WorldWideScience

Sample records for hamburg saksimaa thringen

  1. Hamburger hazards and emotions

    DEFF Research Database (Denmark)

    Olsen, Nina Veflen; Røssvoll, Elin; Langsrud, Solveig

    2014-01-01

    Previous studies indicate that many consumers eat rare hamburgers and that information about microbiological hazards related to undercooked meat not necessarily leads to more responsible behavior.With this study we aim to investigate whether consumers’ willingness to eat hamburgers depends...... on the emotions they experience when confronted with the food. A representative sample of 1046 Norwegian consumers participated in an online experiment. In the first part, participants were randomly divided into two groups. One group was confronted with a picture of a rare hamburger, whereas the other group...... was confronted with a picture of a well-done hamburger. The respondents were instructed to imagine that they were served the hamburger on the picture and then to indicate which emotions they experienced: fear, disgust, surprise, interest, pleasure, or none of these. In part two, all respondents were confronted...

  2. Hamburger hazards and emotions.

    Science.gov (United States)

    Olsen, Nina Veflen; Røssvoll, Elin; Langsrud, Solveig; Scholderer, Joachim

    2014-07-01

    Previous studies indicate that many consumers eat rare hamburgers and that information about microbiological hazards related to undercooked meat not necessarily leads to more responsible behavior. With this study we aim to investigate whether consumers' willingness to eat hamburgers depends on the emotions they experience when confronted with the food. A representative sample of 1046 Norwegian consumers participated in an online experiment. In the first part, participants were randomly divided into two groups. One group was confronted with a picture of a rare hamburger, whereas the other group was confronted with a picture of a well-done hamburger. The respondents were instructed to imagine that they were served the hamburger on the picture and then to indicate which emotions they experienced: fear, disgust, surprise, interest, pleasure, or none of these. In part two, all respondents were confronted with four pictures of hamburgers cooked to different degrees of doneness (rare, medium rare, medium well-done, well-done), and were asked to state their likelihood of eating. We analyzed the data by means of a multivariate probit model and two linear fixed-effect models. The results show that confrontation with rare hamburgers evokes more fear and disgust than confrontation with well-done hamburgers, that all hamburgers trigger pleasure and interest, and that a consumer's willingness to eat rare hamburgers depends on the particular type of emotion evoked. These findings indicate that emotions play an important role in a consumer's likelihood of eating risky food, and should be considered when developing food safety strategies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Hamburg kui hiiglaslik ehitustander

    Index Scriptorium Estoniae

    2003-01-01

    6. novembrist Eesti Arhitektuurimuuseumis Rotermanni soolalaos näitus "arcHH - Architektur made in Hamburg", mis esitleb Hamburgi arhitektide viimase viie aasta loomingut. Näituse koostaja Dirk Meyhöfer, arhitekt Michael Karassowitch

  4. History of the Expansion of Hamburg City and IBA Hamburg

    OpenAIRE

    北澤, 恒人

    2012-01-01

    本稿では、まずドイツのハンブルク市を対象として、その住民数の増加と市域の拡大を歴史的に跡づけ、これをヨーロッパの都市の一類型として考察する。次に、現在抱えている都市問題を解決するためにハンブルク市が採用した展覧会という手法を紹介する。すなわち2013年度に全プロジェクトが終結するハンブルク国際建築展覧会(IBA Hamburg)と、同時に開催される国際園芸博覧会(IGS 2013)の二つであるが、これには自然破壊だとの批判も出されている。...

  5. Optimum use of CDOT French and Hamburg data (French and Hamburg tests).

    Science.gov (United States)

    2013-11-01

    The Colorado Department of Transportation (CDOT) has been collecting data from the Hamburg Rutter and the : French Rutter for over 20 years. No specifications have been written in that time for either the Hamburg Rutter : or the French Rutter. This r...

  6. Climate change experiments in Hamburg

    Energy Technology Data Exchange (ETDEWEB)

    Gubasch, U. [DKRZ, Hamburg (Germany)

    1995-12-31

    Nowadays the anthropogenic climate change is been simulated world wide with a fair number of coupled ocean atmosphere general circulation models (IPCC, 1995). Typical model problems do not only blur the estimates of the anthropogenic climate change, but they also cause errors in the estimates of the natural variability. An accurate representation of the natural variability of the climate system is, however, essential for the detection of the anthropogenic climate change. All model simulations world wide show, even though they differ considerably in their technical details and the experimental setup and the forcing data, similar amplitudes and pattern of the predicted climate change. In the model world it is already at the beginning of the next century possible to detect the anthropogenic climate change in the global mean. If the model results are applied in a `fingerprint analysis`, then it is possible to prove that the climate change during the last 30 years is with a significance of 95 % larger than any other climate change during the last 100 years. The experiments performed in Hamburg show that the experimental conditions are of great importance for the estimate of the future climate. The usual starting point of most of the simulations with present day conditions (1980-1990) is too late, because then a considerable part of the warming since the beginning of the industrialization (ca. 1750) has been neglected. Furthermore it has only recently become clear that the sulphat-aerosols play an important role in the present day climate and in the future climate. The effect of the sulphat aerosols has first been simulated in a number of equilibrium simulations with mixed layer models, but nowadays with globally coupled ocean-atmosphere circulation models

  7. Mosquitoes (Diptera: Culicidae) of metropolitan Hamburg, Germany.

    Science.gov (United States)

    Krüger, A; Börstler, J; Badusche, M; Lühken, R; Garms, R; Tannich, E

    2014-08-01

    In Europe, mosquito-related public health concerns are growing due to the increasing spread of invasive mosquito species and the recent emergence of mosquito-borne arboviruses. A vital backbone in the assessment of these issues is detailed knowledge of the mosquito fauna, i.e. regional mosquito inventories. It was therefore decided to intensify nationwide investigations on the occurrence and distribution of mosquitoes in Germany in order to update old records and to detect possible faunal changes. This paper is focussing on a densely populated metropolitan region, the federal state of Hamburg and its adjacent environs, taking two historical baseline inventories into consideration, spanning almost 100 years of mosquito research in Hamburg. In the period between 2010 and 2014, more than 10,000 juvenile, neonate and adult mosquito specimens were sampled and trapped at 105 sites in Hamburg and its environs, of which about 60% have been identified to species level, resulting in a total of 33 recorded species. Of these, Anopheles algeriensis, Culex modestus, Ochlerotatus caspius, Ochlerotatus nigrinus and Ochlerotatus sticticus are new to the area. The most common species in Hamburg are Culex pipiens/torrentium and Ochlerotatus annulipes/cantans. In contrast, two previously common species, Anopheles atroparvus and Ochlerotatus excrucians, were not detected. Despite substantial environmental changes due to reconstruction, urbanisation and renaturation in the Hamburg metropolitan region in recent decades, there has been remarkably little change within the mosquito fauna during the last century.

  8. Nitrite in hamburgers in Arak, Iran.

    Science.gov (United States)

    Rezaei, Mohammad; Shariatifar, Nabi; Jahed Khaniki, Gholamreza; Javadzadeh, Morteza

    2013-01-01

    Nitrite and nitrate are used as additives in meat products to provide colour, taste and protection against micro-organisms, but excessive use of these substances can be toxic and can cause carcinogenesis in man. Natural and organic foods are not permitted to use chemical preservatives, the traditional curing agents used for cured meats, and so nitrate and/or nitrite cannot be added to hamburgers. This study aimed to measure nitrite in hamburgers sold in Arak city, in the centre of Iran, in 2011. For this purpose, 105 samples were randomly selected and analysed according to Official AOAC Method 973. The residual nitrite in the samples was 30-100 mg/kg (p < 0.001). In 85.7% of the samples, presence of nitrite was demonstrated, which suggests unfavourable production conditions and poor sodium nitrite standards at hamburger factories.

  9. Hamburg: privaatrechtelijk paradijsje aan de Aussenalster

    NARCIS (Netherlands)

    Hondius, E.H.

    2005-01-01

    In dit verslag wil ik mij beperken tot een beschrijving van mijn ervaringen aan het Max Planck Institut te Hamburg. Dat instituut telt een kleine honderd 'vaste' juridische onderzoekers, voornamelijk uit Duitsland, maar ook uit Frankrijk, Griekenland, Iran, Italië en Rusland. Nederlandse

  10. [psychenet - The Hamburg Network for Mental Health].

    Science.gov (United States)

    Härter, Martin; Brandes, Andreas; Hillebrandt, Bernd; Lambert, Martin

    2015-07-01

    With the research and development project psychenet: the Hamburg Network for Mental Health (2011 - 2015), the Federal Ministry of Education and Research contributes to strengthening healthcare regions in Germany by establishing new transsectoral cooperations and implementing evaluated innovations. More than 300 partners from research, health care, health industry and government in the Free and Hanseatic City of Hamburg are promoting innovative measures to improve the detection, diagnosis, and treatment for mental disorders. The main objective is to implement integrated healthcare networks based on evidence for effective treatment methods, deriving from high-quality research throughout five indications such as psychosis, depression, somatoform and functional syndromes, anorexia and bulimia and addiction illnesses in adolescence. Those networks are accompanied by additional measures, for example, for improving awareness, information and education for mental health, addressing occupational health or strengthening the participation of patients and their families suffering from mental illness. © Georg Thieme Verlag KG Stuttgart · New York.

  11. HAMBURG ENERGIE makes biogas plants fit for the balancing energy market; HAMBURG ENERGIE macht Biogasanlagen fit fuer den Regelenergiemarkt

    Energy Technology Data Exchange (ETDEWEB)

    Timmann, Bernd [HAMBURG ENERGIE, Hamburg (Germany). Direktvermarktung und Regelenergie; Bettinger, Carola [HAMBURG ENERGIE, Hamburg (Germany). Forschungsprojekt SMART POWER HAMBURG

    2013-04-15

    HAMBURG ENERGIE GmbH (Hamburg, Federal Republic of Germany) bundles 40 biogas plants with a total capacity of 15 megawatts to a virtual power plant. Thus, also small, decentralized plants may offer negative balancing power and achieve additional profits that were previously available only to large producers. In the medium term, HAMBURG ENERGIE wants to place a performance of 150 MW on the market.

  12. Dalbybogen / The Dalby Book. Angersfragmentet / The Angers Fragment. Hamburgbibelen / The Hamburg Bible

    DEFF Research Database (Denmark)

    Petersen, Erik

    2006-01-01

    Dalbybogen / The Dalby Book; Angersfragmentet / The Angers Fragment; Hamburgbibelen / The Hamburg Bible......Dalbybogen / The Dalby Book; Angersfragmentet / The Angers Fragment; Hamburgbibelen / The Hamburg Bible...

  13. Climate Education at the University of Hamburg

    Science.gov (United States)

    Dilly, Oliver; Stammer, Detlef; Pfeiffer, Eva-Maria

    2010-05-01

    The new graduate School of Integrated Climate Sciences (www.sicss.de) at the KlimaCampus of the University of Hamburg was opened at October 20, 2009 and includes a 2-yr MSc (120 ECTS, 30 compulsory, 90 eligible) and 3-yr doctoral program (12 ECTS). About 40 students were enrolled in early 2010. The interdisciplinary MSc program is based on a number of disciplines such as meteorology, geophysics, oceanography, geosciences and also economics and social sciences. These disciplines are required to address the faced key issues related to climate change effectively. The graduate school is guiding pupils and BSc students with competence in maths and physics on how to become a climate expert. Acquisition is done internationally at fairs, uni days and dircectly at schools and intuitions for higher education. BSc degree in the disciplines listed above is set for positive application. Climate experts are needed for both research and the professional world outside the university and research institutions. In accordance, connection within and outside the university are continuously explored and soft skills for the communication to politics and the public's are included in the MSc and PhD curricula. Since the graduate school was established within the cluster of excellence ‘Integrated Climate Analysis and Predication' (www.clisap.de), this school represents a prototype for graduate programs at the University of Hamburg. Advantages and limitations of this Climate System School concept will be discussed.

  14. The End of Hamburg's Anglophilia: Wilhelmine Hamburg Attitudes Viewed through School Examination Essays and a University Lecture (1912-1914)

    Science.gov (United States)

    Gärtner, Niko

    2014-01-01

    Late nineteenth-century German-English rivalry changed attitudes in Hamburg. Previously, the once fiercely independent city and its burgeoning mercantile middle class had developed an Anglophilia that justified Hamburg being labelled a "London suburb" and "the most British town on the Continent". The affinity for all things…

  15. The Art of Memory: "Social Bookmarking Hamburg"

    Directory of Open Access Journals (Sweden)

    Noga Stiassny

    2018-02-01

    Full Text Available At the end of November 2016, a unique and intruding art project took place in the city of Hamburg, Germany, a result of collaboration between German artists and a Chinese artist, who all seek to commemorate the Chinese victims who lived in the city pre- World War II but had to suffer the injustices of the Nazi regime. The project lasted three days and was presented in various locations throughout the city, while including many artistic mediums alongside scholarly work. By referring to the main events of that weekend, the paper traces after a “forgotten” past that many people refuse to look at, not to say to take responsibility for it, while in contrast, the art continues to extract it from the depths of oblivion and forced amnesia – to the dismay of many.

  16. Evaluation of bias in the Hamburg wheel tracking device.

    Science.gov (United States)

    2013-09-01

    As the list of states adopting the Hamburg Wheel Tracking Device (HWTD) continues to grow, there is a need to evaluate how results are utilized. American Association of State Highway and Transportation Officials T 324 does not standardize the analysi...

  17. Learning by Doing: Science Education at the Hamburg Observatory

    Science.gov (United States)

    Wolfschmidt, Gudrun

    2015-01-01

    In my contribution I would like to offer three different examples: the activities of the association "Förderverein Hamburger Sternwarte", science education in the "astronomy workshop", and the teaching of the history of science and technology for university students.

  18. Molecular Assay for Fraud Identification of Handmade Hamburgers

    Directory of Open Access Journals (Sweden)

    Gilda Eslami

    2014-11-01

    Full Text Available Background: Meat products could be sources of enter pathogens. Identification of meat species in different foods could help us in molecular epidemiological studies of pathogens transmitted by meat. Objectives: In this study, we targeted cytochrome b for identification of beef in handmade hamburgers. Patients and Methods: A total of 110 raw handmade hamburgers were collected from different areas of Yazd city, Iran, during spring of 2013. Genomic DNA was extracted using the salting out method. The beef cytochrome b gene was amplified using specific primers. Analysis of the amplicons was done with agarose gel electrophoresis usinga100 base pair (bp DNA ladder. Results: The results showed that among the 110 handmade hamburger samples, 10 (9.09% samples did not containany cow meat while 100 samples contained cow meat. Conclusions: We used an appropriate molecular method for controlling raw and processed products. Therefore, this study would be useful for control of correct labeling and protection of consumer’s rights.

  19. [Health Economic Evaluations within the Hamburg Network for Mental Health].

    Science.gov (United States)

    König, Hans-Helmut; Grochtdreis, Thomas; Brettschneider, Christian

    2015-07-01

    Within the Hamburg Network for Mental Health, cost-effectiveness analyses of collaborative care models are conducted. After providing an overview of the international literature on the cost-effectiveness of collaborative care for mental disorders, this article describes the rationale, aims and methods of the cost-effectiveness analyses conducted within the Hamburg Network for Mental Health. Proof of cost-effectiveness is expected to promote the transfer of collaborative care models into routine care. © Georg Thieme Verlag KG Stuttgart · New York.

  20. Contents of polycyclic aromatic hydrocarbons (PAH) in Hamburg`s upper soil; Gehalte an polycyclischen aromatischen Kohlenwasserstoffen (PAK) in Hamburger Oberboeden

    Energy Technology Data Exchange (ETDEWEB)

    Gras, B.; Jaeger, C.; Sievers, S.

    1996-11-01

    In 1993/95, a programme of investigations covering the area of Hamburg was carried out to determine the content of polycyclic aromatic hydrocarbons (PAH) in the upper soil. This programme of measurements was intended to give an overview of the general loading situation in an inhabited area and to show main points of loading. One also intended to consider how great the effect of the type of use of an area is on the PAH contents and whether information on the sources can be derived from the PAH patterns. Soil mixture samples were taken from depths of 0-10 cm and in worked areas from depths of 0-30 cm at 108 sites distributed over the city area of Hamburg, and these were examined for 19 individual PAH materials (PAH (EPA) plus 1 and 2 methyl naphthalene and Benzopyrene). Differently exposed and used sites were included in this programme. Industrial, traffic, residential areas, small gardens, agriculture, flood meadows, woods/parks, nature protection and other green areas (fallow land, meadows). (orig.) [Deutsch] 1993/95 wurde in Hamburg ein flaechendeckendes Untersuchungsprogramm zur Ermittlung der Gehalte an polycyclischen aromatischen Kohlenwasserstoffen (PAK) in Oberboeden durchgefuehrt. Dieses Messprogramm sollte einen Ueberblick ueber die generelle Belastungssituation in einem Ballungsraum geben und ggfs. Belastungsschwerpunkte aufzeigen. Es sollte ausserdem betrachtet werden, wie gross der Einfluss der jeweiligen Nutzungsart einer Flaeche auf die PAK-Gehalte ist und ob sich aus den PAK-Mustern in Oberboeden Hinweise auf Quellen ableiten lassen. An 108 Standorten verteilt ueber das Hamburger Stadtgebiet wurden aus 0-10 cm und bei bearbeiteten Flaechen aus 0-30 cm Tiefe Bodenmischproben entnommen und auf 19 PAK-Einzelstoffe untersucht (PAK(EPA) zzgl. 1- und 2-Methylnaphthalin sowie Benzo(e)pyren). In das Programm wurden unterschiedlich exponierte und genutzte Standorte einbezogen: Industrie, Verkehr, Wohngebiete, Kleingaerten, Landwirtschaft

  1. A New Type of German University Takes Root in Hamburg.

    Science.gov (United States)

    Bollag, Burton

    1999-01-01

    The Technical University of Hamburg-Harburg (Germany), a member of a new European consortium of innovative universities, has been broadening its revenue base by conducting research and training for industry and local government and marketing the technical advances developed in its own laboratories. An interdisciplinary approach to research is…

  2. Review and analysis of Hamburg Wheel Tracking device test data.

    Science.gov (United States)

    2014-02-01

    The Hamburg Wheel Tracking Device (HWTD) test (TEX-242-F) and the Kansas Test Method KT-56 (KT-56), or : modified Lottman test, have been used in Kansas for the last 10 years or so to predict rutting and moisture damage potential of : Superpave mixes...

  3. Community Participation in School Management: A Parent's Eye View (Hamburg).

    Science.gov (United States)

    Aviner, Saronet

    1980-01-01

    Describes the management of the International School in Hamburg, West Germany, which serves children from 42 countries, and the school's attempts to formulate a workable curriculum responsive to heterogeneous needs and frequent changes in the national composition of the student body. (SJL)

  4. Development of hamburger using full fat soybean flour | Igene ...

    African Journals Online (AJOL)

    This study determined the level of soy flour appropriate for hamburger (beef patties) production. They were formulated to contain 0%, 10%, 15% and 20% of soy flour respectively with some flavouring agents. A 5-point hedonic scale was used to investigate the sensory characteristics of products in terms of juiciness, colour, ...

  5. Lepton Photon conference - Hamburg 17-22 August

    CERN Multimedia

    PH Department

    2009-01-01

    An easier registration procedure has been recently set up for the Lepton Photon conference, to be held in Hamburg, Germany from 17 to 22 August. To sign up, simply send an email to lp09@desy.de and request an invitation. For more details, check the website http://lp09.desy.de/

  6. Insecure Identities: Unaccompanied Minors as Refugees in Hamburg

    Science.gov (United States)

    Schroeder, Joachim

    2012-01-01

    This paper analyses the financial circumstances and social income of nearly one hundred unaccompanied minors who have come to Hamburg as refugees from various regions of Africa. It is based on extensive qualitative surveys, analysing their objective conditions of life and in particular their legal situation. A wide range of interview material and…

  7. Change of traction voltage in 100 years of the Hamburg city railway; Traktionsspannungswechsel in 100 Jahren S-Bahn Hamburg

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, H. [S-Bahn Hamburg GmbH, Hamburg (Germany)

    2007-07-01

    In its 100-year history the Hamburg city railway was operated with a.c. voltage in the beginning and with a.c. voltage later on. There were numerous attempts at changing back the currently used type of voltage before finally a Solomonic solution was found with the introduction of dual-current vehicles. (orig.)

  8. Misconceived Traditions: On the dispute between Ingarden, Wellek and Hamburger

    Directory of Open Access Journals (Sweden)

    Gerardo Argüelles Fernández

    2017-03-01

    Full Text Available This paper deals with the recovery of the phenomenological and ontological legacy of Roman Ingarden given the controversies of his work with prestigious names in literature theory such as René Wellek and Käte Hamburger. This is in order to defend Ingarden’s aesthetic theory which, according to my premises, has not been properly recognized in the framework of traditional knowledge of contemporary literary theories

  9. [Pathways leading to work--the Hamburg integration specialty service].

    Science.gov (United States)

    Marquardt, U

    2001-06-01

    A model project of the Federal Ministry of Labour and Social Affairs, the Hamburg Integrationsfachdienst zur Eingliederung Schwerbehinderter (IFD Hamburg, selective placement and support agency for occupational integration of persons with severe disablement) has been active since 1998 in placing people with sensory or physical handicap in the open labour market, based on cooperative partnership between Adecco Dienstleistungen, a market-oriented temporary staff business, and the vocational retraining centre Berufsförderungswerk Hamburg, provider of training programmes for vocational rehabilitation. The IFD combines social competence with business considerations (counselling employers, clarification of wage subsidies or grants, in-depth job analysis, preliminary selection of suitable job seekers). A proactive customer orientation vis-a-vis the prospective employer is the clear message of the IFD's consultants, which hence acts as a professional staff service for severely disabled job seekers in its dealings with the prospective customers, in their majority company decision-makers from small and medium scale firms. Counselling and support offered to the disabled clients are based on a case-management approach, in partnership with the IFD's principals, i.e., employment office, pension insurance fund, industrial injuries insurance institutes, and sometimes also health insurance funds.

  10. Arvi Hamburg : rumal arst võib tappa korraga ühe inimese, rumal insener tuhandeid / Arvi Hamburg ; interv. Taivo Paju

    Index Scriptorium Estoniae

    Hamburg, Arvi, 1948-

    2008-01-01

    Eesti Inseneride Liidu president Arvi Hamburg annab lühiülevaate insenerides arvukusest ja kutsekvalifikatsioonist. Projekt tehnikahariduse ja insenerikutse populaarsuse tõstmiseks. Vt. samas: Lühiülevaade inseneri kutseala kvalifikatsioonitasemetest

  11. Hamburg subway vehicles with new control and traction systems; Hamburger U-Bahn-Fahrzeuge mit neuer Leit- und Antriebstechnik

    Energy Technology Data Exchange (ETDEWEB)

    Polster, H.J.; Lehr, G.; Werner-Wieland, P. [Bombardier Transportation, LRV, Mannheim (Germany)

    2007-07-01

    With a view to testing new technologies for future vehicle series for the Hamburg subway network, the last 17 DT4 cars to be delivered under a current contract were equipped with the latest generation of control and traction systems. A MITRAC control system was installed instead of the MICAS-S type used in the DT4 vehicles delivered before. The GTO converters were replaced by IGBT elements. The concept is designed to allow for the change-over of DT4 vehicles of previous series to the new system. (orig.)

  12. [Acute ethanol intoxication among children and adolescents in Hamburg, Germany].

    Science.gov (United States)

    Stolle, M; Sack, P-M; Spieles, H; Thomasius, R

    2010-09-01

    By using an anonymous postcard reporting system, data of n=358 children, adolescents, and young adults who were treated in 26 emergency departments because of acute alcohol intoxication were collected. The aim of this study was to estimate the prevalence of acute alcohol intoxications in Hamburg, compare these data with the official hospital diagnosis register, and analyze the circumstances that led to the intoxication. A total of 358 cases were reported by the postcard system. Age ranged from 11-21 years, with 64.5% being 14-17 years old. Data were collected in the municipal area of Hamburg during the calendar year of 2008. The percentage of female patients was 65.6% in the age group from 11-17 years and decreased in the age group of patients being 18 years and older. A vast majority of patients were admitted by ambulance and were reported as being a"first offender". On average, male patients showed a higher level of blood alcohol when being admitted (2.02 ‰) than female patients (1.76 ‰). The older the age group, the higher the blood alcohol level. Among drinking circumstances, the situation"drank together with friends" was most frequently reported. In comparison with the official hospital diagnosis register, prevalence was 31.6% higher. This could mean that the prevalence reported in the official hospital diagnosis register is an underestimation of the actual case numbers.

  13. [Health Care for Refugees: Challenges and Opportunities in Hamburg].

    Science.gov (United States)

    Jakubowski, Elke; Rau, Cornelius; Quellhorst, Sibylle; Sothmann, Peter; Plenge-Bönig, Anita; Niessen, Johannes

    2017-08-01

    The massive increase in the number of refugees represents a great challenge to German cities. In Hamburg, 40 868 asylum seekers were registered in 2015, of which 22 315 remained in the city. The goal of the health administration is to provide primary medical care in response to specific health risks and needs of refugees while allowing them to be swiftly integrated into the standard health care system. Public authorities, charities and civil society are working hand in hand. In all reception centres in Hamburg, medical consultations with translation services are offered in fully equipped medical container practices. For every 1 000 refugees, a full-time doctor and a medical assistant are available. In addition to contractual staff, employees of contractually integrated hospitals are participating in the provision of medical care. Systematic collection of data on the health condition of the refugees as well as strengthening public health services are key factors in the planning and improvement of services in the future. Healthier living conditions and access to the standard health care system provide an opportunity to facilitate successful integration of refugees into society. © Georg Thieme Verlag KG Stuttgart · New York.

  14. Operation and organization of Hamburg's S-Bahn; Verkehr und Betrieb der Hamburger S-Bahn

    Energy Technology Data Exchange (ETDEWEB)

    Huettel, M. [S-Bahn Hamburg GmbH, Hamburg (Germany). Projektleitung Stade

    2005-11-01

    Nearly a hundred years have gone by since the first electric regional-express (S-Bahn) trains ran in Hamburg on the line between Blankenese and Ohlsdorf. Much has changed in the operation of this railway system since then: AC traction has been switched to DC, open-saloon trains have replaced compartment multiple units, and drivers are now responsible for supervising their own trains in stations, replacing the former conductors, platform supervisors and central dispatchers. Over the years, the network has grown, thanks to the construction of new lines, and is now more than 110 kilometres long. A further 35 kilometres are to be added in the coming years, and it is interesting to note that the trains will be returning to an AC feed over 32 of them. Other additions to the network are also possible sometime in the future. Since the 1990s the S-Bahn system has been the object of a thorough modernization programme, including new and renovated trains, a modern operations and service centre and new destination indicators and information columns in stations. The operator, S-Bahn Hamburg GmbH, can rightly claim that passengers' interests are at the heart of its investment decisions. (orig.)

  15. [Telematics and quality. Implementation of a telematic platform in Hamburg].

    Science.gov (United States)

    Niemeyer, A; Stettin, J

    2005-07-01

    Since the end of the year 2000 a group of interested people has been working on the subject of quality improvement in breast cancer. Within this framework the project "improvement of breast cancer treatment by telemedicine" was started. Based on a workflow analysis and interviews with patients as well as health professionals, it turned out that there are gaps and flaws in the communication process. These problems occurred between health professionals involved in the treatment of patients and between health professionals and patients as well. As a result a telemedicine network has been developed which is based on MPLS technology. Within this network a central communication unit facilitates optimization of the workflow for the treatment of breast cancer. It will also be possible to set up groups for integrated care. Currently the system is being evaluated in specific breast centres in Hamburg. As the net is based on a positive business plan, it can be foreseen that a broad implementation will follow.

  16. [German Society of Urology Congress, Hamburg and the Presidential Medal].

    Science.gov (United States)

    Albrecht, K; Schultheiss, D

    2017-02-01

    The German Society of Urology (DGU) e. V. meeting has been an integral part of knowledge sharing among national and international experts since 1907. Hamburg was the host city for this meeting nine times (until 2015), including the 47th Annual Meeting of the DGU in 1995 under the presidency of Prof. Dr. U. Jonas (Hannover). As part of the 47th conference, a new insignia in the form of the Presidential Medal was given to the designated successor for the first time. The medal, which is in the form of a chain, was made in a small workshop in Idar-Oberstein, Germany.

  17. Gilles Coignet. A migrant painter from Antwerp and his Hamburg career

    Directory of Open Access Journals (Sweden)

    Barbara Uppenkamp

    2015-12-01

    Full Text Available The painter Gilles Coignet was born in Antwerp c. 1542 to a family of artists and scientists. He spent some time in Italy and, as a Lutheran Protestant, fled from Antwerp to Amsterdam in 1585. He lived in Hamburg since 1595, where he died in December 1599. Here he had contact with other Netherlandish artists. Van Mander reports that it was Coignet who advised Vredeman de Vries to move from Hamburg to Amsterdam in 1598. This contribution focuses on Coignet’s last years and sheds new light on the professional and social networks of exiled Netherlandish artists in Hamburg.

  18. Evaluation of Georgia asphalt mixture properties using a Hamburg wheel-tracking device.

    Science.gov (United States)

    2017-05-01

    This study used a Hamburg Wheel-Tracking Device (HWTD) to evaluate the resistance of Georgia asphalt mixtures to rutting and stripping. It aimed to develop an HWTD test procedure and criteria aligned with GDOTs asphalt materials and mixture design...

  19. Quarterly Costs Of Transporting Brazilian Soybeans From The North And Northeastern Ports To Hamburg, Germany

    Data.gov (United States)

    Department of Agriculture — Quarterly total landed costs (truck and ocean) of shipping Brazilian soybeans through the ports of Santarém and São Luís to Hamburg, Germany. This is table 6 of the...

  20. [Madness and malaria--intersections and boundary blurring between psychiatry and tropical medicine in Hamburg].

    Science.gov (United States)

    Wulf, Stefan; Schmiedebach, Heinz-Peter

    2014-01-01

    The object of this article is to point out and to discuss the significant intersections and boundary blurring between psychiatry and tropical medicine while treating malaria in the German "colonial metropolis" Hamburg. The focus of this study is the Hamburg asylum at Friedrichsberg and the Institute for Maritime and Tropical Diseases (Hamburg Tropical Institute). Under analysis are two groups of patients as well as the means with which their doctors treated them: 1. patients who have been sent back from the German colonies in Africa after mental disorders had been diagnosed, and 2. patients suffering from general paralysis and treated in Friedrichsberg after 1919 using the then newly developed malaria fever therapy (according to Wagner-Jauregg). The implementation of this latter led to an intensification of the cooperation between psychiatry and tropical medicine in Hamburg which prior to this had been only very sporadic.

  1. Die Bedeutung des industriellen Sektors in der Freien und Hansestadt Hamburg

    OpenAIRE

    Kowalewski, Julia; Teuber, Mark-Oliver

    2013-01-01

    Die Hamburger Industrieunternehmen sind ein bedeutender Faktor für die Schaffung und Sicherung von Arbeitsplätzen in der Hansestadt und dem gesamten Umland. Durch eine weitreichende Branchenvielfalt bildet die Hamburger Industrie den vollständigen Wertschöpfungsprozess ab. Zudem leistet sie einen wesentlichen Beitrag zu Einkommens-, Körperschafts- und Kommunalsteuern. Ein besonderer Schwerpunkt der Hansestadt liegt zum Beispiel im Bereich des Luft- und Raumfahrzeugbaus. Aber auch andere, teil...

  2. [Quality of Glaucoma Care in the Greater Hamburg Area].

    Science.gov (United States)

    Waibel, S; Gesser, C; Klemm, M

    2017-08-01

    Background There is insufficient data on the quality of health services and health-related quality of life of patients with glaucoma. The purpose of this study was to investigate the extent to which the health services for glaucoma patients in the Greater Hamburg area conform to the guidelines set by the German Ophthalmological Society (DOG). Materials and Methods 196 glaucoma patients were offered an interview-administered questionnaire during their inpatient diurnal IOP measurement. The quality of glaucoma care and examinations recommended by the DOG were analysed. The results of the questionnaire were correlated with glaucoma severity, according to the stage of visual field defects. The correlation to the type of glaucoma was also analysed. Results The frequency of visits to the ophthalmologist was 5.1 per year. Most patients reported quarterly medical consultations. The majority of patients reported short waiting periods, because appointments were made in advance. In 92 % of cases, an intraocular pressure measurement was performed with each medical consultation. Half of the patients stated that their intraocular pressure had been measured at different times of the day. The visual field was tested a mean of 0.9 times per year at the ophthalmology clinic, but 1.4 times per year in the outpatient area. Further measures for glaucoma diagnostic testing were carried out 0.8 times per year at the ophthalmology clinic, and 0.4 times per year in the outpatient area. For the majority of patients, there were no additional costs for outpatient glaucoma diagnostic testing. Only 4 % of patients had to pay more than 100 € per year for these services. Conclusions For the majority of glaucoma patients in the Greater Hamburg area, the glaucoma health services conform to the guidelines set by the German Ophthalmological Society. Intraocular pressure measurements were performed on almost all patients at the regular check-ups and visual fields were examined as recommended

  3. Nonvolatile organic pollutants in domestic dust samples from the urban Hamburg area; Schwerfluechtige organische Umweltchemikalien in Hamburger Hausstaeuben

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-07-01

    Nonvolatile organic pollutants were measured in 65 private apartments, i.e. biocides, softeners, flame protection agents, stabilisers, soot, tar and bitumen which are contained in many everyday products and building materials. The homes were the private homes of staff members of the Hamburg Environmental Office and their friends; none of the homes were problem cases. The information was obtained by collecting vacuum cleaner dust. The inhomogeneous dust was screened, and the < 63 {mu}m fraction was analyzed. This fraction was homogeneously enough to provide reproducible results. Chloroparaffins and organic tin compounds were measured for the first time ever in this project. While the concentrations of chloroparaffins were significant, organic tin compounds are rather scarce. Bis(2,ethylhexyl)phthalate (DEHP) was the main component in nearly all household dust samples. Phthalates in general had the highest concentrations. Next to phthalates, chloroparaffins and the biocide permethrin were found in high concentrations, followed by organic phosphates, further biocides, organic tin compounds and benzo(a)pyrene. The individual substances wre assessed on the basis of 95 percent percentiles obtained from the measured frequency distributions. This figure means that 95 percent of the household dust have a lower or equal concentration than the 95 percent percentile. 95 percent percentiles are generally used as reference values in environmental measurements. The reference values presented here should be considered as preliminary values, owing to the fact that the apartments are not representative of the city of Hamburg, and 65 dust samples are too small a data base. Among the most important substances, owing to their high concentrations and/or toxic effects, are DEHP with a preliminary reference value of 1600 mg/kg of household dust, dibutyl phthalate with 180 mg/kg of dust, short-chain chloroparaffins with 180 mg/kg of dust, permethrin with 110 mg/kg of dust, monobutyl tin

  4. Processing, physicochemical, and sensory analyses of ostrich meat hamburger

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Ferreira de Souza

    2012-09-01

    Full Text Available The objective of this study was to assess the potential utilization of ostrich meat trimming in hamburger preparation, as well as its physicochemical and sensory characterization. Using ostrich meat trimmings from the legs and neck, four different formulations were prepared with varied amounts of bacon and textured soybean protein. Physical analysis of yield, shrinkage percentage, and water retention capacity and chemical analysis of proximate composition, cholesterol levels, and calories were performed. The formulations underwent sensory analysis by 52 potential ostrich meat consumers, who evaluated tenderness, juiciness, flavor, and purchase intent. The formulations containing textured soybean protein showed the highest yield, lowest shrinkage percentage, and highest water retention capacity. Lipid content varied from 0.58 to 4.99%; protein from 17.08 to 21.37%; ash from 3.00 to 3.62%; moisture from 73.87 to 76.27%; cholesterol from 22.54 to 32.11 mg.100 g-1; and calorie from 87.22 to 163.42 kcal.100 g-1. All formulations showed low cholesterol and calorie levels, even that containing 10% bacon and 3.5% textured soybean protein, which achieved the best scores and acceptance by the panelists.

  5. From Holland to Hamburg: The Experimental and Community Schools of Hamburg Seen through the Eyes of Dutch Observers (1919-1933)

    Science.gov (United States)

    Braster, Sjaak

    2014-01-01

    In the period 1919-1933 the experimental and community schools in Hamburg tried to put into practice a new model of schooling without a set curriculum that was based on providing a considerable amount of freedom for pupils and teachers. These experiences were introduced in the Netherlands by way of magazines published by the New Education…

  6. Description of measles D4-Hamburg outbreak in Hamburg, Germany, December 2008 to June 2009, which disproportionally affected a local Roma community.

    Science.gov (United States)

    Hegasy, G; Kätzner, K; Helle, M; Mankertz, A; Baumgarte, S; Wille, A; Fell, G

    2012-06-14

    From December 2008 to June 2009 a measles outbreak occurred in the Federal State of Hamburg, Germany. The outbreak affected 216 persons and was caused by a new measles strain termed D4-Hamburg which led to consecutive outbreaks between 2009 and 2011 in at least 12 European countries. Here, we describe epidemiological characteristics of the outbreak and evaluate the control measures taken in Hamburg. In one of the seven boroughs of Hamburg a local Roma community comprised more than 50% of the notified cases.We compared in a stratified analysis the age distribution of these cases with cases of fellow citizens who did not belong to the Roma community. The age group of infants (0-11 months) comprised 33% among the non-Roma measles cases, while in the Roma community only 4% belonged to this stratum. In the stratum of 5-17 year-olds only 8% were affected among the non-Roma cases, whereas in the Roma community 50% belonged to this age group. We discuss the influencing factors that might have led to this difference in age distribution between the two groups.

  7. [Habitus, capital and fields: the search for an acting head of the Hamburg Asylum Friedrichsberg in 1897].

    Science.gov (United States)

    Sammet, Kai

    2005-01-01

    In 1897 Hamburg was in search of an Oberarzt for the asylum Friedrichsberg who should function as the acting head of the head Wilhelm Reye (1833-1912). This search was part of the intended reformation of the outmoded psychiatric care in Hamburg. During this application procedure the Hamburg Physikus John Wahncau examined all possible candidates and applicants. The article explores the election process by using some sociological categories developed by Pierre Bourdieu (habitus, capital, field). The author argues that not only meritocratic attributes led to the choice of one candidate, but also his functional "fitting" into the field in Hamburg.

  8. Epidemiological and Ecological Characterization of the EHEC O104:H4 Outbreak in Hamburg, Germany, 2011.

    Science.gov (United States)

    Tahden, Maike; Manitz, Juliane; Baumgardt, Klaus; Fell, Gerhard; Kneib, Thomas; Hegasy, Guido

    2016-01-01

    In 2011, a large outbreak of entero-hemorrhagic E. coli (EHEC) and hemolytic uremic syndrome (HUS) occurred in Germany. The City of Hamburg was the first focus of the epidemic and had the highest incidences among all 16 Federal States of Germany. In this article, we present epidemiological characteristics of the Hamburg notification data. Evaluating the epicurves retrospectively, we found that the first epidemiological signal of the outbreak, which was in form of a HUS case cluster, was received by local health authorities when already 99 EHEC and 48 HUS patients had experienced their first symptoms. However, only two EHEC and seven HUS patients had been notified. Middle-aged women had the highest risk for contracting the infection in Hamburg. Furthermore, we studied timeliness of case notification in the course of the outbreak. To analyze the spatial distribution of EHEC/HUS incidences in 100 districts of Hamburg, we mapped cases' residential addresses using geographic information software. We then conducted an ecological study in order to find a statistical model identifying associations between local socio-economic factors and EHEC/HUS incidences in the epidemic. We employed a Bayesian Poisson model with covariates characterizing the Hamburg districts as well as incorporating structured and unstructured spatial effects. The Deviance Information Criterion was used for stepwise variable selection. We applied different modeling approaches by using primary data, transformed data, and preselected subsets of transformed data in order to identify socio-economic factors characterizing districts where EHEC/HUS outbreak cases had their residence.

  9. Recurrence rate and subjective symptoms after standardized (Hamburg protocol) phototherapeutic keratectomy on recurrent corneal erosions.

    Science.gov (United States)

    Mehlan, J; Steinberg, J; Traber, L; Katz, T; Linke, S J

    2016-10-01

    To evaluate the objective and subjective outcome after phototherapeutic keratectomy (PTK) on recurrent corneal erosions (Hamburg protocol). For the standardized PTK according to Hamburg protocol a manual abrasio corneae performed with 20 % alcohol is followed by an excimer ablation depth of ≥15 μm (group1 15 μm; group 2 > 15 μm ablation depth) and 7 mm optical zone. All patients (N = 48) were invited for follow-up examinations and the evaluation of changes concerning subjective symptoms. A significantly reduced subjective impairment of night vision, significantly less pain and less foreign body sensations (for all p Hamburg Schema) is a safe and effective procedure to reduce subjective symptoms and improve discomfort in recurrent corneal erosion.

  10. Spread of Measles Virus D4-Hamburg, Europe, 2008–2011

    Science.gov (United States)

    Mihneva, Zefira; Gold, Hermann; Baumgarte, Sigrid; Baillot, Armin; Helble, Rudolph; Roggendorf, Hedwig; Bosevska, Golubinka; Nedeljkovic, Jasminka; Makowka, Agata; Hutse, Veronik; Holzmann, Heidemarie; Aberle, Stefan W.; Cordey, Samuel; Necula, Gheorghe; Mentis, Andreas; Korukluoğlu, Gulay; Carr, Michael; Brown, Kevin E.; Hübschen, Judith M.; Muller, Claude P.; Mulders, Mick N.; Santibanez, Sabine

    2011-01-01

    A new strain of measles virus, D4-Hamburg, was imported from London to Hamburg in December 2008 and subsequently spread to Bulgaria, where an outbreak of >24,300 cases was observed. We analyzed spread of the virus to demonstrate the importance of addressing hard-to-reach communities within the World Health Organization European Region regarding access to medical care and vaccination campaigns. The D4-Hamburg strain appeared during 2009–2011 in Poland, Ireland, Northern Ireland, Austria, Greece, Romania, Turkey, Macedonia, Serbia, Switzerland, and Belgium and was repeatedly reimported to Germany. The strain was present in Europe for >27 months and led to >25,000 cases in 12 countries. Spread of the virus was prevalently but not exclusively associated with travel by persons in the Roma ethnic group; because this travel extends beyond the borders of any European country, measures to prevent the spread of measles should be implemented by the region as a whole. PMID:21801615

  11. Sharp increase of imported Plasmodium vivax malaria seen in migrants from Eritrea in Hamburg, Germany.

    Science.gov (United States)

    Roggelin, Louise; Tappe, Dennis; Noack, Bernd; Addo, Marylyn M; Tannich, Egbert; Rothe, Camilla

    2016-06-17

    Since 2014, a considerable increase in Plasmodium vivax malaria has been observed in Germany. The majority of cases was seen in Eritrean refugees. All patients with P. vivax malaria admitted to the University Medical Centre Hamburg-Eppendorf Germany from 2011 until August 2015 were retrospectively identified by the hospital coding system and data was matched with records from the laboratory diagnostics unit of the Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany. Between May 2014 and August 2015, 37 cases were reported in newly-arrived Eritrean refugees at the University Medical Centre Hamburg-Eppendorf, Germany. Relapses occurred due to difficulties in procurement of primaquine. Countries hosting Eritrean refugees need to be aware of vivax malaria occurring in this group and the risk of autochthonous cases due to local transmission by indigenous, vector competent Anopheles species.

  12. Formative Studies of First Year of the Competency-Based Field Center for Teacher Education at Hamburg, New York.

    Science.gov (United States)

    Bicknell, J. E.; And Others

    This report describes the first-year progress of the Fredonia/Hamburg Teacher Education Center and is concerned with aspects of the general format, program, and organization of the center. Chapter one defines and discusses the development of competency-based programs and describes the purpose of the Teacher Education Center at Fredonia/Hamburg.…

  13. Gilles Coignet. A migrant painter from Antwerp and his Hamburg career

    OpenAIRE

    Barbara Uppenkamp

    2015-01-01

    The painter Gilles Coignet was born in Antwerp c. 1542 to a family of artists and scientists. He spent some time in Italy and, as a Lutheran Protestant, fled from Antwerp to Amsterdam in 1585. He lived in Hamburg since 1595, where he died in December 1599. Here he had contact with other Netherlandish artists. Van Mander reports that it was Coignet who advised Vredeman de Vries to move from Hamburg to Amsterdam in 1598. This contribution focuses on Coignet’s last years and sheds new light on t...

  14. [Improving Mental Health Literacy and Mental Illness Stigma in the Population of Hamburg].

    Science.gov (United States)

    Lambert, Martin; Härter, Martin; Arnold, Detlef; Dirmaier, Jörg; Tlach, Lisa; Liebherz, Sarah; Sänger, Sylvia; Karow, Anne; Brandes, Andreas; Sielaff, Gyöngyver; Bock, Thomas

    2015-07-01

    Evidence shows that poor mental health literacy and stigmatization have negative consequences on mental health. However, studies on interventions to improve both are often heterogenic in methodology and results. The psychenet-campaign in Hamburg was developed and implemented in collaboration with patients and relatives and comprised multidimensional interventions focusing on education and contact to patients. The main goals were the improvement of mental health literacy and destigmatization and the long-term implementation within Hamburg's mental health care system. © Georg Thieme Verlag KG Stuttgart · New York.

  15. Location for new research facility determined X-ray laser XFEL to be realized in the federal states of Hamburg and Schleswig-Holstein starting in 2006

    CERN Document Server

    2003-01-01

    "...The site for the XFEL has now been determined by the research center DESY (Deutsches Elektronen-Synchrotron); it was announced today at a press conference in Hamburg. The 3.3-kilometer-long facility is to be located in the federal states of Hamburg and Schleswig-Holstein. It will begin on the DESY site in Hamburg-Bahrenfeld and run in a north-western direction to the town of Schenefeld (district of Pinneberg), which borders on Hamburg" (1 page).

  16. Electric current, thermal energy, cold and zero current for the Airport Fuhlsbuettel in Hamburg; Strom, Waerme, Kaelte und Notstrom fuer den Flughafen Fuhlsbuettel, Hamburg

    Energy Technology Data Exchange (ETDEWEB)

    Lindenau, C. [Ingenieurgesellschaft Ridder/Meyn, Norderstedt (Germany)

    1995-12-31

    Several technical plants have been built for the energy supply of the new Terminal 4 and Pier of the Airport Fuhlsbuettel in Hamburg. A cogeneration power plant with a refrigerating plant has been erected for the supply with thermal energy, steam, cold and electric current. The energies which have been gained from natural gas have been integrated into the overall system Airport. The task of this plant is to guarantee an almost autarkic supply of the Pier and Terminal with electric current, thermal energy, cold and steam. (orig.) [Deutsch] Fuer die Versorgung des Neubaus Terminal 4 und Pier des Flughafens Fuhlsbuettel in Hamburg, wurden mehrere Technikzentralen neu geschaffen. Fuer die Waerme-, Dampf-, Kaelte- und Stromversorgung ist ein Blockheizkraftwerk mit Kaeltezentrale errichtet worden. Die hier aus Erdgas gewandelten Energien sind in das Gesamtsystem des Flughafens eingebunden. Aufgabe dieser Zentrale ist es, fuer eine weitgehend autarke Versorgung des Neubaus Pier und Terminal mit Strom, Waerme, Kaelte und Dampf zu sorgen. (orig.)

  17. Ergebnisse der Nachuntersuchung einiger Rhizostomeen-Typen Haeckel's und Chun's aus dem Zoologischen Museum in Hamburg

    NARCIS (Netherlands)

    Stiasny, G.

    1922-01-01

    Durch das Entgegenkommen der Herren Prof. Dr. Hans Lohmann und Prof. Dr. Ernst Hentschel, denen ich hiefür bestens danke, wurde ich in die Lage versetzt, einige Typen-Exemplare von Haeckel und Chun, die sich im Zoologischen Museum der Universität in Hamburg befinden, nachzuuntersuchen. Dies erwies

  18. Local effects of global climate change on the urban drainage system of Hamburg.

    Science.gov (United States)

    Krieger, Klaus; Kuchenbecker, Andreas; Hüffmeyer, Nina; Verworn, Hans-Reinhard

    2013-01-01

    The Hamburg Water Group owns and operates a sewer network with a total length of more than 5,700 km. There has been increasing attention paid to the possible impacts of predicted changes in precipitation patterns on the sewer network infrastructure. The primary objective of the work presented in this paper is an estimation of the hydraulic impacts of climate change on the Hamburg drainage system. As a first step, simulated rainfalls based on the regional climate model REMO were compared and validated with long-term precipitation measurements. In the second step, the hydraulic effects on the sewer network of Hamburg have been analyzed based on simulated long-term rainfall series for the period of 2000-2100. Simulation results show a significant increase in combined sewer overflows by 50% as well as an increase in surcharges of storm sewer manholes. However, there is still a substantial amount of uncertainty resulting from model uncertainty and unknown development of future greenhouse gas emissions. So far, there seems to be no sound basis for the implementation of an overall climate factor for sewer dimensioning for the Hamburg region. Nevertheless, possible effects of climate change should be taken into account within the planning process for major sewer extensions or modifications.

  19. Achievement Inequalities in Hamburg Schools: How Do They Change as Students Get Older?

    Science.gov (United States)

    Caro, Daniel H.; Lehmann, Rainer

    2009-01-01

    A handful of studies have found evidence of a gap in academic achievement between students of high- and low-socioeconomic status (SES) families. Furthermore, some scholars argue that the gap tends to widen as students get older. Evidence is, however, inconclusive and relies mostly on limited methodological designs. Drawing on the Hamburg School…

  20. Kalle Hamburg lõi kartulirekordi / Silja Lättemäe

    Index Scriptorium Estoniae

    Lättemäe, Silja, 1952-

    2008-01-01

    Kalle Hamburg on saanud Eesti kõigi aegade suurima kartulisaagi 75 t/ha ja juurutanud paarkümmend uut kartulisorti. Tema talu Raplamaalt pälvis aasta talu tiitli. Lisaks nimekiri: Konkursi "Eesti parim talu 2008" võitjad

  1. From the Quixotic to the Pragmatic: The "Hamburg Declaration", Adult Education, and Work

    Science.gov (United States)

    Rose, Amy

    2013-01-01

    The "Hamburg Declaration" (UNESCO, 1997) is perhaps most quixotic and prescient in laying out the changing world of work as envisioned in 1997. It includes particular commitments to promote the rights to work and to work-related adult learning, to increase access to work-related adult learning for different target groups, and to…

  2. Methods of analyzing regional dermatological care as exemplified by the city of Hamburg.

    Science.gov (United States)

    Augustin, Jobst; Erasmi, Stefan; Reusch, Michael; Augustin, Matthias

    2015-07-01

    The rural-urban divide is often linked to regional inequalities in healthcare. However, studies have also shown regional healthcare disparities within urban areas. To evaluate these studies, further parameters such as accessibility must be added to the standard criteria. The objective of this study was to present methodic tools for evaluating dermatological healthcare provision in Hamburg, primarily focusing on accessibility. Analyzing data from 97 districts, the geographical distribution of 101 dermatologists and the physician-patient ratio were determined. In a second step, network analysis regarding accessibility was performed. There are regional inequalities in Hamburg with respect to dermatological care. Depending on the district, the physician-patient ratio ranges from 44.9 % (undersupply) to > 500 % (oversupply). Similar differences exist regarding accessibility. Although 94.5 % of the population of Hamburg is able to reach the nearest dermatologist within ten minutes (by car), it may take more than 30 minutes depending on district and mode of transportation. Analysis of the physician-patient ratio reveals differences regarding dermatological care in Hamburg. However, results of the network analysis show that these differences do not significantly affect access to dermatological care. Therefore, network analysis should be used as an additional tool to evaluate regional healthcare provision. © 2015 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

  3. Spectator Democracy: An Intersectional Analysis of Education Reform in Hamburg, Germany

    Science.gov (United States)

    Bale, Jeff

    2016-01-01

    This article uses the theoretical framework of intersectionality to analyze a partially failed school reform measure in Hamburg, Germany and the political conflict over it between 2008 and 2010. The analysis focuses on "the extent to which" and the "mechanisms by which" the interests of marginalized members of the proreform…

  4. [Urban Health (StadtGesundheit): The Wider Perspective Exemplified by the City State of Hamburg].

    Science.gov (United States)

    Fehr, R; Fertmann, R; Stender, K-P; Lettau, N; Trojan, A

    2016-09-01

    Public health and city planning have common roots, and in many places they are now reuniting under the heading of urban health. To organize this field adequately requires a broad, integrative view of medical care, health promotion, and health in all urban policies. Given current crises and developments including climate change and globalization, such a wider perspective should also be useful for Germany. Using the City State of Hamburg as an example and combining historic and systematic approaches, we explore the preconditions for in-depth analyses. Our results show that health is a significant topic of Hamburg urban policy, featuring a broad range of structures, processes and actors, both within the health sector and far beyond. Health promotion over the last 30 years evolved notably from a niche topic into an established field with remarkable cooperative structures. The tradition of comprehensive reporting on urban health in Hamburg that was initiated more than 200 years ago is no longer alive today. However, local health reporting keeps integrating a wide range of diverse topics. Communication among the Hamburg health actors - beyond straightforward medical quality assurance - does not seem to focus on critical evaluations, e. g. concerning social and ecologic sustainability. A prerequisite for in-depth analyses including external comparisons is to secure permanent access to relevant sources. Robust approaches to this end, however, seem to be lacking. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Modeling and Simulation of Hamburger Cooking Process Using Finite Difference and CFD Methods

    Directory of Open Access Journals (Sweden)

    J. Sargolzaei

    2011-01-01

    Full Text Available Unsteady-state heat transfer in hamburger cooking process was modeled using one dimensional finite difference (FD and three dimensional computational fluid dynamic (CFD models. A double-sided cooking system was designed to study the effect of pressure and oven temperature on the cooking process. Three different oven temperatures (114, 152, 204°C and three different pressures (20, 332, 570 pa were selected and 9 experiments were performed. Applying pressure to hamburger increases the contact area of hamburger with heating plate and hence the heat transfer rate to the hamburger was increased and caused the weight loss due to water evaporation and decreasing cooking time, while increasing oven temperature led to increasing weight loss and decreasing cooking time. CFD predicted results were in good agreement with the experimental results than the finite difference (FD ones. But considering the long time needed for CFD model to simulate the cooking process (about 1 hour, using the finite difference model would be more economic.

  6. Acceptance of fish hamburgers in school meals in the Southwest Region of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Leandra Schuastz BREDA

    2017-10-01

    Full Text Available Abstract The regular consumption of fish provides health gains for people, and its introduction in school meals is an important strategy to insert the habit of consuming this food by a population. Thus the objective of this study was to verify the acceptance of fish, presented in the form of hamburger, by children in municipal primary schools in the town of Pato Branco, Brazil, in which the school cooks had been trained to produce fish hamburgers. Acceptance was evaluated using a hedonic scale with 5 facial classifications (1 = disliked extremely to 5 = liked extremely. Students of both genders from 5 to 10 years of age (n = 142 were served the hamburgers for their midday meal, representing the protein portion of the meal. The results were analyzed by logistic regression. No effect of age or gender was observed between the children in the acceptance of the hamburgers, but the interaction between age and gender was significant. The cluster analysis was applied to distinguish this interaction using two-way joining to present the results, which showed the effect between specific age and gender situations. The acceptance index was 87% showing the potential for the consumption of this food by children.

  7. Occurrence of Clostridium difficile in seasoned hamburgers and seven processing plants in Iran.

    Science.gov (United States)

    Esfandiari, Zahra; Weese, Scott; Ezzatpanah, Hamid; Jalali, Mohammad; Chamani, Mohammad

    2014-11-25

    The recent increment of the incidence of Community Associated Clostridium difficile Infection (CA)-CDI has led to speculation that this disease is associated to foodborne transmission. Therefore it is critical to establish the community sources of CDI in order to implement the appropriate interventions. The present study was conducted to evaluate the prevalence of C. difficile in seasoned hamburger and examine the sources of C. difficile dispersal in hamburger processing plants. A total of 211 samples including hamburger ingredients, the final product, processing equipment and food contact surfaces were collected from seven hamburger processing plants to evaluate the routes of dispersal of C. difficile. The samples were assessed for the occurrence of C. difficile using culture and polymerase chain reaction (PCR) methods. All isolates were screened for the existence of toxin A, B and binary toxin genes. In addition, isolates were subjected to PCR ribotyping. Overall, 9/211 (4.2%) samples were positive. Toxigenic C. difficile were detected from 2/7 (28.5%) hamburger processing plants, in (3/54) 5.6% of beef meat samples, (2/56) 3.5% of swabs taken from the environment and (4/56) 7.1% of hamburger samples after both molding and freezing. C. difficile was not found in 45 non-meat ingredients including 14 defrosted onions, 14 textured soy proteins and 17 seasonings. All isolates contained tcdB gene while 7 strains were positive for tcdA and two remaining strains were negative for tcdA. None of the isolates harbored binary toxin gene (cdtB). PCR ribotyping of 9 isolates categorized into four ribotypes (IR21, IR 22, IR 23 and IR24). Ribotype IR 22 was the most common type 6/9 (66.6%) found. This genotype was isolated from raw meat, environmental samples and hamburger after both forming and freezing in one processing plant, suggesting raw beef meat as a possible major source of contamination. Hyper-virulent strains of ribotype were not found in this study however

  8. Molecular Method Development to Identify Foodborne Sarcocystishominis in Raw Beef Commercial Hamburger

    Directory of Open Access Journals (Sweden)

    Bahador Hajimohammadi

    2014-11-01

    Full Text Available Background: Sarcocystisspp. is zoonotic parasitic pathogen endangering safety of meat and derived meat products such as hamburgers which is among the most popular fast foods worldwide. Objectives: The current study aimed to design a protocol for molecular identification of Sarcocystis hominis in commercial hamburgers using PCR-RFLP with target of 18S rRNA. Materials and Methods: A total of 25 raw commercial hamburger samples were randomly collected from supermarkets of Yazd city, Iran. Five mm slices from different parts of each sample were selected, well mixed, and then preserved in ethanol 70% at -20°C for the next steps. The genomic DNA was extracted using salting out method. Detection and identification of Sarcocystis isolates were performed using PCR RFLP. The 18s rRNA gene sequence was mined from GenBank and the specific primer pair was designed using Primer3 software. Restriction fragment length polymorphims (RFLP analysis was performed using BfaI and RsaI restriction enzymes. The digestion was analyzed, using agarose gel electrophoresis alongside 100base pair DNA ladder. Results: Among 25 commercial hamburger samples, 17 samples showed a PCR product around 900 bp which could detect Sarcocyst Spp. After RFLP with BfaI, the restriction fragments of 376 bp and 397 bp detected S. hominis or S. hirsuta and fragments of 184 bp, 371 bp and 382 bp detected S. cruzi. After RFLP with RsaI, the restriction fragments of 376 bp and 557 bp detected S. hirsuta and fragment of 926 bp, without any digestion, detected S. hominis. For verification, each species detected in samples was randomly selected and sent for sequencing and the results were analyzed with BLAST. Conclusions: In conclusion, the current study developed a practical technique to detect the prevalence of S. hominis in meat products such as hamburgers.

