLA-DPB1*05:01 gene was associated with the geographical region of PV and the BTNL2 gene was significantly associated with family history and age of onset of PV. In conclusion, the HLA-DPB1*05:01 and BTNL2 genes might be responsible for the complicacy of clinical features. Copyright © 2017 John Wiley & Sons, Ltd.

  2. Place of dairy products in the Chinese-American family food system.

    Science.gov (United States)

    Lv, Nan; Brown, J Lynne

    2010-08-01

    Chinese Americans have a high risk of osteoporosis and their calcium intake is substantially below the daily recommendation. However, little has been done to reduce the risk of this hard-to-reach population. This theory-based qualitative study explored how first-generation Chinese American couples with children view dairy products, how they use them in their family food system, and how these uses influence their dietary behavior or intake. Twenty couples, recruited from weekend Chinese schools at three locations in Pennsylvania, were interviewed. Taste, texture, and use of additives and growth hormones appeared to be more important influences on dairy choice than lactose intolerance. In these families, parental use of food rules and power to influence food patterns affected family flexibility about dairy use. Father's power, his views of dairy products, and his preference for Chinese-based dinners had a greater influence than those of his wife or children on the use of dairy-based dinner dishes. In contrast, choices at breakfast or lunch and for snacks were more flexible and could include dairy products. Nutrition educators can encourage introduction of dairy products into the traditional dietary pattern of Chinese Americans by offering opportunities to taste unfamiliar dairy products, demonstrating use of dairy products to prepare familiar foods, including both parents in any intervention or at least in tasting recipes, and providing information on importance of calcium to bone health and amount of calcium needed from reputable sources. 2010 American Dietetic Association. Published by Elsevier Inc. All rights reserved.

  3. A Chinese family with Axenfeld-Rieger syndrome: report of the clinical and genetic findings

    Directory of Open Access Journals (Sweden)

    Da-Peng Sun

    2017-06-01

    Full Text Available AIM: To describe a Chinese family affected by a severe form of Axenfeld-Rieger syndrome (ARS and characterize the molecular defect in PITX2 in the family. METHODS: Patients presented with typical ARS from a Chinese family were investigated. We performed genome-wide linkage scan and exome sequencing to identify the pathogenic mutations. Candidate mutations were verified for co-segregation in the whole pedigree using Sanger sequencing. Real-time polymerase chain reaction (RT-PCR and Western blotting were performed to verify the expression of the pathogenic gene. RESULTS: Genome-wide linkage and exome sequencing analyses showed PITX2 as the disease candidate gene. A>G substitution at position -11 of 3’ss of exon 5 (IVS5-11A>G that co-segregated with the disease phenotype was discovered in the family. The PITX2 messenger ribonucleic acid and protein levels were about 50% lower in patients with ARS than in unaffected family members in the family. CONCLUSION: Our findings implicate the first intronic mutation of the PITX2 gene in the pathogenesis of a severe form of ARS in a Chinese family. This study highlights the importance of a systematic search for intronic mutation in ARS cases for which no mutations in the exons of PITX2 have been found.

  4. 2 Novel deletions of the sterol 27-hydroxylase gene in a Chinese Family with Cerebrotendinous Xanthomatosis

    Directory of Open Access Journals (Sweden)

    Tian Di

    2011-10-01

    Full Text Available Abstract Background Cerebrotendinous xanthomatosis (CTX is a rare lipid-storage disease. We investigated the clinic manifestation, histopathology and sterol 27-hydroxylase gene (CYP27A1 in a Chinese family with Cerebrotendinous Xanthomatosis (CTX. Case Presentation A 36-year-old female with typical CTX clinical manifestation had Spindle-shaped lipid crystal clefts in xanthomas and "onion-like demyelination" in sural nerve. The patient was compound heterozygote carrying two deletions in exon 1 (c.73delG and exon 2 (c.369_375delGTACCCA. The family memebers were carriers. Conclusions A Chinese family with Cerebrotendinous Xanthomatosis had typical clinical manifestation. CYP27A1 mutations were found in the proband and all other family members.