  9. Epidemiological and Ecological Characterization of the EHEC O104:H4 Outbreak in Hamburg, Germany, 2011.

    Directory of Open Access Journals (Sweden)

    Maike Tahden

    Full Text Available In 2011, a large outbreak of entero-hemorrhagic E. coli (EHEC and hemolytic uremic syndrome (HUS occurred in Germany. The City of Hamburg was the first focus of the epidemic and had the highest incidences among all 16 Federal States of Germany. In this article, we present epidemiological characteristics of the Hamburg notification data. Evaluating the epicurves retrospectively, we found that the first epidemiological signal of the outbreak, which was in form of a HUS case cluster, was received by local health authorities when already 99 EHEC and 48 HUS patients had experienced their first symptoms. However, only two EHEC and seven HUS patients had been notified. Middle-aged women had the highest risk for contracting the infection in Hamburg. Furthermore, we studied timeliness of case notification in the course of the outbreak. To analyze the spatial distribution of EHEC/HUS incidences in 100 districts of Hamburg, we mapped cases' residential addresses using geographic information software. We then conducted an ecological study in order to find a statistical model identifying associations between local socio-economic factors and EHEC/HUS incidences in the epidemic. We employed a Bayesian Poisson model with covariates characterizing the Hamburg districts as well as incorporating structured and unstructured spatial effects. The Deviance Information Criterion was used for stepwise variable selection. We applied different modeling approaches by using primary data, transformed data, and preselected subsets of transformed data in order to identify socio-economic factors characterizing districts where EHEC/HUS outbreak cases had their residence.

  10. Modernization of the graphics post-processors of the Hamburg German Climate Computer Center Carbon Cycle Codes

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, E.J.; McNeilly, G.S.

    1994-03-01

    The existing National Center for Atmospheric Research (NCAR) code in the Hamburg Oceanic Carbon Cycle Circulation Model and the Hamburg Large-Scale Geostrophic Ocean General Circulation Model was modernized and reduced in size while still producing an equivalent end result. A reduction in the size of the existing code from more than 50,000 lines to approximately 7,500 lines in the new code has made the new code much easier to maintain. The existing code in Hamburg model uses legacy NCAR (including even emulated CALCOMP subrountines) graphics to display graphical output. The new code uses only current (version 3.1) NCAR subrountines.

  11. Entwicklung einer integrativen Informationssystemarchitektur für Customer-Relationship-Management und Supply-Chain-Management - Hamburg

    OpenAIRE

    Selk, Bernhard

    2005-01-01

    Entwicklung einer integrativen Informationssystemarchitektur für Customer-Relationship-Management und Supply-Chain-Management - Hamburg : Kovač, 2005. - XIV, 322 S. - (Studien zur Wirtschaftsinformatik ; 17). - Zugl.: Augsburg, Univ., Diss., 2005

  12. CAS on Free-Electron Lasers and Energy Recovery Linacs in Hamburg

    CERN Multimedia

    CERN Accelerator School

    2016-01-01

    The CERN Accelerator School (CAS) and DESY held a jointly-organised specialised course on Free-Electron Lasers and Energy Recovery Linacs (FELs and ERLs) in Hamburg, Germany, from 31 May to 10 June 2016.      The course was held in the Hotel Scandic Emporio in Hamburg and was attended by 68 participants of 13 nationalities, coming from countries as far away as China, Iran and Japan. The intensive programme comprised 44 lectures and one seminar. Following introductory lectures on electromagnetism, relativity and synchrotron radiation issues, the basic requirements of linacs and ERLs were discussed. Detailed lectures on the theory of FEL science followed. Undulators and the process of lasing and seeding were covered in some detail along with lectures on various beam dynamics and beam control issues. Case studies, for which seven hours were allocated, completed the academic programme. For these, the students were divided into small groups and tasked with completing the basic desig...

  13. Rationale and content of psychenet: the Hamburg Network for Mental Health.

    Science.gov (United States)

    Härter, Martin; Kentgens, Maren; Brandes, Andreas; Bock, Thomas; Dirmaier, Jörg; Erzberger, Melanie; Fürstenberg, Werner; Hillebrandt, Bernd; Karow, Anne; von dem Knesebeck, Olaf; König, Hans-Helmut; Löwe, Bernd; Meyer, Hans-Jochim; Romer, Georg; Rouhiainen, Tuula; Scherer, Martin; Thomasius, Rainer; Watzke, Birgit; Wegscheider, Karl; Lambert, Martin

    2012-11-01

    With the public-funded research and development project psychenet: the Hamburg Network for Mental Health (2011-2014), the Federal Ministry of Education and Research contributes to strengthening healthcare regions in Germany by establishing new trans-sectoral cooperations and implement and evaluate selected innovations. More than 60 partners from research, health care, health industry and government in the Free and Hanseatic City of Hamburg are promoting innovative measures to improve the treatment for mental disorders. The main objective is to implement integrated healthcare networks based on evidence for effective treatment methods, deriving from high-quality research throughout five indications such as psychosis, depression, somatoform and functional syndromes, anorexia and bulimia and addiction illnesses in adolescence. Those networks are accompanied by additional measures, for example, for improving information and education, addressing occupational health or strengthening the participation of patients and their families suffering from mental illness.

  14. [Semi-structured interviews on suicidality in the Hamburg pre-trial detention center].

    Science.gov (United States)

    Djerkovic, Dijana; Jasker, Janine; Kunze-Klempert, Sabrina; Morick, Yvonne; Thiel, Andreas; Briken, Peer; Klaus Püschell

    2014-01-01

    A detailed study regarding inmates' suicides was conducted in the detention center of Holstenglacis Hamburg (UHA). This study was triggered by an above-average number of attempted and committed suicides in detention centers in Germany and in particular, two committed suicides in the above-mentioned prison in early 2012. In this qualitative empirical study, 20 semi-structured interviews were conducted with inmates and staff of the UHA Hamburg. The focus was placed on aspects encountered in the daily life within the detention center and stressful situations that could encourage suicides. This article presents the most striking results of the study which are used as a basis for proposing several preventative measures. The aim of this article is to present new ideas and methods conducive to a decrease in the number of suicides in detention centers at minimal costs and personnel expenses.

  15. [SVM-based qualitative analysis of Muscat Hamburg wine produced in Tianjin region].

    Science.gov (United States)

    Zhang, Jun; Wang, Fang; Wei, Ji-Ping; Li, Chang-Wen; Yang, Hua; Shao, Chun-Fu; Zhang, Fu-Qing; Yin, Ji-Tai; Xiao, Dong-Guang

    2011-01-01

    The purpose was to achieve the identification of Muscat Hamburg wines produced in Tianjin region through scanning and analyzing dry white wine samples of different grape varieties and regions by infrared spectroscopy technology. A support vector machine (SVM) based method was introduced to analyze infrared spectra of dry white wines. The pretreatment processes of the IR spectra were also elaborated, including baseline adjustment, noise Elimination, standard normalization and eliminating the main component of abnormal sample points. The authors selected great quantity of dry white wine samples of different grape regions including 511 Muscat Hamburg wine samples, 438 Italian Riesling wine samples, 307 Chardonnay wine samples, 29 Ugni Blanc wine samples, 44 Rkatsiteli wine samples, 31 longan wine samples and 79 ZeHong wine samples. According to different classification problems, 80% of IR spectra of the wine samples were used to establish discrimination models with SVM-based method, and the remaining 20% of IR spectra were used for the validation of the discrimination models. Experimental results showed that the proposed method is effective, since high classification accuracy, identification rate and rejecting rate were achieved: over 97% for the white wine samples of different grape varieties, meanwhile over 98% for the Muscat Hamburg wine samples produced in different regions. So the method developed in this paper played a good role in the qualitative classification and discrimination of Muscat Hamburg wines produced in Tianjin region. This novel method has a considerable potential and a rosy application future due to the expeditiousness, stability and easy-operation of FTIR method, as well as the veracity and credibility of SVM method.

  16. [Stem cell transplantation for multiple sclerosis. Hamburg experiences and state of international research].

    Science.gov (United States)

    Stellmann, J-P; Stürner, K H; Ufer, F; Havemeister, S; Pöttgen, J; Ayuk Ayuketang, F; Kröger, N; Friese, M A; Heesen, C

    2015-08-01

    Autologous hematopoietic stem cell transplantation (aHSCT) is still not the standard treatment for highly inflammatory multiple sclerosis (MS). Even though randomized controlled trials are lacking, predictors for treatment response have been established. Since 2007, ten patients have received aHSCT in Hamburg. To present observational data from patients treated in Hamburg and a review of the literature. Descriptive statistics were used for evaluating the course of the expanded disability status scale (EDSS) as a measure for clinical outcome, magnetic resonance imaging (MRI) and neuropsychology. New gadolinium and T2-MRI uptake lesions per scan were compared. In addition, a systematic review of the currently available literature was performed. The Hamburg series can be divided in two groups, one group including four patients with chronic progressive MS with low inflammatory activity (median EDSS = 6.25, 0.5 relapses per year, no gadolinium-enhancing lesions) and the other group including six patients with mild to moderate disability, relapses and inflammatory activity (median EDSS = 4.25, 1 relapse per year, 2 gadolinium-enhancing lesions). The median follow-up was 2.4 years. While the first group did not seem to benefit from aHSCT, an improvement in five out of six patients was observed in the second group. New T2 lesions occurred within the first 6 months but gadolinium-enhancing lesions were not observed (p Hamburg. Cohort reports describe aHSCT as a safe and efficient treatment option in highly inflammatory MS. Based on these data aHSCT seems to be a reasonable option in selected patients with highly inflammatory MS but a randomized controlled trial is warranted.

  17. A model output statistics system to forecast the 2 metre temperature at the "Wettermast Hamburg" site

    Science.gov (United States)

    Finn, Tobias Sebastian; Ament, Felix

    2016-04-01

    The model output statistics (MOS) method is frequently used to downscale and improve numerical weather models for specific measurement sites. One of these is the "Wettermast Hamburg" (http://wettermast-hamburg.zmaw.de/) in the south-east of Hamburg. It is operated by the Meteorological Institute of the University of Hamburg. The MOS approach was used to develop a not yet existing 2 metre temperature forecasting system for this site. The forecast system is based on the 0 UTC control run of the legacy "global ensemble forecast system". The multiple linear equations were calculated using a training period of 2 years (01.03.2012-28.02.2014), while the developed models were evaluated using the following year (01.03.2014-28.02.2015). During the development process it was found that a combination of forward and backward selection together with the "Bayesian information criterion", a warm-cold splitting and a five-fold cross-validation was the best automated method to minimize the risk of overfitting. To further reduce the risk, the number of predictors were limited to 6. Also the first 3 possible predictors were selected by hand. In comparison to the fully automated method, the error was not changed significantly through this restrictions for the evaluation period. The analysis of the importance of selected predictors shows that the global weather model has problems characterizing specific weather phenomena. Large model errors by misrepresenting the boundary layer were highlighted through the 10 metre wind speed, the surface temperature and the 1000 hPa temperature as frequently selected predictors. The final forecast system has a root-mean-square error minimum of 1.15 K for the initialization and a maximum 2.2 K at the 84 hour lead time. Compared to the direct model output this is a mean improvement of ˜ 22%. The main error reduction is achieved in the first 24 hours of the forecast, especially at the initialization (up to 45% error reduction).

  18. [General practice quality circles in the large city. Participation by Hamburg general physicians].

    Science.gov (United States)

    Steinkohl, M; Niemann, D

    1997-01-01

    Quality circles (peer review) will play an increasing and important role in ambulatory care when they are based on voluntary participation and in a setting of open discussion. Goal is the further qualification of physicians by critical reflections on their practice based on learning processes and the experiences of the participants. Reported are experiences from the unit for primary care and health service research of the Hamburg University on implementing quality circles. Engagement in quality assurance may be helpful in the shaping and professionalisation of general practice.

  19. Considering the Physicochemical and Sensorial Properties of Momtaze Hamburgers Containing Lentil and Chickpea Seed Flour

    OpenAIRE

    Amir Motamedi; Marzieh Vahdani; Homa Baghaei; Monire Alsadat Borghei

    2015-01-01

    Background and Objectives: The food product known as the ‘hamburger’ plays a crucial role in people’s nutrition and the diversity of the food they consume. The reasons for our study include the area under cultivation, the remarkable amount of protein in chickpeas and lentils, as well as the public interest in tending to meat products, especially hamburgers. Materials and Methods: In this study, beef burgers were combined with chickpea flour and lentil flour at 4%, 8% and 12% levels. We eva...

  20. [psychenet - Hamburg Network for Mental Health: Results of the Process Evaluation].

    Science.gov (United States)

    Makowski, Anna C; Mnich, Eva E; Kofahl, Christopher; von dem Knesebeck, Olaf

    2015-07-01

    Aspects of implementation, functionality, acceptability and sustainability of the network psychenet - Hamburg network for mental health were examined.In March 2012 and September 2013, 19 expert interviews were carried out with leaders of subprojects and representatives of insurances, public authorities and patients.The complexity of the network was hindering. Positive aspects were communication, clear hierarchies and qualified staff.The implementation of a complex network requires shared goals. The establishment of a steering committee has proved as crucial. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Defining Moments in MMWR History: 1993 E. coli O157:H7 Hamburger Outbreak

    Centers for Disease Control (CDC) Podcasts

    2017-05-31

    During the 1993 E. coli O157 outbreak, four children died, and approximately 700 persons in four states became ill with severe and often bloody diarrhea after eating hamburgers from fast food restaurants. The first reports of CDC’s investigation into this deadly outbreak were published in MMWR. In this podcast, Dr. Beth Bell shares what it was like to serve as one of CDC’s lead investigators – a boots-on-the-ground disease detective -- for the historic outbreak.  Created: 5/31/2017 by MMWR.   Date Released: 5/31/2017.

  2. Learning to Fly: Family-Oriented Literacy Education in Schools. Celebrating the Tenth Anniversary of Hamburg's Family Literacy Project 2004-2014

    Science.gov (United States)

    Rabkin, Gabriele, Ed.; Roche, Stephen, Ed.

    2014-01-01

    This book was published to mark the tenth anniversary of Hamburg's award-winning Family Literacy project (FLY). It includes contributions from key stakeholders--academics, teachers, parents and children--participating in the conceptualization and implementation of FLY in the city of Hamburg. FLY mainly targets people from socially disadvantaged…

  3. The Women's College (Hochschule fur das weibliche Geschlect) and its Impact on the Development of Higher Education for Girls in the City of Hamburg.

    Science.gov (United States)

    Kleinau, Elke

    1990-01-01

    Reports a study on the Women's College founded in Hamburg, Germany, in 1850. Describes the college as an outgrowth of numerous reform-oriented forces present in Germany around 1848. Examines the impact of the college on higher education for girls in Hamburg; particularly in the establishment of further schools for poor women. (RW)

  4. Time-transgressive tunnel-valley infill revealed by a three- dimensional sedimentary model, Hamburg, north-west Germany

    DEFF Research Database (Denmark)

    Janszen, Adriaan; Moreau, Julien; Moscariello, Andrea

    2013-01-01

    highly intricate and therefore difficult to predict. This study intends to improve the comprehension of the sedimentology and to establish a conceptual model of tunnel-valley infill, which can be used as a predictive tool. To this end, the densely sampled, Pleistocene tunnel valleys in Hamburg (north...... succession filling the Hamburg area tunnel valleys can be subdivided into three distinct units, which are distinguished by their inferred depositional proximity to the ice margin. The overall trend of the succession shows a progressive decrease in transport energy and glacial influence through time. The rate...

  5. Migrants' educational success through innovation: The case of the Hamburg bilingual schools

    Science.gov (United States)

    Duarte, Joana

    2011-12-01

    Although Germany has experienced net in-migration for the past five decades, this fact has only recently been officially acknowledged. Furthermore, Germany is marked by a general monolingual self-concept very much attached to the idea of a nation-state with one homogeneous language. However, in large urban areas of Germany about 35 per cent of the population has a migration background, as has almost every second child enrolling in primary school. Hence the country is marked by this dichotomy between a monolingual policy discourse and a multilingual society, manifested in everyday life and, as a consequence, in educational institutions. The fact is that this political attitude towards Germany's own migration history and migrants has led to an educational gap between students with a migration background and their monolingual peers. In 2000, a project was started in Hamburg, aiming to overcome this educational gap and involving the creation of bilingual schools for some of the largest migrant languages. Bilingual classes were thus set up for the following language combinations: German-Portuguese, German-Italian, German-Spanish and German-Turkish, and were evaluated by the University of Hamburg. This paper reports on the model used and the specific school outcomes of the students attending these classes.

  6. [The new German educational law for medical schools: the Hamburg concept in dermatology and venereology].

    Science.gov (United States)

    Neuber, Karsten; Weidtmann, Katja; Coors, Esther; Harendza, Sigrid

    2006-03-01

    Medical school graduates are required to deal with complex situations in their future work which require profound theoretical knowledge as well as many practical skills. The University of Hamburg used a new educational law (AappO 2002) as catalyst to define learning objectives relevant for practice and to guarantee a close connection between theory and practice. A newly founded curriculum committee with twelve members developed a strategy and structure for the new clinical curriculum (KliniCuM) in weekly sessions. The subject dermatology and venereology is taught in the thematic block "The Internal and External Human Being" in integrated courses with the subjects internal medicine, pathology and pharmacology. The teaching modules (introductory lectures, symptom-oriented lectures, problem-based tutorials and bedside-teaching) are practice oriented and teach diseases and skills of dermatology which are important for "general medicine". Written and practical exams take place at the end of the block. Although there is more required attendance and increased demands on students' time, dermatology has received very positive evaluation results. Students consider their gain in knowledge and skills as very high. The new curriculum in Hamburg could provide helpful orientation for other medical faculties in changing their curricula for the subject "dermatology and venereology" according to the new educational law.

  7. Qualitative characteristics of hamburgers and koftas produced from meat of lambs fed glycerine

    Directory of Open Access Journals (Sweden)

    T. H. Borghi

    2016-12-01

    Full Text Available The objective of this study was to evaluate the qualitative (pH, color, water activity, water retention capacity, cooking loss, and shear force and sensory characteristics of processed meat produced from less noble cuts of the carcasses of lambs fed diets containing sugarcane as roughage and concentrates with and without 10 and 20% glycerine. Neck and rib meat of 30 lambs slaughtered at a body weight of 32.0 ± 0.2 kg was used for the elaboration of hamburgers and koftas. Except for color, the inclusion of glycerine in the lamb diet did not influence (P>0.05 the qualitative traits evaluated. The inclusion of glycerine reduced the redness (from 10.07 to 8.89, P=0.044 and yellowness (from 5.97 to 5.07, P=0.039 of hamburgers. The same effect was observed for the redness (from 10.83 to 9.61, P=0.031 and yellowness (from 5.86 to 5.12, P=0.047 of koftas. The sensory characteristics evaluated were not influenced (P>0.05 and the grades of overall acceptance ranged from 7.4 to 7.9. The inclusion of glycerine in the diet of lambs altered the color of processed meat products, but provided satisfactory sensory characteristics.

  8. Hans Jacob and brain research on Hamburg "euthanasia" victims: "Awaiting further brains!"

    Science.gov (United States)

    Zeidman, Lawrence A

    2017-03-14

    Several neuropathologists conducted brain research on victims of so-called euthanasia programs carried out by the National Socialist (Nazi) regime in Germany from 1940 to 1945. Some published their results in German journals or books during and after the war. One of these neuropathologists was Hans Jacob of Hamburg, a former Nazi party member and the leader of the same laboratory previously run by Alfons Jakob (Creutzfeldt-Jakob disease). Though much has been published on the unethical actions of Jacob's fellow neuropathologist from Berlin, Julius Hallervorden, Jacob's actions were remarkably similar and have not been previously analyzed in the neuroscience literature. Jacob dissected at least 42 patient brains from euthanasia centers near Hamburg, and saved the specimens from at least 17 of them. He published a 1956 book chapter featuring 2 such specimens. Jacob was denazified, had a notable career, and never publicly addressed his actions during the war. His ethical violations may not have been on the same scale as Hallervorden's, but the effect of his work echoes to the modern era. As responsible researchers, we must always be conscious of the provenance of material provided and not succumb to opportunistic temptation despite the ethical consequences. © 2017 American Academy of Neurology.

  9. Regional experiences of tissue donation and forensic medicine in hamburg - results of a 5-year period.

    Science.gov (United States)

    Wulff, Birgit; Müller, Katja; Heinemann, Axel; Püschel, Klaus

    2012-12-01

    We present the operational organization and daily workflow of our Hamburg model and the results of the years 2007-2011 concerning donation of corneas, musculoskeletal and, since 2010, cardiovascular tissues. Each of the about 3,600 deceased every year undergoes an evaluation process by two coordinators on duty, the tissue coordinator and the family coordinator. All donation connected issues are carried out within the standardized protocols of a quality management system and documented in a special data base. Two catamnestic surveys evaluated the satisfaction of donor families retrospectively. The inclusion rate for cornea donation was 23% and for musculoskeletal donation 10%, with a decrease after the 75 years age restriction of musculoskeletal donors in 2011 defined by the contracting tissue bank German Institute for Cell and Tissue Replacement gGmbH (DIZG), Berlin. Since 2007 1,268 corneas were explanted altogether, reflecting an increasing explantation rate from 156 (University Medical Center Hamburg-Eppendorf (UMC: 9) in 2007 up to 304 (UMC: 52) in 2011. Overall 173 musculoskeletal donors (5 years) and 11 cardiovascular donors (2 years) spent tissues. The consent rate was much higher. The evaluation of the families reflected a positive feedback for the guiding of the donation process. Forensic institutes can act as an interface between donors and recipients without neglecting forensic investigations. They are uniquely positioned to recognize potential donors. In addition, the contact with a physician of the forensic institute may help families during the mourning phase.

  10. [Suicide among physicians--a current analysis for the City of Hamburg].

    Science.gov (United States)

    Naumovska, Katerina; Gehl, Axel; Friedrich, Peter; Püschell, Klaus

    2014-01-01

    According to the literature, physicians have an increased risk of committing suicide, which can partly be explained by occupational stress. A retrospective analysis of the deaths investigated by the Hamburg office of Criminal Investigation and documents of the Hamburg Institute of Forensic Medicine for the years 2001 to 2013 showed that the average suicide rate among physicians is not significantly higher than that of the total population, it is 0.021% for physicians, 0.023% for dentists and 0.013% for the general public; thus the difference is not statistically significant (p: 0.57 for physicians and 0.74 for dentists). Drug intoxication has been found to be the most common method of suicide committed by physicians. However, these results must be interpreted with caution in view of the fact that a detailed evaluation of data was often not possible, especially because information as to the profession of the deceased and the motive for the suicide were missing or insufficiently documented.

  11. A study of the glow discharge plasma jet of the novel Hamburger-electrode

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenzheng, E-mail: wzhliu@bjtu.edu.cn; Ma, Chuanlong, E-mail: 15121452@bjtu.edu.cn; Yang, Xiao; Cui, Weisheng; Chen, Xiuyang [School of Electrical Engineering, Beijing Jiaotong University, Beijing 100044 (China)

    2016-08-15

    To generate atmospheric pressure glow discharge plasma jets (APGDPJs), a novel Hamburger-electrode was proposed. Through the study on electric field distributions, flow field distributions, and characteristics of the discharge and jet, we found that adopting the mode of dielectric barrier discharge with non-uniform thickness of dielectric, it was easy to form the strong electric field areas which were conducive to generate discharge and electric field distributions with large electric field intensity in the narrow gap and weak electric field intensity in the wide gap that were not inclined to form a filament discharge. Using the structure of evenly distributed inner electrodes, it was easy to weaken the pressure of strong electric field areas and form flow field distributions which is beneficial for taking out the high density charged particles and generating APGDPJs. Stable APGDPJs in nitrogen with 3.5 mm in diameter and 9 mm in length were formed by using the novel Hamburger-electrode.

  12. Antimicrobial properties of clove essential oil on raw hamburger during storage in freezer

    Directory of Open Access Journals (Sweden)

    S.E Hoseini

    2015-05-01

    Full Text Available Providing safe foods resistant to pathogens as well as replacing chemical preservatives with natural compounds including essential oils has attracted great attention in current studies. The purpose of this study was to investigate the antimicrobial properties of clove’s essential oil on hamburger. For this reason, clove essential oil was extracted by Clevenger apparatus method. Minimum Inhibitory Concentration (MIC of Staphylococcus aureus, Escherichia coli, Candida albicans and Aspergillus niger was measured. The antimicrobial effect of the essence in the concentrations of 0.0015%, 0.01%, 0.1% and 0.15% was examined on hamburger. The samples were examined at 0, 7, 30, 60 and 90 days of cold storage. Sensory characteristics of the samples were assessed through Hedonic method. MICs resulted from the test for S. aureus, E. coli, C. albicans and A. niger were 0.1%, 0.065%, 0.03% and 0.01% (V/V, respectively. The results of microbial examinations indicated that with the increasing of the concentration of clove oil essence and also with the progression of storage time, the microbial load was gradually decreased. According to the sensory assays conducted by the consumers, low concentrations of 0.0015% and maximum of 0.01% were found desirable.

  13. Hamburger Science

    Science.gov (United States)

    Trent, Ann

    2004-01-01

    While babysitting or preparing home meals, young people (and adults too) sometimes overlook cleanliness procedures. One of the first employment opportunities for teenagers is often in a fast-food restaurant where the safe handling and proper cooking of foods is essential. To teach students about food safety practices, the U.S. Food and Drug…

  14. Innovatives Medizinstudium der Semmelweis Universität Budapest am Asklepios Campus Hamburg [Innovation in the Field of Medical Studies in Europe: Asklepios Campus Hamburg of Budapest's Semmelweis University

    Directory of Open Access Journals (Sweden)

    Weidenhammer, Jörg

    2010-05-01

    Full Text Available [english] In our article we present a pioneering and unique transnational European model of university education. We discuss the cooperation between Semmelweis University Budapest and Asklepios Campus Hamburg. After several years of negotiation, it is now possible for students who did their preliminary medical examination in Hungary to continue and finish their medical studies in Hamburg, Germany. We report on the background of this development, the historical ties and legal requirements. We also describe the status quo and the future plans for the project. [german] In diesem Artikel stellen wir ein neues bisher in Europa einzigartiges länderübergreifendes Hochschulbildungsmodell vor. Dargestellt wird die Zusammenarbeit der Semmelweis Universität Budapest mit dem Asklepios Campus Hamburg. Nach mehrjährigen Verhandlungen ist es nun möglich, dass Studenten, die in Ungarn ihr Physikum gemacht haben, in Hamburg ihre klinische Ausbildung fortsetzen und abschließen können. Wir berichten über die Hintergründe und historischen Zusammenhänge sowie die rechtlichen Voraussetzungen dieser Entwicklung und beschreiben den gegenwärtigen Stand sowie die zukünftigen Planungen dieses Projekts.

  15. Studien zur Kirchenmusik und weltlichen Vokalmusik in Hamburg in der ersten Hälfte des 18. Jahrhunderts

    NARCIS (Netherlands)

    Voss, Steffen

    2014-01-01

    Hamburg was a main center for the development of protestant church music in the first half of the 18th century, especially for the oratorio, a genre which is stylistically indebted to operatic music. Works of two of the main composers of so called theatrical church music, Johann Mattheson and Georg

  16. A Very Long Term Forecast of the Port Throughput in the Le Havre - Hamburg Range up to 2100

    NARCIS (Netherlands)

    Van Dorsser, J.C.M.; Wolters, M.; Van Wee, G.P.

    2012-01-01

    This paper presents a new methodology for the development of a probabilistic very long term forecast of the total port throughput in the Le Havre – Hamburg range up to 2100. The forecast is based on a combination of System Dynamic Modelling, Judgement, and Causal Relations. It is intended to provide

  17. Synergistic benefits between stormwater management measures and a new pricing system for stormwater in the City of Hamburg.

    Science.gov (United States)

    Bertram, N P; Waldhoff, A; Bischoff, G; Ziegler, J; Meinzinger, F; Skambraks, A-K

    2017-09-01

    Hamburg is a growing metropolitan city. The increase in sealed surfaces of about 0.36% per year and the subsequent increased runoff impacts on the city's wastewater infrastructure. Further potential risks to the drainage infrastructure arise also from effects of climate change, e.g. increased intensity and frequency of heavy rainfalls. These challenges were addressed in the Rain InfraStructure Adaption (RISA) project conducted 2009-2015 by HAMBURG WASSER and the State Ministry for Environment and Energy, supported by several municipal stakeholders. RISA addressed intensifying conflicts in the context of urban development and stormwater management at that time. Major results of the project are improvements and recommendations for adequate consideration of stormwater management issues during urban planning as well as new funding mechanisms for stormwater management measures. The latter topic resulted in the introduction of a separated stormwater charge based on the amount of sealed area connected to the sewer system of each property. For both undertakings - the RISA project and the introduction of the separated stormwater charge - a novel, comprehensive, digital database was built. Today, these geographical information system (GIS)-based data offer various scale-independent analysis and information opportunities, which facilitate the day-to-day business of HAMBURG WASSER and stormwater management practice in Hamburg.

  18. Annotierter Katalog der Benhamiinae Arten in der Sammlung des Zoologischen Instituts und Museums von Hamburg (Oligochaeta: Acanthodrilidae

    Directory of Open Access Journals (Sweden)

    Csuzdi, Cs

    2006-12-01

    Full Text Available An annotated catalogue of the Benhamiinae earthworms housed in the Zoological Institute and Zoological Museum of the University of Hamburg is presented. All the entries are arranged by the valid names published (CSUZDI, 1995. An alphabetic list of the original specific epithets with the valid combinations is also tabulated.

  19. Birth of a New Degree Programme in Europe: Media Documentation, a Course of Study at the Fachhochschule of Hamburg, Germany.

    Science.gov (United States)

    Schmidt, Ralph; Werther, Sabine

    1995-01-01

    Describes the development, framework, and curriculum of the new degree program called Media Documentation at the Fachhochschule Hamburg (Germany). Highlights include changes in the job market for information professionals, determination and estimation of need, combining practice and theory, and cooperation with commercial organizations and…

  20. Engaging Stakeholders in a Sustainability Context: The Regional Centre of Expertise on Education for Sustainable Development in Hamburg and Region

    Science.gov (United States)

    Filho, Walter Leal; Schwarz, Jens

    2008-01-01

    Purpose: The purpose of this paper is to describe the experiences of RCE Hamburg, one of the latest Regional Centres of Excellence (RCE) to be created. It outlines the activities performed by the RCE and describes its relationships with the various stakeholders. Design/methodology/approach: A description of the region where the RCE is located is…

  1. Poverty, Education and Gender: Pedagogic Transformations in the Schools for the Poor ("Armenschulwesen") in Hamburg, 1788-1871

    Science.gov (United States)

    Mayer, Christine

    2011-01-01

    In the second half of the eighteenth century, an enlightened reformist spirit spread among Hamburg's bourgeois upper classes. This was exemplified by the activities of the "Gesellschaft zur Beforderung der Kunste und nutzlichen Gewerbe" ("Society for the Promotion of the Arts and Useful Trades") founded in 1765 as well as by a…

  2. How different are the Liège and Hamburg atlases of the solar spectrum?

    Science.gov (United States)

    Doerr, H.-P.; Vitas, N.; Fabbian, D.

    2016-05-01

    Context. The high-fidelity solar spectral atlas prepared by http://adsabs.harvard.edu/abs/1973apds.book.....D Delbouille et al. (Liège atlas, 1973) and the atlas by http://adsabs.harvard.edu/abs/1999SoPh..184..421N Neckel (Hamburg atlas, 1999, Sol. Phys., 184, 421) are widely recognised as the most important collection of reference spectra of the Sun at disc centre in the visible wavelength range. The two datasets serve as fundamental resources for many researchers, in particular for chemical abundance analyses. But despite their similar published specifications (spectral resolution and noise level), the shapes of the spectral lines in the two atlases differ significantly and systematically. Aims: Knowledge of any instrumental degradations is imperative to fully exploit the information content of spectroscopic data. We seek to investigate the magnitude of these differences and explain the possible sources. We provide the wavelength-dependent correction parameters that need to be taken into account when the spectra are to be compared with synthetic data, for instance. Methods: A parametrically degraded version of the Hamburg spectrum was fitted to the Liège spectrum. The parameters of the model (wavelength shift, broadening, intensity scaling, and intensity offset) represent the different characteristics of the respective instruments, observational strategies, and data processing. Results: The wavelength scales of the Liège and Hamburg atlases differ on average by 0.5 mÅ with a standard deviation of ± 2 mÅ, except for a peculiar region around 5500 Å. The continuum levels are offset by up to 18% below 5000 Å, but remain stably at a 0.8% difference towards the red. We find no evidence for spectral stray light in the Liège spectrum. Its resolving power is almost independent of wavelength but limited to about 216 000, which is between two to six times lower than specified. When accounting for the degradations determined in this work, the spectra of the two

  3. Pitch and Harmony in Gyorgy Ligeti's "Hamburg Concerto" and "Syzygy" for String Quartet

    Science.gov (United States)

    Corey, Charles

    The analysis component of this dissertation focuses on intricate and complex pitch relationships in Gyorgy Ligeti's last work, the Hamburg Concerto. This piece uses two distinct tuning systems---twelve tone equal temperament and just intonation---throughout its seven movements. Often, these two systems are used simultaneously, creating complex harmonic relationships. This combination allows Ligeti to exploit the unique features of each system and explore their relationships to each other. Ligeti's just intonation in the Hamburg Concerto comes mainly from the five French horns, who are instructed to keep their hands out of the bell to allow the instrument to sound its exact harmonics. The horns themselves, however, are tuned to varying different fundamentals, creating a constantly changing series of just-intoned pitches anchored above an equal-tempered bass. This method of generating just-intoned intervals adds a second layer to the relationship between equal temperament and just intonation. This paper focuses on creating ways to understand this relationship, and describing the ramifications of these tunings as they unfold throughout the piece. Ligeti very carefully crafts this work in a way that creates a balance between the systems. Research done at the Paul Sacher Stiftung has uncovered a significant collection of errors in the published score. Clearing up these discrepancies allows for a much more accurate and more informed analysis. Throughout this dissertation, mistakes are corrected, and several aspects of the score are clarified. The tuning systems are described, and a likely tuning scheme for the horns is posited. (The analytical component of the dissertation delves into the many varying intervals which all fit into one interval class---a feature that is best explored when two distinct tuning systems are juxtaposed.) A language is created herein to better understand these pitch relationships that fit neither into equal temperament nor just intonation. The

  4. Hass avocado modulates postprandial vascular reactivity and postprandial inflammatory responses to a hamburger meal in healthy volunteers.

    Science.gov (United States)

    Li, Zhaoping; Wong, Angela; Henning, Susanne M; Zhang, Yanjun; Jones, Alexis; Zerlin, Alona; Thames, Gail; Bowerman, Susan; Tseng, Chi-Hong; Heber, David

    2013-02-26

    Hass avocados are rich in monounsaturated fatty acids (oleic acid) and antioxidants (carotenoids, tocopherols, polyphenols) and are often eaten as a slice in a sandwich containing hamburger or other meats. Hamburger meat forms lipid peroxides during cooking. After ingestion, the stomach functions as a bioreactor generating additional lipid peroxides and this process can be inhibited when antioxidants are ingested together with the meat. The present pilot study was conducted to investigate the postprandial effect of the addition of 68 g of avocado to a hamburger on vasodilation and inflammation. Eleven healthy subjects on two separate occasions consumed either a 250 g hamburger patty alone (ca. 436 cal and 25 g fat) or together with 68 grams of avocado flesh (an additional 114 cal and 11 g of fat for a total of 550 cal and 36 g fat), a common culinary combination, to assess effects on vascular health. Using the standard peripheral arterial tonometry (PAT) method to calculate the PAT index, we observed significant vasoconstriction 2 hours following hamburger ingestion (2.19 ± 0.36 vs. 1.56 ± 0.21, p = 0.0007), which did not occur when the avocado flesh was ingested together with the burger (2.17 ± 0.57 vs. 2.08 ± 0.51, NS p = 0.68). Peripheral blood mononuclear cells were isolated from postprandial blood samples and the Ikappa-B alpha (IκBα) protein concentration was determined to assess effects on inflammation. At 3 hours, there was a significant preservation of IκBα (131% vs. 58%, p = 0.03) when avocado was consumed with the meat compared to meat alone, consistent with reduced activation of the NF-kappa B (NFκB) inflammatory pathway. IL-6 increased significantly at 4 hours in postprandial serum after consumption of the hamburger, but no change was observed when avocado was added. Postprandial serum triglyceride concentration increased, but did not further increase when avocado was ingested with the burger compared to burger alone despite the added fat and

  5. The Marginalization of Globally-Born Businesses: Ethnically Divided Trade in Hamburg and the World Economy

    DEFF Research Database (Denmark)

    Rezaei, Shahamak

    2009-01-01

    , qualitative as well as quantitative, of how such an ethnic enclave economy of scale operates, how it reproduced itself and how it met the challenges, be it political, demographical or others. Results: The study showed, that in spite of major political turbulence in Iran since 1979, the spreading of state...... controlled trading companies inside and outside of Iran and increasing international market pressure due to the growth of copying production of Persian carpets in other countries, the Tehran-Hamburg axis remains the core of this trade-with private Iranian traders occupying the dominant position on both sides......, entrance into mainstream economy which required both more than common national and ethnic background. The challenge for this economy is how to dissolve from strong ties to more loose organization based on rationally structured mode of organization. So far, however, the limited group of traders stick...

  6. Port Competition in the Northern Range from Le Havre to Hamburg

    Directory of Open Access Journals (Sweden)

    Pierre Thorez

    2006-03-01

    Full Text Available The main European ports of the Northern Range facingstrong competition develop various strategies. Rotterdam andLe Havre, fast transit, Antwe1p, logistic activities with storage,Hamburg, hub for central and eastem Europe. These strategieswill be described in the paper.All of them are building new container terminals and usenew tools in technology of communications to increase trafficand to enable shipping lines to achieve their own strategies. Thenew equipments will also b.: analysed.In the last years, the competition is mainly on the links withthe hinterland. Major ports t1y to enlarge their hinterlands bytransshipment, railway con"idors, waterway connections andhighways. The importance of ports and inland intermodalnodes is growing.Nowadays, port competition in the Northern Range is locatednot only in the ports.

  7. [Model study programs in medicine : Innovations in medical education in Hamburg and Berlin].

    Science.gov (United States)

    Guse, Andreas H; Kuhlmey, Adelheid

    2018-02-01

    Medical science is constantly evolving. Teaching and training must keep pace with these innovations and react in a flexible fashion to new requirements. Model medical education programs, which are governed by the provisions of Sect. 41 of the Regulations for the Licensing of Medical Practitioners (ÄAppO), permit the piloting of innovative teaching programs, which support the continuous development of medical training through incorporation into the standard curricula. This paper reports on the model study programs at the University Medical Centre Hamburg-Eppendorf (iMED) and Charité - University Medicine Berlin (MSM). It describes the reform objectives, the curricula and selected projects accompanying both models and concludes by exploring the significance of various training concepts for the development of medical education.

  8. 28th Annual DIA EuroMeeting (April 6-8, 2016 - Hamburg, Germany).

    Science.gov (United States)

    Petit, M D; Fernández, J

    2016-05-01

    The 28(th) Drug Information Association (DIA) Annual EuroMeeting took place in Hamburg, Germany, gathering together participants from different industries, organizations, academic research centers, regulatory agencies and health ministries, mainly from the E.U. The conference began with a regulatory Town Hall meeting focusing on the E.U. Medicines Agencies Network strategy to 2020. This was followed by an opening plenary session where the diverse roles of innovation in drug development were discussed. Areas for discussion over the meeting were classified into 14 main themes, and for each session, profession¬als from the pharmaceutical industry, regulatory agencies and health ministries, as well as delegates from patient organizations, presented their considerations for debate. This report covers some regulatory sessions presented at the meeting. Copyright 2016 Prous Science, S.A.U. or its licensors. All rights reserved.

  9. The Technical and Business Analysis of Using Shore Power Connection in The Port of Hamburg

    Directory of Open Access Journals (Sweden)

    Devi Hotnauli Samosir

    2017-01-01

    Full Text Available In port, when the ship is berthing the loading, unloading, and hospitality activity is using auxiliary engine. The combustion of marine fuels is a major contributor to air pollution, the air pollution is released 400 km around the port area. The impacts of the pollution are respiratory, health, and the environment around ports. Study indicates 60.000 of cardiopulmonary mortalities caused by ship air emission. Ship emission represents 3% of global CO2, 15% of global NOx, and 6% of global SOx emission. Because of that Hamburg Port is released the shore power facilities in July 2015 with idea of smart port and use the renewable energy such as wind turbine and solar panel compliance with IEC-ISO-IEEE 8005-1. In this bachelor thesis, the cost and also the condition between shore power and auxiliary engine will be analyzed and compared to find the most economical between shore power facilities and ship’s auxiliary engine. Shore power facilities in Hamburg are provided by SIEMENS with SIHARBOR and use a robot arm by Stemman Technik as the cable management system. The goal of this thesis is developed calculation tool to see the cost comparison and also the emission. And from the calculation tool the shore power is reducing the emission by 100% because of using the renewable energy and become economical than using auxiliary engine, it can save up to €1000. The other benefits  are ship owner can save maintenance of their auxiliary engine and also saved the file. It shows that the shore power is a proven technology to reduce the emission and saved berth cost.

  10. Inactivation of Mycobacterium avium subsp. paratuberculosis during cooking of hamburger patties.

    Science.gov (United States)

    Hammer, Philipp; Walte, Hans-Georg C; Matzen, Sönke; Hensel, Jann; Kiesner, Christian

    2013-07-01

    The role of Mycobacterium avium subsp. paratuberculosis (MAP) in Crohn's disease in humans has been debated for many years. Milk and milk products have been suggested as possible vectors for transmission since the beginning of this debate, whereas recent publications show that slaughtered cattle and their carcasses, meat, and organs can also serve as reservoirs for MAP transmission. The objective of this study was to generate heat-inactivation data for MAP during the cooking of hamburger patties. Hamburger patties of lean ground beef weighing 70 and 50 g were cooked for 6, 5, 4, 3, and 2 min, which were sterilized by irradiation and spiked with three different MAP strains at levels between 10² and 10⁶ CFU/ml. Single-sided cooking with one flip was applied, and the temperatures within the patties were recorded by seven thermocouples. Counting of the surviving bacteria was performed by direct plating onto Herrold's egg yolk medium and a three-vial most-probable-number method by using modified Dubos medium. There was considerable variability in temperature throughout the patties during frying. In addition, the log reduction in MAP numbers showed strong variations. In patties weighing 70 g, considerable bacterial reduction of 4 log or larger could only be achieved after 6 min of cooking. For all other cooking times, the bacterial reduction was less than 2 log. Patties weighing 50 g showed a 5-log or larger reduction after cooking times of 5 and 6 min. To determine the inactivation kinetics, a log-linear regression model was used, showing a constant decrease of MAP numbers over cooking time.

  11. Variation in the effectiveness of refractive surgery during the year: results from the Hamburg Weather Study.

    Science.gov (United States)

    Neuhaus-Richard, Ines; Frings, Andreas; Ament, Felix; Görsch, Isabel Caroline; Druchkiv, Vasyl; Katz, Toam; Linke, Stephan Johannes; Richard, Gisbert

    2014-07-01

    To examine the impact of seasonality on the refractive and visual outcomes of laser in situ keratomileusis (LASIK) in myopic eyes. Department of Ophthalmology and Care Vision Refractive Centers, University Medical Center Hamburg-Eppendorf, Hamburg, Germany. Retrospective cross-sectional data analysis. Two subgroups were defined. The first comprised patients having surgery during meteorological winter and the second, patients having surgery during meteorological summer. The manifest refraction and uncorrected and corrected visual acuities were assessed preoperatively and postoperatively. Robust regression analysis was applied with the efficacy index, safety index, and postoperative SE as dependent variables. This study comprised 1052 eyes of 1052 consecutive myopic patients (419 men, 633 women; mean age at surgery 35.0 years ± 9.0 [SD]) with a mean preoperative refractive spherical equivalent (SE) of -3.88 ± 1.85 diopters (D). At the 1-month follow-up (mean 33.0 ± 5.0 days), the mean postoperative SE was -0.18 ± 0.44 D. The efficacy index was 0.023 higher in eyes with refractive surgery during summer than in eyes treated during winter (P=.032), indicating less efficacy during winter. The differences in the safety index and postoperative SE between summer and winter were not statistically significant. No eye had a change of more than 1 line on the logMAR scale (corrected distance visual acuity). Although the difference in the efficacy index was statistically significant, the difference in the outcomes of LASIK was not clinically relevant, which shows the procedure's highly standardized reliability. Prospective longitudinal studies are warranted to address meteorotropic reactions by evaluating defined meteorological parameters. No author has a financial or proprietary interest in any material or method mentioned. Copyright © 2014 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  12. Modelling the emissions from ships in ports and their impact on air quality in the metropolitan area of Hamburg

    Science.gov (United States)

    Ramacher, Martin; Karl, Matthias; Aulinger, Armin; Bieser, Johannes; Matthias, Volker; Quante, Markus

    2016-04-01

    Exhaust emissions from shipping contribute significantly to the anthropogenic burden of air pollutants such as nitrogen oxides (NOX) and particulate matter (PM). Ships emit not only when sailing on open sea, but also when approaching harbors, during port manoeuvers and at berth to produce electricity and heat for the ship's operations. This affects the population of harbor cities because long-term exposure to PM and NOX has significant effects on human health. The European Union has therefore has set air quality standards for air pollutants. Many port cities have problems meeting these standards. The port of Hamburg with around 10.000 ship calls per year is Germany's largest seaport and Europe's second largest container port. Air quality standard reporting in Hamburg has revealed problems in meeting limits for NO2 and PM10. The amount and contribution of port related ship emissions (38% for NOx and 17% for PM10) to the overall emissions in the metropolitan area in 2005 [BSU Hamburg (2012): Luftreinhalteplan für Hamburg. 1. Fortschreibung 2012] has been modelled with a bottom up approach by using statistical data of ship activities in the harbor, technical vessel information and specific emission algorithms [GAUSS (2008): Quantifizierung von gasförmigen Emissionen durch Maschinenanlagen der Seeschiffart an der deutschen Küste]. However, knowledge about the spatial distribution of the harbor ship emissions over the city area is crucial when it comes to air quality standards and policy decisions to protect human health. Hence, this model study examines the spatial distribution of harbor ship emissions (NOX, PM10) and their deposition in the Hamburg metropolitan area. The transport and chemical transformation of atmospheric pollutants is calculated with the well-established chemistry transport model TAPM (The Air Pollution Model). TAPM is a three-dimensional coupled prognostic meteorological and air pollution model with a condensed chemistry scheme including

  13. Environmental management in the context of an integrated system in the gas supply concepts of Hamburg and Vienna; Umweltmanagement im Rahmen eines integrierten Systems in der Gasversorgung in Hamburg und in Wien

    Energy Technology Data Exchange (ETDEWEB)

    Reimers, G.; Rennecke, R.W. [HEIN GAS Hamburger Gaswerke GmbH, Hamburg (Germany); Dvorak, H. [WIENGAS, Wien (Austria)

    2001-11-01

    WIENGAS implemented an environmental management system based on DIN EN ISO 14001 as integrated management system with a quality management system based on DIN EN ISO 9001:2000. The existing integrated management system of HEIN GAS was used as basis. Additional consultant was bought from Hamburg too. The following news item reports about the ecobalance of HEIN GAS and the process ratio of WIENGAS. (orig.) [German] Bei der Wiengas wurde ein Umweltmanagementsystem nach DIN EN ISO 14001 zusammen als integriertes Managementsystem mit einem Qualitaetsmanagementsystem nach DIN EN ISO 9001:2000 eingefuehrt. Bei der Einfuehrung wurde das seit 1996 existierende integrierte Managementsystem von HEINGAS als Orientierungsgrundlage herangezogen und Beratung aus Hamburg eingekauft. Im nachfolgenden Artikel soll auf die Oekobilanz von HEINGAS und auf die Prozesskennzahlen der WIENGAS eingegangen werden. (orig.)

  14. Port of Hamburg - masterpiece of logistic: Presentation held at the Workshop Maritime and Logistics - Partnerships for Global Competitiveness, 24.10.2013, Montreal

    OpenAIRE

    Jahn, Carlos

    2013-01-01

    The port of Hamburg represents a masterpiece of logistics. It not only delivers performance but also masters complexity. In addition it provides connectivity to other continents and within Europe. The "Port River Information System Elbe" and the "Port Road Management" contribute to the efficiency of the port. All this is topped off with the fact that the port of Hamburg also strives to eco-friendliness.

  15. Interdisciplinary MSc and Doctoral Education in Climate System Science at the University of Hamburg

    Science.gov (United States)

    Dilly, Oliver; Stammer, Detlef; Pfeiffer, Eva-Maria

    2010-05-01

    Modern education in climate system sciences is based on a number of disciplines such as meteorology, geophysics, oceanography, geosciences and also economics and social sciences. Facts across these disciplines are required to address the faced key issues related to climate change effectively. Climate experts need to have profound knowledge that can only be achieved in interdisciplinary MSc and PhD programs. In Europe, graduate students who completed a BSc degree are typically proceeding with MSc programs to increase knowledge and qualification. Afterwards, the participation in a doctoral program may follow. Many doctoral programs include courses supporting disciplinary methodological and scientific background in particular. Those courses derive either from advanced MSc programs or specific trainings. Typically, interdisciplinary exchange is difficult to achieve at any stage of disciplinary graduate programs. Recent developments showed the need to educate climate experts in interdisciplinary MSc programs in climate system sciences for both researchers and professionals outside the university. The University of Hamburg offers an interdisciplinary 2-yr MSc program in Integrated System Sciences with 120 ECTS (30 compulsory, 90 eligible) in English language. If the MSc student decides to proceed with a PhD thesis, he/she may not necessarily complete the MSc program but may start to work on a specific and disciplinary doctoral thesis for 3 years. Each doctoral student is guided by an advisory panel (AP) which meets at least bi-annually. The AP consists of a Principal Advisor, a Co-Advisor and a Chair of the panel who come from neighboring disciplines. The structured doctoral program with only 12 CPs includes interdisciplinary compulsory courses and tailor-made eligible expert courses. Summer schools and soft skill courses add to both MSc and doctoral programs. Accordingly, the new graduate school concepts in climate system sciences at the University of Hamburg supports

  16. Reliability of a science admission test (HAM-Nat) at Hamburg medical school

    Science.gov (United States)

    Hissbach, Johanna; Klusmann, Dietrich; Hampe, Wolfgang

    2011-01-01

    Objective: The University Hospital in Hamburg (UKE) started to develop a test of knowledge in natural sciences for admission to medical school in 2005 (Hamburger Auswahlverfahren für Medizinische Studiengänge, Naturwissenschaftsteil, HAM-Nat). This study is a step towards establishing the HAM-Nat. We are investigating parallel forms reliability, the effect of a crash course in chemistry on test results, and correlations of HAM-Nat test results with a test of scientific reasoning (similar to a subtest of the "Test for Medical Studies", TMS). Methods: 316 first-year students participated in the study in 2007. They completed different versions of the HAM-Nat test which consisted of items that had already been used (HN2006) and new items (HN2007). Four weeks later half of the participants were tested on the HN2007 version of the HAM-Nat again, while the other half completed the test of scientific reasoning. Within this four week interval students were offered a five day chemistry course. Results: Parallel forms reliability for four different test versions ranged from rtt=.53 to rtt=.67. The retest reliabilities of the HN2007 halves were rtt=.54 and rtt =.61. Correlations of the two HAM-Nat versions with the test of scientific reasoning were r=.34 und r=.21. The crash course in chemistry had no effect on HAM-Nat scores. Conclusions: The results suggest that further versions of the test of natural sciences will not easily conform to the standards of internal consistency, parallel-forms reliability and retest reliability. Much care has to be taken in order to assemble items which could be used interchangeably for the construction of new test versions. The test of scientific reasoning and the HAM-Nat are tapping different constructs. Participation in a chemistry course did not improve students’ achievement, probably because the content of the course was not coordinated with the test and many students lacked of motivation to do well in the second test. PMID:21866246

  17. Reliability of a science admission test (HAM-Nat) at Hamburg medical school.

    Science.gov (United States)

    Hissbach, Johanna; Klusmann, Dietrich; Hampe, Wolfgang

    2011-01-01

    The University Hospital in Hamburg (UKE) started to develop a test of knowledge in natural sciences for admission to medical school in 2005 (Hamburger Auswahlverfahren für Medizinische Studiengänge, Naturwissenschaftsteil, HAM-Nat). This study is a step towards establishing the HAM-Nat. We are investigating parallel forms reliability, the effect of a crash course in chemistry on test results, and correlations of HAM-Nat test results with a test of scientific reasoning (similar to a subtest of the "Test for Medical Studies", TMS). 316 first-year students participated in the study in 2007. They completed different versions of the HAM-Nat test which consisted of items that had already been used (HN2006) and new items (HN2007). Four weeks later half of the participants were tested on the HN2007 version of the HAM-Nat again, while the other half completed the test of scientific reasoning. Within this four week interval students were offered a five day chemistry course. Parallel forms reliability for four different test versions ranged from r(tt)=.53 to r(tt)=.67. The retest reliabilities of the HN2007 halves were r(tt)=.54 and r(tt )=.61. Correlations of the two HAM-Nat versions with the test of scientific reasoning were r=.34 und r=.21. The crash course in chemistry had no effect on HAM-Nat scores. The results suggest that further versions of the test of natural sciences will not easily conform to the standards of internal consistency, parallel-forms reliability and retest reliability. Much care has to be taken in order to assemble items which could be used interchangeably for the construction of new test versions. The test of scientific reasoning and the HAM-Nat are tapping different constructs. Participation in a chemistry course did not improve students' achievement, probably because the content of the course was not coordinated with the test and many students lacked of motivation to do well in the second test.

  18. The Comparative Effect of Carrot and Lemon Fiber as a Fat Replacer on Physico-chemical, Textural, and Organoleptic Quality of Low-fat Beef Hamburger.

    Science.gov (United States)

    Soncu, Eda Demirok; Kolsarıcı, Nuray; Çiçek, Neslihan; Öztürk, Görsen Salman; Akoğlu, Ilker T; Arıcı, Yeliz Kaşko

    2015-01-01

    This study was designed to determine the usability of lemon fiber (LF-2%, 4%, 6%) and carrot fiber (CF-2%, 4%, 6%) to produce low-fat beef hamburgers. To that end, a certain amount of fat was replaced with each fiber. The proximate composition, pH value, cholesterol content, cooking characteristics, color, texture profile, and sensory properties of low-fat beef hamburgers were investigated. LF increased moisture content and cooking yield due to its better water binding properties, while CF caused higher fat and cholesterol contents owing to its higher fat absorption capacity (p<0.05). LF resulted in a lighter, redder, and more yellow color (p<0.05). Hardness, gumminess, springiness, and chewiness parameters decreased when the usage level of both fibers increased (p<0.05). However, more tender, gummy, springy, and smoother hamburgers were produced by the addition of CF in comparison with LF (p<0.05). Moreover, hamburgers including CF were rated with higher sensory scores (p<0.05). In conclusion, LF demonstrated better technological results in terms of cooking yield, shrinkage, moisture retention, and fat retention. However it is suggested that CF produces better low-fat hamburgers since up to 2% CF presented sensory and textural properties similar to those of regular hamburgers.

  19. The Zoology Department at Washington University (1944-1954): from undergraduate to graduate studies with Viktor Hamburger.

    Science.gov (United States)

    Dunnebacke, T H

    2001-04-01

    Beginning from an undergraduate's perspective and continuing through graduate school, this student's experiences in the Department of Zoology at Washington University in St. Louis, Missouri was a time of many rewarding experiences. Now, on this occasion of his 100th birthday, I wish to express my appreciation to the Chairman, Dr. Viktor Hamburger, for his teachings, his encouragement, and his friendship that has lasted over the past 56 years.

  20. Quality of life of Turkish type 2 diabetics in Germany and Turkey--a comparison between Hamburg and Istanbul.

    Science.gov (United States)

    Kofahl, Christopher; Doğan, Mustafa; Doğan, Gülsün; Mnich, Eva; von dem Knesebeck, Olaf

    2014-01-01

    The analyses address the following research questions: (1) Do Turkish diabetics in Germany and Turkey differ in terms of quality of life? (2) If yes, can these differences (in part) be explained by social factors (age, gender, education, household size), functional limitations and availability of support? (3) Are social factors, functional limitations and availability of support differently associated with quality of life among Turkish diabetics in Germany and Turkey? For this comparative cross-sectional study, 111 patients with type 2 diabetes were personally interviewed in Istanbul (Turkey) and 294 Turkish patients in Hamburg (Germany). For quality of life measurement we have used the Turkish version of the WHOQOL-Bref-26. Sociodemographics included age, sex, education and household-size. Health related functional limitations were assessed on the basis of an index of (instrumental) activities of daily living including the availability of help. Statistical analyses were conducted on group comparisons with Chi-square- and T-tests as well as linear regressions. There are no significant differences between Turkish diabetics in Germany and Turkey in the physical and the psychological dimensions of the WHOQOL-Bref. However, in the WHOQOL-domains 'social QoL' and 'environmental QoL' Turkish diabetics living in Hamburg have a significantly better quality of life than their counterparts in Istanbul. These differences cannot be explained by individual sociodemographic factors, functional limitations and availability of support. Furthermore, we found much stronger positive associations between education and quality of life in Istanbul than in Hamburg. Beyond strong similarities between the two samples in sociodemographics, physical and mental health the social and environmental quality of life was significantly assessed better by the Turkish diabetics living in Hamburg. This is most likely an effect of public investment in social security, infrastructure and health care

  1. Managing and governing commodity chains: the role of producer service firms in the secondary global city of Hamburg

    Directory of Open Access Journals (Sweden)

    Parnreiter, Christof

    2015-03-01

    Full Text Available This paper is motivated by the observation that our understanding of global cities in Germany and beyond is limited because the practices through which producer service firms (PSFs are involved in managing and governing their clients’ global commodity chains (GCCs have barely been studied. Based on interviews with representatives of PSFs in the secondary global city of Hamburg, the paper scrutinises whether and how service professionals contribute to the functioning and the control of their clients’ cross-border operations. It also analyses why clients choose global PSFs located in Hamburg, and it discusses which place Hamburg occupies in the network of German global cities. The paper concludes that because PSFs fulfil management functions for their clients’ global operations Hamburg is, beyond the role of its port, a critical node in many GCCs. Secondly, PSFs influence their clients’ decision-making processes. They are part of economic governance processes, though this impact cannot be straightforwardly equated with ‘command and control’. The paper also confirms that (and explains why the world city network is the spatial correlate of a globalising economy. Finally, there is no such a thing as a ‘global city hierarchy’ because the division of labour between the offices of PSFs is functional. As regards further research, a first task is to verify this paper’s findings through interviews with clients of PSFs to consolidate our knowledge on the role of PSFs in GCCs. Secondly, the contention that the world city network is flat has to be re-examined against the backdrop of an evident clustering of PSFs in specific cities. Finally, the discussion of whether and how PSFs are involved in the governance of their clients‘ GCCs needs to be continued and deepened.

  2. The dioxin/POPs legacy of pesticide production in Hamburg: part 2--waste deposits and remediation of Georgswerder landfill.

    Science.gov (United States)

    Götz, Rainer; Sokollek, Volker; Weber, Roland

    2013-04-01

    α-HCH, β-HCH, and γ-HCH (lindane) were listed as persistent organic pollutants in the Stockholm Convention. Therefore, they need to be globally addressed including the wastes remaining from historic use and production. While at most lindane production sites the unintentionally produced 85% HCH waste isomers have been deposited, at a former pesticide factory in Hamburg-Moorfleet HCH waste isomers have been recycled from 1953 to 1984 by thermal decomposition to chlorobenzenes and resulted in high polychlorinated dibenzo-p-dioxin/polychlorinated dibenzofuran (PCDD/PCDF)-contaminated residues. The management of the PCDD/PCDF-contaminated waste from the former pesticide factory in Hamburg has been assessed and quantified. Based on past accredited PCDD/PCDF measurements, the registered 3,700 tonnes of disposed thermal HCH decomposition residue contained 333 to 854 kg of PCDD/PCDF toxicity equivalent (I-TEQ) in 53-102 tonnes total sum of PCDD/PCDF. The wastes have been deposited together with other wastes in landfills in Hamburg and other parts of Germany. For the Georgswerder landfill (Hamburg), where approximately 50% of the PCDD/PCDF is disposed, current and previous situation and remediation activities are described. While PCDD/PCDF leaching from the landfill is controlled and incinerated, more water soluble organochlorines (vinyl chloride, cis-1,2-dichlorethene, chlorobenzenes) and benzene remain as a challenge for groundwater management. A comprehensive aftercare program has been established and will need to be operated by future generations including renewal of containment systems. Former lindane/HCH productions need-in addition to HCH deposits-to be assessed for possible recycling practice of HCH and related PCDD/PCDF-containing deposits. This could systematically be addressed within the Stockholm Convention implementation.

  3. Effects of Lemon Balm on the Oxidative Stability and the Quality Properties of Hamburger Patties during Refrigerated Storage

    Science.gov (United States)

    Lee, Hyun-Joo; Choi, Yang-Il

    2014-01-01

    This study was performed to investigate the effects of lemon balm (Melissa officinalis L.) on various quality and antioxidant activity of hamburger patties. Lemon balm extract (LBE) showed the highest amount of total polyphenol (801.00 mg TAE/g DW) and flavonoids (65.05 mg RA/g DW). The IC50 value of DPPH hydroxyl scavenging of LBE was 132 μg/mL. The hamburger patties were prepared by 0% (N), 0.1% (L1), 0.5% (L2), and 1.0% (L3) of the lemon balm powder. The addition of lemon balm powder increased the chewiness value, but did not affect the hardness, cohesiveness, and springiness values. Lemon balm powder had positive effects on sensory evaluation of patties. The pH of all patties decreased with longer storage period. 2-Thiobarbituric acid value, volatile basic nitrogen content, and the total microbial counts of hamburger patties in the L3 group were lower, compared to those of the normal (N group). In conclusion, the L3 group had significantly delayed lipid peroxidation compared to other treatment groups. However, the addition of lemon balm powder into patties showed no significantly influence on proximate composition, calorie contents, water holding capacity and cooking loss of patties. Therefore, lemon balm might be a useful natural antioxidant additive in meat products. PMID:26761292

  4. Isolation of shiga toxin-producing Escherichia coli O157:H7/NM from hamburger and chicken nugget

    Directory of Open Access Journals (Sweden)

    Ali Miri

    2014-01-01

    Material and Methods: From June 2013 to July 2013, a total of 190 hamburger (120 and chicken nugget (70, were collected from four randomly selected factories in Isfahan, Iran. They were evaluated for the presence of E. coli O157:H7/NM using microbiological culture and polymerase chain reaction. Statistical analysis was performed using SPSS software version 16.0 (SPSS Inc., Chicago o, IL, USA. Results: From a total of 190 samples analyzed four samples (2.1% were contaminated with E. coli O157. All of the E. coli O157 were isolated from hamburger samples (3.3% and chicken nugget samples were negative. Of four E. coli O157 isolated, only one sample was serotype E. coli O157:H7 and others were serotype E. coli O157:NM. Among four E. coli O157:H7/NM isolates, one strain was positive for all stx1, stx2, eaeA and ehxA genes. One strain was positive for stx2 gene. The other two were negative for these genes. All isolates (100% were resistant to one or more antimicrobial agents. Conclusions: The results of this study showed that hamburger could be a significant source of E. coli O157:H7 and E. coli O157:NM serotypes in Iran and multi-resistance was found in 27% of E. coli O157 strains and this is a major public health concern.

  5. Measurements to check vapour recovery systems of public retail stations in Hamburg (Phase 1); Messaktion zur Ueberpruefung von Gasrueckfuehrungssystemen an oeffentlichen Tankstellen in der Freien und Hansestadt Hamburg (Phase 1)

    Energy Technology Data Exchange (ETDEWEB)

    Altmann, B.R. [Deutsche Wissenschaftliche Gesellschaft fuer Erdoel, Erdgas und Kohle e.V., Hamburg (Germany); Golgert, R. [Gesundheits- und Umweltamt, Hamburg (Germany). Bezirksamt Wandsbek; Okelmann, J. [Umweltbehoerde, Hamburg (Germany). Amt fuer Immissionsschutz und Betriebe; Schenck, H.G. [Gesundheits- und Umweltamt, Hamburg (Germany). Bezirksamt Eimsbuettel, Abt. fuer Umweltschutz

    2000-06-01

    DGMK jointly with the local authorities of health and environment, in close co-operation with the environmental authorities of the city of Hamburg, are thoroughly examining the vapour recovery systems at all public service stations in Hamburg. In phase I 50 sites were examined in August/September 1999 by several measuring methods called liquid-measurement, liquid-check, quick-check (UPA 50/Flo-Tester) and dry-measurement procedure. They delivered proportions and causes of bad performing and defective devices leading to appropriate maintenance. The dry-measurement procedure commonly used with regular checks by itself is not satisfactory to prove overall performance of the vapour recovery equipment. It should always be supplemented by a liquid-check procedure in order to ensure that the assigned vapour pumps work. As the dry-measurement procedure simulates a fuel flow it cannot detect such defects. Complete breakdowns of vapour recovery systems can be localised reliably with the quick check devices UPA 50/Flo-Tester. But due to high error tolerances, quick check devices are not suitable for quantitative measurement of vapour recovery rates on service stations. (orig.) [German] Die DGMK fuehrt unter Beteiligung der Umweltbehoerde Hamburg zusammen mit den Gesundheits- und Umweltaemtern der Bezirke und den Tankstellenbetreibern in einem Gemeinschaftsprojekt detaillierte Untersuchungen der Gasrueckfuehrungssysteme an allen Hamburger Tankstellen durch. Ziel der Untersuchung ist die Ueberpruefung und Verbesserung des technischen Zustandes der Gasrueckfuehrsysteme an allen Hamburger Tankstellen. Darueber hinaus sollen genaue Kenntnisse ueber die Verlaesslichkeit von gaengigen Messverfahren zur Ueberpruefung von Gasrueckfuehrsystemen erworben werden. In der Phase I wurden an 50 Tankstellen Messungen im August/September 1999 unter Anwendung des Nassmessverfahrens, des Trockenmessverfahrens, der Schnelltester (Flo-Tester und UPA 50) sowie der Nasskontrolle zur Ueberpruefung

  6. An XUV-split and delay line at the free electron laser in Hamburg

    Energy Technology Data Exchange (ETDEWEB)

    Beeck, Torben; Meyer, Holger; Gieschen, Sven; Beye, Martin; Schlotter, William F.; Sorgenfrei, Florian; Foehlisch, Alexander; Wurth, Wilfried [Institut fuer Experimentalphysik, Universitaet Hamburg (Germany); Nagasono, Mitsuru [Institut fuer Experimentalphysik, Universitaet Hamburg (Germany); XFEL Project Head Office, RIKEN, Hyogo (Japan)

    2008-07-01

    At the Free Electron Laser in Hamburg (FLASH) we are integrating a soft X-ray beam split and delay line to the plane grating monochromator beamline (PG2). This system will enable pump-probe spectroscopy of ultrafast dynamics. Pulse to pulse timing jitter is circumvented by the controlled synchronisation of the delay line. The wavefront of the incoming beam is divided by illuminating the edge of a mirror. By controlling the optical path length for each beam, pulse delays as short as 10 fs or as long as 20 ps can be generated. The system employs four mirrors to split and mix the beam and four mirrors to control the delay. Each mirror is a silicon single crystal with a diamond like carbon coating. The four delay mirrors are arranged at grazing incidence forming a parallelogram. Together with the beam splitters this forms an adjustable path Mach-Zehnder interferometer. For stability the delay mirrors are fixed to a rigid support structure. Simply translating the structure imparts a delay between the pulses.

  7. [Transfer of Care Innovations from the Hamburg Network for Mental Health to other Health Regions].

    Science.gov (United States)

    Tokar, Oksana; Dörbecker, Regine; Böhmann, Tilo; Härter, Martin

    2015-07-01

    The goal of this paper is to present the research conducted for systemizing network elements and analyzing their interconnection that emerged during the establishment and functioning of health care innovation project of psychenet - the Hamburg Network for Mental Health.Semi-structured manual-based face-to-face interviews with project researchers and leaders were conducted. The gathered data was validated and updated several times during the project duration. The results include a systematic description of 186 network elements developed during the overall project and respective subprojects. The elements were consolidated in a web-based database and integrated into the psychenet.de public website. A clustering of elements was conducted and modules of elements were generated based on the interconnection between the related elements.The systematic description of network elements as well as determination of their interconnection and dependency can play an important role in understanding the emergence and functioning of integrated mental health networks. The innovative medical networks prove to be complex service systems and urge for a grounded application of integration techniques in order to be successfully transferred and adopted in other regions. © Georg Thieme Verlag KG Stuttgart · New York.

  8. [Home treatment--a treatment model of integrated care in Hamburg].

    Science.gov (United States)

    Schöttle, Daniel; Ruppelt, Friederike; Karow, Anne; Lambert, Martin

    2015-03-01

    Treatment models like "Crisis Resolution and Hometreatment (CRHT)" or "Assertive Community Treatment" (ACT), were found to be effective, enhancing the qualitative level of treatment for patients with severe mental disorders. In Germany, these are implemented only sporadically until today, often as part of a cross-sectoral Integrated Care (IC) treatment system. We will present the implementation of an "Assertive Community Treatment" embedded into an IC-treatment model in Hamburg and discuss the 3-year-outcomes. The IC-treatment model has been designed for severe mentally ill patients with psychotic disorders. Since May 2007 the model is financed by different health insurances as a managed-care "capitation-model" and its effectiveness gets continuously evaluated. The model proved to be effective in earlier studies were compared with standard care low rates of service disengagement were found as well as significantly improved psychopathology, psychosocial functioning, quality of life, satisfaction with care and adherence, while being cost effective. The rates of involuntary admissions declined to 10% in comparison to the years before. In 2011 the model was specified to the indication "first-episode adolescents and young adults in the age of 12-29" in a government-funded study "Integrated Care in Early Psychosis, ICEP Study". In this study an interdisciplinary team of child, adolescent and adult psychiatrists was implemented and since 2012 it is financed by the involved health insurances throughout an expansion of the §140 SGB V agreement. © Georg Thieme Verlag KG Stuttgart · New York.

  9. Flow model of the Hudson River estuary from Albany to New Hamburg, New York

    Science.gov (United States)

    Stedfast, David A.

    1982-01-01

    A one-dimensional transient-flow-simulation model was developed to represent a 76-mile reach of the tidal Hudson River between Albany and New Hamburg, N.Y. The river 's direction of flow reverses four times daily as a result of tidal influence, and this process produces complex current patterns and retards the rate at which the river can flush out pollutants. In the model, the reach studied is treated as two subreaches to incorporate differences in channel conditions and to simplify model calibration. This report provides all stage (water-level) and discharge data that were used to calibrate and verify the model and compares the model results with measured data. The model accurately simulated observed flows, but further calibration based upon additional prototype flow measurements would improve simulation of the flow magnitude and phasing of the tide reversal under low-flow conditions. The model can be used to calculate instantaneous stage, velocity, and discharge for any location in the reach and can also be used to calculate net volume flux between tide reversals. (USGS)

  10. Performance Evaluation of the Approaches and Algorithms for Hamburg Airport Operations

    Science.gov (United States)

    Zhu, Zhifan; Okuniek, Nikolai; Gerdes, Ingrid; Schier, Sebastian; Lee, Hanbong; Jung, Yoon

    2016-01-01

    The German Aerospace Center (DLR) and the National Aeronautics and Space Administration (NASA) have been independently developing and testing their own concepts and tools for airport surface traffic management. Although these concepts and tools have been tested individually for European and US airports, they have never been compared or analyzed side-by-side. This paper presents the collaborative research devoted to the evaluation and analysis of two different surface management concepts. Hamburg Airport was used as a common test bed airport for the study. First, two independent simulations using the same traffic scenario were conducted: one by the DLR team using the Controller Assistance for Departure Optimization (CADEO) and the Taxi Routing for Aircraft: Creation and Controlling (TRACC) in a real-time simulation environment, and one by the NASA team based on the Spot and Runway Departure Advisor (SARDA) in a fast-time simulation environment. A set of common performance metrics was defined. The simulation results showed that both approaches produced operational benefits in efficiency, such as reducing taxi times, while maintaining runway throughput. Both approaches generated the gate pushback schedule to meet the runway schedule, such that the runway utilization was maximized. The conflict-free taxi guidance by TRACC helped avoid taxi conflicts and reduced taxiing stops, but the taxi benefit needed be assessed together with runway throughput to analyze the overall performance objective.

  11. Viticultural and chemical characteristics of Muscat Hamburg preselected clones grown for table grapes.

    Science.gov (United States)

    Vujović, Dragan; Maletić, Radojka; Popović-Đorđević, Jelena; Pejin, Boris; Ristić, Renata

    2017-01-01

    Clonal selection is one of the tools used for grapevine improvement and therefore is very important for obtaining clones with better characteristics than the variety population. The aim of this study was to select superior grapevines of Vitis vinifera L. cv. Muscat Hamburg grown for fresh consumption. The viticultural parameters and fruit composition of 35 selected vines were determined during a 5-year period. The evaluated parameters showed high variability among selected vines. The significant effect of vintage was observed for all descriptors with the exception of the number of seeds per berry and sugar concentration. Additionally, all vines were examined for their tolerance to low temperatures and the results showed 73% and 90% of primary bud injury at -20 and -25 °C, respectively. In relation to berry classification, the percentage of first-class grapes ranged from 60% to 69% for all selected grapevines. Multivariate statistical analysis was performed to classify grapevines based on their performance. Fourteen grapevines were identified as the most promising among the 35 vines initially planted, based on high yield, bunch and berry weight, sugar content and percentage of first-grade grapes. Those grapevines were selected for the next phase of the clonal selection. This study highlighted the importance of clonal selection for improvement of the variety population. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  12. Performance Evaluation of the Approaches and Algorithms Using Hamburg Airport Operations

    Science.gov (United States)

    Zhu, Zhifan; Okuniek, Nikolai; Gerdes, Ingrid; Schier, Sebastian; Lee, Hanbong; Jung, Yoon

    2016-01-01

    The German Aerospace Center (DLR) and the National Aeronautics and Space Administration (NASA) have been independently developing and testing their own concepts and tools for airport surface traffic management. Although these concepts and tools have been tested individually for European and US airports, they have never been compared or analyzed side-by-side. This paper presents the collaborative research devoted to the evaluation and analysis of two different surface management concepts. Hamburg Airport was used as a common test bed airport for the study. First, two independent simulations using the same traffic scenario were conducted; one by the DLR team using the Controller Assistance for Departure Optimization (CADEO) and the Taxi Routing for Aircraft: Creation and Controlling (TRACC) in a real-time simulation environment, and one by the NASA team based on the Spot and Runway Departure Advisor (SARDA) in a fast-time simulation environment. A set of common performance metrics was defined. The simulation results showed that both approaches produced operational benefits in efficiency, such as reducing taxi times, while maintaining runway throughput. Both approaches generated the gate pushback schedule to meet the runway schedule, such that the runway utilization was maximized. The conflict-free taxi guidance by TRACC helped avoid taxi conflicts and reduced taxiing stops, but the taxi benefit needed be assessed together with runway throughput to analyze the overall performance objective.

  13. Distribution of rodenticide resistance and zoonotic pathogens in Norway rats in Lower Saxony and Hamburg, Germany.

    Science.gov (United States)

    Runge, Martin; von Keyserlingk, Michael; Braune, Silke; Becker, Detlef; Plenge-Bönig, Anita; Freise, Jona F; Pelz, Hans-Joachim; Esther, Alexandra

    2013-03-01

    Genetically based resistance to anticoagulants has led to increasing difficulties in the control of rodents over recent decades. The possible impact of rodenticide-resistant rats on the infection risk of humans and livestock by zoonotic pathogens is generally unknown. Hence, in a monitoring programme in the German federal states of Lower Saxony and Hamburg, more than 500 Norway rats were analysed for both Tyr139Cys polymorphisms within the VKORC1 gene and zoonotic agents. Evidence of resistance was almost completely restricted to the known resistance area in southern Lower Saxony. Homozygous mutations were only found in urban areas sampled owing to the occurrence of rat control problems and were missing in bycatches of rats by muskrat trappers in rural areas. In more than 25% of the rats, zoonotic bacteria (Leptospira, Salmonella, Yersinia and Coxiella) were detected. There was no obvious correlation between the occurrence of rats carrying zoonotic pathogens and anticoagulant resistance. Zoonotic agents and genetically based resistance conferred by the Tyr139Cys polymorphism are both unevenly distributed in Lower Saxony. The study provides the basis for further studies focusing on districts with high levels of pathogens and resistance to assess the potential health risk of their combined occurrence. Copyright © 2012 Society of Chemical Industry.

  14. The Hamburg Ocean Atmosphere Parameters and Fluxes from Satellite Data – HOAPS-3

    Directory of Open Access Journals (Sweden)

    A. Andersson

    2010-09-01

    Full Text Available The availability of microwave instruments on satellite platforms allows the retrieval of essential water cycle components at high quality for improved understanding and evaluation of water processes in climate modelling. HOAPS-3, the latest version of the satellite climatology "Hamburg Ocean Atmosphere Parameters and Fluxes from Satellite Data" provides fields of turbulent heat fluxes, evaporation, precipitation, freshwater flux and related atmospheric variables over the global ice-free ocean. This paper describes the content, methodology and retrievals of the HOAPS climatology. A sophisticated processing chain, including all available Special Sensor Microwave Imager (SSM/I instruments aboard the satellites of the Defense Meteorological Satellites Program (DMSP and careful inter-sensor calibration, ensures a homogeneous time-series with dense data sampling and hence detailed information of the underlying weather situations. The completely reprocessed data set with a continuous time series from 1987 to 2005 contains neural network based algorithms for precipitation and wind speed and Advanced Very High Resolution Radiometer (AVHRR based SST fields. Additionally, a new 85 GHz synthesis procedure for the defective SSM/I channels on DMSP F08 from 1988 on has been implemented. Freely available monthly and pentad means, twice daily composites and scan-based data make HOAPS-3 a versatile data set for studying ocean-atmosphere interaction on different temporal and spatial scales. HOAPS-3 data products are available via http://www.hoaps.org.

  15. Rock, Pop, Jazz: Vom Amateur zum Profi : Referate und Diskussionen der Tagung des Arbeitskreises Studium Populärer Musik, veranstaltet vom 12. bis 15. November 1987 in Hamburg anläßlich der Musikmesse Musica

    OpenAIRE

    Arbeitskreis Studium Populärer Musik

    1987-01-01

    Die Jahrestagung 1987 im Rahmen der Hamburger Musikmesse "Musica" stellte unseren relativ jungen Arbeitskreis auf den Prüfstand. Galt es doch nicht nur, sich auf dem Hamburger Messegelände mit einem ASPM-Messestand den professionellen Ausstellern gegenüber zu behaupten, sondern auch, neben den vielen parallel laufenden Tagungsangeboten zur "Musica" im Hamburger Congress Centrum ein eigenes ASPM-spezifisches Profil zu entwickeln. Mit einem abwechslungsreichen Programm, in des...

  16. Effect of ionizing radiation on the oxidation of cholesterol in frozen chicken and beef hamburgers;Efeito da radiacao ionizante sobre a oxidacao do colesterol em hamburgueres de frango e bovino congelados

    Energy Technology Data Exchange (ETDEWEB)

    Moura, Andrea Figueiredo Procopio de

    2004-07-01

    Several technologies have been developed to assure food quality. Among these technological processes, ionizing radiation has been described as a feasible alternative for food conservation, mainly for meat products, since it keeps their natural properties. In hamburgers, the use of irradiation has been studied due to the frequent implication of such products in outbreaks of food-borne diseases. Some of the outbreaks, which even killed consumers, were caused by E. coli O157:H7. But the use of ionizing radiation in hamburgers may form free radicals able to trigger lipid oxidation in the muscle tissue. As a component of the cell membrane lipids, cholesterol may also undergo oxidation and form biologically active compounds, with atherogenic, mutagenic, cytotoxic and cancerous properties. The aim of this work was to evaluate the occurrence of cholesterol oxidation products in chicken hamburgers and beef hamburgers submitted to irradiation and stored frozen, aerobically and under vacuum. The results showed that irradiation caused an increase of around 11% in the concentration of cholesterol oxides in frozen hamburgers. In chicken hamburgers, an increase in the levels of cholesterol oxides was observed ali over the storage period, while in beef hamburgers it was observed only in the final part of the storage period. Packaging itself did not have a significant effect on the concentrations of cholesterol oxides in either of the types of hamburgers studied. However, it showed a significant interaction with irradiation, that is, vacuum packaging prevented the formation of cholesterol oxides in irradiated beef hamburgers. (author)

  17. [Characteristics of children and adolescents with gender dysphoria referred to the Hamburg Gender Identity Clinic].

    Science.gov (United States)

    Becker, Inga; Gjergji-Lama, Voltisa; Romer, Georg; Möller, Birgit

    2014-01-01

    Given the increasing demand for counselling in gender dysphoria in childhood in Germany, there is a definite need for empirical data on characteristics and developmental trajectories of this clinical group. This study aimed to provide a first overview by assessing demographic characteristics and developmental trajectories of a group of gender variant boys and girls referred to the specialised Gender Identity Clinic in Hamburg. Data were extracted from medical charts, transcribed and analysed using qualitative content analysis methods. Categories were set up by inductive-deductive reasoning based on the patients' parents' and clinicians' information in the files. Between 2006 and 2010, 45 gender variant children and adolescents were seen by clinicians; 88.9% (n = 40) of these were diagnosed with gender identity disorder (ICD-10). Within this group, the referral rates for girls were higher than for boys (1:1.5). Gender dysphoric girls were on average older than the boys and a higher percentage of girls was referred to the clinic at the beginning of adolescence (> 12 years of age). At the same time, more girls reported an early onset age. More girls made statements about their (same-sex) sexual orientation during adolescence and wishes for gender confirming medical interventions. More girls than boys revealed self-mutilation in the past or present as well as suicidal thoughts and/or attempts. Results indicate that the presentation of clinically referred gender dysphoric girls differs from the characteristics boys present in Germany; especially with respect to the most salient age differences. Therefore, these two groups require different awareness and individual treatment approaches.

  18. Walter Baade, Dynamical Astronomer at Goettingen, Hamburg, Mount Wilson, and Palomar Observatories

    Science.gov (United States)

    Osterbrock, D. E.

    2002-09-01

    Walter Baade, famous for his astrophysical discoveries, also made many contributions in dynamical astronomy. His thesis at Goettingen University on the spectroscopic orbit of β Lyrae was based on spectrograms his teacher, Johannes Hartmann, had taken at Potsdam years earlier. Immediately on receiving his Ph.D. in 1919, Baade joined the Hamburg Bergedorf Observatory staff, and soon was the sole observer with its 1-m reflector, the largest telescope in Europe. Under its director, Richard Schorr, Baade's main job at first was to obtain direct plates of asteroids and comets for positional measurements. As an incidental part of this observing he discovered many asteroids, eight of which were eventually named, including 966 Muschi (his wife's nickname), 944 Hidalgo, with large orbital semi-major axis, eccentricity, and inclination, and 1036 Ganymed, whose orbit extends inside that of Mars. Baade also discovered a new comet, 1922 II. During the close approach of Eros in 1930 Baade measured its period of light variation, its color, and its mean magnitude. After Pluto was discovered in 1930 he measured its position assiduously, following it as far from opposition as he could. In 1931 Baade moved to Mount Wilson, where he concentrated almost entirely on globular-cluster, supernova, and galaxy research. He saw many asteroid trails on his long exposures but did not report them except for one, 7448 (still not named), which showed a very long trail on a 3-hr exposure of the Crab nebula. At Palomar, using the 48-in Schmidt soon after it went into operation, he dicovered and reported 1566 Icarus, with a very small perihelion distance, and later his second comet, 1955 VI.

  19. Transmission of hepatitis A in hamburg, germany, 1998-1999--A prospective population based study.

    Science.gov (United States)

    Diel, R; Schneider, S

    2001-01-01

    To study the pattern of transmission of HAV in a large urban community a prospective cohort study was conducted in Hamburg between 1 January 1998 and 31 December 1999. Four hundred and eleven patients were classified as hepatitis A cases comprising 144 foreign and 267 German persons. Univariate analyses were carried out to examine differences between socio-demographic, clinical and behavioural characteristics. To determine independent predictors for HAV infection a multiple logistic-regression model was used. The principal risk factor was travel to areas where hepatitis A is endemic, with 32.6% (n= 134/411) of all documented cases of hepatitis A. Foreign patients who had acquired the infection abroad, mostly children, accounted for the majority of these cases. Of all 411 cases, 42 (10.2%) were associated with parenteral drug, followed by day-care or school contact (8.3%; n = 34). Outbreaks contributed to 11.4% of cases (n = 47), but only 7.1% (n = 29) were household contacts. The low incidence rate among exposed persons in the households of those infected was similar in the groups of foreign and German nationals (17/384 = 4.4% and 12/231 = 5.2%, respectively), which may demonstrate a good hygienic level in general. Our findings suggest that preventive measures such as the improvement of hygienic conditions in a defined general population may contribute to a reduced incidence of hepatitis A. Nevertheless, because hygienic standards may change with time, this policy should be supplemented by targeted vaccination of groups at risk.

  20. Bright Metal-Poor Stars from the Hamburg/ESO Survey. II. A Chemodynamical Analysis

    Science.gov (United States)

    Beers, Timothy C.; Placco, Vinicius M.; Carollo, Daniela; Rossi, Silvia; Lee, Young Sun; Frebel, Anna; Norris, John E.; Dietz, Sarah; Masseron, Thomas

    2017-01-01

    We obtain estimates of stellar atmospheric parameters for a previously published sample of 1777 relatively bright (9Hamburg/ESO Survey. The original Frebel et al. analysis of these stars was able to derive estimates of [Fe/H] and [C/Fe] only for a subset of the sample, due to limitations in the methodology then available. A new spectroscopic analysis pipeline has been used to obtain estimates of {T}{eff}, {log} g, [Fe/H], and [C/Fe] for almost the entire data set. This sample is very local—about 90% of the stars are located within 0.5 kpc of the Sun. We consider the chemodynamical properties of these stars in concert with a similarly local sample of stars from a recent analysis of the Bidelman and MacConnell “weak metal” candidates by Beers et al. We use this combined sample to identify possible members of the halo stream of stars suggested by Helmi et al. and Chiba & Beers, as well as stars that may be associated with stripped debris from the putative parent dwarf of the globular cluster Omega Centauri, suggested to exist by previous authors. We identify a clear increase in the cumulative frequency of carbon-enhanced metal-poor (CEMP) stars with declining metallicity, as well as an increase in the fraction of CEMP stars with distance from the Galactic plane, consistent with previous results. We also identify a relatively large number of CEMP stars with kinematics consistent with the metal-weak thick-disk population, with possible implications for its origin.

  1. Monitoring the Soil Water Availability of Young Urban Trees in Hamburg, Germany

    Science.gov (United States)

    Titel, Selina; Gröngröft, Alexander; Eschenbach, Annette

    2017-04-01

    In large cities numerous trees have to be planted each year to replace died off or cut down trees or for greening of constructed roads and newly built quarters. The typical age of planted trees is between five and fifteen years. Often the planting takes place in special planting pits to stimulate the tree growth under the restricted urban conditions. Consequently, trees are surrounded by different soil substrates: the soil from the nursery in the root ball, the special planting pit substrate and the surrounding urban soil which is often anthropogenic influenced. Being relocated in the city, trees have to cope with the warmer urban climate, the soil sealing and compaction and the low water storage capacity of the substrate. All factors together increase the probability of dry phases for roadside trees. The aim of this study is to monitor the soil water availability at sites of planted roadside trees during the first years after planting. Therefore, a measuring design was developed, which works automatically and takes the complex below ground structure of the soil into account. This approach consists of 13 soil water tension sensors inside and outside of each planting pit up to one meter depth connected to a data logger. The monitoring devices will finally be installed at 20 roadside trees (amongst others Quercus cerris, Quercus robur, Acer platanoides 'Fairview') in Hamburg, Germany, to identify phases of drought stress. The young trees were mainly planted in spring 2016. Data of the first year of measurements show, that the water tension varied between the different soil substrates and the depth. In the first year of tree growth in the city, soil in the tree root ball became significantly drier than the surrounding soil material. In late summer 2016 the water tension in the topsoil had the potential to cause drought stress below some trees.

  2. Formulation and evaluation on human skin of a water-in-oil emulsion containing Muscat hamburg black grape seed extract.

    Science.gov (United States)

    Sharif, A; Akhtar, N; Khan, M S; Menaa, A; Menaa, B; Khan, B A; Menaa, F

    2015-04-01

    Vitis vinifera 'muscat hamburg' (Vitaceae) is a blue-black grape variety commonly found in Pakistan. It has been consumed and used in traditional medicine for centuries. Compared to other grapes, M. hamburg records one of the greatest amount of polyphenols and displays potent antioxidant activities, which make it a great candidate for its exploitation in the development of stable cream emulsions destined to improve the skin appearance. Evaluate the effects of stable water-in-oil (W/O) emulsion containing 2% M. hamburg grape seed extract ('formulation') on human cheek skin in comparison with the placebo ('base'). An occlusive patch test, containing either the formulation or the base, was topically tested for 8 weeks during a winter period in young adult and healthy Pakistani male volunteers. The subjects were instructed to use twice a day the base and the formulation on their right and left cheek skin, respectively. Non-invasive measurements on these skin areas were carried out every week to assess any effects produced on melanin, elasticity and sebum. Skin compatibility assay (Burchard test) was used to report any potential skin reactivity. ANOVA, paired sample t-test and LSD test were applied to determine the statistical data significance. Significant differences (P ≤ 0.05) were found between the placebo and the formulation in terms of their respective skin effects elicited on melanin, elasticity and sebum content. Nevertheless, placebo and formulation exerted similar effects on skin erythema and moisture contents. Importantly, no skin hypersensitivity cases were reported during the whole course of the study. The developed grape-based cream could be efficiently and safely applied to improve a number of skin conditions (e.g. hyper-pigmentation, premature ageing, acne). © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  3. An updated list of type material of Ephemeroptera Hyatt & Arms, 1890, deposited at the Zoological Museum of Hamburg (ZMH).

    Science.gov (United States)

    Sartori, Michel; Kubiak, Martin; Rajaei, Hossein

    2016-01-01

    The type specimens of Ephemeroptera (Insecta) housed at the Zoological Museum of Hamburg (ZMH) are compiled in this document. The current nomenclature of all species is given. In total, Ephemeroptera type material of ZMH encompasses 161 species. Fifty-one holotypes and five lectotypes are present. Forty-one species are represented by syntypes, 85 by paratypes and five by paralectotypes. Material of two species (Cinygma asiaticum Ulmer, 1924 and Pseudocloeon klapaleki Müller-Liebenau, 1982) is missing. The present catalogue is an updated version of Weidner (1964a).

  4. [The Hamburg-model of integrated care for patients with psychosis: Part 1. Rationale, treatment concept and results of the pre-study].

    Science.gov (United States)

    Lambert, Martin; Bock, Thomas; Daubmann, Anne; Meigel-Schleiff, Christina; Lange, Benjamin; Lange, Matthias; Ohm, Gunda; Bussopulos, Alexandra; Frieling, Marietta; Golks, Dietmar; Kerstan, Andrea; König, Hans-Helmut; Nika, Lia; Ruppelt, Friederike; Schödlbauer, Michael; Schöttle, Daniel; Sauerbier, Anne-Lena; Rietschel, Liz; Wegscheider, Karl; Wiedemann, Klaus; Schimmelmann, Benno G; Naber, Dieter; Karow, Anne

    2014-07-01

    The "Hamburg model" designates an integrated care model for severely ill patients with psychotic disorders financed by the health insurance system in accordance with § 140 SGB V. It comprises comprehensive and long-term treatment within a regional network of the psychosis center of the University Medical Center Hamburg-Eppendorf (UKE) and private psychiatrists. The treatment model consists of therapeutic assertive community treatment (ACT) provided by a highly specialized treatment team and need-adapted in- and outpatient care. The present article summarizes the disease- and treatment-specific rationales for the model development as well as the model structure and treatment contents. The article further summarizes the effectiveness and efficiency results of a study comparing the Hamburg model and treatment as usual (without ACT) within a 12-month follow-up study (ACCESS trial). © Georg Thieme Verlag KG Stuttgart · New York.

  5. [Comparability of studies of epidemiological research on aging : Results from the Longitudinal Urban Cohort Ageing Study (LUCAS) and three representative Hamburg cross-sectional studies of healthy aging].

    Science.gov (United States)

    Dapp, Ulrike; Dirksen-Fischer, Martin; Rieger-Ndakorerwa, Gudrun; Fertmann, Regina; Stender, Klaus-Peter; Golgert, Stefan; von Renteln-Kruse, Wolfgang; Minder, Christoph E

    2016-05-01

    Participants of the Longitudinal Urban Cohort Ageing Study (LUCAS) were recruited from patients 60 years and older from general practitioner's offices in Hamburg. This is different from the usual methods of drawing representative samples. The research question addressed the comparability of LUCAS results with those from cross-sectional surveys with participants randomly chosen from a population list. Therefore, the LUCAS data collected in four waves during the first 12 years were compared with data (age, gender) from the Hamburg Statistics Office (HSO), and selected characteristics (socio-demography, health, mobility) from three representative cross-sectional surveys in older Hamburg citizens. First, HSO data compiled in population pyramids for older men and women were compared with equivalent pyramids based on the LUCAS data at recruitment (2000/01) and in waves 2 to 4. Second, characteristics worded identically in the cross-sectional surveys and the simultaneous LUCAS waves were compared. The LUCAS population pyramids were in good accordance at all time points with those of the general older population in Hamburg (except ages 60-64 in men in 2000). Good comparability was also found for health related characteristics from the three representative studies and simultaneous LUCAS waves (e. g. need of nursing care in 2012: LUCAS 7.1 %; Hamburg 7.4 %). Information on health in old age generated periodically in the LUCAS cohort was largely comparable with that from representative cross-sectional studies and statistics registries. Older people are frequently under-represented in epidemiological studies. Therefore, the LUCAS data may provide useful information for Hamburg and similar metropolitan areas in Germany.

  6. Unidentified atmospheric absorption structure observed by DOAS near Hamburg harbour, Germany

    Science.gov (United States)

    Schmitt, Stefan; Weigelt, Andreas; Mathieu-Üffing, Barbara; Seyler, André; Wittrock, Folkard; Lampel, Johannes; Pöhler, Denis; Platt, Ulrich

    2017-04-01

    Within a six week campaign in July and August 2016, Long Path (LP)-DOAS measurements were performed near the harbour of Hamburg to monitor ship emissions of NO2 and SO2. LP-DOAS instruments retrieve information about the composition of ambient air using active spectroscopy. Therefore, an absorption light path was set up between the northern and the southern riverside of the river Elbe with a total length of ca. 5.7 km. The light of a laser driven Xenon arc lamp was sent to a retro reflector mounted on a light house on the opposite riverside. By comparing the spectrum of the Xenon lamp before and after being sent through the atmosphere, spectral absorption structures of several molecules can be identified and their mixing ratios can be quantified. Besides the well-known trace gas species such as NO2, SO2, O3 and HCHO, a so far unidentified, strong absorption structure could be observed regularly throughout the measurement period. The structure is similar to other known absorption structures in the UV-vis range and can be most likely associated with a molecular absorption cross section. The absorber features a progression of absorption bands in the range of 280 nm to 330 nm with an average band distance of 3 nm to 4 nm. These bands were observed with optical densities of up to 2 per cent along the absorption path. The absorber predominantly occurs during daylight indicating that photolytic processes are most likely to play an important role. Further, direct emission from ships could be excluded by the comparison with NO2 peaks, which serve as a proxy for ship plumes. The respective LP-DOAS instrument was deployed at multiple other measurement sites at the past including rural, urban and remote areas. However, the discussed absorption structure has never been detected before and instrumental errors can be excluded. Currently, MAX-DOAS measurements performed at the same site are evaluated. We will present the spectral features of the putative absorber as well as an

  7. Protracted outbreak of S. Enteritidis PT 21c in a large Hamburg nursing home

    Science.gov (United States)

    Frank, Christina; Buchholz, Udo; Maaß, Monika; Schröder, Arthur; Bracht, Karl-Hans; Domke, Paul-Gerhard; Rabsch, Wolfgang; Fell, Gerhard

    2007-01-01

    Background During August 2006, a protracted outbreak of Salmonella (S.) Enteritidis infections in a large Hamburg nursing home was investigated. Methods A site visit of the home was conducted and food suppliers' premises tested for Salmonella. Among nursing home residents a cohort study was carried out focusing on foods consumed in the three days before the first part of the outbreak. Instead of relying on residents' memory, data from the home's patient food ordering system was used as exposure data. S. Enteritidis isolates from patients and suspected food vehicles were phage typed and compared. Results Within a population of 822 nursing home residents, 94 case patients among residents (1 fatality) and 17 among staff members were counted 6 through 29 August. The outbreak peaked 7 through 9 August, two days after a spell of very warm summer weather. S. Enteritidis was consistently recovered from patients' stools throughout the outbreak. Among the food items served during 5 through 7 August, the cohort study pointed to afternoon cake on all three days as potential risk factors for disease. Investigation of the bakery supplying the cake yielded S. Enteritidis from cakes sampled 31 August. Comparison of the isolates by phage typing demonstrated both isolates from patients and the cake to be the exceedingly rare phage type 21c. Conclusion Cake (various types served on various days) contaminated with S. Enteritidis were the likely vehicle of the outbreak in the nursing home. While the cakes were probably contaminated with low pathogen dose throughout the outbreak period, high ambient summer temperatures and failure to keep the cake refrigerated led to high pathogen dose in cake on some days and in some of the housing units. This would explain the initial peak of cases, but also the drawn out nature of the outbreak with cases until the end of August. Suggestions are made to nursing homes, aiding in outbreak prevention. Early outbreak detection is crucial, such that

  8. Urban air temperature anomalies and their relation to soil moisture observed in the city of Hamburg

    Directory of Open Access Journals (Sweden)

    Sarah Wiesner

    2014-09-01

    Full Text Available The spatial variability of the urban air temperature for the city of Hamburg is analyzed based upon a one-year dataset of meteorological and pedological measurements. As local air temperature anomalies are subject to land-use and surface cover, they are monitored by a network of measurement stations within three different urban structures. Mean annual temperature deviations are found to be +1.0K$+1.0\\,\\text{K}$ for inner city sites and +0.25K$+0.25\\,\\text{K}$ to -0.2K$-0.2\\,\\text{K}$ for suburban sites compared to a rural reference. The nocturnal urban heat island (UHI is identified and averages +1.7K$+1.7\\,\\text{K}$ at the inner city stations, +0.7K$+0.7\\,\\text{K}$ at a suburban district housing area and +0.3K$+0.3\\,\\text{K}$ at a nearby green space. The observed UHI effect is most prominent when the wind speed is low (≤2ms-1$\\leq2\\,\\text{ms}^{-1}$ and the sky is only partly cloudy (≤6∕8th$\\leq6/8^{\\text{th}}$. In spring 2011 an average inner city UHI of up to +5.2K$+5.2\\,\\text{K}$ is observed during situations matching these conditions, while the extraordinary dry fall of 2011 lead to remarkably high air temperature differences at all observed stations. As expected, no evidence for a significant impact of topsoil moisture on nighttime UHI effect is found. The analysis of air temperature anomalies during daytime results in an annual mean deviation of -0.5K$-0.5\\,\\text{K}$ above unsealed, vegetated surfaces from a sealed site during days with a turbulent mixing induced by wind speed >2ms-1$>2\\,\\text{ms}^{-1}$. Here, there is an indication for a relation between the water content of upper soil layers and the warming of air: 11 to 17 % of the variance of the diurnal air temperature span is found to be explained by the soil water content for selected relevant days.

  9. [Transfer and Implementation of Innovative Awareness and Education Measures, e-Mental Health and Care Models in psychenet - Hamburg Network for Mental Health].

    Science.gov (United States)

    Lambert, Martin; Härter, Martin; Brandes, Andreas; Hillebrandt, Bernd; Schlüter, Catarina; Quante, Susanne

    2015-07-01

    The Hamburg Network for Mental Health belongs to the healthcare regions in Germany, funded by the Federal Ministry of Education and Research from 2011 to 2015. More than 330 partners from research, health care, health industry and government are promoting innovative health care models and products to improve mental health care in Hamburg. The main objectives comprise the sustained implementation of the Network itself and of successful health care models and products. The article describes current and future implementation possibilities and the present state of the implementation process. © Georg Thieme Verlag KG Stuttgart · New York.

  10. The role of forensic medicine and forensic dentistry in estimating the chronological age of living individuals in Hamburg, Germany.

    Science.gov (United States)

    Mansour, Hussam; Fuhrmann, Andreas; Paradowski, Ioana; van Well, Eilin Jopp; Püschel, Klaus

    2017-03-01

    Age estimation represents one of the primary responsibilities of forensic medicine and forensic dentistry. It is an integral procedure aiming to estimate the chronological age of an individual, whose age is either unknown or doubtful, by means of assessing the stage of dental, skeletal, and physical development. The present publication reviews the methods and procedures used in estimating the age of young living individuals as well as the experiences of the Institute of Legal Medicine in Hamburg-Eppendorf, Germany, during the last 25 years. From 1990 to 2015, 4223 age estimations were carried out in Hamburg. During this time, forensic age estimation was requested by different concerned authorities including courts, the foreigners' registration office (Zentrale Ausländerbehörde), and the state office of education and consultation (Landesbetrieb Erziehung und Beratung). In the context of judicial proceedings, orthopantomograms, as well as X-ray examinations of both the left hand and the medial clavicular epiphyses were carried out in accordance with AGFAD recommendations. For investigations not associated with judicial proceedings, orthopantomogram examinations play a key role in the process of age estimation, due to their high diagnostic value and low radiation exposure. Since 2009, mainly unaccompanied young refugees were examined for age estimation. Orthopantomograms and clinical-physical examinations have been used as essential steps in this context to determine whether an individual is 18 years or less. Additional X-ray examinations of the left hand and the medial clavicular epiphyses have been used less frequently.

  11. Effect of the addition of chia's by-product on the composition of fatty acids in hamburgers through chemometric methods.

    Science.gov (United States)

    Souza, Aloisio H P; Gohara, Aline K; Rotta, Eliza M; Chaves, Marcia A; Silva, Claudia M; Dias, Lucia F; Gomes, Sandra T M; Souza, Nilson E; Matsushita, Makoto

    2015-03-30

    Hamburger is a meat-based food that is easy to prepare and is widely consumed. It can be enriched using different ingredients, such as chia's by-product, which is rich in omega-3. Chemometrics is a very interesting tool to assess the influence of ingredients in the composition of foods. A complete factorial design 2(2) (two factors in two levels) with duplicate was performed to investigate the influence of the factors (1) concentration of textured soy proteins (TSP) and (2) concentration of chia flour partially defatted (CFPD) as a partial replacement for the bovine meat and porcine fat mix in hamburgers. The results of proximal composition, lipid oxidation, fatty acids sums, ratios, and nutritional indexes were used to propose statistical models. The factors TSP and CFPD were significant, and the increased values contributed to improve the composition in fatty acids, crude protein, and ash. Principal components analysis distinguished the samples with a higher content of chia. In desirability analysis, the highest level of TSP and CFPD was described as the optimal region, and it was not necessary to make another experimental point. The addition of chia's by-product is an alternative to increase the α-linolenic contents and to obtain nutritionally balanced food. © 2014 Society of Chemical Industry.

  12. "History had taken such a large piece out of my life" - Neuroscientist refugees from Hamburg during National Socialism.

    Science.gov (United States)

    Zeidman, Lawrence A; von Villiez, Anna; Stellmann, Jan-Patrick; van den Bussche, Hendrik

    2016-01-01

    Approximately 9,000 physicians were uprooted for so-called "racial" or "political" reasons by the Nazi regime and 6,000 fled Germany. These refugees are often seen as survivors who contributed to a "brain drain" from Germany. About 432 doctors (all specialties, private and academic) were dismissed from the major German city of Hamburg. Of these, 16 were Hamburg University faculty members dismissed from their government-supported positions for "racial" reasons, and, of these, five were neuroscientists. In a critical analysis, not comprehensively done previously, we will demonstrate that the brain drain did not equal a "brain gain." The annihilation of these five neuroscientists' careers under different but similar auspices, their shameful harassment and incarceration, financial expropriation by Nazi ransom techniques, forced migration, and roadblocks once reaching destination countries stalled and set back any hopes of research and quickly continuing once-promising careers. A major continuing challenge is finding ways to repair an open wound and obvious vacuum in the German neuroscience community created by the largely collective persecution of colleagues 80 years ago.

  13. Borrelia burgdorferi sensu lato and co-infections with Anaplasma phagocytophilum and Rickettsia spp. in Ixodes ricinus in Hamburg, Germany.

    Science.gov (United States)

    May, K; Jordan, D; Fingerle, V; Strube, C

    2015-12-01

    To obtain initial data on Borrelia burgdorferi sensu lato (Spirochaetales: Spirochaetaceae) in Ixodes ricinus (Ixodida: Ixodidae) ticks in Hamburg, Germany, 1400 questing ticks were collected by flagging at 10 different public recreation areas in 2011 and analysed using probe-based quantitative real-time polymerase chain reaction. The overall rate of infection with B. burgdorferi s.l. was 34.1%; 30.0% of adults were infected (36.7% of females and 26.0% of males), as were 34.5% of nymphs. Significant differences in tick infection rates were observed between the spring and summer/autumn months, as well as among sampling locations. Borrelia genospecies identification by reverse line blotting was successful in 43.6% of positive tick samples. The most frequent genospecies was Borrelia garinii/Borrelia bavariensis, followed by Borrelia afzelii, Borrelia valaisiana, B. burgdorferi sensu stricto, Borrelia spielmanii, Borrelia bissettii and Borrelia lusitaniae. Based on previously published data, co-infection of Borrelia and Rickettsiales spp. was determined in 25.8% of ticks. Overall, 22.9% of ticks were co-infected with Rickettsia spp. (Rickettsiales: Rickettsiaceae), 1.7% with Anaplasma phagocytophilum (Rickettsiales: Anaplasmataceae), and 1.2% with both pathogens. Study results show a high prevalence of Borrelia-positive ticks in recreation areas in the northern German city of Hamburg and the potential health risk to humans in these areas should not be underestimated. © 2015 The Royal Entomological Society.

  14. Semen quality in sub-fertile range for a significant proportion of young men from the general German population: a co-ordinated, controlled study of 791 men from Hamburg and Leipzig

    DEFF Research Database (Denmark)

    Paasch, U.; Salzbrunn, A.; Glander, H.J.

    2008-01-01

    of a general trend in Europe. We therefore carried out a prospective study of semen quality of young men raised in the former East Germany (Leipzig) and West Germany (Hamburg). To enable inter-regional comparisons, we utilized a common European research protocol previously used in studies in the Nordic......-Baltic region. Three hundred and thirty-four young men representative of the general population from Hamburg, and 457 from Leipzig delivered semen samples, underwent physical examinations and provided information on life-style and reproductive health parameters. The study period in Hamburg was February 2003......--July 2004, and in Leipzig July 2003--April 2005. No significant differences were observed in sperm concentration (median 46, 42, and 44 million/mL for men from Hamburg, Leipzig and the combined Hamburg-Leipzig group respectively) or total sperm count (154,141 and 149 million), whereas the differences...

  15. Modelling the urban air quality in Hamburg with the new city-scale chemistry transport model CityChem

    Science.gov (United States)

    Karl, Matthias; Ramacher, Martin; Aulinger, Armin; Matthias, Volker; Quante, Markus

    2017-04-01

    Air quality modelling plays an important role by providing guidelines for efficient air pollution abatement measures. Currently, most urban dispersion models treat air pollutants as passive tracer substances or use highly simplified chemistry when simulating air pollutant concentrations on the city-scale. The newly developed urban chemistry-transport model CityChem has the capability of modelling the photochemical transformation of multiple pollutants along with atmospheric diffusion to produce pollutant concentration fields for the entire city on a horizontal resolution of 100 m or even finer and a vertical resolution of 24 layers up to 4000 m height. CityChem is based on the Eulerian urban dispersion model EPISODE of the Norwegian Institute for Air Research (NILU). CityChem treats the complex photochemistry in cities using detailed EMEP chemistry on an Eulerian 3-D grid, while using simple photo-stationary equilibrium on a much higher resolution grid (receptor grid), i.e. close to industrial point sources and traffic sources. The CityChem model takes into account that long-range transport contributes to urban pollutant concentrations. This is done by using 3-D boundary concentrations for the city domain derived from chemistry-transport simulations with the regional air quality model CMAQ. For the study of the air quality in Hamburg, CityChem was set-up with a main grid of 30×30 grid cells of 1×1 km2 each and a receptor grid of 300×300 grid cells of 100×100 m2. The CityChem model was driven with meteorological data generated by the prognostic meteorology component of the Australian chemistry-transport model TAPM. Bottom-up inventories of emissions from traffic, industry, households were based on data of the municipality of Hamburg. Shipping emissions for the port of Hamburg were taken from the Clean North Sea Shipping project. Episodes with elevated ozone (O3) were of specific interest for this study, as these are associated with exceedances of the World

  16. A Comparison of the Motor Ability of 8 and 9 Year Old Primary School Children in Hamburg, Melbourne and Cape Town--An Exploratory Study

    Science.gov (United States)

    Kretschmer, Jurgen; Saunders, John; Bressan, Liz; Erhorn, Jan; Wirszing, Daniel

    2013-01-01

    An increasing worldwide concern about a decline in the quality of the motor ability of children was the motivation for this exploratory comparative study. It involves a comparison of the motor ability of children aged 8 and 9 years from Hamburg (n = 774), Melbourne (n = 141) and Cape Town (n = 81). Since each of these global cities represents a…

  17. Evaluation of the Hamburg Rut Tester and Moisture Induced Stress Test (MIST) for field control of hot mix asphalt (HMA) in Oklahoma : final report.

    Science.gov (United States)

    2013-03-01

    This report covers the evaluation of the Hamburg Loaded Wheel Rut Tester (OHD L-55) and the : Moisture Induced Stress Tester (MIST) for field control of Oklahoma HMA mixtures. OHD L-55 : was evaluated as a possible replacement for AASHTO T 283 and fo...

  18. Circulation and Internationalisation of Pedagogical Concepts and Practices in the Discourse of Education: The Hamburg School Reform Experiment (1919-1933)

    Science.gov (United States)

    Mayer, Christine

    2014-01-01

    In the context of the international exchange of school reform ideas and concepts, the new schools in Hamburg were recognised as exemplary instances of a revolutionary and forceful reform in the public elementary school systems. Based on studies of transfer and their premise that the transnational transfer of ideas, practices and objects does not…

  19. The "Hamburger Connection" as Ecologically Unequal Exchange: A Cross-National Investigation of Beef Exports and Deforestation in Less-Developed Countries

    Science.gov (United States)

    Austin, Kelly

    2010-01-01

    This study explores Norman Myers's concept of the "hamburger connection" as a form of ecologically unequal exchange, where more-developed nations are able to transfer the environmental costs of beef consumption to less-developed nations. I used ordinary least squares (OLS) regression to test whether deforestation in less-developed…

  20. Prevalence of Rickettsiales (Anaplasma phagocytophilum and Rickettsia spp.) in hard ticks (Ixodes ricinus) in the city of Hamburg, Germany.

    Science.gov (United States)

    May, Kathrin; Strube, Christina

    2014-06-01

    To narrow the gap of missing knowledge on Rickettsia spp. and Anaplasma phagocytophilum infections in ticks in northwestern Germany and, at the same time, to provide first prevalence data on these pathogens in the city of Hamburg, a total of 1,400 questing Ixodes ricinus ticks were collected at ten different public green areas from April until October 2011. Ticks were examined using probe-based quantitative real-time PCR. A percentage of 3.6% (51/1,400) ticks were tested positive for A. phagocytophilum infections divided into 2.1% (3/141) adults [1.7% (1/60) females and 2.5% (2/81) males] and 3.8% (48/1,259) nymphs. The percentage of infected ticks per sampling site varied statistically significantly from 0.7% (1/140) to 12.1% (17/140), whereas between sampling months, no statistically significant differences were observed (2.0-6.5%, 4-13/140). The overall Rickettsia spp. infection rate was 52.5% (735/1,400). In adult ticks, Rickettsia spp. infection rate was 56% (79/141) divided into 61.7% (37/60) infected females and 51.9% (42/81) infected males. Nymphs showed an infection rate of 52.1% (656/1,259). In contrast to A. phagocytophilum infections, no statistically significant differences in Rickettsia spp. infection rates among sampling sites (44.3-63.6%, 62-89/140) were observed, whereas seasonal variations were obvious: the percentage of Rickettsia-positive ticks was significantly lower in April (36.5%, 73/200) and May (29.5%, 59/200) compared to the summer and fall months (55.0-64.5%, 110-129/200). Rickettsia species differentiation via real-time pyrosequencing revealed Rickettsia helvetica as the only occurring species. Co-infections with both Rickettsia spp. and A. phagocytophilum were detected in 2.0% (28/1,400) of the ticks. The present study revealed that in the city of Hamburg, the tick infection rate with A. phagocytophilum is comparable with other German data, whereas the Rickettsia spp. infection rate of 52.5% is by far the highest prevalence detected in

  1. A new era in science at Washington University, St. Louis: Viktor Hamburger's zoology department in the 1940's.

    Science.gov (United States)

    Carson, H L

    2001-04-01

    In the early 1940s, the administration of the College of Arts and Sciences at Washington University, St. Louis was firmly in the hands of classical scholars who were not inclined to promote the development of modern research on scientific subjects. Funds supporting research in biology favored the School of Medicine and the Missouri Botanical Garden. Viktor Hamburger arrived at Washington University in 1935. At about the time he became the Acting Chairman of Zoology in 1942, research work in the biological departments began a dramatic surge that has continued to this day. For 65 years under his counsel and leadership, basic biology has thrived at this fine institution. As an early faculty recruit, I recount here a few personal recollections from those formative years.