  5. The influence of Chinese culture on family caregivers of stroke survivors: A qualitative study.

    Science.gov (United States)

    Qiu, Xichenhui; Sit, Janet W H; Koo, Fung Kuen

    2017-07-05

    To explore and describe the caregiving experiences of Chinese stroke caregivers. Previous research has indicated that culture can have a significant impact on the stroke caregiving experience. Moreover, scant research exists on stroke caregivers' experience within the Chinese culture. A qualitative descriptive design was used. In-depth, semistructured interviews were conducted with 25 family caregivers of stroke survivors. The interviews were audiotaped, transcribed and analysed. Content analysis was also performed. Twenty-five family caregivers of stroke survivors were recruited for the study. On average, respondents were 66 years old (range 45-82 years). Of 25 interviewees, 76% were female, 64% were spouse-caregivers and 36% were children-caregivers. Three themes reflecting the influence of Chinese culture on stroke caregiving emerged from the interviews. (i) Caregiving role perception. Informants accepted caregiving for the sick family member as an expected part of life, a culturally prescribed obligation and an expression of reciprocal love. (ii) Coping strategies. Connecting with family resources and connecting with inner strength were frequently reported coping strategies. (iii) Self-sacrifice. Informants identified self-reliance and feeling of restraint in their utilisation or access of formal caregiving service. Chinese caregivers sacrifice themselves for the care recipients regardless of the hardships and the neglect of their own health. Our findings provide a comprehensive and culturally sensitive perspective in understanding the experience of stroke caregivers in Chinese communities. Cultural and religious backgrounds were found to influence Chinese stroke caregivers' experience, coping strategies and self-sacrifice behaviour in idiosyncratic ways. Research on the practice of culture can serve as a basis for the formulation of specific policies and effective interventions for supporting stroke caregivers of different cultural backgrounds. © 2017 John

  6. Family Processes and Suicidal Ideation among Chinese Adolescents in Hong Kong

    OpenAIRE

    Kwok, Sylvia Y. C. L.; Shek, Daniel T. L.

    2011-01-01

    Based on the responses of 5,557 Chinese secondary students in Hong Kong, the relationships between perceived family functioning (systemic correlate), parent-adolescent communication (dyadic correlate), and suicidal ideation were examined in this study. Results showed that suicidal ideation was negatively related to global family functioning and parent-adolescent communication. Regression analyses indicated that the dyadic and systemic factors had similar importance in predicting suicidal idea...

  7. Family Processes and Suicidal Ideation among Chinese Adolescents in Hong Kong

    Directory of Open Access Journals (Sweden)

    Sylvia Y. C. L. Kwok

    2011-01-01

    Full Text Available Based on the responses of 5,557 Chinese secondary students in Hong Kong, the relationships between perceived family functioning (systemic correlate, parent-adolescent communication (dyadic correlate, and suicidal ideation were examined in this study. Results showed that suicidal ideation was negatively related to global family functioning and parent-adolescent communication. Regression analyses indicated that the dyadic and systemic factors had similar importance in predicting suicidal ideation. Theoretical and practical implications of the findings are discussed.

  8. Family involvement for breast cancer decision making among Chinese-American women.

    Science.gov (United States)

    Lee, Shiuyu Katie C; Knobf, M Tish

    2016-12-01

    To describe family involvement in decision making for primary treatment in Chinese-American women with early-stage breast cancer. Qualitative data were collected in 2003 from semi-structured questions in interviews with a sample of Chinese-American (ChA) women with breast cancer, who were recruited from the metropolitan New York area. Responses to the questions were written in Chinese immediately during the interview and read back to the subject for accuracy and validation. Content analysis was used to inductively code and analyze the data to generate themes. The participants consisted of 123 ChA women with early stage breast cancer with a mean age of 48.7 years (±9.3) and who had lived in the United States a median of 13.6 years. Support and Caring was the major theme that described family involvement in the breast cancer decision-making process. Gathering Information, Being There, Navigating the Health Care System, Maintaining Family Life and Making the Decision described the aspects of family support in the process. The majority of women described the treatment decision making as a collaborative supportive process with the family, but limited English fluency, strong opinions, lack of a shared perspective, distant living proximity and competing work responsibilities of family members were stressful for the women and perceived as non-supportive. Family involvement in health care decision making is culturally embedded in Asian populations. Culturally sensitive patient and family consultation strategies are needed to assist informed treatment decision making in Chinese-American women diagnosed with breast cancer. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Family Life Quality and Emotional Quality of Life in Chinese Adolescents with and without Economic Disadvantage