  2. John Lennon, autograph hound: The fan-musician community in Hamburg's early rock-and-roll scene, 1960–65

    Directory of Open Access Journals (Sweden)

    Julia Sneeringer

    2011-03-01

    Full Text Available This article explores the Beat music scene in Hamburg, West Germany, in the early 1960s. This scene became famous for its role in incubating the Beatles, who played over 250 nights there in 1960–62, but this article focuses on the prominent role of fans in this scene. Here fans were welcomed by bands and club owners as cocreators of a scene that offered respite from the prevailing conformism of West Germany during the Economic Miracle. This scene, born at the confluence of commercial and subcultural impulses, was also instrumental in transforming rock and roll from a working-class niche product to a cross-class lingua franca for youth. It was also a key element in West Germany's broader processes of democratization during the 1960s, opening up social space in which the meanings of authority, respectability, and democracy itself could be questioned and reworked.

  3. The preference and actual use of different types of rural recreation areas by urban dwellers--the Hamburg case study.

    Directory of Open Access Journals (Sweden)

    Thiemen Boll

    Full Text Available In the wake of urbanisation processes and the constitution of metropolitan regions, the role of the city's rural surroundings is receiving more attention from researchers and planners as rural areas offer various (cultural ecosystem services for the urban population. Urban dwellers increasingly desire recreation and landscape experience. Although this need for recreation is generally recognized, few studies have focused on the question of people's preferences for certain types and characteristics of outdoor recreation areas in relation to the frequency of use. In order to acquire baseline data on this subject, the main objectives of this study were to explore recreation preferences of urban dwellers and the relation between actual use and perceived value of recreation areas in a case study in the Hamburg Metropolitan Region (Germany. In a social survey, Hamburg residents (n = 400 were asked about their preferences and use of four important regional recreation areas with different landscape characteristics in face-to-face interviews in different locations in the city. We found that both outdoor recreation within and outside of the city were fairly or very important for more than 70% of the questioned urban dwellers. Interestingly, the preference for a recreation area outside of the city did not depend on the frequency of use, which indicates that certain recreation areas had a symbolic value besides their use value. When people were questioned on the characteristics of recreation areas, perceived naturalness was found to be strongly related to preference. Respondents considered the diversity, uniqueness, and naturalness of the landscape to be far more important than the accessibility of the recreation areas and the provision of service facilities.

  4. The preference and actual use of different types of rural recreation areas by urban dwellers--the Hamburg case study.

    Science.gov (United States)

    Boll, Thiemen; von Haaren, Christina; von Ruschkowski, Eick

    2014-01-01

    In the wake of urbanisation processes and the constitution of metropolitan regions, the role of the city's rural surroundings is receiving more attention from researchers and planners as rural areas offer various (cultural) ecosystem services for the urban population. Urban dwellers increasingly desire recreation and landscape experience. Although this need for recreation is generally recognized, few studies have focused on the question of people's preferences for certain types and characteristics of outdoor recreation areas in relation to the frequency of use. In order to acquire baseline data on this subject, the main objectives of this study were to explore recreation preferences of urban dwellers and the relation between actual use and perceived value of recreation areas in a case study in the Hamburg Metropolitan Region (Germany). In a social survey, Hamburg residents (n = 400) were asked about their preferences and use of four important regional recreation areas with different landscape characteristics in face-to-face interviews in different locations in the city. We found that both outdoor recreation within and outside of the city were fairly or very important for more than 70% of the questioned urban dwellers. Interestingly, the preference for a recreation area outside of the city did not depend on the frequency of use, which indicates that certain recreation areas had a symbolic value besides their use value. When people were questioned on the characteristics of recreation areas, perceived naturalness was found to be strongly related to preference. Respondents considered the diversity, uniqueness, and naturalness of the landscape to be far more important than the accessibility of the recreation areas and the provision of service facilities.

  5. Effectiveness of inactivation of foodborne pathogens during simulated home pan frying of steak, hamburger or meat strips.

    Science.gov (United States)

    Lahou, Evy; Wang, Xiang; De Boeck, Elien; Verguldt, Elien; Geeraerd, Annemie; Devlieghere, Frank; Uyttendaele, Mieke

    2015-08-03

    In order to evaluate the effect of simulated home pan frying of raw meat and meat preparations of different animal species on the thermal inactivation of pathogens, the heat resistance (D-value) of three strains of Campylobacter jejuni, Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes and two strains of generic E. coli was validated in BHI and adjusted BHI (i.e. pH5.6 and 1.5% NaCl) at 60°C. The D-values were obtained of the linear phase of the survivor curves created in GInaFiT, a freeware tool to fit models to experimental data. The obtained D-values corresponded to those previously published in literature and confirmed L. monocytogenes to be the most heat resistant pathogen among them. Heat treatment in adjusted BHI significantly increased heat-resistance of E. coli O157:H7 and generic E. coli. Subsequently, the thermal inactivation of L. monocytogenes, Salmonella spp., C. jejuni and E. coli O157:H7 was evaluated using a standardized procedure simulating commonly used home pan frying of various types of meat including steaks or filets, hamburgers and meat strips from various animal species such as pork, beef, chicken, lamb and some turkey, horse, kangaroo and crocodile meat. Corresponding F70-values were calculated based upon measured core time/temperature profiles. It was noted that a core temperature of 70 °C was not always achieved and, moreover, a heat treatment equivalent to 2 min at 70 °C was also not always obtained. This was in particular noted in hamburgers although the meat was visually judged well done. On several occasions, residual survivors of the initial inoculated (4 logCFU/g) food borne pathogens could be recovered either by enumeration (limit of detection 1 logCFU/g) or by the presence/absence testing per 25 g. Pan frying of hamburgers yielded the highest number of surviving pathogenic bacteria (46%), followed by well-done filets and steaks (13%) and meat strips (12%). Taking only steaks (beef, horse, kangaroo, crocodile and

  6. HAMBÚRGUERES FORMULADOS COM BASE PROTÉICA DE PESCADO HAMBURGERS FORMULATES WITH FISH PROTEIN BASE

    Directory of Open Access Journals (Sweden)

    D.R.S. SIMÕES

    1998-10-01

    Full Text Available A recuperação das proteínas de pescado, de espécies de baixo valor comercial ou de subprodutos de sua industrialização, constitui-se em ma alternativa promissora para a elaboração de produtos alimentícios de alta qualidade nutricional e economicamente viáveis. O objetivo deste trabalho foi obter uma Base-Protéica-de-Pescado (BPP que permitisse elaborar hambúrgueres com diferentes sabores. Pela disponibilidade e baixo custo de matéria-prima foi utilizada a pescada (Cynoscion striatus. A parte comestível, essencialmente músculo, foi submetida a sucessivas lavagens para retirar matéria solúvel e odores característicos, controlando-se as variáveis: solvente, soluto/solvente, tempo, temperatura, regime de agitação e número de ciclos de lavagens. A matéria-prima e BPP foram caracterizadas pelas propriedades físico-químicas e microbiológicas. O tratamento estatístico dos resultados, mediante modelo fatorial, permitiu verificar que é possível obter uma BPP, principalmente sem o sabor e odor característico do pescado, utilizando uma parte de soluto para cada duas de solvente, independente do tempo do ciclo de lavagens. A BPP foi utilizada para elaborar seis diferentes tipos de hambúrgueres e, mediante avaliação sensorial, utilizando escala hedônica para sabor, ficou evidenciada a aceitação de todos esses produtos não havendo preferência por um específico. Os resultados experimentais levam a concluir que a BPP, obtida a partir da pescada, pode ser utilizada na elaboração de hambúrgueres com bons atributos sensoriais e nutricionais.The utilization of fish protein, from species of low commercial value or subproducts of industrialization, became a promising alternative for the food products development with high nutritive quality and economically feasible. The goal of this work was to obtain a Fish Protein Base (FPB wich allowed preparation of different flavors of hamburgers. Whting Cynoscion striatu was used, due to

  7. Mortality and life expectancy of professional fire fighters in Hamburg, Germany: a cohort study 1950 – 2000

    Directory of Open Access Journals (Sweden)

    Peschke Michel

    2006-10-01

    Full Text Available Abstract Background The healthy worker effect may hide adverse health effects in hazardous jobs, especially those where physical fitness is required. Fire fighters may serve as a good example because they sometimes are severely exposed to hazardous substances while on the other hand their physical fitness and their strong health surveillance by far exceeds that of comparable persons from the general population. Methods To study this effect a historic cohort study was conducted to assess mortality and life expectancy of professional fire fighters of the City of Hamburg, Germany. Fire departments and trade unions questioned the validity of existing studies from outside Germany because of specific differences in the professional career. No mortality study had been conducted so far in Germany and only few in Europe. Information on all active and retired fire fighters was extracted from personnel records. To assure completeness of data the cohort was restricted to all fire fighters being active on January 1, 1950 or later. Follow up of the cohort ended on June 30th 2000. Vital status was assessed by personnel records, pension fund records and the German residence registries. Mortality of fire fighters was compared to mortality of the Hamburg and German male population by means of standardized mortality ratios. Life expectancy was calculated using life table analysis. Multivariate proportional hazard models were used to assess the effect of seniority, time from first employment, and other occupational characteristics on mortality. Results The cohort consists of 4640 fire fighters accumulating 111796 person years. Vital status could be determined for 98.2% of the cohort. By the end of follow up 1052 person were deceased. Standardized Mortality Ratio (SMR for the total cohort was 0.79 (95% CI, 0.74–0.84 compared to Hamburg reference data and 0.78 (95% CI, 0.74–0.83 compared to National German reference data. Conditional life expectancy of a 30 year

  8. Vom "vorklinischen Studienabschnitt" zu "Medizin I" [The new pre-clinical curriculum "Medicine I" at Hamburg Medical School

    Directory of Open Access Journals (Sweden)

    Kuhnigk, Olaf

    2006-05-01

    Full Text Available [english] A revision of the educational law (ÄAppO in Germany requires major reorganization of the curricula since 2002. Hamburg Medical Faculty introduced interdisciplinary education into the pre-clinical education integrating case-based and problem-based theoretical knowledge of medical preclinical subjects with practical skills. For this curricular change an independent curriculum committee was established by the faculty board. Reformation was carried out in close cooperation of the departments of medical science and basic science and was accompanied by a central evaluation organized by the office of the vice-dean of education. Curriculum contents were distributed on the basis of an interdisciplinary learning spiral with horizontal and vertical connections of basic and medical science subjects. Basic sciences are strictly focussed on medically relevant topics as required by the new ÄAppO. Case-based learning has become the major focus during "Integrated seminars" where small group discussions, self-studies, essays, and short reports form the basis for modern didactics. Electives are offered on the basis of the research profiles determined by the medical basic sciences. Training of basic medical skills is offered during the course "Introduction to clinical medicine". Students´ parcours through the curriculum are analysed by regular feedback meetings and followed by a computer programme. For better management of information the internet homepage of Hamburg medical faculty was reorganized. Positive results of evaluation and exams confirm a successful reform of the pre-clinical curriculum. [german] Die neue Approbationsordnung für Ärzte (ÄAppO stellt die Universitäten seit 2002 vor die Aufgabe einer weit reichenden Umstrukturierung des Medizinstudiums. An der Medizinischen Fakultät in Hamburg erfolgte die Einführung einer fächerübergreifenden Ausbildung, die an den medizinischen Grundlagenfächern orientiert fallbasiert und

  9. [The Hamburg-model of integrated care for patients with psychosis: Part 2. Results of the clinical course over 2- and 4-years of treatment].

    Science.gov (United States)

    Karow, Anne; Bock, Thomas; Daubmann, Anne; Meigel-Schleiff, Christina; Lange, Benjamin; Lange, Matthias; Ohm, Gunda; Bussopulos, Alexandra; Frieling, Marietta; Golks, Dietmar; Kerstan, Andrea; König, Hans-Helmut; Nika, Lia; Lange, Matthias; Ruppelt, Friederike; Schödlbauer, Michael; Schöttle, Daniel; Sauerbier, Anne-Lena; Rietschel, Liz; Wegscheider, Karl; Wiedemann, Klaus; Schimmelmann, Benno G; Naber, Dieter; Lambert, Martin

    2014-07-01

    Since the beginning of the integrated care model for severely ill patients with psychotic disorders ("Hamburg model") in 2007 different clinical parameters have been consecutively assessed within a naturalistic, observational, prospective study. Clinical outcome of the 2-year and 4-year follow-ups of n = 158 patients. A significant and ongoing improvement of psychopathology, severity of illness, functional outcome, quality of life and satisfaction with care in this sample of severely ill and merely chronic patients with psychosis was shown. Moreover, medication adherence improved and quality and quantity of outpatient treatment increased. The ongoing psychosocial stabilisation of the patients most likely result from a combination of various factors: continuity of care, multimodal and individualized care, therapeutic specialisation and the multidisciplinary ACT team. RESULTS provide clinical and scientific evidence for future implementations of the integrated care model "Hamburg Model" for the treatment of psychosis. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Gelingende Integration? Anmerkungen zur Studie von D. Katzenbach u.a. uber den Hamburger Schulversuch "Integrative Grundschule" in ZfPad. 45 (1999), S. 567-590 (Successful Integration? Remarks on the Study by D. Katzenbach et al. on the Hamburg School Experiment "Integrative Elementary School" in ZfPad. 45 (1999), S. 567-590).

    Science.gov (United States)

    Roeder, Peter Martin

    1999-01-01

    Critiques two normative premises that guide the researchers' interpretation of results from the Hamburg School Experiment, an empirical study that focused on mainstreaming elementary students diagnosed as needing special education: (1) integrating these children in normal classrooms is legitimated; and (2) social integration should not preclude…

  11. Determination of fat content in chicken hamburgers using NIR spectroscopy and the Successive Projections Algorithm for interval selection in PLS regression (iSPA-PLS)

    Science.gov (United States)

    Krepper, Gabriela; Romeo, Florencia; Fernandes, David Douglas de Sousa; Diniz, Paulo Henrique Gonçalves Dias; de Araújo, Mário César Ugulino; Di Nezio, María Susana; Pistonesi, Marcelo Fabián; Centurión, María Eugenia

    2018-01-01

    Determining fat content in hamburgers is very important to minimize or control the negative effects of fat on human health, effects such as cardiovascular diseases and obesity, which are caused by the high consumption of saturated fatty acids and cholesterol. This study proposed an alternative analytical method based on Near Infrared Spectroscopy (NIR) and Successive Projections Algorithm for interval selection in Partial Least Squares regression (iSPA-PLS) for fat content determination in commercial chicken hamburgers. For this, 70 hamburger samples with a fat content ranging from 14.27 to 32.12 mg kg- 1 were prepared based on the upper limit recommended by the Argentinean Food Codex, which is 20% (w w- 1). NIR spectra were then recorded and then preprocessed by applying different approaches: base line correction, SNV, MSC, and Savitzky-Golay smoothing. For comparison, full-spectrum PLS and the Interval PLS are also used. The best performance for the prediction set was obtained for the first derivative Savitzky-Golay smoothing with a second-order polynomial and window size of 19 points, achieving a coefficient of correlation of 0.94, RMSEP of 1.59 mg kg- 1, REP of 7.69% and RPD of 3.02. The proposed methodology represents an excellent alternative to the conventional Soxhlet extraction method, since waste generation is avoided, yet without the use of either chemical reagents or solvents, which follows the primary principles of Green Chemistry. The new method was successfully applied to chicken hamburger analysis, and the results agreed with those with reference values at a 95% confidence level, making it very attractive for routine analysis.

  12. Reliabilität des Hamburger Auswahlverfahrens für Medizinische Studiengänge, Naturwissenschaftsteil (HAM-Nat [Reliability of a science admission test (HAM-Nat at Hamburg medical school

    Directory of Open Access Journals (Sweden)

    Hissbach, Johanna

    2011-08-01

    Full Text Available [english] Objective: The University Hospital in Hamburg (UKE started to develop a test of knowledge in natural sciences for admission to medical school in 2005 (Hamburger Auswahlverfahren für Medizinische Studiengänge, Naturwissenschaftsteil, HAM-Nat. This study is a step towards establishing the HAM-Nat. We are investigating Methods: 316 first-year students participated in the study in 2007. They completed different versions of the HAM-Nat test which consisted of items that had already been used (HN2006 and new items (HN2007. Four weeks later half of the participants were tested on the HN2007 version of the HAM-Nat again, while the other half completed the test of scientific reasoning. Within this four week interval students were offered a five day chemistry course.Results: Parallel forms reliability for four different test versions ranged from r=.53 to r=.67. The retest reliabilities of the HN2007 halves were r=.54 and r=.61. Correlations of the two HAM-Nat versions with the test of scientific reasoning were r=.34 und r=.21. The crash course in chemistry had no effect on HAM-Nat scores.Conclusions: The results suggest that further versions of the test of natural sciences will not easily conform to the standards of internal consistency, parallel-forms reliability and retest reliability. Much care has to be taken in order to assemble items which could be used interchangeably for the construction of new test versions. The test of scientific reasoning and the HAM-Nat are tapping different constructs. Participation in a chemistry course did not improve students’ achievement, probably because the content of the course was not coordinated with the test and many students lacked of motivation to do well in the second test.[german] Ziele: Die Universität Hamburg hat im Jahr 2005 begonnen, einen Naturwissenschaftstest zur Auswahl von Studienbewerbern zu entwickeln (Hamburger Auswahlverfahren für Medizinische Studiengänge, Naturwissenschaftsteil

  13. Influence of Diet on the Proteome of Drosophila Melanogaster as Assessed by Two-Dimensional Gel Electrophoresis and Capillary Liquid Chromatography–Mass Spectrometry: The Hamburger Effect Revisited

    Science.gov (United States)

    Culwell, Thomas F.; Thulin, Craig D.; Merrell, Karen J.; Graves, Steven W.

    2008-01-01

    Proteomic biomarker discovery has been called into question. Diamandis hypothesized that seemingly trivial factors, such as eating a hamburger, may cause sufficient proteomic change as to confound proteomic differences. This has been termed the hamburger effect. Little is known about the variability of complex proteomes in response to the environment. Two methods—two-dimensional gel electrophoresis (2DGE) and capillary liquid chromatography–electrospray ionization time-of-flight mass spectrometry (LCMS)—were used to study the hamburger effect in two cross-sections of the soluble fruit fly proteome. 2DGE measured abundant proteins, whereas LCMS measured small proteins and peptides. Proteomic differences between males and females were first evaluated to assess the discriminatory capability of the methods. Likewise, wild-type and white-eyed flies were analyzed as a further demonstration that genetically based proteomic differences could be observed above the background analytical variation. Then dietary interventions were imposed. Ethanol was added to the diet of some populations without significant proteomic effect. However, after a 24-h fast, proteomic differences were found using LCMS but not 2DGE. Even so, only three of ~1000 molecular species were altered significantly, suggesting that the influence of even an extreme diet change produced only modest proteomic variability, and that much of the fruit fly proteome remains relatively constant in response to diet. These experiments suggest that proteomics can be a viable approach to biomarker discovery. PMID:19137114

  14. Interdisciplinary approach to design, performance, and quality management in a multicenter newborn hearing screening project. Discussion of the results of newborn hearing screening in Hamburg (part II).

    Science.gov (United States)

    Rohlfs, Anna-Katharina; Wiesner, Thomas; Drews, Holger; Müller, Frank; Breitfuss, Achim; Schiller, Regina; Hess, Markus

    2010-12-01

    Previously presented results of the newborn hearing screening in Hamburg and the perspectives are subsequently discussed. Minimum standards referring a participation of 95% of the neonates and a fail rate of less than 4% hearing-impaired children at the primary screening are fulfilled in Hamburg. Systematic screening of newborn hearing by an interdisciplinary approach provides early identification and intervention for children with permanent unilateral and bilateral hearing loss. But a newborn hearing screening on a voluntary basis alone cannot be maintained in the long run. Further, an anonymous data collection is not sufficient in regard to an uninterrupted tracking of conspicuous and unscreened neonates. A lost-to-follow-up rate of 31.3% at primary screening in Hamburg is much too high and emphasizes the need for a public health approach to a population-based newborn hearing screening with an elaborate and name-based tracking system. The legislation and implementation of a nationwide newborn hearing screening program in Germany and the association of German newborn hearing screening centers are highlighting long efforts of hearing professionals. But the implementation of a newborn hearing screening only makes sense if there exists an efficient tracking system. Sad to say, we are still a long way from the implementation of such a tracking system.

  15. Evaluation of spatio-temporal variability of Hamburg Aerosol Climatology against aerosol datasets from MODIS and CALIOP

    Directory of Open Access Journals (Sweden)

    V. Pappas

    2013-08-01

    Full Text Available The new global aerosol climatology named HAC (Hamburg Aerosol Climatology is compared against MODIS (Collection 5, 2000–2007 and CALIOP (Level 2-version 3, 2006–2011 retrievals. The comparison of aerosol optical depth (AOD from HAC against MODIS shows larger HAC AOD values over regions with higher aerosol loads and smaller HAC AOD values than MODIS for regions with lower loads. The HAC data are found to be more reliable over land and for low AOD values. The largest differences between HAC and MODIS occur from March to August for the Northern Hemisphere and from September to February for the Southern Hemisphere. In addition, both the spectral variability and vertical distribution of the HAC AOD are examined at selected AERONET (1998–2007 sites, representative of main aerosol types (pollutants, sea salt, biomass and dust. Based on comparisons against spectral AOD values from AERONET, the mean absolute percentage error in HAC AOD data is 25% at ultraviolet wavelengths (400 nm, 6–12% at visible and 18% at near-infrared (1000 nm. For the same AERONET sites, the HAC AOD vertical distribution is compared against CALIOP space lidar data. On a daily average basis, HAD AOD is less by 9% in the lowest 3 km than CALIOP values, especially for sites with biomass burning smoke, desert dust and sea salt spray. Above the boundary layer, the HAC AOD vertical distribution is reliable.

  16. [Aviation fuels and aircraft emissions. A risk characterization for airport neighbors using Hamburg Airport as an example].

    Science.gov (United States)

    Tesseraux, I; Mach, B; Koss, G

    1998-06-01

    Aviation fuels are well characterised regarding their physical and chemical properties. Health effects of fuel vapours and of liquid fuel are described after occupational exposure and in animal studies. Exposure of the general population (airport visitors and people living in the vicinity of airports) may occur during fuel supply particularly in warm summers (odour). Aircraft emissions vary with the engine type and the kind of fuel. Combustion of aviation fuel results in CO2, H2O, CO, C, NOx and a great number of organic compounds. Among the emitted polyaromatic hydrocarbons (PAH) no compound characteristic for jet engines (tracer) could be detected so far. Hardly any data exist on the toxicology of jet engine emissions. According to analyses of their chemical composition, however, they contain various toxicologically relevant compounds including carcinogenic substances. Measurements in ambient air around the Hamburg Airport show no elevated pollutant levels. However, no such data exist on aldehydes, black smoke or fine particles. Annoying odours have been stated in some areas around the airport, which were mainly attributed to the aircraft engine emissions rather than to fuel vapours.

  17. [Acute injuries in road bicycle racing. Injury surveillance at the Hamburg UCI ProTour"Cyclassics" 2006].

    Science.gov (United States)

    Ueblacker, P; Rathmann, W; Rueger, J M; Püschel, K

    2008-06-01

    Few data on risks and injury patterns of road cycling events are available. The aim of our study was to evaluate all injured participants in the 2006 Hamburg "Cyclassics". Injuries of the 182 professional and 18,788 recreational participants were registered with the help of the emergency medical services, the promoter and the hospitals. A total of 193 injuries were registered in 70 participants; the mean age was 44 years (range: 19-72). The injury rate amounted to 0.37%. Extremities were affected in 94.4%, and 32 fractures were registered. The MAIS amounted to 1.34+/-0.73 (range: 1-4), and the mean ISS was 2.86 +/- 3.61 (range: 1-20). The region affected most frequently was the shoulder girdle. Of the participants, 10% sustained serious injuries (AIS> or =3), which were significantly more frequent in women than in men (p<0.01). Based on 100,000 km most accidents occurred in the 55-km distance (p<0.01); 84.4% of the accidents occurred in groups. The mean speed at the time of the crash was 37.3 km/h (range: 0-57). In conclusion, accidents were more likely to occur in inexperienced drivers, in the shortest distance, with straight conditions and in well-known dangerous areas.

  18. Did the International ALPPS Meeting 2015 Have an Impact on Daily Practice? The Hamburg Barmbek Experience of 58 Cases.

    Science.gov (United States)

    Stavrou, Gregor A; Donati, Marcello; Fard-Aghaie, Mohammad H; Zeile, Martin; Huber, Tessa M; Stang, Axel; Oldhafer, Karl J

    2017-12-01

    ALPPS (associating liver partition and portal vein ligation for staged hepatectomy) was introduced only 10 years ago and has gained wide acceptance as a variation of staged procedures in liver surgery. It has been criticized for its high morbidity and mortality, which all centers reported in their initial series. After a world expert meeting in Hamburg in 2015 where all experts in the field met to discuss this method, caveats were extracted and formulated. We researched our complete prospective ALPPS database to see if the recommendations had any impact on outcome. In total, we performed 58 ALPPS procedures in our center. 33 patients were operated on before, 25 after the meeting. Results in terms of morbidity and mortality were significantly better after the meeting, as were patient selection and strategy. In our own center's experience, the implementation of the meetings' recommendations and the information gathered through this valuable exchange had a dramatic impact on results. Having performed 58 ALPPS procedures in total, we can now conclude that ALPPS has become much safer in our hands since the 2015 meeting and that morbidity and mortality are no longer the issue to be discussed. Future research must focus on oncologic outcomes in these patients.

  19. Interpersonal violence in road rage. Cases from the Medico-Legal Center for Victims of Violence in Hamburg.

    Science.gov (United States)

    Pfeiffer, Joost-Levin; Pueschel, Klaus; Seifert, Dragana

    2016-04-01

    Aggressive behavior in traffic is a widespread phenomenon. Up to 90% of the population are involved in mild forms such as shouting or gesturing. More dramatic cases with injury to individuals affect at least 1100 people in the US annually. Certain factors such as a male sex, a young age and an urban residency have been identified to contribute to the likelihood of road rage. Central to this analysis is the determination of specific features regarding the conflicting parties, the crime scene and the injury pattern in violent offenses related to traffic. In a retrospective study spanning 10 years, cases of road rage-linked injuries were identified amongst patients at the Medico-Legal Center of the Institute of Legal Medicine in Hamburg, Germany. The data were digitized and then analyzed using descriptive statistics via SPSS. There are disproportionately large numbers of males (85.7%) and motorists (61.2%) amongst road rage perpetrators. Usually the conflicting parties have no prior relationship (89.7%). In 68.1% of the cases, the violence applied was exclusively physical. Objects were utilized in 31.0% of all cases, and in more than half (55.6%) of these cases the vehicle was used as a weapon. The resulting trauma in road rage is mostly blunt and applied to the face and the extremities. There are characteristic features regarding the demographics, time and place of incident, as well as severity and pattern of injury in road rage associated offenses. Identifying these factors may lead to appropriate measures in the reduction of road rage. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  20. Hamburg-Glasgow classification: preoperative staging by combination of disseminated tumour load and systemic inflammation in oesophageal carcinoma.

    Science.gov (United States)

    Reeh, Matthias; Ghadban, Tarik; Uzunoglu, Faik G; Nentwich, Michael F; Bockhorn, Maximilian; Pantel, Klaus; Izbicki, Jakob R; Vashist, Yogesh K

    2017-08-22

    The aim of this study was to establish a new preoperative staging classification and evaluate its comparability to the post-operative tumour stage, lymph node invasion and metastasis (TNM) classification. To date, adequate, preoperative staging in patients with oesophageal carcinoma (EC) is still missing but urgently needed. Systemic inflammation and disseminated tumour load have a pivotal role in recurrence and oncological outcome. To improve the clinical staging, we merged the Glasgow Prognostic Score (GPS) and disseminated tumour cells (DTC) into a new sufficient preoperative staging classification, the Hamburg-Glasgow classification (HGC). In this prospective, single-centre study, 326 patients following curative oesophagectomy were included. From all patients preoperative bone marrow was aspirated from the iliac crest to detect DTCs by immunostaining with the pan-keratin antibody A45-B/B3. HGC was subdefined into four prognostic groups on the basis of C-reactive protein (CRP), albumin and DTC. The three prognostic groups of the GPS were supplemented by DTC detection status. Results were correlated with clinicopathological parameters and clinical outcome. Increasing HGC significantly correlated with lymph node invasion (P=0.022), post-operative pathohistological TNM staging (P=0.001) and tumour recurrence (P=0.001). The four HGC prognostic groups displayed a gradual decrease in overall as well as disease-free survival (PHamburg-Glasgow classification was a strong, significant independent predictor of overall survival and disease-free survival (PHamburg-Glasgow classification seems to be a promising preoperative additive staging classification for accurate and simple outcome stratification.

  1. [Network Analyses in Regional Health Care Research: Example of Dermatological Care in the Metropolitan Region of Hamburg].

    Science.gov (United States)

    Augustin, J; Austermann, J; Erasmi, S

    2016-10-18

    Background: One of the overall objectives of the legislator is to ensure an overall "homogeneous", and easily accessible medical care for the population. The physician-patient ratio can be used to describe the regional health care situation. But this method does not provide information concerning the availability of, for instance, the nearest doctor. Therefore, further parameters such as accessibility must be taken into consideration. For this purpose, network analyses are an appropriate method. The objective of this study is to present methodological tools to evaluate the healthcare situation in the metropolitan region of Hamburg, primarily focusing on accessibility using dermatologists as an example. Methods: Analyzing data of 20 counties, the geographical distribution of N=357 dermatologists and the physician-patient ratio were calculated. In a second step, a network analysis regarding accessibility was performed. In order to calculate accessibility, address data (physicians) were transformed into coordinates, consisting of defined places (N=303) and restrictions (e. g. speed, turn restrictions) of the network. The calculation of population-based accessibility is based on grid cells for the population density. Results: Despite adequacy of the overall medical situation, differences in the availability of the nearest dermatologists in the metropolitan region are remarkable, particularly when use of public transport is taken into consideration. In some counties, over 60% of the population require at least one hour to get to the nearest dermatologist using public transportation. In rural regions within the metropolitan area are particularly affected. Conclusion: The network analysis has shown that the choice and availability of transportation in combination with the location (rural/urban) is essential for health care access. Especially elderly people in rural areas with restricted mobility are at a disadvantage. Therefore, modern health care approaches (e

  2. Análise físico-química e sensorial de hambúrguer elaborado com carne de avestruz Physicochemical and sensorial analyses of ostrich hamburger

    Directory of Open Access Journals (Sweden)

    Tiffany Prokopp Hautrive

    2008-12-01

    Full Text Available O objetivo deste estudo foi elaborar um hambúrguer com carne de avestruz, para possibilitar o aproveitamento total da carne de avestruz, utilizando cortes considerados menos nobres como recortes resultantes da desossa. Avaliar sua aceitação entre potenciais consumidores, como apreciadores de carnes e hambúrgueres, bem como sugerir a industrialização e comercialização pelas indústrias como um novo produto de conveniência. Foram elaboradas três formulações de hambúrgueres com diferentes percentuais de carne de avestruz e bovina. As amostras foram analisadas por 50 provadores não treinados, escolhidos em função de gostarem e serem consumidores de hambúrgueres. O hambúrguer de formulação 2, composto por carne bovina (50% e carne de avestruz (50% obteve maior aceitação em relação aos demais. Os teores de lipídios e proteínas das amostras de hambúrgueres encontram-se dentre os valores exigidos pela legislação. Sendo assim, os hambúrgueres formulados com carne de avestruz foram bem aceitos pelos julgadores. O hambúrguer misto, o qual obteve maior aceitação, seria uma alternativa de um produto para a industrialização e comercialização, pois agregado com a carne bovina o custo dos hambúrgueres de avestruz são mais acessíveis.The objective of this study was to prepare a hamburger with ostrich meat, making use of the ostrich meat cuts that are considered less noble such as those resulting form boning. This study also aimed at evaluating its acceptance among potential clients such meat and hamburger consumers as well as suggesting its industrialization as a new product. Three types of hamburgers were prepared with different percentage of ostrich and bovine meat. The samples were tested by 50 tasters without training, but who were hamburger consumers. The hamburger of formulation 2, composed by bovine meat (50% and ostrich meat (50%, obtained better acceptance than the others. The contents of lipids and proteins of

  3. Are female daycare workers at greater risk of cytomegalovirus infection? A secondary data analysis of CMV seroprevalence between 2010 and 2013 in Hamburg, Germany.

    Science.gov (United States)

    Stranzinger, Johanna; Kozak, Agnessa; Schilgen, Benjamin; Paris, Diana; Nießen, Thomas; Schmidt, Lutz; Wille, Andreas; Wagner, Norbert L; Nienhaus, Albert

    2016-01-01

    Close contact with asymptomatic children younger than three years is a risk factor for a primary cytomegalovirus (CMV) infection. In pregnant women, such primary infection increases the risk of CMV-induced feto- or embryopathy. Daycare providers have therefore implemented working restrictions for pregnant daycare workers (DCWs) in accordance with legislation and guidelines for maternity protection. However, little is known about the infection risk for DCWs. We therefore compared the prevalence of CMV antibodies of pregnant DCWs to that of female blood donors (BDs). In a secondary data analysis, the prevalence of anti-CMV IgG among pregnant DCWs (N=509) in daycare centers (DCCs) was compared to the prevalence of female first-time BDs (N=14,358) from the greater region of Hamburg, Germany. Data collection took place between 2010 and 2013. The influence of other risk factors such as age, pregnancies and place of residence was evaluated using logistic regression models. The prevalence of CMV antibodies in pregnant DCWs was higher than in female BDs (54.6 vs 41.5%; OR 1.6; 95%CI 1.3-1.9). The subgroup of BDs who had given birth to at least one child and who lived in the city of Hamburg (N=2,591) had a prevalence of CMV antibodies similar to the prevalence in pregnant DCWs (53.9 vs 54.6%; OR 0.9; 95%CI 0.8-1.2). Age, pregnancy history and living in the center of Hamburg were risk factors for CMV infections. The comparison of pregnant DCWs to the best-matching subgroup of female first-time BDs with past pregnancies and living in the city of Hamburg does not indicate an elevated risk of CMV infection among DCWs. However, as two secondary data sets from convenience samples were used, a more detailed investigation of the risk factors other than place of residence, age and maternity was not possible. Therefore, the CMV infection risk in DCWs should be further studied by taking into consideration the potential preventive effect of hygiene measures.

  4. Are female daycare workers at greater risk of cytomegalovirus infection? A secondary data analysis of CMV seroprevalence between 2010 and 2013 in Hamburg, Germany

    Directory of Open Access Journals (Sweden)

    Stranzinger, Johanna

    2016-04-01

    Full Text Available Background: Close contact with asymptomatic children younger than three years is a risk factor for a primary cytomegalovirus (CMV infection. In pregnant women, such primary infection increases the risk of CMV-induced feto- or embryopathy. Daycare providers have therefore implemented working restrictions for pregnant daycare workers (DCWs in accordance with legislation and guidelines for maternity protection. However, little is known about the infection risk for DCWs. We therefore compared the prevalence of CMV antibodies of pregnant DCWs to that of female blood donors (BDs.Method: In a secondary data analysis, the prevalence of anti-CMV IgG among pregnant DCWs (N=509 in daycare centers (DCCs was compared to the prevalence of female first-time BDs (N=14,358 from the greater region of Hamburg, Germany. Data collection took place between 2010 and 2013. The influence of other risk factors such as age, pregnancies and place of residence was evaluated using logistic regression models. Results: The prevalence of CMV antibodies in pregnant DCWs was higher than in female BDs (54.6 vs 41.5%; OR 1.6; 95%CI 1.3–1.9. The subgroup of BDs who had given birth to at least one child and who lived in the city of Hamburg (N=2,591 had a prevalence of CMV antibodies similar to the prevalence in pregnant DCWs (53.9 vs 54.6%; OR 0.9; 95%CI 0.8–1.2. Age, pregnancy history and living in the center of Hamburg were risk factors for CMV infections.Conclusion: The comparison of pregnant DCWs to the best-matching subgroup of female first-time BDs with past pregnancies and living in the city of Hamburg does not indicate an elevated risk of CMV infection among DCWs. However, as two secondary data sets from convenience samples were used, a more detailed investigation of the risk factors other than place of residence, age and maternity was not possible. Therefore, the CMV infection risk in DCWs should be further studied by taking into consideration the potential preventive

  5. Characteristics of suspended and streambed sediment within constructed chutes and the main channel at Upper Hamburg and Glovers Point Bends, Missouri River, Nebraska, 2008

    Science.gov (United States)

    Woodward, Brenda K.; Rus, David L.

    2011-01-01

    The U.S. Army Corps of Engineers, Omaha District, as part of the Missouri River Bank Stabilization and Navigation Mitigation Project, has constructed 17 off-channel chutes along the channelized Missouri River, downstream from Sioux City, Iowa, to increase habitat diversity. To better understand characteristics of suspended and streambed sediment within these constructed chutes, the U.S. Geological Survey investigated specific aspects of chute design and function in relation to sediment characteristics including: (1) effects of inlet structures; (2) changes occurring between the inlet and the outlet of a chute; (3) effects of chutes on sediment characteristics in the main channel; and (4) differences in chute dynamics between sampled chutes. Two chutes differing in design, location, and dynamics were studied, Upper Hamburg Bend near Nebraska City, Nebr., and Glovers Point Bend near Winnebago, Nebr. Each site was characterized using five or more sampling transects (two in the chute and three to four in the main channel) designed to bracket sediment exchanges between chutes and the main channel. A sixth transect was included at the Upper Hamburg Bend study site to account for the effects of a nontarget chute having its inlet midway between the inlet and outlet of the primary chute. Representative samples of suspended and streambed sediment were collected at each transect, along with measurements of turbidity and streamflow, between June and November 2008. Four sets of samples were collected at the Glovers Point Bend study site and five sample sets were collected from the Upper Hamburg Bend study site. Results from paired t-tests and standard t-tests indicated that the inlet structure design, passing inflow only from the top of the main-channel water column, reduced the supply of coarse-grained suspended sediment entering the chutes. Statistical comparisons did not indicate differences between the inlet and outlet of either chute; however, anecdotal evidence of recent

  6. Transoceanic dispersal of benthic macrofauna: Haliplanella luciae (Verrill, 1898) (Anthozoa, Actiniaria) found on a ship's hull in a shipyard dock in Hamburg Harbour, Germany

    Science.gov (United States)

    Gollasch, S.; Riemann-Zürneck, K.

    1996-06-01

    In September 1993, 26 live specimens of the small, delicate sea anemone Haliplanella luciae (Verrill, 1898) were sampled from the hull of a ship docked in Hamburg Harbour. After a worldwide journey the ship had passed into the freshwater region of the river Elbe. Although the migratory potential of the species (supposed home region is Japan) is well known, its transport on ships' bottoms has never been documented. Behavioural traits enabling the anemone to settle on ships are discussed together with probable reasons why Haliplanella luciae did not establish itself in the fauna of the German Bight.

  7. „Besuch&Buch“: Soziale Bibliotheksarbeit der Stadtbibliothek Graz nach dem Vorbild der „Medienboten“ (Hamburg im Blickfeld der Gerontologie

    Directory of Open Access Journals (Sweden)

    Burkert, Petra

    2016-12-01

    Full Text Available In 2013 the Public Library of Graz launched a home library service which is unique in Austria up to today: volunteer book messengers visit senior and homebound citizens at their homes. “Besuch&Buch” has been inspired by the “Medienboten”, a socio-cultural project started by Hamburg Public Libraries in 2007. The author – librarian and gerontologist in Graz – has written her master thesis on “Besuch&Buch” and describes why library social projects as “Besuch&Buch” have never been more important than in today’s demographic change.

  8. Farklı Işınlama Dozlarının Hamburger Köftelerde E. coli ve Toplam Mezofilik Aerobik Bakteri Üzerine Etkileri

    Directory of Open Access Journals (Sweden)

    Ayça Aylangan

    2015-02-01

    Full Text Available Bu çalışmada, ülkemizde önemli bir tüketim potansiyeli olan, özellikle ayaküstü yenilen gıdalar olarak adlandırılan fast food zincirlerinde yüksek miktarda tüketilen hamburger köftelerin muhafazası amacıyla ışınlama teknolojisi kullanılmıştır. Bu amaçla, dana kıymasından % 0.8 oranında NaCl içeren hamburger köfteleri üretilmiştir. Hamburger köfteleri iki gruba ayrılmış, bir grup E. coli ATCC 25922 suşu ile aşılanırken, diğer grup aşılanmamıştır. İki farklı depolama sıcaklığında ve süresinde (+4 °C’de 8 gün ve -12 °C’de 30 gün, ürünün mikrobiyel güvenlik ve kalitesinin sağlanması amacıyla uygulanan 3 farklı ışınlama dozunun (0.4 kGy; 0.8 kGy ve 1.2 kGy toplam mezofilik aerobik bakteri (TMAB sayısı ve Escherichia coli üzerine etkisi incelenmiştir. Yapılan çalışma sonunda, E. coli için D10 değeri 0.55 kGy olarak bulunmuştur. E. coli aşılanmamış hamburger örneklerinde gerçekleştirilen sayım sonuçlarına göre, 1.2 kGy doz uygulanmasının TMAB sayısında 2 log düzeyinde bir azalmaya yol açtığı belirlenmiştir.

  9. SEARCHES FOR METAL-POOR STARS FROM THE HAMBURG/ESO SURVEY USING THE CH G BAND

    Energy Technology Data Exchange (ETDEWEB)

    Placco, Vinicius M.; Rossi, Silvia [Departamento de Astronomia-Instituto de Astronomia, Geofisica e Ciencias Atmosfericas, Universidade de Sao Paulo, Sao Paulo, SP 05508-090 (Brazil); Kennedy, Catherine R.; Beers, Timothy C.; Lee, Young Sun [Department of Physics and Astronomy and JINA (Joint Institute for Nuclear Astrophysics), Michigan State University, East Lansing, MI 48824 (United States); Christlieb, Norbert [Zentrum fuer Astronomie der Universitaet Heidelberg, Landessternwarte, Koenigstuhl 12, 69117 Heidelberg (Germany); Sivarani, Thirupathi [Indian Institute of Astrophysics, 2nd Block, Koramangala, Bangalore 560034 (India); Reimers, Dieter [Hamburger Sternwarte, Universitaet Hamburg, Gojenbergsweg 112, 21029 Hamburg (Germany); Wisotzki, Lutz, E-mail: vmplacco@astro.iag.usp.br [Astrophysical Institute Potsdam, An der Sternwarte 16, 14482 Potsdam (Germany)

    2011-12-15

    We describe a new method to search for metal-poor candidates from the Hamburg/ESO objective-prism survey (HES) based on identifying stars with apparently strong CH G-band strengths for their colors. The hypothesis we exploit is that large overabundances of carbon are common among metal-poor stars, as has been found by numerous studies over the past two decades. The selection was made by considering two line indices in the 4300 A region, applied directly to the low-resolution prism spectra. This work also extends a previously published method by adding bright sources to the sample. The spectra of these stars suffer from saturation effects, compromising the index calculations and leading to an undersampling of the brighter candidates. A simple numerical procedure, based on available photometry, was developed to correct the line indices and overcome this limitation. Visual inspection and classification of the spectra from the HES plates yielded a list of 5288 new metal-poor (and by selection, carbon-rich) candidates, which are presently being used as targets for medium-resolution spectroscopic follow-up. Estimates of the stellar atmospheric parameters, as well as carbon abundances, are now available for 117 of the first candidates, based on follow-up medium-resolution spectra obtained with the SOAR 4.1 m and Gemini 8 m telescopes. We demonstrate that our new method improves the metal-poor star fractions found by our pilot study by up to a factor of three in the same magnitude range, as compared with our pilot study based on only one CH G-band index. Our selection scheme obtained roughly a 40% success rate for identification of stars with [Fe/H] <-1.0; the primary contaminant is late-type stars with near-solar abundances and, often, emission line cores that filled in the Ca II K line on the prism spectrum. Because the selection is based on carbon, we greatly increase the numbers of known carbon-enhanced metal-poor stars from the HES with intermediate metallicities -2

  10. [Integrated care for patients with first and multiple episodes of severe psychotic illnesses: 3-year results of the Hamburg model].

    Science.gov (United States)

    Lambert, Martin; Schöttle, D; Ruppelt, F; Lüdecke, D; Sarikaya, G; Schulte-Markwort, M; Gallinat, J; Karow, A

    2015-04-01

    The so-called "Hamburg model" is a designated integrated care model according to § 140 of the Social Code Book (SGB) V for psychosis patients fulfilling the definition of severe mental illness (SMI). Description of the model and evaluation of efficacy of all patients being treated for ≥ 3 years. Service entry illness status, course of illness, and interventions were assessed within a continuous quality assurance study. One hundred and fifty-eight patients who fulfilled the criterion of being treated for ≥ 3 years were analyzed. At service entry, SMI were among others mirrored by a high level of psychopathology (Brief Psychiatric Rating Scale [BPRS]: 80.3) and severity of illness (Clinical Global Impression Severity [CGI-S]/Clinical Global Impression Bipolar scales [CGI-BP]: 5.8), low functioning level (Global Assessment of Functioning scale [GAF]: 35.9), and high rates of comorbid psychiatric (94.3 %) and somatic (81.6 %) disorders. Only 8 patients (5.1 %) disengaged from the service within the 3-year treatment period. The course of the illness over 3 years showed significant and stable improvements in psychopathology (BPRS: p < 0.001), the severity of illness (CGI-S/CGI-BP: p < 0.001), functioning (GAF: p < 0.001), quality of life (Quality of Life Enjoyment and Satisfaction Questionnaire [Q-LES-Q-18]: p < 0.001), and satisfaction with care (Client Satisfaction Questionnaire [CSQ-8]: 2.0 to 3.3; p = 0.164; nonsignificant because of early improvements). Further, compulsory admissions were reduced and medication adherence in addition to working ability improved (all p < 0.001). Data on interventions showed a continuously high frequency of outpatient interventions over time (on average 112.0 per year), a high percentage of patients in psychotherapy (67 %), and a nearly 90 % reduction in inpatient treatment days from year 1 to year 3. Integrated care in severely ill patients with psychotic disorders leads to multidimensional

  11. The effect of effort-reward imbalance on the health of childcare workers in Hamburg: a longitudinal study.

    Science.gov (United States)

    Koch, Peter; Kersten, Jan Felix; Stranzinger, Johanna; Nienhaus, Albert

    2017-01-01

    The prevalence of effort-reward imbalance (ERI) among qualified childcare workers in Germany is currently estimated at around 65%. High rates of burnout and musculoskeletal symptoms (MS) have also been reported for this group. Previous longitudinal studies show inconsistent results with regard to the association between ERI and MS. As yet, no longitudinal studies have been conducted to investigate the association between ERI and burnout or MS in childcare workers. This study aims to investigate the extent to which a relationship between ERI and MS or burnout can be observed in childcare workers in Germany on a longitudinal basis. In 2014 childcare workers (N = 199, response rate: 57%) of a provider of facilities for children and youth in Hamburg were asked about stress and health effects in the workplace. Follow-up was completed one year later (N = 106, follow-up rate: 53%) For the baseline assessment, ERI was determined as the primary influencing factor. Data on MS was recorded using the Nordic questionnaire, and burnout using the personal burnout scale of the Copenhagen Burnout Inventory (CBI). The statistical analysis was carried out using multivariate linear and logistic regression. At baseline ERI was present in 65% of the sample population. The mean burnout score at the time of follow-up was 53.7 (SD: 20.7); the prevalence of MS was between 19% and 62%. ERI was identified as a statistically significant factor for MS, after adjusting especially for physical stress (lower back: OR 4.2; 95% CI: 1.14 to 15.50, neck: OR 4.3; 95% CI: 1.25 to 15.0, total MS: OR 4.0; 95% CI: 1.20 to 13.49). With regard to burnout, a relative increase of 10% in the ERI ratio score increased the burnout score by 1.1 points (p = 0.034). ERI was revealed to be a major factor in relation to MS and burnout in childcare workers. Based on this observation worksite interventions on the individual and organizational level should be introduced in order to prevent ERI.

  12. [Hospitalization of Migrants without Health Insurance: An Explorative Study of Hospital Healthcare in Lower Saxony, Berlin and Hamburg].

    Science.gov (United States)

    Mylius, M

    2016-04-01

    Different reasons prevent migrants from obtaining health insurance resulting in their exclusion from regular medical care in Germany. In case of medical emergency, hospitals are obliged by law to provide treatment. In addition, hospitals might get reimbursed for treatment expenses by social welfare authorities. This includes undocumented migrants who should not be reported to the police. However, actual legislation regarding the level of medical intervention, the principles of medical confidentiality and the conditions of reimbursement by the authorities is unclear. Thus, migrants without health insurance may be precluded from receiving urgent medical treatment. A first assessment of hospital health care for migrants without health insurance in three federal states with the intention to identify obstacles in access to in- and out-patient emergency treatment. Electronic mail survey of all non-specialized general hospitals located in the federal states of Niedersachsen (Lower Saxony, n=129), Berlin (n=46) and Hamburg (n=24). Data was anonymized and descriptively analyzed using SPSS statistical software. Rate of questionnaire return was 31.2% (n=62). Almost all hospitals had already encountered migrants without health insurance in their emergency wards (82.3%) including 72.5% undocumented migrants. 76.7% of all hospitals had submitted a subsequent emergency aid proposal to the social welfare authorities. 17.1% of them confirmed that they were reimbursed in most cases. 8.5% of all participating hospitals mostly consult the police in case migrants are not able to provide any means of identification, whereas 43.6% consult the police only in rare cases. 64.5% of all hospitals reported non-reimbursed expenses for 2011 - 2014 ranging from € 4 000 - €1.01 million. RESULTS indicate that the provision of care for people without health care insurance represents an important issue for a majority of the assessed hospitals since they have to take the responsibility for

  13. [Active and healthy living in old age--results from a representative survey of community-dwelling senior citizens in Hamburg].

    Science.gov (United States)

    Dapp, Ulrike; Lorentz, Ch; Laub, S; Anders, J; von Renteln-Kruse, W; Minder, Ch; Dirksen-Fischer, M

    2009-06-01

    The majority of community-dwelling people 60 years and older are independent and live actively. However, there is little information about elderly persons' views on aging, health and health promotion. Therefore, an anonymous, written questionnaire survey was performed in a representative sample of inhabitants from a section of the city of Hamburg, 60 years and older; 5 year intervals, 14 subsamples according to 7 age groups of females and males. Questionnaires from 950 participants (29% response) could be evaluated: mean age 71.5 years, 58% women, 34% living alone, 5% with professional healthcare needs as indicated by status according to German nursing care insurance. Senior citizens' positive attitudes towards aging and health were predominant: 69% of respondents felt young, 85% worried about loss of autonomy in old age. The results provide evidence indicating potential for improving health-promoting lifestyles in parts of the older population by evaluating and strengthening older persons' competencies and by considering their concerns seriously. These results provide valuable information for future plans in the public-health sector in the city of Hamburg where particular health-promoting actions for elderly persons will be considered.

  14. Prevalence and genotypes of extended spectrum beta-lactamases in Enterobacteriaceae isolated from human stool and chicken meat in Hamburg, Germany.

    Science.gov (United States)

    Belmar Campos, Cristina; Fenner, Ines; Wiese, Nicole; Lensing, Carmen; Christner, Martin; Rohde, Holger; Aepfelbacher, Martin; Fenner, Thomas; Hentschke, Moritz

    2014-07-01

    Chicken meat has been proposed to constitute a source for extended spectrum beta-lactamase (ESBL)-carrying Enterobacteriaceae that colonize and infect humans. In this study the prevalence of ESBL-producing Enterobacteriaceae in stool samples from ambulatory patients who presented in the emergency department of the University Medical Centre Hamburg-Eppendorf with gastrointestinal complains and in chicken meat samples from the Hamburg region were analysed and compared with respect to ESBL-genotypes, sequence types and antibiotic resistance profiles. Twenty-nine (4.1%) of 707 stool samples and 72 (60%) of 120 chicken meat samples were positive for ESBL-producing Enterobacteriaceae. The distribution of ESBL genes in the stool vs. chicken meat isolates (given as % of total isolates from stool vs. chicken meat) was as follows: CTX-M-15 (38% vs. 0%), CTX-M-14 (17% vs. 6%), CTX-M-1 (17% vs. 69%), SHV-12 (3% vs. 18%) and TEM-52 (3% each). Comparison of ESBL- and multilocus sequence type revealed no correlation between isolates of human and chicken. Furthermore, ESBL-producing E. coli from stool samples were significantly more resistant to fluoroquinolones, aminoglycosides and/or trimethoprim-sulfamethoxazole than chicken isolates. The differences in ESBL-genotypes, sequence types and antibiotic resistance patterns indicate that in our clinical setting chicken meat is not a major contributor to human colonization with ESBL-carrying Enterobacteriaceae. Copyright © 2014 Elsevier GmbH. All rights reserved.

  15. The transforming perception of a regional geohazard between coastal defence and mediated discourse on global warming: Storm surges in Hamburg, Germany

    Science.gov (United States)

    Neverla, I.; Lüthje, C.

    2010-03-01

    The term regional geohazard is used for a major geophysical risk which can lead to a natural disaster. The effects will be strictly located to a specific region. It is expected but still not proven that global warming will intensify weather extremes and thus the number of regional geohazards will increase. Regional geohazards are not dangerous per se, but from the perspective of human being certain weather and nature extremes are considered dangerous as they impose damage on human beings and their belongings. Therefore the media often call them ‘natural disaster’ and as a matter of fact it seems to be a ‘must’ - according to theory and practice of news selections - that media report on any natural disaster that occur in their region. Moreover, media even report on geohazards in any other region as soon as these events seem to have any general impact. The major geophysical risk along the coast of the North Sea is storm surges. A long list of historical disasters has deeply engraved the ubiquity of this hazard into the collective memory and habitus of the local population. Not only coastal region is concerned by this danger but also the megacity of Hamburg. Hamburg is the second-largest city in Germany and the sixth-largest city in the European Union. The Hamburg Metropolitan Region has more than 4.3 million inhabitants. The estuary of the river Elbe extends from Cuxhaven (coast) to Hamburg a distance of about 130 km. Hamburg has often been subject to storm surges with significant damages. But after the storm flood in 1855 for more than 100 years until 1962 no severe storm surge happened. The Big Flood in the night from February 16 to February 17 1962 destroyed the homes of about 60.000 people. The death toll amounted to 315 in the city of Hamburg, where the storm surge had a traumatic impact and was followed by political decisions driven by the believe in technological solutions. After 1962 massive investments into the coastal defence were made and dikes

  16. AG Queer Studies (Hg.: Verqueerte Verhältnisse. Intersektionale, ökonomiekritische und strategische Interventionen. Hamburg: Männerschwarm Verlag 2009.

    Directory of Open Access Journals (Sweden)

    Heinz-Jürgen Voß

    2009-11-01

    Full Text Available Der vorliegende Band enthält Beiträge zu den aktuell intensiv geführten Debatten um die Notwendigkeit einer deutlichen Positionierung von Queer Theorie zu Theorien der Ökonomiekritik und Intersektionalität. Dabei werden historische und aktuelle Beispiele herangezogen. Exzellent und besonders hervorzuheben sind die Aufsätze von Jin Haritaworn – ein anti-rassistischer Beitrag, der sich fundiert in aktuelle politische Queer-Auseinandersetzungen einmischt – sowie von Jo Bucher und Angelika Göres, die an einem zeitgeschichtlichen Beispiel queerende Momente des Widerstands herausarbeiten. Wie der vor acht Jahren erschienene erste Band der AG Queer Studies an der Hamburger Universität ist auch dieser für den deutschsprachigen Raum hochaktuell und wärmstens zu empfehlen.The volume at hand contains articles on the current and intense debate over the necessity of queer theory’s clear position in relation to theories of economic critique and intersectionality. It does so using historical and current examples. Essays deserving of special note include an article by Jin Haritaworn that engages in current queer political discussions and an article by Jo Bucher and Angelika Göres that highlights queer moments of resistance using a contemporary example. As was the case with the first volume of the AG Queer Studies at Hamburg University, published eight years ago, this volume is extremely current for the German-language market and is highly recommended.

  17. An electro-optical timing diagnostic for pump-probe experiments at the free-electron laser in Hamburg FLASH

    Energy Technology Data Exchange (ETDEWEB)

    Azima, Armin

    2009-07-15

    Femtosecond pump-probe experiments have extensively been used to follow atomic and molecular motion in time. The very intense extreme ultraviolet XUV light of the Free electron LASer in Hamburg FLASH facility allows to investigate fundamental processes such as direct one or few photon inner shell ionizations. A supplementary Ti:Sapphire near infrared femtosecond laser system allows to perform two-color pump-probe experiments with FLASH involving intense laser fields of hugely different photon energies. Within this work a bunch arrival measurement system has been built, which assists these two-color pump-probe experiments to reduce the temporal jitter of FLASH and to increase the temporal resolution. The diagnostic is based upon an electro-optical detection scheme and measures the relative arrival time between the Ti:Sapphire femtosecond pulse and the electron bunch, which generates the self-amplified by stimulated emission SASE XUV pulse in the undulator section of FLASH. Key feature of the diagnostic is a 150 m long glass fiber pulse transport line, which inflicts non-linear dispersion. A dispersion control system to compensate for this higher order dispersion has been developed including the control and programming of a spatial light phase modulator. It was possible to transport a 90 fs FWHM short near infrared femtosecond laser pulse Fourier limited by the dispersion compensated glass fiber. The electro-optical signal induced by the FLASH electron bunch was generated, characterized and optimized. The signal features beside the designated bunch arrival timing capability the additional possibility to measure the longitudinal electron bunch density distribution of an arbitrary bunch of FLASH in a single shot with a temporal resolution of below 100 fs RMS. Timing and bunch analysis capabilities of the developed diagnostic have been cross-checked with other comparable diagnostics at FLASH like the transversal deflecting cavity structure named LOLA. Finally, the

  18. [Evaluation of family doctor-centred health care in Germany based on AOK Rheinland/Hamburg claims data].

    Science.gov (United States)

    Klora, Mike; Zeidler, Jan; May, Melanie; Raabe, Nils; von der Schulenburg, J-Matthias Graf

    2017-02-01

    Health insurance funds in Germany are obliged to offer family doctor-centred health care models (Hausarztzentrierte Versorgung, "HzV"). The participation is voluntary for the insured persons. Participants agree to utilise outpatient specialist care only if their family doctor or general practitioner ("gatekeeper") refers them to a specialist. The aim of this programme is to both strengthen the role of general practitioners and to avoid unnecessary specialist visits and double examinations. Moreover, the quality of care should increase and costs decrease. There is a controversial debate among health politicians whether these objectives can be achieved with current HzV contracts. Therefore, the aim of this project was to conduct an economic evaluation of family doctor-centred health care compared with the standard of care. The analysis covered continuously insured adult HzV participants, who have been enrolled in the contract offered by a large German sickness fund (AOK Rheinland/Hamburg) since 2011. In addition, the analysis contained data of a control group which was three times larger than the intervention group. Logistic regression analysis with relevant characteristics (social demographics, health care utilisation, cost, and Charlson Comorbidity Index) of participants and non-participants was conducted to assess the likelihood of participation in the HzV contract. With the subsequent propensity score matching, differences in the characteristics between the control and the intervention group were compensated for the base year 2010 in order to be able to evaluate the influence of the HzV contract in subsequent years. Study objectives were to analyse differences in costs as well as utilisation of services between HzV participants and the control group. The intervention group consisted of 25,201 HzV participants with an average age of 49.5 years [SD: 17.9]. 54.4% of them were female. The HzV participants showed significantly higher costs compared to the control

  19. Educational Theory and Practice in Post-Revolutionary Times: The European Academic Debate on the Experimental Schools in Hamburg (1919-1933) in the 1930s and 1970s

    Science.gov (United States)

    Roith, Christian

    2014-01-01

    After the revolution in 1918, many reformist teachers were convinced that they could put into practice their dreams of a free and independent school in a democratic republic. Four state schools in Hamburg became anti-authoritarian school communities, in which teachers, parents and students experimented with revolutionary concepts of education. For…

  20. Determination of gamma radiation dose to the destruction of Escherichia coli O157: H7 in hamburger;Determinacao da dose de radiacao gama para a destruicao de Escherichia coli O157:H7 em hamburguer bovino

    Energy Technology Data Exchange (ETDEWEB)

    Orejuela Chirinos, Rodolfo Raul

    1999-07-01

    Escherichia coli O157:H7 has been incriminated in several foodborne outbreaks due to the consumption of different kinds of foods. Among these, hamburgers are the most common. Irradiation process is an effective method for food preservation because it causes no significant change in organoleptic and nutritional food characteristics and destroys pathogens and spoilage microorganisms. Hamburgers and nutrient broth inoculated with Escherichia coli O157:H7 were submitted to gamma irradiation ({sup 60}Co) treatment, with doses ranging from 0,0 to 0,7 kGy in order to calculate the D{sub 10} for this bacteria in these substrate. The D{sub 10} for the pathogen nutrient broth ranged from 0.08 kGy to 0.10 kGy and in hamburger from 0.11 kGy to 0.21 kGy. Considering the highest D{sub 10} value in hamburger, a dose of 0,8 kGy would not change the sensorial characteristics of the product, and would reduce the population of E. coli O157:H7 in 4 cycles logarithmic. (author)

  1. Point of Care Tools im Vergleich des Universitätsklinikums Hamburg-Eppendorf (UKE: UpToDate, ClinicalResource@Ovid/Clin-eguide und Dynamed / Point of Care Tools in comparison at the University Medical Center Hamburg-Eppendorf: UpToDate, ClinicalResource@Ovid and Dynamed

    Directory of Open Access Journals (Sweden)

    Menn, Elke

    2006-09-01

    Full Text Available Point of Care Tools are used for clinical decision making – UpToDate is also used in continuing medical education. These databases compile only evidence-based knowledge which is updated regularly. Using Point of Care Tools promises to improve clinical outcomes. UpToDate has been used at the University Hospital Hamburg-Eppendorf for the last four years. In a recent trial the use of ClinicalResource@Ovid/Clin-eguide and Dynamed has been evaluated in comparison with UpToDate.

  2. MRSA Prevalence and Risk Factors among Health Personnel and Residents in Nursing Homes in Hamburg, Germany – A Cross-Sectional Study

    Science.gov (United States)

    Peters, Claudia; Dulon, Madeleine; Kleinmüller, Olaf; Nienhaus, Albert; Schablon, Anja

    2017-01-01

    Introduction The increase of multidrug-resistant organisms in hospitals causes problems in nursing homes. Staff in geriatric nursing homes are at greater risk of MRSA colonisation. The aim of the study was to describe the occupational exposure to MRSA among health personnel in geriatric nursing. Methods A point prevalence survey was conducted among health personnel and residents of geriatric nursing homes within the greater Hamburg district. Nasal swabs and, where relevant, wound swabs were collected for the screening survey. Risk factors for MRSA colonisation were identified by means of a questionnaire and using the files held on the residents. Where tests on nursing staff were positive, a control swab was taken; when the results were confirmed positive, decolonisation was performed. The responsible general practitioners were notified of positive MRSA findings among residents. A molecular biological examination of the MRSA samples was performed. Results A total of 19 institutions participated in the study. Nasal swabs were taken from 759 nursing staff and 422 residents. Prevalence of MRSA was 1.6% among staff and 5.5% among residents. MRSA colonisation among health personnel indicated a correlation with male gender (OR 4.5, 95% CI 1.4–14.1). Among the residents, chronic skin diseases (OR 3.2, 95% CI 1.0–10.3) and indwelling devices (OR 3.2, 95% CI 1.2–8.1) were identified as risk factors. No link between MRSA in residents and in health personnel could be established. Conclusion The number of MRSA colonisations among nursing staff and residents of geriatric nursing homes in Hamburg was rather low at 1.6% and 5.5% respectively and equates to the results of other surveys in non-outbreak scenarios. PMID:28068356

  3. MRSA Prevalence and Risk Factors among Health Personnel and Residents in Nursing Homes in Hamburg, Germany - A Cross-Sectional Study.

    Science.gov (United States)

    Peters, Claudia; Dulon, Madeleine; Kleinmüller, Olaf; Nienhaus, Albert; Schablon, Anja

    2017-01-01

    The increase of multidrug-resistant organisms in hospitals causes problems in nursing homes. Staff in geriatric nursing homes are at greater risk of MRSA colonisation. The aim of the study was to describe the occupational exposure to MRSA among health personnel in geriatric nursing. A point prevalence survey was conducted among health personnel and residents of geriatric nursing homes within the greater Hamburg district. Nasal swabs and, where relevant, wound swabs were collected for the screening survey. Risk factors for MRSA colonisation were identified by means of a questionnaire and using the files held on the residents. Where tests on nursing staff were positive, a control swab was taken; when the results were confirmed positive, decolonisation was performed. The responsible general practitioners were notified of positive MRSA findings among residents. A molecular biological examination of the MRSA samples was performed. A total of 19 institutions participated in the study. Nasal swabs were taken from 759 nursing staff and 422 residents. Prevalence of MRSA was 1.6% among staff and 5.5% among residents. MRSA colonisation among health personnel indicated a correlation with male gender (OR 4.5, 95% CI 1.4-14.1). Among the residents, chronic skin diseases (OR 3.2, 95% CI 1.0-10.3) and indwelling devices (OR 3.2, 95% CI 1.2-8.1) were identified as risk factors. No link between MRSA in residents and in health personnel could be established. The number of MRSA colonisations among nursing staff and residents of geriatric nursing homes in Hamburg was rather low at 1.6% and 5.5% respectively and equates to the results of other surveys in non-outbreak scenarios.

  4. Distribution and properties of mesozoic sandstones and barrier rocks in Schleswig-Holstein and Hamburg. Basic informations on possible energetic utilisation of the deeper subsurface; Verbreitung und Eigenschaften mesozoischer Sandsteine sowie ueberlagernder Barrieregesteine in Schleswig-Holstein und Hamburg. Basisinformationen zur energiewirtschaftlichen Nutzung des tieferen Untergrundes

    Energy Technology Data Exchange (ETDEWEB)

    Kaufhold, Holger; Hable, Regina; Liebsch-Doerschner, Thomas; Thomsen, Claudia [Landesamt fuer Landwirtschaft, Umwelt und Laendliche Raeume Schleswig-Holstein (LLUR), Flintbek (Germany). Geologischer Dienst; Taugs, Renate [Behoerde fuer Stadtentwicklung und Umwelt, Hamburg (Germany). Geologisches Landesamt Hamburg

    2011-07-01

    Within the scope of the project Storage Catalogue of Germany the Geological Survey of Schleswig-Holstein (LLUR, Flintbek) studied mesozoic sedimentary systems in Schleswig-Holstein and Hamburg with regard to petrophysical properties. The main objective of the study, which was part of a joint research project of the Federal Institute for Geosciences and Natural Resources (BGR) and the State Geological Surveys of Germany, consisted in mapping of sandstone and barrier rock units and in characterization of its storage potential. The interest was focussed on sandstone layers of the Middle Buntsandstein (Lower Triassic), of the Rhaetian Exter Formation (Upper Triassic) and of Middle Jurassic. Whereas Early Triassic (Middle Buntsandstein) sandstones occur over the entire area of Schleswig-Holstein and Hamburg, Late Triassic and Middle Jurassic sandstones are linked to halokinetic rim synclines. The results discussed herein show that a greater part of the concerned sandstone units offers potential options of different usage. But available reservoir and barrier data allow no definite conclusions for CO{sub 2}-storage suitability. (orig.)

  5. A seismological study of shallow weak earthquakes in the urban area of Hamburg city, Germany, and its possible relation to salt dissolution

    Science.gov (United States)

    Dahm, Torsten; Heimann, Sebastian; Bialowons, Wilhelm

    2010-05-01

    In the night from 8/9 April 2009, shortly after midnight on Maundy Thursday before Easter, several people in Gross-Flottbek, Hamburg, felt unusual strong ground shocks so that some of them left their houses in fear of earthquake shaking. Police and Fire Brigade received phone calls of worried residents, and few days later Internet pages were published where people reported their observations. On 21 April 2009 at about 8 p.m. local time a second micro-earthquake was felt. Damage to buildings or infrastructure did not occur to our knowledge. The Institute of Geophysics, University of Hamburg, installed from 22 April to 17 May 2009 three temporal seismic stations in the epicentral area. Seismological data from two close-by stations at the Deutsches Elektron-Synchrotron (DESY) in about 1 km and the Geophysical Institute in about 7 km distance were collected and integrated to the temporal network. The events occurred above the roof of the shallow Othmarschen Langenfelde salt diapir (OLD), in an area known for active sinkhole formation and previous historic ground shaking events. The analysis of the seismological data recovers that three shallow micro-earthquakes occurred from 8 to 21 April at a depth of about 100m, the largest one with a moment magnitude of about MW 0.6. Depth location of such shallow events is difficult with standard methods, and is here constrained by waveform modeling of surface waves. Earthquakes occurring in soft sediments within the uppermost 100 m are a rare phenomena and cannot be explained by standard models. Rupture process in soft sediments differ from those on faults in more competent rock. We discuss the rupture and source mechanism of the earthquakes in the context of previous historic shocks and existing sinkhole and deformation data. Although the event was so weak, the rupture duration was unusual long and possibly 0.3 s. Three possible models for the generation of repeated micro-earthquakes in Gross Flottbek are developed and discussed

  6. Validation of Baking To Control Salmonella Serovars in Hamburger Bun Manufacturing, and Evaluation of Enterococcus faecium ATCC 8459 and Saccharomyces cerevisiae as Nonpathogenic Surrogate Indicators.

    Science.gov (United States)

    Channaiah, Lakshmikantha H; Holmgren, Elizabeth S; Michael, Minto; Sevart, Nicholas J; Milke, Donka; Schwan, Carla L; Krug, Matthew; Wilder, Amanda; Phebus, Randall K; Thippareddi, Harshavardhan; Milliken, George

    2016-04-01

    This study was conducted to validate a simulated commercial baking process for hamburger buns to destroy Salmonella serovars and to determine the appropriateness of using nonpathogenic surrogates (Enterococcus faecium ATCC 8459 or Saccharomyces cerevisiae) for in-plant process validation studies. Wheat flour was inoculated (∼6 log CFU/g) with three Salmonella serovars (Typhimurium, Newport, or Senftenberg 775W) or with E. faecium. Dough was formed, proofed, and baked to mimic commercial manufacturing conditions. Buns were baked for up to 13 min in a conventional oven (218.3°C), with internal crumb temperature increasing to ∼100°C during the first 8 min of baking and remaining at this temperature until removal from the oven. Salmonella and E. faecium populations were undetectable by enrichment (>6-log CFU/g reductions) after 9.0 and 11.5 min of baking, respectively, and ≥5-log-cycle reductions were achieved by 6.0 and 7.75 min, respectively. D-values of Salmonella (three-serovar cocktail) and E. faecium 8459 in dough were 28.64 and 133.33, 7.61 and 55.67, and 3.14 and 14.72 min at 55, 58, and 61°C, respectively, whereas D-values of S. cerevisiae were 18.73, 5.67, and 1.03 min at 52, 55, and 58°C, respectivly. The z-values of Salmonella, E. faecium, and S. cerevisiae were 6.58, 6.25, and 4.74°C, respectively. A high level of thermal lethality was observed for baking of typical hamburger bun dough, resulting in rapid elimination of high levels of the three-strain Salmonella cocktail; however, the lethality and microbial destruction kinetics should not be extrapolated to other bakery products without further research. E. faecium demonstrated greater thermal resistance compared with Salmonella during bun baking and could serve as a conservative surrogate to validate thermal process lethality in commercial bun baking operations. Low thermal tolerance of S. cerevisiae relative to Salmonella serovars limits its usefulness as a surrogate for process validations.

  7. Reduzierbarkeit der Abbrecherquote im Humanmedizinstudium durch das Hamburger Auswahlverfahren für Medizinische Studiengänge - Naturwissenschaftsteil (HAM-Nat [Possible reduction of the medical school dropout number by the Hamburg Assessment test for Medicine - part Natural sciences (HAM-Nat

    Directory of Open Access Journals (Sweden)

    Harendza, Sigrid

    2008-05-01

    Full Text Available [english] Aims: Since 2005 German medical faculties are allowed to select 60% of their freshmen. Nevertheless, many faculties stick to a selection based merely on the grade point average assigned by the secondary school (Abiturnote which is the best known predictor of success in German medical schools. Methods: In order to improve selection with respect to medical school dropout numbers we developed the HAM-Nat (Hamburg Admission test for Medicine - part Natural sciences, a test consisting of 52 multiple-choice questions from the topics of chemistry, physics, biology and mathematics, and assessed its difficulty with pupils of 6 different schools. Then the HAM-Nat was administered to 333 first-year students just before the start of their courses in October 2006. After the first academic year the power of the HAM-Nat to predict individual study success was compared to that of the grade point average. Study success was measured by the number of passed exams. Outcomes: The HAM-Nat was found to correlate better with study success than the grade point average. A projection based on data from older student cohorts shows that student selection with the HAM-Nat can reduce the number of students dropping out compared with a selection based on the grade point average alone. Other parameters like chosen natural science subjects at school or an industrial training in medicine or other areas do not predict academic success. Conclusions: The HAM-Nat is a valuable tool to predict student success at medical school. Based on this study Hamburg’s medical faculty has decided to introduce the HAM-Nat to select its entrants in 2008. [german] Zielsetzung: Seit das Hochschulrahmengesetz 2005 den Hochschulen ermöglicht, 60% der Medizinstudienanfänger selbst auszuwählen, sind die Medizinischen Fakultäten auf der Suche nach dem optimalen Auswahlverfahren. Viele tun sich schwer, ein Auswahlkriterium zu definieren. Noch schwieriger ist es, einen Test für die Auswahl

  8. The New Hamburg-Hannover Agitation Scale in Clinical Samples: Manifestation and Differences of Agitation in Depression, Anxiety, and Borderline Personality Disorder.

    Science.gov (United States)

    Jung, Stefanie; Proske, Miriam; Kahl, Kai G; Krüger, Tillmann H C; Wollmer, M Axel

    2016-01-01

    Agitation is a burdening phenomenon that occurs in a variety of psychiatric disorders. The aim of this study was to give a first direction for agitation occurrence in depression, anxiety disorder, and borderline personality disorder (BPD) as well as in healthy controls with and without psychiatric record. Using the Hamburg-Hannover Agitation Scale (H2A), an instrument that allows for the measurement of agitation independently of the presence of a specific disorder, a patient sample (n = 158) and a healthy control group (n = 685) with (n = 94) and without (n = 591) psychiatric record were examined. The data were mainly analysed using ANOVAs and post hoc tests. Patients showed significantly higher H2A agitation levels than healthy controls. Within the clinical sample, BPD patients exhibited the strongest manifestation of agitation, scoring significantly higher than the depression and the anxiety disorder sample, while these two subgroups did not significantly differ from each other. Moreover, healthy subjects with a psychiatric record experienced a significantly stronger agitation than subjects without a psychiatric record. Further studies are needed with larger, more balanced, and differentiated sample sizes including a wider range of clinical pictures. The results demonstrate that agitation occurs and differs in psychiatric patients as well as in healthy controls. © 2016 S. Karger AG, Basel.

  9. Pre-travel advice at a crossroad: Medical preparedness of travellers to South and Southeast-Asia - The Hamburg Airport Survey.

    Science.gov (United States)

    Rolling, Thierry; Mühlenpfordt, Melina; Addo, Marylyn M; Cramer, Jakob P; Vinnemeier, Christof D

    Specific travel-related recommendations exist for the prevention or self-treatment of infectious diseases contracted by travellers to the tropics. In the current study, we assessed the medical preparedness per these recommendations, focusing on whether travellers carried antidiarrheal and antimalarial medication with them stratified by type of pre-travel advice. We surveyed travellers departing from Hamburg International Airport to South or Southeast Asia, using a questionnaire on demographic, medical and travel characteristics. 975 travellers were analysed - the majority (817, 83%) being tourists. A large proportion packed any antidiarrheal medication (612, 63%) - most frequently loperamide (440, 72%). Only 176 of 928 (19%) travellers to destinations with low-to medium risk for malaria packed a recommended antimalarial medication. The majority (162, 17%) of them carried antimalarials as stand-by emergency treatment (SBET). 468 (48%) travellers had a pre-travel medical consultation. This lead to higher odds of carrying SBET- with the highest odds associated with a consultation at a travel medicine specialist (OR 7.83 compared to no consultation). Attending a travel medicine specialist was associated with better adherence to current recommendations concerning the carriage of stand-by emergency treatment of malaria. However, the proportion of travellers seeking pre-travel health advice was overall low in our population. Promoting pre-travel consultations may, therefore, lead to higher adherence to the current recommendations in travel medicine. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. [Collaborative and stepped care for depression: Development of a model project within the Hamburg Network for Mental Health (psychenet.de)].

    Science.gov (United States)

    Härter, Martin; Heddaeus, Daniela; Steinmann, Maya; Schreiber, Robert; Brettschneider, Christian; König, Hans-Helmut; Watzke, Birgit

    2015-04-01

    Depression is one of the most widespread mental disorders in Germany and causes a great suffering and involves high costs. Guidelines recommend stepped and interdisciplinary collaborative care models for the treatment of depression. Stepped and collaborative care models are described regarding their efficacy and cost-effectiveness. A current model project within the Hamburg Network for Mental Health exemplifies how guideline-based stepped diagnostics and treatment incorporating innovative low-intensity interventions are implemented by a large network of health care professionals and clinics. An accompanying evaluation using a cluster randomized controlled design assesses depressive symptom reduction and cost-effectiveness for patients treated within "Health Network Depression" ("Gesundheitsnetz Depression", a subproject of psychenet.de) compared with patients treated in routine care. Over 90 partners from inpatient and outpatient treatment have been successfully involved in recruiting over 600 patients within the stepped care model. Communication in the network was greatly facilitated by the use of an innovative online tool for the supply and reservation of treatment capacities. The participating professionals profit from the improved infrastructure and the implementation of advanced training and quality circle work. New treatment models can greatly improve the treatment of depression owing to their explicit reference to guidelines, the establishment of algorithms for diagnostics and treatment, the integration of practices and clinics, in addition to the implementation of low-intensity treatment alternatives. These models could promote the development of a disease management program for depression.

  11. Spectrometer for shot-to-shot photon energy characterization in the multi-bunch mode of the free electron laser at Hamburg.

    Science.gov (United States)

    Palutke, S; Gerken, N C; Mertens, K; Klumpp, S; Mozzanica, A; Schmitt, B; Wunderer, C; Graafsma, H; Meiwes-Broer, K-H; Wurth, W; Martins, M

    2015-11-01

    The setup and first results from commissioning of a fast online photon energy spectrometer for the vacuum ultraviolet free electron laser at Hamburg (FLASH) at DESY are presented. With the use of the latest advances in detector development, the presented spectrometer reaches readout frequencies up to 1 MHz. In this paper, we demonstrate the ability to record online photon energy spectra on a shot-to-shot base in the multi-bunch mode of FLASH. Clearly resolved shifts in the mean wavelength over the pulse train as well as shot-to-shot wavelength fluctuations arising from the statistical nature of the photon generating self-amplified spontaneous emission process have been observed. In addition to an online tool for beam calibration and photon diagnostics, the spectrometer enables the determination and selection of spectral data taken with a transparent experiment up front over the photon energy of every shot. This leads to higher spectral resolutions without the loss of efficiency or photon flux by using single-bunch mode or monochromators.

  12. Fuzzy controlled tele-biogas-fermentation between Hamburg and Nordhausen for a high throughput and regulation of the electrical feeding in rate; Fuzzy-geregelte Tele-Biogasfermentation zwischen Hamburg und Nordhausen fuer einen hohen Durchsatz und Anpassungen an die Gaseinspeisungsrate

    Energy Technology Data Exchange (ETDEWEB)

    Scherer, Paul; Antonczyk, Sebastian [Hochschule fuer Angewandte Wissenschaften Hamburg, Hamburg-Bergedorf (Germany). FSP Biomassenutzung Hamburg; Schreiber, Anja; Vollmer, Gerd-Rainer [Fachhochschule Nordhausen (Germany)

    2011-07-01

    The anaerobic digestion of cereals (Triticale) as mono-input in the presence of swine manure was tested by manual intermittent feeding in comparison by feeding with the help of a fuzzy logic feedback control (FLC). By manual intermittent feeding only a process-safe OLR of 4 kg VS/(m{sup 3} d) was possible, followed by an induced overloading and reactor disturbance at {<=} 6.3 kg VS/(m{sup 3} d). By using FLC 585 days with a feedback controlled of feeding three times/d, the reliable substrate dosage of an OLR was 9 kg VS/(m{sup 3} d) being reached at a residence time of 10 days. With the fuzzy control, an increase of the OLR by more than 5 kg VS/(m{sup 3} d) was possible without jeopardizing the safe process. That means doubling of the process efficiency. During OLR 9 kg VS/(m{sup 3} d) the specific GPR was on average 0.72 m{sup 3}/(kg VS{sup *}d) being equivalent to 91.5% degradation. During OLR 11 kg VS/(m{sup 3} d) the volumetric GPR reached on average 12.6, with a peak of 27 m{sup 3}/(m{sup 3}d), but foam problems prevented an exact weighing of the input, and the series hat to be stopped. The whole fermentation process of the high-throughput biogas plant in Nordhausen could be viewed and controlled in Hamburg. For that, the fuzzy calculations were performed in Hamburg and sent for further control via Internet and FTP server to Nordhausen, naming it ''Tele-Biogas-Fermentation''. It is just like an ''autopilot''-system in an aeroplane. It also could be used to control the output of a linked gas storage system and thereby adapting the electrical output of a biogas plant to the grid demand. (orig.)

  13. Ärztliche Zentralbibliothek – Mitgestalterin einer elektronischen Lernumgebung am Universitätsklinikum Hamburg-Eppendorf / Central Medical Library (Ärztliche Zentralbibliothek – participating in the development of an e-learning environment at the University Medical Centre Hamburg-Eppendorf

    Directory of Open Access Journals (Sweden)

    Sunderbrink, Norbert

    2007-12-01

    Full Text Available The development of e-learning has brought new tasks to libraries as a providers of information services. The Central Medical Library (ÄZB has played an active part in the development of the concept for an e-learning platform at the University Medical Centre Hamburg-Eppendorf (UKE since 2006. The responsibilities of the ÄZB within the faculty's e-learning project are: to ensure the compliance with standards, to integrate recent developments, to provide first level support to users and creators of e-learning modules. The ÄZB developed a modular concept for training and assisting teachers in the creation of e-learning modules as well as on the spot hotline support. This article presents the e-learning platform „Mephisto" at the University Medical Centre Hamburg-Eppendorf including the services provided by the Central Medical Library (ÄZB. E-learning systems are primarily seen as teaching aids but they can also be turned into useful instruments for the daily work of a library. The ÄZB developed its own e-learning module in order to enhance the internal flow of information and the structured provision of materials. By using these modules, staff come in contact with new web-based technologies and their enhanced understanding will also improve the support of users. After the test phase the concept developed by the ÄZB could be used as a template for Medical Centre wide applications on the departmental or institute level.

  14. DEVELOPMENT OF HAMBURGER USING ADULT SHEEP MEAT AND OAT FLOUR DESENVOLVIMENTO DE HAMBÚRGUER DE CARNE DE OVINOS DE DESCARTE ENRIQUECIDO COM FARINHA DE AVEIA

    Directory of Open Access Journals (Sweden)

    Luís Carlos Oliveira dos Santos Júnior

    2009-12-01

    Full Text Available

    The purpose of the present study was to produce a hamburger using adult sheep meat – which is not usually well accepted for in natura consumption – and oat flour. Centesimal composition, pH, water activity, color, fatty acid content, water retention capacity and cooking loss (of both adult sheep meat and the burger patty were assessed. Carbohydrates, total calorie content and sensory characteristics of the formulated products were also considered. Adult sheep meat contained 19% of protein, 5.4% of lipids, 1.18% of ashes and 76% of humidity. The meat from adult sheep and that from young animals differed remarkably in terms of lipid content. All other parameters complied with current meat regulations, although the addition of oats and/or pork to the burgers modified the ash and humidity contents. The sensory evaluation revealed that the sample containing 50% of adult sheep meat, 46% of pork and 4% of oats – which represents the maximum content allowed by law for non-meat sources of protein – enjoyed more widespread acceptance. The hamburgers made of adult sheep meat and oat flour were well accepted by the sensory panel and conform to current regulations, being therefore suitable for the manufacture of meat derivatives.

    Key words: Centesimal composition, dietary fiber, sensorial analysis.
    O objetivo deste trabalho foi desenvolver um produto cárneo do tipo hambúrguer, adicionado de farinha de aveia, visando ao aproveitamento da carne de ovinos de descarte, uma matéria-prima de pouca aceitação na forma in natura. Foram avaliadas a composição centesimal, o pH, a atividade de água, a cor, a capacidade de retenção de água e perda de peso por cozimento da carne e dos hambúrgueres, bem como carboidratos, valor calórico total e análise sensorial dos produtos formulados. A carne ovina apresentou em média 19% de proteína, 5,4% de lipídios, 1,18% de cinzas e 76% de umidade, sendo o conte

  15. Radiation Dosage for Percutaneous PAD Treatment is Different in Cardiovascular Disciplines: Results From an Eleven Year Population Based Registry in the Metropolitan Area of Hamburg.

    Science.gov (United States)

    Behrendt, C-A; Rieß, H C; Heidemann, F; Diener, H; Rohlffs, F; Hohnhold, R; Debus, E S

    2017-02-01

    The worldwide prevalence of peripheral artery disease (PAD) has evolved to an intervention as the primary treatment option and therefore radiation is used with escalating incidence. Dose area product (DAP) correlates well with the total energy imparted to the patient during fluoroscopic interventions. This study aims to determine whether there are any associations among stage of disease, gender, age, and expertise on the radiation dose in single endovascular treatments of PAD. This study was a prospective, mandatory, population based cross-sectional registry design. In total, 24,000 invasive percutaneous endovascular treatments of PAD conducted in the metropolitan area of Hamburg (Germany) were consecutively collected between January 2004 and December 2015. DAP was analysed by discipline conducting the procedure, Fontaine classification, patient gender, and age. Statistically significant differences in median DAP values were found. The lowest median DAP values were observed in surgical centres (7.1 vs. 18.0 Gy*cm2, p<.001) and in endovascular revascularisations (ER) following multidisciplinary consultation (11.6 vs. 23.4 Gy*cm2, p<.001). Considering the treatment of intermittent claudication, men had statistically significantly higher DAP values compared with women. Furthermore, lower median DAP values were observed in higher age groups, with lowest dosages in octogenarians. This is the first large population based study on DAP during ER for PAD. Several significant differences in median DAP values were observed, although patient stratification was comparable. Pre-operative therapy strategy planning can lead to lower DAP values, emphasising the importance of further vascular research and quality improvement projects targeting this topic. To date, available evidence is limited and therefore there is no accepted range of DAP levels. However, the ever increasing use of fluoroscopic interventions means that further investigation into radiation exposure to patients

  16. The Hamburg-Hannover Agitation Scale (H2A): Development and validation of a self-assessment tool for symptoms of agitation.

    Science.gov (United States)

    Jung, Stefanie; Wollmer, M Axel; Kruger, Tillmann H C

    2015-10-01

    Agitation has long been underestimated as a symptom occurring across psychiatric disorders. While several instruments exist for highly specific clinical target groups (e.g., dementia, traumatic brain injury), no tool captures agitation in a broader range of psychiatric patients. The Hamburg-Hannover Agitation Scale (H2A) has been designed to satisfy this demand. This study concentrated on the development and validation of the scale in a psychiatric and a healthy control sample. The H2A was developed, tested in an expert sample, and revised. The German version was validated in a study involving two clinical institutions. Patients (n = 180) completed the H2A and several other questionnaires in order to test for congruent and discriminant validity. Healthy subjects (n = 685) completed the H2A only. The H2A was translated into English. The H2A showed very satisfying quality criteria (reliability, selectivity, item difficulty) and regression analysis demonstrated the H2A's ability to distinguish between subjects with a psychiatric diagnosis and healthy subjects with or without psychiatric record. Factor analysis revealed a three-factorial structure representing a physiological/somatic, a mental and a mixed ('psychophysiological') dimension of agitation. Although validation showed promising quality criteria and predictive value of the H2A, calibration tests with bigger and more balanced sample sizes are necessary. Agitation has become more clinically relevant as a symptom occurring in various affective disorders, yet its assessment is limited. The H2A was developed in order to meet this need. Validation of the H2A revealed very satisfactory item and scale quality criteria promoting its utility. Copyright © 2015. Published by Elsevier Ltd.

  17. Cutting costs of multiple mini-interviews – changes in reliability and efficiency of the Hamburg medical school admission test between two applications

    Science.gov (United States)

    2014-01-01

    Background Multiple mini-interviews (MMIs) are a valuable tool in medical school selection due to their broad acceptance and promising psychometric properties. With respect to the high expenses associated with this procedure, the discussion about its feasibility should be extended to cost-effectiveness issues. Methods Following a pilot test of MMIs for medical school admission at Hamburg University in 2009 (HAM-Int), we took several actions to improve reliability and to reduce costs of the subsequent procedure in 2010. For both years, we assessed overall and inter-rater reliabilities based on multilevel analyses. Moreover, we provide a detailed specification of costs, as well as an extrapolation of the interrelation of costs, reliability, and the setup of the procedure. Results The overall reliability of the initial 2009 HAM-Int procedure with twelve stations and an average of 2.33 raters per station was ICC=0.75. Following the improvement actions, in 2010 the ICC remained stable at 0.76, despite the reduction of the process to nine stations and 2.17 raters per station. Moreover, costs were cut down from $915 to $495 per candidate. With the 2010 modalities, we could have reached an ICC of 0.80 with 16 single rater stations ($570 per candidate). Conclusions With respect to reliability and cost-efficiency, it is generally worthwhile to invest in scoring, rater training and scenario development. Moreover, it is more beneficial to increase the number of stations instead of raters within stations. However, if we want to achieve more than 80 % reliability, a minor improvement is paid with skyrocketing costs. PMID:24645665

  18. Isolation, Characterization and Antibiotic Resistance of Shiga Toxin-Producing Escherichia coli in Hamburger and Evolution of Virulence Genes stx1, stx2, eaeA and hly by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mohammad Kargar

    2013-09-01

    Full Text Available Background & Objectives: Shiga toxin-producing Escherichia coli (STEC O157:H7 have emerged as pathogens that can cause food-borne infections and severe and potentially fatal illnesses in humans. E.coli O157:H7 colonizes the digestive tract of cattle and is transmitted to humans by food and water. The objectives of this study were to characterize the prevalence of E.coli O157:H7 isolates in hamburger in Shiraz and to test their antimicrobial sensitivity. Material & Methods: In this research, 428 samples of hamburger were collected from 7 main factories of meat products and enriched in TSB with novobiocin medium at 37ºC. Fermentation of sorbitol and lactose and activities of β- glucuronidase of separated bacteria were examined by using the SMAC and VRBA media and CHROMagar medium. Then isolation of E.coli O157:H7 was confirmed with the use of specific antisera; and with the multiplex PCR method, the presence of E.coli O157:H7 virulence genes – including stx1, stx2, eaeA, and hly – was analyzed. Finally, antibiotic resistance strains were tested with disk diffusion methods. Results: Out of all the examined samples, 264 (61.68% sorbitol-negative bacteria were separated in the CT-SMAC medium. After evaluation with specific antisera, the rate of the recognition of E.coli O157:H7 was 5 (1.17%. The stx1 and eaeA genes were diagnosed in 2 (0.47% cases of these samples. All the isolated bacteria were resistant to penicillin, clindamycin, and erythromycin antibiotics.Conclusion: The presence of STEC in animal products suggests that they may be a potential hazard for human health. A regular monitoring of STEC O157, mainly in hamburger, should be performed to prevent a possible consumer health threat.

  19. 22 May 2009-DE-President of Hamburg University-Prof. Dr M. Auweter-Kurtz signing the Guest book with Director for Research and Computing,S. Bertolucci

    CERN Multimedia

    Maximilien Brice

    2009-01-01

    Tirage 1 to 3:Signature of the Guest book,Prof. Dr M. Auweter-Kurtz with S. Bertolucci, Director for Research and Computing Tirage 4 to 5 :Dr M. Auweter-Kurtz with S. Bertolucci and Senior Physicist, ATLAS Collaboration, External Relations Office, Dr R. Voss Tirage 6 : Deputy to the BE Department Head,O. Brüning,H. Kurtz,M. Auweter-Kurtz, Dean of the Faculty of Mathematics, Informatics and Natural Sciences H. Graener, S. Bertolucci,R. Voss,CMS Collaboration, Universität Hamburg, Former SPC Member, R. Klanner

  20. Spanish, Portuguese, and Neo-Latin Poetry Written and/or Published by Seventeenth-, Eighteenth-, and Nineteenth-Century Sephardim from Hamburg and Frankfurt (2

    Directory of Open Access Journals (Sweden)

    Brown, Kenneth

    2001-06-01

    Full Text Available The present study is the second in a three-part series (the first appearing in Sefarad 59 [1999] pp. 3-42; the third being in press on the phenomenon of Neo- Latin and Romance-Language —Spanish and Portuguese— poetry of the Sephardim in Hamburg and Frankfurt am Main from the early seventeenth to the midnineteenth centuries. Our collection expands the original poetic corpus from twenty-eight to forty-five works. In an historical and critical Introduction to the poems, the authors distinguish the creative genius of a new type of literary discourse, one which meshes neo-classical strophic forms with inspiration from Sephardic orthodox Judaism as it was practiced in the Dutch Netherlands, biblical events and Jewish philosophical constructs. In addition to the evaluation and edition of the poems and, in the cases of Neo-Latin works, their translation to English, the Introduction includes an argument for substantiating book printing of Sephardic-authored books in Frankfurt am Main during the period 1614-1634 as well as sporadically throughout the remainder of the seventeenth century.

    Nuestro estudio representa la segunda parte (la primera apareció en Sefarad 59 [1999] págs. 3-42; la tercera está en prensa de un trabajo sobre la poesía en latín y lenguas romances —español y portugués— de los sefardíes de Hamburgo y de Frankfurt am Main desde principios del siglo XVII hasta mediados del XVIII. Aquí el corpus poetarum se amplía de veintiocho a cuarenta y cinco obras; estas nuevas poesías evidencian un espíritu neoclasicista mezclado ingeniosamente con un discurso apegado a un judaísmo ortodoxo-sefardí tal como entonces se practicaba en los países protestantes del norte de Europa. En el apartado introductorio, que es tanto descriptivo como evaluativo de la obra poética, se defiende la tesis de que la ciudad protestante de Frankfurt am Main con su feria del libro anual servía como lugar de impresi

  1. Development of a multichannel RF field detector for the low-level RF control of the free-electron laser at Hamburg

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, Matthias

    2008-10-15

    Modern free electron lasers produce synchrotron radiation with constantly shortening wavelengths of up to 6 nm and pulse widths of up to 100 fs. That requires a constantly increasing stability of the beam energy and arrival time of the electron beam at the undulator entrance which is situated at the end of the accelerator. At the same time, the increasing speed of digital signal processing and data acquisition facilitates new possibilities for the digital radio frequency control and field detection. In this thesis the development of a multichannel radio frequency field detector for the low level radio frequency (LLRF) control of the superconducting cavities of the Free-Electron Laser at Hamburg (FLASH) is described. The applied method of IF sampling is state of the technology and is utilized in many areas of digital communication. It is evaluated concerning its applicability for the LLRF control. Analytical and numerical investigations of the noise behavior and transport in the control loop have been accomplished to define the requirements for the measurement accuracy of the field detector that was to be developed. Therefore, simplified models of the noise behavior of each system component of the control loop, e.g. amplifier, radio frequency mixer and analog-to-digital converter, were established and subsequently assorted to a the model of the control loop. Due to the application of the vector-sum control, where several separately measured field vectors are added to a vector-sum, requirements concerning the allowable compression error of the detector nonlinearity were defined. These were investigated by analytical and numerical methods, as well. Requirements for the hardware that was to be developed were compiled from the simulation results. For the development of the field detector, a modular and EMC-compatible concept with a high-level passive front-end for an improvement of the signal-to-noise ratio was chosen. The following tests in the lab delivered the

  2. Sediment loads and transport at constructed chutes along the Missouri River - Upper Hamburg Chute near Nebraska City, Nebraska, and Kansas Chute near Peru, Nebraska

    Science.gov (United States)

    Densmore, Brenda K.; Rus, David L.; Moser, Matthew T.; Hall, Brent M.; Andersen, Michael J.

    2016-02-04

    The U.S. Geological Survey, in cooperation with the U.S. Army Corps of Engineers, monitored suspended sediment within constructed Missouri River chutes during March through October 2012. Chutes were constructed at selected river bends by the U.S. Army Corps of Engineers to help mitigate aquatic habitat lost through the creation and maintenance of the navigation channel on the Missouri River. The restoration and development of chutes is one method for creating shallow-water habitat within the Missouri River to meet requirements established by the amended 2000 Biological Opinion. Understanding geomorphic channel-evolution processes and sediment transport is important for the design of chutes, monitoring and maintenance of existing chutes, and characterizing the habitat that the chutes provide. This report describes the methods used to monitor suspended sediment at two Missouri River chutes and presents the results of the data analysis to help understand the suspended-sediment characteristics of each chute and the effect the chutes have on the Missouri River. Upper Hamburg chute, near Nebraska City, Nebraska, and Kansas chute, near Peru, Nebraska, were selected for monitoring. At each study site, monthly discrete samples were collected from April through October in the Missouri River main-channel transects upstream from the chute inlet, downstream from the chute outlet, at the outlet (downstream transect) of both chutes, and at the inlet (upstream transect) of Kansas chute. In addition, grab samples from all chute sampling locations were collected using autosamplers. Suspended-sediment concentration (SSC) and grain-size metrics were determined for all samples (discrete and grab). Continuous water-quality monitors recorded turbidity and water temperature at 15-minute intervals at the three chute sampling locations. Two acoustic Doppler velocimeters, one within each chute, measured water depth and current velocities continuously. The depth and velocity data were used to

  3. Caracterização físico-química e sensorial de hambúrguer vegetal elaborado à base de caju Physical chemical and sensory characterization of vegetal hamburger elaborated from cashew apple

    Directory of Open Access Journals (Sweden)

    Janice Ribeiro Lima

    2008-02-01

    Full Text Available A elaboração de produtos derivados do caju é uma alternativa para seu aproveitamento e para o consumo fora o período de safra. Objetivou-se neste trabalho caracterizar hambúrgueres elaborados à base de caju e comparar suas características com as de produtos comerciais. Foram adquiridos quatro tipos de hambúrgueres comerciais, um deles à base de carne e os demais à base de proteína vegetal. Os hambúrgueres foram analisados quanto às características físico-químicas (proteína, gordura, umidade, cinzas, carboidratos, atividade de água e pH e aceitação sensorial (aparência, aroma, sabor, textura e impressão global. Foram observadas grandes variações nas características dos hambúrgueres: proteínas variaram de 5,75 a 12,95%, gordura de 5,79 a 16,44%, umidade de 45,83 a 63,71%, cinzas de 2,89 a 4,75%, carboidratos de 16,35 a 33,99%, atividade de água de 0,958 a 0,983 e pH de 4,75 a 6,78. Os hambúrgueres de caju apresentaram menor pH e menores teores de proteína e gordura do que a maioria dos produtos comerciais. A aceitação sensorial também apresentou grandes variações, com notas para aparência de 6,2 a 7,8, aroma de 6,1 a 7,9, sabor de 5,7 a 8,0, textura de 5,9 a 7,9 e impressão global de 5,9 a 7,9. Para o hambúrguer de caju, a aceitação sensorial foi, em média, próxima da avaliação gostei ligeiramente (nota 6,0, para todos os atributos avaliados.Products elaborated from cashew are good alternatives for their utilization and for consumption after harvest period. This work aimed to characterize hamburgers made from cashew apple and to compare their characteristics with the ones from commercial products. Four kinds of commercial products were bought, one made of meat and the others made of vegetal protein. Hamburgers were analyzed for their physical chemical characteristics (protein, fat, moisture, ash, carbohydrates, water activity and pH and sensory acceptance (appearance, flavor, taste, texture and overall

  4. Controle bacteriológico de carne caprina para elaboração de hambúrguer caprino defumado Bacteriological control of goat meat to elaboration of smoked goat hamburger

    Directory of Open Access Journals (Sweden)

    J.C. Metri

    2006-06-01

    Full Text Available Realizaram-se avaliações bacteriológicas da matéria-prima utilizada na elaboração de um produto cárneo caprino tipo hambúrguer defumado, antes e após sanitização. A carne foi tratada por aspersão, com uma solução de ácidos orgânicos contendo 2% de ácido acético, 1% de ácido lático, 0,25% de ácido cítrico e 0,1% de ácido ascórbico, e armazenada sob refrigeração. As análises bacteriológicas foram realizadas no dia 0 e aos 7 e 14 dias após defumação. Na carne, no dia 0, a contagem de coliformes fecais estava acima do limite permitido pela legislação vigente, mas sete dias após a sanitização, esse parâmetro estava dentro dos limites permitidos. No produto final todos os parâmetros bacteriológicos encontraram-se dentro dos padrões higiênico-sanitários.In order to obtain a safe goat smoked hamburger, bacteriological analysis of the raw material was performed before and after sanitation. Meat was sprayed with a solution of organic acids containing 2% acetic acid, 1% lactic acid, 0.25% citric acid and 0.1% ascorbic acid and, after that, stored under refrigeration. Bacteriological analysis was carried out on days 0, 7 and 14 after goat smoked hamburger processing. In meat, on day 0, the fecal coliform count was above legal limits, but on day 7 after sanitation this parameter was these limits. In the final product, all the results of the bacteriological parameters were according to the sanitary-hygienic standards.

  5. [Initial experiences in psychiatric emergency service. Comments on the prevention or indication of compulsory hospitalization in accordance with the Hamburg Law on Aid and Protective Measures in Mental Diseases (author's transl)].

    Science.gov (United States)

    Spengler, A; Strege, W; Dörner, K; Hagenah, R; Meyberg, U

    1981-02-01

    On the basis of the rules of the Hamburg Law on Aid and Protective Measures in Mental Diseases, a psychiatric emergency service operates at night and on weekends. This emergency service is called upon to decide on the need for compulsory hospitalization and to prevent the same, if possible, via therapeutic alternatives. The article illustrates by documents an initial phase of the activities of this public service. Within the framework of a preliminary study, 63 recorded incidents of service by four physicians are presented who collected data on the situation encountered by them at the time of examination, on the social and anamnestic background of the patients, on their psychiatric evaluation and on the indication for compulsory hospitalization or alternative treatment methods. 22% of the patients were subjected to compulsory hospitalization. Provisional hypotheses on the conditions under which compulsory hospitalization becomes more probable, are developed from the recorded data. The concept of the risk situation is specially reflected upon. The therapeutic possibilities in connection with institutional factors are discussed with a view to promote further development of crisis intervention in the sense of preventing compulsory hospitalization.

  6. 5 February 2010: Romanian Former Minister of Justice V. Stoica (4th from left) visiting SM18 with, from left to right, University of Bucharest Faculty of Physics A. Costescu, DESY Hamburg C. Diaconu; Mrs Valeriu Stoica; Université de Montpellier II S. Ciulli; Technology Department Vacuum, Surfaces and Coatings group S. Ilie; Technology Department Head F. Bordry and Adviser for Russian Federation, Central and Eastern Europe T. Kurtyka.

    CERN Multimedia

    Maximilien Brice

    2010-01-01

    5 February 2010: Romanian Former Minister of Justice V. Stoica (4th from left) visiting SM18 with, from left to right, University of Bucharest Faculty of Physics A. Costescu, DESY Hamburg C. Diaconu; Mrs Valeriu Stoica; Université de Montpellier II S. Ciulli; Technology Department Vacuum, Surfaces and Coatings group S. Ilie; Technology Department Head F. Bordry and Adviser for Russian Federation, Central and Eastern Europe T. Kurtyka.

  7. German Aircraft Industry, Bremmen-Hamburg Area.

    Science.gov (United States)

    1946-01-02

    Vandplattenfabrik Date Visited: June 1, 1945 We talked to Gustav Harder. He lives at Bremerstr. 15, Vegesack. He is the director of the Reich-Tire...manufactured apparently by Gustav Reichter, Esslin~en Neckar. This piece of equipment is developed to the extent that the use of microscope or any reference to...iuohtini, Name: Theo dore Klatte kor Sittel-Huchting) Date Visited: June 5, 1945 This facility had been reported as Fo cke- Achgelis, manufacturing

  8. Energeetikafoorum "Quo vadis, Eesti energeetika?" / Arvi Hamburg

    Index Scriptorium Estoniae

    Hamburg, Arvi, 1948-

    2006-01-01

    Tallinna Tehnikaülikoolis 27. aprillil 2006. a. Ühiskondliku Leppe Sihtasutuse, Tallinna Tehnikaülikooli, Eesti Teadlaste Liidu ja Eesti Inseneride Liidu korraldatud foorumist. Avaettekandega esines foorumil president Arnold Rüütel

  9. Energeetikafoorum "Quo vadis, Eesti energeetika?" / Arvi Hamburg

    Index Scriptorium Estoniae

    Hamburg, Arvi, 1948-

    2006-01-01

    Tallinna Tehnikaülikoolis 27. aprillil 2006. a. Ühiskondliku Leppe Sihtasutuse, TTÜ, Eesti Teadlaste Liidu ja Eesti Inseneride Liidu korraldatud foorumist. Avaettekandega esines president Arnold Rüütel

  10. Major General Melvin Zais and Hamburger Hill

    Science.gov (United States)

    2012-12-06

    Normandy stalled in the hedgerows of the bocage countryside. In addition, the German destruction of the port of Cherbourg combined with the destruction...207/rec/36 (accessed 03 April 2012). Dolman, Everett C. Pure Strategy: Power and Principle in the Space and Information Age , London: New York, 2005

  11. Processing, physicochemical, and sensory analyses of ostrich meat hamburger Processamento, análise físico-química e sensorial do hambúrguer de carne de avestruz

    Directory of Open Access Journals (Sweden)

    Vera Lúcia Ferreira de Souza

    2012-09-01

    Full Text Available The objective of this study was to assess the potential utilization of ostrich meat trimming in hamburger preparation, as well as its physicochemical and sensory characterization. Using ostrich meat trimmings from the legs and neck, four different formulations were prepared with varied amounts of bacon and textured soybean protein. Physical analysis of yield, shrinkage percentage, and water retention capacity and chemical analysis of proximate composition, cholesterol levels, and calories were performed. The formulations underwent sensory analysis by 52 potential ostrich meat consumers, who evaluated tenderness, juiciness, flavor, and purchase intent. The formulations containing textured soybean protein showed the highest yield, lowest shrinkage percentage, and highest water retention capacity. Lipid content varied from 0.58 to 4.99%; protein from 17.08 to 21.37%; ash from 3.00 to 3.62%; moisture from 73.87 to 76.27%; cholesterol from 22.54 to 32.11 mg.100 g-1; and calorie from 87.22 to 163.42 kcal.100 g-1. All formulations showed low cholesterol and calorie levels, even that containing 10% bacon and 3.5% textured soybean protein, which achieved the best scores and acceptance by the panelists.O objetivo deste trabalho foi verificar a potencialidade do aproveitamento tecnológico de aparas da carne de avestruz na elaboração de hambúrguer, e sua caracterização físico-química e sensorial. Com aparas de carne de avestruz, retiradas das pernas e pescoço, foram elaboradas quatro diferentes formulações de hambúrgueres, variando teores de toucinho e proteína texturizada de soja. Foram feitas análises físicas de rendimento, percentagem de encolhimento e capacidade de retenção de água; e análises químicas de composição centesimal, teores de colesterol e calorias. As formulações foram analisadas através de teste afetivo por 52 potenciais consumidores de carne de avestruz, que avaliaram a maciez, suculência, sabor e intenção de

  12. Detección de Escherichia coli O157: H7 en carne picada fresca y hamburguesas congeladas Escherichia coli O157: H7 detection in fresh ground beef and hamburgers

    Directory of Open Access Journals (Sweden)

    M. A. Marzocca

    2006-03-01

    Full Text Available Escherichia coli O157:H7 es un patógeno emergente asociado a enfermedades transmitidas por alimentos. En el año 1982 fue reconocido por primera vez, en los Estados Unidos, como causante de dos brotes de colitis hemorrágica. Hoy se sabe que la mayoría de los casos de síndrome urémico hemolítico son ocasionados por este microorganismo. El objetivo del trabajo fue detectar su presencia en carne picada fresca y hamburguesas congeladas, muestras obtenidas en puntos de venta de nuestra cadena de supermercados en un total de 37 y 43, respectivamente, en el período comprendido entre abril de 2003 y agosto de 2004. Las mismas fueron procesadas utilizando el caldo selectivo para enriquecimiento EC modificado conteniendo novobiocina, seguido de la aplicación de un método de inmunocaptura (TECRA E. COLI O157 IMMUNOCAPTURE TM ECOICM 20, y posterior aislamiento en agar MacConkey sorbitol suplementado con cefixima y telurito de potasio y un medio cromogénico. Las cepas sospechosas fueron caracterizadas a genotípicamente mediante la detección de los genes de virulencia stx1, stx2, eaeA y EHEC-hlyA por PCR e hibridación con sondas genéticas, b fenotípicamente mediante la determinación del serotipo, sensibilidad a los antimicrobianos por el método de difusión de Kirby-Bauer y producción de Stx por ensayo de citotoxicidad específica en células Vero. Se aisló E. coli O157:H7 en una sola muestra de carne picada fresca (2,7% caracterizada como gen eae (+/stx2/EHEC-hlyA.Escherichia coli O157:H7 is an emergent pathogen associated with food transmitted diseases. In 1982, Escherichia coli 0157:H7 was for the first time identified as the cause of two hemorrhagic colitis outbreaks in the United States. It is now well known that most cases of hemolytic uremic syndrome are caused by these bacteria. The objective of this work was to detect the microorganism in fresh ground beef and hamburgers. From April 2003 to August 2004 samples were taken at sale

  13. Personal Storytelling and Narrative as a Means for Climate Scientists to Engage and Inform Public Audiences - Illustrated by the Play '2071 - The World We'll Leave Our Grandchildren' Comissioned by the Royal Court Theatre, London and the Deutsches Schauspielhaus, Hamburg

    Science.gov (United States)

    Rapley, C. G.

    2015-12-01

    In order to engage greater public interest in science it is necessary to move beyond the traditional academic "information deficit" mode of communication, with its emphasis on the delivery and explantion of 'facts'. This is especially the case for topics such as climate science, which have the potential to provoke strong conscious or unconscious emotional and ideological audience reactions. The use of personalised narrative and storytelling offers a means to draw in non-experts in a way that overcomes barriers of disinterest or prejudice. The talk will address the role of climate scientists in communicating within the public square, and will use the play '2071 - The World We'll Leave Our Grandchildren" as an example of how theatre can provide an effective means of communicating complex and provocative knowledge and understanding. The play was commissioned by the Royal Court Theatre, London and the Deutshes Schauspielhaus, Hamburg. It received positive reviews and sold out at the London venue.

  14. Microbiological quality of hamburgers sold in the streets of Cuiabá - MT, Brazil and vendor hygiene-awareness Qualidade microbiológica de sanduíche comercializado nas ruas de Cuiabá - MT, Brasil e a percepção dos manipuladores

    Directory of Open Access Journals (Sweden)

    Aída Couto Dinucci Bezerra

    2010-06-01

    Full Text Available This study evaluated the microbiological quality of hamburgers and the microbe community on the hands of vendors in Cuiabá, Mato Grosso, Brazil, in relation to vendors´ awareness as to what constitute acceptable food-handling practices as part of a broad-spectrum research programme on street foods in Brazil . Sale of the hamburger known as the 'baguncinha' is common and widespread in urban Cuiabá, Mato Grosso, Brazil. Food inspectors encounter various difficulties in carrying out inspections. One hundred and five hamburgers samples were evaluated using conventional methods including tests for facultative aerobic and/or anaerobic mesophytic bacteria, coliform counts at 45 °C, the coagulase test for Staphylococcus, Gram-staining for the presence of Bacillus cereus, Clostridium sulphite reductase and Salmonella spp. The hamburgers were categorized as unsuitable for human consumption in 31.4% of samples, with those testing positive for coliforms and Staphylococcus at unacceptably high levels by Brazilian standards. High levels of microbiological contamination were detected on the hands of the food handlers and mesophytic bacterial counts reached 1.8 × 10(4 CFU/hand. Interviews were carried out by means of questionnaires to evaluate levels of awareness as to acceptable food handling practices and it was found that 80,1% of vendors had never participated in any kind of training.Este estudo avaliou a qualidade microbiológica de sanduíches e a microbiota nas mãos dos vendedores em Cuiabá - Mato Grosso, Brasil, relacionando com o conhecimento dos comerciantes sobre boas práticas de manipulação, como parte de um amplo programa de pesquisa sobre alimentos de rua no Brasil. O comércio de sanduíche denominado baguncinha é típico na região metropolitana de Cuiabá - Mato Grosso, Brasil. A vigilância sanitária tem problemas estruturais e financeiros para a fiscalização. Cento e cinco amostras de sanduíches foram avaliadas utilizando-se m

  15. Emission trading north - benefits for the economy and the environment. A pilot project of the Energy Foundation Schleswig-Holstein in co-operation with the Association of the Chambers of Industry and Commerce in Schleswig-Holstein and the Union of Employers' Associations in Hamburg and Schleswig-Holstein

    Energy Technology Data Exchange (ETDEWEB)

    Barzantny, Katja [Energiestiftung Schleswig-Holstein, Kiel (Germany); Hahn, Michael [ERM Lahmeyer Int. GmbH, Neu-Isenburg (Germany); Kruska, Martin [EUtech Energie plus Umwelt, Technik plus Management, Aachen (Germany); Klein, Michael [500 PPM Gesellschaft fuer Emissionshandel und Beratung mbH, Hannover (Germany)

    2003-07-01

    In co-operation with the Association of the Chambers of Industry and Commerce in Schleswig-Holstein and the Union of Employers' Associations in Hamburg and Schleswig-Holstein the Energy Foundation Schleswig-Holstein is carrying out the pilot project Emission Trading North. Its primary target is the regional application of the flexible mechanisms (ET, JI, CDM) together with the industry of Schleswig-Holstein. In detail, it focuses on capacity building on behalf of the different parties involved, a smooth transition to real ET and the positioning of the Energy Foundation in a future ET system. The project cycle consists of 3 phases (Phase 0: preparatory work; Phase 1: development of emission inventories, identification and evaluation of emission reduction measures; Phase 2: simulation of ET). Participating companies located in Schleswig-Holstein and Hamburg, representing the power sector, cement production, paper and pulp production, non-ferrous metals as well as the renewable energy sector, dealt with the central question of allocation of emission allowances. During in-depth energy analyses emission reduction measures were identified and evaluated with respect to their volume of emission reductions and related costs. Participating companies developed mid and long-term trading strategies taking into account investment cycles, project risks and market prices. The strategy was tested during a multi-period trading simulation. With respect to the national allocation plan, a central element of the future European emission trading system, the pilot project proposes consistent solutions relating to CHP, capacity limits, process emissions, fuel substitutes, new entrants and shut-down of installations.