    Science.gov (United States)

    Shek, Daniel T. L.; Lee, T. Y.

    2007-01-01

    Chinese secondary school students (N = 2758) responded to measures of perceived family life quality (parenting quality and parent-child relational quality) and emotional quality of life (hopelessness, mastery, life satisfaction and self-esteem). Parenting quality included different aspects of parental behavioral control (parental knowledge,…

  10. Perceived Treatment Effectiveness of Family Therapy for Chinese Patients Suffering from Anorexia Nervosa: A Qualitative Inquiry

    Science.gov (United States)

    Ma, Joyce L. C.; Lai, Kelly

    2006-01-01

    Although family therapy has become highly acceptable in the West, its applicability and acceptability for Chinese adolescents and young women with anorexia nervosa (AN) remains unknown. In this article, we report the results of a qualitative study using post-treatment in-depth interviews to understand the subjective perceptions of sufferers of AN…

  11. Coming into an Inheritance: Family Support and Chinese Heritage Language Learning

    Science.gov (United States)

    Mu, Guanglun Michael; Dooley, Karen

    2015-01-01

    The critical role that family plays in Chinese Heritage Language learning (CHLL) has gained increasing attention from psychological, political and sociological scholarships. Guided by Bourdieu's notion of "habitus", our mixed methods sociological study firstly addresses the need for quantitative evidence on the relationship between…

  12. Literacy, Culture, and Politics of Schooling: Counternarratives of a Chinese Canadian Family.

    Science.gov (United States)

    Li, Guofang

    2003-01-01

    Describes a Chinese Canadian immigrant family that is encountering difficulties with schooling, demonstrating the complex interrelationship between home literacy, culture, and politics of schooling. Findings suggest that cultural mismatch theory alone cannot explain minority school failure. Rather, multilevel interactions, including cultural…

  13. Transnational business and family strategies among Chinese/Nigerian couples in Guangzhou and Lagos

    NARCIS (Netherlands)

    Lan, S.

    2015-01-01

    Based on ethnographic fieldwork in Guangzhou and Lagos, this paper explores transnational trade activities and family strategies among Chinese/Nigerian interracial couples in the context of growing China/Africa trade relations and the recent tightening of China's immigration control. It examines how

  14. The Chinese Family Assessment Instrument (C-FAI): Hierarchical Confirmatory Factor Analyses and Factorial Invariance

    Science.gov (United States)

    Shek, Daniel T. L.; Ma, Cecilia M. S.

    2010-01-01

    Objective: This paper examines the dimensionality and factorial invariance of the Chinese Family Assessment Instrument (C-FAI) using multigroup confirmatory factor analyses (MCFAs). Method: A total of 3,649 students responded to the C-FAI in a community survey. Results: Results showed that there are five dimensions of the C-FAI (communication,…

  15. Novel NPHS1 gene mutations in a Chinese family with congenital ...

    Indian Academy of Sciences (India)

    Department of Pediatrics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology,. Wuhan, Hubei 430030, People's Republic of China. [Yang F., Chen Y., Zhang Y., Qiu L., Chen Y. and Zhou J. 2016 Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome.

  16. A novel TSC2 mutation in a Chinese family with tuberous sclerosis ...

    Indian Academy of Sciences (India)

    1Department of Medical Genetics, College of Basic Medical Science and 2Undergraduate Student Brigade, Third Military. Medical University, Chongqing 400038, People's Republic of China. [Yu Z., Zhang X., Guo H. and Bai Y. 2014 A novel TSC2 mutation in a Chinese family with tuberous sclerosis complex. J. Genet.