  16. Upper and Lower Hamburg Bend 2011 Flood Evaluation on the Missouri River near Hamburg, Iowa

    Science.gov (United States)

    2017-01-01

    frequency study. The frequency study was previously performed by the Omaha District with a HEC - RAS model in which the resulting model water surface...on AdH model elevation data. ERDC/CHL TR-17-1 13 Figure 6. Water surface elevation profile comparison. The Omaha District’s HEC - RAS model...yd ra ul ic s La bo ra to ry Nathan Clifton, David Abraham, and Dan Pridal January 2017 Approved for public release; distribution is

  17. Solar-assisted central heating in Hamburg-Bramfeld; Solarunterstuetzte Nahwaermeversorgung Hamburg-Bramfeld

    Energy Technology Data Exchange (ETDEWEB)

    Ebel, M. [HGC Hamburg Gas Consult, Hamburg (Germany)

    1998-12-31

    About 38% of the energy consumed in Germany is used for space heating. Hot water demand of old buildings accounts for approximately 10% while buildings constructed according to modern insulation standards account for 15 - 20 %. Space heating has a considerable conservation potential, which plays an important role in terms of reducing carbon dioxide pollution. More and more new technologies for conventional thermal insulation as well as for the active use of solar energy are being developed and will soon be commercially available. (orig.) [Deutsch] In der Bundesrepublik Deutschland werden ca. 38% des Energieverbrauches fuer die Waermeversorgung von Gebaeuden eingesetzt. Auf den Warmwasserbedarf entfallen davon ca. 10% bei Altbauten und 15-20% bei Wohngebaeuden nach den heute gueltigen Waermeschutzbestimmungen. Damit liegt im Bereich der Waemreversorgung von Gebaeuden ein erhebliches Einsparpotential, welches innerhalb der Diskussion ueber die CO{sub 2}-Problematik eine immer groessere Bedeutung erlangt. Neben einer Verbesserung der konventionellen Waermedaemmung der Gebaeude werden zunehmend Techniken der aktiven Solarenergienutzung zur Einsatzreife entwickelt. (orig.)

  18. La « connexion hamburger » appliquée à l’Amazonie brésilienne. Décryptage de l’ « effet papillon » entre consumérisme carné et déboisement

    Directory of Open Access Journals (Sweden)

    Guillaume Marchand

    2009-03-01

    Full Text Available Selon l’énoncé de la « connexion hamburger », l’un des derniers grands massifs forestiers de la planète serait directement menacé par notre consommation excessive de viande bovine. L’idée n’est pas vraiment neuve, elle a déjà été formulée dans les années 1980 par un environnementaliste du nom de N. Myers pour expliquer la recrudescence des déboisements en Amérique Centrale. Vingt-quatre ans plus tard, un groupe de chercheurs du CIFOR1 l’a exhumée pour l’Amazonie brésilienne. Médias et ONG’s environnementalistes se sont alors empressés de divulguer l’information, en incitant parfois au boycott des viandes brésiliennes voire des restaurants européens ou nord-américains qui en servent. Si l’identification de liens de causes à effets entre nos gestes quotidiens et des impacts environnementaux globaux est tout à fait louable, l’objectif étant de faire évoluer les mentalités, il s’opèrent parfois quelques simplifications sur la nature et l’ampleur de ces phénomènes…En s’intéressant à l’évolution des structures spatiales des filières bovines brésiliennes et plus spécifiquement amazoniennes depuis l’ouverture de la frontière agraire (1970’s, le présent article a pour objectif d’évaluer dans quelle mesure les différents écosystèmes de la région ont eut à pâtir de nos instincts carnivores. Nous verrons ainsi que la connexion hamburger internationale est un phénomène aux nombreuses ramifications, ne consommant pas toujours directement de la forêt ombrophile dense mais bien souvent des espaces de savanes ou des forêts de transition.According to the “hamburger connection” concept, one of the lasts rainforest regions of the earth would be directly menaced by our excessive consumption of beef meat. The idea is not very new, it was formulated in the 1980 by the environmentalist N. Myers to explain the intensification of deforestation in Central America. Twenty

  19. Hábitos de consumo de hamburguesas y riesgo de exposición a Escherichia coli verotoxigénica (VTEC: modelo de simulación Hamburger consumption patterns and exposure assessment for verocytotoxigenic Escherichia coli (VTEC: simulation model

    Directory of Open Access Journals (Sweden)

    M. L. Signorini

    2009-09-01

    Full Text Available El objetivo del trabajo fue evaluar cuantitativamente el riesgo para la salud pública debido a la infección por VTEC derivado del consumo de hamburguesas. Mediante un modelo de simulación, se analizaron procesos de distribución, almacenamiento y venta, así como hábitos de consumo. La prevalencia y concentración de VTEC fue incluida en el modelo sobre la base de información científica publicada acerca de la enfermedad. Las distribuciones de probabilidad que mejor describieron cada paso del proceso fueron incorporadas en el programa @RiskR, y se realizaron múltiples simulaciones empleando el análisis Monte Carlo. El riesgo estimado de padecer la infección por VTEC en los adultos fue de 4,45 x 10-4; mientras que en los niños, los riesgos de adquirir la infección, de padecer Síndrome Urémico Hemolítico (SUH y de mortalidad fueron de 2,6 x 10-4, 1,38 x 10-5 y 4,54 x 10-7, respectivamente. El riesgo de adquirir la infección y sus secuelas estuvo correlacionado con la concentración bacteriana en la carne (r = 0,664. El consumo de hamburguesas de elaboración propia (r = -0,203 estuvo asociado con el riesgo de enfermar dadas las características del almacenamiento (r = -0,567, que forman parte de los hábitos de consumo de la población. La información generada debería considerarse durante el diseño de estrategias de gestión y comunicación del riesgo del SUH, con énfasis en la importancia que estos factores tienen en la trasmisión de la enfermedad.A quantitative risk assessment was developed for verocytotoxigenic Escherichia coli (VTEC associated with hamburger consumption. The assessment (simulation model considers the distribution, storage and consumption patterns of hamburgers. The prevalence and concentration of VTEC were modelled at various stages along the agri-food beef production system using input derived from Argentinean data, whenever possible. The model predicted an infection risk of 4.45 x 10-4 per meal for adults

  20. "ArtGenda" erobert Hamburg / Anders Härm

    Index Scriptorium Estoniae

    Härm, Anders, 1977-

    2002-01-01

    7.-23. VI Hamburgis Läänemere-äärsete linnade noorte kunstnike biennaal "ArtGenda". Eestist osalevad projektides rühmitus Valie Export Society (Killu Sukmit, Mari Laanemets, Kadi Estland), rühmitus Tiit Sokk (Ulvi Tiit, Marili Sokk), ESTO TV (Ken & Tolk, Andres Maimik), Elin Kard, Aivar Tõnso, Kiwa

  1. Sandra Witte: Zouber. Hamburg: Verlag Dr. Kovač 2007

    Directory of Open Access Journals (Sweden)

    Andrea Sieber

    2009-03-01

    Full Text Available Die Freiburger Dissertation widmet sich dem Faszinosum Magie am Beispiel der höfischen Literatur des 12. und 13. Jahrhunderts. Im Zentrum steht die deskriptive Analyse von Magiedarstellungen auf der Handlungsebene fiktionaler Texte, wobei ein besonderes Augenmerk auf Geschlechterdifferenzen magiekundiger Figuren liegt. Vorab werden mögliche Schnittflächen zu zeitgenössischen Diskursen in den Bereichen Religion, Wissenschaft und Heilkunde konturiert und diese um Skizzen zu ausgewählten nichtfiktionalen Quellen ergänzt. Leider verschenkt die mediävistische Studie durch ihren überwiegend nacherzählenden Duktus das in der Magie-Thematik inhärente gender-theoretische und kulturwissenschaftliche Potential.This Freiburger dissertation approaches fascination with magic using the example of the courtly literature of the 12th and 13th centuries. Central to the study is the descriptive analysis of representations of magic at the plot level of fictional texts, whereby specific attention is paid to gender differences of those figures skilled in magic. Possible intersections with contemporary discourses in the areas of religion, science, and medical science are outlined at the outset. These are expanded with sketches of select non-fictional sources. Unfortunately, because of its tendency to uncritically re-narrate the texts, the medieval study passes up on the gender-theoretical and cultural studies oriented potential inherent to the theme of magic.

  2. Metropolitan Cities under Transition: The Example of Hamburg/Germany

    National Research Council Canada - National Science Library

    Amelie Boje; Ingrid Ott; Silvia Stiller

    2010-01-01

    .... In industrialized countries, the former induces an overall reduction of population and labor force, whereas the latter implies an ongoing shift to the tertiary sector and increased specialization...

  3. Microburger Biochemistry: Extraction and Spectral Characterization of Myoglyobin from Hamburger

    Science.gov (United States)

    Bylkas, Sheri A.; Andersson, Laura A.

    1997-04-01

    This experiment provides a demonstration of useful biochemical methods at a Basic or Advanced Level, depending upon the available spectrophotometric equipment. The protocol combines protein extraction, ox-i-dation and reduction, and simple spectroscopic analysis, as well as gel filtration chromatography and generation/analysis of spectral scans. Mammalian myoglobin (Mb) is a monomeric O2-binding protein that functions in muscle to store oxygen. The single iron protoporphyrin IX (heme) group is bound to protein by the amino acid Histidine93. The common, stable forms, Met-Mb and Oxy-Mb are studied because in a non-living system, red Oxy-Mb is converted to brown Met-Mb as bound O2 molecule is released. Mb is easily extracted from steak, to illustrate and address why fresh meat is red and aged meat is brown; the protein has unique spectral properties that are diagnostic for characterization of sample identity. After application of heme redox chemical methods, the MetMb or OxyMb samples can be studied spectroscopically. The color change between Oxy-Mb and Met-Mb is dramatic (illustrating bright red fresh meat vs. brown older meat), and method(s) used in this laboratory are simple, inexpensive, and non-harmful to the student.

  4. The Hamburg Humanist Albert Krantz's Use of Saxo Grammaticus

    DEFF Research Database (Denmark)

    Friis-Jensen, Karsten

    2007-01-01

    Albert Krantz indkorporerer Saxos lange latinske digt (ca. 1200) om Starkads død i sin Nordenshistorie (ca. 1500). Saxos tekst af digtet findes kun i én afskrift, mens Krantz' version af digtet findes både i et tryk og et håndskrift. Krantz-håndskriftet udnyttes for første gang til at rette fejl ...

  5. Modelo de contaminación cruzada por Escherichia coli verocitotoxigénica durante la elaboración de hamburguesas caseras y evaluación cuantitativa de riesgos Quantitative risk model for verocytotoxigenic Escherichia coli cross-contamination during hamburger preparation

    Directory of Open Access Journals (Sweden)

    M. L. Signorini

    2009-12-01

    Full Text Available El objetivo del presente trabajo fue generar un modelo probabilístico para evaluar cuantitativamente el riesgo de contaminación cruzada de E. coli verocitotoxigénica (VTEC durante el proceso de elaboración de hamburguesas caseras y su impacto en la salud pública. El modelo tuvo en cuenta un grupo de prácticas culinarias corrientes y a cada una de ellas se le asignó la probabilidad asociada de transferencia de VTEC entre los alimentos y los utensilios de cocina. Las distribuciones de probabilidad que mejor describieron cada paso del proceso fueron incorporadas en el programa @Risk® y se realizaron las simulaciones empleando el análisis Monte Carlo. La manipulación de alimentos crudos (en este caso, la carne picada antes de la preparación de alimentos que no demandan cocción (como las guarniciones de vegetales frescos que suelen acompañarlas (Odds ratio, OR = 6,57, así como el hábito del lavado de manos (OR = 12,02 y de las tablas que se utilizan durante la elaboración de estos platos (OR = 5,02, fueron los principales factores de riesgo de contaminación cruzada del patógeno entre la carne y las verduras. La información aportada por este modelo debería considerarse durante el diseño de estrategias de comunicación del riesgo del síndrome urémico hemolítico para acentuar la importancia que estos factores pueden tener en la transmisión de la enfermedad.The objective of this study was to develop a quantitative risk model for verocytotoxigenic Escherichia coli (VTEC cross-contamination during hamburger preparation at home. Published scientific information about the disease was considered for the elaboration of the model, which included a number of routines performed during food preparation in kitchens. The associated probabilities of bacterial transference between food items and kitchen utensils which best described each stage of the process were incorporated into the model by using @Risk® software. Handling raw meat before

  6. Ernst Odefey 1882 1964: Leben und Werk des Hamburger Maiers und Grafikers(Ernst Odefey 1882 1964: Life and Work of the Hamburger Painter and Printmaker)

    Science.gov (United States)

    2016-01-01

    Engagement, einen geeigneten und reprasentativen Ausstellungsort zu finden . Unser ganz besonderer Dank gilt der Helmut-Schmidt-Universitat und Herrn...Tier- und Landschaftsmalerei. Ludwig von Hofmann (1903 nach Weimar berufen) gilt als einer der deutschen Hauptvertreter der naturlyrischen Variante...Schneider, der Maler gro13er Figurenkompositionen, und Theodor Hagen, der als der Haupt- vertreter der Weimarer Malerschule gilt und der bis zu

  7. Progress report about the rehabilitation of a former gasworks area in Hamburg-Bergedorf; Erfahrungsbericht ueber die Sanierung eines ehemaligen Gaswerkgelaendes in Hamburg-Bergedorf

    Energy Technology Data Exchange (ETDEWEB)

    Krebs, H. [Hamburg Gas Consult GmbH, Hamburg (Germany)

    1997-12-01

    Since the gas supply was changed from city gas to natural gas the former gaswork sites are one by one decontaminated. Due to the present scope of laws, but also frequently for architectural reasons, in many kinds of remediation specific solutions are conceived and realized. In the case, that will be reported here, such a conception was developed. In between it has been already partly realized and it is partly in execution yet. In the first part of the remediation program the ground was sealed or the most contaminated soil was replaced. In the current stage the ground and groundwater are purified by exhausting of ground air and treating of the soil with water in the underground. Each plant is in effective operation since 1.5 years. (orig.) [Deutsch] Seit der Umstellungsphase von Stadtgas auf Erdgas werden Zug um Zug die alten Gaswerkstandorte saniert. Aufgrund der heutigen gesetzlichen Rahmenbedingungen aber haeufig auch aus baulichen Gruenden werden vielfach standortspezifische Sanierungsloesungen konzipiert und umgesetzt. Im hier berichteten Fall wurde ein solches Konzept entwickelt, das teils schon umgesetzt und teils sich noch in der Ausfuehrung befindet. Es wurden im ersten Sanierungsabschnitt Versiegelungs- und Bodenaustauschmassnahmen durchgefuehrt; in der jetzt laufenden Phase findet eine Boden- und Grundwasserreinigung mittels Bodenluftabsaugung und hydraulischer Behandlung statt. Seit ueber 1,5 Jahren ist jeweils eine Anlage erfolgreich in Betrieb. (orig.)

  8. A strategy-based framework for assessing the flood resilience of cities : a Hamburg case study

    NARCIS (Netherlands)

    Restemeyer, Britta; Woltjer, Johannes; van den Brink, Margaretha

    Climate change and continuous urbanization contribute to an increased urban vulnerability towards flooding. Only relying on traditional flood control measures is recognized as inadequate, since the damage can be catastrophic if flood controls fail. The idea of a flood-resilient city – one which can

  9. Thermotolerance responses in ripening berries of Vitis vinifera L. cv Muscat Hamburg.

    Science.gov (United States)

    Carbonell-Bejerano, Pablo; Santa María, Eva; Torres-Pérez, Rafael; Royo, Carolina; Lijavetzky, Diego; Bravo, Gema; Aguirreolea, Jone; Sánchez-Díaz, Manuel; Antolín, M Carmen; Martínez-Zapater, José M

    2013-07-01

    Berry organoleptic properties are highly influenced by ripening environmental conditions. In this study, we used grapevine fruiting cuttings to follow berry ripening under different controlled conditions of temperature and irradiation intensity. Berries ripened at higher temperatures showed reduced anthocyanin accumulation and hastened ripening, leading to a characteristic drop in malic acid and total acidity. The GrapeGen GeneChip® combined with a newly developed GrapeGen 12Xv1 MapMan version were utilized for the functional analysis of berry transcriptomic differences after 2 week treatments from veraison onset. These analyses revealed the establishment of a thermotolerance response in berries under high temperatures marked by the induction of heat shock protein (HSP) chaperones and the repression of transmembrane transporter-encoding transcripts. The thermotolerance response was coincident with up-regulation of ERF subfamily transcription factors and increased ABA levels, suggesting their participation in the maintenance of the acclimation response. Lower expression of amino acid transporter-encoding transcripts at high temperature correlated with balanced amino acid content, suggesting a transcriptional compensation of temperature effects on protein and membrane stability to allow for completion of berry ripening. In contrast, the lower accumulation of anthocyanins and higher malate metabolization measured under high temperature might partly result from imbalance in the expression and function of their specific transmembrane transporters and expression changes in genes involved in their metabolic pathways. These results open up new views to improve our understanding of berry ripening under high temperatures.

  10. Decrease in (Major Amputations in Diabetics: A Secondary Data Analysis by AOK Rheinland/Hamburg

    Directory of Open Access Journals (Sweden)

    Melanie May

    2016-01-01

    Full Text Available Aim. In two German regions with 11.1 million inhabitants, 6 networks for specialized treatment of DFS were implemented until 2008. Data provided for accounting purposes was analysed in order to determine changes in the rate of diabetics requiring amputations in the years before and after the implementation. Method. Data covering 2.9 million people insured by the largest insurance company between 2007 and 2013 was analysed by the use of log-linear Poisson regression adjusted for age, gender and region. Results. The rate of diabetics needing major amputations fell significantly by 9.5% per year (p<0.0001 from 217 to 126 of 100,000 patients per year. The rate of diabetics needing amputations of any kind fell from 504 to 419 of 100,000 patients per year (p=0.0038. Discussion. The networks integrate health care providers in an organised system of shared care. They educate members of the medical community and the general public. At the same time, a more general disease management program for people with diabetes was implemented, which may also have contributed to this decrease. At the end of the observation period, the rate of diabetics requiring amputations was still high. For this reason, further expansion of organised specialized care is urgently needed.

  11. Bindung und Bindungstherapie - Die Hamburger Interventionsstudie „Kreis der Sicherheit“

    OpenAIRE

    Ramsauer, Brigitte; Gehrke, Julia; Lotzin, Annett; Powell, Bert; Romer, Georg

    2011-01-01

    Seit den 60er Jahren ist das Interesse an der empirischen Forschung zur frühen Kindheit und Mutter-Kind-Beziehung gestiegen. Wesentliche Impulse gehen von der Bindungstheorie aus. In wechselseitig regulierter Interaktion erfährt die Bindungs- und Fürsorgebeziehung zwischen Mutter und Säugling ihre besondere emotionale Qualität. Frühe Bindung beeinflusst die soziale, emotionale und kognitive Entwicklung über die Kindheit hinaus. Dies erfordert die Entwicklung bindungsbezogener Präventions- und...

  12. From Hamburg to Belem: The Limits of Technocratic Thinking in Adult Learning Education

    Science.gov (United States)

    Torres, Carlos Alberto

    2015-01-01

    This article discusses some of the generalized analyses of adult learning education, mostly informed by technocratic thinking, highlighting perceived trends in adult learning education between CONFINTEA V and CONFITEA VI. Those trends could be understood as challenges. Employing a political sociology of adult learning education as a critique of…

  13. Struggling for recognition and affordable housing in Amsterdam and Hamburg : Resignation, resistance, relocation

    NARCIS (Netherlands)

    Buchholz, Tino

    2016-01-01

    Searching for justice in cities invokes the recognition paradigm in contemporary critical theory, where Axel Honneth counts as a leading voice. Honneth has not only conceptualised the moral grammar of social conflict but has convincingly explained what we want from life. Linking Honneth’s theory of

  14. Viktor Hamburger's Department of Zoology in the 1940s: a student perspective.

    Science.gov (United States)

    Wenger, B S; Wenger, E

    2001-04-01

    Eleanor and Byron Wenger were graduate students in the Department of Zoology in the 1940s. Both took several courses with Viktor, and he was thesis advisor for both of us. We have attempted to provide a summary of life in the department from a student perspective as well as our impression of Viktor's style of mentoring and guiding student research and education.

  15. Baseline assessment and best practices in urban water cycle services in the city of Hamburg

    OpenAIRE

    Bertram, Niels-Peter; Van Leeuwen, Cornelis Johannes

    2013-01-01

    Megatrends (e.g. demographic changes, water scarcity, water pollution and climate change) pose urgent water challenges in cities. This is highlighted in the European Union (EU) project TRUST (Transitions to the Urban Water Services of Tomorrow; www.trust-i.net/index.php). The main objective of TRUST is to support water authorities and utilities in Europe in formulating and implementing appropriate urban water policies as well as new technology and management solutions in order to enhance urba...

  16. Rezension von: Ingrid Galster: Simone de Beauvoir und der Feminismus. Hamburg: Argument Verlag 2015.

    Directory of Open Access Journals (Sweden)

    Romana Weiershausen

    2015-05-01

    Full Text Available Ingrid Galster hat ihre Schriften zu Simone de Beauvoir und zur Frauen- und Geschlechterforschung in einem Band zusammengeführt. Die Artikel vermitteln klare Einsichten und ergeben ein beeindruckendes Gesamtbild, das die – neue oder erneute – Lektüre lohnt.

  17. IDRC contributes to policy advice for G20 Summit in Hamburg ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2017-07-07

    Jul 7, 2017 ... IDRC thought leadership in two areas — eSkills for women and girls and the health-related Sustainable Development Goals (SDGs) — is contributing to ... contribute to agricultural resilience to climate change in Costa Rica and Brazil by developing more sustainable soil and water management strategies.

  18. Rezension zu: Sandra Witte: Zouber. Hamburg: Verlag Dr. Kovač 2007

    Directory of Open Access Journals (Sweden)

    Andrea Sieber

    2009-03-01

    Full Text Available Die Freiburger Dissertation widmet sich dem Faszinosum Magie am Beispiel der höfischen Literatur des 12. und 13. Jahrhunderts. Im Zentrum steht die deskriptive Analyse von Magiedarstellungen auf der Handlungsebene fiktionaler Texte, wobei ein besonderes Augenmerk auf Geschlechterdifferenzen magiekundiger Figuren liegt. Vorab werden mögliche Schnittflächen zu zeitgenössischen Diskursen in den Bereichen Religion, Wissenschaft und Heilkunde konturiert und diese um Skizzen zu ausgewählten nichtfiktionalen Quellen ergänzt. Leider verschenkt die mediävistische Studie durch ihren überwiegend nacherzählenden Duktus das in der Magie-Thematik inhärente gender-theoretische und kulturwissenschaftliche Potential.

  19. Review and analysis of Hamburg Wheel Tracking Device test data : [technical summary].

    Science.gov (United States)

    2014-02-01

    Approximately 89% of the paved-road network in Kansas is asphalt surfaced (bituminous and : composite). According to the Kansas Department of Transportation (KDOT), typical design : performance period of hot-mix asphalt (HMA) pavement for new constru...

  20. Baseline assessment and best practices in urban water cycle services in the city of Hamburg

    NARCIS (Netherlands)

    van Leeuwen, C.J.|info:eu-repo/dai/nl/071976817; Bertram, N.P.

    2013-01-01

    Megatrends (e.g. demographic changes, water scarcity, water pollution and climate change) pose urgent water challenges in cities. This is highlighted in the European Union (EU) project TRUST (Transitions to the Urban Water Services of Tomorrow; www.trust-i.net/index.php). The main objective of TRUST

  1. Migrants' educational success through innovation: The case of the Hamburg bilingual schools

    NARCIS (Netherlands)

    Duarte, Joana

    2011-01-01

    Although Germany has experienced net in-migration for the past five decades, this fact has only recently been officially acknowledged. Furthermore, Germany is marked by a general monolingual self-concept very much attached to the idea of a nation-state with one homogeneous language. However, in

  2. Kalle Hamburg lõi kartulirekordi / Silja Lättemäe

    Index Scriptorium Estoniae

    Lättemäe, Silja, 1952-

    2008-01-01

    Jäneda talupäevadel kuulutati välja konkursi "Eesti parim talu 2008 võitjad. Vt. samas: Heli Raamets. Tsiklivennast põllumees hakkas laevnikuks; Pealinnast maale mahelehmi pidama; Oma tarbeks peetud mahetalu toodangul on nõudlust

  3. "Weg Da-Wir Wollen Lernen!" Education Reform in Hamburg, Germany in Neoliberal Times

    Science.gov (United States)

    Bale, Jeff

    2013-01-01

    Background/Context: This paper is in dialogue with critical policy scholarship that has developed a certain consensus about what neoliberalism is and what its impact has been on recent education policy. A substantial part of the paper comprises a synthesis of recent German scholarship on neoliberal education policies in that country.…

  4. Migrants' Educational Success through Innovation: The Case of the Hamburg Bilingual Schools

    Science.gov (United States)

    Duarte, Joana

    2011-01-01

    Although Germany has experienced net in-migration for the past five decades, this fact has only recently been officially acknowledged. Furthermore, Germany is marked by a general monolingual self-concept very much attached to the idea of a nation-state with one homogeneous language. However, in large urban areas of Germany about 35 per cent of the…

  5. Russian Higher Educational Institutions' Ability to Compete and the Strict Standards of "Hamburg Scoring"

    Science.gov (United States)

    Plaksii, S.

    2009-01-01

    Russian universities rank poorly in international comparisons, and recent suggested reforms will not change this situation. There is an urgent need to find ways to improve the quality of Russia's higher education and to make it more appealing to scientists and to international students. In general, in order for the world to begin to appreciate and…

  6. Palkmaja Otepää vallas võitis peapreemia / Hannes Hamburg

    Index Scriptorium Estoniae

    Hamburg, Hannes, 1975-

    2004-01-01

    Haapsalus, Epp Maria Kokamäe kodus anti üle konkursi "Ilus puitmaja 2004" preemiad: Ivo Meisner - peapreemia, Margus Loks - 2. koht ja perekond Pugi - 3. koht. Võitja sai E. M. Kokamäe maali. Margit Mutso kommentaar

  7. Zwei Brüder Dunte aus Reval tun Gutes in Hamburg / Peter von Tiling

    Index Scriptorium Estoniae

    Tiling, Peter von

    2004-01-01

    Tallinnast pärit Dunte suguvõsast, peamiselt vendadest Gustav ja Gerhard Dunte'st (sünd. 1635-1693), kes asunud edukate kaupmeestena elama Hamburgi toetasid märkimisväärselt pastor Johann Winklerit tema tegevuses omaaegsete sotsiaalprobleemidega

  8. University Government in Nazi Germany: The Example of Hamburg. Yale Higher Education Program Working Paper.

    Science.gov (United States)

    Giles, Geoffrey J.

    Many apologies have been made for the part the German universities played in the Third Reich. The general stigma of having failed the people as intellectual leaders clung to the German academics for a long time. Their contention of helplessness before the forces of National Socialism gave rise to fears of similar weakness in the future. Although…

  9. Hydrographic Surveys of the Missouri River at Lower Hamburg chute, 2011-13

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — An Innerspace 456 single-beam echosounder in conjunction with a Trimble® differential Global Positioning System (DGPS), HYPACK® navigation software, and Ashtech...

  10. Hydrographic Surveys of the Missouri River at Upper Hamburg chute, 2011-13

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — An Innerspace 456 single-beam echosounder in conjunction with a Trimble® differential Global Positioning System (DGPS), HYPACK® navigation software, and Ashtech...

  11. Selecting and training a panel to evaluate the rancid defect in soybean oil and fish hamburgers

    Directory of Open Access Journals (Sweden)

    C. Marques

    2017-09-01

    Full Text Available Due to its composition of unsaturated and polyunsaturated fatty acids, oils and fats are very susceptible to oxidation, with rancidity being one of the main defects. Among the several existing methodologies to monitor oxidation in foods, sensory analysis stands out because of the sensitivity of responses. Accordingly, this study aimed to select and train a panel of expert assessors to identify the rancid flavor, showing the statistical steps in the process. Assessors were selected according to their individual performance, statistically analyzed by ANOVA and Tukey’s mean comparison, Wald Sequential Analysis and chi-square test. The validation of the trained panel was carried out with the sensory analysis of fish burgers and soybean oil. F Value and box-plot graphic methods were effective for better visualization of results when used along with the mean and standard deviation tables. The final trained panel consisted of seven assessors, who have been able to identify and differentiate rancid taste in both samples used for validation.

  12. Gaye Suse Kromer: Obszöne Lust oder etablierte Unterhaltung? Zur Rezeption pornografischer Filme. Hamburg: Diplomica Verlag 2008.

    Directory of Open Access Journals (Sweden)

    Sarah Dellmann

    2010-03-01

    Full Text Available The author questions four men and four women as to their use of pornography and their experience with the reception of the pornographic film Adrenaline (Italy 2003. The introductory chapter containing legal sources on pornography, a definition for pornography, and the history of pornographic films cannot serve as a theoretical and professional contextualization, even by dissertation standards; these are also not related to the interviews. The main section contains the interviews. The author is only partially able to develop stringent categories for analyzing the qualitative interviews – for example in the development of a research question. The interviews, published in the appendix of the book, are an interesting source for further research on the reception of pornographic films.Die Autorin befragte vier Männer und vier Frauen zu ihrer Pornografienutzung und ihren Rezeptionserfahrungen mit dem pornografischen Film Adrenalin (Italien 2003. Selbst nach Maßstäben einer Qualifikationsarbeit überzeugen die Überblickskapitel zu Rechtsgrundlagen, Definition und Geschichte des pornografischen Films, zur theoretischen und fachlichen Verortung nicht; diese werden später auch nicht auf die Interviews bezogen. Den Hauptteil stellen die Interviews dar. Der Autorin gelingt es nur teilweise – so bei der Entwicklung der Leitfragen –, stringente Kategorien für die Auswertung der qualitativen Interviews zu entwickeln. Die im Anhang des Buches abgedruckten Interviews stellen eine interessante Quelle für die Erforschung der Rezeption pornografischer Filme dar.

  13. Jenny Brettschneider: Frauen in Führungspositionen: Anspruch und Wirklichkeit von Chancengleichheit. Hamburg: Verlag Dr. Kovač 2008

    Directory of Open Access Journals (Sweden)

    Annette von Alemann

    2009-03-01

    Full Text Available Die Autorin geht der Frage nach, warum in der Wirtschaft Frauen nicht gefördert werden, obwohl ihre gesellschaftliche Benachteiligung und ihre Unterrepräsentation in Führungspositionen wahrgenommen wird. Mit Hilfe von Leitfadeninterviews mit Führungskräften aus elf Unternehmen kommt sie zu dem Ergebnis, dass sich die Unternehmen für die Herstellung von Chancengleichheit nicht verantwortlich sehen. Zum einen widersprechen Frauenförderprogramme dem meritokratischen Verständnis individueller Leistungszurechnung, zum anderen sehen sich Unternehmen außerstande, das Kernproblem der Benachteiligung – das „Risiko Mutterschaft“ – zu lösen. Die herausgearbeiteten Begründungsmuster für die Unterrepräsentation von Frauen in Führungspositionen werden als Hinweis auf männerbündische Strukturen in den Organisationen identifiziert, deren Ziel die Ausgrenzung von Frauen aus wichtigen Positionen ist.The author pursues the question as to why businesses do not support women, even though they readily admit to the discrimination of women in society and their underrepresentation in executive positions. On the basis of guided interviews with executives from eleven businesses she comes to the conclusion that businesses do not consider themselves responsible for the creation of equal opportunities. For one, the programs for the promotion of women contradict the meritocratic understanding of individual performance within businesses. Secondly, businesses see themselves as unable to solve the core problem of the discrimination: the “danger of motherhood.” The author extracts patterns for the rationalization of the underrepresentation of women in executive positions and identifies these as evidence of masculine group structures within businesses that intend to exclude women from important positions.

  14. Rezension von: Angela Frischauf: Sexualität und Pornographie im Frauenbild der Gegenwartsliteratur. Hamburg: Diplomica Verlag 2009.

    Directory of Open Access Journals (Sweden)

    Julia Jäckel

    2010-05-01

    Full Text Available Angela Frischauf untersucht das Frauenbild in der Literatur im Umgang mit ,Sexualität‘ und ,Pornographie‘ und zieht als Primärtexte Romane von Elfriede Jelinek, Marlene Streeruwitz und Christa Nebenführ heran. In ihrer Abschlussarbeit in den Literaturwissenschaften gelingt es der Autorin jedoch nicht, die komplexen Themen differenziert und kritisch zu behandeln. Entstanden ist eine zweifelhafte Untersuchung über ,Pornographie‘ und ,Sexualität‘, die das eigentliche Thema aus dem Auge verliert und auf einem sprachlich prätentiösen Niveau verharrt.

  15. Martina Oster, Waltraud Ernst, Marion Gerards (Hg.: Performativität und Performance. Hamburg u.a.: LIT Verlag 2008

    Directory of Open Access Journals (Sweden)

    Isa Wortelkamp

    2009-07-01

    Full Text Available Der Band versammelt Perspektiven unterschiedlicher wissenschaftlicher Disziplinen zur performativen Herstellung von Geschlecht in den Bereichen von Musik, Theater und Medienkultur. Ausgangspunkt und Verbindungsglied der Beiträge ist Judith Butlers Konzept zur Performativität von Geschlecht, das in seiner Relevanz für musikwissenschaftliche Frauen- und Genderforschung diskutiert wird. Im Zentrum steht die Reflexion der musikalischen Aufführung als Aufführung performativer Akte zur Konstruktion von Geschlechteridentitäten. Über die musikwissenschaftliche Perspektive hinaus liefern die verschiedenen Studien anregende und weitreichende Impulse zur Betrachtung künstlerischer Ausdrucksformen im Prozess der soziokulturellen Konstruktion von Geschlecht und Sexualität.The volume collects different disciplinary perspectives on the performative production of gender in the areas of music, theater, and media culture. The point of departure and nexus of the contributions is Judith Butler’s concept of the performativity of gender, which is discussed in its relevance for women���s and gender research in musicology. Central is the reflection on the musical performance as a performative act for the construction of gender identities. Over and beyond the perspective of musicology, the different studies provide stimulating and broad-reaching impulses for the consideration of artistic forms of expression in the process of the sociocultural construction of gender and sexuality.

  16. Summary and Outlook of the International Workshop on Aging Phenomena in Gaseous Detectors (DESY, Hamburg, October, 2001)

    CERN Document Server

    Titov, M L; Padilla, C; Tesch, N

    2002-01-01

    High Energy Physics experiments are currently entering a new era which requires the operation of gaseous particle detectors at unprecedented high rates and integrated particle fluxes. Full functionality of such detectors over the lifetime of an experiment in a harsh radiation environment is of prime concern to the involved experimenters. New classes of gaseous detectors such as large-scale straw-type detectors, Micro-pattern Gas Detectors and related detector types with their own specific aging effects have evolved since the first workshop on wire chamber aging was held at LBL, Berkeley in 1986. In light of these developments and as detector aging is a notoriously complex field, the goal of the workshop was to provide a forum for interested experimentalists to review the progress in understanding of aging effects and to exchange recent experiences. A brief summary of the main results and experiences reported at the 2001 workshop is presented, with the goal of providing a systematic review of aging effects in ...

  17. Adult Education for All. Minority and Indigenous Communities at CONFINTEA V (Hamburg, Germany, July 14-18, 1997). Seminar Report.

    Science.gov (United States)

    Minority Rights Group, London (England).

    Ten themes were explored at the Fifth World Conference on Adult Education: (1) adult learning and democracy; (2) improving the conditions and quality of adult learning; (3) ensuring the universal right to literacy and basic education; (4) adult learning, gender equality and equity, and the empowerment of women; (5) adult learning and the changing…

  18. [Six years of Advanced Trauma Life Support (ATLS) in Germany: the 100th provider course in Hamburg].

    Science.gov (United States)

    Münzberg, M; Mahlke, L; Bouillon, B; Paffrath, T; Matthes, G; Wölfl, C G

    2010-07-01

    With over 1 million certified physicians in more than 50 countries worldwide, the Advanced Trauma Life Support (ATLS) concept is one of the most successful international education programs. The concept is simple, priority-orientated (ABCDE scheme) and assesses the situation of the trauma patient on the basis of vital signs to treat the life-threatening injuries immediately. With over 100 ATLS provider courses and 10 instruction courses accomplished in less than 6 years, no other land in the world has successfully established this concept in such a short time as Germany. Meanwhile nearly 1,600 colleagues have been trained and certified. Evaluation of the first 100 ATLS courses in Germany supports this concept. The total evaluation of all courses is 1.36 (1.06-1.8, n=100). The individual parts of the course were marked as followed: presentations 1.6 (1.0-2.81, n=100), practical skills stations 1.46 (1.0-2.4, n=100) and surgical skills stations 1.38 (1.0-2.38, n=100). In 2009 a total of 47 ATLS courses were accomplished which will clearly increase in 2010. Other ATLS formats, such as ATCN (Advanced Trauma Care for Nurses) and refresher courses are planned for the beginning of 2010.

  19. Cognitive Onomastics: A Look from Europe. Review of the book: Brendler, S. (Ed.. (2016. Cognitive Onomastics: A Reader. Hamburg: Baar.

    Directory of Open Access Journals (Sweden)

    Natalia V. Vasilyeva

    2017-11-01

    Full Text Available The review provides a critical survey of the book which is the first anthology on cognitive onomastics. The book comprises articles by ten onomasticians from Austria, Hungary, Germany, Poland, and Finland for the period 2004–2014, selected by the editor Silvio Brendler as those most clearly expressing ideas and the diversity of the given research field. The book also includes the work Of Names (1655 by the English philosopher Thomas Hobbes, as the forerunner of the cognitive approach to language and to proper names. The articles are grouped into sections: Onomastics and Cognitive Science (1 article; Nature of Names (3 articles; Grammatical Description of Names (1 article; Meaning of Names (3 articles; Names in Literature (2 articles. Each article is analyzed in detail by the reviewer. The productivity of cognitive linguistics’ tools for onomastic research (such as Construction Grammar, the theory of prototypes, conceptual metaphor, axiological profiling, etc. is noted. A particular attention is drawn to the fact that onomastics not only borrows ideas and tools from «wider» cognitive linguistics, but also generates its own cognitive theories, such as Ernst Hansack’s theory of name and Silvio Brendler’s nomematics. In conclusion, the reviewer emphasizes the didactic and awarenessraising value of this anthology, as well as the relevance of the genre for this new and largely controversial research area: it provides the interested readers with an opportunity to make their own judgment in regards to cognitive onomastics, drawing information from primary sources. In general, getting acquainted with this book is very useful as it raises the concern of what cognitive onomastics is in our country and whether a similar book based on domestic material would help answer this question.

  20. Die Toolbox: Das neue Informationskompetenzangebot der Ärztlichen Zentralbibliothek des Universitätsklinikums Hamburg-Eppendorf

    Directory of Open Access Journals (Sweden)

    Rümmele, Sandra

    2017-12-01

    Full Text Available In 2017, the Central Medical Library started a new course on information literacy to actively support the students in their studies. In this course, e-contents supplement face-to-face lessons. Topics of these course lessons are research, text processing with Microsoft Office, copyright and citing and information about the doctoral procedures and completing their doctorates.

  1. Nature, nurture, or that fast food hamburger: media framing of diabetes in the New York Times from 2000 to 2010.

    Science.gov (United States)

    Stefanik-Sidener, Kelsey

    2013-01-01

    Diabetes is a growing yet misunderstood health concern in the United States. This study examined the ways in which diabetes has been framed by the New York Times over the past decade. The public's perception of the causes and solutions to complex problems such as diabetes has significant implications for the way public policy interventions are viewed; therefore, understanding how diabetes is being framed in the media can be an important first step in shifting public opinion about ways to combat the disease. A content analysis of 239 articles published in the New York Times between 2000 and 2010 revealed that nearly one-third of articles failed to differentiate between type 1, type 2, and gestational diabetes, which may cause confusion given substantial differences in the root cause and treatment of each. An examination of frames used within each type of diabetes showed that the overall dominant frame across types was either a medical frame or a behavioral frame, with deficient use of a societal frame. The limited use of societal-level framing may make it difficult for the public to see the wider consequences of diabetes and decreases the likelihood of public support for policy solutions to combat the disease.

  2. Six Decades of Educational Multilateralism in a Globalising World: The History of the UNESCO Institute in Hamburg

    Science.gov (United States)

    Elfert, Maren

    2013-01-01

    Created in 1945 as a specialised agency of the United Nations (UN), the United Nations Educational, Scientific and Cultural Organization (UNESCO) was given, among other mandates, the task of reconstructing education systems devastated during the Second World War. UNESCO, in turn, and after some debate about an engagement in Germany, founded the…

  3. Community and the Myth of the Ideal School: Circulation and Appropriation of the Hamburg Gemeinschaftsschulen in Spain (1922-1933)

    Science.gov (United States)

    del Pozo Andrés, María del Mar

    2014-01-01

    The progressive education movement was known in Spain from its very inception, and in fact many of its pedagogical theories and practices reached Spain before reaching other European countries. Yet traditional historiography has always maintained that Spain was never integrated in the progressive education movement, a misconception that helps…

  4. Bernhard Heininger (Hg.: Ehrenmord und Emanzipation. Die Geschlechterfrage in Ritualen von Parallelgesellschaften. Hamburg u.a.: LIT Verlag 2009.

    Directory of Open Access Journals (Sweden)

    Janne Mende

    2010-11-01

    Full Text Available Der Tagungssammelband des Würzburger Graduiertenkollegs „Wahrnehmung der Geschlechterdifferenz in religiösen Symbolssystemen“ bietet vielfältige, zum großen Teil vor- und frühgeschichtliche Beispiele historisch spezifischer Geschlechterkonstellationen. Anhand detailgetreuer Studien archäologischer und literarischer Artefakte werden durchaus spannende, weil häufig unbekannte Dimensionen herausgearbeitet. Mit dem Phänomen des im Buchtitel angekündigten Ehrenmordes beschäftigt sich nur ein Text des Sammelbandes. Konfrontiert mit einer nur losen Verbundenheit der Beiträge untereinander bleibt es der Leser/-in selbst überlassen, die unterschiedlichen Zugänge in einen gemeinsamen Diskussionszusammenhang zu bringen, als dessen Bezugspunkt ein kaum konturiertes Emanzipationskonzept nahe gelegt wird.The proceedings of the Würzburg graduate colloquium “The Perception of Gender Differences in Religious Symbolic Systems” offer various mainly pre- and early-historic examples of historically specific gender constellations. The detailed studies of archeological and literary artifacts illustrate quite exciting dimensions that are often unknown. Only one article in the anthology deals with the phenomenon of the honor killing that is announced in the title of the book. Faced with rather loose connections between the individual articles, it is up to the reader to find one cohesive context (based on a suggested yet barely outlined concept of emancipation for the varying approaches.

  5. [Twenty-five years' experience in epidemiology and prophylaxis of epidemics at the Centre for Salmonella of Hamburg (author's transl)].

    Science.gov (United States)

    Winkle, S; Rohde, R

    1979-04-01

    Salmonella-epidemiology has changed fundamentally since underdeveloped countries have entered international trade and export food-supplies which, due to less stringent controls, are already contaminated either in the countries of origin or in transit. This is shown by numerous case histories of food-poisoning. Multifarious causes of infection from imported food-stuffs are exposed and also the epidemiological consequences from latently infected fat-stock and poultry. Prophylactic measures and advice on preventive treatment are given. The progressive automation in many factories and plants, with aspirations to the highes-degree of efficiency, frequently hides potential sources of infection with a shining facade of chrome and plastic. In the planning and servicing of technical installations, which later may well prove to be a source of infection, sanitary experts are rarely consulted, or if so too late. This paper also emphasises the considerable influence of mass-tourism with the consequent introduction of exotic Salmonella serotypes, and also the potential danger of faeca contamination on motorway rest-stops.

  6. What Can We Learn from Gramsci Today? Migrant Subalternity and the Refugee Movements: Perspectives from the Lampedusa in Hamburg

    DEFF Research Database (Denmark)

    Meret, Susi

    2018-01-01

    Global metropolitan cities have become vital hubs of exploitation, of profit making, class hierarchy, competition and struggles over local and global resources . The metropolis is where marginalisation, destitution and precarity are generated and then attempted concealed from the urban centre and...

  7. "Doing for Group Exercise What McDonald's Did for Hamburgers": Les Mills, and the Fitness Professional as Global Traveller

    Science.gov (United States)

    Andreasson, Jesper; Johansson, Thomas

    2016-01-01

    This article analyses fitness professionals' perceptions and understanding of their occupational education and pedagogical pursuance, framed within the emergence of a global fitness industry. The empirical material consists of interviews with personal trainers and group fitness instructors, as well as observations in their working environment. In…

  8. 2009. aasta turunduseelarve sunnib ajurakud taas tööle / Tauno Loodus

    Index Scriptorium Estoniae

    Loodus, Tauno

    2008-01-01

    Majanduslik langus sunnib ettevõtteid maksimaalse kliendirahulolu saavutamiseks turundusstrateegiat muutma. Kommenteerib Kommunikatsioonibüroo Hamburg & Partnerid konsultant Hannes Hamburg. Julgetel eelarve suureneb

  9. Silja Schoett: Medienbiografie und Familie – Jugendliche erzählen. Theorie und Methode der medienbiografischen Fallrekonstruktion. Hamburg u.a.: LIT Verlag 2009.

    Directory of Open Access Journals (Sweden)

    Hannes Schweiger

    2010-07-01

    Full Text Available To a great extent, the family determines what media children and youth consume, as well as in what phase of life, how, and why. Silja Schoett proves this not-so-new claim in a convincing manner by analyzing two case studies utilizing as her instrument a media-biographical case reconstruction. She justifies these methods extensively and thus makes them applicable to other examples and problems. On the basis of her systematic perspective, she examines the individual within the entire familial context, ignoring however other factors (for example social environment, school, economic relations, which equally determine life stories and media socialization.Die Familie bestimmt in hohem Maße, welche Medien Kinder und Jugendliche in welcher Lebensphase wie und warum rezipieren. Silja Schoett beweist diese nicht neue Annahme auf überzeugende Art anhand ihrer Analyse zweier Fallgeschichten mit Hilfe des Instruments einer medienbiografischen Fallrekonstruktion. Sie begründet diese Methode ausführlich und macht sie auf andere Beispiele und Fragestellungen übertragbar. Aufgrund ihrer systemischen Perspektive betrachtet sie das Individuum im familiären Gesamtzusammenhang, blendet dabei aber andere Faktoren (u. a. soziales Umfeld, Schule, ökonomische Verhältnisse aus, die die Lebensgeschichte und die mediale Sozialisation ebenfalls mitbestimmen.

  10. Rezension zu: Gaye Suse Kromer: Obszöne Lust oder etablierte Unterhaltung? Zur Rezeption pornografischer Filme. Hamburg: Diplomica Verlag 2008.

    Directory of Open Access Journals (Sweden)

    Sarah Dellmann

    2010-02-01

    Full Text Available Die Autorin befragte vier Männer und vier Frauen zu ihrer Pornografienutzung und ihren Rezeptionserfahrungen mit dem pornografischen Film Adrenalin (Italien 2003. Selbst nach Maßstäben einer Qualifikationsarbeit überzeugen die Überblickskapitel zu Rechtsgrundlagen, Definition und Geschichte des pornografischen Films, zur theoretischen und fachlichen Verortung nicht; diese werden später auch nicht auf die Interviews bezogen. Den Hauptteil stellen die Interviews dar. Der Autorin gelingt es nur teilweise – so bei der Entwicklung der Leitfragen –, stringente Kategorien für die Auswertung der qualitativen Interviews zu entwickeln. Die im Anhang des Buches abgedruckten Interviews stellen eine interessante Quelle für die Erforschung der Rezeption pornografischer Filme dar.

  11. The Hamburg Ocean-Atmosphere Parameters and Fluxes from Satellite Data (HOAPS): A climatological atlas of satellite-derived air-sea interaction parameters over the world oceans

    Digital Repository Service at National Institute of Oceanography (India)

    Grassl, H.; Jost, V.; Schulz, J.; RameshKumar, M.R.; Bauer, P.; Schluessel, P.

    of an estimation of sea surface temperature is highly dependent on 3 the quality of the used aerosol and cloud detection schemes. A description of errors oc- curring in sea surface temperature by different quality of cloud detection during day and night can.../I brightness temperatures were corrected with regard to the different scan angle devia- tions (Fuhrhop and Simmer, 1996). II.2. Parameterisations and Retrieval Schemes As a sort of review this section describes the used parameterisations, satellite retrievals...

  12. RcsB contributes to the distinct stress fitness between Escherichia coli O157:H7 curli variants of 1993 hamburger-associated outbreak strains

    Science.gov (United States)

    Curli are adhesive fimbriae of Enterobactericaeae and are involved in surface attachment, cell aggregation and biofilm formation. We previously reported that natural curli variants of E. coli O157:H7 (EcO157) displayed distinct acid resistance; however, this difference was not linked to the curli fi...

  13. The Hamburg selection procedure for dental students - introduction of the HAM-Nat as subject-specific test for study aptitude.

    Science.gov (United States)

    Kothe, Christian; Hissbach, Johanna; Hampe, Wolfgang

    2013-01-01

    The present study examines the question whether the selection of dental students should be based solely on average school-leaving grades (GPA) or whether it could be improved by using a subject-specific aptitude test. The HAM-Nat Natural Sciences Test was piloted with freshmen during their first study week in 2006 and 2007. In 2009 and 2010 it was used in the dental student selection process. The sample size in the regression models varies between 32 and 55 students. Used as a supplement to the German GPA, the HAM-Nat test explained up to 12% of the variance in preclinical examination performance. We confirmed the prognostic validity of GPA reported in earlier studies in some, but not all of the individual preclinical examination results. The HAM-Nat test is a reliable selection tool for dental students. Use of the HAM-Nat yielded a significant improvement in prediction of preclinical academic success in dentistry.

  14. Prediction of practical performance in preclinical laboratory courses – the return of wire bending for admission of dental students in Hamburg

    Directory of Open Access Journals (Sweden)

    Kothe, Christian

    2014-05-01

    Full Text Available [english] Although some recent studies concluded that dexterity is not a reliable predictor of performance in preclinical laboratory courses in dentistry, they could not disprove earlier findings which confirmed the worth of manual dexterity tests in dental admission. We developed a wire bending test (HAM-Man which was administered during dental freshmen’s first week in 2008, 2009, and 2010. The purpose of our study was to evaluate if the HAM-Man is a useful selection criterion additional to the high school grade point average (GPA in dental admission. Regression analysis revealed that GPA only accounted for a maximum of 9% of students’ performance in preclinical laboratory courses, in six out of eight models the explained variance was below 2%. The HAM-Man incrementally explained up to 20.5% of preclinical practical performance over GPA. In line with findings from earlier studies the HAM-Man test of manual dexterity showed satisfactory incremental validity. While GPA has a focus on cognitive abilities, the HAM-Man reflects learning of unfamiliar psychomotor skills, spatial relationships, and dental techniques needed in preclinical laboratory courses. The wire bending test HAM-Man is a valuable additional selection instrument for applicants of dental schools.

  15. Die Gesundheit von pädagogischem Personal in Kindertagesstätten. Qualitative Untersuchung zum Gesundheitsverhalten von Erzieherinnen in Hamburg

    OpenAIRE

    Prüßner, Silke

    2016-01-01

    Die Bachelorarbeit befasst sich inhaltlich mit der Gesundheit und dem Gesundheitsverhalten von pädagogischem Personal in Kindertagesstätten. Ihr Ziel ist es, abzubilden inwiefern Kenntnisse zu Gesundheitswissen in der Berufsgruppe vorliegen und welchen Einfluss diese auf das gesundheitsförderliche Handeln haben. Die Untersuchung nutzt einen Methoden-Mix aus Literaturrecherche und qualitativer Untersuchung. Die Literaturrecherche fällt recht umfänglich aus. Im Anschluss daran werden sechs Erzi...

  16. NCHRP project 20-07/task 361 : hamburg wheel-track test equipment requirements and improvements to AASHTO T 324 : research project capsule.

    Science.gov (United States)

    2015-02-01

    The Loaded Wheel Test (LWT) is a laboratory-controlled rut depth test that uses loaded wheel(s) : to apply a moving load on hot-mix and warm-mix asphalt (HMA and WMA) specimens to simulate : tra c load applied on asphalt pavements. In the 1970s He...

  17. Randomized comparison of antiarrhythmic drug therapy with implantable defibrillators in patients resuscitated from cardiac arrest : the Cardiac Arrest Study Hamburg (CASH).

    Science.gov (United States)

    Kuck, K H; Cappato, R; Siebels, J; Rüppel, R

    2000-08-15

    We conducted a prospective, multicenter, randomized comparison of implantable cardioverter-defibrillator (ICD) versus antiarrhythmic drug therapy in survivors of cardiac arrest secondary to documented ventricular arrhythmias. From 1987, eligible patients were randomized to an ICD, amiodarone, propafenone, or metoprolol (ICD versus antiarrhythmic agents randomization ratio 1:3). Assignment to propafenone was discontinued in March 1992, after an interim analysis conducted in 58 patients showed a 61% higher all-cause mortality rate than in 61 ICD patients during a follow-up of 11.3 months. The study continued to recruit 288 patients in the remaining 3 study groups; of these, 99 were assigned to ICDs, 92 to amiodarone, and 97 to metoprolol. The primary end point was all-cause mortality. The study was terminated in March 1998, when all patients had concluded a minimum 2-year follow-up. Over a mean follow-up of 57+/-34 months, the crude death rates were 36.4% (95% CI 26.9% to 46.6%) in the ICD and 44.4% (95% CI 37.2% to 51.8%) in the amiodarone/metoprolol arm. Overall survival was higher, though not significantly, in patients assigned to ICD than in those assigned to drug therapy (1-sided P=0.081, hazard ratio 0.766, [97.5% CI upper bound 1.112]). In ICD patients, the percent reductions in all-cause mortality were 41.9%, 39.3%, 28. 4%, 27.7%, 22.8%, 11.4%, 9.1%, 10.6%, and 24.7% at years 1 to 9 of follow-up. During long-term follow-up of cardiac arrest survivors, therapy with an ICD is associated with a 23% (nonsignificant) reduction of all-cause mortality rates when compared with treatment with amiodarone/metoprolol. The benefit of ICD therapy is more evident during the first 5 years after the index event.

  18. Informationstechnische Weiterbildung Fur Frauen Von Frauen: Internationaler Workshop = Education in Informatics for Women By Women: International Workshop (Hamburg, Germany, November 30-December 3, 1992).

    Science.gov (United States)

    Ellebrecht, Ingrid, Ed.; And Others

    This document presents workshop results and participants' reports from the international conference "Train the Trainers in Information and Communication Technology." The participants consisted of 18 women and one man from Czechoslovakia, Russia, Latvia, Bulgaria, Romania, Mongolia, Jordan, Egypt, and the Philippines. Eleven reports were presented…

  19. Lernen, Informationskompetenz und Visualisierung - das Online-Tutorial DISCUS (Developing Information Skills & Competence for University Students)der Universitätsbibliothek der TU Hamburg-Harburg

    OpenAIRE

    Bieler, Detlev; Hapke, Thomas; Marahrens, Oliver

    2005-01-01

    Über effiziente Recherche - und Navigationsstrategien hinaus umfasst Informationskompetenz vor allem die Kreativität, den eigenen Informationsprozess bewusst und bedarfsgerecht zu gestalten. Um diverse Zielgruppen und Lerntypen zu erreichen, ist ein weites Spektrum an Aktivitäten zur Informationskompetenz-Förderung - von vollständigen Curricula bis hin zu Lernobjekten - durch Bibliotheken wünschenswert. Der explorative und eher spielerische Ansatz des zweisprachigen Online-Tutorials DISCUS (D...

  20. Learning Gender Justice through Women's Discourses. Report of Theme IV. Proceedings of the Fifth International Conference on Adult Education (Hamburg, Germany, July 14-18, 1997).

    Science.gov (United States)

    United Nations Educational, Scientific, and Cultural Organization, Hamburg (Germany). Inst. for Education.

    This publication documents the presentations, papers, and discussions of two workshops. On theme 4, "Adult Learning, Gender Equality and Equity and the Empowerment of Women," of the Fifth International Conference on Adult Education: "Women's Education: The Contending Discourses and Possibilities for Change" and "Raising Gender Issues in Different…

  1. The Hamburg/ESO R-process Enhanced Star survey (HERES). XI. The highly r-process-enhanced star CS 29497-004

    Science.gov (United States)

    Hill, V.; Christlieb, N.; Beers, T. C.; Barklem, P. S.; Kratz, K.-L.; Nordström, B.; Pfeiffer, B.; Farouqi, K.

    2017-11-01

    We report an abundance analysis for the highly r-process-enhanced (r-II) star CS 29497-004, a very metal-poor giant with solar system Teff = 5013 K and [Fe/H] = -2.85, whose nature was initially discovered in the course of the HERES project. Our analysis is based on high signal-to-noise ratio, high-resolution (R 75 000) VLT/UVES spectra and MARCS model atmospheres under the assumption of local thermodynamic equilibrium, and obtains abundance measurements for a total of 46 elements, 31 of which are neutron-capture elements. As is the case for the other 25 r-II stars currently known, the heavy-element abundance pattern of CS 29497-004 well-matches a scaled solar system second peak r-process-element abundance pattern. We confirm our previous detection of Th, and demonstrate that this star does not exhibit an "actinide boost". Uranium is also detected (log ɛ(U) = -2.20 ± 0.30), albeit with a large measurement error that hampers its use as a precision cosmo-chronometer. Combining the various elemental chronometer pairs that are available for this star, we derive a mean age of 12.2 ± 3.7 Gyr using the theoretical production ratios from published waiting-point approximation models. We further explore the high-entropy wind model (Farouqi et al. 2010, ApJ, 712, 1359) production ratios arising from different neutron richness of the ejecta (Ye), and derive an age of 13.7 ± 4.4 Gyr for a best-fitting Ye = 0.447. The U/Th nuclei-chronometer is confirmed to be the most resilient to theoretical production ratios and yields an age of 16.5 ± 6.6 Gyr. Lead (Pb) is also tentatively detected in CS 29497-004, at a level compatible with a scaled solar r-process, or with the theoretical expectations for a pure r-process in this star. Based on observations collected at the European Southern Observatory, Paranal, Chile (Proposal Number 170.D-0010).Table B.1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/607/A91

  2. The high latitudes in the International Reference Ionosphere; Meeting C4 of Commission C, COSPAR Scientific Assembly, 30th, Hamburg, Germany, July 11-21, 1994

    Science.gov (United States)

    Rawer, K.; Bilitza, D.; Singer, W.

    1995-01-01

    An international conference on high-latitude ionospheric modeling produced 27 papers in the areas of ionospheric mapping, electron density and distribution, ion density and distribution, ionospheric storems, ionospheric composition, and ionospheric sounding techniques. Upgrades to the International Reference Ionosphere (IRI) model were proposed in several papers.

  3. "I don't eat a hamburger and large chips every day!" A qualitative study of the impact of public health messages about obesity on obese adults

    Directory of Open Access Journals (Sweden)

    Blood R Warwick

    2010-06-01

    Full Text Available Abstract Background We are a society that is fixated on the health consequences of 'being fat'. Public health agencies play an important role in 'alerting' people about the risks that obesity poses both to individuals and to the broader society. Quantitative studies suggest people comprehend the physical health risks involved but underestimate their own risk because they do not recognise that they are obese. Methods This qualitative study seeks to expand on existing research by exploring obese individuals' perceptions of public health messages about risk, how they apply these messages to themselves and how their personal and social contexts and experiences may influence these perceptions. The study uses in depth interviews with a community sample of 142 obese individuals. A constant comparative method was employed to analyse the data. Results Personal and contextual factors influenced the ways in which individuals interpreted and applied public health messages, including their own health and wellbeing and perceptions of stigma. Individuals felt that messages were overly focused on the physical rather than emotional health consequences of obesity. Many described feeling stigmatised and blamed by the simplicity of messages and the lack of realistic solutions. Participants described the need for messages that convey the risks associated with obesity while minimising possible stigmatisation of obese individuals. This included ensuring that messages recognise the complexity of obesity and focus on encouraging healthy behaviours for individuals of all sizes. Conclusion This study is the first step in exploring the ways in which we understand how public health messages about obesity resonate with obese individuals in Australia. However, much more research - both qualitative and quantitative - is needed to enhance understanding of the impact of obesity messages on individuals.

  4. Solar-assisted district heating system - Scientific study. Solar-assisted district heating system with long-term thermal storage in Friedrichshafen-Wiggenhausen and Hamburg-Bramfeld.. Results of the first year of operation; Solar unterstuetzte Nahwaermeversorgung - Wissenschaftliches Begleitprogramm. Solare Nahwaermeversorgung mit Langzeitwaermespeicher in Friedrichshafen-Wiggenhausen und Hamburg-Bramfeld. Ergebnisse des ersten Betriebsjahres

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, M.E.; Mahler, B.; Hahne, E. [Stuttgart Univ. (Germany). Inst. fuer Thermodynamik und Waermetechnik

    1998-12-31

    The first two pilot plants for solar district heating with seasonal thermal energy storage were put in operation in October 1996. Both projects were initiated by the Institute for Thermodynamics and Thermal Energy Technology (ITW) of the University of Stuttgart that also provided scientific support up to the present. This report presents the results of the first two years of operation of both plants. Both solar plants have been operated without any major problems. The solar energy yield in the first year of operation has only been reduced by the unsatisfactory operation of the heating grid. The most important step towards optimising the plants is the adjustment of the internal heating systems and thus the reduction of the heating temperatures which are currently too high. Based on subject pre-conditions the results projected for the first pilot plants for solar district heating and long-term thermal energy storage will be reached in the following years of operation. (orig.) [Deutsch] Im Oktober 1996 gingen die ersten beiden Pilotanlagen zur solaren Nahwaermeversorgung mit saisonaler Waermespeicherung in Betrieb. Beide Projekte wurden vom Institut fuer Thermodynamik und Waermetechnik (ITW), Universitaet Stuttgart initiiert und ueber die gesamte bisherige Laufzeit wissenschaftlich begleitet. Die Ergebnisse des ersten Betriebsjahres der beiden Anlagen sind in diesem Bericht zusammengestellt. In beiden Faellen funktionieren die Solaranlagen ohne grosse Probleme. Die solaren Ertraege wurden im ersten Betriebsjahr noch durch die unzureichende Betriebsweise der Heiznetze gemindert. Wichtigster Ansatzpunkt fuer eine Optimierung der Anlagen ist die Einregulierung der hausinternen Heizungssysteme und damit die Absenkung der derzeit noch zu hohen Heiznetztemperaturen. Unter dieser Voraussetzung werden die vorausgesagten Ergebnisse fuer die ersten Pilotanlagen zur solaren Nahwaerme mit Langzeit-Waermespeicher in den naechsten Betriebsjahren erreicht werden. (orig.)

  5. Das Hamburger Auswahlverfahren in der Zahnmedizin – Einführung des HAM-Nat als fachspezifischer Studierfähigkeitstest [The Hamburg Selection Procedure for Dental Students – Introduction of the HAM-Nat as subject-specific test for study aptitude

    Directory of Open Access Journals (Sweden)

    Kothe, Christian

    2013-11-01

    Full Text Available [english] Introduction: The present study examines the question whether the selection of dental students should be based solely on average school-leaving grades (GPA or whether it could be improved by using a subject-specific aptitude test.Methods: The HAM-Nat Natural Sciences Test was piloted with freshmen during their first study week in 2006 and 2007. In 2009 and 2010 it was used in the dental student selection process. The sample size in the regression models varies between 32 and 55 students. Results: Used as a supplement to the German GPA, the HAM-Nat test explained up to 12% of the variance in preclinical examination performance. We confirmed the prognostic validity of GPA reported in earlier studies in some, but not all of the individual preclinical examination results. Conclusion: The HAM-Nat test is a reliable selection tool for dental students. Use of the HAM-Nat yielded a significant improvement in prediction of preclinical academic success in dentistry.[german] Einleitung: In der vorliegenden Untersuchung wird der Frage nachgegangen, ob die Auswahl der Studierenden in der Zahnmedizin alleine durch die Abiturdurchschnittsnote erfolgen sollte oder ob sie durch den Einsatz eines fachspezifischen Studierfähigkeitstest verbessert werden kann. Methoden: Der Naturwissenschaftstest HAM-Nat wurde in den Jahren 2006 und 2007 in der Erstsemesterwoche an den Studienanfängerinnen und -anfängern* erprobt sowie 2009 und 2010 im Auswahlverfahren eingesetzt. Die Stichprobengrößen der Regressionsmodelle variieren in allen Jahrgängen zwischen 32 und 55 Teilnehmern. Ergebnisse: Der HAM-Nat erklärte zusätzlich zur Abiturdurchschnittsnote bis zu 12 % der Leistungsvarianz in den vorklinischen Prüfungsleistungen. Die in anderen Studien gefundene prognostische Güte der Abiturdurchschnittsnote konnte für einige, aber nicht für alle Einzelprüfungen bestätigt werden. Schlussfolgerung: Der HAM-Nat erwies sich als zuverlässiges Auswahlinstrument in der Zahnmedizin. Durch den Einsatz des HAM-Nat wird die Vorhersage des vorklinischen, akademischen Studienerfolgs in der Zahnmedizin deutlich verbessert.

  6. 77 FR 71192 - Notice of Agreement Filed

    Science.gov (United States)

    2012-11-29

    ....: 012190. Title: HSDG-GWF Space Charter Agreement. Parties: Hamburg Sud and Great White Fleet Liner..., DC 20006-4007. Synopsis: The agreement authorizes Hamburg Sud to charter space to Great White Fleet...

  7. [Olaf Mertelsmann. Der stalinistische Umbau in Estland] / Jörg Hackmann

    Index Scriptorium Estoniae

    Hackmann, Jörg, 1962-

    2007-01-01

    Arvustus: Olaf Mertelsmann. Der stalinistische Umbau in Estland. Von der Markt- zur Komandowirtscahft. (Hamburger Beiträge zur Gescichte des östlichen Europa. Bd. 14.9 verlag Dr. Kovač. Hamburg 2006

  8. [Eugen Helimski, Urlike Kahrs. Nordselkupisches Wörterbuch von F. G. Mal'cev (1903)] / Ago Künnap

    Index Scriptorium Estoniae

    Künnap, Ago, 1941-

    2003-01-01

    Raamatust: Helimski, Eugen, Kahrs, Urlike. Nordselkupisches Wörterbuch von F. G. Mal'cev (1903). Hamburg, 2001. (Hamburger Sibirische und Finnisch-Ugrische Materialen / Habent Sua Fata Manuscripts; 1)

  9. Liivimaa reformatsiooni poliitilised, religioossed ja sotsiaalsed aspektid / Juhan Kreem

    Index Scriptorium Estoniae

    Kreem, Juhan

    2007-01-01

    Rets. rmt.: Joachim Kuhles. Die Reformation in Livland - religiöse, politische und ökonomische Wirkungen. (Hamburger Beiträge zur Geschichte des östlichen Europa, 16). Verlag Dr. Kovaè, Hamburg, 2007. 363 lk.

  10. Occurrence of an Artifact in Brain 18F-FDG PET with Calculated Attenuation Correction

    National Research Council Canada - National Science Library

    von Borczyskowski, Daniel; Schulte, Ulrike; Brenner, Winfried; Clausen, Malte; Buchert, Ralph

    2006-01-01

    ...: For correspondence or reprints contact: Daniel von Borczyskowski, MD, Department of Nuclear Medicine, University Hospital Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany. E-mail: d.borczyskowski{at}uke.uni...

  11. 75 FR 7265 - Notice of Agreement Filed

    Science.gov (United States)

    2010-02-18

    ... Americana de Vapores, S.A.; Frontier Liner Services, Inc.; Hamburg-S d; King Ocean Services Limited, Inc... of the Federal Maritime Commission. Rachel E. Dickon, Assistant Secretary. BILLING CODE P ...

  12. [Juzhnoselkupskij slovar N. P. Grigorovskogo] / Ago Künnap

    Index Scriptorium Estoniae

    Künnap, Ago, 1941-

    2007-01-01

    Juzhnoselkupskij slovar N. P. Grigorovskogo. Obrabotka i izdanie Jevgenija Helimskogo. Südselkupisches Wörterbuch von N. P. Grigorovski. Bearbeitet und herausgegeben von Eugen Helimski, Hamburg 2007. (Hamburger Sibirische Finnougrische Materialien. Habent Sua Fata Manuscripta. Band 4)

  13. Migrant Education. Adult Learning and Groups with Special Needs. A Series of 29 Booklets Documenting Workshops Held at the Fifth International Conference on Adult Education (Hamburg, Germany, July 14-18, 1997).

    Science.gov (United States)

    United Nations Educational, Scientific, and Cultural Organization, Hamburg (Germany). Inst. for Education.

    This booklet provides an overview of the growing demands for adult education as well as other social services in helping migrant workers move out of poverty and succeed in cultures other than their own. Issues raised included questions about migrants' access to education and about building solidarity networks for ensuring basic human rights. A…

  14. Cumacea (Crustacea) from the Red Sea and the Maldives (Indian Ocean) in the collection of the Zoological Museum, Hamburg, with the description of seven new species and a new genus

    NARCIS (Netherlands)

    Muhlenhardt-Siegel, Ute

    1996-01-01

    Eleven species of the families Bodotriidae, Nannastacidae and Diastylidae from the Red Sea and Maldive Islands (Indian Ocean) were identified and partly redescribed. Six new species were described for the genera Eocuma, Iphinoe, Nannastacus, Schizotrema, Makrokylindrus and Dimorphostylis. A new

  15. Quantity and type forecasting tool for offshore wind power plant spare parts: Presentation held at Marine 2013, V International Conference on Computational Methods in Marine Engineering, 29-31 May 2013, Hamburg, Germany

    OpenAIRE

    Rauer, Robert; Münsterberg, Torsten; Jahn, Carlos

    2013-01-01

    In this paper a forecasting model for offshore wind power plant spare parts is presented. The paper starts with an overview about the German offshore wind energy market and the expected future development. To reach a high availability of the turbines, the right amount of spare parts is needed and therefore the authors introduce a tool to forecast the quantity / type of spare parts by a given availability and maintenance strategy. In this context essential terms as reliability, availability, m...

  16. Judith Will: Familienförderung im Sozialrecht. Eine Darstellung familienfördernder Leistungen, ihrer Defizite und Reformmöglichkeiten. Hamburg: Verlag Dr. Kovač 2009.

    Directory of Open Access Journals (Sweden)

    Arne Duncker

    2010-07-01

    Full Text Available In ihrer sehr gut strukturierten Arbeit über gegenwärtige sowie zukünftig neu zu schaffende famlienfördernde Leistungen im Sozialrecht gibt Judith Will einen ausführlichen und weitgehend vollständigen Überblick über sämtliche wesentlichen Sozialleistungen zur Familienförderung. Will untersucht außerdem eine Reihe von Reformansätzen und Lösungsmodellen, mit welchen den bestehenden Defiziten begegnet werden soll, und neigt dabei zu einer Lösung, welche auf den Ausbau von Dienstleistungen für Familien setzt, z. B. durch Ausbau und qualitative Verbesserung öffentlicher Kinderbetreuung in Kindergärten, Krippen und Horten. Dies trage auch zu verbesserten Erwerbschancen für Frauen sowie zur Vermeidung von Familienarmut bei.In her very well structured work of social justice on the existing benefits intended to support families as well as those to be created in the future, Judith Will offers a comprehensive and (for the most part complete overview of all the essential social benefits needed for family support. Will examines, moreover, a series of proposals for reform and solution models, with which the existing deficits should be approached. She leans toward a solution that banks on the expansion of family services, for example through the qualitative improvement of public childcare in kindergartens, day cares, and after school care. This would also significantly better the earning chances for women and help to avoid family poverty.

  17. Near-earth radiation environment including time variations and secondary radiation; Meetings F2.6 and F2.7, COSPAR Scientific Assembly, 30th, Hamburg, Germany, July 11-21, 1994

    Science.gov (United States)

    Shea, M. A. (Editor); Heinrich, W. (Editor); Badhwar, G. D. (Editor)

    1996-01-01

    Both man and technological equipment must survive the near-earth space radiation environment, which can, under specific conditions, be extremely severe. This conference produced 17 papers on the dynamic space radiation environment covering: galactic, solar and trapped particles; nuclear fragmentation; nuclear interactions and transport theory; solar proton events; radiation shielding; and heavy ion fluences. Several papers present results from the recent SAMPEX mission.

  18. Functional body composition and related aspects in research on obesity and cachexia: report on the 12th Stock Conference held on 6 and 7 September 2013 in Hamburg, Germany

    NARCIS (Netherlands)

    Muller, M.J; Baracos, V.; Bosy-Westphal, A.; Dulloo, A.G.; Eckel, J.; Fearon, K.C.H.; Hall, K.D.; Pietrobelli, A.; Sorensen, T.I.A.; Speakman, J.; Trayhurn, P.; Visser, M.; Heymsfield, S.B.

    2014-01-01

    The 12th Stock Conference addressed body composition and related functions in two extreme situations, obesity and cancer cachexia. The concept of 'functional body composition' integrates body components into regulatory systems relating the mass of organs and tissues to corresponding in vivo

  19. String Math 2017

    CERN Document Server

    The series of String-Math conferences has developed into a central event on the interface between mathematics and physics related to string theory, quantum field theory and neighboring subjects. The conference will take place from July 24-28 in the main building of Hamburg university. The String-Math conference is organised by the University of Hamburg jointly with DESY Hamburg.

  20. Dicty_cDB: Contig-U03072-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available -05 1 ( EC975015 ) WIN1020.C21_N13 Muscat Hamburg post-veraison peri... 64 1e-05 1 ( EC974914 ) WIN1020.C21_I07 Muscat Hamburg... post-veraison peri... 64 1e-05 1 ( EC973881 ) WIN1017.C21_B06 Muscat Hamburg

  1. Dicty_cDB: Contig-U13402-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 0.50 1 ( EC990438 ) WIN1139.C21_I24 Muscat Hamburg pre-veraison berry... 48 0.50 1 ( EC989165 ) WIN1135.C21_M21 Muscat Hamburg... pre-veraison berry... 48 0.50 1 ( EC985602 ) WIN1125.C21_E22 Muscat Hamburg pre-veraison ...berry... 48 0.50 1 ( EC985504 ) WIN1125.C21_A09 Muscat Hamburg pre-veraison berry... 48 0.50 1 ( EC984299 ) ...WIN1121.C21_H19 Muscat Hamburg pre-veraison berry... 48 0.50 1 ( EC981740 ) WIN1113.C21.1_L12 Muscat Hambu...rg pre-veraison ber... 48 0.50 1 ( EC976189 ) WIN1030.C21_J14 Muscat Hamburg post-v

  2. Effects of laser in situ keratomileusis (LASIK) on corneal biomechanical measurements with the Corvis ST tonometer

    OpenAIRE

    Frings A; Linke SJ; Bauer EL; Druchkiv V; Katz T; Steinberg J

    2015-01-01

    Andreas Frings,1,* Stephan J Linke,1,2,* Eva L Bauer,1 Vasyl Druchkiv,1 Toam Katz,1,2 Johannes Steinberg1,2 1Department of Ophthalmology, University Medical Center Hamburg-Eppendorf (UKE), Hamburg, Germany; 2Care Vision Refractive Center, Hamburg, Germany *These authors contributed equally to this work Purpose: This study was initiated to evaluate biomechanical changes using the Corvis ST tonometer (CST) on the cornea after laser in situ keratomileusis (LASIK). Setting: University Medical...

  3. Multiwavelength studies of X-ray selected extragalactic sample

    OpenAIRE

    Mickaelian, A. M.; Paronyan, G. M.; Harutyunyan, G. S.; Abrahamyan, H. V.; Gyulzadyan, M. V.

    2015-01-01

    The joint catalogue of Active Galactic Nuclei selected from optical identifications of X-ray sources was created as a combination of two samples: Hamburg-ROSAT Catalogue (HRC) and Byurakan-Hamburg-ROSAT Catalogue (BHRC). Both are based on optical identifications of X-ray sources from ROSAT catalogues using low-dispersion spectra of Hamburg Quasar Survey (HQS). However, HRC and BHRC contain a number of misidentifications and using the recent optical and multiwavelength (MW) catalogues we have ...

  4. Dicty_cDB: Contig-U04514-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4314 ) C4B05603 Berries veraison stage (VvC4) Vitis vini... 44 6.1 1 ( EC981965 ) WIN1114.C21_G20 Muscat Hamburg... pre-veraison berry... 44 6.1 1 ( EC973252 ) WIN1015.C21_M21 Muscat Hamburg post-veraison peri... 44 6.1... 1 ( EC972343 ) WIN1012.C21_M19 Muscat Hamburg post-veraison peri... 44 6.1 1 ( E...C970870 ) WIN102.C21_P12 Muscat Hamburg post-veraison peric... 44 6.1 1 ( EC970220 ) WIN094.C21_O13 Cab Sauv

  5. Dicty_cDB: Contig-U16316-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 2B06627 Buds/little clusters (VvC2) Vitis vinife... 46 3.8 1 ( EC996314 ) WIN117.C21_O01 Muscat Hamburg... pre-veraison berry ... 46 3.8 1 ( EC992419 ) WIN1145.C21_G13 Muscat Hamburg pre-verai...son berry... 46 3.8 1 ( EC992222 ) WIN1144.C21_N13 Muscat Hamburg pre-veraison berry... 46 3.8 1 ( EC979714 ...) WIN112.C21_L10 Muscat Hamburg pre-veraison berry ... 46 3.8 1 ( EC942862 ) WIN0

  6. Dicty_cDB: Contig-U13650-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 42 0.021 2 ( EC992626 ) WIN1146.C21_A04 Muscat Hamburg pre-veraison berry... 42 0.021 2 ( EC994101 ) WIN115.C21_F20 Muscat Hamburg...stage (VvC4) Vitis vini... 42 0.021 2 ( EC987162 ) WIN1129.C21_N20 Muscat Hamburg... pre-veraison berry... 42 0.021 2 ( EC982923 ) WIN1117.C21_G07 Muscat Hamburg pre-veraison berry... 42 0.021

  7. PRISMA: an investigation of processes influencing pollutant fluxes in the North Sea

    National Research Council Canada - National Science Library

    Brockmann, U; Beddig, S; Engel, M

    1991-01-01

    Marine scientists at the University of Hamburg have initiated a new research project, PRISMA, designed to elucidate transport, transfer and transformation processes of pollutants in the German Bight...

  8. GRUNDTVIG in transnational exchange

    DEFF Research Database (Denmark)

    Grundtvig in transnational exchange is the report from the seminar in december 2015 in cooperation with University of Cape Town and University of Hamburg.......Grundtvig in transnational exchange is the report from the seminar in december 2015 in cooperation with University of Cape Town and University of Hamburg....

  9. The Marginalization of Globally-Born Businesses:

    DEFF Research Database (Denmark)

    Rezaei, Shahamak

    Persian carpets have long been a major commodity in the world market, controlled by the Tehran Carpet Bazaar and the Hamburg Free Harbour. Today about 200 private traders in the Hamburg Free Harbour area export their carpets to about 10,000 private carpet traders throughout the world , these being...

  10. 77 FR 21774 - Notice of Agreements Filed

    Science.gov (United States)

    2012-04-11

    ... Company Limited; Crowley Maritime Corporation; Evergreen Line Joint Service Agreement; Hamburg-S d; Hapag... Coast--East Coast South America Service Space Charter Agreement. Parties: Mediterranean Shipping Company... Overseas Container Line, Ltd.; Pacific International Lines (Pte) Ltd.; United Arab Shipping Company (S.A.G...

  11. Vermittlungen - musically speaking

    DEFF Research Database (Denmark)

    Weymann, Eckhard; Metzner, Susanne; Fitzthum, Elena

    2001-01-01

    Bilingual publication - mixed content in English and German. Articles were written by participants in the First European Symposium "Improvisation Training in Music Therapy education" which took place in Hamburg, 1998.......Bilingual publication - mixed content in English and German. Articles were written by participants in the First European Symposium "Improvisation Training in Music Therapy education" which took place in Hamburg, 1998....

  12. The Prussian German General Staff System and Its Impact on the General and Admiral Staff Officers of the Federal Armed Forces of Today

    Science.gov (United States)

    1991-03-15

    the General Staff uniform of the Wehrmacht see Eberhard Hettler , Uniformen der Deutschen Wehrmacht, Hamburg 1979, Tables 9 and 25. 80. On General...Deutsche Militaergeschichte. Frankfurt am Main: 1968. 29. Hettler , Eberhard. Uniformen der deutschen Wehrmacht. Hamburg: 1979. 30. Herre, Franz. Moltke

  13. Fast Food: Tips for Choosing Healthier Options

    Science.gov (United States)

    ... what you order. Consider these tips. If the fast-food restaurant offers several sandwich sizes, pick the smallest. Bypass hamburgers with two or three beef patties, which can be close to 800 calories. Choose instead a regular- or children's-sized hamburger, which has about 250 calories. And ...

  14. Dicty_cDB: Contig-U12509-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 100 ) CHUS2317.b1_I03.ab1 CHU(LMS) puzzle sunflower Hel... 48 0.87 1 ( EC996890 ) WIN119.C21_K16 Muscat Hamburg... pre-veraison berry ... 48 0.87 1 ( EC985644 ) WIN1125.C21_G20 Muscat Hamburg pre-veraison berry... 48 0.

  15. Dicty_cDB: Contig-U10515-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 03e12.b1 Vitis vinifera cv. perlette LibB V... 44 0.007 2 ( EC984024 ) WIN1120.C21_J19 Muscat Hamburg pre-ve..... 44 0.008 2 ( EC985854 ) WIN1126.C21_A19 Muscat Hamburg pre-veraison berry... 44 0.008 2 ( DT039271 ) VVL1

  16. Dicty_cDB: Contig-U16535-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ( EE066775 ) C2C04436 Buds/little clusters (VvC2) Vitis vinife... 52 0.12 1 ( EC991505 ) WIN1142.C21_L22 Muscat Hamburg... pre-veraison berry... 52 0.12 1 ( EC981176 ) WIN1112.C21_B07 Muscat Hamburg

  17. Dicty_cDB: Contig-U16517-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available geno... 36 2.8 2 ( AJ294725 ) Astasia longa complete chloroplast genome. 36 3.1 7 ( EC976877 ) WIN1032.C21_N05 Muscat Hamburg... post-veraison peri... 36 3.3 3 ( EC978745 ) WIN108.C21_M14 Muscat Hamburg post-veraison p

  18. Dicty_cDB: Contig-U15863-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ) SBB02219 Inflorescence (VvS11) Vitis vinifera cDN... 48 0.84 1 ( EC980948 ) WIN1111.C21_G21 Muscat Hamburg... pre-veraison berry... 48 0.84 1 ( EC976956 ) WIN1033.C21_B08 Muscat Hamburg post-veraison peri... 48 0.84

  19. Juhtimiskonsultant David Erdal: ettevõttes osalust omavad töötajad panustavad rohkem / intervjueerinud Kairi Oja

    Index Scriptorium Estoniae

    Erdal, David

    2014-01-01

    Intervjuu juhtimiskonsultant David Erdaliga tema teooriast, mille järgi ettevõtted annavad oma töötajatele ettevõtte aktsiaid, et neid sel moel organisatsiooniga siduda. Arvamust avaldavad ka LHV Panga juhatuse esimees Erki Kilu ning Hamburg ja Partnerid partner Hannes Hamburg

  20. Briefe aus dem Morgenland - Otto Friedrich von Richters Forschungsreise in den Jahren 1814-1816 / Vladimir Sazonov

    Index Scriptorium Estoniae

    Sazonov, Vladimir, 1979-

    2013-01-01

    Arvustus: Briefe aus dem Morgenland - Otto Friedrich von Richters Forschungsreise in den Jahren 1814-1816, hrsg. von Indrek Jürjo, Sergei Stadnikov, Hamburger Beiträge zur Geschichte des östlichen Europa, Bd. 20. Hamburg: Verlag Dr. Kovač 2013, 313 lk.

  1. The effect of cowpea (Vigna unguiculata) flour as an extender on the ...

    African Journals Online (AJOL)

    This study was conducted in search of meat extenders/filler, which would minimize excessive bulging (swelling at the centre) of beef and hamburgers so as to enhance their use in sandwiches. The potential of dehulled cowpea flour was evaluated in beef and hamburgers, to determine its effects on the sensory, physical and ...

  2. ISSN 2073 ISSN 2073-9990 East Cent. East Cent. East Cent. Afr. J ...

    African Journals Online (AJOL)

    DELL

    East and Central African Journal of Surgery. East and Central African Journal of Surgery. 2011 July/ August;16 (2). 2. Gharib H, Goellner JR. Fine needle aspiration biopsy of the thyroid: an appraisal. Ann Intern Med. 1993; 15: 118(4): 282-9. 3. Hamburger J, Hamburger S. Fine needle biopsy of thyroid nodules: Avoiding the.

  3. Download this PDF file

    African Journals Online (AJOL)

    User

    World J Surg 2003; 27:208-211. Fine-needle aspiration of the thyroid and correlation with histopathology in a contemporary series of 240 patients. Am J Surg 2003; 186:702-710. Prevalence of malignancy within cytologically indeterminate thyroid nodules. Am J Surg 2004; 188: 459-462. 9. Hamburger JI, Hamburger SW.

  4. EAMJ March -molecular

    African Journals Online (AJOL)

    iMac User

    2008-03-03

    Mar 3, 2008 ... Kenyatta University, P.O. Box 43844-00100 Nairobi, Kenya, J. Hamburger,PhD, Professor, Hadassah Medical School,. Hebrew University, P.O. Box 12272, ... J. M. KAGAI, S. MPOKE, F. MULI, J. HAMBURGER and E. U. KENYA. ABSTRACT ... World Health Organization (WHO) initiated a Global Program for ...

  5. Mannheim carotid intima-media thickness and plaque consensus (2004-2006-2011). An update on behalf of the advisory board of the 3rd, 4th and 5th watching the risk symposia, at the 13th, 15th and 20th European Stroke Conferences, Mannheim, Germany, 2004, Brussels, Belgium, 2006, and Hamburg, Germany, 2011.

    Science.gov (United States)

    Touboul, P-J; Hennerici, M G; Meairs, S; Adams, H; Amarenco, P; Bornstein, N; Csiba, L; Desvarieux, M; Ebrahim, S; Hernandez Hernandez, R; Jaff, M; Kownator, S; Naqvi, T; Prati, P; Rundek, T; Sitzer, M; Schminke, U; Tardif, J-C; Taylor, A; Vicaut, E; Woo, K S

    2012-01-01

    Intima-media thickness (IMT) provides a surrogate end point of cardiovascular outcomes in clinical trials evaluating the efficacy of cardiovascular risk factor modification. Carotid artery plaque further adds to the cardiovascular risk assessment. It is defined as a focal structure that encroaches into the arterial lumen of at least 0.5 mm or 50% of the surrounding IMT value or demonstrates a thickness >1.5 mm as measured from the media-adventitia interface to the intima-lumen interface. The scientific basis for use of IMT in clinical trials and practice includes ultrasound physics, technical and disease-related principles as well as best practice on the performance, interpretation and documentation of study results. Comparison of IMT results obtained from epidemiological and interventional studies around the world relies on harmonization on approaches to carotid image acquisition and analysis. This updated consensus document delineates further criteria to distinguish early atherosclerotic plaque formation from thickening of IMT. Standardized methods will foster homogenous data collection and analysis, improve the power of randomized clinical trials incorporating IMT and plaque measurements and facilitate the merging of large databases for meta-analyses. IMT results are applied to individual patients as an integrated assessment of cardiovascular risk factors. However, this document recommends against serial monitoring in individual patients. Copyright © 2012 S. Karger AG, Basel.

  6. Modern-Day Public Space in the Historical Context of a City – New Development of the Cathedral Square (Domplatz in Hamburg/ Współczesna Przestrzeń Publiczna W Hsitorycznym Kontekście Miasta – Nowe Zagospodarowanie Placu Katedralnego (Domplatz W Hamburgu

    Directory of Open Access Journals (Sweden)

    Jóźwik Renata

    2015-06-01

    Full Text Available W referacie przedstawiono historię przekształcania się jednego z najstarszych najstarszych miejsc Hamburga - Placu Katedralnego (Domplatz oraz wpływ czynników historycznych na koncepcję jego zagospodarowania. Burzliwa historia, przede wszystkim konsekwencje II wojny światowej, doprowadziła do zatarcia jego historycznego znaczenia. Niezabudowany kwartał po dawnym grodzie i Katedrze Mariackiej przez kilkadziesiąt lat funkcjonował jako nieużytek miejski i parking. Podejmowane próby zmiany tego stanu były nieefektywne. Obecnie coraz częściej realizowane są działania rewitalizacyjne, których celem jest odnowa centrów miast, tak aby stały się one konkurencyjne wobec nadmiernie zabudowywanych przedmieść oraz po to, żeby powrócić do tradycji kształtowania miasta europejskiego. Zrealizowany w 2009 roku na Placu Katedralnym zielony skwer miał być pierwotnie zabudowany, ale dzięki sprzeciwowi środowisk miejskich - konserwatorów, archeologów, urbanistów, polityków, jak i głosom społecznym wycofano się z tych planów. Zaproponowana i zrealizowana współczesna forma placu nawiązauje do historycznej tożsamości miejsca i honoruje znaczenie miejsca. W artykule odniesiono omawiany przykład do podpisanej w 2011 roku przez Zgromadzenie Generalne UNESCO Rekomendacji w sprawie Historycznego Krajobrazu Miejskiego

  7. FORMAÇÃO PARA O EXERCÍCIO DA DOCÊNCIA: HISTÓRIA DE PROFESSORES DE CLASSES MULTISSERIADAS – NOVO HAMBURGO/RS (1940-2009.TRAINING FOR THE EXERCISE OF TEACHING: HISTORY OF MULTIGRADE CLASSES TEACHERS - NOVO HAMBURG0/RS (1940-2009

    Directory of Open Access Journals (Sweden)

    José Edimar Souza

    2012-11-01

    Full Text Available Este estudo trata da história do ensino rural no período de 1940 a 2009, a partir da memória de dez professores que atuaram em classes multisseriadas na rede pública municipal, na região de Lomba Grande, município de Novo Hamburgo/RS, Brasil. As memórias são analisadas sob a perspectiva do “tempo social”, quando a memória permite aos sujeitos assumir o seu lugar na rede das relações sociais inscritas no contexto, envolvendo recordações coletivas desse grupo de sujeitos: cuja memória permite compreender o processo de constituição e opção pelo Magistério, principalmente o aspecto da formação para ser professor(a. A pesquisa, de natureza qualitativa, utiliza a metodologia da História Oral, valendo-se de entrevistas semiestruturadas, além da análise documental. O referencial teórico sustenta-se na perspectiva da História Cultural. A análise enfatiza a dimensão das memórias na constituição docente em classes multisseriadas e sua relação com a representação docente enquanto prática cultural. Destaca-se, no conjunto de análise, as estratégias construídas no processo de escolarização, a realização de cursos supletivos, as formas de ingresso no magistério público municipal e a formação em serviço. Constata-se que, mesmo à margem da cidade, os professores rurais, em Novo Hamburgo/RS, inventaram formas criativas para continuar seu processo formativo e de atualização constante.This study deals with the history of rural education in the period from 1940 to 2009, from the memory of ten teachers who worked in multigrade classes in the public educational system in Lomba Grande, a region in the city of Novo Hamburgo/RS, Brazil. Memories are analyzed from the perspective of "social time", when memory allows individuals to take their places in the network of social relations that are part of this context, involving collective memories of thisgroup of subjects, whose memory allows us to understand the process ofincorporation and choice of teaching, especially the aspect of training to become a teacher. The research is qualitative and uses the methodology of Oral History, with semi-structured interviews and documentary analysis. The theoretical framework rests on the perspective of Cultural History. The analysis emphasizes the size of memory in constituting teaching in multigrade classes and their relation to the representation of teaching as a cultural practice. In the set of analysis, strategies constructed in the schooling process, the conduction of supplementary courses, forms of entry into the municipal public teaching service and in-service training are highlighted. It appears that even in the fringes of the city, rural teachers in Novo Hamburgo/RS invented creative ways to continue their educational process and constant updating.

  8. ‘The originality of Kaschnitz’: Guido Kaschnitz Weinberg, ‘The problem of originality in Roman art’ [Guido Kaschnitz von Weinberg, Das Schöpferische in der römischen Kunst, Römische Kunst, vol. 1, chapter 4, Hamburg: Rowohlt, 1961, 51-73

    Directory of Open Access Journals (Sweden)

    Karl Johns

    2014-12-01

    Full Text Available The vindication of Roman art had been a nearly obsessive preoccupation of the earliest serious comprehensive art historians in Vienna at the end of the nineteenth century. While the relevant books by Franz Wickhoff and Alois Riegl are quoted more than they are actually read, the work of Guido Kaschnitz is even less well known in spite of the fact that he has placed these fundamental questions on a more solid footing. The present text from a lecture held late in his life and published posthumously can hopefully correct misconceptions of his approach to artistic principles.

  9. Assessing the Impact of LFTB in the Beef Cattle Industry

    OpenAIRE

    Pruitt, J. Ross; Anderson, David P.

    2012-01-01

    Ground beef consumption in the United States accounts for over half of total beef consumption and is included in a variety of products from tacos to chili to hamburgers (Greene 2012; National Cattlemen’s Beef Association 2009, 2012; Peel, 2012). The importance of ground beef to U.S. consumers is reflected in the number of restaurants that include hamburgers on their menus as well as the different types of hamburgers offered. Despite the slow economic recovery that has been occurring over the ...

  10. Dicty_cDB: Contig-U12625-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available B05584 Clusters 4 cm (VvC3) Vitis vinifera cDNA... 46 2.3 1 ( EC994962 ) WIN1151.C21_N20 Muscat Hamburg pre-...veraison berry... 46 2.3 1 ( EC973576 ) WIN1016.C21.1_B07 Muscat Hamburg post-veraison pe... 46 2.3 1 ( EC97...3328 ) WIN1016.C21_B07 Muscat Hamburg post-veraison peri... 46 2.3 1 ( EC952528 )

  11. Dicty_cDB: Contig-U06151-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ( EC982174 ) WIN1115.C21_B16 Muscat Hamburg pre-veraison berry... 34 7e-05 3 ( EC921022 ) WIN015.BR.2_E01 C...sed Berry Fr... 34 7e-05 3 ( EC978436 ) WIN107.C21_M18 Muscat Hamburg post-veraison peric... 34 7e-05 3 ( EC...Vit... 34 7e-05 3 ( EC982834 ) WIN1117.C21_B23 Muscat Hamburg pre-veraison berry... 34 7e-05 3 ( EC935544 )

  12. Dicty_cDB: Contig-U03011-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available GA3 (VvS... 48 0.89 1 ( EC993009 ) WIN1147.C21_B23 Muscat Hamburg pre-veraison berry... 48 0.89 1 ( EC98460...9 ) WIN1122.C21_G17 Muscat Hamburg pre-veraison berry... 48 0.89 1 ( EC974458 ) WIN1019.C21_B06 Muscat Ham...burg post-veraison peri... 48 0.89 1 ( EC965042 ) WIN089.C21_P14 Cab Sauv seed norm

  13. Hacking Europe from computer cultures to demoscenes

    CERN Document Server

    Alberts, Gerard

    2014-01-01

    This book traces the evolution of European hacker culture: chopping games in Warsaw, hacking software in Athens, chaos in Hamburg, producing demos in Turku and partying with computing in Zagreb and Amsterdam. Emphasizes the role of mischief, humor and play.

  14. Decision Support for Learners in Mash-Up Personal Learning Environments

    NARCIS (Netherlands)

    Drachsler, Hendrik

    2009-01-01

    Drachsler, H. (2009). Decision Support for Learners in Mash-Up Personal Learning Environments. Presentation given at PLE course. December, 15, 2009‚ Hamburg, Germany: Fakultät für Erziehungswissenschaft, Psychologie und Bewegungswissenschaft.

  15. Pseudorezeption / Cornelius Hasselblatt

    Index Scriptorium Estoniae

    Hasselblatt, Cornelius

    2002-01-01

    Eesti kirjanduse saksakeelsete tõlgete retseptsioonist. Lähtutud on C. Hasselblatti ja Volker Pirischi bibliograafiast "Estnische Literatur in deutscher Sprache 1802-1985" (Hamburg : H. Buske, 1988)

  16. Cozy up to a winter of reading

    Index Scriptorium Estoniae

    2005-01-01

    Tutvustus: Pumpurs, Andrejs. Bearslayer. Hamburg : A. Cropley, 2005 ; Mason, P. M. Puppet maker. P. M. Mason, 2005 ; Estonian folktales : the heavenly wedding / koost. Piret Päär & Anne Türnpu. Tallinn : Varrak, 2005

  17. An investigation into the conditions leading to monsoon onset over Kerala

    Digital Repository Service at National Institute of Oceanography (India)

    RameshKumar, M.R.; Sankar, S.; Reason, C.

    Monsoon onset over the Kerala (MOK) coast has been studied using the recently released high resolution Hamburg Ocean Atmosphere Parameters and Fluxes from Satellite data (HOAPS 3). Columnar water vapour content, sea surface temperature...

  18. The unification of law via the institution of jurisdiction in the 19th century : commercial law before the High Court of Appeal of the four free cities of Germany / Peter Oestmann

    Index Scriptorium Estoniae

    Oestmann, Peter

    2009-01-01

    Institutsioonide pädevuse kaudu õiguse ühtlustamisest 19. sajandil Saksamaal. Nelja Hansa vabalinna (Hamburg, Frankfurt, Bremen, Lübeck) ühiskohtu Oberappellationsgericht tegevusest, Lübecki õigusest Tallinnas ja kohtulahenditest

  19. Ground Beef and Food Safety

    Science.gov (United States)

    ... Standard Forms FSIS United States Department of Agriculture Food Safety and Inspection Service About FSIS District Offices Careers ... JSR 286) Actions ${title} Loading... Ground Beef and Food Safety Questions about "ground meat" or "hamburger" have always ...

  20. WATER DEPTH and Other Data (NODC Accession 7800906)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The ocean station data was submitted by Deutsches Ozeanographisches Datenzentrum (German Oceanographic data center) located in Hamburg, Germany. Data contains...

  1. AIR PRESSURE and Other Data from UNKNOWN PLATFORMS and Other Platforms From North Atlantic Ocean from 19381127 to 19760127 (NODC Accession 7601422)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Historical sea surface temperature and salinity data submitted by D. Kohnke of the German data center (DOD) in Hamburg. The data include surface temperature and...

  2. Historical bottle temperature and salinity data collected globally by multiple platforms from 1868 to 1959, submitted by the German Data Center (BSH) (NODC Accession 0071062)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Historical bottle temperature and salinity data from the German data center, Bundesamt fur Seeschifffahrt und Hydrographie (BSH) in Hamburg. The data contain...

  3. Small x phenomenology. Summary of the 3rd Lund small x workshop in 2004

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, J.R. [Cavendish Lab., Cambridge Univ. (United Kingdom); Baranov, S. [Lebedev Inst. of Physics, Moscow (Russian Federation); Bartels, J. [Hamburg Univ. (DE). FRG] (and others)

    2006-04-15

    A third workshop on small-x physics, within the Small-x Collaboration, was held in Hamburg in May 2004 with the aim of overviewing recent theoretical progress in this area and summarizing the experimental status. (Orig.)

  4. A climatic atlas of the air-sea interaction parameters and fluxes of the oceans using satellite data

    Digital Repository Service at National Institute of Oceanography (India)

    RameshKumar, M.R.; Schulz, J.; Jost, V.

    The present climatic atlas is based on the newly available data set known as the Hamburg Ocean Atmosphere Parameters and fluxes from Satellite data (HOAPS), for the global oceans. It presents the basic fields of air-sea interaction parameters...

  5. (Copepoda, Harpacticoida) from South Africa

    African Journals Online (AJOL)

    1976-12-09

    ? and 200, K-31017, in the Zoologisches. Institut und Zoologisches Museum, Hamburg. Further paratypes in the Zoologisches Museum der UniversiHit. Kiel, Federal Republic of Germany. Type-locality: Langvlei, Wilderness ...

  6. Marker list: QM300242 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM300242 Brassica napus Brassicaceae MR181 SSR AGATTTGCATGTGGTTTGAC ATTGCTTANTGATGTTGGGAA 'Mansholt's Hambu...rger Raps' x 'Samourai' LG_17 ... 10.1046/j.1439-0523.1999.00371.x ...

  7. Dicty_cDB: Contig-U02993-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available u... 50 0.13 1 ( EY741561 ) CS00-C3-705-086-D06-CT.F Sweet orange fruit, deve... 50 0.13 1 ( EC984516 ) WIN1122.C21_C17 Muscat Hambur...g pre-veraison berry... 42 0.13 3 ( EC974842 ) WIN1020.C21_E15 Muscat Hamburg post-... root no... 42 0.14 3 ( EC982779 ) WIN1116.C21_P05 Muscat Hamburg pre-veraison berry... 42 0.15 3 ( EC984425... ) WIN1121.C21_N24 Muscat Hamburg pre-veraison berry... 42 0.15 3 ( CN623006 ) tad98c10.x1 Hydra EST Darmsta

  8. Oceanographic profile temperature, salinity, oxygen and other measurements collected using bottle from the METEOR in the Mediterranean Sea during 1978 (NODC Accession 0001404)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Oceanographic profile data collected during the FS Meteor cruise No. 50 (ALexandria-Malaga-Hamburg), 9 Nov. to 13. Dec. 1978.

  9. International Advisory Committee B Barish, Caltech S Ozaki, BNL S ...

    Indian Academy of Sciences (India)

    , IHEP, Beijing. J Brau, Oregon. D Miller, UCL, London. T Camporesi, CERN. A Miyamoto, KEK. M Danilov, ITEP. Y Okada, KEK. R Godbole, IISc, Bangalore. M Oreglia, Chicago. A Gurtu, TIFR, Mumbai. R Patterson, Cornell. R Heuer, Hamburg.

  10. FARMER EVALUATION OF DRIED BANANA-BASED PRODUCTS

    African Journals Online (AJOL)

    Prtlfverfahren der Lebensrnittelsensorik. Hamburg, Deutschland. IDEA, 1998. Invcstiment in Developing Export. Agriculture and Natural Resources, USAID,. Kampala. INIBAP. 2001 . Networking Banana and Plantain: INIBAB Annual Report, 2001. International. Network for Improvement of Banana and. Plantain, Montpellier ...

  11. Southern Hemisphere Ice Limits, 1973-1978

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Weekly Southern Ocean ice limits, have been digitized from U.S. Navy Fleet Weather Facility ice charts, at the Max-Planck Institut fur Meteorologie, Hamburg....

  12. Southern Hemisphere Ice Limits, 1973-1978, Version 1

    Data.gov (United States)

    National Aeronautics and Space Administration — Weekly Southern Ocean ice limits, have been digitized from U.S. Navy Fleet Weather Facility ice charts, at the Max-Planck Institut fur Meteorologie, Hamburg....

  13. [Kriegsland im Osten Eroberung, Kolonisierung und Militärherrschaft im Ersten Weltkrieg] / Markus Pöhlmann

    Index Scriptorium Estoniae

    Pöhlmann, Markus

    2003-01-01

    Rets.: Vejas Gabriel Liulevicius. Kriegsland im Osten Eroberung, Kolonisierung und Militärherrschaft im Ersten Weltkrieg. Aus dem Amerikanischen von Jürgen Bauer, Edith Nerke und Fee Engemann. Hamburg : 2002

  14. Smart Substitutions for Healthy Cooking

    Science.gov (United States)

    ... bagel or slice of toast. For High-Fat Items at Restaurant You can eat sensibly when you ... cheeseburger, try a grilled chicken sandwich, a sliced meat sandwich or a regular hamburger on a bun ...

  15. 76 FR 64944 - Notice of Agreements Filed

    Science.gov (United States)

    2011-10-19

    ...: Hamburg-Sud (``HSDG''); Alianca Navegacao e Logistica Ltda. e CIA (``Alianca''); Compania Sud Americana de...-010. Title: Maritime Credit Agreement. Parties: Alianca Navegacao e Logistica Ltda. & Cia.; China...

  16. [Prehn, Ulrich. Max Hildebert Boehm. Radikales Ordnungsdenken vom Ersten Weltkrieg bis in die Bundesrepublik] / Karsten Brüggemann

    Index Scriptorium Estoniae

    Brüggemann, Karsten, 1965-

    2015-01-01

    Arvustus: Prehn, Ulrich. Max Hildebert Boehm. Radikales Ordnungsdenken vom Ersten Weltkrieg bis in die Bundesrepublik (Hamburger Beiträge zur Sozizl- und Zeitgeschichte, 51). Wallstein Verlag. Göttingen 2013

  17. 78 FR 51726 - Notice of Agreements Filed

    Science.gov (United States)

    2013-08-21

    ... ( www.fmc.gov ) or by contacting the Office of Agreements at (202) 523-5793 or [email protected]fmc.gov... Corporation; Evergreen Marine Corporation (Taiwan), Ltd.; Hamburg- S d KG; Hanjin Shipping Co., Ltd.; Hapag...

  18. African Journal of Biomedical Research - Vol 5, No 1-2 (2002)

    African Journals Online (AJOL)

    Screening of some Nigerian medicinal plants for antioxidant activity using 2,2, diphenyl-picryl-hydrazyl radical · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JM Oke, MO Hamburger ...

  19. Antitrypanosomal isoflavan quinones from Abrus precatorius

    CSIR Research Space (South Africa)

    Hata, Y

    2014-03-01

    Full Text Available , Marcel Kaiser b, Reto Brun b, Olivier Potterat a, Matthias Hamburger a,⁎ a Department of Pharmaceutical Sciences, University of Basel, Klingelbergstrasse 50, CH-4056 Basel, Switzerland b Swiss Tropical and Public Health Institute and University...

  20. Anti- angiogenic effect of efavirenz on chick chorioallantoic membrane

    African Journals Online (AJOL)

    Rankuwa, 2Department of Internal Medicine,. 3School of Anatomical Sciences, Medical School, University of the ... (Hamburger and Hamilton's stage 21) and used as in vivo systems, a vascular test environment to study angiogenesis.

  1. Global ocean warming tied to anthropogenic forcing

    National Research Council Canada - National Science Library

    Reichert, B.K; Schnur, R; Bengtsson, L

    2001-01-01

    Observed global ocean heat content anomalies over the past five decades agree well with an anthropogenically forced simulation using the European Center/Hamburg coupled general circulation model (GCM...

  2. Stool Culture

    Science.gov (United States)

    ... disease) – found in raw or undercooked hamburger/beef, spinach, or unpasteurized cider; causes bloody diarrhea and may ... best things to do are to not drink water or eat food that may be contaminated and ...

  3. Observed low-frequency currents in the deep mid-Arabian sea

    Digital Repository Service at National Institute of Oceanography (India)

    Shetye, S.R.; Shenoi, S.S.C.; Sundar, D.

    ) are produced in the western part of the basin, they could decay due to horizontal and bottom friction as they propagate eastward. This then would be one possible mechanism to explain the decrease in energy from west to east, particularly at the deeper level... and Industrial Research, New Delhi, and the Federal German Ministry for Research and Technology, Bonn. We thank R. R. Nair (National Institute of Oceanography, Goa) and V. Ittekot (University of Hamburg, Hamburg) for their co-operation during deployment...

  4. Analysis of the Finite Precision s-Step Biconjugate Gradient Method

    Science.gov (United States)

    2014-03-13

    many other analyses of the behavior of various KSMs in finite precision arithmetic (see, e.g. [17, 16, 25]). The reader is also directed to the...transformations, SIAM J. Sci. Stat. Comput., 9 (1988), pp. 152–163. [29] J-P. Zemke, Krylov subspace methods in finite precision: a unified approach, PhD thesis, Dissertation, Technische Universität Hamburg-Harburg, Hamburg, Germany, 2003.

  5. The Consumer’s Opinions of the Food Service System: The 1973 Fort Lee Survey

    Science.gov (United States)

    1974-05-01

    the serving line (2 eggs: 15 cents; hamburger: 20 cents; french fries : 10 cents; chicken : 45 cents). Extremely Unfavorable (]) Mildly Unfavorable...15¢; hamburger: 20¢; french fries : 10¢; chicken : 45¢) Proposal 1: The current system gives some people a separate rat- ions allowance and...17 Kentucky 0 44 Utah () 18 Louisiana .--::\\ 45 Vermont 0 19 Maine 0 46 Virginia 0 20 Maryland 0 47 Washington 0 21 Massachusetts C; 48 West

  6. Profile of bosutinib and its clinical potential in the treatment of chronic myeloid leukemia

    OpenAIRE

    Amsberg, Gunhild Keller-von; Koschmieder, Steffen

    2013-01-01

    Gunhild Keller-von Amsberg,1 Steffen Koschmieder21Department of Hematology and Oncology, University Cancer Center Hamburg, University Hospital Hamburg Eppendorf, 2Department of Medicine (Hematology, Oncology, and Stem Cell Transplantation), University Medical Center of Aachen and RWTH Aachen University, Aachen, GermanyAbstract: Bosutinib (SKI-606) is an orally available, once-daily, dual Src and Abl kinase inhibitor with promising clinical potential in first-, second-, and third-line treatmen...

  7. Bosutinib in the management of chronic myelogenous leukemia

    OpenAIRE

    von Amsberg, Gunhild Keller; Schafhausen,

    2013-01-01

    Gunhild Keller-von Amsberg, Philippe SchafhausenDepartment of Hematology and Oncology and, Stem Cell Transplantation and Pulmonology Division, Oncological Center, University Hospital Hamburg-Eppendorf, Hamburg, GermanyAbstract: Bosutinib (SKI-606) is an orally available, once-daily dual Src and Abl kinase inhibitor, approved by the US Food and Drug Administration for the treatment of adults with chronic, accelerated, or blast-phase Philadelphia chromosome-positive chronic myelogenous leukemia...

  8. Review: Lisa Mackenrodt, Swahili Spirit Possession and Islamic Healing in Contemporary Tanzania: The Jinn Fly on Friday (2011 Buchbesprechung: Lisa Mackenrodt, Swahili Spirit Possession and Islamic Healing in Contemporary Tanzania: The Jinn Fly on Friday (2011

    Directory of Open Access Journals (Sweden)

    Jigal Beez

    2013-01-01

    Full Text Available Review of the monograph:Lisa Mackenrodt, Swahili Spirit Possession and Islamic Healing in Contemporary Tanzania: The Jinn Fly on Friday, Hamburg: Verlag Dr. Kovač, 2011, ISBN 978-3-8300-5806-9, 216 pagesBesprechung der Monographie:Lisa Mackenrodt, Swahili Spirit Possession and Islamic Healing in Contemporary Tanzania: The Jinn Fly on Friday, Hamburg: Verlag Dr. Kovač, 2011, ISBN 978-3-8300-5806-9, 216 Seiten

  9. Statistic>

    DEFF Research Database (Denmark)

    Hansen, Flemming Tvede

    2008-01-01

    Co-organizer for and participant at the exhibition: Statistic>Hamburg 3/4-27/4 2008......Co-organizer for and participant at the exhibition: Statistic>2-16/3 2008 Museum fur Kunst und Gewerbe, Hamburg 3/4-27/4 2008...

  10. Proceedings of the 5th International Workshop on Constraints and Language Processing (CSLP 2008)

    DEFF Research Database (Denmark)

    This research report constitutes the proceedings of the 5th International Workshop on Constraints and Language Processing (CSLP 2008) which is part of the European Summer School in Logic, Language, and Information (ESSLLI 2008), Hamburg, Germany, August 2008.......This research report constitutes the proceedings of the 5th International Workshop on Constraints and Language Processing (CSLP 2008) which is part of the European Summer School in Logic, Language, and Information (ESSLLI 2008), Hamburg, Germany, August 2008....

  11. Solution of the Stieltjes truncated matrix moment problem

    Directory of Open Access Journals (Sweden)

    Vadim M. Adamyan

    2005-01-01

    Full Text Available The truncated Stieltjes matrix moment problem consisting in the description of all matrix distributions \\(\\boldsymbol{\\sigma}(t\\ on \\([0,\\infty\\ with given first \\(2n+1\\ power moments \\((\\mathbf{C}_j_{n=0}^j\\ is solved using known results on the corresponding Hamburger problem for which \\(\\boldsymbol{\\sigma}(t\\ are defined on \\((-\\infty,\\infty\\. The criterion of solvability of the Stieltjes problem is given and all its solutions in the non-degenerate case are described by selection of the appropriate solutions among those of the Hamburger problem for the same set of moments. The results on extensions of non-negative operators are used and a purely algebraic algorithm for the solution of both Hamburger and Stieltjes problems is proposed.

  12. Model projections on the impact of HCV treatment in the prevention of HCV transmission among people who inject drugs in Europe"

    DEFF Research Database (Denmark)

    Fraser, Hannah; Martin, Natasha K; Brummer-Korvenkontio, Henrikki

    2018-01-01

    among PWID. RESULTS: At baseline, chronic HCV prevalence varied from 55% (Finland/Sweden), and Hamburg/Norway/Denmark/Sweden) to 5% (Slovenia/Czech Republic) of chronically infected PWID were treated annually. Current treatment rates using new direct...... acting antivirals (DAAs) may achieve observable reductions in chronic prevalence (38-63%) in 10 years in Czech Republic, Slovenia and Amsterdam. Doubling HCV-treatment rates will reduce prevalence in other sites (12-24%, Belgium/Denmark/Hamburg/Norway/Scotland) but is unlikely to reduce prevalence...... to substantial increases in current treatment rates are required to achieve the same impact elsewhere, from 1.4-3 times (Czech Republic/France), 5-17 times (France/Scotland/Hamburg/Norway/Denmark/Belgium/Sweden), to 200 times (Finland). Scaling-up OST and NSP coverage to 80% in all sites reduces treatment scale...

  13. LASIK and PRK in hyperopic astigmatic eyes: is early retreatment advisable?

    OpenAIRE

    Frings A; Richard G; Steinberg J; Druchkiv V; Linke SJ; Katz T

    2016-01-01

    Andreas Frings,1 Gisbert Richard,1,2 Johannes Steinberg,1,3,4 Vasyl Druchkiv,1,4 Stephan Johannes Linke,1,3,4 Toam Katz1,4 1Department of Ophthalmology, University Medical Centre Hamburg-Eppendorf, 2Ophthalmologikum an der Alster, 3zentrumsehstärke, 4CARE Vision Germany GmbH, Hamburg, Germany Purpose: To analyze the refractive and keratometric stability in hyperopic astigmatic laser in situ keratomileusis (LASIK) or photorefractive keratectomy (PRK) during the first 6 mont...