  17. Identification of a novel SHOX mutation in a Chinese family with ...

    Indian Academy of Sciences (India)

    Novel SHOX mutation in Chinese IMD family. Table 2. Primers and PCR conditions used to amplify the genomic segments of SHOX. Primer. Forward primer (5 –3 ). Reverse primer (5 –3 ). Annealing temperature (. ◦. C) Product size (bp). SHOX-2. GAGGTCGCCGCGTATAAATAGT TCGGGTCCACTCCTGCCTT. 61. 603.

  18. Job Insecurity and Remuneration in Chinese Family-Owned Business Workers

    Science.gov (United States)

    Hu, Qiao; Schaufeli, Wilmar B.

    2011-01-01

    Purpose: The purpose of this paper is to study the impact of job insecurity (past job downsizing and anticipated job downsizing) and current remuneration--via wellbeing (burnout and work engagement)--on organizational outcomes (organization commitment and low turnover intention) of Chinese family-owned business. Design/methodology/approach: The…

  19. Chinese educational system and culture family education to development

    Directory of Open Access Journals (Sweden)

    Camila Silveira Stangherlin

    2017-12-01

    Full Text Available This study aims to demonstrate the nuances of the current communist China, and present the main progress achieved in the educational system of that country, aiming the insertion in the global economy . Carried out bibliographical study with scholars experts in that area , using the deductive method of approach , and interview technique. The communist regime currently present in China has odd quirks resulting in a very Chinese communism . One of the pillars of the overhaul is the opening of the education system and significant investments as well as on the perception by the population of the need for a substantial familiar application in education.

  20. Univariate and multiple linear regression analyses for 23 single nucleotide polymorphisms in 14 genes predisposing to chronic glomerular diseases and IgA nephropathy in Han Chinese.

    Science.gov (United States)

    Wang, Hui; Sui, Weiguo; Xue, Wen; Wu, Junyong; Chen, Jiejing; Dai, Yong

    2014-09-01

    Immunoglobulin A nephropathy (IgAN) is a complex trait regulated by the interaction among multiple physiologic regulatory systems and probably involving numerous genes, which leads to inconsistent findings in genetic studies. One possibility of failure to replicate some single-locus results is that the underlying genetics of IgAN nephropathy is based on multiple genes with minor effects. To learn the association between 23 single nucleotide polymorphisms (SNPs) in 14 genes predisposing to chronic glomerular diseases and IgAN in Han males, the 23 SNPs genotypes of 21 Han males were detected and analyzed with a BaiO gene chip, and their associations were analyzed with univariate analysis and multiple linear regression analysis. Analysis showed that CTLA4 rs231726 and CR2 rs1048971 revealed a significant association with IgAN. These findings support the multi-gene nature of the etiology of IgAN and propose a potential gene-gene interactive model for future studies.

  1. HLA-DRB1 shared epitope-dependent DR-DQ haplotypes are associated with both anti-CCP-positive and -negative rheumatoid arthritis in Chinese Han.

    Directory of Open Access Journals (Sweden)

    Xu Liu

    Full Text Available The association between Human Leukocyte Antigen (HLA class II and rheumatoid arthritis (RA has been extensively studied, but few reported DR-DQ haplotype. Here we investigated the association of HLA-DRB1, DQA1, DQB1, and DR-DQ haplotypes with RA susceptibility and with anti-CCP antibodies in 281 RA patients and 297 control in Han population. High-resolution genotyping were performed. The HLA-DRB1 shared epitope (SE-encoding allele *0405 displayed the most significant RA association (P = 1.35×10(-6. The grouped DRB1 SE alleles showed great association with RA (P = 3.88×10(-13. The DRB1 DRRAA alleles displayed significant protective effects (P = 0.021. The SE-dependent DR-DQ haplotype SE-DQ3/4/5 remained strong association with both anti-CCP -positive (P = 3.71×10(-13 and -negative RA (P = 3.89×10(-5. Our study revealed that SE alleles and its haplotypes SE-DQ3/4/5 were highly associated with RA susceptibility in Han population. The SE-DQ3/4/5 haplotypes were associated with both anti-CCP positive RA and -negative RA.

  2. Culture- and Immigration-Related Stress Faced by Chinese American Families with a Patient Having Schizophrenia.

    Science.gov (United States)

    Kung, Winnie W

    2016-07-01

    The impact of culture and immigration on the experience of Chinese American families with a member having schizophrenia is explored within the frameworks of family systems and stress and coping. This qualitative study was conducted within an intervention study of family psychoeducation using therapists' session notes from 103 family sessions and 13 relatives' group sessions from nine patients and 19 relatives. The high stigma attached to mental illness leading to social isolation, and families' devotion to caregiving exacerbated caregiver burden. Taboo against discussing dating and sexuality and the consideration of arranged marriages caused unique stress. The insecurity as immigrants and shortage of bilingual services were related to greater enmeshment within these families. Implications on research methodology and practice are discussed. © 2015 American Association for Marriage and Family Therapy.

  3. Work-family conflict and burnout among Chinese female nurses: the mediating effect of psychological capital.

    Science.gov (United States)

    Wang, Yang; Chang, Ying; Fu, Jialiang; Wang, Lie

    2012-10-29

    Burnout among nurses not only threatens their own health, but also that of their patients. Exploring risk factors of nurse' burnout is important to improve nurses' health and to increase the quality of health care services. This study aims to explore the relationship between work-family conflict and burnout among Chinese female nurses and the mediating role of psychological capital in this relationship. This cross-sectional study was performed during the period of September and October 2010. A questionnaire that consisted of the Maslach Burnout Inventory-General Survey (MBI-GS), the work-family conflict scale and the psychological capital questionnaire (PCQ-24) scale, as well as demographic and working factors, was distributed to nurses in Liaoning province, China. A total of 1,332 individuals (effective response rate: 78.35%) became our subjects. Hierarchical linear regression analyses were performed to explore the mediating role of psychological capital. Both work interfering family conflict and family interfering work conflict were positively related with emotional exhaustion and cynicism. However, work interfering family conflict was positively related with professional efficacy whereas family interfering work conflict was negatively related with it. Psychological capital partially mediated the relationship of work interfering family conflict with emotional exhaustion and cynicism; and partially mediated the relationship of family interfering work conflict with emotional exhaustion, cynicism and professional efficacy. Work-family conflict had effects on burnout and psychological capital was a mediator in this relationship among Chinese nurses. Psychological capital was a positive resource for fighting against nurses' burnout.

  4. The validity and reliability of a Chinese version of the family burden interview schedule.

    Science.gov (United States)

    Chien, Wai-Tong; Norman, Ian

    2004-01-01

    The caregiver burden within the family is one of the most commonly used outcome variables in research studies of patient care provision. However, few measures of family caregiver burden have been validated for use with Asian populations. To examine the reliability and validity of the Chinese version of the Family Burden Interview Schedule. The first phase of the investigation involved translation and back translation of the measure for burden and a review by an expert panel. In this phase, equivalence between the Chinese and English versions, content validity, and test-retest reliability of the Family Burden Interview Schedule were assessed using a sample including 30 family caregivers of mental patients. The second phase established the internal consistency and construct validity of the scale using a sample comprising 185 family caregivers of patients with schizophrenia. Sensitivity of the scale for families of schizophrenic patients was examined through comparison with 40 caregivers of patients who had major affective disorder. The Chinese version of the Family Burden Interview Schedule adequately addressed the original concepts and dimensions, achieving 96% on the Content Validity Index. These results demonstrated high levels of equivalence with the original English version (intra-class correlation [ICC] of .87 for the overall scale and.80-.89 for the six domains). It also demonstrated a high internal consistency (Cronbach alpha of .87 for the scale and .78-.88 for the domains) and adequate test - retest response stability (r = .83 for the scale and r = .88-.92 for the domains). The mean scores for the overall scale and domains of the Family Burden Interview Schedule differed significantly between the family providers of care for the two illness groups and between the groups with high and low time involvement in caregiving. The principal components analysis showed the presence of five factors that together explained 65.85% of the variance. It also demonstrated

  5. Lack of association between vitamin D receptor polymorphisms ApaI (rs7975232 and BsmI (rs1544410 and osteoporosis among the Han Chinese population: A meta-analysis

    Directory of Open Access Journals (Sweden)

    Meng Yu

    2016-12-01

    Full Text Available In this study, we aimed to assess the relationship between vitamin D receptor gene polymorphisms and osteoporosis in the Han Chinese population. Articles regarding associations between vitamin D receptor polymorphisms (ApaI rs7975232 and BsmI rs1544410 and osteoporosis were retrieved from databases in November 2014. Eligible studies were tested by the Hardy–Weinberg equilibrium. The odds ratio and 95% confidence interval (95% CI were analyzed to evaluate the strength of the associations. Pooled effect estimates were derived using a fixed-effect model and a random-effect model according to the heterogeneity of the test results. A subgroup analysis by study type and a sensitivity analysis based on studies that conform to the Hardy–Weinberg equilibrium and studies with postmenopausal women as participants were performed. This meta-analysis involved 15 eligible studies including 1580 cases and 1389 controls. The pooled estimated odds ratios in the dominant and additive genetic models were 0.73 (95% CI: 0.46–1.14, p=0.17 and 1.01 (95% CI: 0.77–1.33, p=0.81, respectively, for rs7975232 and 1.01 (95% CI: 0.81–1.26, p=0.91 and 1.01 (95% CI: 0.77–1.33, p=0.92, respectively, for rs1544410. The subgroup analysis showed that regardless of the dominant or additive genetic model, the effect of pooled odds ratios for rs7975232 and rs1544410 was insignificant. The sensitivity analysis also showed that the pooled effect was not significantly changed. In conclusion, no evidence of association is apparent between polymorphisms of vitamin D receptor genes and osteoporosis risk in the Han Chinese population.

  6. Molecular analysis and phenotypic study in 14 Chinese families with Bietti crystalline dystrophy.

    Directory of Open Access Journals (Sweden)

    Houfa Yin

    Full Text Available To investigate the clinical features and cytochrome P450 family 4 subfamily V polypeptide 2 (CYP4V2 gene mutations in 14 Chinese families with Bietti crystalline dystrophy (BCD.Seventeen patients from 14 unrelated Chinese families with BCD were recruited for complete clinical ophthalmic examination and genetic study. The 11 exons of CYP4V2 were amplified from genomic DNA of all patients and their family members by polymerase chain reaction (PCR and then sequenced. Exons of TIMP3 were also sequenced in BCD patient associated with choroidal neovascularization (CNV. One hundred and seventy unrelated healthy Chinese subjects were screened for mutations in CYP4V2.All 17 patients with BCD had mutations in CYP4V2; one of these mutations was novel (c.219T>A, p.F73L and four other mutations had been reported. The p.F73L mutation was a commonly detected mutation in our study (seven out of 34 alleles, either in the homozygous state or in the heterozygous state. Among the patients, considerable phenotypic variability was detected, both within and between families. Screening of TIMP3 did not find any mutation in the BCD patient associated with CNV.The novel CYP4V2 c.219T>A (p.F73L mutation may be another recurrent mutation in Chinese patients with BCD. Our study expands the mutation spectrum of CYP4V2 and characterizes novel genotype-phenotype associations in Chinese patients with BCD.

  7. Depressive Symptoms, Family Functioning and Quality of Life in Chinese Patients with Type 2 Diabetes.

    Science.gov (United States)

    Wang, Jikun; He, Ming; Zhao, Xudong

    2015-12-01

    Patients with type 2 diabetes mellitus often have depression or depressive symptoms, impaired family functioning and poor quality of life. This study aimed to examine relationships among psychological variables, including depressive symptoms, family functioning and quality of life, for Chinese patients with type 2 diabetes and to explore the influencing factors on quality of life for these patients. In this cross-sectional study, 257 patients with type 2 diabetes and 259 nondiabetic community controls completed the Beck Depression Inventory, the Family Assessment Device, and the Quality of Life Enjoyment and Satisfaction Questionnaire-Short Form. Patients with type 2 diabetes reported significant family impairment in the dimension of affective involvement compared with nondiabetic community controls (pFamily Assessment Device scores were negatively associated with quality of life scores among patients with type 2 diabetes. Age, depressive symptoms, duration of diabetes, communication, affective involvement and behavioural control were associated with quality of life in patients with type 2 diabetes. The results indicate that having type 2 diabetes was associated with some difficulties with family functioning and that poor family functioning was associated with a poorer quality of life. Additional factors, including older age, depressive symptoms, duration of diabetes, and some dimensions of family functioning, were found to be associated with quality of life in Chinese individuals with type 2 diabetes. Copyright © 2015 Canadian Diabetes Association. Published by Elsevier Inc. All rights reserved.

  8. Trinucleotide repeat expansion of spinocerebellar ataxia (SCA1) found in a Chinese family.

    Science.gov (United States)

    Cai, T; Yu, P; Chen, X; Lopa, M

    1998-02-01

    To investigate the gene mutation and the ratio of the spinocerebellar ataxia type 1 (SCA1) in Chinese patients with autosomal dominant spinocerebellar ataxia (ADSCA). The family material and DNA samples were collected from thirteen families with ADSCA. To determine the characteristics of the CAG trinucleotide repeats in SCA1 gene, the PCR products of the Rep1 and Rep2 primers were analyzed, and the bands with CAG repeat expansion were cloned by PCR2. 1 vector and sequenced. One family was found to have an expanded CAG repeat in the 13 families with ADSCA. The clinically affected individual was heterozygous with one disease allele being 55 CAG repeats, whereas the mean size of the CAG repeats on 104 chromosomes generated from unrelated control Chinese individuals is 29.3 (ranging from 18 to 34). The frequency of the SCA1 mutation is about 7% in the 13 Chinese families with ADSCA, suggesting that this type of genetic defect is not the main cause involved in the pathogenesis of ADSCA in China. Since the mutation has also been found in Caucasian, Japanese, Malaysian, and Bangladeshi kindreds, it is suggested that this genetic defect may well have multiple origins in different ethnic groups.

  9. Family and social environmental factors associated with aggression among Chinese adolescents.

    Science.gov (United States)

    Dou, Chunxia; Wei, Zhen; Jin, Ke; Wang, He; Wang, Xiulan; Peng, Ziwen

    2015-09-01

    Family and school environments are assumed to be associated with and influence aggressive behaviors. However, which specific risk factors within these environments that are associated with aggressive behavior are unclear. The goal of this study is to identify family and social environmental qualities that are related to aggression among Chinese adolescents. Survey data were obtained from 3,213 randomly selected urban high school students ages 10 through 18 in southern China. Lower parental attachment, higher family income, mother's higher education levels, father's parenting goals, rough or changeable parenting styles, unsuitable peer relationships, and inadequate social atmospheres at school serve as risk factors for aggression among Chinese adolescents. Our findings provide some implications for understanding aggression among adolescents and suggests possible interventions to help overcome potential environmental risk factors and thus to prevent aggressive behavior in school. (c) 2015 APA, all rights reserved).

  10. Association between Family Structure and Physical Activity of Chinese Adolescents

    Directory of Open Access Journals (Sweden)

    Lijuan Wang

    2016-01-01

    Full Text Available Background. This study examines the association between family structure and moderate-to-vigorous physical activity (MVPA of adolescents in China. Methods. The participants included 612 adolescents (317 boys and 295 girls from Shanghai with ages ranging from 10 to 16 years. Accelerometers were used to measure the duration of MVPA of adolescents, and questionnaires on family structure were completed by the parents of these adolescents. Results. Findings suggested that family structure significantly increased the likelihood of adolescents engaging in physical activity (PA and explained 6% of MPVA variance. Adolescents living in single-parent households and step families were more physically active than those living in two-parent homes and with biological parents, respectively. However, adolescents residing with grandparents were less active than those living with neither grandparent. No significant difference was found in MVPA time between adolescents living with one sibling and those without siblings. Conclusion. Family environment may be considered in the development of PA interventions and policies, and adolescents living with their grandparents may be targeted in PA promotion.

  11. Association of the plasminogen activator inhibitor-1 (PAI-1) Gene -675 4G/5G and -844 A/G promoter polymorphism with risk of keloid in a Chinese Han population.

    Science.gov (United States)

    Wang, Yongjie; Long, Jianhong; Wang, Xiaoyan; Sun, Yang

    2014-10-28

    A keloid is pathological scar caused by aberrant response to skin injuries, characterized by excessive accumulation of histological extracellular matrix, and occurs in genetically susceptible individuals. Plasminogen activator inhibitor-1 (PAI-1) has been implicated in the pathogenesis of keloid. We investigated the association between PAI-1 polymorphisms and plasma PAI-1 level with keloid risk. A total of 242 Chinese keloid patients and 207 controls were enrolled in this study. Polymerase chain reaction-restriction technique was used to determine PAI-1 promoter polymorphism (-675 4G/5G and -844 A/G) distribution. Plasma PAI-1 levels were detected using enzyme-linked immunosorbent assay (ELISA). There was a statistically significant difference in the distribution of PAI-1 -675 4G/5G polymorphism between keloid patients and healthy controls. 4G/4G carriers were more likely to develop keloid. In contrast, the -844 A/G polymorphism distribution did not vary significantly between keloid patients and controls. The keloid patients group had a significantly higher plasma PAI-1 level than the control group. In the -675 4G/4G carrier population, the plasma PAI-1 levels were significant higher in keloid patients compared with controls. Our study provides evidence that PAI-1 promoter polymorphism -675 4G/5G and plasma PAI-1 level are associated with keloid risk. PAI-1 -675 4G/5G polymorphism may be an important hereditary factor responsible for keloid development in the Chinese Han population.

  12. Polymorphisms in Four Genes (KCNQ1 rs151290, KLF14 rs972283, GCKR rs780094 and MTNR1B rs10830963) and Their Correlation with Type 2 Diabetes Mellitus in Han Chinese in Henan Province, China.

    Science.gov (United States)

    Gao, Kaiping; Wang, Jinjin; Li, Linlin; Zhai, Yujia; Ren, Yongcheng; You, Haifei; Wang, Bingyuan; Wu, Xuli; Li, Jianna; Liu, Zichen; Li, Xiong; Huang, Yaxin; Luo, Xin-Ping; Hu, Dongsheng; Ohno, Kinji; Wang, Chongjian

    2016-02-26

    Genetic variants at KCNQ1 rs151290, KLF14 rs972283, GCKR rs780094 and MTNR1B rs10830963 have been associated with type 2 diabetes mellitus (T2DM), but the results are contradictory in Chinese populations. The aim of the present study was to investigate the association of these four SNPs with T2DM in a large population of Han Chinese at Henan province, China. Seven-hundred-thirty-six patients with T2DM (cases) and Seven-hundred-sixty-eight healthy glucose-tolerant controls were genotyped for KCNQ1 rs151290, KLF14 rs972283, GCKR rs780094 and MTNR1B rs10830963. The association of genetic variants in these four genes with T2DM was analyzed using multivariate logistic regression. Genotypes and allele distributions of KCNQ1 rs151290 were significantly different between the cases and controls (p KCNQ1 were associated with increases risk of T2DM before (OR = 1.482, 95% CI = 1.062-2.069; p = 0.021; OR = 1.544, 95% CI = 1.097-2.172, p = 0.013; and OR = 1.509, 95% CI = 1.097-2.077, p = 0.011, respectively) and after (OR = 1.539, 95% CI = 1.015-2.332, p = 0.042; OR = 1.641