  14. Profitable use. Gas turbines modular cogeneration plants in a malting company; Lohnender Einsatz. Gasturbinen-BHKW in Maelzerei

    Energy Technology Data Exchange (ETDEWEB)

    Holtkamp, E. [ENERATIO, Ingenieurbuero fuer Rationellen Energieeinsatz, Hamburg (Germany); Schommer, R. [Tivoli-Werke, Hamburg (Germany)

    1994-10-01

    The article presents a gas turbines modular cogeneration plants for a malting company in Hamburg. Cogeneration is in this case particularly profitable as the company needs both, power and heat. With flow charts the structure and mode of operation are described. (orig.) [Deutsch] Der vorliegende Beitrag stellt ein Gasturbinen-Blockheizkraftwerk fuer einen Maelzereibetrieb in Hamburg vor. Die Kraft-Waerme-Kopplung ist dabei besonders geeignet, da Strom und Waerme in diesem Betrieb gleichzeitig benoetigt werden. Anhand von Flussdiagrammen werden Aufbau und Funktionsweise dargestellt. (HW)

  15. Proceedings of the International Conference on Algorithms for Approximation (2nd) Held in Royal Military College of Science, Shrivenham, England on July 1988. Part 1

    Science.gov (United States)

    1989-01-01

    Ibadan, Ibadan, Oyo State, Nigeria . G. OPFER Insti tut f(Ir Angwandte Mathematik, Universittt Hamburg, 0 Bundesstrasse 55, D-2000 Hamburg 13, W.Germany...M. G. (1987), Data approximation by splines in one and two independent variables. In The State of the Art in Numerical Analysis, (Iserles, A. and...then (Mnf)(S)(x) - (n+l)a(n,s)k 0pn -sk(x)0pn+s’k+s(t)f(s)(t)dt, (1)k=n nok °x) nnsIk with a(n,s) n 7 -s n (1)). < 1, cf. Derriennic 979).n-s. n s

  16. Vorwort

    OpenAIRE

    Feuerstein, Günter

    2007-01-01

    Im letzten Jahrzehnt haben sich die Anstrengungen verstärkt, in der Region Hamburg einen tragfähigen Standort für moderne Biotechnologien zu etablieren. Die wachsende Intensität der Hamburger Biotechnologieförderung kann als Reflex auf den drastischen Einbruch neu gegründeter Biotechnologiefirmen gesehen werden, der sich in den Jahren zuvor vollzog. Zahlreiche Unternehmen verschwanden ungeachtet guter Konzepte und guter Technologien nach kurzer Zeit wieder von der Bildfläche. Vor diesem Hinte...

  17. Steuerungsversuche und Dynamik biotechnischer Innovationen

    OpenAIRE

    Feuerstein, Günter

    2007-01-01

    Im letzten Jahrzehnt haben sich die Anstrengungen verstärkt, in der Region Hamburg einen tragfähigen Standort für moderne Biotechnologien zu etablieren. Die wachsende Intensität der Hamburger Biotechnologieförderung kann als Reflex auf den drastischen Einbruch neu gegründeter Biotechnologiefirmen gesehen werden, der sich in den Jahren zuvor vollzog. Zahlreiche Unternehmen verschwanden ungeachtet guter Konzepte und guter Technologien nach kurzer Zeit wieder von der Bildfläche. Vor diesem Hinte...

  18. Halal on the menu?: Contested food politics and French identity in fast-food

    OpenAIRE

    Wright, Wynne; Annes, Alexis

    2013-01-01

    International audience; Many regard France as a nation with a distinctive and world-renown cuisine. However, the common hamburger became the center of a public dialog in 2009e2010 as the nation grappled with the meaning of fast-food processed by halal standards. Using content analysis of national newspapers, we analyze how the French media framed the introduction of a halal hamburger onto the menu of fast-food restaurant Quick. Media framing was unsettled and contentious. We explore this disc...

  19. Fehmarnbelt Business Barometer

    DEFF Research Database (Denmark)

    Jespersen, Per Homann; Endres, Jean Paulo; Jakobsen, Marianne

    2013-01-01

    Results from a survey made among CEO's and CFO's of large and medium sized companies in the Denmark Capital, Zealand and Scania regions and on the States of Hamburg and Schleswig-Holstein regarding the businnes perspectives related to the construction of the Fehmarn fixed link.......Results from a survey made among CEO's and CFO's of large and medium sized companies in the Denmark Capital, Zealand and Scania regions and on the States of Hamburg and Schleswig-Holstein regarding the businnes perspectives related to the construction of the Fehmarn fixed link....

  20. Formation of mutagens in beef and beef extract during cooking.

    Science.gov (United States)

    Commoner, B; Vithayathil, A J; Dolara, P; Nair, S; Madyastha, P; Cuca, G C

    1978-09-08

    Mutagens, distinguishable from benzo[a]pyrene and from mutagenic amino acid and protein pyrolysis products, are formed when ground beef is cooked in a home hamburger cooking appliance or when beef stock is concentrated, by boiling, to a paste known commercially as beef extract. "Well-done" hamburgers contain about 0.14 part per million of the mutagens, and beef bouillon cubes which contain beef extract about 0.1 part per million. Since such mutagens may be potentially carcionogenic and are formed during ordinary cooking procedures, their occurrence raises questions about possible risks to human health.

  1. The Revista Médica project: medical journals as instruments of German foreign cultural policy towards Latin America, 1920-1938.

    Science.gov (United States)

    Wulf, Stefan

    2013-03-01

    After the First World War, foreign cultural policy became one of the few fields in which Germany could act with relative freedom from the restrictions imposed by the Treaty of Versailles. In this context the Hamburg doctors Ludolph Brauer, Bernhard Nocht and Peter Mühlens created the Revista Médica de Hamburgo (as of 1928 Revista Médica Germano-Ibero-Americana), a monthly medical journal in Spanish (and occasionally in Portuguese), to increase German influence especially in Latin American countries. The focus of this article is on the protagonists of this project, the Hamburg doctors, the Foreign Office in Berlin, the German pharmaceutical industry, and the publishing houses involved.

  2. Corrigendum

    Directory of Open Access Journals (Sweden)

    Zoellner Y

    2011-09-01

    Full Text Available York Zoellner1, Maria-Magdalena Balp2, Andrea Gili Marco21Hamburg University of Applied Sciences, Hamburg, Germany; 2Novartis Pharma AG, Basel, SwitzerlandThe role of galenic innovation in improving treatment compliance and persistence: three case studies. Clinicoecon Outcomes Res. 2011;3:109-116. In the results section of the abstract, "...+15% in Germany for desferrioxamine vs deferasirox." should read "...+15% in Germany for deferasirox vs desferrioxamine." In the ‘Compliance' section, "...and +15% in Germany for desferrioxamine vs deferasirox." should read "...and +15% in Germany for deferasirox vs desferrioxamine."Original Article 

  3. Doppelarbeit und Wiederholungen beim Versuch, Schulbibliotheksnetzwerke aufzubauen

    Directory of Open Access Journals (Sweden)

    Karsten Schuldt

    2012-03-01

    Full Text Available Der Text nimmt das aktuelle Ende des Schulbibliotheksprojektes der Hamburger Bücherhallen zum Anlass, um über ähnliche Projekte in der Vergangenheit zu berichten. Er argumentiert, dass das Scheitern des Hamburger Projektes nicht unerwartet war, sondern aufgrund ähnlicher Strukturen, Argumentationen und Herangehensweisen bei früheren Projekten als strukturelles Problem beschrieben werden kann. Der Text versucht, eine Reflexion zu den Annahmen über Schulbibliotheken im deutschen Bibliothekswesen, auf der Basis bereits gesammelter Erfahrungen, anzustoßen. Zudem versteht er sich als Plädoyer für eine problemzentrierte Bibliotheksgeschichte.

  4. Structure-activity relationship study of sesquiterpene lactones and their semi-synthetic amino derivatives as potential antitrypanosomal products

    CSIR Research Space (South Africa)

    Zimmermann, S

    2014-03-01

    Full Text Available Stefanie Zimmermann 1,2, Gerda Fouché 3, Maria De Mieri 1, Yukiko Yoshimoto 4, Toyonobu Usuki 4, Rudzani Nthambeleni 3, Christopher J. Parkinson 5, Christiaan van der Westhuyzen 3, Marcel Kaiser 2,6, Matthias Hamburger 1 and Michael Adams 1,* 1... Department Pharmaceutical Biology, University of Basel, Klingelbergstrasse 50, 4056 Basel, Switzerland; E-Mails: stefanie.zimmermann03@gmail.com (S.Z.); maria.demieri@unibas.ch (M.D.M.); matthias.hamburger@unibas.ch (M.H.) 2 Department Medical Parasitology...

  5. REPAiR: REsource Management in Peri-urban AReas: Going Beyond Urban Metabolism : D 5.1: PULLs Handbook

    NARCIS (Netherlands)

    Russo, M; Amenta, Libera; Attademo, Anna; Cerreta, Maria; Formato, E.; Remoy, Hilde; van der Leer, J.G.G.; Varju, Viktor; Arciniegas, Gustavo

    2017-01-01

    REPAiR will provide local and regional authorities with an innovative transdisciplinary open source Geodesign Decision Support Environment (GDSE) developed and implemented in Living Labs (LLs) context, in six metropolitan areas namely Naples, Ghent, Hamburg, Pécs, Łódź and Amsterdam. LLs are

  6. Embryo rescue of crosses between diploid and tetraploid grape ...

    African Journals Online (AJOL)

    Five cross combinations Jumeigui×Xinghua No.1, 87-1×Kyoho, Kyoho×Muscat Hamburg, Jumeigui× Hongqitezao and Red globle×Kyoho were used as the testing materials. Factors that affect embryo rescue from crossed seeds between diploid and tetraploid grape were studied applying L25(55) orthogonal experiment ...

  7. The Tongue and Quill

    Science.gov (United States)

    2004-08-01

    There is no egg in eggplant nor ham in hamburger; neither apple nor pine in pineapple . Sweetmeats are candies while sweetbreads, which aren’t...Remember “My Very Energetic Mother Just Served Us Nine Pizzas ?” This catch phrase helped us remember the order of the planets: Mercury, Venus, Earth, Mars

  8. Oil and Fatty Acid Content Among Diverse Sesame Genetic Resources

    Science.gov (United States)

    Sesame, Sesamum indicum contains oil used for salads, cooking while the seeds are used on hamburger buns, candies, and are used to make tahini. Sesame oil is known to reduce cholesterol due to the high polyunsaturated fat content in the oil. Oil content ranges from about 40 to 63% among sesame acces...

  9. 47{sup th} Annual meeting on nuclear technology (AMNT 2016). Key Topics / Enhanced safety and operation excellence

    Energy Technology Data Exchange (ETDEWEB)

    Bohnstedt, Angelika [Karlsruher Institut fuer Technologie (KIT), Eggenstein-Leopoldshafen (Germany). Programm Nukleare Entsorgung, Sicherheit und Strahlenforschung (NUSAFE); Baumann, Erik [AREVA GmbH, Erlangen (Germany). Radiation Protection

    2016-12-15

    Summary report on the Key Topic 'Enhanced Safety and Operation Excellence' Focus Session 'Radiation Protection' of the 47{sup th} Annual Meeting on Nuclear Technology (AMNT 2016) held in Hamburg, 10 to 12 May 2016. Other Sessions of AMNT 2016 have been and will be covered in further issues of atw.

  10. Evaluation of deformation response of HMA under APT and wheel tracking tests

    CSIR Research Space (South Africa)

    Denneman, E

    2008-10-01

    Full Text Available laboratory test program to characterize the material was conducted as well. This paper contains a comparison between the Accelerated Pavement Testing (APT) in the field and wheel tracking tests performed as part of the laboratory study (Hamburg Wheel Tracking...

  11. Tähelepanu, lätlased tulevad...! / Peeter Järvelaid

    Index Scriptorium Estoniae

    Järvelaid, Peeter, 1957-

    1991-01-01

    Arvustus: Tartu Ülikooli õigusteaduskonna lõpetanute ja õigusteadust õpetanute nimekiri 1919-1989. Tartu, 1989 ; Latvijas Universitātes Tiesību Zinātnu Nodalas absolventu saraksts 1920-1940. Hamburg, 1990. - Sisaldab andmeid ka prof. Dietrich André Loeberi kohta

  12. Naval Ship Maintenance: An Analysis of the Dutch Shipbuilding Industry Using the Knowledge Value Added, Systems Dynamics, and Integrated Risk Management Methodologies

    Science.gov (United States)

    2012-10-10

    and Service Agency, The Netherlands. Bert Geisler, Business Development Director Shipbuilding, Siemens PLM Software, Hamburg, Germany. Paul J...Director, Marine/Federal Business Development, Siemens PLM Software, Washington, D.C. Niek Marse, Integrated Logistic System, Engineering Department...Damen Schelde Naval Shipbuilding, Vlissingen, The Netherlands. Michael Schwind, Vice President, Federal Sector, Siemens–UGS PLM Software, Philadelphia

  13. Ingarden en de fenomenologie van de lezer

    NARCIS (Netherlands)

    Stralen, J.J.M. van

    2005-01-01

    Hoewel de fenomenoloog Roman Ingarden (1893-1970) talrijke originele ideeën over esthetische kwesties heeft ontvouwd, bleef hij in West-Europa lange tijd nagenoeg onbekend. Pas na 1945 wordt zijn theorie uitgewerkt door onder andere Staiger, Kayser, Dufrenne, Stanzel, Hamburger, Strelka en Wellek.

  14. Inelastic scattering of low- and intermediate-energy polarized protons from various light nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Plavko, A.; Onegin, M.; Kudriashov, V. [St. Petersburg State Technical University, St. Petersburg 195251 (Russian Federation); Olmer, C.; Bacher, A.; Schwandt, P.; Stephenson, E. [Indiana University Cyclotron Facility, Bloomington, Indiana 47408 (United States)

    1995-07-15

    Analyzing powers and differential cross sections for inelastic proton scattering from {sup 28}Si, {sup 20}Ne, and {sup 16}O targets at an incident proton energy of T{sub p}=135 MeV are presented. These observables have also been modeled with a microscopic approach using the Paris-Hamburg effective NN potential. (AIP)

  15. Untitled

    African Journals Online (AJOL)

    Neville Alexander, editor, Social Dynamics - special issue on. 'Language and Development in Africa', Volume 25 Number 1,. 1999, Centre for African Studies, University of Cape Town, 199pp. Ayo Bamgbose, Language and Exclusion: The Consequences of Language Policies in Africa. Hamburg: Lit Verlag Munster,. 2000 ...

  16. Ergebnisse der Nachuntersuchung einiger Rhizostomeen-typen Ehrenberg's, Haeckel's und Vanhöffen's aus den Zoologischen Museen im Berlin und Königsberg

    NARCIS (Netherlands)

    Stiasny, G.

    1923-01-01

    Die vorliegende Mitteilung schliesst sich enge an an die Reihe inhaltsverwandter Arbeiten über die Untersuchungsergebnisse von RhizostomeenOriginaltypen, die in den Museen von Amsterdam (8), Kopenhagen (9), Hamburg (10) und Jena (11) sich befinden. Hier handelt es sich um einige Originale von

  17. [Thomas Lange. Zwischen Reformation und Untergang Alt-Livlands : der Rigaer Erzbischof Wilhelm von Brandenburg im Beziehungsgeflecht der livländischen Konföderation und ihrer Nachbarländer] / Juhan Kreem

    Index Scriptorium Estoniae

    Kreem, Juhan, 1971-

    2015-01-01

    Arvustus: Lange, Thomas. Zwischen Reformation und Untergang Alt-Livlands : der Rigaer Erzbischof Wilhelm von Brandenburg im Beziehungsgeflecht der livländischen Konföderation und ihrer Nachbarländer (Hamburger Beiträge zur Geschichte des östlichen Europa)

  18. Uncovertebral joint injury in cervical facet dislocation: the headphones sign.

    Science.gov (United States)

    Palmieri, Francesco; Cassar-Pullicino, Victor N; Dell'Atti, Claudia; Lalam, Radhesh K; Tins, Bernhard J; Tyrrell, Prudencia N M; McCall, Iain W

    2006-06-01

    The purpose of our study is to demonstrate the uncovertebral mal-alignment as a reliable indirect sign of cervical facet joint dislocation. We examined the uncovertebral axial plane alignment of 12 patients with unilateral and bilateral cervical facet joint dislocation (UCFJD and BCFJD, respectively), comparing its frequency to the reverse hamburger bun sign on CT and MR axial images. Of the seven cases with BCFJD, five clearly demonstrated the diagnostic reverse facet joint hamburger bun sign on CT and MR images, but in two cases this sign was not detectable. In the five cases with UCFJD, four demonstrated the reverse hamburger bun sign on both CT and MRI. In one case the reverse hamburger bun sign was not seen adequately with either image modality, but the facet dislocation was identified on sagittal imaging. The uncovertebral mal-alignment was detected in all 12 cases. Normally, the two components of the uncovertebral joint enjoy a concentric relationship that in the axial plane is reminiscent of the relationship of headphones with the wearer's head. We name this appearance the 'headphones' sign. Radiologists should be aware of the headphones sign as a reliable indicator of facet joint dislocation on axial imaging used in the assessment of cervical spine injuries.

  19. NCBI nr-aa BLAST: CBRC-ACAR-01-1153 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-ACAR-01-1153 ref|YP_578337.1| MATE efflux family protein [Nitrobacter hamburge...nsis X14] gb|ABE63877.1| MATE efflux family protein [Nitrobacter hamburgensis X14] YP_578337.1 1.2 33% ...

  20. Draft Genome Sequence of Nitrobacter vulgaris Strain Ab1, a Nitrite-Oxidizing Bacterium.

    Science.gov (United States)

    Mellbye, Brett L; Davis, Edward W; Spieck, Eva; Chang, Jeff H; Bottomley, Peter J; Sayavedra-Soto, Luis A

    2017-05-04

    Here, we present the 3.9-Mb draft genome sequence of Nitrobacter vulgaris strain Ab1, which was isolated from a sewage system in Hamburg, Germany. The analysis of its genome sequence will contribute to our knowledge of nitrite-oxidizing bacteria and acyl-homoserine lactone quorum sensing in nitrifying bacteria. Copyright © 2017 Mellbye et al.

  1. Draft Genome Sequence of Nitrobacter vulgaris Strain Ab1, a Nitrite-Oxidizing Bacterium

    OpenAIRE

    Brett L. Mellbye; Davis, Edward W.; Spieck, Eva; Jeff H Chang; Bottomley, Peter J.; Sayavedra-Soto, Luis A.

    2017-01-01

    ABSTRACT Here, we present the 3.9-Mb draft genome sequence of Nitrobacter vulgaris strain Ab1, which was isolated from a sewage system in Hamburg, Germany. The analysis of its genome sequence will contribute to our knowledge of nitrite-oxidizing bacteria and acyl-homoserine lactone quorum sensing in nitrifying bacteria.

  2. Raamatuautomaadid Hamburgis / A. Bösch ; refereerinud Lea Laurberg-Heckelmann

    Index Scriptorium Estoniae

    Bösch, A.

    2012-01-01

    Refereeritud väljaandest: Bösch, A. Eine Schachtel Literatur ziehen: Bettina von Bülow betreibt in Hamburg Bücherautomaten - Das Angebot reicht vom Comics bis zum Stadtführer. - Lübecker Nachrichten, 30./31.10.2011, lk. 19

  3. Lupin seed meal (Lupinus albus cv. Buttercup) as a source of ...

    African Journals Online (AJOL)

    Experiment 2, conducted to evaluate certified L. a/bus cv. Buttercup seed (at an ... Buttercup-saad in die dleet, te ondersoek,. Die resultate behaal het tot die tweede studie gelei, wat uitgevoer is om gesertifiseerde. L. a/bus cv. Buttercupsaad. (teen 'n ... value of Hamburg lupins relative to soya bean meal can be ascribed to ...

  4. Dicty_cDB: Contig-U14142-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available _C21 GQ025: Annual flush SHOOTS diurnal ... 30 6.8 3 ( EC973956 ) WIN1017.C21_F11 Muscat Hamburg post-verais...on peri... 40 7.0 2 ( CO489460 ) GQ0259.B3_C21 GQ025: Annual flush SHOOTS diurnal ... 30 7.1 3 ( AC167496 )

  5. Mandibular Advancing Positive Pressure Apnea Remediation Device (MAPPARD)

    Science.gov (United States)

    2014-06-01

    Obstructed sleep apnea , remediation devices, modeling and simulations, health care simulations, mandibular advancing positive pressure apnea ...School NURBS non-uniform rational basis spline OSA obstructive sleep apnea OPAL oral , pharyngeal and laryngeal OP oropharynx REM rapid eye...Lobbezoo, F., Hamburger, H. L., & Naeije, M. (2011). Oral appliance therapy versus nasal continuous positive airway pressure in obstructive sleep apnea

  6. Reconstruction of Past Climatic Variability

    Science.gov (United States)

    1976-03-01

    S. Dean, TRL Jaan Terasmae, Brock Univ., St. Catharines, Ontario, Canada John Yu, TRL Klaus Brehme, formerly Universität Hamburg, Federal Republic...T.P. HARLAN 6 K. SCHWAB riARK PEAK SADDLE AZ USA 1B9540 PSME’ 82 3241N 10959W 26a2M 33aY 1630:1967 18C SR

  7. Organising and learning experiences of the first semester MA Program ePedagogy / Visual Knowledge Building

    NARCIS (Netherlands)

    Jaap Jansen

    2006-01-01

    This paper will discuss the process of the MA program ePedagogy / Visual Knowledge Building during the first semester of the academic year 2005 – 2006. This MA program is a joint venture between the Universities of Helsinki, Hamburg and INHOLLAND. This publication will discuss and evaluate the

  8. Weeping Glass: The Identification of Ionic Species on the Surface of Vessel Glass Using Ion Chromatography

    NARCIS (Netherlands)

    Verhaar, G.; van Bommel, M.R.; Tennent, N.H.; Roemich, H.; Fair, L.

    2016-01-01

    Aqueous films on the surface of unstable vessel glass were analysed. Five cation and eight anion species from eleven glass items in the Rijksmuseum, Amsterdam, the Hamburg Museum and the Corning Museum of Glass have been quantified by ion chromatography. Sodium, potassium, magnesium and calcium

  9. Standards in stacking and reclaiming reach new heights

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-06-01

    This paper reports on two coal handling projects it has recently completed by Krupp Foerdertechnik. One was for the design of a new coal handling plant and associated stockyard for a power station owned by the Israel Electric Corporation (IEC), the other for a bucket wheel machine for the redesigned extended coal stockyard at Hamburg, Hansaport. 4 figs.

  10. The Concept of Comprehensive Security: A Distinctive Feature of a Shared Security Culture in Europe

    Science.gov (United States)

    2007-12-01

    These developments may have significant effects for Europe as a regional power. 5. Max Singer and...Sicherheitspolitik. Hamburg: Mittler, 2001. Frank, Johann , Gustav E. Gustenau, Erich Reiter. Anmerkungen zum Entwurf einer Europäischen...Sicherheitsstrategien der USA und der EU im Vergleich." In: Die Beziehungen zwischen NATO und EU. Partnerschaft, Konkurrenz, Rivalität? edited by Johannes Varwick

  11. Advancement in Perfluoroalkyl Research Hampered by Analytical Challenges

    NARCIS (Netherlands)

    Martin, J.W.; Kannan, K.; Berger, U.; de Voogt, P.; Field, J.; Giesy, J.P.; Harner, T.; Muir, D.C.G.; Scott, B.; Kaiser, M.; Jarnberg, U.; Jones, K.C.; Mabury, S.A.; Schroeder, H.; Simcik, M.; Sottani, C.; Van Bavel, B.; Karrman, A.; Lindstrom, G.; Van Leeuwen, S.

    2004-01-01

    The growing concern over these organohalogens, some of which have been found in human blood and appear to be widespread in the environment, led researchers to gather in Hamburg, Germany, in 2003 to evaluate the current state of methods to analyze for the organic contaminants. Jonathan Martin of the

  12. Production Systems for the Muslim Goat's Meat Market | Asheim ...

    African Journals Online (AJOL)

    Marketing of modern Halal products such as pizzas, sausages and hamburgers, takes place through a separate company “Alfathi Ltd.” and the meat industry is also interesting in enhancing the production of fresh goat's meat, in particular for Islamic religious celebrations. In the study, the economy of specialized sheep ...

  13. Strategic Value of Water to the National Guard

    Science.gov (United States)

    2010-06-04

    require further study. These new pollutants 5 may be of interest to the Army National Guard as its reverse osmosis water purification units are able...per pound of potatoes  Quarter pound hamburger  3,000 gallons for the burger  40 gallons for the bun  Slightly less than 4 gallons for the

  14. The U.S. Army War College Guide to National Security Issues. Volume 1: Theory of War and Strategy

    Science.gov (United States)

    2010-07-01

    with his staff at the Veracruz Cathedral to dis- play the respect of U.S. forces. He further ordered U.S. soldiers to salute Mexican priests in the...had been vilified. Sauerkraut had become liberty cabbage, hamburger was Salisbury Steak, but more seriously, teaching the German language and

  15. Role of heat accumulation in the multi-shot damage of silicon irradiated with femtosecond XUV pulses at a 1 Mhz repetition rate

    NARCIS (Netherlands)

    Sobierajski, R.; Jacyna, I.; Dluzewski, P.; Klepka, M.; Klinger, D.; Pelka, J.B.; Burian, T.; Hajkova, V.; Juha, L.; Saksl, K.; Vozda, V.; Makhotkin, Igor Alexandrovich; Louis, Eric; Faatz, B.; Tiedtke, K.; Toleikis, S.; Enkisch, H.; Hermann, M.; Strobel, S.; Loch, R.A.; Chalupsky, J.

    2016-01-01

    The role played by heat accumulation in multi-shot damage of silicon was studied. Bulk silicon samples were exposed to intense XUV monochromatic radiation of a 13.5 nm wavelength in a series of 400 femtosecond pulses, repeated with a 1 MHz rate (pulse trains) at the FLASH facility in Hamburg. The

  16. Expression of recombinant interferon α-2a in tobacco chloroplasts ...

    African Journals Online (AJOL)

    Yomi

    2011-11-23

    Nov 23, 2011 ... 1National Institute for Biotechnology and Genetic Engineering (NIBGE), P. O. Box 577, Jhang road, Faisalabad,. Postcode 38000, Pakistan. 2Centre of Agricultural Biochemistry and .... PCR amplification was carried out using a master cycler gradiant PCR (Eppendorf AG 22331, Hamburg, Germany) with a.

  17. At WA18

    CERN Document Server

    CERN PhotoLab

    1978-01-01

    By July 1978 the CERN-Hamburg-Amsterdam-Rome-Moskow Collaboration (CHARM) has set up the experiment WA18, behind WA1 (on the right), in the neutrino wide-band (WBB) and narrow-band (NBB) beams, at the West Area Neutrino Facility (WANF)and started data taking data.

  18. Fireworks in noble gas clusters a first experiment with the new "free-electron laser"

    CERN Multimedia

    2002-01-01

    An international group of scientists has published first experiments carried out using the new soft X-ray free-electron laser (FEL) at the research center DESY in Hamburg, Germany. Using small clusters of noble gas atoms, for the first time, researchers studied the interaction of matter with intense X-ray radiation from an FEL on extremely short time scales (1 page).

  19. Dr. John Marburger visits DESY

    CERN Multimedia

    2003-01-01

    Dr. John Marburger, Director of the United States Office of Science and Technology Policy, visited the research center DESY in Hamburg. The American physicist wanted to inform himself about the status of the TESLA X-ray laser and the TESLA linear collider as well as the international collaboration at DESY (1/2 page).

  20. Geography of a Sports Metropolis

    DEFF Research Database (Denmark)

    Feddersen, Arne; Ahlfeldt, Gabriel M.

    2010-01-01

    This study analyses the sports infrastructure of Hamburg, Germany, from the residents’ perspective. Empirical evidence is provided for the Sports Place Theory developed by BALE (2003) using a micro-level dataset of 1,319 sports facilities, which is merged with highly disaggregated data on populat...

  1. On the construction of a regional atmospheric climate model

    DEFF Research Database (Denmark)

    Christensen, J. H.; Van Meijgaard, E.

    1992-01-01

    A Regional Atmospheric Climate Model which combines the physical parameterization package of the General Circulation or Climate Model (ECHAM) used at the Max Planck Institute for Meteorology in Hamburg, and the dynamics package of the Nordic - Dutch - Irish Limited Area Model (HIRLAM), has been...... developed. The necessary changes applied to both model packages in order to obtain a working code are described. -from Authors...

  2. internal root morphology in mandibular first permanent molars

    African Journals Online (AJOL)

    2013-06-11

    Jun 11, 2013 ... INTRODUCTION. The scientific advances in analysing endodontic ... An endodontic irrigation syringe with a 27 gauge needle (BU Kwang. Medical Inc., Seoul, Korea) was used to inject Indian ink (Sanford rotring GmbH, Hamburg, Germany) into the root ... lens with a magnification power of 3X. The Vertucci.

  3. High Lassa Fever activity in Northern part of Edo State, Nigeria ...

    African Journals Online (AJOL)

    The purpose was to establish simple statistics of the effects of lassa fever in northern part of Edo State, Nigeria. Lassa fever activity in the northern part of Edo state, Nigeria, was confirmed in 2004 by laboratory analysis of samples sent to Bernhard–Nocht Institute (BNI) for Tropical Medicine Hamburg, Germany.

  4. Electric operation of Deutsche Bahn in 2007; Elektrischer Betrieb bei der Deutschen Bahn im Jahre 2007

    Energy Technology Data Exchange (ETDEWEB)

    Kiewert, F. [Deutsche Bahn AG, Berlin (Germany). Konzernentwicklung, Konzernstrategie und Verkehrsmarkt; Groh, T. [DB Energie GmbH, Frankfurt am Main (Germany); Braun, M. (and others)

    2008-01-15

    In 2007 Deutsche Bahn did not open up any supraregional infrastructure facilities or take into operation any new vehicle generations. Yet, significant construction projects were continued or newly started. As events of outstanding importance, interoperable traffic relations were newly established or consolidated both in long-distance passenger and freight traffic and at the Hamburg city railway. (orig.)

  5. Integration and Self-Assertion: The Relationship between East Germany and the Soviet Union (and Eastern Europe),

    Science.gov (United States)

    1975-04-01

    reported in Neues Deutschland, Feb. 25, 1958. 23. See Joachim Nawrocki, Das geplante Wunder (Hamburg, 1967) and Fritz Schenk, Das rote Wirtschaftswunder ...Stuttgart, 1969). For the official East German presentation, cf. Hans MUller and Karl Reissig, Wirtschaftswunder DDR (Berlin, 1968). 24. The 1965

  6. Quality of beef burger with addition of wet okara along the storage

    Directory of Open Access Journals (Sweden)

    Rafaela Bergmann Strada de Oliveira

    Full Text Available ABSTRACT Combining the consuming of agricultural residues with satisfying consumers is a challenge that may result in financial income for the frozen meat industries, besides generating products with different nutritional value and satisfactory technological quality. Thus, we aimed at elaborating and assessing the physical, chemical and microbiological characteristics of frozen raw and fried beef hamburgers with addition of okara in its wet form throughout their storage over a period of 120 days. The inclusion of okara was proportional to the reduction in the content of protein, and to the increase of the lipid and moisture amount in the fried and raw formulations. Okara increased the luminosity and dimmed along the storage period. In the raw formulations at zero time lower values for b*, a* were observed when compared to the zero time of the fried hamburgers. This leaded to a light brown color and highlighting the clearing of the color due to the inclusion of okara. The fried hamburgers also featured this clearing, but they were darker brown. Chromaticity was greater with the inclusion of okara and with the passage of time. It can be concluded after 120 days storage the levels of protein, lipid and moisture of the formulations were according to the recommended by the Technical Regulation for Identity and Quality of Hamburgers and comply with the requirements of the Brazilian Law for microbiological standards. The brown colour changed with the inclusion of okara but without alterations in the characteristic colour for beef burguers.

  7. Effects of the storage time on the folic acid added to ready-to-eat meat products manufactured by irradiation

    Science.gov (United States)

    Galán, I.; García, M. L.; Selgas, M. D.

    2013-04-01

    Three different meat products enriched with folic acid (FA) (2.4 mg/100 g) were manufactured: hamburgers, cooked and dry fermented sausages. They were prepared as ready-to-eat (RTE) products using E-beam radiation (2 and 3 kGy) to ensure their safety. The stability of FA and sensory properties of the irradiated meat products were studied during three months of storage under freezing conditions for hamburgers and refrigeration conditions for cooked and dry fermented sausages. FA content was stable in non-irradiated and irradiated hamburgers and cooked sausages over the storage period, whereas it decreased 20% in non-irradiated dry fermented sausages and 12-8% in irradiated samples at 2 and 3 kGy, respectively. Nevertheless, the final amount remained sufficient to provide the recommended daily intake. Panelists rated the sensory properties of the hamburger as satisfactory even after irradiation and 90 days of storage. The overall acceptability of RTE cooked and dry fermented sausages improved slightly with storage (P>0.05).

  8. Riga und Tallinn wollen ihre Umweltstandards erhören : der "Zug der Ideen" faszinierte vor allem junge Menschen / Rainer Müller

    Index Scriptorium Estoniae

    Müller, Rainer

    2011-01-01

    Euroopa keskkonna-pealinn Hamburg esitleb uusi ideid Riias ja Tallinnas. Tallinnast kui Euroopa kultuuripealinnast, kultuurikilomeetrist, Tallinna avamisest merele. Linnaplaneerimise, ökoloogia ja kultuuri parimate seoste otsimisest. Euroopa Rohelise pealinna idee autori Jüri Ratase mõtteid Tallinna tulevikust

  9. Design and OAM&P aspects of a DWDM system equipped with a 40Gb/s PM-QPSK alien wavelength and adjacent 10Gb/s channels

    DEFF Research Database (Denmark)

    Nuijts, Roeland; Bjørn, Lars Lange; Petersen, Martin Nordal

    2011-01-01

    We present theoretical and experimental investigations of the interaction, in terms of BER performance, between a 40Gb/s PM-QPSK alien wavelength and adjacent (50GHz spacing) 10Gb/s NRZ-OOK channels. Experiments were conducted on the Hamburg-Copenhagen section of the Amsterdam-Copenhagen CBF (Cro...

  10. Data collection with a tailored X-ray beam size at 2.69 angstrom wavelength (4.6 keV) : sulfur SAD phasing of Cdc23(Nterm)

    NARCIS (Netherlands)

    Cianci, Michele; Groves, Matthew R.; Barford, David; Schneider, Thomas R.

    The capability to reach wavelengths of up to 3.1 angstrom at the newly established EMBL P13 beamline at PETRA III, the new third-generation synchrotron at DESY in Hamburg, provides the opportunity to explore very long wavelengths to harness the sulfur anomalous signal for phase determination. Data

  11. Inspection of the Armed Forces Retirement Home

    Science.gov (United States)

    2010-02-25

    Medicine/Family Medicine, Psychology, Nutrition, Social Work, Rehabilitation (physical, occupational and speech therapy), Dentistry , and Podiatry...Contract services exist for mobile radiology and dentistry . There are no diagnostic services onsite other than dental x-rays. 39...members eventually opted for the speed line of hamburgers and hot dogs for lunch. c. Lack of sponsored weekend recreational activities/tours. Many

  12. Reframing Paul's sibling language in light of Jewish epistolary forms ...

    African Journals Online (AJOL)

    2015-06-17

    Jun 17, 2015 ... Yet, whereas sociological explorations of Paul's sibling language in the context of the Greco-Roman background are ..... the carpenter.' In the Griechische Papyri der Staats- und. Universitätsbibliothek Hamburg (P.Hamb.) 60, Pascheis (a. Jew), a letter writer, addresses Justos (non-Jew) as 'strategos.

  13. Adult Education of Women for Social Transformation: Reviving the Promise, Continuing the Struggle

    Science.gov (United States)

    Stromquist, Nelly P.

    2013-01-01

    This chapter considers Theme 4 of the "Hamburg Declaration": Adult learning, gender equality and equity, and the empowerment of women. It has a fourfold purpose. It begins with a review of the balance of progress to date in conceptualizing gender. Second, it examines the objectives of CONFINTEA V and VI from a gender perspective. Third,…

  14. Combined spinal and epidural anaesthesia for an elective ...

    African Journals Online (AJOL)

    2012-02-02

    Feb 2, 2012 ... electrocardiography, pulse oximetry and the heart rate using the Classic-120 Multiparameter® monitor (Hamburg,. Combined spinal and epidural anaesthesia for an elective. Caesarean section in a patient with achondroplasia. Rukewe A, Consultant Anaesthetist. Department of Anaesthesia, University ...

  15. Coping with the Economic Order through the Big Mac

    Science.gov (United States)

    Akenson, James E.

    1977-01-01

    Describes an economic education unit for use in the elementary classroom which employs a case study of McDonalds hamburger chain to teach students about multinational corporations, mass production, standardization, advertising, and capital investment. For journal availability, see SO 505 448. (Author/DB)

  16. Die invloed van klimaatverandering op die Suid-Afrikaanse stad en ...

    African Journals Online (AJOL)

    The purpose of this article is to research the effect of climate change on the. South African city and .... storms. Die toename in temperatuur veroorsaak ook ʼn meer intense. Stedelike Hitte-Eiland (SHE)-effek. Die SHE-effek word veroorsaak deur die absorpsie van sonlig deur ..... European Centre Model Hamburg Version 4.

  17. Fighting Cholera One-on-One: The Development and Efficacy of Multivalent Cholera-Toxin-Binding Molecules

    NARCIS (Netherlands)

    Zuilhof, H.

    2016-01-01

    A series of diseases, ranging from cholera via travelers’ diarrhea to hamburger disease, are caused by bacterially produced toxic proteins. In particular, a toxic protein unit is brought into the host cell upon binding to specific membrane-bound oligosaccharides on the host cell membrane. For

  18. Untitled

    African Journals Online (AJOL)

    Salmonella ssp were not isolated from the samples bought at the three sampling sites. Khebab samples from sites were contaminated with E. coli, other gram- ..... 0157:H7 infections: insights into the infec- tious dose and method of widespread eon- tamination of hamburger patties. Epidemic! Infect 1999; 122: 185-197.

  19. WA18

    CERN Multimedia

    1977-01-01

    Front view. The target plates are cut from marble (3x3 m slabs surrounded by magnetized iron) and allow the use of the calorimeter as a muon polarimeter. WA18 was CHARM, the experiment of the CERN-Hamburg-Amsterdam-Rome(INFN)-Moskow(ITEP) Collaboration

  20. North American Jumelage ’Type Systems’

    Science.gov (United States)

    1993-10-20

    VII Tour 45-55, 5eme Etage 2, Place Jussieu 75251 Paris Cedex 05 France Email: danosglogique.jussieu.fr Valeria de Paiva Address: Computing Laboratory...ler etage Universite Paris VII 2 Place JUSSIEU 75251 PARIS CEDEX 05 France Email: ehrhardgdmi.ens.fr Berndt Farwer Address: Universitaet Hamburg FB

  1. (SSR) markers

    African Journals Online (AJOL)

    aghomotsegin

    Unknown. V. vinifera L. 1980s. Russia. Cabernet Franc. Ancient variety of France. V. vinifera L. 1890s. France. Malvasia Istriana. Ancient variety of Greece. V. vinifera L. 2000s. Italy. BиHTA. Unknown. V. vinifera L. 1980s. Bulgaria. Yan Tai No: 73. Muscat hamburg × alicante bouschet. V. vinifera L. ----. China. Beta. Unknown.

  2. [The transgenerational transmission of traumatic experiences of the Second World War over three generations--a psychoanalytical perspective].

    Science.gov (United States)

    Silke, Wiegand-Grefe; Möller, Birgit

    2012-01-01

    The paper presents some reflections on the transgenerational transmission of traumatic experiences of war and in particular bombing during Second World War. These theoretical considerations are based on a case study (family interview) deriving from the research project "Kriegskindheit im Hamburger Feuersturm" additionally illustrated and complemented with impressions based on interviews with three generations in context of the project.

  3. On the extension of the wind profile over homogeneous terrain beyond the surface boundary layer

    DEFF Research Database (Denmark)

    Gryning, Sven-Erik; Batchvarova, Ekaterina; Brümmer, B.

    2007-01-01

    Analysis of profiles of meteorological measurements from a 160 m high mast at the National Test Site for wind turbines at H phi vs phi re (Denmark) and at a 250 m high TV tower at Hamburg (Germany) shows that the wind profile based on surface-layer theory and Monin-Obukhov scaling is valid up to ...

  4. Evaluating the Role of Genetic Markers in Prostate Cancer Progression: A Multiethnic Cohort Experience

    Science.gov (United States)

    2011-10-01

    2) NO CONDITION BEEN TOLD? DATE/AGE DIAGNOSED TREATMENT/MEDICATION NAME 17. High cholesterol _____ (1) YES _____ (2) NO 18...fat for this patient population were beef steaks, cheese and cheese spreads, hamburgers and cheeseburgers, eggs, ice cream and salad dressing

  5. Big Ben on the Elbe river. Climbing a wind tower; Big Ben steht an der Elbe. Auf dem Turm einer Windkraftanlage

    Energy Technology Data Exchange (ETDEWEB)

    Wille, H.

    2004-11-01

    Non-experts tend to think that the more wind the larger the volume of power generated. However, this is not the case. The technology is highly sensitive, and wind power systems are shut off at high wind velocities in order to prevent the machinery from being ruined. The contribution describes a visit to a wind park outside Hamburg. (orig.)

  6. Integrating immigrants in today's globalized society : the example of the Portuguese community in Germany

    NARCIS (Netherlands)

    Duarte, Joana

    2007-01-01

    In the last fifty years, Germany has developed into an immigration society. In cities such as Hamburg and Bremen, the percentage of foreign born citizens has reached almost 20% of the population. Politicians, sociologists and educators often speak of the need for integration, yet claim that some

  7. WEST AFRICAN JOURNAL OF MEDICINE

    African Journals Online (AJOL)

    user1

    Diel R, Niemann S. Outcome of tuberculosis treatment in Hamburg: A survey, 1997–2001. Int J Tuberculosis. Lung Dis. 2003; 7: 124–31. 15. Groth S, Mortensen J, Lange P, Munch. EP, Sorensen PG, Rossing N. Imaging of airways of bronchoscintigraphy for the study of mucociliary clearance. Thoarx 1988; 48: 360–365. 16.

  8. Uncovertebral joint injury in cervical facet dislocation: the headphones sign

    Energy Technology Data Exchange (ETDEWEB)

    Palmieri, Francesco; Cassar-Pullicino, Victor N.; Dell' Atti, Claudia; Lalam, Radhesh K.; Tins, Bernhard J.; Tyrrell, Prudencia N.M.; McCall, Iain W. [Robert Jones and Agnes Hunt Orthopaedic and District Hospital, Department of Radiology, Oswestry, England (United Kingdom)

    2006-06-15

    The purpose of our study is to demonstrate the uncovertebral mal-alignment as a reliable indirect sign of cervical facet joint dislocation. We examined the uncovertebral axial plane alignment of 12 patients with unilateral and bilateral cervical facet joint dislocation (UCFJD and BCFJD, respectively), comparing its frequency to the reverse hamburger bun sign on CT and MR axial images. Of the seven cases with BCFJD, five clearly demonstrated the diagnostic reverse facet joint hamburger bun sign on CT and MR images, but in two cases this sign was not detectable. In the five cases with UCFJD, four demonstrated the reverse hamburger bun sign on both CT and MRI. In one case the reverse hamburger bun sign was not seen adequately with either image modality, but the facet dislocation was identified on sagittal imaging. The uncovertebral mal-alignment was detected in all 12 cases. Normally, the two components of the uncovertebral joint enjoy a concentric relationship that in the axial plane is reminiscent of the relationship of headphones with the wearer's head. We name this appearance the 'headphones' sign. Radiologists should be aware of the headphones sign as a reliable indicator of facet joint dislocation on axial imaging used in the assessment of cervical spine injuries. (orig.)

  9. 47{sup th} Annual meeting on nuclear technology (AMNT 2016). Key topic / Enhanced safety and operation excellence

    Energy Technology Data Exchange (ETDEWEB)

    Traichel, Anke [NUKEM Technologies Engineering Services GmbH, Alzenau (Germany). Dept. of Safety Engineering and Assessment / Proposals Engineering

    2017-04-15

    Summary report on the Key Topic ''Enhanced Safety and Operation Excellence'' Technical Session ''Safety, IT, Hazards and PSA'' of the 47th Annual Meeting on Nuclear Technology (AMNT 2016) held in Hamburg, 10 to 12 May 2016.

  10. Ontwikkeling van de sojateelt in Noord Nederland

    NARCIS (Netherlands)

    Timmer, R.D.; Visser, de C.L.M.

    2014-01-01

    In Europa wordt voor non-GMO soja een premie betaald van zo'n 150 euro per ton. Dit geldt voor soja voor de humane voeding zoals sojadrinks en vleesvervangers. Het volume van deze markt is beperkt, maar in Hamburg staat een fabriek die graag Nederlandse soja koopt terwijl inmiddels ook een

  11. Sport und soziale Integration

    OpenAIRE

    Hofmann, Jürgen

    2012-01-01

    Sport und soziale Integration : Chancen, Probleme und Perspektiven für Städte und Kommunen ; Tagungsband der gleichnamigen Tagung am 28. und 29. Juni 2011 in Augsburg / Helmut Altenberger ... (Hrsg.). - Hamburg : Feldhaus, Ed. Czwalina, 2012. - 104 S. - (Sportwissenschaft und Sportpraxis ; 161)

  12. Can the Teddy Bear Speak?

    Science.gov (United States)

    Nieuwenhuys, Olga

    2011-01-01

    One of the most perplexing aspects of global childhood is how its material culture emerges, circulates, takes on hegemonic traits and becomes contested. Though debates around the impact and nature of globalization have tended to take such artefacts as McDonald's hamburgers and the Islamic veil as signifiers of the possible emergence of a global…

  13.  Zwischen Mission und Markt - Ansgars Kirchen im Norden

    DEFF Research Database (Denmark)

    Dobat, A.S.

    2012-01-01

    Abstract: Between Mission and Market – Ansgar’s Churches in the North. An Interdisciplinary Examination of the Continental Mission in 9th Century Scandinavia Historic and archaeological scholarship traditionally viewed the missionary endeavours of the Archbishopric of Hamburg-Bremen in Scandinavi...

  14. Catastrophe or psychosis; The greenhouse problem faces a solution. Katastrophe oder Psychose; Treibhausraetsel vor der Loesung

    Energy Technology Data Exchange (ETDEWEB)

    Gerdes, A.

    1994-02-01

    The article gives a state-of-the-art report on climate research into the anthropogenic greenhouse effect. In particular, recent findings of coupled circulation models of the Max Planck Institute of Meteorology, Hamburg, are presented as well as analyses of drill cares from Greenland which will provide information on climate changes during the past 150000 years. (KW)

  15. C3I and Modelling and Simulation (M&S) Interoperability

    Science.gov (United States)

    2004-03-01

    Building up a Common Data Infrastructure, 2002 [9] Smith, Barry: Aristoteles 2002in T. Buchheim, H. Flashar, R. A. H. King (eds.): “Kann man heute noch...etwas anfangen mit Aristoteles ?”, Meiner, Hamburg: 2003, pp. 3-38. [10] Gates, Ray: Metadata Standards, Presentation to IRMAC Metadata SIG, Toronto

  16. COST SAVING WITH ULTRASONOGRAPHY IN A DEVELOPING ...

    African Journals Online (AJOL)

    1999-05-05

    May 5, 1999 ... under the Progamme of Science, Research and Development. STD 111 (Science and Technology for Development nr. TS3. - CT 94 - 0330) and Glaxo, Wellcome, Hamburg, Germany. REFERENCES. Margulis, A.R. Radiologic imaging: Changing cost, greater benefits (Whitehouse Lecture). Amer. J. Radiol.

  17. Dicty_cDB: Contig-U04959-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available WIN1138.C21_J22 Muscat Hamburg pre-veraison berry... 46 1.4 1 ( CN762051 ) ID0AAA3CB05FM1 ApMS Acyrthosipho...19, forw... 46 1.4 1 ( AG529901 ) Mus musculus molossinus DNA, clone:MSMg01-439J07.... 46 1.4 1 ( EC990114 )

  18. Dicty_cDB: Contig-U14382-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 1 ) 201867 Tomato MboI BAC Library Solanum lycopersic... 46 1.0 1 ( EC978923 ) WIN109.C21_F11 Muscat Hambu...rg post-veraison peric... 46 1.0 1 ( AY528560 ) Spiroplasma kunkelii strain CR2-3x

  19. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Volume 69 Issue 6 December 2007 pp 1089-1092 Simulation and Reconstruction. Software for the international linear collider: Simulation and reconstruction frameworks · Ties Behnke Frank Gaede DESY Hamburg · More Details Abstract Fulltext PDF. Software plays an increasingly important role already in the early stages ...

  20. Event reconstruction with MarlinReco at the International Linear ...

    Indian Academy of Sciences (India)

    This package includes a full set of modules for event reconstruction based on the particle flow approach. The status of the software is reviewed and recent results using this software package for event reconstruction are presented. Author Affiliations. O Wendt1 F Gaede1 T Krämer1. DESY, 22603 Hamburg, Germany ...

  1. Dicty_cDB: Contig-U11149-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ... 40 0.054 4 ( AM460044 ) Vitis vinifera contig VV78X092507.10, whole genom... 38 0.069 2 ( EC988264 ) WIN1133.C21_D13 Muscat Hambu...rg pre-veraison berry... 38 0.078 2 ( CP000498 ) Pichia stipitis CBS 6054 chromosom

  2. Philosophische Begleitung für Suche nach »Gottesteilchen«

    CERN Multimedia

    2007-01-01

    Berlin_Der designierte Generaldirektor des europäischen Zentrums für Teilchenphysik CERN in Genf, Rolf-Dieter Heuer, will die Suche nach dem mysteriösen Higgs-Teilchen philosophisch begleiten lassen. Der Dialog zwischen Naturwissenschaftlern und Philosophen sei wichtig, sagte der Hamburger Experimentalphysiker am Montag im Deutschlandradio Kultur.

  3. The E166 experiment: Development of an undulator-based ...

    Indian Academy of Sciences (India)

    5DESY, Hamburg, Germany. 6DESY, Zeuthen, Germany. 7Humboldt University, Germany. 8Princeton University, USA. 9SLAC, USA. 10University of Tel Aviv, Israel. 11University of Tennessee, USA. ∗E-mail: karim.laihem@desy.de. Abstract. A longitudinal polarized positron beam is foreseen for the international linear.

  4. editorial emerging alternatives to allogeneic blood transfusions

    African Journals Online (AJOL)

    3. Chan K. Blood Supply: FDA Oversight and Remaining Issues of. Safety. Washington DC, US General Accounting Office, 1997. 4. Steward W.P. Considerations in the use of blood transfusions in anaemic cancerpatients. Monograph of the l 5 International Cancer. Congress, Saturday 18 August 1990, Hamburg, Germany.

  5. Transient post-exercise hyper-perspiration of forehead area

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... were measured by ELISA using kit (adrenalin, and noradrenalin IBL Hamburg ELIZA kits). Plasma arginine vasopressin (PAVP). PAVP was determined by radioimmunoassay. Processing and storage of samples were the same as stated earlier. Plasma samples were extracted using Sep-Pack C18 cartridge ...

  6. Semifinite Bundles and the Chevalley-Weil Formula

    Indian Academy of Sciences (India)

    34

    [1] Chevalley, C. and Weil, A. and Hecke, E., ¨Uber das verhalten der integrale 1. gattung bei automorphismen des funktionenkörpers, Abh. Math. Sem. Univ. Hamburg, 10 (1934), no. 1, 358–361. [2] Deligne, P. and J. Milne, Tannakian Categories, Lectures Notes in Mathematics 900, Springer-Verlag,. Berlin-New York, 1982.

  7. Dicty_cDB: Contig-U05250-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available WIN1126.C21_N19 Muscat Hamburg pre-veraison berry... 44 8.5 1 ( EC641976 ) BHE00001891 Blastocystis hominis...8672 ) AH1143 Shanyou 523 Peanut Cotyledon cDNA Library ... 44 8.5 1 ( EC986143 )

  8. Dicty_cDB: Contig-U05050-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available um ge... 44 8.8 1 ( EK327581 ) 1095467011863 Global-Ocean-Sampling_GS-31-01-01-1... 44 8.8 1 ( EC980572 ) WIN1110.C21_C22 Muscat Hamb...urg pre-veraison berry... 44 8.8 1 ( EB330357 ) CNSN01-F-135218-501 Normalized CNS

  9. A bright light for Europe

    Science.gov (United States)

    Horiuchi, Noriaki

    2017-10-01

    Following eight years of construction, the superconducting European X-ray free-electron laser in Hamburg, Germany has just opened and started its first experiments. Nature Photonics spoke to Thomas Tschentscher, its scientific director, about the facility and its plans.

  10. Paul Johansen (1901-1965), Hanse- und Osteuropahistoriker. Bemerkungen zu einer neuen Publikation / Hugo Veczerka

    Index Scriptorium Estoniae

    Veczerka, Hugo

    2012-01-01

    Tallinnas sündinud, siin toomkoolis käinud ja hiljem Tallinna Linnaarhiivis töötanud taani päritolu Eesti ja Saksa ajaloolasest. Frank Golczewski artikli ilmumise puhul kogumikus "100 years of historical research in Hamburg"

  11. Hesburger asub ründama, McDonalds teeb kaevikuid / Andres Reimer

    Index Scriptorium Estoniae

    Reimer, Andres

    2005-01-01

    Hesburger tahab Eestis oma restoranide hulka kolmekordistada. McDonald's Eestis ei laiene, kuid kavatseb ettevõtte efektiivsust suurendada. Eesti hamburgerirestoranide kett Nehatu on konkurentsist välja langenud. Tabelid: Tulemused; Hamburgerirestoranid Eestis; Hamburger ja McDonald's maailmas. Lisad: Hakkas Hesburgeri partneriks; Hakka McDonald'si partneriks

  12. Response of the Atlantic overturning circulation to South Atlantic sources of buoyancy

    NARCIS (Netherlands)

    Weijer, W.; Ruijter, W.P.M. de; Sterl, A.; Drijfhout, S.

    2001-01-01

    The heat and salt input from the Indian to Atlantic Oceans by Agulhas Leakage is found to influence the Atlantic overturning circulation in a low-resolution Ocean General Circulation Model. The model used is the Hamburg Large-Scale Geostrophic (LSG) model, which is forced by mixed boundary

  13. alpha- and beta-diversity in moth communities in salt marshes is driven by grazing management

    NARCIS (Netherlands)

    Rickert, C.; Fichtner, A.; van Klink, R.; Bakker, J. P.

    This study evaluates the effects of long-term sheep grazing in salt marshes on the diversity of moths and derives conclusive management suggestions for the conservation of invertebrate diversity in salt marshes. Study sites were located on the Hamburger Hallig, on the Western coast of

  14. [Julia Rosche. Zwischen den Fronten. Die Rolle Estlands zwischen dem Hitler-Stalin-Pakt und dem Ende des Zweiten Weltkriegs im internationalen Kontext] / Olaf Mertelsmann

    Index Scriptorium Estoniae

    Mertelsmann, Olaf, 1969-

    2014-01-01

    Arvustus: Rosche, Julia. Zwischen den Fronten. Die Rolle Estlands zwischen dem Hitler-Stalin-Pakt und dem Ende des Zweiten Weltkriegs im internationalen Kontext. Diplomica Verlag. Hamburg 2012. Unter demselben Titel mit identischem Text auch: Grin Verlag. München 2013

  15. Language ideologies and the politics of language in post- colonial ...

    African Journals Online (AJOL)

    Kate H

    Africa as well, like operating professional foreign language teaching and learning through a familiar medium of .... institutions of higher learning in Berlin, Leipzig, Hamburg, and Vienna since the turn of the. 20th century at the ..... Another deep sociolinguistic divide is that between standard languages and non-standardised.

  16. 48 CFR 846.408-71 - Waiver of USDA inspection and specifications.

    Science.gov (United States)

    2010-10-01

    ... or prefabricated meats, e.g., pork chops, hamburger, are considered meats, not meat food products. (5...). (3) Sausage. (4) Meat food products*. * “Meat food products” means processed foods containing meat in... the grade specified herein. (2) Sausage and meat food products.* (i) This product must be a high...

  17. Wind climate from the regional climate model REMO

    DEFF Research Database (Denmark)

    Larsén, Xiaoli Guo; Mann, Jakob; Berg, Jacob

    2010-01-01

    Selected outputs from simulations with the regional climate model REMO from the Max Planck Institute, Hamburg, Germany were studied in connection with wind energy resource assessment. It was found that the mean wind characteristics based on observations from six mid-latitude stations are well...

  18. Inter-regional spillovers of seaports: the case of North-West Europe

    NARCIS (Netherlands)

    Merk, O.M.; Manshanden, W.J.J.; Dröes, M.I.

    2013-01-01

    This article describes the inter-regional spillover of seaports by assessing four large ports in Northwest Europe: Rotterdam, Antwerp, Hamburg and Le Havre. The authors disaggregate national input/output-tables to the level of the functional port area and calculate the relevant Leontief multipliers

  19. Zoological researches in Liberia. A list of Birds, collected by the Author and Mr. F. X. Stampfli during their last sojourn in Liberia

    NARCIS (Netherlands)

    Büttikofer, J.

    1888-01-01

    As I told in my previous paper on Liberian Ornithology ¹), Mr. Stampfli and I left for Liberia at the end of October 1886, and arrived at Monrovia, after short stays at Hamburg, Madeira, Teneriffa, Gran Canaria and the Senegal, on the 26th of November. The next day I proceeded in an open sailing

  20. New system for production of reactor medical radionuclides tested with Lu-176

    Czech Academy of Sciences Publication Activity Database

    Seifert, Daniel; Kropáček, Martin; Tomeš, Marek; Kučera, Jan; Lebeda, Ondřej

    2015-01-01

    Roč. 42, S (2015), s. 857-857 ISSN 1619-7070. [28th Annual congress of the European-Association-of-Nuclear-Medicine (EANM). 10.10.2015-14.10.2015, Hamburg] R&D Projects: GA MŠk(CZ) LM2011019 Institutional support: RVO:61389005 Keywords : Lu-177 * radionuclides * reactor Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders