Analysis of haloacetic acids, bromate, and dalapon in natural waters by ion chromatography-tandem mass spectrometry.

Science.gov (United States)

Wu, Shimin; Anumol, Tarun; Gandhi, Jay; Snyder, Shane A

2017-03-03

The addition of oxidants for disinfecting water can lead to the formation of potentially carcinogenic compounds referred to as disinfection byproducts (DBPs). Haloacetic acids (HAAs) are one of the most widely detected DBPs in US water utilities and some of them are regulated by the US Environmental Protection Agency (USEPA). The present study developed a method to analyze all the compounds in the USEPA method 557 (nine HAAs, bromate and dalapon) plus four potentially more toxic iodinated HAAs in water by coupling ion chromatography with tandem mass spectrometry (IC-MS/MS). This aqueous direct injection method has significant advantages over traditional GC methods, which require a derivatization and sample extraction that are laborious, time-consuming, and can negatively impact reproducibility. The method developed in this study requires half the time of the current USEPA method 557 on IC-MS/MS while including more compounds and achieving sub-μg/L level method detection limits (MDLs) for all 15 target analytes. The single laboratory lowest concentration minimum reporting level (LCMRL) has also been determined in reagent water, which ranged from 0.011 to 0.62μg/L for the analytes. The mean recoveries of the analytes during matrix spike recovery tests were 77-125% in finished drinking water and 81-112% in surface water. This method was then applied to untreated, chlorinated, and chloraminated groundwater and surface water samples. Bromate and 9 HAAs were detected at different levels in some of these samples. Copyright © 2017 Elsevier B.V. All rights reserved.

Occurrence and Determination of Haloacetic Acids in Metro Manila Drinking Water

Directory of Open Access Journals (Sweden)

Irene B. Rodriguez

2009-12-01

Full Text Available Haloacetic acids are found in chlorinated water with high organic matter content. An analytical method based on a US EPA method for measuring these compounds in water is described. The optimized method used diethyl ether as extraction solvent with sulphuric acid-methanol as esterification agent and subsequent detection by gas chromatography-electron capture detection. Evaluation of this method showed that it was linear in the concentration range of 10 to 150 µg L-1 and the method detection limits were from 17 to 57 µg L-1. Although the method demonstrated low recoveries (16 to 43%, it is useful in the quantitative determination of monochloroacetic acid as well as the qualitative determination of other haloacetic acids in water. Drinking water samples taken from different areas in Metro Manila serviced by the local treatment plants were analysed using the method. Monochloroacetic acid, monobromoacetic acid, and bromochloroacetic acid were detected in these samples. Monochloroacetic acid was quantified and found in concentrations ranging from 19 to 157 µg L-1. In most of the water samples, the concentration of monochloroacetic acid exceeded the US EPA maximum allowable total concentration of 60 µg L-1 for the five haloacetic acids (monochloro-, dichloro-, trichloro-, monobromo-, and dibromoacetic acids in drinking water. This initial study established the occurrence of potentially harmful haloacetic acids in the local drinking water supplies.

The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

Science.gov (United States)

Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

2017-01-13

The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

International Nuclear Information System (INIS)

Ge, Fei; Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin

2011-01-01

The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L -1 iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L -1 manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH) 3(am) or MnO 2(am) coat the algal cells , which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

Effects of iron and manganese on the formation of HAAs upon chlorinating Chlorella vulgaris

Energy Technology Data Exchange (ETDEWEB)

Ge, Fei, E-mail: gefei@xtu.edu.cn [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China); Wu, Xiuzhen; Wang, Na; Zhu, Runliang; Wang, Tong; Xu, Yin [Department of Environmental Science and Engineering, Xiangtan University, Egongtang Road, Xiangtan, Hunan 411105 (China)

2011-05-15

The major objective of the present study was to investigate the role of iron and manganese on the formation of haloacetic acids (HAAs) when algae are chlorinated at different pHs. The results showed that both iron and manganese can reduce the yields of dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA) on chlorinating green alga Chlorella vulgaris (C. vulgaris) at a pH range of 6.0-9.0, and the decline of DCAA and TCAA was shown to be more significant at the low pH range. At pH 6.0, DCAA and TCAA yields decreased by 44.5% and 57.3%, respectively with the addition of 0.5 mg L{sup -1} iron, and decreased 39.5% and 49.4%, respectively with the addition of 0.5 mg L{sup -1} manganese. The main reason for decreasing the yields of HAAs as shown by scanning electron microscope (SEM) is that Fe(OH){sub 3(am)} or MnO{sub 2(am)} coat the algal cells{sub ,} which then improves their agglomeration of algal cells which is also revealed by the laser particle size analysis (LPSA).

Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

Energy Technology Data Exchange (ETDEWEB)

Sun Yingxue; Wu Qianyuan [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Hu Hongying, E-mail: hyhu@tsinghua.edu.cn [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China); Tian Jie [Environmental Simulation and Pollution Control State Key Joint Laboratory, Department of Environmental Science and Engineering, Tsinghua University, Beijing 100084 (China)

2009-09-15

Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

Effects of operating conditions on THMs and HAAs formation during wastewater chlorination

International Nuclear Information System (INIS)

Sun Yingxue; Wu Qianyuan; Hu Hongying; Tian Jie

2009-01-01

Disinfection is the last barrier of wastewater reclamation process to protect ecosystem safety and human health. However, the chlorination process results in the formation of mutagenic/carcinogenic disinfection by-products (DBPs) deriving from the reaction of the chlorine with organic compounds in wastewater. The effects of operating conditions (chlorine dose, contact time, reaction temperature and pH value) of chlorination on the formation of trihalomethanes (THMs) and haloacetic acids (HAAs) in biologically treated wastewater samples were investigated in this study. The results indicated that the total THMs (TTHM) and total HAAs (THAA) increased exponentially with increasing chlorine dose, but there are discrepancies between the formation rates of TTHM and THAA. The THAA reached a peak at contact time of 2 h and thereafter decreased with extended time. The formation time of THMs depends on the wastewater content of quick or slow formers. The yields of bromated HAAs (as MBAA, BCAA, and BDCAA) would decrease markedly after the contact time over 2 h during wastewater chlorination, and were favored in low pH values of 4 and high pH values of 9 under certain contact time. In addition, the formation of MBAA, BCAA, BDCAA decreased gradually as reaction temperature increased from 4 to 30 deg. C in the chlorination of wastewater containing a certain concentration of bromide. The effects of operating conditions on THMs and HAAs formation during wastewater chlorination were completely different from those of surface water disinfection.

Pyruvate remediation of cell stress and genotoxicity induced by haloacetic acid drinking water disinfection by-products.

Science.gov (United States)

Dad, Azra; Jeong, Clara H; Pals, Justin A; Wagner, Elizabeth D; Plewa, Michael J

2013-10-01

Monohaloacetic acids (monoHAAs) are a major class of drinking water disinfection by-products (DBPs) and are cytotoxic, genotoxic, mutagenic, and teratogenic. We propose a model of toxic action based on monoHAA-mediated inhibition of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a target cytosolic enzyme. This model predicts that GAPDH inhibition by the monoHAAs will lead to a severe reduction of cellular ATP levels and repress the generation of pyruvate. A loss of pyruvate will lead to mitochondrial stress and genomic DNA damage. We found a concentration-dependent reduction of ATP in Chinese hamster ovary cells after monoHAA treatment. ATP reduction per pmol monoHAA followed the pattern of iodoacetic acid (IAA) > bromoacetic acid (BAA) > chloroacetic acid (CAA), which is the pattern of potency observed with many toxicological endpoints. Exogenous supplementation with pyruvate enhanced ATP levels and attenuated monoHAA-induced genomic DNA damage as measured with single cell gel electrophoresis. These data were highly correlated with the SN 2 alkylating potentials of the monoHAAs and with the induction of toxicity. The results from this study strongly support the hypothesis that GAPDH inhibition and the possible subsequent generation of reactive oxygen species is linked with the cytotoxicity, genotoxicity, teratogenicity, and neurotoxicity of these DBPs. Copyright © 2013 Wiley Periodicals, Inc.

Advanced oxidation processes of decomposing dichloroacetic acid and trichloroacetic acid in water

Institute of Scientific and Technical Information of China (English)

WANG Kun-ping; GUO Jin-song; YANG Min; JUNJI Hirotsuji; DENG Rong-sen; LIU Wei

2008-01-01

We studied the decomposition of two haloacetic acids (HAAs), dichloroacetic acid (DCAA) and trichloroacetic acid (TCAA), in water by single oxidants ozone (O3) and ultraviolet radiation (UV) and the advanced oxidation processes (AOPs) constituted by the combinations of O3/UV, H2O2/UV, O3 /H2O2, and O3/H2O2/UV. The concentrations of HAAs were analyzed at specified time intervals to track their decomposition. Except for O3 and UV, the four combined oxidation processes remarkably enhance the decomposition of DCAA and TCAA owing to the generated very reactive hydroxyl radicals. The fastest decomposition process is O3/H2O2/UV, closely followed by O3/UV. DCAA is much easier to decompose than TCAA. The kinetics of HAA decomposition by O3/UV can be described well by a pseudo first-order reaction model under a constant initial dissolved O3 concentration and fixed UV radiation. Humic acids and HCO3- in the reaction system both decrease the decomposition rate constants for DCAA and TCAA. The amount of H2O2 accumulates in the presence of humic acids in the O3/UV process.

Casein Kinase I Isoform Hrr25 Is a Negative Regulator of Haa1 in the Weak Acid Stress Response Pathway in Saccharomyces cerevisiae.

Science.gov (United States)

Collins, Morgan E; Black, Joshua J; Liu, Zhengchang

2017-07-01

Haa1 is a transcription factor that adapts Saccharomyces cerevisiae cells to weak organic acid stresses by activating the expression of various genes. Many of these genes encode membrane proteins, such as TPO2 and YRO2 How Haa1 is activated by weak acids is not clear. Here, we show that casein kinase I isoform Hrr25 is an important negative regulator of Haa1. Haa1 is known to be multiply phosphorylated. We found that mutations in HRR25 lead to reduced Haa1 phosphorylation and increased expression of Haa1 target genes and that Hrr25 interacts with Haa1. The other three casein kinase I isoforms, Yck1, Yck2, and Yck3, do not seem to play critical roles in Haa1 regulation. Hrr25 has a 200-residue C-terminal region, including a proline- and glutamine-rich domain. Our data suggest that the C-terminal region of Hrr25 is required for normal inhibition of expression of Haa1 target genes TPO2 and YRO2 and is important for cell growth but is not required for cell morphogenesis. We propose that Hrr25 is an important regulator of cellular adaptation to weak acid stress by inhibiting Haa1 through phosphorylation. IMPORTANCE Our study has revealed the casein kinase I protein Hrr25 to be a negative regulator of Haa1, a transcription factor mediating the cellular response to stresses caused by weak acids. Many studies have focused on the target genes of Haa1 and their roles in weak acid stress responses, but little has been reported on the regulatory mechanism of Haa1. Weak acids, such as acetic acid, have long been used for food preservation by slowing down the growth of fungal species, including S. cerevisiae In the biofuel industry, acetic acid in the lignocellulosic hydrolysates limits the production of ethanol, which is undesirable. By understanding how Haa1 is regulated, we can make advances in the field of food sciences to better preserve food and engineer acetic acid-resistant strains that will increase productivity in the biofuel industry. Copyright © 2017 American

Avoiding pitfalls in the determination of halocarboxylic acids: the photochemistry of methylation.

Science.gov (United States)

Rubio, F J; Urbansky, E T; Magnuson, M L

2000-06-01

Haloethanoic (haloacetic) acids are formed during chlorination of drinking water and are regulated by the Environmental Protection Agency (EPA). These compounds are normally quantified by gas chromatography with electron capture detection (GC-ECD) as the methyl esters. EPA Method 552 uses diazomethane (CH2N2) for this purpose, but has only been validated by EPA for HAA6: chloro-, dichloro-, bromo-, dibromo-, bromochloro- and trichloroacetic acids. EPA Method 552.2 was developed and validated for all nine analytes (HAA9 = HAA6 + dibromochloro-, bromodichloro- and tribromoethanoic acids). Since the promulgation of Method 552.2, which uses acidic methanol, a debate has ensued over discrepancies observed by various laboratories when using diazomethane instead. In an effort to identify and eliminate potential sources for these discrepancies, a comparative study was undertaken for HAA9. Better accuracy and precision were observed for all HAA9 species by Method 552.2; recoveries were satisfactory in de-ionized and tap water. Method 552 remains satisfactory for HAA6. Systematic differences in instrumental response are observed for the two methods, but these are precise and may be accounted for using similarly treated standards and analyte-fortified (spiked) samples. That notwithstanding, Method 552 (CH2N2) was shown to be unsuitable for dibromochloro-, bromodichloro- and tribromoethanoic acids (HAA9-6). The primary problem appears to be a photoactivated reaction between diazomethane and the HAA9-6 analytes; however, side reactions were found to occur even in the dark. Analyte loss is most pronounced under typical laboratory lighting (white F40 fluorescent lamps + sunlight), but it is also observed under Philips gold F40 lamps (lambda > or = 520 nm), and in the dark.

Improved ethanol production from xylose in the presence of acetic acid by the overexpression of the HAA1 gene in Saccharomyces cerevisiae.

Science.gov (United States)

Sakihama, Yuri; Hasunuma, Tomohisa; Kondo, Akihiko

2015-03-01

The hydrolysis of lignocellulosic biomass liberates sugars, primarily glucose and xylose, which are subsequently converted to ethanol by microbial fermentation. The rapid and efficient fermentation of xylose by recombinant Saccharomyces cerevisiae strains is limited by weak acids generated during biomass pretreatment processes. In particular, acetic acid negatively affects cell growth, xylose fermentation rate, and ethanol production. The ability of S. cerevisiae to efficiently utilize xylose in the presence of acetic acid is an essential requirement for the cost-effective production of ethanol from lignocellulosic hydrolysates. Here, an acetic acid-responsive transcriptional activator, HAA1, was overexpressed in a recombinant xylose-fermenting S. cerevisiae strain to yield BY4741X/HAA1. This strain exhibited improved cell growth and ethanol production from xylose under aerobic and oxygen limited conditions, respectively, in the presence of acetic acid. The HAA1p regulon enhanced transcript levels in BY4741X/HAA1. The disruption of PHO13, a p-nitrophenylphosphatase gene, in BY4741X/HAA1 led to further improvement in both yeast growth and the ability to ferment xylose, indicating that HAA1 overexpression and PHO13 deletion act by different mechanisms to enhance ethanol production. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

HAA1 and PRS3 overexpression boosts yeast tolerance towards acetic acid improving xylose or glucose consumption: unravelling the underlying mechanisms.

Science.gov (United States)

Cunha, Joana T; Costa, Carlos E; Ferraz, Luís; Romaní, Aloia; Johansson, Björn; Sá-Correia, Isabel; Domingues, Lucília

2018-04-02

Acetic acid tolerance and xylose consumption are desirable traits for yeast strains used in industrial biotechnological processes. In this work, overexpression of a weak acid stress transcriptional activator encoded by the gene HAA1 and a phosphoribosyl pyrophosphate synthetase encoded by PRS3 in a recombinant industrial Saccharomyces cerevisiae strain containing a xylose metabolic pathway was evaluated in the presence of acetic acid in xylose- or glucose-containing media. HAA1 or PRS3 overexpression resulted in superior yeast growth and higher sugar consumption capacities in the presence of 4 g/L acetic acid, and a positive synergistic effect resulted from the simultaneous overexpression of both genes. Overexpressing these genes also improved yeast adaptation to a non-detoxified hardwood hydrolysate with a high acetic acid content. Furthermore, the overexpression of HAA1 and/or PRS3 was found to increase the robustness of yeast cell wall when challenged with acetic acid stress, suggesting the involvement of the modulation of the cell wall integrity pathway. This study clearly shows HAA1 and/or, for the first time, PRS3 overexpression to play an important role in the improvement of industrial yeast tolerance towards acetic acid. The results expand the molecular toolbox and add to the current understanding of the mechanisms involved in higher acetic acid tolerance, paving the way for the further development of more efficient industrial processes.

Determination of haloacetic acids in water using layered double hydroxides as a sorbent in dispersive solid-phase extraction followed by liquid chromatography with tandem mass spectrometry.

Science.gov (United States)

Alsharaa, Abdulnaser; Sajid, Muhammad; Basheer, Chanbasha; Alhooshani, Khalid; Lee, Hian Kee

2016-09-01

In the present study, highly efficient and simple dispersive solid-phase extraction procedure for the determination of haloacetic acids in water samples has been established. Three different types of layered double hydroxides were synthesized and used as a sorbent in dispersive solid-phase extraction. Due to the interesting behavior of layered double hydroxides in an acidic medium (pH˂4), the analyte elution step was not needed; the layered double hydroxides are simply dissolved in acid immediately after extraction to release the analytes which are then directly introduced into a liquid chromatography with tandem mass spectrometry system for analysis. Several dispersive solid-phase extraction parameters were optimized to increase the extraction efficiency of haloacetic acids such as temperature, extraction time and pH. Under optimum conditions, good linearity was achieved over the concentration range of 0.05-100 μg/L with detection limits in the range of 0.006-0.05 μg/L. The relative standard deviations were 0.33-3.64% (n = 6). The proposed method was applied to different water samples collected from a drinking water plant to determine the concentrations of haloacetic acids. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

EXPOSURE TO A P13KINASE INHIBITOR PRODUCED DYSMORPHOGENESIS IN NEURULATION-STAGED MOUSE EMBRYOS IN CULTURE

Science.gov (United States)

The haloacetic acids (HAA) are a family of chemicals that are drinking water disinfection byproducts. We previously reported that bromo- and chloro-acetic acids alter embryonic development when mouse conceptuses are directly exposed to these xenobiotics in whole embryo culture. C...

Chloramination of nitrogenous contaminants (pharmaceuticals and pesticides): NDMA and halogenated DBPs formation

KAUST Repository

Le Roux, Julien; Gallard, Hervé ; Croue, Jean-Philippe

2011-01-01

Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N

Chlorination and chloramination of aminophenols in aqueous solution: oxidant demand and by-product formation.

Science.gov (United States)

Mehrez, O Abou; Dossier-Berne, F; Legube, B

2015-01-01

Chlorination and monochloramination of aminophenols (AP) were carried out in aqueous solution at 25°C and at pH 8.5. Oxidant demand and disinfection by-product formation were determined in excess of oxidant. Experiments have shown that chlorine consumption of AP was 40-60% higher than monochloramine consumption. Compared with monochloramination, chlorination of AP formed more chloroform and haloacetic acids (HAA). Dichloroacetic acid was the major species of HAA. Chloroform and HAA represented, respectively, only 1-8% and 14-15% of adsorbable organic halides (AOX) by monochloramination but up to 29% and 39% of AOX by chlorination.

Effect of NaOH on large-volume sample stacking of haloacetic acids in capillary zone electrophoresis with a low-pH buffer.

Science.gov (United States)

Tu, Chuanhong; Zhu, Lingyan; Ang, Chay Hoon; Lee, Hian Kee

2003-06-01

Large-volume sample stacking (LVSS) is an effective on-capillary sample concentration method in capillary zone electrophoresis, which can be applied to the sample in a low-conductivity matrix. NaOH solution is commonly used to back-extract acidic compounds from organic solvent in sample pretreatment. The effect of NaOH as sample matrix on LVSS of haloacetic acids was investigated in this study. It was found that the presence of NaOH in sample did not compromise, but rather help the sample stacking performance if a low pH background electrolyte (BGE) was used. The sensitivity enhancement factor was higher than the case when sample was dissolved in pure water or diluted BGE. Compared with conventional injection (0.4% capillary volume), 97-120-fold sensitivity enhancement in terms of peak height was obtained without deterioration of separation with an injection amount equal to 20% of the capillary volume. This method was applied to determine haloacetic acids in tap water by combination with liquid-liquid extraction and back-extraction into NaOH solution. Limits of detection at sub-ppb levels were obtained for real samples with direct UV detection.

Direct injection ion chromatography for the control of chlorinated drinking water: simultaneous estimation of nine haloacetic acids and quantitation of bromate, chlorite and chlorate along with the major inorganic anions.

Science.gov (United States)

Garcia-Villanova, Rafael J; Raposo Funcia, César; Oliveira Dantas Leite, M Vilani; Toruño Fonseca, Ivania M; Espinosa Nieto, Miguel; Espuelas India, Javier

2014-09-01

Most methods for the analysis of haloacetic acids published in recent years are based on ion chromatography with direct injection, employing a gradient elution with potassium hydroxide (KOH). This work reports the exploration of an alternative eluent, a buffer of sodium carbonate/sodium hydrogen carbonate, aimed at the simultaneous analysis of nine haloacetic acids along with bromate, chlorite and chlorate. The alternative of both a less alkaline eluent and a lower temperature of operation may prevent the partial decomposition of some of the haloacetic acids during the analytical process, especially the more vulnerable brominated ones. Gradient elution at temperature of 7 °C yielded the best results, with an acceptable separation of 17 analytes (which includes the major natural inorganic anions) and a good linearity. Precision ranges from 0.3 to 23.4 (% V.C.), and detection limits are within units of μg L⁻¹, except for tribromoacetic acid - somewhat high in comparison with those of the official methods. Nonetheless, with the basic instrumentation setup herein described, this method may be suitable for monitoring when the drinking water treatments are to be optimized. This is especially interesting for small communities or for developing/developed countries in which regulations on disinfection by-products others than trihalomethanes are being addressed.

Haloacetates in fog and rain.

Science.gov (United States)

Römpp, A; Klemm, O; Fricke, W; Frank, H

2001-04-01

Atmospheric haloacetates can arise from photochemical degradation of halogenated hydrocarbons and from direct anthropogenic emissions. Furthermore, there is also evidence of natural sources although these are quantitatively uncertain. As haloacetates are highly soluble in water, hydrometeors are most significant for their deposition. Fogwater (96 samples) and rainwater samples (over 100 samples) were collected from July 1998 to March 1999 at an ecological research site in northeastern Bavaria, Germany. They were analyzed for monofluoroacetate (MFA), difluoroacetate (DFA), trifluoroacetate (TFA), monochloroacetate (MCA), dichloroacetate (DCA), trichloroacetate (TCA), monobromoacetate (MBA), and dibromoacetate (DBA). The major inorganic ions were also determined. High concentrations of up to 11 microg/L MCA, 5 microg/L DCA, 2 microg/L TCA, and 2 microg/L TFA were found in fogwater associated with westerly winds. Backward trajectories were calculated to determine the origin of the air masses. MBA and DBA have highest concentrations in fogwater advected with air originating from the Atlantic, suggesting the marine origin of these two compounds. All analyzed substances show higher average concentrations in fog than in rain. Estimates of the deposition of haloacetates suggest that the contribution of fog may be more important than rain for the total burden of a forest ecosystem.

Associations Between Disinfection By-Product Exposures and Craniofacial Birth Defects.

Science.gov (United States)

Kaufman, John A; Wright, J Michael; Evans, Amanda; Rivera-Núñez, Zorimar; Meyer, Amy; Narotsky, Michael G

2018-02-01

The aim of this study was to examine associations between craniofacial birth defects (CFDs) and disinfection by-product (DBP) exposures, including the sum of four trihalomethanes (THM4) and five haloacetic acids (HAA5) (ie, DBP9). We calculated first trimester adjusted odds ratios (aORs) for different DBPs in a matched case-control study of 366 CFD cases in Massachusetts towns with complete 1999 to 2004 THM and HAA data. We detected elevated aORs for cleft palate with DBP9 (highest quintile aOR = 3.52; 95% CI: 1.07, 11.60), HAA5, trichloroacetic acid (TCAA), and dichloroacetic acid. We detected elevated aORs for eye defects with TCAA and chloroform. This is the first epidemiological study of DBPs to examine eye and ear defects, as well as HAAs and CFDs. The associations for cleft palate and eye defects highlight the importance of examining specific defects and DBPs beyond THM4.

In Vitro Cytotoxicity and Adaptive Stress Responses to Selected Haloacetic Acid and Halobenzoquinone Water Disinfection Byproducts.

Science.gov (United States)

Procházka, Erik; Escher, Beate I; Plewa, Michael J; Leusch, Frederic D L

2015-10-19

The process of disinfecting drinking water inadvertently leads to the formation of numerous disinfection byproducts (DBPs). Some of these are mutagenic, genotoxic, teratogenic, and cytotoxic, as well as potentially carcinogenic both in vivo and in vitro. We investigated the in vitro biological activity of five DBPs: three monohaloacetic acids (monoHAAs) [chloroacetic acid (CAA), bromoacetic acid (BAA), and iodoacetic acid (IAA)] and two novel halobenzoquinones (HBQs) [2,6-dichloro-p-benzoquinone (DCBQ) and 2,6-dibromo-p-benzoquinone]. We focused particularly on cytotoxicity and induction of two adaptive stress response pathways: the oxidative stress responsive Nrf2/ARE and DNA-damage responsive p53 pathways. All five DBPs were cytotoxic to the Caco-2 cell line after a 4 h exposure, and all DBPs induced both of the adaptive stress response pathways, Nrf2/ARE and p53, in the micromolar range, as measured by two β-lactamase-based reporter gene assays. The decreasing order of potency for all three endpoints for the five DBPs was IAA ∼ BAA > DCBQ ∼ DBBQ > CAA. Induction of oxidative stress was previously proposed to be the molecular initiating event (MIE) for both classes of DBPs. However, comparing the levels of activation of the two pathways uncovered that the Nrf2/ARE pathway was the more sensitive endpoint for HAAs, whereas the p53 pathway was more sensitive in the case of HBQs. Therefore, the DNA damage-responsive p53 pathway may be an important piece of information to fill in a gap in the adverse outcome pathway framework for the assessment of HBQs. Finally, we cautiously compared the potential risk of the two novel HBQs using a benchmarking approach to that of the well-studied CAA, which suggested that their relative risk may be lower than that of BAA and IAA.

Effect of drinking water disinfection by-products in human peripheral blood lymphocytes and sperm.

Science.gov (United States)

Ali, Aftab; Kurzawa-Zegota, Malgorzata; Najafzadeh, Mojgan; Gopalan, Rajendran C; Plewa, Michael J; Anderson, Diana

2014-12-01

Drinking water disinfection by-products (DBPs) are generated by the chemical disinfection of water and may pose hazards to public health. Two major classes of DBPs are found in finished drinking water: haloacetic acids (HAAs) and trihalomethanes (THMs). HAAs are formed following disinfection with chlorine, which reacts with iodide and bromide in the water. Previously the HAAs were shown to be cytotoxic, genotoxic, mutagenic, teratogenic and carcinogenic. To determine the effect of HAAs in human somatic and germ cells and whether oxidative stress is involved in genotoxic action. In the present study both somatic and germ cells have been examined as peripheral blood lymphocytes and sperm. The effects of three HAA compounds: iodoacetic acid (IAA), bromoacetic acid (BAA) and chloroacetic acid (CAA) were investigated. After determining appropriate concentration responses, oxygen radical involvement with the antioxidants, butylated hydroxanisole (BHA) and the enzyme catalase, were investigated in the single cell gel electrophoresis (Comet) assay under alkaline conditions, >pH 13 and the micronucleus assay. In the Comet assay, BHA and catalase were able to reduce DNA damage in each cell type compared to HAA alone. In the micronucleus assay, micronuclei (MNi) were found in peripheral lymphocytes exposed to all three HAAs and catalase and BHA were in general, able to reduce MNi induction, suggesting oxygen radicals play a role in both assays. These observations are of concern to public health since both human somatic and germ cells show similar genotoxic responses. Copyright © 2014. Published by Elsevier B.V.

Transports of acetate and haloacetate in Burkholderia species MBA4 are operated by distinct systems

Directory of Open Access Journals (Sweden)

Su Xianbin

2012-11-01

Full Text Available Abstract Background Acetate is a commonly used substrate for biosynthesis while monochloroacetate is a structurally similar compound but toxic and inhibits cell metabolism by blocking the citric acid cycle. In Burkholderia species MBA4 haloacetate was utilized as a carbon and energy source for growth. The degradation of haloacid was mediated by the production of an inducible dehalogenase. Recent studies have identified the presence of a concomitantly induced haloacetate-uptake activity in MBA4. This uptake activity has also been found to transport acetate. Since acetate transporters are commonly found in bacteria it is likely that haloacetate was transported by such a system in MBA4. Results The haloacetate-uptake activity of MBA4 was found to be induced by monochloroacetate (MCA and monobromoacetate (MBA. While the acetate-uptake activity was also induced by MCA and MBA, other alkanoates: acetate, propionate and 2-monochloropropionate (2MCPA were also inducers. Competing solute analysis showed that acetate and propionate interrupted the acetate- and MCA- induced acetate-uptake activities. While MCA, MBA, 2MCPA, and butyrate have no effect on acetate uptake they could significantly quenched the MCA-induced MCA-uptake activity. Transmembrane electrochemical potential was shown to be a driving force for both acetate- and MCA- transport systems. Conclusions Here we showed that acetate- and MCA- uptake in Burkholderia species MBA4 are two transport systems that have different induction patterns and substrate specificities. It is envisaged that the shapes and the three dimensional structures of the solutes determine their recognition or exclusion by the two transport systems.

Chlorodifluoroacetic acid fate and toxicity to the macrophytes Lemna gibba, Myriophyllum spicatum, and Myriophyllum sibiricum in aquatic microcosms.

Science.gov (United States)

Hanson, M L; Sibley, P K; Mabury, S A; Muir, D C; Solomon, K R

2001-12-01

Chlorodifluoroacetic acid (CDFA) is a novel haloacetic acid (HAA) and has been recently documented in aquatic systems. It is a suspected degradation product of the refrigerants 1,1,2-trichloro-1,1-difluoroethane (CFC-113) and 1-chloro-1,1-difluoroethane (HCFC-142b). Haloacetic acids can be phytotoxic, putatively acting through inhibition of the citric acid cycle. Replicate (n = 3) 12,000-L model aquatic ecosystems (microcosms) were dosed once at 0.5, 1, 5, and 20 mg/L of neutralized CDFA. Three microcosms served as controls. Each microcosm was stocked with eight individual apical shoots of both Myriophyllum spicatum and Myriophyllum sibiricum and sampled at regular intervals over a 42-d exposure period. The plants were assessed for the somatic endpoints of plant length, root growth, node number, and wet and dry mass and the biochemical endpoints of chlorophyll-a/b and carotenoid content as well as citric acid levels. The duckweed Lemna gibba was also introduced into these systems and monitored over a period of 14 d for wet/dry mass, plant/frond number, chlorophyll content, and growth rate. Concentrations of CDFA remained constant in the water column over the course of the fate investigation (241 d), indicating that this compound undergoes little, if any, degradation in aquatic systems. Results showed few statistically significant differences from controls for all three plant species with exposure to CDFA but no biologically relevant impacts. Overall, CDFA does not appear to pose any risk to these aquatic macrophytes at current environmental concentrations.

Genotoxicity of drinking water treated with different disinfectants and effects of disinfection conditions detected by umu-test.

Science.gov (United States)

Nie, Xuebiao; Liu, Wenjun; Zhang, Liping; Liu, Qing

2017-06-01

The genotoxicity of drinking water treated with 6 disinfection methods and the effects of disinfection conditions were investigated using the umu-test. The pretreatment procedure of samples for the umu-test was optimized for drinking water analysis. The results of the umu-test were in good correlation with those of the Ames-test. The genotoxicity and production of haloacetic acids (HAAs) were the highest for chlorinated samples. UV+chloramination is the safest disinfection method from the aspects of genotoxicity, HAA production and inactivation effects. For chloramination, the effects of the mass ratio of Cl 2 to N of chloramine on genotoxicity were also studied. The changes of genotoxicity were different from those of HAA production, which implied that HAA production cannot represent the genotoxic potential of water. The genotoxicity per chlorine decay of chlorination and chloramination had similar trends, indicating that the reaction of organic matters and chlorine made a great contribution to the genotoxicity. The results of this study are of engineering significance for optimizing the operation of waterworks. Copyright © 2016. Published by Elsevier B.V.

Evaluation of Drinking Water Disinfectant Byproducts Compliance Data as an Indirect Measure for Short-Term Exposure in Humans.

Science.gov (United States)

Parvez, Shahid; Frost, Kali; Sundararajan, Madhura

2017-05-20

In the absence of shorter term disinfectant byproducts (DBPs) data on regulated Trihalomethanes (THMs) and Haloacetic acids (HAAs), epidemiologists and risk assessors have used long-term annual compliance (LRAA) or quarterly (QA) data to evaluate the association between DBP exposure and adverse birth outcomes, which resulted in inconclusive findings. Therefore, we evaluated the reliability of using long-term LRAA and QA data as an indirect measure for short-term exposure. Short-term residential tap water samples were collected in peak DBP months (May-August) in a community water system with five separate treatment stations and were sourced from surface or groundwater. Samples were analyzed for THMs and HAAs per the EPA (U.S. Environmental Protection Agency) standard methods (524.2 and 552.2). The measured levels of total THMs and HAAs were compared temporally and spatially with LRAA and QA data, which showed significant differences ( p water stations showed higher levels than LRAA or QA. Significant numbers of samples in surface water stations exceeded regulatory permissible limits: 27% had excessive THMs and 35% had excessive HAAs. Trichloromethane, trichloroacetic acid, and dichloroacetic acid were the major drivers of variability. This study suggests that LRAA and QA data are not good proxies of short-term exposure. Further investigation is needed to determine if other drinking water systems show consistent findings for improved regulation.

Evidence of arsenic release promoted by disinfection by-products within drinking-water distribution systems.

Science.gov (United States)

Andra, Syam S; Makris, Konstantinos C; Botsaris, George; Charisiadis, Pantelis; Kalyvas, Harris; Costa, Costas N

2014-02-15

Changes in disinfectant type could trigger a cascade of reactions releasing pipe-anchored metals/metalloids into finished water. However, the effect of pre-formed disinfection by-products on the release of sorbed contaminants (arsenic-As in particular) from drinking water distribution system pipe scales remains unexplored. A bench-scale study using a factorial experimental design was performed to evaluate the independent and interaction effects of trihalomethanes (TTHM) and haloacetic acids (HAA) on arsenic (As) release from either scales-only or scale-biofilm conglomerates (SBC) both anchored on asbestos/cement pipe coupons. A model biofilm (Pseudomonas aeruginosa) was allowed to grow on select pipe coupons prior experimentation. Either TTHM or HAA individual dosing did not promote As release from either scales only or SBC, detecting water. In the case of scales-only coupons, the combination of the highest spike level of TTHM and HAA significantly (pwater in pipe networks remains to be investigated in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

Humic Acid Degradation by ZnO Photocatalyst

Directory of Open Access Journals (Sweden)

Sekartaji Putri A.

2016-01-01

Full Text Available Humic acid (HA is universally present in soils and natural water resources in a yellow-brown form. HA can react with chlorine during drinking water treatment and produce disinfection byproducts (DBPs, such as trihalomethanes (THMs and haloacetic acids (HAAs, which are harmful for health. Therefore, HA has to be eliminated from water environment. The photocatalysis is an effective alternative solution for the degradation of HA in a water environment. This research aims to degrade HA from water environment. The rapid degradation of HA, using zinc oxide nanoparticles, irradiated by ultraviolet light (ZnO/UV, is investigated. The optimum conditions of pertinent factors, which include the light wavelength (UV-A and UV-C, and light intensity, HA concentration, ZnO dose, and contact time are investigated at neutral pH conditions, considered for drinking water treatment. HA degradation efficiency reached more than 80% after 60 min for both types of irradiation in optimum conditions of 0.3 g/L ZnO dose in 180 min of contact time. Comparisons for degradation efficiency under UV-A and UV-C irradiation indicate that UV-C has higher efficiency, up to 150 min of contact time. The reusability of catalyst is performed for three reuses and still revealed effective for beneficial commercial applications.

Disinfection byproduct formation in drinking water sources: A case study of Yuqiao reservoir.

Science.gov (United States)

Zhai, Hongyan; He, Xizhen; Zhang, Yan; Du, Tingting; Adeleye, Adeyemi S; Li, Yao

2017-08-01

This study investigated the potential formation of disinfection byproducts (DBPs) during chlorination and chloramination of 20 water samples collected from different points of Yuqiao reservoir in Tianjin, China. The concentrations of dissolved organic matter and ammonia decreased downstream the reservoir, while the specific UV absorbance (SUVA: the ratio of UV 254 to dissolved organic carbon) increased [from 0.67 L/(mg*m) upstream to 3.58 L/(mg*m) downstream]. The raw water quality played an important role in the formation of DBPs. During chlorination, haloacetic acids (HAAs) were the major DBPs formed in most of the water samples, followed by trihalomethanes (THMs). CHCl 3 and CHCl 2 Br were the major THM species, while trichloroacetic acid (TCAA) and dichloroacetic acid (DCAA) were the major HAA species. Chloramination, on the other hand, generally resulted in lower concentrations of THMs (CHCl 3 ), HAAs (TCAA and DCAA), and haloacetonitriles (HANs). All the species of DBPs formed had positive correlations with the SUVA values, and HANs had the highest one (R 2  = 0.8). The correlation coefficients between the analogous DBP yields and the SUVA values in chlorinated samples were close to those in chloraminated samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

Monte-Carlo and multi-exposure assessment for the derivation of criteria for disinfection byproducts and volatile organic compounds in drinking water: Allocation factors and liter-equivalents per day.

Science.gov (United States)

Akiyama, Megumi; Matsui, Yoshihiko; Kido, Junki; Matsushita, Taku; Shirasaki, Nobutaka

2018-06-01

The probability distributions of total potential doses of disinfection byproducts and volatile organic compounds via ingestion, inhalation, and dermal exposure were estimated with Monte Carlo simulations, after conducting physiologically based pharmacokinetic model simulations to takes into account the differences in availability between the three exposures. If the criterion that the 95th percentile estimate equals the TDI (tolerable daily intake) is regarded as protecting the majority of a population, the drinking water criteria would be 140 (trichloromethane), 66 (bromodichloromethane), 157 (dibromochloromethane), 203 (tribromomethane), 140 (dichloroacetic acid), 78 (trichloroacetic acid), 6.55 (trichloroethylene, TCE), and 22 μg/L (perchloroethylene). The TCE criterion was lower than the Japanese Drinking Water Quality Standard (10 μg/L). The latter would allow the intake of 20% of the population to exceed the TDI. Indirect inhalation via evaporation from water, especially in bathrooms, was the major route of exposure to compounds other than haloacetic acids (HAAs) and accounted for 1.2-9 liter-equivalents/day for the median-exposure subpopulation. The ingestion of food was a major indirect route of exposure to HAAs. Contributions of direct water intake were not very different for trihalomethanes (30-45% of TDIs) and HAAs (45-52% of TDIs). Copyright © 2018 Elsevier Inc. All rights reserved.

Concentración de trihalometanos y de ácidos haloacéticos en el agua de consumo y estimación de su ingesta durante el embarazo en la cohorte INMA-Guipúzcoa (España Trihalomethane and haloacetic acid concentrations in drinking water and their estimated intake during pregnancy in the INMA cohort (Guipúzcoa, Spain

Directory of Open Access Journals (Sweden)

Loreto Santa Marina

2010-08-01

Full Text Available Objetivos: Describir la concentración de trihalometanos (THM y ácidos haloacéticos (AHA del agua de consumo, valorar su variación espacio-temporal y estimar las ingestas individuales en el embarazo. Métodos: En los años 2006-2008 se analizó el agua en 33 puntos representativos de las redes de abastecimiento de los 25 municipios del área de estudio. Los hábitos de consumo de agua se obtuvieron mediante cuestionario. Resultados: La media (desviación estándar fue de 16,9µg/l (7,9 para el total de THM y de 10,9µg/l (4,9 para la suma de las concentraciones de cinco: monocloroacético, dicloroacético, tricloroacético, monobromoacético y dibromoacético (AHA5. Las concentraciones fueron menores en las aguas de manantial, sólo cloradas, que en las de embalse, sometidas a tratamiento completo de potabilización: 8,8µg/l frente a 19,1µg/l (pObjectives: To report trihalomethane (THM and haloacetic acid (HAA concentrations in drinking water, assess variations in these concentrations depending on source and over time, and estimate individual intake during pregnancy. Methods: Water taken from 33 representative points of the water supply network of the 25 municipalities in the study area was analyzed from 2006-2008. Water drinking habits were recorded using a questionnaire. Results: Mean total THM concentrations were 16.9µg/L (standard deviation, 7.9, while the mean value for the sum of concentrations of five HAA (monochloroacetic, dichloroacetic, tricholoroacetic, monobromoacetic, and dicromoacetic acids was 10.9µg/L (standard deviation, 4.9. Concentrations were lower in spring waters, which were only chlorinated, compared with dam waters, which were subject to a complete purification treatment: 8.8µg/L vs 19.1µg/L (p<0.01 and 8.2µg/L vs 11.7µg/L (p<0.01. Concentrations significantly increased with the number of deposits in the network and with their rechlorination and were higher in the summer and fall. Mean intakes of total THM and

Halogenating reaction activity of aromatic organic compounds during disinfection of drinking water

International Nuclear Information System (INIS)

Guo Gaimei; Chen Xiaodong

2009-01-01

The halogenating reactions of five aromatic organic compounds (AOCs) with aqueous chlorine (HOCl/OCl - ) and aqueous bromine (HOBr/OBr - ) were studied with an aim to compare the formation properties of haloacetic acids (HAAs) for the corresponding chlorination or bromination reactions of AOCs, respectively. The experiment results indicated that the HAAs substitution efficiency for the bromination reactions of AOCs was greater than that for the chlorination reactions, and the formation of HAAs had a strong dependence on the chemical structure of AOCs. The chlorination or bromination reaction activities for the AOCs with electron donating functional groups were higher than that for them with electron withdrawing functional groups. The kinetic experiments indicated that the reactions of aqueous bromine with phenol were faster than those of aqueous chlorine with phenol and the halogen consumption exhibited rapid initial and slower consumption stages for the reactions of phenol with aqueous chlorine and bromine, respectively. In addition, the HAAs production for the chlorination reaction of phenol decreased with the increase of pH. These conclusions could provide the valuable information for the effective control of the disinfection by-products during drinking water treatment operation

Haloacetate analogs of pheromones: effects on catabolism and electrophysiology in Plutella xylostella

International Nuclear Information System (INIS)

Prestwich, G.D.; Streinz, L.

1988-01-01

A series of mono, di-, and trihalogenated acetate analogs of Z11-16:Ac were prepared and examined for electrophysiological activity in antennae of males of the diamondback moth, Plutella xylostella. In addition, two potential affinity labels, a diazoacetate (Dza) and a trifluoromethyl ketone (Tfp), were evaluated for EAG activity. The Z11-16:Ac showed the highest activity in EAG assays, followed by the fluorinated acetates, but other haloacetates were essentially inactive. The effects of these analogs on the hydrolysis of [ 3 H]Z11-16:Ac to [ 3 H]Z11-16:OH by antennal esterases was also examined. The three fluorinated acetates showed the greatest activity as inhibitors in competition assays, with rank order F 2 Ac > F 3 Ac > FAc > AC > Cl 2 Ac > ClAc > Dza > Br 2 Ac > BrAc > Tfp > I > Cl 3 Ac > Br 3 Ac > OH. The relative polarities of the haloacetates, as determined by TLC mobility, are in the order mono- > di- > trihalo, but F, Cl, Br, and I all confer similar polarities within a substitution group. Thus, the steric size appears to be the predominant parameter affecting the interactions of the haloacetate analogs with both receptor and catabolic proteins in P. xylostella males

Electrochemical processes in macro and microfluidic cells for the abatement of chloroacetic acid from water

International Nuclear Information System (INIS)

Scialdone, O.; Corrado, E.; Galia, A.; Sirés, I.

2014-01-01

Highlights: • The electrochemical abatement of chloroacetic acid in water was studied. • The performance of both macro and microfluidic reactors was examined. • Cathodic reduction and anodic oxidation was studied in detail. • Mediated oxidation by electro-Fenton and active chlorine was carried out. • Anodic oxidation at BDD gave better performances. • Microfluidic reactors gave better performances compared to conventional cells. - Abstract: The remediation of solutions contaminated with monochloroacetic acid (CAA), which is one of the most resistant haloacetic acids (HAAs) to chemical degradation, dramatically depends on the adopted electrochemical approach: (i) CAA is only poorly oxidized either by homogeneous hydroxyl radical in electro-Fenton (EF), electrogenerated active chlorine or electro-oxidation on Pt anode; (ii) it is moderately abated by direct reduction on silver or compact graphite cathodes (from 30% in macro cells to 60% in the microfluidic devices); (iii) it is quantitatively removed by direct electro-oxidation on a boron-doped diamond (BDD) anode. The use of a microreactor enables operation in the absence of supporting electrolyte and drastically enhances the performance of the cathodic process. Simultaneously performing direct oxidation on BDD and reduction on graphite in a microfluidic cell yields the fastest CAA removal with 100% abatement at low current densities (∼5 mA cm −2 )

Haloacetate analogs of pheromones: Effects on catabolism and electrophysiology inPlutella xylostella.

Science.gov (United States)

Prestwich, G D; Streinz, L

1988-03-01

A series of mono-, di-, and trihalogenated acetate analogs of Zl 1-16: Ac were prepared and examined for electrophysiological activity in antennae of males of the diamondback moth,Plutella xylostella. In addition, two potential affinity labels, a diazoacetate (Dza) and a trifluoromethyl ketone (Tfp), were evaluated for EAG activity. The Z11-16∶Ac showed the highest activity in EAG assays, followed by the fluorinated acetates, but other halo-acetates were essentially inactive. The polar diazoacetate and the trifluoromethyl ketone were also very weak EAG stimulants. The effects of these analogs on the hydrolysis of [(3)H]Z11-16∶Ac to [(3)H]Z11-16∶OH by antennal esterases was also examined. The three fluorinated acetates showed the greatest activity as inhibitors in competition assays, with rank order F2Ac > F(3)Ac > FAc > Ac > Cl2Ac > ClAc > Dza > Br2Ac > BrAc > Tfp > I > Cl3Ac > Br3Ac > OH. The relative polarities of the haloacetates, as determined by TLC mobility, are in the order mono- > di- > trihalo, but F, Cl, Br, and I all confer similar polarities within a substitution group. Thus, the steric size appears to be the predominant parameter affecting the interactions of the haloacetate analogs with both receptor and catabolic proteins inP. xylostella males.

Effect of pH on the formation of disinfection byproducts in swimming pool water – Is less THM better?

DEFF Research Database (Denmark)

Hansen, Kamilla Marie Speht; Willach, Sarah; Antoniou, Maria

2012-01-01

This study investigated the formation and predicted toxicity of different groups of disinfection byproducts (DBPs) from human exudates in relation to chlorination of pool water at different pH values. Specifically, the formation of the DBP groups trihalomethanes (THMs), haloacetic acids (HAAs......), haloacetonitriles (HANs) and trichloramine (NCl3), resulting from the chlorination of body fluid analog, were investigated at 6.0 ≤ pH ≤ 8.0. Either the initial concentration of active chorine or free chlorine was kept constant in the tested pH range. THM formation was reduced by decreasing pH but HAN, and NCl3...... formation was investigated and found to follow the same pH dependency as without bromide present, with the overall DBP formation increasing, except for HAAs. Estimation of genotoxicity and cytotoxicity of the chlorinated human exudates showed that among the quantified DBP groups, HAN formation were...

Formation of bromate and halogenated disinfection byproducts during chlorination of bromide-containing waters in the presence of dissolved organic matter and CuO

KAUST Repository

Liu, Chao; Croue, Jean-Philippe

2015-01-01

Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.

Formation of bromate and halogenated disinfection byproducts during chlorination of bromide-containing waters in the presence of dissolved organic matter and CuO

KAUST Repository

Liu, Chao

2015-12-02

Previous studies showed that significant bromate (BrO3-) can be formed via the CuO-catalyzed disproportionation of hypobromous acid (HOBr) pathway. In this study, the influence of CuO on the formation of BrO3- and halogenated disinfection byproducts (DBPs) (e.g., trihalomethanes, THMs and haloacetic acids, HAAs) during chlorination of six dissolved organic matter (DOM) isolates was investigated. Only in the presence of slow reacting DOM (from treated Colorado River water, i.e., CRW-BF-HPO), significant BrO3- formation is observed, which competes with bromination of DOM (i.e., THM and HAA formation). Reactions between HOBr and 12 model compounds in the presence of CuO indicates that CuO-catalyzed HOBr disproportionation is completely inhibited by fast reacting phenols, while it predominates in the presence of practically unreactive compounds (acetone, butanol, propionic, and butyric acids). In the presence of slow reacting di- and tri-carboxylic acids (oxalic, malonic, succinic, and citric acids), BrO3- formation varies, depending on its competition with bromoform and dibromoacetic acid formation (i.e., bromination pathway). The latter pathway can be enhanced by CuO due to the activation of HOBr. Therefore, increasing CuO dose (0-0.2 g L-1) in a reaction system containing chlorine, bromide, and CRW-BF-HPO enhances the formation of BrO3-, total THMs and HAAs. Factors including pH and initial reactant concentrations influence the DBP formation. These novel findings have implications for elevated DBP formation during transportation of chlorinated waters in copper-containing distribution systems.

Factors affecting THMs, HAAs and HNMs formation of Jin Lan Reservoir water exposed to chlorine and monochloramine.

Science.gov (United States)

Hong, Huachang; Xiong, Yujing; Ruan, Mengyong; Liao, Fanglei; Lin, Hongjun; Liang, Yan

2013-02-01

The formations of THMs, HAAs, and HNMs from chlorination and chloramination of water from Jinlan Reservoir were investigated in this study. Results showed that monochloramine rather than chlorine generally resulted in lower concentration of DBPs, and the DBPs formation varied greatly as the treatment conditions changed. Specifically, the yields of THMs, HAAs and HNMs all increased with the high bromide level and high disinfectant dose both during chlorination and chloramination. The longer reaction time had a positive effect on the formation of THMs, HAAs and HNMs during chlorination and HNMs during chloramination. However, no time effect was observed on the formation of THMs and HAAs during chloramination. An increase in pH enhanced the levels of THMs and HNMs upon chlorination but reduced levels of HNMs upon chloramination. As for the THMs in chloramination and HAAs in chlorination and chloramination, no obvious pH effect was observed. The elevated temperature significantly increased the yields of THMs during chlorination and HNMs during chloramination, but has no effect on THMs and HAAs yields during chloramination. In the same temperature range, the formation of HAAs and HNMs in chlorination showed a first increasing and then a decreasing trend. In chloramination study, addition of nitrite markedly increased the formation of HNMs but had little impact on the formation of THMs and HAAs. While in chlorination study, the presence of high nitrite levels significantly reduced the yields of THMs, HAAs and HNMs. Range analysis revealed that the bromide and disinfectant levels were the major factors affecting THMs, HAAs and HNMs formation, in both chlorination and chloramination. Finally, comparisons of the speciation of mono-halogenated, di-halogenated, tri-halogenated HAAs and HNMs between chlorination and monochloramination were also conducted, and factors influencing the speciation pattern were identified. Copyright © 2012 Elsevier B.V. All rights reserved.

De Haas-Van Alphen affect and helicons in metals

International Nuclear Information System (INIS)

Vol'skij, E.P.

1975-01-01

Specific features of helicon electrodynamics associated with the de Haas-van Alphen effect are considered for an uncompensated metal with the closed Fermi surface of arbitrary shape. The consideration is carried out entirely in the local limit, when the metal may be characterized by a static tensor for the magnetic resistance and by a static tensor for the differential magnetic permeability which describes the anisotropy of the de Haas-van Alphen effect. The amplitude of the effect is assumed to be of an arbitrary value, but in the limits determined by the thermodynamical stability of a uniformly magnetized state. It has been shown that in the general case the de Haas-van Alphen effect may strongly influence not only the phase velocity, but also the damping and polarization of a helicon. A significant effect of nondiagonal components of the differential magnetic permeability tensor that sometimes arise even at very small deviations of the magnetic field from the symmetric direction, is noted. The resonance excitation of waves in a plate is considered. The question of a possible relation between periodic diamagnetic structures in metals and helicons is discussed

Catalysis of copper corrosion products on chlorine decay and HAA formation in simulated distribution systems.

Science.gov (United States)

Zhang, Hong; Andrews, Susan A

2012-05-15

This study investigated the effect of copper corrosion products, including Cu(II), Cu(2)O, CuO and Cu(2)(OH)(2)CO(3), on chlorine degradation, HAA formation, and HAA speciation under controlled experimental conditions. Chlorine decay and HAA formation were significantly enhanced in the presence of copper with the extent of copper catalysis being affected by the solution pH and the concentration of copper corrosion products. Accelerated chlorine decay and increased HAA formation were observed at pH 8.6 in the presence of 1.0 mg/L Cu(II) compared with that observed at pH 6.6 and pH 7.6. Further investigation of chlorine decay in the presence of both Suwannee River NOM and Cu(II) indicated that an increased reactivity of NOM with dissolved and/or solid surface-associated Cu(II), rather than chlorine auto-decomposition, was a primary reason for the observed rapid chlorine decay. Copper corrosion solids [Cu(2)O, CuO, Cu(2)(OH)(2)CO(3)] exhibited catalytic effects on both chlorine decay and HAA formation. Contrary to the results observed when in the absence of copper corrosion products, DCAA formation was consistently predominant over other HAA species in the presence of copper corrosion products, especially at neutral and high pH. This study improves the understanding for water utilities and households regarding chlorine residuals and HAA concentrations in distribution systems, in particular once the water reaches domestic plumbing where copper is widely used. Copyright © 2012 Elsevier Ltd. All rights reserved.

Comparison of the effect of Haas and Hyrax rapid palatal expanders on nasal cavity dimensions

Directory of Open Access Journals (Sweden)

Amini F.

2009-11-01

Full Text Available "nBackground and Aim: In treatment of posterior crossbite awareness of the effects of Haas and Hyrax rapid maxillary expanders (RME on nasal cavity will help the clinician to select the better appliance. This study was carried out to compare the effects of Haas and Hyrax expanders on the nasal cavity of patients treated for posterior crossbite. "nMaterials and Methods: A clinical trial study was designed on posteroanterior (PA cephalograms of 30 subjects to evaluate the nasal cavity width of 14 subjects (8 female & 6 male with mean chronological age of 12± 2years who received RME with Hyrax type and 16 subjects (9 female & 7 male with mean chronological age of 11±1.6 years who received Haas type palatal expander. Paired t-test was used to analyze the outcomes of expansion in each group. Student t-test was used to compare Haas and Hyrax groups. "nResults: The mean value of screw expansion was 9±2 mm in both groups. In Hyrax group nasal cavity width"n(Nc-cN increased from 29.2 ±1.94 mm to 31.7 ±1.93mm (p= 0.001 and In Haas group it was increased from 27.75± 2.21 mm to 29.35 ± 2.26 mm(p= 0.043. When two groups were compared to each other, statistically this increase was more significant in Hyrax than in the Haas group (p=0.038. "nConclusion: In this study RME affected geometry of the nasal cavity by increasing the nasal cavity width. However In our sample, Hyrax appliance demonstrated better performance over the Haas appliance in all variables.

FORMATION AND ENANTIOSELECTIVE BIODEGRADATION OF THE ENANTIOMERS OF BROMOCHLOROACETIC ACID

Science.gov (United States)

Bromochloroacetic acid (BCAA) is formed by chlorination of drinking waters containing naturally occurring bromide. This haloacetic acid is a concern to public health because of suspected carcinogenicity and toxicity, and is a potential target of disinfectant byproduct regulations...

Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders

Directory of Open Access Journals (Sweden)

Matheus Melo Pithon

2012-06-01

Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.

Disinfection By-Product Exposures and the Risk of Specific Cardiac Birth Defects

Science.gov (United States)

Wright, J. Michael; Evans, Amanda; Kaufman, John A.; Rivera-Núñez, Zorimar; Narotsky, Michael G.

2016-01-01

Background: Epidemiological studies suggest that women exposed to disinfection by-products (DBPs) have an increased risk of delivering babies with cardiovascular defects (CVDs). Objective: We examined nine CVDs in relation to categorical DBP exposures including bromoform, chloroform, dibromochloromethane (DBCM), bromodichloromethane (BDCM), monobromoacetic acid (MBAA), dichloroacetic acid (DCAA), trichloroacetic acid (TCAA), and summary DBP measures (HAA5, THMBr, THM4, and DBP9). Methods: We calculated adjusted odds ratios (aORs) in a case–control study of birth defects in Massachusetts with complete quarterly 1999–2004 trihalomethane (THM) and haloacetic acid (HAA) data. We randomly matched 10 controls each to 904 CVD cases based on week of conception. Weight-averaged aggregate first-trimester DBP exposures were assigned to individuals based on residence at birth. Results: We detected associations for tetralogy of Fallot and the upper exposure categories for TCAA, DCAA, and HAA5 (aOR range, 3.34–6.51) including positive exposure–response relationships for DCAA and HAA5. aORs consistent in magnitude were detected between atrial septal defects and bromoform (aOR = 1.56; 95% CI: 1.01, 2.43), as well as DBCM, chloroform, and THM4 (aOR range, 1.26–1.67). Ventricular septal defects (VSDs) were associated with the highest bromoform (aOR = 1.85; 95% CI: 1.20, 2.83), MBAA (aOR = 1.81; 95% CI: 0.85, 3.84), and DBCM (aOR = 1.54; 95% CI: 1.00, 2.37) exposure categories. Conclusions: To our knowledge, this is the first birth defect study to develop multi-DBP adjusted regression models as well as the first CVD study to evaluate HAA exposures and the second to evaluate bromoform exposures. Our findings, therefore, inform exposure specificity for the consistent associations previously reported between THM4 and CVDs including VSDs. Citation: Wright JM, Evans A, Kaufman JA, Rivera-Núñez Z, Narotsky MG. 2017. Disinfection by-product exposures and the risk of specific

Galvano-magnetic properties and Shubnikov de Haas effect of Te-whiskers

International Nuclear Information System (INIS)

Berezovets, Veacheslav; Bondarchuk, Nikolai; Nikolaeva, Albina; Nijankovskii, Victor

2009-01-01

The work is devoted to investigation of the peculiarities of magnetoresistance, Hall effect and Shubnikov de Haas oscillations in Te-whiskers. Te-whiskers was prepared from vapor-gas phase on the substrate pure tellurium and grown naturally, of the walls of a crucible in the course of growing Te single crystals by the Czochralski method . The measurements of the galvanomagnetic properties and Shubnikov de Haas oscillation correspond to the notion of the occurrence of the effect of intraband magnetic breakdown when two different quasi-classical cyclotron trajectories coexist simultaneously in a magnetic field. This effect is a consequence of the presence of the saddle point in the dispersion law of the tellurium valence band. (authors)

Seasonal evaluation of the presence of 46 disinfection by-products throughout a drinking water treatment plant

Energy Technology Data Exchange (ETDEWEB)

Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes, E-mail: mercedes.gallego@uco.es

2015-06-01

In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was

Seasonal evaluation of the presence of 46 disinfection by-products throughout a drinking water treatment plant

International Nuclear Information System (INIS)

Serrano, Maria; Montesinos, Isabel; Cardador, M.J.; Silva, Manuel; Gallego, Mercedes

2015-01-01

In this work, we studied a total of 46 regulated and non-regulated disinfection by-products (DBPs) including 10 trihalomethanes (THMs), 13 haloacetic acids (HAAs), 6 halonitromethanes (HNMs), 6 haloacetonitriles (HANs) and 11 aldehydes at different points in a drinking water treatment plant (DWTP) and its distribution network. Determining an increased number of compounds and using accurate, sensitive analytical methodologies for new DBPs can be useful to overcome some challenges encountered in the comprehensive assessment of the quality and safety of drinking water. This paper provides a detailed picture of the spatial and seasonal variability of DBP concentrations from raw water to distribution network. Samples were collected on a monthly basis at seven different points in the four seasons of a year to acquire robust data for DBPs and supplementary quality-related water parameters. Only 5 aldehydes and 2 HAAs were found in raw water. Chlorine dioxide caused the formation of 3 new aldehydes (benzaldehyde included), 5 HAAs and chloroform. The concentrations of DBPs present in raw water were up to 6 times higher in the warmer seasons (spring and summer). The sedimentation process further increased their concentrations and caused the formation of three new ones. Sand filtration substantially removed aldehydes and HAAs (15–50%), but increased the levels of THMs, HNMs and HANs by up to 70%. Chloramination raised the levels of 8 aldehydes and 7 HAAs; also, it caused the formation of monoiodoacetic acid, dibromochloromethane, dichloroiodomethane and bromochloroacetonitrile. Therefore, this treatment increases the levels of existing DBPs and leads to the formation of new ones to a greater extent than does chlorine dioxide. Except for 5 aldehydes, the 23 DBPs encountered at the DWTP exit were found at increased concentrations in the warmer seasons (HAAs by about 50% and THMs by 350%). - Highlights: • Occurrence of 46 regulated and non-regulated DBPs through a DWTP was

75 FR 22627 - Chrysler LLC, St. Louis North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc...

Science.gov (United States)

2010-04-29

... North Assembly Plant Including On-Site Leased Workers From HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services, Inc., Corrigan Company and Murphy Company, Fenton, MO... workers from HAAS TCM, Inc., Logistics Services, Inc., Robinson Solutions, Logistics Management Services...

Histopathological Study of Subacute Toxic Effects of Chloroacetic Acid on Albino Rats and its Correlation with Serum Levels of Malondialdehyde

Directory of Open Access Journals (Sweden)

Kafil Akhtar

2012-04-01

Full Text Available Human beings are increasingly being exposed to chloroacetic acid (CAA, a type of halo acetic acid. It would not be an exaggeration to say that almost the whole humankind today is affected by it or its metabolites. The concern over the carcinogenicity of haloacetic acids led the United States Environmental Protection Agency to regulate the allowable concentration of haloacetic acids in drinking water as part of the Disinfectants and Disinfection Byproducts Rule promulgated in 1998. Keeping this view in mind, the present study on histolopathological evaluation of different types of tissues viz., brain, kidney, liver, spleen and testes of Rattus norvegicus was performed, to find out the subacute toxicity of chloroacetic acid and correlation between CAA administration and changes in malondialdehyde (MDA level in blood.

De bepaling van halo-azijnzuren, chloriet en chloraat in drinkwater

NARCIS (Netherlands)

Peters RJB; van de Meer-Arp KKM; Versteegh JFM

1990-01-01

A method was developed to determine halo-acetic acids with a detection limit of 0.1 mug/L. Halo-acetic acids were determined in samples drinking water derived from surface- and bankfiltrated water however, not in drinking water derived from groundwater. Halo-acetic acids were found in chlorinated

Use of ozone-biofiltration for bulk organic removal and disinfection byproduct mitigation in potable reuse applications.

Science.gov (United States)

Arnold, Mayara; Batista, Jacimaria; Dickenson, Eric; Gerrity, Daniel

2018-07-01

The purpose of this research was to investigate the impacts of ozone dose and empty bed contact time (EBCT) in ozone-biofiltration systems on disinfection byproduct (DBP) formation potential. The data were used to evaluate the possibility of using DBP formation potential as an alternative guideline for total organic carbon (TOC) removal in potable reuse applications. A pilot-scale ozone-biofiltration system was operated with O 3 /TOC ratios ranging from 0.1 to 2.25 and EBCTs ranging from 2 to 20 min. The biofiltration columns contained anthracite or biological activated carbon (BAC). Bench-scale chlorination was performed using the uniform formation conditions (UFC) approach, and quenched samples were analyzed for total trihalomethanes (TTHMs) and regulated haloacetic acids (HAA5s). The data demonstrated that ozone-biofiltration achieved TOC removals ranging from ∼10 to 30%, depending on operational conditions, but biofiltration without ozone generally achieved <10% TOC removal. UFC testing demonstrated that ozone alone was efficient in transforming bulk organic matter and reducing DBP formation potential by 10-30%. The synergistic combination of ozone and biofiltration achieved average overall reductions in TTHM and HAA5 formation potential of 26% and 51%, respectively. Finally, a maximum TOC concentration of 2.0 mg/L was identified as a recommended treatment target for reliable compliance with TTHM and HAA5 regulations for potable reuse systems in the United States. Copyright © 2018 Elsevier Ltd. All rights reserved.

Comparison between HPSEC-OCD and F-EEMs for assessing DBPs formation in water.

Science.gov (United States)

Hidayah, Euis Nurul; Chou, Yung-Chen; Yeh, Hsuan-Hsien

2017-03-21

In this study, natural organic matter (NOM) in source water, as well as the treated water after coagulation with or without potassium permanganate (KMnO 4 ) preoxidation, was characterized by using high performance size exclusion chromatography with organic carbon detector (HPSEC-OCD) and fluorescence excitation emission matrices (F-EEMs) with parallel factor (PARAFAC) analysis. Bulk parameters, such as dissolved organic carbon (DOC) and ultraviolet light absorbance at 254 nm (UV 254 ), were also analyzed. The results show that KMnO 4 preoxidation caused the breakdown of high molecular weight (MW) organics into low MW organics. All organics, whether those that existed in the source water or those generated by KMnO 4 preoxidation, could be partly removed by coagulation. Combining the derived organic fractions obtained from HPSEC-OCD with peak-fitting and from F-EEMs with PARAFAC on the same sample, humic substances have been specified as the main organic composition. Further, the predictive models for trihalomethanes formation potential (THMFP) and haloacetic acids formation potential (HAAFP) based on organic fractions from HPSEC-OCD have higher accuracy than those based on the components from PARAFAC modeling. These models provide useful tools to specify the organic fractions from HPSEC-OCD and F-EEMs that constitute active precursors towards trihalomethanes (THMs) or haloacetic acids (HAAs) formation in water. Further, by knowing the major organic precursors, it would facilitate choosing the appropriate water treatment process for disinfection by-products (DBPs) control.

Potentially bioavailable natural organic carbon and hydrolyzable amino acids in aquifer sediments

Science.gov (United States)

Thomas, Lashun K.; Widdowson, Mark A.; Novak, John T.; Chapelle, Francis H.; Benner, Ronald; Kaiser, Karl

2012-01-01

This study evaluated the relationship between concentrations of operationally defined potentially bioavailable organic -carbon (PBOC) and hydrolyzable amino acids (HAAs) in sediments collected from a diverse range of chloroethene--contaminated sites. Concentrations of PBOC and HAA were measured using aquifer sediment samples collected at six selected study sites. Average concentrations of total HAA and PBOC ranged from 1.96 ± 1.53 to 20.1 ± 25.6 mg/kg and 4.72 ± 0.72 to 443 ± 65.4 mg/kg, respectively. Results demonstrated a statistically significant positive relationship between concentrations of PBOC and total HAA present in the aquifer sediment (p amino acids are known to be readily biodegradable carbon compounds, this relationship suggests that the sequential chemical extraction procedure used to measure PBOC is a useful indicator of bioavailable carbon in aquifer sediments. This, in turn, is consistent with the interpretation that PBOC measurements can be used for estimating the amount of natural organic carbon available for driving the reductive dechlorination of chloroethenes in groundwater systems.

Real-time discriminatory sensors for water contamination events :LDRD 52595 final report.

Energy Technology Data Exchange (ETDEWEB)

Borek, Theodore Thaddeus III (; ); Carrejo-Simpkins, Kimberly; Wheeler, David Roger; Adkins, Douglas Ray; Robinson, Alex Lockwood; Irwin, Adriane Nadine; Lewis, Patrick Raymond; Goodin, Andrew M.; Shelmidine, Gregory J.; Dirk, Shawn M.; Chambers, William Clayton; Mowry, Curtis Dale (1722 Micro-Total-Analytical Systems); Showalter, Steven Kedrick

2005-10-01

The gas-phase {mu}ChemLab{trademark} developed by Sandia can detect volatile organics and semi-volatiles organics via gas phase sampling . The goal of this three year Laboratory Directed Research and Development (LDRD) project was to adapt the components and concepts used by the {mu}ChemLab{trademark} system towards the analysis of water-borne chemicals of current concern. In essence, interfacing the gas-phase {mu}ChemLab{trademark} with water to bring the significant prior investment of Sandia and the advantages of microfabrication and portable analysis to a whole new world of important analytes. These include both chemical weapons agents and their hydrolysis products and disinfection by-products such as Trihalomethanes (THMs) and haloacetic acids (HAAs). THMs and HAAs are currently regulated by EPA due to health issues, yet water utilities do not have rapid on-site methods of detection that would allow them to adjust their processes quickly; protecting consumers, meeting water quality standards, and obeying regulations more easily and with greater confidence. This report documents the results, unique hardware and devices, and methods designed during the project toward the goal stated above. It also presents and discusses the portable field system to measure THMs developed in the course of this project.

Models for estimation of the presence of non-regulated disinfection by-products in small drinking water systems.

Science.gov (United States)

Guilherme, Stéphanie; Rodriguez, Manuel J

2017-10-23

Among all the organic disinfection by-products (DBPs), only trihalomethanes (THMs) and haloacetic acids (HAAs) are regulated in drinking water, while most DBPs are not. Very little information exists on the occurrence of non-regulated DBPs, particularly in small water systems (SWS). Paradoxically, SWS are more vulnerable to DBPs because of a low capacity to implement adequate treatment technologies to remove DBP precursors. Since DBP analyses are expensive, usually SWS have difficulties to implement a rigorous characterization of these contaminants. The purpose of this study was to estimate non-regulated DBP levels in SWS from easy measurements of relevant parameters regularly monitored. Since no information on non-regulated DBPs in SWS was available, a sampling program was carried out in 25 SWS in two provinces of Canada. Five DBP families were investigated: THMs, HAAs, haloacetonitriles (HANs), halonitromethanes (HNMs), and haloketones (HKs). Multivariate linear mixed regression models were developed to estimate HAN, HK, and HNM levels from water quality characteristics in the water treatment plant, concentrations of regulated DBPs, and residual disinfectant levels. The models obtained have a good explanatory capacity since R 2 varies from 0.77 to 0.91 according to compounds and conditions for application (season and type of treatment). Model validation with an independent database suggested their ability for generalization in similar SWS in North America.

The measurement of the amplitude of de Haas-van Alphen oscillations in indium

International Nuclear Information System (INIS)

Wilde, J. de; Meredith, D.J.

1976-01-01

A flux-gate magnetometer incorporating a superconducting flux transformer is described and its application to the measurement of de Haas-van Alphen oscillation amplitude is compared with conventional techniques. Measurements on the third zone Fermi surface of indium in magnetic fields of up to 4 T are given to show the advantages of the method. (author)

A comparison of disinfection by-products formation during sequential or simultaneous disinfection of surface waters with chlorine dioxide and chlor(am)ine.

Science.gov (United States)

Shi, Yanwei; Ling, Wencui; Qiang, Zhimin

2013-01-01

The effect of chlorine dioxide (ClO2) oxidation on the formation of disinfection by-products (DBPs) during sequential (ClO2 pre-oxidation for 30 min) and simultaneous disinfection processes with free chlorine (FC) or monochloramine (MCA) was investigated. The formation of DBPs from synthetic humic acid (HA) water and three natural surface waters containing low bromide levels (11-27 microg/L) was comparatively examined in the FC-based (single FC, sequential ClO2-FC, and simultaneous ClO2/FC) and MCA-based (single MCA, ClO2-MCA, and ClO2/MCA) disinfection processes. The results showed that much more DBPs were formed from the synthetic HA water than from the three natural surface waters with comparative levels of dissolved organic carbon. In the FC-based processes, ClO2 oxidation could reduce trihalomethanes (THMs) by 27-35% and haloacetic acids (HAAs) by 14-22% in the three natural surface waters, but increased THMs by 19% and HAAs by 31% in the synthetic HA water after an FC contact time of 48 h. In the MCA-based processes, similar trends were observed although DBPs were produced at a much lower level. There was an insignificant difference in DBPs formation between the sequential and simultaneous processes. The presence of a high level of bromide (320 microg/L) remarkably promoted the DBPs formation in the FC-based processes. Therefore, the simultaneous disinfection process of ClO2/MCA is recommended particularly for waters with a high bromide level.

The interaction between nitrobenzene and Microcystis aeruginosa and its potential to impact water quality.

Science.gov (United States)

Liu, Zhiquan; Cui, Fuyi; Ma, Hua; Fan, Zhenqiang; Zhao, Zhiwei; Hou, Zhenling; Liu, Dongmei; Jia, Xuebin

2013-08-01

The potential water quality problems caused by the interaction between nitrobezene (NB) and Microcystis aeruginosa was investigated by studying the growth inhibition, the haloacetic acids formation potential (HAAFP) and the secretion of microcystin-LR (MC-LR). The results showed that NB can inhibit the growth of M. aeruginosa, and the value of EC50 increased with the increase of initial algal density. Although NB can hardly react with chlorine to form HAAs, the presence of NB can enhance the HAAFP productivity. The secretion of the intracellular MC-LR is constant under the steady experimental conditions. However, the presence of NB can reduce the MC-LR productivity of M. aeruginosa. Overall, the increased disinfection risk caused by the interaction has more important effect on the safety of drinking water quality than the benefit of the decreased MC-LR productivity, and should be serious considered when the water contained NB and M. aeruginosa is used as drinking water source. Copyright © 2013 Elsevier Ltd. All rights reserved.

Electrons in a Magnetic Field: Special Spin in de Haas-van Alphen effect

International Nuclear Information System (INIS)

Shrivastava, Keshav N

2012-01-01

When the magnetic field is applied in a metal, the electrons behave like a harmonic oscillator. When the field is increased these harmonic oscillator type levels cross the Fermi energy at a particular point resulting into the discontinuities in the population of any particular level at that point. For a large orbital magnetic moment, different from L = 0 and both signs of spin in the total magnetic momentum quantum number, j = l ± s, the discontinuities in the population of the electrons in a particular level become double valued resulting into doubling of oscillations in the magnetization. There is a double valued change in the energy of the electrons when they transfer from the harmonic oscillator type level to the Fermi level. The magnetization depends on the value of j = l ± s so that there is a double valued period in the oscillations. The de Haas-van Alphen effect is usually described for the L = 0 electrons. Hence, we see that the de Haas-van Alphen effect is considerably modified in going from L = 0 to j = l ± s, with both signs in the spin.

Production of volatiles in fresh-cut apple: effect of applying alginate coatings containing linoleic acid or isoleucine.

Science.gov (United States)

Maya-Meraz, Irma O; Espino-Díaz, Miguel; Molina-Corral, Francisco J; González-Aguilar, Gustavo A; Jacobo-Cuellar, Juan L; Sepulveda, David R; Olivas, Guadalupe I

2014-11-01

One of the main quality parameters in apples is aroma, its main precursors are fatty acids (FA) and amino acids (AA). In this study, alginate edible coatings were used as carriers of linoleic acid or isoleucine to serve as precursors for the production of aroma in cut apples. Apple wedges were immersed in a CaCl2 solution and coated with one of the following formulations: alginate solution (Alg-Ca), Alg-Ca-low-level linoleic acid (0.61 g/Lt), (LFA), Alg-Ca-high-level linoleic acid (2.44 g/L; HFA), Alg-Ca-low-level isoleucine (0.61 g/L; LAA), and Alg-Ca-high-level isoleucine (2.44 g/L; HAA). Apple wedges were stored at 3 °C and 85% relative humidity for 21 d and key volatiles were studied during storage. Addition of precursors, mainly isoleucine, showed to increase the production of some key volatiles on coated fresh-cut apples during storage. The concentration of 2-methyl-1-butanol was 4 times higher from day 12 to day 21 in HAA, while 2-methyl butyl acetate increased from day 12 to day 21 in HAA. After 21 d, HAA-apples presented a 40-fold value of 2-methyl-butyl acetate, compared to Alg-Ca cut apples. Values of hexanal increased during cut apple storage when the coating carried linoleic acid, mainly on HFA, from 3 to 12 d. The ability of apples to metabolize AA and FA depends on the concentration of precursors, but also depends on key enzymes, previous apple storage, among others. Further studies should be done to better clarify the behavior of fresh-cut apples as living tissue to metabolize precursors contained in edible coatings for the production of volatiles. © 2014 Institute of Food Technologists®

Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

Science.gov (United States)

Façanha, Anna Júlia de Oliveira; Lara, Tulio Silva; Garib, Daniela Gamba; da Silva Filho, Omar Gabriel

2014-01-01

Objective The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months); and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months). Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho AnalyzerTM 3D software. Results The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders. PMID:24945513

Transverse effect of Haas and Hyrax appliances on the upper dental arch in patients with unilateral complete cleft lip and palate: A comparative study

Directory of Open Access Journals (Sweden)

Anna Júlia de Oliveira Façanha

2014-04-01

Full Text Available Objective: The aim of the present study was to evaluate the transverse effect of rapid maxillary expansion in patients with unilateral complete cleft lip and palate while comparing the Haas and Hyrax appliances. Methods: The sample consisted of 48 patients divided into two groups: Group I - 25 patients treated with modified Haas appliance (mean age: 10 years 8 months; and Group II - 23 patients treated with Hyrax appliance (mean age: 10 years 6 months. Casts were taken during pre-expansion and after removal of the appliance at the end of the retention period. The models were scanned with the aid of the 3 Shape R700 3D scanner. Initial and final transverse distances were measured at cusp tips and cervical-palatal points of maxillary teeth by using the Ortho Analyzer(tm 3D software. Results: The mean expansion obtained between cusp tips and cervical-palatal points for inter-canine width was 4.80 mm and 4.35 mm with the Haas appliance and 5.91 mm and 5.91 mm with the Hyrax appliance. As for first premolars or first deciduous molars, the values obtained were 6.46 mm and 5.90 mm in the Haas group and 7.11 mm and 6.65 mm in the Hyrax group. With regard to first molars, values were 6.11 mm and 5.24 mm in the Haas group and 7.55 mm and 6.31 mm in the Hyrax group. Conclusion: Rapid maxillary expansion significantly increased the transverse dimensions of the upper dental arch in patients with cleft palate, with no significant differences between the Hass and Hyrax expanders.

Effect of medium-pressure UV-lamp treatment on disinfection by-products in chlorinated seawater swimming pool waters.

Science.gov (United States)

Cheema, Waqas A; Manasfi, Tarek; Kaarsholm, Kamilla M S; Andersen, Henrik R; Boudenne, Jean-Luc

2017-12-01

Several brominated disinfection by-products (DBPs) are formed in chlorinated seawater pools, due to the high concentration of bromide in seawater. UV irradiation is increasingly employed in freshwater pools, because UV treatment photodegrades harmful chloramines. However, in freshwater pools it has been reported that post-UV chlorination promotes the formation of other DBPs. To date, UV-based processes have not been investigated for DBPs in seawater pools. In this study, the effects of UV, followed by chlorination, on the concentration of three groups of DBPs were investigated in laboratory batch experiments using a medium-pressure UV lamp. Chlorine consumption increased following post-UV chlorination, most likely because UV irradiation degraded organic matter in the pool samples to more chlorine-reactive organic matter. Haloacetic acid (HAA) concentrations decreased significantly, due to photo-degradation, but the concentrations of trihalomethanes (THMs) and haloacetonitriles (HANs) increased with post-UV chlorination. Bromine incorporation in HAAs was significantly higher in the control samples chlorinated without UV irradiation but decreased significantly with UV treatment. Bromine incorporation was promoted in THM and HAN after UV and chlorine treatment. Overall, the accumulated bromine incorporation level in DBPs remained essentially unchanged in comparison with the control samples. Toxicity estimates increased with single-dose UV and chlorination, mainly due to increased HAN concentrations. However, brominated HANs are known in the literature to degrade following further UV treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of Ozonation and Biological Activated Carbon Treatment of Wastewater Effluents on Formation of N-nitrosamines and Halogenated Disinfection Byproducts.

Science.gov (United States)

Chuang, Yi-Hsueh; Mitch, William A

2017-02-21

Ozonation followed by biological activated carbon (O 3 /BAC) is being considered as a key component of reverse osmosis-free advanced treatment trains for potable wastewater reuse. Using a laboratory-scale O 3 /BAC system treating two nitrified wastewater effluents, this study characterized the effect of different ozone dosages (0-1.0 mg O 3 /mg dissolved organic carbon) and BAC empty bed contact times (EBCT; 15-60 min) on the formation after chlorination or chloramination of 35 regulated and unregulated halogenated disinfection byproducts (DBPs), 8 N-nitrosamines, and bromate. DBP concentrations were remarkably similar between the two wastewaters across O 3 /BAC conditions. Ozonation increased bromate, TCNM, and N-nitrosodimethylamine, but ozonation was less significant for other DBPs. DBP formation generally decreased significantly with BAC treatment at 15 min EBCT, but little further reduction was observed at higher EBCT where low dissolved oxygen concentrations may have limited biological activity. The O 3 /BAC-treated wastewaters met regulatory levels for trihalomethanes (THMs), haloacetic acids (HAAs), and bromate, although N-nitrosodimethylamine exceeded the California Notification Level in one case. Regulated THMs and HAAs dominated by mass. When DBP concentrations were weighted by measures of their toxic potencies, unregulated haloacetonitriles, haloacetaldehydes, and haloacetamides dominated. Assuming toxicity is additive, the calculated DBP-associated toxicity of the O 3 /BAC-treated chloraminated effluents were comparable or slightly higher than those calculated in a recent evaluation of Full Advanced Treatment trains incorporating reverse osmosis.

Disinfection Methods for Swimming Pool Water: Byproduct Formation and Control

Directory of Open Access Journals (Sweden)

Huma Ilyas

2018-06-01

Full Text Available This paper presents a comprehensive and critical comparison of 10 disinfection methods of swimming pool water: chlorination, electrochemically generated mixed oxidants (EGMO, ultraviolet (UV irradiation, UV/chlorine, UV/hydrogen peroxide (H2O2, UV/H2O2/chlorine, ozone (O3/chlorine, O3/H2O2/chlorine, O3/UV and O3/UV/chlorine for the formation, control and elimination of potentially toxic disinfection byproducts (DBPs: trihalomethanes (THMs, haloacetic acids (HAAs, haloacetonitriles (HANs, trihaloacetaldehydes (THAs and chloramines (CAMs. The statistical comparison is carried out using data on 32 swimming pools accumulated from the reviewed studies. The results indicate that O3/UV and O3/UV/chlorine are the most promising methods, as the concentration of the studied DBPs (THMs and HANs with these methods was reduced considerably compared with chlorination, EGMO, UV irradiation, UV/chlorine and O3/chlorine. However, the concentration of the studied DBPs including HAAs and CAMs remained much higher with O3/chlorine compared with the limits set by the WHO for drinking water quality. Moreover, the enhancement in the formation of THMs, HANs and CH with UV/chlorine compared with UV irradiation and the increase in the level of HANs with O3/UV/chlorine compared with O3/UV indicate the complexity of the combined processes, which should be optimized to control the toxicity and improve the quality of swimming pool water.

Disinfection byproduct formation during biofiltration cycle: Implications for drinking water production.

Science.gov (United States)

Delatolla, R; Séguin, C; Springthorpe, S; Gorman, E; Campbell, A; Douglas, I

2015-10-01

The goal of this study was to investigate the potential of biofiltration to reduce the formation potential of disinfection byproducts (DBPs). Particularly, the work investigates the effect of the duration of the filter cycle on the formation potential of total trihalomethanes (TTHM) and five species of haloacetic acids (HAA5), dissolved oxygen (DO), organic carbon, nitrogen and total phosphorous concentrations along with biofilm coverage of the filter media and biomass viability of the attached cells. The study was conducted on a full-scale biologically active filter, with anthracite and sand media, at the Britannia water treatment plant (WTP), located in Ottawa, Ontario, Canada. The formation potential of both TTHMs and HAA5s decreased due to biofiltration. However the lowest formation potentials for both groups of DBPs and or their precursors were observed immediately following a backwash event. Hence, the highest percent removal of DBPs was observed during the early stages of the biofiltration cycle, which suggests that a higher frequency of backwashing will reduce the formation of DBPs. Variable pressure scanning electron microscopy (VPSEM) analysis shows that biofilm coverage of anthracite and sand media increases as the filtration cycle progressed, while biomass viability analysis demonstrates that the percentage of cells attached to the anthracite and sand media also increases as the filtration cycle progresses. These results suggest that the development and growth of biofilm on the filters increases the DPB formation potential. Copyright © 2015 Elsevier Ltd. All rights reserved.

Ingested Nitrate, Disinfection By-products, and Kidney Cancer Risk in Older Women.

Science.gov (United States)

Jones, Rena R; Weyer, Peter J; DellaValle, Curt T; Robien, Kim; Cantor, Kenneth P; Krasner, Stuart; Beane Freeman, Laura E; Ward, Mary H

2017-09-01

N-nitroso compounds formed endogenously after nitrate/nitrite ingestion are animal renal carcinogens. Previous epidemiologic studies of drinking water nitrate did not evaluate other potentially toxic water contaminants, including the suspected renal carcinogen chloroform. In a cohort of postmenopausal women in Iowa (1986-2010), we used historical measurements to estimate long-term average concentrations of nitrate-nitrogen (NO3-N) and disinfection by-products (DBP) in public water supplies. For NO3-N and the regulated DBP (total trihalomethanes [THM] and the sum of five haloacetic acids [HAA5]), we estimated the number of years of exposure above one-half the current maximum contaminant level (>½-MCL NO3-N; >5 mg/L). Dietary intakes were assessed via food frequency questionnaire. We estimated hazard ratios (HRs) and 95% confidence intervals (CIs) with Cox models, and evaluated interactions with factors influencing N-nitroso compound formation. We identified 125 incident kidney cancers among 15,577 women reporting using water from public supplies >10 years. In multivariable models, risk was higher in the 95th percentile of average NO3-N (HRp95vsQ1 = 2.3; CI: 1.2, 4.3; Ptrend = 0.33) and for any years of exposure >½-MCL; adjustment for total THM did not materially change these associations. There were no independent relationships with total THM, individual THMs chloroform and bromodichloromethane, or with haloacetic acids. Dietary analyses yielded associations with high nitrite intake from processed meats but not nitrate or nitrite overall. We found no interactions. Relatively high nitrate levels in public water supplies were associated with increased risk of renal cancer. Our results also suggest that nitrite from processed meat is a renal cancer risk factor.

Relative turnover of [3H]arachidonic acid and [14C]eicosapentaenoic acid in stimulated human platelets

International Nuclear Information System (INIS)

Weaver, B.J.; Holub, B.J.

1986-01-01

The relative release of arachidonic acid (AA) versus eicosapentaenoic acid (EPA) from platelet phospholipids may be important in accounting for the potential of dietary fish oil containing EPA to alter platelet reactivity. Human platelets enriched in EPA and prelabelled with [ 3 H]AA and [ 14 C]EPA were used to examine the relative losses of these fatty acids from platelet phospholipids upon stimulation. Washed dual-labelled platelets were incubated with and without thrombin in the presence of BW755C and in the presence and absence of trifluoperazine. The platelet lipids were extracted and the individual phospholipids as well as diacylglycerol (DG), phosphatidic acid (PA), etc. were separated by thin-layer chromatography and the radioactivity in each fraction determined. The [ 3 H]AA/[ 14 C]EPA dpm ratio for the loss in radioactivity from PC upon thrombin stimulation was similar to that for the PC in resting platelets. This suggests no marked selectivity in the degradation of AA versus EPA species of PC during platelet activation. The [ 3 H]/[ 14 C] ratios for the increased radioactivity in DG and PA upon thrombin stimulation were slightly higher than the ratio in PI from resting platelets suggesting only a minor preference for 1-acyl 2-arachidonoyl PI over 1-acyl 2-eicosapentaenoyl PI in the pathway from PI to DG to PA

Killing rate of colony count by hydrodynamic cavitation due to square multi-orifice plates

Science.gov (United States)

Dong, Zhiyong; Zhao, Wenqian

2018-02-01

Currently,in water supply engineering, the conventional technique of disinfection by chlorination is employed to kill pathogenic microorganisms in raw water. However, chlorine reacts with organic compounds in water and generates disinfection byproducts (DBPs), such as trihalomethanes (THMs), haloacetic acids (HAAs) etc. These byproducts are of carcinogenic, teratogenic and mutagenic effects, which seriously threaten human health. Hydrodynamic cavitation is a novel technique of drinking water disinfection without DBPs. Effects of orifice size, orifice number and orifice layout of multi-orifice plate, cavitation number, cavitation time and orifice velocity on killing pathogenic microorganisms by cavitation were investigated experimentally in a self-developed square multi-orifice plate-type hydrodynamic cavitation device. The experimental results showed that cavitation effects increased with decrease in orifice size and increase in orifice number, cavitation time and orifice velocity. Along with lowering in cavitation number, there was an increase in Reynolds shear stress,thus enhancing the killing rate of pathogenic microorganism in raw water. In addition, the killing rate by staggered orifice layout was greater than that by checkerboard-type orifice layout.

Glutamate signalling and secretory phospholipase A2 modulate the release of arachidonic acid from neuronal membranes

DEFF Research Database (Denmark)

Rodriguez De Turco, Elena B; Jackson, Fannie R; DeCoster, Mark A

2002-01-01

The lipid mediators generated by phospholipases A(2) (PLA(2)), free arachidonic acid (AA), eicosanoids, and platelet-activating factor, modulate neuronal activity; when overproduced, some of them become potent neurotoxins. We have shown, using primary cortical neuron cultures, that glutamate...... and secretory PLA(2) (sPLA(2)) from bee venom (bv sPLA(2)) and Taipan snake venom (OS2) elicit synergy in inducing neuronal cell death. Low concentrations of sPLA(2) are selective ligands of cell-surface sPLA(2) receptors. We investigated which neuronal arachidonoyl phospholipids are targeted by glutamate......) and in minor changes in other phospholipids. A similar profile, although of greater magnitude, was observed 20 hr posttreatment. Glutamate (80 microM) induced much less mobilization of (3)H-AA than did sPLA(2) and resulted in a threefold greater degradation of (3)H-AA PE than of (3)H-AA PC by 20 hr...

Pavel Haas Study Day a IMR Study Day: Inter-War Avant-Garde across National and Disciplinary Borders, 30. a 31. ledna 2016, Cardiff University School of Music, Cardiff, Velká Británie

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Markéta; Zapletal, Miloš

2016-01-01

Roč. 53, č. 1 (2016), s. 101-102 ISSN 0018-7003. [Pavel Haas Study Day. Cardiff, 30.01.2016] R&D Projects: GA ČR(CZ) GP14-35842P Institutional support: RVO:68378076 Keywords : Pavel Haas * conference * music * inter-war * avantgarde Subject RIV: AL - Art, Architecture, Cultural Heritage

Kas tasemetööd täidavad oma eesmärki? / Marge Lepik, Kristi Mere, Merike Haas...[jt.

Index Scriptorium Estoniae

2009-01-01

Küsimusele vastavad Lääne-Viru maavalitsuse haridusosakonna juhataja Marge Lepik, Haridus- ja Teadusministeeriumi välishindamisosakonna peaekspert Kristi Mere, Viira kooli klassiõpetaja Merike Haas, Rääma põhikooli direktor Elmo Joa ja Tallinna Ülikooli Haapsalu kolledži õppejõud Sirje Piht

Development of a method for the quantitation of chloro-, bromo-, and iodoacetic acids in alcoholic beverages.

Science.gov (United States)

Cardador, Maria Jose; Gallego, Mercedes

2012-01-25

Chloroacetic, bromoacetic, and iodoacetic acids can be found in alcoholic beverages when they are used as preservatives/stabilizers or as disinfectants. As they are toxic components, their addition is not permitted under European Union and U.S. regulations. To date, no sensitive methods are available, and those proposed are very laborious. This paper describes a sensitive and straightforward method for the determination of the three monohalogenated acetic acids (m-HAAs) in wines and beers using static headspace extraction coupled with gas chromatography-mass spectrometry. Prior to extraction, the target analytes were esterified to increase their volatility, and all parameters related to the extraction/methylation process were optimized to achieve high efficiency (>90%). The study examined the influence both of the ethanol concentration on the headspace partitioning and of the primary acids present in wine on the derivatization reaction of the m-HAAs. The proposed method allows the determination of these compounds at microgram per liter levels in alcoholic beverages.

De Haas-van Alphen effect of a two-dimensional ultracold atomic gas

Science.gov (United States)

Farias, B.; Furtado, C.

2016-01-01

In this paper, we show how the ultracold atom analogue of the two-dimensional de Haas-van Alphen effect in electronic condensed matter systems can be induced by optical fields in a neutral atomic system. The interaction between the suitable spatially varying laser fields and tripod-type trapped atoms generates a synthetic magnetic field which leads the particles to organize themselves in Landau levels. Initially, with the atomic gas in a regime of lowest Landau level, we display the oscillatory behaviour of the atomic energy and its derivative with respect to the effective magnetic field (B) as a function of 1/B. Furthermore, we estimate the area of the Fermi circle of the two-dimensional atomic gas.

Assessment of air and water contamination by disinfection by-products at 41 indoor swimming pools.

Science.gov (United States)

Tardif, Robert; Catto, Cyril; Haddad, Sami; Simard, Sabrina; Rodriguez, Manuel

2016-07-01

This study was aimed at assessing the profiles (occurrence and speciation) of disinfection by-product (DBP) contamination in air and water of a group of 41 public indoor swimming pools in Québec (Canada). The contaminants measured in the water included the traditional DBPs [i.e., four trihalomethanes (THMs), six haloacetic acids (HAAs)] but also several emergent DBPs [i.e., halonitriles, halonitromethanes, haloketones and nitrosodimethylamine (NDMA)]. Those measured in the air comprised THMs and chloramines (CAMs). Overall, extremely variable DBP levels were found from one pool to another (both quantitatively and in terms of speciation). For instance, in water, among the four THMs, chloroform was usually the most abundant compound (37.9±25.7µg/L). Nevertheless, the sum of the three other brominated THMs represented more than 25% of total THMs at almost half the facilities visited (19 cases). In 13 of them, the levels of brominated THMs (66±24.2µg/L) even greatly outweighed the levels of chloroform (15.2±6.31µg/L). Much higher levels of HAAs (294.8±157.6µg/L) were observed, with a consistent preponderance of brominated HAAs in the swimming pools with more brominated THMs. NDMA levels which were measured in a subset of 8 pools ranged between 2.8ng/L and 105ng/L. With respect to air, chloroform was still the most abundant THM globally (119.4±74.2µg/m(3)) but significant levels of brominated THMs were also observed in various cases, particularly in the previously evoked group of 13 swimming pools with preponderant levels of brominated THMs in water. CAM levels (0.23±0.15mg/m(3)) varied highly, ranging from not detected to 0.56mg/m(3). Overall, the levels were generally relatively high compared to current guidelines or reference values from several countries, and they point to a relatively atypical presence of brominated compounds, and to significant levels of emergent DBPs for which health risk is less documented. Copyright © 2016 Elsevier Inc. All rights

Targeting 2.5 versus 4 g/kg/day of amino acids for extremely low birth weight infants: a randomized clinical trial.

Science.gov (United States)

Burattini, Ilaria; Bellagamba, Maria Paola; Spagnoli, Cristina; D'Ascenzo, Rita; Mazzoni, Nadia; Peretti, Anna; Cogo, Paola E; Carnielli, Virgilio P

2013-11-01

To compare the effect of 2.5 vs 4 g/kg/d of amino acid (AA) in parenteral nutrition of extremely low birth weight infants on metabolic tolerance, short-term growth, and neurodevelopment. One hundred thirty-one infants with birth weight between 500 and 1249 g were randomized to 2.5 (standard AA [SAA] group) or 4 (high AA [HAA] group) g/kg/d AA intake, with equal nonprotein energy. The primary outcome was body size at 36 weeks. One hundred thirty-one patients were randomized and 114 analyzed (58 SAA group and 56 HAA group). Study groups had similar demographics and clinical characteristics. Elevated blood urea (BU >70 mg/dL = BU nitrogen >32.6 mg/dL) occurred in 24% vs 59% (P = .000) and hyperglycemia (>175 mg/dL) in 34% vs 11% (P = .003) of the SAA and HAA patients, respectively. Body weight, length, and head circumference at 36 weeks and 2 years were similar between groups. Bayley Scales of Infant and Toddler Development, Third Edition score was 94 ± 13 in the SAA group and 97 ± 15 in the HAA group (P = .35). The HAA group had higher BU levels and better glucose control. An extra 8 g/kg of AA over the first 10 days of life did not improve growth and neurodevelopment. Copyright © 2013 Mosby, Inc. All rights reserved.

ANALISA MODA DAN EFEK KEGAGALAN (FAILURE MODE AND EFFECTS ANALYSIS / FMEA PADA PRODUK KURSI LIPAT CHITOSE YAMATO HAA

Directory of Open Access Journals (Sweden)

Denny Nurkertamanda

2012-02-01

Full Text Available Chitose Indonesia Manufacturing merupakan perusahaan yang memproduksi dan menjual furniture dari logam dengan kerjasama negara Jepang. Berdasarkan data penjualan Chitose Indonesia Manufacturing pada tahun 2003, kursi lipat Chitose Yamato merupakan jenis kursi lipat yang memiliki angka penjualan sebesar 59% dari keseluruhan jenis produk yang diproduksi. Kursi lipat Chitose Yamato HAA merupakan salah satu sarana untuk duduk yang dilengkapi dengan sandaran sesuai dengan bentuk punggung manusia dan dapat dilipat untuk memudahkan penyimpanannya. Selain itu juga rangka kakinya yang berbentuk H sehingga dapat digunakan pada permukaan yang datar atau bergelombang. Material yang digunakan pada rangka kursi lipat Chitose Yamato HAA adalah berupa elemen struktur rangka yang bersifat isotropik, yakni memiliki keseragaman sifat dan bahan suatu elemen (regangan, tegangan, mekanis, dsb. Pada analisa moda kegagalan dilakukan identifikasi moda kegagalan yang potensial, keparahan yang ditimbulkan, dan frekuensi kejadian moda kegagalan. Dengan menggunakan analisa moda kegagalan, maka diharapkan kualitas produk akan meningkat dan dapat digunakan sesuai dengan fungsinya. RPN adalah indikator kekritisan untuk menentukan tindakan koreksi yang sesuai dengan moda kegagalan. RPN digunakan oleh banyak prosedur FMEA untuk menaksir resiko menggunakan tiga kriteria yaitu Keparahan efek (Severity S, Kejadian penyebab (Occurrence O, Deteksi penyebab (Detection D. Angka prioritas RPN merupakan hasil kali rating keparahan, kejadian, dan deteksi. Angka ini hanyalah menunjukkan rangking atau urutan defisiensi desain sistem. Kata kunci : Moda Kegagalan, Efek Kegagalan, Penyebab Kegagalan, Deteksi, Kejadian, Keparahan, RPN (Risk Priority Number.     Chitose Manufacturing Indonesia is a company that produce and sells furniture made from alloy in cooperation with Japan. Based on Sales data by Chitose Indonesia Manufacturing in 2003, Chitose Yamato foldable chair has a sales number

Fingerprinting the reactive toxicity pathways of 50 drinking water disinfection by-products.

Science.gov (United States)

Stalter, Daniel; O'Malley, Elissa; von Gunten, Urs; Escher, Beate I

2016-03-15

A set of nine in vitro cellular bioassays indicative of different stages of the cellular toxicity pathway was applied to 50 disinfection by-products (DBPs) to obtain a better understanding of the commonalities and differences in the molecular mechanisms of reactive toxicity of DBPs. An Eschericia coli test battery revealed reactivity towards proteins/peptides for 64% of the compounds. 98% activated the NRf2-mediated oxidative stress response and 68% induced an adaptive stress response to genotoxic effects as indicated by the activation of the tumor suppressor protein p53. All DBPs reactive towards DNA in the E. coli assay and activating p53 also induced oxidative stress, confirming earlier studies that the latter could trigger DBP's carcinogenicity. The energy of the lowest unoccupied molecular orbital ELUMO as reactivity descriptor was linearly correlated with oxidative stress induction for trihalomethanes (r(2)=0.98) and haloacetamides (r(2)=0.58), indicating that potency of these DBPs is connected to electrophilicity. However, the descriptive power was poor for haloacetic acids (HAAs) and haloacetonitriles (r(2) (0.80, indicating that HAAs' potency is connected to both, electrophilicity and speciation. Based on the activation of oxidative stress response and the soft electrophilic character of most tested DBPs we hypothesize that indirect genotoxicity-e.g., through oxidative stress induction and/or enzyme inhibition-is more plausible than direct DNA damage for most investigated DBPs. The results provide not only a mechanistic understanding of the cellular effects of DBPs but the effect concentrations may also serve to evaluate mixture effects of DBPs in water samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

Exopolymeric substances from drinking water biofilms: Dynamics of production and relation with disinfection by products.

Science.gov (United States)

Lemus Pérez, M F; Rodríguez Susa, M

2017-06-01

Exopolymeric substances (EPS) as an external matrix of biofilm could react with disinfectants in drinking water networks forming disinfection by-products (DBP). Based on an experimental setup using two chlorine conditions-biofilm 1 (2.6 ± 0.8 mgCl/L) and biofilm 2 (0.7 ± 0.2 mg Cl/L)-samples of biofilms were recovered during 9 campaigns and EPS were extracted. Analyses of SUVA, fluorescence and amino acid (AA) content were carried out on the EPS to observe variation over time and correlations with DBP formation potential (DBP fp ) after chlorination. SUVA values were under 2 L/mgC*m showing that both EPS were hydrophilic. Slightly higher SUVA in biofilm 2 with low variation over time was observed. Fluorescence showed that aromatic proteins and fulvic like substances were the principal components and increased in biofilm 1 over time. AA decreased with time, and higher values of alanine, threonine, proline and isoleucine were observed in biofilm 2. Based on general associations, the SUVA of biofilm 2 correlated well with chloroform (CF) (r = 0.80). Generally, in both biofilms, tryptophan-like substances were negatively correlated with DBP while humic acid-like substances correlated positively, but with low indexes (r = 0.3-0.6). Correlations of data from individual sampling increased the indices (r over 0.8), suggesting a temporal influence of other factors on DBP fp such as inorganics, filtered water and the structural composition of EPS. In biofilm 1, Br-haloacetic acids (Br-HAA), dibromoacetonitrile and bromochloro acetonitrile were inversely associated with arginine and valine, as were di and trichloropropanone to arginine. On the contrary, in biofilm 2, the following amino acids correlated positively with DBP: alanine with Br-HAA, alanine with CF, alanine with N-DBP (chloropicrin, di and tri-chloro acetonitrile), and valine with CF. As this is the first report about the relation between temporal variation of EPS and DBP fp of biofilms in two

Microwave radiation absorption and Shubnikov-de Haas oscillations in semimetal InAs/GaSb/AlSb composite quantum wells

Czech Academy of Sciences Publication Activity Database

Mikhailova, M. P.; Veinger, A.I.; Kochman, I.V.; Semenikhin, P.V.; Kalinina, K.V.; Parfeniev, R.V.; Berezovets, V.A.; Safonchik, M.O.; Hospodková, Alice; Pangrác, Jiří; Zíková, Markéta; Hulicius, Eduard

2016-01-01

Roč. 10, č. 4 (2016), 1-8, č. článku 046013. ISSN 1934-2608 R&D Projects: GA ČR GA13-15286S; GA MŠk LO1603 Institutional support: RVO:68378271 Keywords : Shubnikov-de Haas oscillations * microwave absorption * electron-paramagnetic resonance * composite quantum wells * InAs/GaSb/AlSb * MOVPE Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.325, year: 2016

Corrosion in Haas expanders with and without use of an antimicrobial agent: an in situ study

Science.gov (United States)

BAGATIN, Cristhiane Ristum; ITO, Izabel Yoko; ANDRUCIOLI, Marcela Cristina Damião; NELSON-FILHO, Paulo; FERREIRA, José Tarcísio Lima

2011-01-01

Objectives The purpose of this study was to evaluate in situ the occurrence of corrosion in the soldering point areas between the wire, silver brazing and band in Haas expanders. Material and Methods Thirty-four 7-12-year-old patients who needed maxillary expansion with a Haas expander were randomly assigned to two groups of 17 individuals each, according to the oral hygiene protocol adopted during the orthodontic treatment: Group I (control), toothbrushing with a fluoride dentifrice and Group II (experimental), toothbrushing with the same dentifrice plus 0.12% chlorhexidine gluconate (Periogard®) mouthrinses twice a week. The appliances were removed after approximately 4 months. Fragments of the appliances containing a metallic band with a soldered wire were sectioned at random for examination by stereomicroscopy, scanning electron microscopy (SEM) and energy dispersive x-ray spectroscopy (EDS). Data were analyzed statistically by Fisher's test at 5% significance level. Results The analysis by optical microscopy revealed areas with color change suggestive of corrosion in the soldering point areas joining the band and the wire in all specimens of both groups, with no statistically significant difference between the groups (p=1). The peaks of chemical elements (Ni, Fe, Cr, O, C and P) revealed by EDS were also similar in both groups. Conclusion: Color changes and peaks of chemical elements suggestive of corrosion were observed in the soldering point areas between the wire, silver brazing and band in both control and experimental groups, which indicate that the 0.12% chlorhexidine gluconate mouthrinses did not influence the occurrence of corrosion in situ. PMID:22231004

Impact of Nitrification on the Formation of N-Nitrosamines and Halogenated Disinfection Byproducts within Distribution System Storage Facilities.

Science.gov (United States)

Zeng, Teng; Mitch, William A

2016-03-15

Distribution system storage facilities are a critical, yet often overlooked, component of the urban water infrastructure. This study showed elevated concentrations of N-nitrosodimethylamine (NDMA), total N-nitrosamines (TONO), regulated trihalomethanes (THMs) and haloacetic acids (HAAs), 1,1-dichloropropanone (1,1-DCP), trichloroacetaldehyde (TCAL), haloacetonitriles (HANs), and haloacetamides (HAMs) in waters with ongoing nitrification as compared to non-nitrifying waters in storage facilities within five different chloraminated drinking water distribution systems. The concentrations of NDMA, TONO, HANs, and HAMs in the nitrifying waters further increased upon application of simulated distribution system chloramination. The addition of a nitrifying biofilm sample collected from a nitrifying facility to its non-nitrifying influent water led to increases in N-nitrosamine and halogenated DBP formation, suggesting the release of precursors from nitrifying biofilms. Periodic treatment of two nitrifying facilities with breakpoint chlorination (BPC) temporarily suppressed nitrification and reduced precursor levels for N-nitrosamines, HANs, and HAMs, as reflected by lower concentrations of these DBPs measured after re-establishment of a chloramine residual within the facilities than prior to the BPC treatment. However, BPC promoted the formation of halogenated DBPs while a free chlorine residual was maintained. Strategies that minimize application of free chlorine while preventing nitrification are needed to control DBP precursor release in storage facilities.

An Environmentally Friendly Method for Testing Photocatalytic Inactivation of Cyanobacterial Propagation on a Hybrid Ag-TiO2 Photocatalyst under Solar Illumination

Science.gov (United States)

Chang, Shu-Yu; Huang, Winn-Jung; Lu, Ben-Ren; Fang, Guor-Cheng; Chen, Yeah; Chen, Hsiu-Lin; Chang, Ming-Chin; Hsu, Cheng-Feng

2015-01-01

Cyanobacteria were inactivated under sunlight using mixed phase silver (Ag) and deposited titanium dioxide (TiO2) coated on the surface of diatomite (DM) as a hybrid photocatalyst (Ag-TiO2/DM). The endpoints of dose-response experiments were chlorophyll a, photosynthetic efficiency, and flow cytometry measurements. In vitro experiments revealed that axenic cultures of planktonic cyanobacteria lost their photosynthetic activity following photocatalyzed exposure to sunlight for more than 24 h. Nearly 92% of Microcystis aeruginosa cells lost their photosynthetic activity, and their cell morphology was severely damaged within 24 h of the reaction. Preliminary carbon-14 (14CO3−2) results suggest that the complete inactivation of cyanobacteria arises from damage to cell wall components (peroxidation). A small concomitant increase in cell wall disorder and a consequent decrease in cell wall functional groups increase the cell wall fluidity prior to cell lysis. A high dosage of Ag-TiO2/DM during photocatalysis increased the concentration of extracellular polymeric substances (EPSs) in the Microcystis aeruginosa suspension by up to approximately 260%. However, photocatalytic treatment had a small effect on the disinfection by-product (DBP) precursor, as revealed by only a slight increase in the formation of trihalomethanes (THMs) and haloacetic acids (HAAs). PMID:26690465

An Environmentally Friendly Method for Testing Photocatalytic Inactivation of Cyanobacterial Propagation on a Hybrid Ag-TiO2 Photocatalyst under Solar Illumination

Directory of Open Access Journals (Sweden)

Shu-Yu Chang

2015-12-01

Full Text Available Cyanobacteria were inactivated under sunlight using mixed phase silver (Ag and deposited titanium dioxide (TiO2 coated on the surface of diatomite (DM as a hybrid photocatalyst (Ag-TiO2/DM. The endpoints of dose-response experiments were chlorophyll a, photosynthetic efficiency, and flow cytometry measurements. In vitro experiments revealed that axenic cultures of planktonic cyanobacteria lost their photosynthetic activity following photocatalyzed exposure to sunlight for more than 24 h. Nearly 92% of Microcystis aeruginosa cells lost their photosynthetic activity, and their cell morphology was severely damaged within 24 h of the reaction. Preliminary carbon-14 (14CO3−2 results suggest that the complete inactivation of cyanobacteria arises from damage to cell wall components (peroxidation. A small concomitant increase in cell wall disorder and a consequent decrease in cell wall functional groups increase the cell wall fluidity prior to cell lysis. A high dosage of Ag-TiO2/DM during photocatalysis increased the concentration of extracellular polymeric substances (EPSs in the Microcystis aeruginosa suspension by up to approximately 260%. However, photocatalytic treatment had a small effect on the disinfection by-product (DBP precursor, as revealed by only a slight increase in the formation of trihalomethanes (THMs and haloacetic acids (HAAs.

Ecotoxicology of bromoacetic acid on estuarine phytoplankton

International Nuclear Information System (INIS)

Gordon, Ana R.; Richardson, Tammi L.; Pinckney, James L.

2015-01-01

Bromoacetic acid is formed when effluent containing chlorine residuals react with humics in natural waters containing bromide. The objective of this research was to quantify the effects of bromoacetic acid on estuarine phytoplankton as a proxy for ecosystem productivity. Bioassays were used to measure the EC 50 for growth in cultured species and natural marine communities. Growth inhibition was estimated by changes in chlorophyll a concentrations measured by fluorometry and HPLC. The EC 50 s for cultured Thalassiosira pseudonana were 194 mg L −1 , 240 mg L −1 for Dunaliella tertiolecta and 209 mg L −1 for Rhodomonas salina. Natural phytoplankton communities were more sensitive to contamination with an EC 50 of 80 mg L −1 . Discriminant analysis suggested that bromoacetic acid additions cause an alteration of phytoplankton community structure with implications for higher trophic levels. A two-fold EC 50 decrease in mixed natural phytoplankton populations affirms the importance of field confirmation for establishing water quality criteria. - Highlights: • Bromoacetic acid exposure resulted in lethal impacts to estuarine phytoplankton. • Cultured phytoplankton were less sensitive to bromoacetic acid than natural communities. • Lab results should be confirmed with field experiments whenever possible. - The toxicology of haloacetic acids has been studied in freshwater ecosystems, and urbanization of the coastal zone is making effects in marine ecosystems equally relevant.

An early feeding regime and a high-density amino acid diet on growth performance of broilers under subclinical necrotic enteritis challenge

Directory of Open Access Journals (Sweden)

Chake Keerqin

2017-03-01

Full Text Available Broilers that have early access to feed have been shown to have enhanced immune system and gut development and heightened resilience against necrotic enteritis (NE. This study examined the effect of early feeding a high amino acid density diet on performance of broilers under a sub-clinical NE challenge model. Ross 308 broilers (n = 576 were assigned to a 2 × 2 × 2 factorial design with 2 feeding regimes (feed access either within 6 h post-hatch or after 48 h post-hatch, 2 diets (control diet or the control diet with an additional 10% digestible amino acids [HAA] and either presence or absence of NE challenge. Oral administrations of Eimeria species (d 9 and a field strain of Clostridium perfringens (d 14 were used to induce NE. Broiler performance was analysed at d 13, 23, 30 and 35. Intestinal lesion score and bacterial count were analysed on d 16. The NE challenge reduced overall bird performance and induced severe intestinal lesions, without causing notable mortality. At d 23 bird weight was significantly lower (P < 0.001 in the challenged birds compared with the unchallenged birds, but by d 30 the challenged birds had recovered and challenge no longer had an impact on bird performance. Birds fed the HAA diet had greater body weight by d 35 and heightened Lactobacillus content in the ileum at d 16 (P < 0.05. Birds that were fed the HAA diet after a period of fasting performed better in terms of feed conversion ratio (FCR under challenge. The findings from this study suggest there are beneficial effects of feeding high amino acid diets to birds in response to external stresses, such as post-hatch fasting and subclinical NE.

Shubnikov-de Haas effect study of InAs after transmutation doping at low temperatures

International Nuclear Information System (INIS)

Gerstenberg, H.; Mueller, P.

1990-01-01

Degenerate InAs single crystals have been irradiated by thermal neutrons below 6 K. The Shubnikov-de Haas effect and the electrical resistivity have been measured as a function of the neutron dose and the annealing temperature. The effects of transmutation doping and simultaneous introduction of lattice defects have been analysed in terms of the conduction electron density and the scattering rates τ ρ -1 - ρne 2 /m * and τ x -1 2πkub(B)X/h/2π (where X is the Dingle temperature). The measured conduction electron density after irradiation and thermal annealing agreed well with the values calculated from the experimental and materials parameters. The effects of radiation damage may qualitatively be explained assuming neutral In vacancies to be the most common type of defect in thermal-neutron-irradiated InAs. A comparison with similar experiments on InSb is given. (author)

Assessment of Diiodoacetic Effects on Eye Malformations in a Developmental Toxicity Screen with F344 Rats

Science.gov (United States)

Diiodoacetic acid (DIA) is an iodinated haloacetic acid and a drinking water disinfection by-product (DBP) formed in drinking water treated by chloramination (chlorine plus ammonia) to prevent microbial contamination and regrowth. Although disinfection of drinking water has prove...

Upper Critical Field and de Haas-van Alphen Oscillations in KOs2O6 Measured in a Hybrid Magnet

Science.gov (United States)

Taichi Terashima,; Nobuyuki Kurita,; Atsushi Harada,; Kota Kodama,; Jun-ichi Yamaura,; Zenji Hiroi,; Hisatomo Harima,; Shinya Uji,

2010-08-01

Magnetic torque measurements have been performed on a KOs2O6 single crystal in magnetic fields up to 35.3 T and at temperatures down to 0.6 K. The upper critical field is determined to be ˜30 T. De Haas-van Alphen oscillations are observed. A large mass enhancement of (1+λ) = m* / mband = 7.6 is found. It is suggested that, for the large upper critical field to be reconciled with Pauli paramagnetic limiting, the observed mass enhancement must be of electron-phonon origin, including electron-rattling-mode interactions, for the most part.

Biological Treatment of Water Disinfection Byproducts using ...

Science.gov (United States)

Major disinfection by-products (DBPs) from the chlorination process of drinking water include trihalomethanes (THMs) and haloacetic acides (HAA5). THMs mainly consist of chloroform, and other harsh chemicals. Prolonged consumptions of drinking water containing high levels of THMs has been linked with diseases of the liver, kidneys, bladder, or central nervous system and may increase likelihood of cancer. A risk also exists for THMs exposure via inhalation while showering, bathing or washing clothes and dishes. Due to these risks, the U.S. EPA regulate THMs content in drinking water. This research investigates biological degradation of THM using chloroform as a model compound. The study aims to decrease possible risks of THMs through filtration. Throughout this year’s presentations, there is a common theme of health and safety concerns. UC researchers are working hard to clean water ways of naturally occurring contaminates as well as man-made toxins found in our waterways. The significance of these presentations translates into the promise of safer environments, and more importantly saved lives, as UC’s faculty continues to produce real-world solutions to problems threatening the world around us. A biotech process has been developed and demonstrated that effectively remove and treat volatile disinfection by-products from drinking water. The process strips low concentration disinfection by-products, such as trihalomethanes, that are formed during the chlori

Avaliação comparativa dos efeitos maxilares da expansão rápida da maxila com os aparelhos de Haas e Hyrax Comparative evaluation of maxilar effects of rapid maxilar expansion with Haas and Hyrax appliances

Directory of Open Access Journals (Sweden)

Marco Antônio Scanavini

2006-02-01

Full Text Available OBJETIVO: avaliar cefalometricamente os efeitos da expansão rápida da sutura palatina mediana sobre o posicionamento vertical e sagital da maxila, comparando os aparelhos de Haas e Hyrax. METODOLOGIA: a amostra consistiu de 93 telerradiografias obtidas de 31 pacientes jovens, brasileiros, de ambos os gêneros, na faixa etária inicial média de 13 anos e 2 meses. As radiografias foram tomadas ao início do tratamento (pré-disjunção, imediatamente após a disjunção (pós-disjunção e ao final do nivelamento. RESULTADOS E CONCLUSÕES: constatou-se que os dois aparelhos disjuntores apresentaram resultados semelhantes, com a ocorrência de deslocamento da maxila em direção inferior, sem rotação, que se manteve ao final do nivelamento e ocorrência de um deslocamento anterior logo após a disjunção, que retornou aos valores pré-disjunção ao final do nivelamento.AIM: the purpose of this cephalometric study was to evaluate, by lateral cephalograms, the changes in maxilar positioning after rapid disjunction of the midpalatal suture, following the use of two types of maxillary disjunction appliances, checked in different phases, and the likely differences between the two appliances Haas and Hyrax. METHODS: the sample comprised of 93 lateral cephalograms, taken before treatment (pre-disjunction, immediately after disjunction and at the end of levelling, obtained from 31 brazilian youths with both genres and average age of 13 years and 2 months. RESULTS AND CONCLUSIONS: both types of appliances showed similar results, with anterior and lower displacement of maxila right after disjunction. Lower displacement was without rotation, and mainttened stable until the end of levelling. Anterior displacement, however, was not stable and cephalometric measurements like SNA and Nperp-A tended to returned to initial values at the end of levelling.

Bromine incorporation into five DBP classes upon chlorination of water with extremely low SUVA values.

Science.gov (United States)

Hong, Huachang; Yan, Xiaoqing; Song, Xuhui; Qin, Yanyan; Sun, Hongjie; Lin, Hongjun; Chen, Jianrong; Liang, Yan

2017-07-15

The main objective of this study was to assess the effects of disinfection conditions on bromine incorporation into disinfection by-products (DBPs) during chlorination of water with low specific UV absorbance (SUVA). Five classes of DBPs were included: trihalomethanes (THMs), dihaloacetic acids (di-HAAs), trihaloacetic acids (tri-HAAs), dihaloacetonitriles (DHANs) and trihalonitromethanes (THNMs). Results showed that the bromine utilization in DBPs formation was positive related with reaction time, pH and temperature. On the other hand, the bromine substitution factors (BSFs) of DBPs were generally increased with pH (except tri-HAAs) and bromide concentration, but decreased with the reaction time, temperature and chlorine dose. Moreover, the BSFs values varied with DBP classes with the ranking being as following: THNMs≫DHANs≫tri-HAAs>THM≈di-HAAs. These results were mostly similar with the references, yet the pH effect on BSFs as well as the rank of BSFs for different DBP classes may differ with the specific UV absorbance of organic matter. Copyright © 2017 Elsevier B.V. All rights reserved.

Reproductive toxicity of a mixture of regulated drinking-water disinfection by-products in a multigenerational rat bioassay

Science.gov (United States)

BACKGROUND:Trihalomethanes (THMs) and haloaretic acids (HAAs) are regulated disinfection by-products (DBPs); their joint reproductive toxicity in drinking water is unknown.OBJECTIVE: We aimed to evaluate a drinking water mixture of the four regulated THMs and five regulated HAAs ...

de Haas-van Alphen effect investigations of the electronic structure of pure and aluminum-doped MgB2

International Nuclear Information System (INIS)

Carrington, A.; Yelland, E.A.; Fletcher, J.D.; Cooper, J.R.

2007-01-01

Our understanding of the superconducting properties of MgB 2 is strongly linked to our knowledge of its electronic structure. In this paper we review experimental measurements of the Fermi surface parameters of pure and Al-doped MgB 2 using the de Haas-van Alphen (dHvA) effect. In general, the measurements are in excellent agreement with the theoretical predictions of the electronic structure, including the strength of the electron-phonon coupling on each Fermi surface sheet. For the Al doped samples, we are able to measure how the band structure changes with doping. These results are in excellent agreement with calculations based on the virtual crystal approximation. We also review work on the dHvA effect in the superconducting state

Topological nature of the node-arc semimetal PtSn4 probed by de Haas-van Alphen quantum oscillations

Science.gov (United States)

Wang, Y. J.; Liang, D. D.; Ge, M.; Yang, J.; Gong, J. X.; Luo, L.; Pi, L.; Zhu, W. K.; Zhang, C. J.; Zhang, Y. H.

2018-04-01

Dirac node arc semimetal state is a new topological quantum state which is proposed to exist in PtSn4 (Wu et al 2016 Dirac node arcs in PtSn4 Nat. Phys. 12 667–71). We present a systematic de Haas-van Alphen quantum oscillation study on this compound. Two intriguing oscillation branches, i.e. F 1 and F 2, are detected in the fast Fourier transformation spectra, both of which are characterized to possess tiny effective mass and ultrahigh quantum mobility. And the F 2 branch exhibits an angle-dependent nontrivial Berry phase. The features are consistent with the existence of the node arc semimetal state and shed new light on its complicated Fermi surfaces and topological nature.

Selective separation of indium by iminodiacetic acid chelating resin

International Nuclear Information System (INIS)

Fortes, M.C.B.; Benedetto, J.S.; Martins, A.H.

2007-01-01

- Indium can be recovered by treating residues, flue dusts, slags, and metallic intermediates in zinc smelting. This paper investigates the adsorption characteristics of indium and iron on an iminodiacetic acid chelating resin, Amberlite R IRC748 (Rohm and Haas Co.-USA). High concentrations of iron are always present in the aqueous feed solution of indium recovery. In addition, the chemical behaviour of iron in adsorptive systems is similar to that of indium. The metal concentrations in the aqueous solution were based on typical indium sulfate leach liquor obtained from zinc hydrometallurgical processing in a Brazilian plant. The ionic adsorption experiments were carried out by the continuous column method. Amberlite R IRC748 resin had a high affinity for indium under acidic conditions. Indium ions adsorbed onto the polymeric resin were eluted with a 0.5 mol/dm 3 sulphuric acid solution passed through the resin bed in the column. 99.5% pure indium sulfate aqueous solution was obtained using the iminodiacetic acid chelating resin Amberlite R IRC748. (author)

Source Water Management for Disinfection By-Product Control using New York City's Operations Support Tool and On-Line Monitoring

Science.gov (United States)

Weiss, W. J.; Becker, W.; Schindler, S.

2012-12-01

The United States Environmental Protection Agency's 2006 Stage 2 Disinfectant / Disinfection Byproduct Rule (DBPR) for finished drinking waters is intended to reduce overall DBP levels by limiting the levels of total trihalomethanes (TTHM) and five of the haloacetic acids (HAA5). Under Stage 2, maximum contaminant levels (MCLs), 80 μg/L for TTHM and 60 μg/L for HAA5, are based on a locational running annual average for individual sites instead of as the system-wide quarterly running annual average of the Stage 1 DBPR. This means compliance will have to be met at sampling locations of peak TTHM and HAA5 concentrations rather than an average across the entire system. Compliance monitoring under the Stage 2 DBPR began on April 1, 2012. The New York City (NYC) Department of Environmental Protection (DEP) began evaluating potential impacts of the Stage 2 DBPR on NYC's unfiltered water supply in 2002 by monitoring TTHM and HAA5 levels at various locations throughout the distribution system. Initial monitoring indicated that HAA5 levels could be of concern in the future, with the potential to intermittently violate the Stage 2 DBPR at specific locations, particularly those with high water age. Because of the uncertainty regarding the long-term prospect for compliance, DEP evaluated alternatives to ensure compliance, including operational changes (reducing chlorine dose, changing flow configurations to minimize water age, altering pH, altering source water withdrawals); changing the residual disinfectant from free chlorine to chloramines; and engineered treatment alternatives. This paper will discuss the potential for using DEP's Operations Support Tool (OST) and enhanced reservoir monitoring to support optimization of source water withdrawals to minimize finished water DBP levels. The OST is a state-of-the-art decision support system (DSS) to provide computational and predictive support for water supply operations and planning. It incorporates a water supply system

Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.

Science.gov (United States)

Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao

2012-10-01

Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DISINFECTION BY-PRODUCT FORMATION BY ALTERNATIVE DISINFECTANTS AND REMOVAL BY GRANULAR ACTIVATED CARBON

Science.gov (United States)

The effects of the use of the alternative disinfectants on the formation of halogenated disinfection by–products (DBPs) including total organic halide, trihalomethanes, haloacetic acids, haloacetonitriles, haloketones, chloral hydrate, and chloropicrin, were examined along ...

Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

Science.gov (United States)

Herzog, F.; Hardtdegen, H.; Schäpers, Th; Grundler, D.; Wilde, M. A.

2017-10-01

The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin-orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI.

Experimental determination of Rashba and Dresselhaus parameters and g *-factor anisotropy via Shubnikov-de Haas oscillations

International Nuclear Information System (INIS)

Herzog, F; Grundler, D; Wilde, M A; Hardtdegen, H; Schäpers, Th

2017-01-01

The spin splitting of conduction band electrons in inversion-asymmetric InGaAs/InP quantum wells (QWs) is studied by Shubnikov-de Haas measurements combining the analysis of beating patterns and coincidence measurements in doubly tilted magnetic fields. The method allows us to determine the absolute values of the Rashba and linear Dresselhaus spin–orbit interaction (SOI) coefficients, their relative sign and the full Landé g-tensor. This is achieved by analyzing the anisotropy of the beat node positions with respect to both polar and azimuthal angles between the magnetic field direction and the QW normal. We show that the SOI is dominated by a large Rashba coefficient together with a linear Dresselhaus coefficient that is 10% of the Rashba coefficient. Their relative sign is found to be positive. The g-tensor is found to have a marked out-of-plane anisotropy and a smaller but distinct in-plane anisotropy due to SOI. (paper)

Examining the interrelationship between DOC, bromide and chlorine dose on DBP formation in drinking water--a case study.

Science.gov (United States)

Bond, Tom; Huang, Jin; Graham, Nigel J D; Templeton, Michael R

2014-02-01

During drinking water treatment aqueous chlorine and bromine compete to react with natural organic matter (NOM). Among the products of these reactions are potentially harmful halogenated disinfection by-products, notably four trihalomethanes (THM4) and nine haloacetic acids (HAAs). Previous research has concentrated on the role of bromide in chlorination reactions under conditions of a given NOM type and/or concentration. In this study different concentrations of dissolved organic carbon (DOC) from U.K. lowland water were reacted with varying amounts of bromide and chlorine in order to examine the interrelationship between the three reactants in the formation of THM4, dihaloacetic acids (DHAAs) and trihaloacetic acids (THAAs). Results showed that, in general, molar yields of THM4 increased with DOC, bromide and chlorine concentrations, although yields did fluctuate versus chlorine dose. In contrast both DHAA and THAA yields were mainly independent of changes in bromide and chlorine dose at low DOC (1 mg·L(-1)), but increased with chlorine dose at higher DOC concentrations (4 mg·L(-1)). Bromine substitution factors reached maxima of 0.80, 0.67 and 0.65 for the THM4, DHAAs and THAAs, respectively, at the highest bromide/chlorine ratio studied. These results suggest that THM4 formation kinetics depend on both oxidation and halogenation steps, whereas for DHAAs and THAAs oxidation steps are more important. Furthermore, they indicate that high bromide waters may prove more problematic for water utilities with respect to THM4 formation than for THAAs or DHAAs. While mass concentrations of all three groups increased in response to increased bromide incorporation, only the THMs also showed an increase in molar yield. Overall, the formation behaviour of DHAA and THAA was more similar than that of THM4 and THAA. © 2013.

Detection of chlorinated and brominated byproducts of drinking water disinfection using electrospray ionization-high-field asymmetric waveform ion mobility spectrometry-mass spectrometry.

Science.gov (United States)

Ells, B; Barnett, D A; Froese, K; Purves, R W; Hrudey, S; Guevremont, R

1999-10-15

The lower limit of detection for low molecular weight polar and ionic analytes using electrospray ionization-mass spectrometry (ESI-MS) is often severely compromised by an intense background that obscures ions of trace components in solution. Recently, a new technique, referred to as high-field asymmetric waveform ion mobility spectrometry (FAIMS), has been shown to separate gas-phase ions at atmospheric pressure and room temperature. A FAIMS instrument is an ion filter that may be tuned, by control of electrical voltages, to continuously transmit selected ions from a complex mixture. This capability offers significant advantages when FAIMS is coupled with ESI, a source that generates a wide variety of ions, including solvent clusters and salt adducts. In this report, the tandem arrangement of ESI-FAIMS-MS is used for the analysis of haloacetic acids, a class of disinfection byproducts regulated by the US EPA. FAIMS is shown to effectively discriminate against background ions resulting from the electrospray of tap water solutions containing the haloacetic acids. Consequently, mass spectra are simplified, the selectivity of the method is improved, and the limits of detection are lowered compared with conventional ESI-MS. The detection limits of ESI-FAIMS-MS for six haloacetic acids ranged between 0.5 and 4 ng/mL in 9:1 methanol/tap water (5 and 40 ng/mL in the original tap water samples) with no preconcentration, derivatization, or chromatographic separation prior to analysis.

Antioxidant Properties of Kynurenines: Density Functional Theory Calculations

Science.gov (United States)

2016-01-01

Kynurenines, the main products of tryptophan catabolism, possess both prooxidant and anioxidant effects. Having multiple neuroactive properties, kynurenines are implicated in the development of neurological and cognitive disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Autoxidation of 3-hydroxykynurenine (3HOK) and its derivatives, 3-hydroxyanthranilic acid (3HAA) and xanthommatin (XAN), leads to the hyperproduction of reactive oxygen species (ROS) which damage cell structures. At the same time, 3HOK and 3HAA have been shown to be powerful ROS scavengers. Their ability to quench free radicals is believed to result from the presence of the aromatic hydroxyl group which is able to easily abstract an electron and H-atom. In this study, the redox properties for kynurenines and several natural and synthetic antioxidants have been calculated at different levels of density functional theory in the gas phase and water solution. Hydroxyl bond dissociation enthalpy (BDE) and ionization potential (IP) for 3HOK and 3HAA appear to be lower than for xanthurenic acid (XAA), several phenolic antioxidants, and ascorbic acid. BDE and IP for the compounds with aromatic hydroxyl group are lower than for their precursors without hydroxyl group. The reaction rate for H donation to *O-atom of phenoxyl radical (Ph-O*) and methyl peroxy radical (Met-OO*) decreases in the following rankings: 3HOK ~ 3HAA > XAAOXO > XAAENOL. The enthalpy absolute value for Met-OO* addition to the aromatic ring of the antioxidant radical increases in the following rankings: 3HAA* < 3HOK* < XAAOXO* < XAAENOL*. Thus, the high free radical scavenging activity of 3HAA and 3HOK can be explained by the easiness of H-atom abstraction and transfer to O-atom of the free radical, rather than by Met-OO* addition to the kynurenine radical. PMID:27861556

Quantum oscillations without a Fermi surface. The anomalous de Haas-van Alphen effect and relation to SmB{sub 6}

Energy Technology Data Exchange (ETDEWEB)

Knolle, Johannes; Cooper, Nigel [T.C.M. Group, Cavendish Laboratory, J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

2016-07-01

The de Haas-van Alphen effect (dHvAE), describing oscillations of the magnetization as a function of magnetic field, is commonly assumed to be a definite sign for the presence of a Fermi surface (FS). Indeed, the effect forms the basis of a well-established experimental procedure for accurately measuring FS topology and geometry of metallic systems, with parameters commonly extracted by fitting to the Lifshitz-Kosevich (LK) theory based on Fermi liquid theory. Here we show that, in contrast to this canonical situation, there can be quantum oscillations even for band insulators of certain types. We provide simple analytic formulas describing the temperature dependence of the quantum oscillations in this setting, showing strong deviations from LK theory. We draw connections to recent experiments on the tentative topological Kondo insulator SmB{sub 6}.

Toxic Byproduct Formation during Electrochemical Treatment of Latrine Wastewater.

Science.gov (United States)

Jasper, Justin T; Yang, Yang; Hoffmann, Michael R

2017-06-20

Electrochemical systems are an attractive option for onsite latrine wastewater treatment due to their high efficiency and small footprint. While concerns remain over formation of toxic byproducts during treatment, rigorous studies examining byproduct formation are lacking. Experiments treating authentic latrine wastewater over variable treatment times, current densities, chloride concentrations, and anode materials were conducted to characterize byproducts and identify conditions that minimize their formation. Production of inorganic byproducts (chlorate and perchlorate) and indicator organic byproducts (haloacetic acids and trihalomethanes) during electrolysis dramatically exceeded recommendations for drinking water after one treatment cycle (∼10-30 000 times), raising concerns for contamination of downstream water supplies. Stopping the reaction after ammonium was removed (i.e., the chlorination breakpoint) was a promising method to minimize byproduct formation without compromising disinfection and nutrient removal. Though treatment was accelerated at increased chloride concentrations and current densities, byproduct concentrations remained similar near the breakpoint. On TiO 2 /IrO 2 anodes, haloacetic acids (up to ∼50 μM) and chlorate (up to ∼2 μM) were of most concern. Although boron-doped diamond anodes mineralized haloacetic acids after formation, high production rates of chlorate and perchlorate (up to ∼4 and 25 μM) made them inferior to TiO 2 /IrO 2 anodes in terms of toxic byproduct formation. Organic byproduct formation was similar during chemical chlorination and electrolysis of wastewater, suggesting that organic byproducts are formed by similar pathways in both cases (i.e., reactions with chloramines and free chlorine).

Tensile strained gray tin: Dirac semimetal for observing negative magnetoresistance with Shubnikov-de Haas oscillations

Science.gov (United States)

Huang, Huaqing; Liu, Feng

2017-05-01

The extremely stringent requirement on material quality has hindered the investigation and potential applications of exotic chiral magnetic effect in Dirac semimetals. Here, we propose that gray tin is a perfect candidate for observing the chiral anomaly effect and Shubnikov-de-Haas (SdH) oscillation at relatively low magnetic field. Based on effective k .p analysis and first-principles calculations, we discover that gray tin becomes a Dirac semimetal under tensile uniaxial strain, in contrast to a topological insulator under compressive uniaxial strain as known before. In this newly found Dirac semimetal state, two Dirac points which are tunable by tensile [001] strains lie in the kz axis and Fermi arcs appear in the (010) surface. Due to the low carrier concentration and high mobility of gray tin, a large chiral anomaly induced negative magnetoresistance and a strong SdH oscillation are anticipated in this half of the strain spectrum. Comparing to other Dirac semimetals, the proposed Dirac semimetal state in the nontoxic elemental gray tin can be more easily manipulated and accurately controlled. We envision that gray tin provides a perfect platform for strain engineering of chiral magnetic effects by sweeping through the strain spectrum from positive to negative and vice versa.

Study on an integrated process combining ozonation with ceramic ultra-filtration for decentralized supply of drinking water.

Science.gov (United States)

Zhu, Jia; Fan, Xiao J; Tao, Yi; Wei, De Q; Zhang, Xi H

2014-09-19

An integrated process was specifically developed for the decentralized supply of drinking water from micro-polluted surface water in the rural areas of China. The treatment process combined ozonation with ceramic ultra-filtration (UF), coagulation for pre-treatment and granular activated carbon filtration. A flat-sheet ceramic membrane was used with a cut-off of 60 nm and the measurement of 254 mm (length) × 240 mm (width) × 6 mm (thickness). Ozonation and ceramic UF was set up whthin one reactor. The experimental results showed that the removal efficiencies of the dissolved organic carbon (DOC) and the formation potential of trihalomethanes (THMs), haloacetic acids (HAAs) and ammonia were 80%, 76%, 70% and 90%, respectively; that the turbidity of the product water was below 0.2 NTU and the particle count number (particles larger than 2 μm) was less than 50 counts per mL. The result also showed that all the pathogenic microorganisms were retained by the ceramic and that UF. Ozonation played a critical role in the control of membrane fouling and the removal of contaminants. Exactly, the membrane fouling can be controlled in situ with 3 mg L(-1) ozone at the permeate flux of 80 L m(-2) h(-1), yet the required dosage of ozone was dependent on the quality of the raw water. Therefore, this study is able to provide a highly compacted system for decentralized supply of high-quality drinking water in terms of both chemical and microbiological safety for the rural areas in China.

Recognition of acidic phospholipase A2 activity in plasma membranes of resident peritoneal macrophages

International Nuclear Information System (INIS)

Shibata, Y.; Abiko, Y.; Ohno, H.; Araki, T.; Takiguchi, H.

1988-01-01

Phospholipase (PLase) activities in the plasma membrane of guinea pig peritoneal macrophages were studied, as these enzymes having such activity may be candidates for the release of arachidonic acid (AA) from phosphatidylcholine (PC). An AA release system operating at acidic pH was identified in the macrophage plasma membrane and characterized. This membrane-bound acidic PLase A 2 had an optimum pH at 4.5, and enzyme activation was observed in Ca ++ -free medium; but the maximum activity was found at 0.5 mM Ca ++ concentration. The Km value for PC of acidic PLase A 2 was 4.2 μM, and a Michaelis-Menten relationship was evident. Calcium might act as a cofactor at some intermediate step during the activation of acidic PLase A 2 in light of the uncompetitive manner of Ca ++ action. Furthermore, the release of [ 3 H]-AA from preradiolabelled macrophage plasma membranes occurred with the addition of Ca ++ at pH 4.5. These data suggest that the acid PLase A 2 is a component of the plasma membrane and is not due to lysosomal contamination since membrane-bound acidic PLase A 2 properties are opposite to those found for lysosomal PLase A 2

High field magnetoresistance and de Haas-van Alphen effect in antiferromagnetic PrB6 and NdB6

International Nuclear Information System (INIS)

Onuki, Y.; Umezawa, A.; Kwok, W.K.; Crabtree, G.W.; Nishihara, M.; Yamazaki, T.; Omi, T.; Komatsubara, T.

1987-08-01

The transport properties and the de Haas-van Alphen (dHvA) effect have been measured for antiferromagnetic PrB 6 and NdB 6 . The number of conduction electrons is approximately one per unit cell. The magnetoresistance shows the existence of open orbits implying a multiply connected Fermi surface. The angular dependence of the magnetoresistance is roughly similar to that of the reference material, LaB 6 . The dHvA data in PrB 6 shows both paramagnetic and antiferromagnetic Fermi surfaces. The antiferromagnetic Fermi surface arises from new magnetic Brillouin zone boundaries and antiferromagnetic gaps introduced by the magnetic order, and the paramagnetic Fermi surface from magnetic breakdown through the small antiferromagnetic gaps in high field. Hybridization between the conduction electrons and the f electrons has been observed through the cyclotron masses, which in PrB 6 are three times larger than the corresponding masses of LaB 6 . In NdB 6 only the antiferromagnetic Fermi surface, quite different from those of LaB 6 and PrB 6 , has been observed. 26 refs., 10 figs., 3 tabs

Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET)2TlHg(SeCN)4

International Nuclear Information System (INIS)

Laukhin, V.N.; Audouard, A.; Rakoto, H.; Broto, J.M.; Goze, F.; Coffe, G.; Brossard, L.; Redoules, J.P.; Kartsovnik, M.V.; Kushch, N.D.; Buravov, L.I.; Khomenko, A.G.; Yagubskii, E.B.; Askenazy, S.; Pari, P.

1995-01-01

Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal α-(ET) 2 TlHg(SeCN) 4 have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F 0 =653±3 T and slow frequency oscillations with F s =38±5 T have been revealed. (orig.)

Transport properties and giant Shubnikov-de Haas oscillations in the first organic conductor with metal complex anion containing selenocyanate ligand, (ET){sub 2}TlHg(SeCN){sub 4}

Energy Technology Data Exchange (ETDEWEB)

Laukhin, V.N. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France)]|[Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Audouard, A. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Rakoto, H. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Broto, J.M. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Goze, F. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Coffe, G. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Brossard, L. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Redoules, J.P. [Service National des Champs Magnetiques Pulses du CNRS et Laboratoire de Physique des Solides, URA CNRS 074, Complexe Scientifique de Rangueil, 31077 Toulouse (France); Kartsovnik, M.V. [Institute of Solid State Physics, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Kushch, N.D. [Institute of Chemical Physics in Chernogolovka, Russian Academy of Sciences, Chernogolovka, MD 142432 (Russian Federation); Buravov, L.I.

1995-05-01

Temperature dependence of the resistivity in various crystallographic directions and high pulsed field magnetoresistance of organic metal {alpha}-(ET){sub 2}TlHg(SeCN){sub 4} have been studied at temperatures down to 80 mK. Giant Shubnikov-de Haas oscillations, which are attributed to the two-dimensional nature of the cylindrical Fermi surface with a very small warping along the direction of the lowest conductivity have been observed. Four harmonics of the fast oscillations with fundamental frequency F{sub 0}=653{+-}3 T and slow frequency oscillations with F{sub s}=38{+-}5 T have been revealed. (orig.).

Control of aliphatic halogenated DBP precursors with multiple drinking water treatment processes: Formation potential and integrated toxicity.

Science.gov (United States)

Zhang, Yimeng; Chu, Wenhai; Yao, Dechang; Yin, Daqiang

2017-08-01

The comprehensive control efficiency for the formation potentials (FPs) of a range of regulated and unregulated halogenated disinfection by-products (DBPs) (including carbonaceous DBPs (C-DBPs), nitrogenous DBPs (N-DBPs), and iodinated DBPs (I-DBPs)) with the multiple drinking water treatment processes, including pre-ozonation, conventional treatment (coagulation-sedimentation, pre-sand filtration), ozone-biological activated carbon (O 3 -BAC) advanced treatment, and post-sand filtration, was investigated. The potential toxic risks of DBPs by combing their FPs and toxicity values were also evaluated. The results showed that the multiple drinking water treatment processes had superior performance in removing organic/inorganic precursors and reducing the formation of a range of halogenated DBPs. Therein, ozonation significantly removed bromide and iodide, and thus reduced the formation of brominated and iodinated DBPs. The removal of organic carbon and nitrogen precursors by the conventional treatment processes was substantially improved by O 3 -BAC advanced treatment, and thus prevented the formation of chlorinated C-DBPs and N-DBPs. However, BAC filtration leads to the increased formation of brominated C-DBPs and N-DBPs due to the increase of bromide/DOC and bromide/DON. After the whole multiple treatment processes, the rank order for integrated toxic risk values caused by these halogenated DBPs was haloacetonitriles (HANs)≫haloacetamides (HAMs)>haloacetic acids (HAAs)>trihalomethanes (THMs)>halonitromethanes (HNMs)≫I-DBPs (I-HAMs and I-THMs). I-DBPs failed to cause high integrated toxic risk because of their very low FPs. The significant higher integrated toxic risk value caused by HANs than other halogenated DBPs cannot be ignored. Copyright © 2017. Published by Elsevier B.V.

Shubnikov - de Haas oscillations, weak antilocalization effect and large linear magnetoresistance in the putative topological superconductor LuPdBi

Science.gov (United States)

Pavlosiuk, Orest; Kaczorowski, Dariusz; Wiśniewski, Piotr

2015-01-01

We present electronic transport and magnetic properties of single crystals of semimetallic half-Heusler phase LuPdBi, having theoretically predicted band inversion requisite for nontrivial topological properties. The compound exhibits superconductivity below a critical temperature Tc = 1.8 K, with a zero-temperature upper critical field Bc2 ≈ 2.3 T. Although superconducting state is clearly reflected in the electrical resistivity and magnetic susceptibility data, no corresponding anomaly can be seen in the specific heat. Temperature dependence of the electrical resistivity suggests existence of two parallel conduction channels: metallic and semiconducting, with the latter making negligible contribution at low temperatures. The magnetoresistance is huge and clearly shows a weak antilocalization effect in small magnetic fields. Above about 1.5 T, the magnetoresistance becomes linear and does not saturate in fields up to 9 T. The linear magnetoresistance is observed up to room temperature. Below 10 K, it is accompanied by Shubnikov-de Haas oscillations. Their analysis reveals charge carriers with effective mass of 0.06 me and a Berry phase very close to π, expected for Dirac-fermion surface states, thus corroborating topological nature of the material. PMID:25778789

Split Fermi Surfaces of the Spin-Orbit-Coupled Metal Cd2Re2O7 Probed by de Haas-van Alphen Effect

Science.gov (United States)

Matsubayashi, Yasuhito; Sugii, Kaori; Hirose, Hishiro T.; Hirai, Daigorou; Sugiura, Shiori; Terashima, Taichi; Uji, Shinya; Hiroi, Zenji

2018-05-01

The superconducting pyrochlore oxide Cd2Re2O7 shows a structural transition with inversion symmetry breaking (ISB) at Ts1 = 200 K. A recent theory [https://doi.org/10.1103/PhysRevLett.115.026401" xlink:type="simple">L. Fu, Phys. Rev. Lett. 115, 026401 (2015)] suggests that the origin is an electronic instability that leads to a multipolar order in the spin-orbit-coupled metal. To observe the Fermi surface of the low-temperature phase of Cd2Re2O7, we perform de Haas-van Alphen effect measurements by means of magnetic torque. In reference to a calculated band structure, the spin-split Fermi surfaces with large cyclotron masses of 5-9m0 are revealed. The splitting is suggested to be due to an antisymmetric spin-orbit coupling induced by ISB, the strength of which is estimated to be approximately 67 K, which is rather smaller than those of typical non-centrosymmetric metals.

Mass Enhancement of Nearly Trivalent Compound EuCo2Si2: Studied by the de Haas-van Alphen Experiments and Energy Band Calculations

International Nuclear Information System (INIS)

Ōnuki, Yoshichika; Hedo, Masato; Nakama, Takao; Nakamura, Ai; Aoki, Dai; Boukahil, Mounir; Haga, Yoshinori; Takeuchi, Tetsuya; Harima, Hisatomo

2015-01-01

We succeeded in growing single crystals of EuCo 2 Si 2 by the Bridgman method, and carried out the de Haas-van Alphen (dHvA) experiments. EuCo 2 Si 2 was previously studied from a viewpoint of the trivalent electronic state on the basis of the magnetic susceptibility and X-ray absorption experiments, whereas most of the other Eu compounds order magnetically, with the divalent electronic state. The detected dHvA branches in the present experiments are found to be explained by the results of the full potential linearized augmented plane wave energy band calculations on the basis of a local density approximation (LDA) for YCo 2 Si 2 (LDA) and EuCo 2 Si 2 (LDA + U), revealing the trivalent electronic state. The detected cyclotron effective masses are moderately large, ranging from 1.2 to 2.9 m 0

How reservoirs alter drinking water quality: Organic matter sources, sinks, and transformations

Science.gov (United States)

Kraus, Tamara E.C.; Bergamaschi, Brian A.; Hernes, Peter J.; Doctor, Daniel H.; Kendall, Carol; Downing, Bryan D.; Losee, Richard F.

2011-01-01

Within reservoirs, production, transformation, and loss of dissolved organic matter (DOM) occur simultaneously. While the balance between production and loss determines whether a reservoir is a net sink or source of DOM, changes in chemical composition are also important because they affect DOM reactivity with respect to disinfection by-product (DBP) formation. The composition of the DOM pool also provides insight into DOM sources and processing, which can inform reservoir management. We examined the concentration and composition of DOM in San Luis Reservoir, a large off-stream impoundment of the California State Water Project. We used a wide array of DOM chemical tracers including dissolved organic carbon (DOC) concentration, trihalomethane and haloacetic acid formation potentials (THMFP and HAAFP, respectively), absorbance properties, isotopic composition, lignin phenol content, and structural groupings determined by 13C nuclear magnetic resonance (NMR). There were periods when the reservoir was a net source of DOC due to the predominance of algal production (summer), a net sink due to the predominance of degradation (fall–winter), and balanced between production and consumption (spring). Despite only moderate variation in bulk DOC concentration (3.0–3.6 mg C/L), changes in DOM composition indicated that terrestrial-derived material entering the reservoir was being degraded and replaced by aquatic-derived DOM produced within the reservoir. Substantial changes in the propensity of the DOM pool to form THMs and HAAs illustrate that the DBP precursor pool was not directly coupled to bulk DOC concentration and indicate that algal production is an important source of DBP precursors. Results suggest reservoirs have the potential to attenuate DOM amount and reactivity with respect to DBP precursors via degradative processes; however, these benefits can be decreased or even negated by the production of algal-derived DOM.

Simultaneous determination of 9 heterocyclic aromatic amines in pork products by liquid chromatography coupled with triple quadrupole tandem mass spectrometry

Science.gov (United States)

Shen, X. C.; Zhang, Y. L.; Cui, Y. Q.; Xu, L. Y.; Li, X.; Qi, J. H.

2017-07-01

Heterocyclic aromatic amines (HAAs) are potent mutagens that formed at high temperature in cooked, protein-rich food. Owing to their frequent intake, an accurate method is essential to access human health risk of HAAs exposure through detecting these compounds in various heat-treated meat products. In this study, a liquid chromatography-electrospray tandem mass spectrometry (LC--ESI-MS/MS) method was developed to perform the determination of 9 mutagenic heterocyclic amines (HAAs) in meat samples with multiple reaction monitoring (MRM) mode. Ultrasound assisted extraction and diatomaceous earth was employed to extract HAAs from food samples, and the analytes were purified and enriched using tandem solid phase extraction, with propyl sulfonic acid coupled to a C18 cartridge. Two parameters, extraction time and eluent, were carefully optimized to improve the extraction and purification efficiency. The LC separation was carried out using a Zorbax SB-C18 (3.5 μm particle size, 2.1 × 150 mm i.d.) column and optimized some parameters, such as pH, concentration and volume. Under the optimal experimental conditions, recoveries ranged from 52.97% to 97.11% with good quality parameters: limit of detection values between 0.02 and 0.24 ng mL-1, linearity (R2>0.998), and run-to-run and day-to-day precisions lower than 9.81% achieved. To evaluate the performance of the method in high throughput analysis of complex meat samples, the LC-MS/MS method was applied to the analysis of HAAs in three food samples, and the results demonstrated that the method can be used for the trace determination of HAAs in pork samples.

Formation of iodo-trihalomethanes, iodo-acetic acids, and iodo-acetamides during chloramination of iodide-containing waters: Factors influencing formation and reaction pathways

Energy Technology Data Exchange (ETDEWEB)

Liu, Shaogang [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China); Guangxi Colleges and Universities Key Laboratory of Food Safety and Pharmaceutical Analytical Chemistry, Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, School of Chemistry and Chemical Engineering, Guangxi University for Nationalities, Nanning, 530006, Guangxi (China); Li, Zhenlin [Guangxi Colleges and Universities Key Laboratory of Food Safety and Pharmaceutical Analytical Chemistry, Guangxi Key Laboratory of Chemistry and Engineering of Forest Products, School of Chemistry and Chemical Engineering, Guangxi University for Nationalities, Nanning, 530006, Guangxi (China); Dong, Huiyu [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China); Goodman, Bernard A. [College of Physical Science and Engineering, State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning, 520004, Guangxi (China); Qiang, Zhimin, E-mail: qiangz@rcees.ac.cn [Key Laboratory of Drinking Water Science and Technology, Research Center for Eco-Environmental Sciences, University of Chinese Academy of Sciences, Chinese Academy of Sciences, 18 Shuang-qing Road, Beijing, 100085 (China)

2017-01-05

This study investigated systematically the factors influencing the formation of iodinated disinfection by-products (I-DBPs) during chloramination of I{sup −}-containing waters, including reaction time, NH{sub 2}Cl dose, I{sup −} concentration, pH, natural organic matter (NOM) concentration, Br{sup −}/I{sup −} molar ratio, and water matrix. Among the I-DBPs detected, iodoform (CHI{sub 3}), iodoacetic acid (IAA), diiodoacetic acid (DIAA), triiodoacetic acid (TIAA), and diiodoacetamide (DIAcAm) were the major species produced from reactions between reactive iodine species (HOI/I{sub 2}) and NOM. A kinetic model involving the reactions of NH{sub 2}Cl auto-decomposition, iodine species transformation and NOM consumption was developed, which could well describe NH{sub 2}Cl decay and HOI/I{sub 2} evolution. Higher concentrations of CHI{sub 3}, IAA, DIAA, TIAA, and DIAcAm were observed in chloramination than in chlorination, whereas IO{sub 3}{sup −} was only formed significantly in chlorination. Maximum formation of I-DBPs occurred at pH 8.0, but acidic conditions favored the formation of iodinated haloacetic acids and DIAcAm. Increasing Br{sup −}/I{sup −} molar ratio from 1 to 10 did not increase the total amount of I-DBPs, but produced more bromine-substituting species. In addition, chloramination of 18 model compounds indicated that low-SUVA{sub 254} (specific ultraviolet absorbance at 254 nm) NOM generally favored the formation of I-DBPs compared to high-SUVA{sub 254} NOM. Finally, potential pathways for I-DBPs formation from chloramination of NOM were proposed.

Removal of Intermediate Aromatic Halogenated DBPs by Activated Carbon Adsorption: A New Approach to Controlling Halogenated DBPs in Chlorinated Drinking Water.

Science.gov (United States)

Jiang, Jingyi; Zhang, Xiangru; Zhu, Xiaohu; Li, Yu

2017-03-21

During chlorine disinfection of drinking water, chlorine may react with natural organic matter (NOM) and bromide ion in raw water to generate halogenated disinfection byproducts (DBPs). To mitigate adverse effects from DBP exposure, granular activated carbon (GAC) adsorption has been considered as one of the best available technologies for removing NOM (DBP precursor) in drinking water treatment. Recently, we have found that many aromatic halogenated DBPs form in chlorination, and they act as intermediate DBPs to decompose and form commonly known DBPs including trihalomethanes and haloacetic acids. In this work, we proposed a new approach to controlling drinking water halogenated DBPs by GAC adsorption of intermediate aromatic halogenated DBPs during chlorination, rather than by GAC adsorption of NOM prior to chlorination (i.e., traditional approach). Rapid small-scale column tests were used to simulate GAC adsorption in the new and traditional approaches. Significant reductions of aromatic halogenated DBPs were observed in the effluents with the new approach; the removals of total organic halogen, trihalomethanes, and haloacetic acids by the new approach always exceeded those by the traditional approach; and the effluents with the new approach were considerably less developmentally toxic than those with the traditional approach. Our findings indicate that the new approach is substantially more effective in controlling halogenated DBPs than the traditional approach.

Arachidonic acid metabolism in fibroblasts derived from canine myocardium

International Nuclear Information System (INIS)

Weber, D.R.; Prescott, S.M.

1986-01-01

Canine fibroblasts from normal or healing infarcted myocardium were grown in culture. The cells were morphologically indistinguishable, but the doubling time of cells from healing myocardium was 39.6 +/- 3.5 hr whereas that of normals was 24 +/- 3.7 (n=5, p 3 H]arachidonate (AA) into phospholipids. Calcium ionophore A23187 (10 μM) caused release and metabolism of [ 3 H] AA. A23187 or AA (10μM) induced production of 6-keto PGF1α, PGE2, and a hydroxy metabolite of AA. RIA of 6-keto PGF1α showed that subconfluent cells from healing myocardium produced 1202 +/- 354 pg/mg protein whereas that of normals was 551 +/- 222 (n=7, p 3 H]AA released but did not metabolize [ 3 H]AA. In coincubations, fibroblasts incorporated myocyte-derived AA. Subsequent stimulation of the fibroblasts with A23187 induced the synthesis of 6-keto PGF1α, PGE2 and a hydroxy metabolite. The fibroblast content of healing myocardium was 35-1000 times that of normal tissue (n=7). Thus even a moderate change in AA metabolism, amplified by the AA released from deteriorating myocytes, may be a significant physiologic or pathologic event

Transport properties of Cu-doped bismuth selenide single crystals at high magnetic fields up to 60 Tesla: Shubnikov-de Haas oscillations and π-Berry phase

Science.gov (United States)

Romanova, Taisiia A.; Knyazev, Dmitry A.; Wang, Zhaosheng; Sadakov, Andrey V.; Prudkoglyad, Valery A.

2018-05-01

We report Shubnikov-de Haas (SdH) and Hall oscillations in Cu-doped high quality bismuth selenide single crystals. To increase the accuracy of Berry phase determination by means of the of the SdH oscillations phase analysis we present a study of n-type samples with bulk carrier density n ∼1019 -1020cm-3 at high magnetic field up to 60 Tesla. In particular, Landau level fan diagram starting from the value of the Landau index N = 4 was plotted. Thus, from our data we found π-Berry phase that directly indicates the Dirac nature of the carriers in three-dimensional topological insulator (3D TI) based on Cu-doped bismuth selenide. We argued that in our samples the magnetotransport is determined by a general group of carriers that exhibit quasi-two-dimensional (2D) behaviour and are characterized by topological π-Berry phase. Along with the main contribution to the conductivity the presence of a small group of bulk carriers was registered. For 3D-pocket Berry phase was identified as zero, which is a characteristic of trivial metallic states.

Multigap superconductivity and Shubnikov-de Haas oscillations in single crystals of the layered boride OsB2

Science.gov (United States)

Singh, Yogesh; Martin, C.; Bud'Ko, S. L.; Ellern, A.; Prozorov, R.; Johnston, D. C.

2010-10-01

Single crystals of superconducting OsB2 [Tc=2.10(5)K] have been grown using a Cu-B eutectic flux. We confirm that OsB2 crystallizes in the reported orthorhombic structure (space group Pmmn ) at room temperature. Both the normal and superconducting state properties of the crystals are studied using various techniques. Heat capacity versus temperature C(T) measurements yield the normal state electronic specific heat coefficient γ=1.95(1)mJ/molK2 and the Debye temperature ΘD=539(2)K . The measured frequencies of Shubnikov-de Haas oscillations are in good agreement with those predicted by band structure calculations. Magnetic susceptibility χ(T,H) , electrical resistivity ρ(T) , and C(T,H) measurements ( H is the magnetic field) demonstrate that OsB2 is a bulk low- κ [κ(Tc)=2(1)] type-II superconductor that is intermediate between the clean and dirty limits [(ξ(T=0)/ℓ=0.97)] with a small upper critical magnetic field Hc2(T=0)=186(4)Oe . The penetration depth is λ(T=0)=0.300μm . An anomalous (not single-gap BCS) T dependence of λ was fitted by a two-gap model with Δ1(T=0)/kBTc=1.9 and Δ2(T=0)/kBTc=1.25 , respectively. The discontinuity in the heat capacity at Tc , ΔC/γTc=1.32 , is smaller than the weak-coupling BCS value of 1.43, consistent with the two-gap nature of the superconductivity in OsB2 . An anomalous increase in ΔC at Tc of unknown origin is found in finite H ; e.g., ΔC/γTc≈2.5 for H≈25Oe .

Preparation methods, reactivity and biological importance of 4-thiazolidinones; Metodos de obtencao, reatividade e importancia biologica de 4-tiazolidinonas

Energy Technology Data Exchange (ETDEWEB)

Liesen, Andre P.; Aquino, Thiago M. de; Goes, Alexandre J.S. [Universidade Federal de Pernambuco (UFPE)e, PE (Brazil). Dept. de Antibioticos]. E-mail: ajsg@ufpe.br; Lima, Jose G. de; Faria, Antonio R. de; Alves, Antonio J. [Universidade Federal de Pernambuco (UFPE)e, PE (Brazil). Dept. de Ciencias Farmaceuticas

2008-07-01

Molecules containing the 4-thiazolidinone ring are known to possess a wide range of biological properties including antimicrobial and antiinflammatory activities among others. These compounds can be synthesized by cyclization reactions involving alpha-haloacetic acid or alpha-mercaptoacetic acid and employed in several chemoselective reactions. Comprehensive reviews have been written on 4-thiazolidinones in 1961 by Brown and in 1980 by Singh et al. In the recent literature, some new synthesis methods for 4-thiazolidinone derivatives and several reactions have been reported. These advances warrant to review the chemical and biological properties of compounds with this important heterocycle employed in synthetic organic chemistry and medicinal chemistry (author)

The role of calcium ions in the photocatalytic oxidation of humic acid at neutral pH.

Science.gov (United States)

Mariquit, Eden G; Salim, Chris; Hinode, Hirofumi

2008-10-01

Humic acids (HAs) are natural organic matter derived from the decomposition of plant, algal, and microbial materials. They belong to the group of the most predominant type of natural organic matter present in ground and surface waters. HAs affect the mobility and bioavailability of aquatic contaminants. However, if they are left unremoved from the water before water treatment processes, they can form carcinogenic disinfection by-products, such as trihalomethanes, haloacetic acids, and other halogenated disinfection by-products, that can pose a threat to human beings. An advanced oxidation process using UV light and a commercially available titanium dioxide was used to oxidize HA at a pH that is similar to that of natural water. The effect of adding calcium ions to the adsorption and the photocatalytic oxidation of HAs was studied. The effect of varying the TiO(2) load was also investigated. The experiment was done using a photochemical batch reactor equipped with a mercury lamp emitting light with wavelengths of 310-580 nm. The absorbances by the samples were determined at wavelengths of 254 nm and 436 nm, which represent the aromatic-compound content of and the color of the solution, respectively. Results indicated calcium ions have an effect on both the adsorption and the photocatalytic oxidation of HA at a pH within 8.0 +/- 0.5. Calcium ions facilitated adsorption of HA onto the surface of TiO(2) and resulted to faster photocatalytic oxidation. The data were plotted with respect to the normalized absorbances and irradiation time.

SUB’HAA

Directory of Open Access Journals (Sweden)

Harisnal Hadi

2017-08-01

Full Text Available The preparation of the artwork entitled "Subhaa", is inspired by the Minangkabau cultural phenomenon. This work focuses on the feelings of children who will be circumcised, the pressure and fear felt by the child who will be circumcised tilled in the form of Polymetrik art works. Circumcision or commonly called Basunaik by Minangkabau society is a Sunna that must be run boys of Islam; indirectly circumcision is also required for boys in Minangkabau. In the area of darek (mainland khitan has its own ceremony, begins with a child who will be circumcised is brought to the bako house to change his clothes, then paraded around the village, after arriving at home circumcised will be held. In the evening there will be entertainment in the form of randai and bagurau saluang. This piece of music is in the form of a new composition. The performance focuses more on the composition of sound as a contextual meaning to be conveyed to the appreciator. This work is a little contrary to the aesthetics that have been awakened in the brain and soul of the arts in the Sendratasik Department of FBS Universitas Negeri Padang. But it cannot be denied that a new works will create its own aesthetic realm. Keywords: Basunaik, Artwork Music. Abstrak Penyusunan karya seni yang berjudul “Subhaa”, ini terinspirasi dari fenomena budaya Minangkabau. Karya ini menitik beratkan garapan pada perasaan anak yang akan dikhitan, tekanan dan ketakutan yang dirasakan oleh anak yang akan dikhitan digarap dalam bentuk penggarapan Polymetrik. Khitan atau biasa disebut Basunaik oleh masyarakat Minangkabau merupakan sunah yang harus dijalankan anak laki-laki Islam, secara tidak langsung khitan juga diwajibkan bagi anak laki-laki di Minangkabau. Di daerah darek (daratan khitan memiliki upacara tersendiri, diawali dengan anak yang akan dikhitan dibawa ke rumah bako untuk mengganti baju, lalu diarak keliling kampung, setelah sampai di rumah baru diadakan khitan, malamnya diadakan hiburan berupa randai dan bagurau saluang. Karya musik ini berbentuk komposisi garapan baru. Penggarapan lebih menitik beratkan kepada penggarapan bunyi sebagai makna kontekstual yang akan disampaikan kepada apresiator. Karya ini memang sedikit bertolak belakang dengan estetika yang sudah terbangun dalam otak dan jiwa kalangan seni di jurusan pendidikan sendratasik FBS Universitas Negeri Padang. Namun tidak bisa dipungkiri sebuah karya garapan baru akan menciptakan ranah estetikanya sendiri. Kata Kunci: Basunaik, Karya seni Musik.

A Model for the Interfacial Kinetics of Phospholipase D Activity on Long-Chain Lipids

Science.gov (United States)

2013-07-01

7506–7513. 18. Zografi, G., R. Verger, and G. H. de Haas. 1971. Kinetic analysis of the hydrolysis of lecithin monolayers by phospholipase A. Chem...ChemBioChem. 9:2853–2859. 54. Albrecht, O., H. Gruler, and E. Sackmann. 1981. Pressure-composition phase diagrams of cholesterol/ lecithin , cholesterol...phosphatidic acid, and lecithin /phosphatidic acid fixed monolayers: a Langmuit film balance study. J. Colloid Interface Sci. 79:319–338. 55. Morris, A

Recovery from hospital-acquired anemia after acute myocardial infarction and effect on outcomes.

Science.gov (United States)

Salisbury, Adam C; Kosiborod, Mikhail; Amin, Amit P; Reid, Kimberly J; Alexander, Karen P; Spertus, John A; Masoudi, Frederick A

2011-10-01

New-onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. The patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center Translational Research Investigating Underlying disparities in acute myocardial infarction Patients' Health Status (TRIUMPH) registry, we identified 530 patients with AMI and HAA (defined as normal hemoglobin at admission with the development of anemia by discharge) who had a repeat, protocol-driven hemoglobin measurement at 1 month after discharge. The 1-month measures were used to define persistent (persistent anemia) and transient (anemia resolved) HAA. The patients' health status was assessed at 1, 6, and 12 months after AMI using the Short-Form 12 Physical Component Summary, and the health status of patients with persistent and transient HAA was compared using multivariate repeated measures regression analysis. Mortality was compared using the log-rank test and proportional hazards regression analysis. Overall, 165 patients (31%) developed persistent HAA. The adjusted mean Short-Form 12 Physical Component Summary scores at the follow-up visit were significantly lower in those with persistent HAA than in those with transient HAA (-2.0 points, 95% confidence interval -3.6 to -0.3; p = 0.02). During a median follow-up of 36 months, the crude mortality (13% vs 5%, p = 0.002) and multivariate-adjusted mortality (hazard ratio 2.08, 95% confidence interval 1.02 to 4.21, p = 0.04) was greater in patients with persistent HAA. In conclusion, HAA persists 1 month after discharge in nearly 1 of 3 patients and is associated with worse health status and greater mortality. Additional investigation is needed to understand whether HAA prevention, recognition, and treatment, particularly among those with persistent HAA, will improve outcomes. Copyright © 2011 Elsevier Inc. All rights reserved.

Four groups of new aromatic halogenated disinfection byproducts: effect of bromide concentration on their formation and speciation in chlorinated drinking water.

Science.gov (United States)

Pan, Yang; Zhang, Xiangru

2013-02-05

Bromide is naturally present in source waters worldwide. Chlorination of drinking water can generate a variety of chlorinated and brominated disinfection byproducts (DBPs). Although substantial efforts have been made to examine the effect of bromide concentration on the formation and speciation of halogenated DBPs, almost all previous studies have focused on trihalomethanes and haloacetic acids. Given that about 50% of total organic halogen formed in chlorination remains unknown, it is still unclear how bromide concentration affects the formation and speciation of the new/unknown halogenated DBPs. In this study, chlorinated drinking water samples with different bromide concentrations were prepared, and a novel approach-precursor ion scan using ultra performance liquid chromatography/electrospray ionization-triple quadrupole mass spectrometry-was adopted for the detection and identification of polar halogenated DBPs in these water samples. With this approach, 11 new putative aromatic halogenated DBPs were identified, and they were classified into four groups: dihalo-4-hydroxybenzaldehydes, dihalo-4-hydroxybenzoic acids, dihalo-salicylic acids, and trihalo-phenols. A mechanism for the formation of the four groups of new aromatic halogenated DBPs was proposed. It was found that increasing the bromide concentration shifted the entire polar halogenated DBPs as well as the four groups of new DBPs from being less brominated to being more brominated; these new aromatic halogenated DBPs might be important intermediate DBPs formed in drinking water chlorination. Moreover, the speciation of the four groups of new DBPs was modeled: the speciation patterns of the four groups of new DBPs well matched those determined from the model equations, and the reactivity differences between HOBr and HOCl in reactions forming the four groups of new DBPs were larger than those in reactions forming trihalomethanes and haloacetic acids.

Chloramination of nitrogenous contaminants (pharmaceuticals and pesticides): NDMA and halogenated DBPs formation.

Science.gov (United States)

Le Roux, Julien; Gallard, Hervé; Croué, Jean-Philippe

2011-05-01

Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N-nitrosamines, including N-nitrosodimethylamine (NDMA), a probable human carcinogen. Previous research used dimethylamine (DMA) as a model precursor of NDMA, but certain widely used tertiary dimethylamines (e.g. the pharmaceutical ranitidine) show much higher conversion rates to NDMA than DMA. This study investigates the NDMA formation potential of several tertiary amines including pharmaceuticals and herbicides. The reactivity of these molecules with monochloramine (NH(2)Cl) is studied through the formation of NDMA, and other halogenated DBPs such as haloacetonitriles (HANs) and AOX (Adsorbable Organic Halides). Several compounds investigated formed NDMA in greater amounts than DMA, revealing the importance of structural characteristics of tertiary amines for NDMA formation. Among these compounds, the pharmaceutical ranitidine showed the highest molar conversion to NDMA. The pH and dissolved oxygen content of the solution were found to play a major role for the formation of NDMA from ranitidine. NDMA was formed in higher amounts at pH around pH 8 and a lower concentration of dissolved oxygen dramatically decreased NDMA yields. These findings seem to indicate that dichloramine (NHCl(2)) is not the major oxidant involved in the formation of NDMA from ranitidine, results in contradiction with the reaction mechanisms proposed in the literature. Dissolved oxygen was also found to influence the formation of other oxygen-containing DBPs (i.e. trichloronitromethane and haloketones). The results of this study identify several anthropogenic precursors of NDMA, indicating that chloramination of waters impacted by these tertiary amines could lead to the formation of significant amounts of NDMA and other non-regulated DBPs of potential health concern (e

Chloramination of nitrogenous contaminants (pharmaceuticals and pesticides): NDMA and halogenated DBPs formation

KAUST Repository

Le Roux, Julien

2011-05-01

Disinfection with chloramines is often used to reduce the production of regulated disinfection by-products (DBPs) such as trihalomethanes (THMs) and haloacetic acids (HAAs). However, chloramination can lead to the formation of N-nitrosamines, including N-nitrosodimethylamine (NDMA), a probable human carcinogen. Previous research used dimethylamine (DMA) as a model precursor of NDMA, but certain widely used tertiary dimethylamines (e.g. the pharmaceutical ranitidine) show much higher conversion rates to NDMA than DMA. This study investigates the NDMA formation potential of several tertiary amines including pharmaceuticals and herbicides. The reactivity of these molecules with monochloramine (NH2Cl) is studied through the formation of NDMA, and other halogenated DBPs such as haloacetonitriles (HANs) and AOX (Adsorbable Organic Halides). Several compounds investigated formed NDMA in greater amounts than DMA, revealing the importance of structural characteristics of tertiary amines for NDMA formation. Among these compounds, the pharmaceutical ranitidine showed the highest molar conversion to NDMA. The pH and dissolved oxygen content of the solution were found to play a major role for the formation of NDMA from ranitidine. NDMA was formed in higher amounts at pH around pH 8 and a lower concentration of dissolved oxygen dramatically decreased NDMA yields. These findings seem to indicate that dichloramine (NHCl2) is not the major oxidant involved in the formation of NDMA from ranitidine, results in contradiction with the reaction mechanisms proposed in the literature. Dissolved oxygen was also found to influence the formation of other oxygen-containing DBPs (i.e. trichloronitromethane and haloketones). The results of this study identify several anthropogenic precursors of NDMA, indicating that chloramination of waters impacted by these tertiary amines could lead to the formation of significant amounts of NDMA and other non-regulated DBPs of potential health concern (e

Effective mass of two-dimensional electrons in InGaAsN/GaAsSb type II quantum well by Shubnikov-de Haas oscillations

Energy Technology Data Exchange (ETDEWEB)

Kawamata, Shuichi, E-mail: s-kawamata@riast.osakafu-u.ac.jp; Kawamura, Yuichi [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan); Research Organization for University-Community Collaborations, Osaka Prefecture University, Sakai 599-8570 (Japan); Hibino, Akira; Tanaka, Sho [Graduate School of Engineering, Osaka Prefecture University, Sakai 599-8531 (Japan)

2016-10-14

In order to develop optical devices for 2–3 μm wavelength regions, the InP-based InGaAs/GaAsSb type II multiple quantum well system has been investigated. By doping nitrogen into InGaAs layers, the system becomes effective in creating the optical devices with a longer wavelength. In this report, electrical transport properties are reported on the InGaAsN/GaAsSb type II system. The epitaxial layers with the single hetero or multiple quantum well structure on InP substrates are grown by the molecular beam epitaxy. The electrical resistance of samples with different nitrogen concentrations has been measured as a function of the magnetic field up to 9 Tesla at several temperatures between 2 and 6 K. The oscillation of the resistance due to the Shubnikov-de Haas (SdH) effect has been observed at each temperature. The effective mass is obtained from the temperature dependence of the amplitude of the SdH oscillations. The value of the effective mass increases from 0.048 for N = 0.0% to 0.062 for N = 1.2 and 1.5% as the nitrogen concentration increases. The mass enhancement occurs with corresponding to the reduction of the bandgap energy. These results are consistent with the band anticrossing model.

Integrated Ion Exchange Regeneration Process for Drinking Water

Science.gov (United States)

2010-04-01

Nitrate - Destruction 123 5.7.3.3 Sulfate- destruction unit process 125 5.7.3.4 NDMA , NDEA, and NDPA in destruction unit process 127 5.7.3.5 pH...Sampling Results 139 5.7.4.1 Free Chlorine 140 5.7.4.2 Total Organic Halides 141 5.7.4.3 Haloacetic Acids 141 5.7.4.4 Trihalomethane 141 5.7.4.5 NDMA ...Typical Destruction Reactor Nitrate Effluent Profile during First Destruction Cycle Parametric Tests 124 Figure 6-1: Washout of NDMA from Virgin IX

Note on de Haas-van Alphen diamagnetism in thin, free-electron films

Directory of Open Access Journals (Sweden)

J. A. Grzesik

2012-03-01

Full Text Available We revisit the problem of de Haas-van Alphen (dHvA diamagnetic susceptibility oscillations in a thin, free-electron film trapped in a synthetic harmonic potential well. A treatment of this phenomenon at zero temperature was announced many years ago by Childers and Pincus (designated hereafter as CP, and we traverse initially much the same ground, but from a slightly different analytic perspective. That difference hinges around our use, in calculating the Helmholtz free energy F, of an inverse Laplace transform, Bromwich-type contour integral representation for the sharp distribution cutoff at Fermi level μ. The contour integral permits closed-form summation all at once over the discrete orbital Landau energy levels transverse to the magnetic field, and the energy associated with the in-plane canonical momenta ℏ k x and ℏ k z. Following such summation/integration, pole/residue pairs appear in the plane of complex transform variable s, a fourth-order pole at origin s = 0, and an infinite ladder, both up and down, of simple poles along the imaginary axis. The residue sum from the infinite pole ladder automatically engenders a Fourier series with period one in dimensionless variable μ/ ℏ ω (with effective angular frequency ω suitably defined, series which admits closed-form summation as a cubic polynomial within any given periodicity slot. Such periodicity corresponds to Landau levels slipping sequentially beneath Fermi level μ as the ambient magnetic field H declines in strength, and is manifested by the dHvA pulsations in diamagnetic susceptibility. The coëxisting steady contribution from the pole at origin has a similar cubic structure but is opposite in sign, inducing a competition whose outcome is a net magnetization that is merely quadratic in any given periodicity slot, modulated by a slow amplitude growth. Apart from some minor notes of passing discord, these simple algebraic structures confirm most of the CP formulae, and their

Humic Acid Degradation via Solar Photo-Fenton Process in Aqueous Environment

Directory of Open Access Journals (Sweden)

Seyed Ali Sajjadi

2015-08-01

Full Text Available Control of mutagenic and carcinogenic disinfection by-products, particularly Trihalomethanes (THMs and Halo Acetic Acids (HAAs in water treatment process is critical, due to their adverse effects on human health. Generally, reducing the toxicity of these by-products hinges on prior removal of the precursor materials, such as Humic Acid (HA in drinking water. This study was conducted to investigate the role of some parameters that could affect the removal of HA, including HA (5 and 10 ppm and H2O2 (20, 40, 60, and 80 ppm initial concentrations, Iron (II, sulfate heptahydrate dosage (4, 8, 12, and 16 ppm, pH (2, 3, 4 and 5, Oxidation time (5, 10, 15 and 30 min, and Sunlight levels (322±13 kWm-2. To accelerate the process of HA removal, the Solar Photo-Fenton (SPF process was employed by direct irradiation of converged sunlight in a Parabolic Trough Collectors (PTC, with 3m2 effective area. HA levels were measured via quantifying Dissolved Organic Carbon (DOC concentrations by means of a TOC Analyzer method. The results showed that the SPF process is under control of the Fe & H2O2 ratio, the Fe2+ dosage and especially the pH quantity. In optimal condition, (pH: 4, oxidation time: 30min, initial HA levels: 50 ppm, H2O2 concentrations: 20 ppm Fe+2 levels: 4 ppm, the study found more than 98% DOC removal. In conclusion, the SPF, as an economically effective technique, could be applied for the removal of HA in aqueous environments.

Initial amino acid intake influences phosphorus and calcium homeostasis in preterm infants--it is time to change the composition of the early parenteral nutrition.

Directory of Open Access Journals (Sweden)

Francesco Bonsante

Full Text Available Early aggressive parenteral nutrition (PN, consisting of caloric and nitrogen intake soon after birth, is currently proposed for the premature baby. Some electrolyte disturbances, such as hypophosphatemia and hypercalcemia, considered unusual in early life, were recently described while using this PN approach. We hypothesize that, due to its impact on cell metabolism, the initial amino acid (AA amount may specifically influence the metabolism of phosphorus, and consequently of calcium. We aim to evaluate the influence of AA intake on calcium-phosphorus metabolism, and to create a calculation tool to estimate phosphorus needs.Prospective observational study. Phosphate and calcium plasma concentrations and calcium balance were evaluated daily during the first week of life in very preterm infants, and their relationship with nutrition was studied. For this purpose, infants were divided into three groups: high, medium and low AA intake (HAA, MAA, LAA. A calculation formula to assess phosphorus needs was elaborated, with a theoretical model based on AA and calcium intake, and the cumulative deficit of phosphate intake was estimated.154 infants were included. Hypophosphatemia (12.5% and hypercalcemia (9.8% were more frequent in the HAA than in the MAA (4.6% and 4.8% and in the LAA group (0% and 1.9%; both p<0.001.Calcium-phosphorus homeostasis was influenced by the early AA intake. We propose to consider phosphorus and calcium imbalances as being part of a syndrome, related to incomplete provision of nutrients after the abrupt discontinuation of the placental nutrition at birth (PI-ReFeeding syndrome. We provide a simple tool to calculate the optimal phosphate intake. The early introduction of AA in the PN soon after birth might be completed by an early intake of phosphorus, since AA and phosphorus are (along with potassium the main determinants of cellular growth.

Cyclotron resonance and De Haas-Van Alphen effect in (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic conductor

CERN Document Server

Voskobojnikov, I B; Samarin, N A; Cluchanko, N E; Lyubovskaya, R N; Moshchalkov, V V

2002-01-01

Within 0.33-1.44 K temperature range at B <= 50 T magnetic field values one measured the De Haas-Van Alphen effect for (BEDT-TTF) sub 8 Hg sub 4 Cl sub 1 sub 2 (C sub 6 H sub 5 Cl) sub 2 organic quasi-two-dimensional conductor. Analysis of quantum oscillations with regard to data on cyclotron resonance derived for 40-120 GHz frequency interval enabled to determine that a complex spectrum of quantum oscillations was formed by alpha approx 256 T and beta approx 670-610 T fundamental frequencies as well as, by combination and multiple frequencies. It is shown that nature of temperature rearrangement of oscillation spectrum may be interpreted in terms of model taking account of occurrence of magnetic phase transition at T sub c approx 0.9 K and proximity of a fundamental frequency with m* = 1.48m sub 0 efficient mass to the spin dumping condition

Transcriptional Response to Lactic Acid Stress in the Hybrid Yeast Zygosaccharomyces parabailii.

Science.gov (United States)

Ortiz-Merino, Raúl A; Kuanyshev, Nurzhan; Byrne, Kevin P; Varela, Javier A; Morrissey, John P; Porro, Danilo; Wolfe, Kenneth H; Branduardi, Paola

2018-03-01

Lactic acid has a wide range of applications starting from its undissociated form, and its production using cell factories requires stress-tolerant microbial hosts. The interspecies hybrid yeast Zygosaccharomyces parabailii has great potential to be exploited as a novel host for lactic acid production, due to high organic acid tolerance at low pH and a fermentative metabolism with a high growth rate. Here we used mRNA sequencing (RNA-seq) to analyze Z. parabailii 's transcriptional response to lactic acid added exogenously, and we explore the biological mechanisms involved in tolerance. Z. parabailii contains two homeologous copies of most genes. Under lactic acid stress, the two genes in each homeolog pair tend to diverge in expression to a significantly greater extent than under control conditions, indicating that stress tolerance is facilitated by interactions between the two gene sets in the hybrid. Lactic acid induces downregulation of genes related to cell wall and plasma membrane functions, possibly altering the rate of diffusion of lactic acid into cells. Genes related to iron transport and redox processes were upregulated, suggesting an important role for respiratory functions and oxidative stress defense. We found differences in the expression profiles of genes putatively regulated by Haa1 and Aft1/Aft2, previously described as lactic acid responsive in Saccharomyces cerevisiae Furthermore, formate dehydrogenase ( FDH ) genes form a lactic acid-responsive gene family that has been specifically amplified in Z. parabailii in comparison to other closely related species. Our study provides a useful starting point for the engineering of Z. parabailii as a host for lactic acid production. IMPORTANCE Hybrid yeasts are important in biotechnology because of their tolerance to harsh industrial conditions. The molecular mechanisms of tolerance can be studied by analyzing differential gene expression under conditions of interest and relating gene expression patterns

Water stress on the performace of herbicides and biochemical characteristics of Euphorbia heterophyllaDéficit hídrico na eficiência de herbicidas e nas características bioquímicas de Euphorbia heterophylla

Directory of Open Access Journals (Sweden)

Caio Ferraz Campos

2013-03-01

Full Text Available The objective of this work was to evaluate conditions the effectiveness of acetolactate synthase (ALS and protoporphyrinogen oxidase (PROTOX inhibitors in the Bidens pilosa control under two water deficit conditions, as well as to determine the action under the content of soluble carbohydrates and protein and free amino acids of weed. The experimental design was randomized completely design, with four replications, with the treatments setup in a factorial scheme 4x2, with four herbicides (fomesafen lactofen, chlorimuron-ethyl and imazethapyr, and two soil water conditions (-0.5 MPa and –0.01MPa. At 7, 14, 21 and 28 days after application (DAA, was assessed visually control efficiency of herbicides. For the determination of organic solutes plants were collected at 24, 48, 72 and 96 hours after application (HAA, except for the amino acids were analyzed 48, 72 e 96 HAA. Herbicides fomesafen and lactofen were efficient to control E. heterophylla, while the ALS inhibitors (chlorimuron-ethyl e imazethapyr provided an unsatisfactory control. Water deficit altered the efficiency of herbicides, mainly chlorimuronethyl. Lactofen provided a smaller content of soluble carbohydrates, in the same way, the protein ranged in the 72 HAA, the lower value observed for imazethapyr e lactofen respectively. Herbicide lactofen increased the concentration of free amino acids, while the imposition of water deficit caused an increase in soluble carbohydrate content.O estudo teve como objetivo avaliar a eficiência de herbicidas inibidores da acetolactato sintase (ALS e protoporfirinogênio oxidase (PROTOX no controle de Euphorbia heterophylla sob duas condições hídricas, bem como determinar a ação destes sob o conteúdo de carboidratos e proteínas solúveis e aminoácidos livres da planta daninha. O delineamento experimental utilizado foi inteiramente casualizado, com quatro repetições, com os tratamentos dispostos em esquema fatorial 4x2, sendo quatro

Human Factors Interface with Systems Engineering for NASA Human Spaceflights

Science.gov (United States)

Wong, Douglas T.

2009-01-01

This paper summarizes the past and present successes of the Habitability and Human Factors Branch (HHFB) at NASA Johnson Space Center s Space Life Sciences Directorate (SLSD) in including the Human-As-A-System (HAAS) model in many NASA programs and what steps to be taken to integrate the Human-Centered Design Philosophy (HCDP) into NASA s Systems Engineering (SE) process. The HAAS model stresses systems are ultimately designed for the humans; the humans should therefore be considered as a system within the systems. Therefore, the model places strong emphasis on human factors engineering. Since 1987, the HHFB has been engaging with many major NASA programs with much success. The HHFB helped create the NASA Standard 3000 (a human factors engineering practice guide) and the Human Systems Integration Requirements document. These efforts resulted in the HAAS model being included in many NASA programs. As an example, the HAAS model has been successfully introduced into the programmatic and systems engineering structures of the International Space Station Program (ISSP). Success in the ISSP caused other NASA programs to recognize the importance of the HAAS concept. Also due to this success, the HHFB helped update NASA s Systems Engineering Handbook in December 2007 to include HAAS as a recommended practice. Nonetheless, the HAAS model has yet to become an integral part of the NASA SE process. Besides continuing in integrating HAAS into current and future NASA programs, the HHFB will investigate incorporating the Human-Centered Design Philosophy (HCDP) into the NASA SE Handbook. The HCDP goes further than the HAAS model by emphasizing a holistic and iterative human-centered systems design concept.

Influence of cooking methods and storage time on lipid and protein oxidation and heterocyclic aromatic amines production in bacon.

Science.gov (United States)

Soladoye, O P; Shand, P; Dugan, M E R; Gariépy, C; Aalhus, J L; Estévez, M; Juárez, M

2017-09-01

This study aimed to examine the influence of cooking methods and pre-determined refrigerated storage days on the production of lipid oxidation (TBARS), protein oxidation (PROTOX) and heterocyclic aromatic amines (HAA) in bacon. Forty-four pork bellies selected from pigs varying in breed, sex and diets to introduce variability in composition were processed as bacon. Sliced-bacon was stored at 4°C either for 2 or 28days and these storage groups were cooked either with microwave or frying pan. Microwave led to significantly higher PROTOX (P0.05) by the cooking methods and storage times. Similarly, the fatty acid composition of pork belly did not significantly influence the production of HAA, TBARS and PROTOX produced in bacon during cooking. Overall, microwave cooking had lesser impact on the production of carcinogenic compounds in bacon with only minor impact on sensory attributes. Copyright © 2017. Published by Elsevier Ltd.

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2007-01-01

Turundusagentuur PNG (loovjuhiks Jüri Peetson) ühendas tänuõhtu oma klientidele ja koostööpartneritele hispaania laulja Enrique Iglesiase esinemisega 1. dets. Tallinnas Saku Suurhalli restoranis Platoo

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2008-01-01

Eesti Kunstimuuseumi Kunstisõprade Seltsi eestvõttel tähistati 4. novembril 2008 Kumule Euroopa aasta muuseumi tiitli andmist. Ühel juuresolevatest fotodest president Toomas Hendrik Ilves koos Kumu kunstimuuseumi direktrissi Sirje Helme ja Eesti Kunstimuuseumi Kunstisõprade Seltsi juhatuse esimehe Enn Kunilaga

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2007-01-01

21. veebruaril 2007 tähistas Tiigrihüppe SA Tallinnas Olümpia hotelli konverentsikeskuses konverentsiga "Kogu tõde Tiigrihüppest" Tiigrihüppe programmi 10. aastapäeva. Kohal viibis ka programmi üks algatajaid Toomas Hendrik Ilves

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2009-01-01

Eesti Posti peakontori hoovis esitleti Indrek Kaingi kujundatud rahvusmustriga tenniseid. Esimesed eksklusiivsed kaks paari MULK-kirjaga papusid kingiti president Toomas Hendrik Ilvesele ning ettevõtte Skype presidendile Josh Silvermanile

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2006-01-01

Tallinna Ülikoolis toimunud ameerika kultuurantropoloogi Clifford Geertzi mälestusõhtust, kus esinesid rektor Rein Raud, Eesti Humanitaarinstituudi dotsent Lorenzo Cañás Bottos ja kultuuriteooria lektor Marek Tamm

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2008-01-01

8. aug. Tallinnas kinos Sõprus ja klubis Juuksur tähistati 30 aasta möödumist ansambli Joy Divison sünnist ja Anton Corbijni debüütfilmi "Control" jõudmist Eesti kinodesse (näidati dokumentaalfilmi "Joy Divison")

Seltskond / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2006-01-01

Inglise rocklaulja Gordon Matthew Sumneri raamatu "Sting. Murtud muusika" esitlusest Tallinnas Viru Keskuse Rahva Raamatu kaupluses ja kontserdist Saku Suurhallis Broken Musicu nimelise tuuri raames 28. juulil

Metabolism and Biomarkers of Heterocyclic Aromatic Amines in Molecular Epidemiology Studies: Lessons Learned from Aromatic Amines

Science.gov (United States)

2011-01-01

Aromatic amines and heterocyclic aromatic amines (HAAs) are structurally related classes of carcinogens that are formed during the combustion of tobacco or during the high-temperature cooking of meats. Both classes of procarcinogens undergo metabolic activation by N-hydroxylation of the exocyclic amine group, to produce a common proposed intermediate, the arylnitrenium ion, which is the critical metabolite implicated in toxicity and DNA damage. However, the biochemistry and chemical properties of these compounds are distinct and different biomarkers of aromatic amines and HAAs have been developed for human biomonitoring studies. Hemoglobin adducts have been extensively used as biomarkers to monitor occupational and environmental exposures to a number of aromatic amines; however, HAAs do not form hemoglobin adducts at appreciable levels and other biomarkers have been sought. A number of epidemiologic studies that have investigated dietary consumption of well-done meat in relation to various tumor sites reported a positive association between cancer risk and well-done meat consumption, although some studies have shown no associations between well-done meat and cancer risk. A major limiting factor in most epidemiological studies is the uncertainty in quantitative estimates of chronic exposure to HAAs and, thus, the association of HAAs formed in cooked meat and cancer risk has been difficult to establish. There is a critical need to establish long-term biomarkers of HAAs that can be implemented in molecular epidemioIogy studies. In this review article, we highlight and contrast the biochemistry of several prototypical carcinogenic aromatic amines and HAAs to which humans are chronically exposed. The biochemical properties and the impact of polymorphisms of the major xenobiotic-metabolizing enzymes on the biological effects of these chemicals are examined. Lastly, the analytical approaches that have been successfully employed to biomonitor aromatic amines and HAAs, and

From Bad to Worse: Anemia on Admission and Hospital-Acquired Anemia.

Science.gov (United States)

Koch, Colleen G; Li, Liang; Sun, Zhiyuan; Hixson, Eric D; Tang, Anne S; Phillips, Shannon C; Blackstone, Eugene H; Henderson, J Michael

2017-12-01

Anemia at hospitalization is often treated as an accompaniment to an underlying illness, without active investigation, despite its association with morbidity. Development of hospital-acquired anemia (HAA) has also been associated with increased risk for poor outcomes. Together, they may further heighten morbidity risk from bad to worse. The aims of this study were to (1) examine mortality, length of stay, and total charges in patients with present-on-admission (POA) anemia and (2) determine whether these are exacerbated by development of HAA. In this cohort investigation, from January 1, 2009, to August 31, 2011, a total of 44,483 patients with POA anemia were admitted to a single health system compared with a reference group of 48,640 without POA anemia or HAA. Data sources included the University HealthSystem Consortium database and electronic medical records. Risk-adjustment methods included logistic and linear regression models for mortality, length of stay, and total charges. Present-on-admission anemia was defined by administrative coding. Hospital-acquired anemia was determined by changes in hemoglobin values from the electronic medical record. Approximately one-half of the patients experienced worsening of anemia with development of HAA. Risk for death and resource use increased with increasing severity of HAA. Those who developed severe HAA had 2-fold greater odds for death; that is, mild POA anemia with development of severe HAA resulted in greater mortality (odds ratio, 2.57; 95% confidence interval, 2.08-3.18; P < 0.001), increased length of stay (2.23; 2.16-2.31; P < 0.001), and higher charges (2.09; 2.03-2.15; P < 0.001). Present-on-admission anemia is associated with increased mortality and resource use. This risk is further increased from bad to worse when patients develop HAA. Efforts to address POA anemia and HAA deserve attention.

A New Approach to Eliminate High Amplitude Artifacts in EEG Signals

Directory of Open Access Journals (Sweden)

Ana Rita Teixeira

2016-09-01

Full Text Available High amplitude artifacts represent a problem during EEG recordings in neuroscience research. Taking this into account, this paper proposes a method to identify high amplitude artifacts with no requirement for visual inspection, electrooscillogram (EOG reference channel or user assigned parameters. A potential solution to the high amplitude artifacts (HAA elimination is presented based on blind source separation methods. The assumption underlying the selection of components is that HAA are independent of the EEG signal and different HAA can be generated during the EEG recordings. Therefore, the number of components related to HAA is variable and depends on the processed signal, which means that the method is adaptable to the input signal. The results show, when removing the HAA artifacts, the delta band is distorted but all the other frequency bands are preserved. A case study with EEG signals recorded while participants performed on the Halstead Category Test (HCT is presented. After HAA removal, data analysis revealed, as expected, an error-related frontal ERP wave: the feedback-related negativity (FRN in response to feedback stimuli.

Anodic dissolution of samarium in acetonitrile solution of acetylacetone

International Nuclear Information System (INIS)

Kostyuk, N.N.; Dik, T.A.; Trebnikov, A.G.; Shirokij, V.L.

2003-01-01

Electrochemical dissolution of metal samarium in acetonitrile medium in the presence of 0.1 M tetraethylammoniumbromide and 0.9 M acetylacetone (HAA) in argon atmosphere under a voltage of 3 V was considered for studying feasibility of electrochemical synthesis of samarium β-diketonates. Using IR and mass spectrometry, thermal and elementary analyses it was ascertained that, depending on cathode and anode areas ratio, anodic dissolution of samarium can give rise to formation of complexes of bi- and trivalent samarium featuring the composition Sm 4 (AA) 8 · 3HAA, Sm(AA) 3 · HAA and Sm(AA) 3 · 4HAA [ru

Urine and plasma metabonomics coupled with UHPLC-QTOF/MS and multivariate data analysis on potential biomarkers in anemia and hematinic effects of herb pair Gui-Hong.

Science.gov (United States)

Li, Shujiao; Lin, Hang; Qu, Cheng; Tang, Yuping; Shen, Juan; Li, Weixia; Yue, Shijun; Kai, Jun; Shang, Guanxiong; Zhu, Zhenhua; Zhang, Changbin; Liu, Pei; Yan, Hui; Zhang, Li; Qian, Li; Qian, Dawei; Duan, Jin-ao

2015-07-21

The compatibility of Angelicae Sinensis Radix (Danggui) and Carthami Flos (Honghua), a famous herb pair Gui-Hong, can produce synergistic and complementary hematinic effects. Our previous studies have indicated that Gui-Hong has therapeutic potential treatment in hemolytic and aplastic anemia (HAA). The present study aimed to investigate the hematinic effects of Danggui, Honghua and Gui-Hong on HAA rats induced by acetyl phenylhydrazine (APH) and cyclophosphamide (CP) and to explore the underlying hematinic regulation mechanisms. Rats were divided into 5 groups, and drugs were administered by oral gavage one time each day for continuous 7 days from the experiment began. Urine and plasma were analyzed by ultra-high-performance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UHPLC-QTOF/MS). Partial least-squares discriminate analysis (PLS-DA) models were built to evaluate the therapeutic effects of Danggui, Honghua and Gui-Hong. Pearson correlation matrix analysis method was used to discover the correlations between potential biomarkers and biochemical indicators of HAA rats. Seven potential biomarkers contribute to the separation of model group and control group were tentatively identified. The levels of l-kynurenine, phenylalanine, nicotinic acid and sphingosine increased significantly (Pmetabonomics method is a promising tool in the efficacy and mechanism research of traditional Chinese medicines. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Effects of multi-frequency ultrasound pretreatment under low power density on the enzymolysis and the structure characterization of defatted wheat germ protein.

Science.gov (United States)

Yang, Xue; Li, Yunliang; Li, Suyun; Oladejo, Ayobami Olayemi; Wang, Yucheng; Huang, Shanfen; Zhou, Cunshan; Wang, Yang; Mao, Li; Zhang, Yanyan; Ma, Haile; Ye, Xiaofei

2017-09-01

The effects of ultrasonic frequency mode, power density, pretreatment time and other parameters under low power density on the degree of hydrolysis (DH) of defatted wheat germ protein (DWGP) and angiotensin-I-converting enzyme (ACE) inhibitory activity of DWGP hydrolysate were studied in this research. Ultraviolet-visible (UV-Vis) spectra, free sulfhydryl (SH), disulfide bond (SS), surface hydrophobicity and hydrophobic protein content of ultrasound-pretreated protein and hydrophobic amino acid (HAA) content of alcalase-hydrolysate of DWGP were measured under optimized ultrasonic condition. The ultrasonic frequency mode with dual-fixed frequency combination of 28/40kHz showed higher ACE inhibitory activity of DWGP hydrolysate compared with that of other ultrasound frequency modes and all the ultrasonic frequency combinations involving in 28kHz showed higher ACE inhibitory activity. Under the dual-fixed frequency ultrasound mode of 28/40kHz, ultrasonic power density of 60W/L, pretreatment time of 70min, temperature of 60°C and substrate concentration of 60g/L, the ACE inhibitory activity of DWGP hydrolysate was the highest with its value of 74.75% (increased by 62.30% compared to control). However, all the ultrasonic pretreatment did not increase the DH of DWGP significantly (p>0.05). The changes in UV-Vis spectra, SH and SS groups, surface hydrophobicity and hydrophobic protein content indicated that the structure of DWGP unfolded after ultrasound pretreatment. The HAA content of hydrolysate from the pretreated DWGP increased significantly (p<0.05). The results proved that ultrasound pretreatment loosed the protein structure and exposed more HAA residues of protein to be attacked easily by alcalase. This resulted in the increase in the HAA content which related to the ACE inhibitory activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis of hydroxyeicosatetraenoic acids (HETE's) by adrenal glomerulosa cells and incorporation into cellular lipids

International Nuclear Information System (INIS)

Campbell, W.B.; Richards, C.F.; Brady, M.T.; Falck, J.R.

1986-01-01

The role of lipoxygenase metabolites of arachidonic acid (AA) in the regulation of aldosterone secretion was studied in isolated rat adrenal glomerulosa cells. Cells were incubated with 14 C-AA in the presence of angiotensin (AII). The media was extracted, metabolites isolated by HPLC, and structures of the metabolites determined by UV absorbance and mass spectrometry. The major products were 12- and 15-HETE with lesser amounts of 11- and 5-HETE. When adrenal cells were incubated with 15-, 12- or 5-HPETE or their respective HETE's (0.03-300nM), there was no significant change in basal or AII-stimulated aldosterone release. Cells were incubated with [ 3 H]-AA, -5-HETE, -15-HETE, -12-HETE or -LTB. The cellular lipids were extracted and analyzed by TLC. AA was incorporated into phospholipids (22%), cholesterol esters (50%) and triglycerides (21%). Neither the HETE's or LTB 4 were incorporated into phospholipids. 5-HETE was taken up into di- and mono-glycerides. The rates of incorporation of AA and 5-HETE were similar (+ 1/2 = 10 min). The incorporation of 5-HETE into glycerol esters did not modify the release of aldosterone by the cells. Thus, while adrenal cells synthesize HETE's, these eicosanoids do not appear to alter the synthesis of aldosterone

Bioremediation of petroleum wastes from the refining of lubricant oils

International Nuclear Information System (INIS)

Prince, M.; Sambasivam, Y.

1993-01-01

The results of an initial feasibility study on the bioremediation of sludge are presented. The sludge used in the study was taken from a site containing waste produced during the refining of lubricant oils to which sulfuric acid had been added. The effectiveness of bioremediation was examined using shake flask experiments with indigenous and other bacteria sources and nutrient supplementation. The initial results show limited effectiveness of biological treatment at conditions employing indigenous bacteria and low (2%) sludge concentrations in Bushnell-Haas media. In addition, the indigenous bacteria were seen to degrade the polycyclic aromatic hydrocarbons naphthalene, penanthrene and pyrene which are present at some locations at the site. No apparent degradation of material was seen using conditions of high (30%) sludge concentrations in Bushnell-Haas medium under a variety of conditions. In addition, nutrients were rapidly depleted at these sludge concentrations, with the exception of sulfates which were produced when high sludge concentrations were used. 23 refs., 8 figs., 3 tabs

Drinking water disinfection by-products during pregnancy and child neuropsychological development in the INMA Spanish cohort study.

Science.gov (United States)

Villanueva, Cristina M; Gracia-Lavedan, Esther; Julvez, Jordi; Santa-Marina, Loreto; Lertxundi, Nerea; Ibarluzea, Jesús; Llop, Sabrina; Ballester, Ferran; Fernández-Somoano, Ana; Tardón, Adonina; Vrijheid, Martine; Guxens, Mònica; Sunyer, Jordi

2018-01-01

Disinfection by-products (DBPs) constitute a complex mixture of prevalent chemicals in drinking water and there is evidence of neurotoxicity for some of them. We evaluated the association between estimates of DBP exposure during pregnancy and child neuropsychological outcomes at 1 and 4-5years of age. We conducted a population-based mother-child cohort study in Spain with recruitment at first trimester of gestation (INMA Project, 2003-2008). Neuropsychological development was measured at 1year of age using the Bayley Scales of Infant Development and at 4-5years with the McCarthy Scales of Children's Abilities. Modeled tap water concentrations of trihalomethanes (THM) were combined with personal ingestion, showering and bathing habits to estimate exposure as ingestion uptake, all route (showering, bathing, ingestion) uptake (μg/day) and crude levels (μg/l) in the residence. Chloroform, brominated THMs (bromodichloromethane, dibromochloromethane, bromoform) and total THMs (chloroform and brominated THMs) were analysed separately. Nine haloacetic acids levels were available in one of the areas. Linear regression was used to estimate associations in 1855 subjects adjusting for covariables. The median concentration of total THMs, chloroform, brominated THMs, total haloacetic acids, dichloroacetic acid, and trichloroacetic acid were, respectively 30.3μg/L, 9.4μg/L, 11.6μg/L, 10.5μg/L, 2.7μg/L, and 3.1μg/L. The associations between THM exposure and neuropsychological outcomes were null, except for total and brominated THM uptake though all routes and the general cognitive score at 4-5years, with a decrease in -0.54 points (95%CI -1.03, -0.05) and -0.64 (95%CI -1.16, -0.12), respectively, for doubling total and brominated THM uptake. A positive association found between dichloroacetic acid and the mental score at 1year did not persist at 4-5years. Minor associations observed between DBP exposure during gestation and child neuropsychological development at 1year

Identification and evaluation of resistance to powdery mildew and yellow rust in a wheat mapping population.

Directory of Open Access Journals (Sweden)

Lijun Yang

Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.

Aquifer Storage Recovery (ASR) of chlorinated municipal drinking water in a confined aquifer

Science.gov (United States)

Izbicki, John A.; Petersen, Christen E.; Glotzbach, Kenneth J.; Metzger, Loren F.; Christensen, Allen H.; Smith, Gregory A.; O'Leary, David R.; Fram, Miranda S.; Joseph, Trevor; Shannon, Heather

2010-01-01

phase. Haloacetic acids (HAAs) were completely sorbed or degraded within 10 months of injection.

Disrupted lymphocyte homeostasis in hepatitis‐associated acquired aplastic anemia is associated with short telomeres

Science.gov (United States)

Babushok, Daria V.; Grignon, Anne‐Laure; Li, Yimei; Atienza, Jamie; Xie, Hongbo M.; Lam, Ho‐Sun; Hartung, Helge; Bessler, Monica

2016-01-01

Hepatitis‐associated aplastic anemia (HAA) is a variant of acquired aplastic anemia (AA) in which immune‐mediated bone marrow failure (BMF) develops following an acute episode of seronegative hepatitis. Dyskeratosis congenita (DC) is an inherited BMF syndrome characterized by the presence of short telomeres, mucocutaneous abnormalities, and cancer predisposition. While both conditions may cause BMF and hepatic impairment, therapeutic approaches are distinct, making it imperative to establish the correct diagnosis. In clinical practice, lymphocyte telomere lengths (TL) are used as a first‐line screen to rule out inherited telomeropathies before initiating treatment for AA. To evaluate the reliability of TL in the HAA population, we performed a retrospective analysis of TL in 10 consecutively enrolled HAA patients compared to 19 patients with idiopathic AA (IAA). HAA patients had significantly shorter telomeres than IAA patients (P = 0.009), including four patients with TL at or below the 1st percentile for age‐matched controls. HAA patients had no clinical features of DC and did not carry disease‐causing mutations in known genes associated with inherited telomere disorders. Instead, short TLs were significantly correlated with severe lymphopenia and skewed lymphocyte subsets, features characteristic of HAA. Our results indicate the importance of caution in the interpretation of TL measurements in HAA, because, in this patient population, short telomeres have limited specificity. Am. J. Hematol. 91:243–247, 2016. © 2015 The Authors. American Journal of Hematology Published by Wiley Periodicals, Inc. PMID:26615915

Recovery from Hospital-Acquired Anemia after Acute Myocardial Infarction and Effect on Outcomes

OpenAIRE

Salisbury, Adam C.; Kosiborod, Mikhail; Amin, Amit P.; Reid, Kimberly J.; Alexander, Karen P.; Spertus, John A.; Masoudi, Frederick A.

2011-01-01

New onset, hospital-acquired anemia (HAA) during acute myocardial infarction (AMI) is independently associated with poor outcomes. Patterns of recovery from HAA after AMI and their association with mortality and health status are unknown. In the prospective 24-center TRIUMPH registry, we identified 530 AMI patients with HAA (defined as normal hemoglobin at admission with development of anemia by discharge) who had repeat, protocol-driven hemoglobin measurement 1 month after discharge. The 1-m...

Effect of cooking methods on the formation of heterocyclic aromatic amines in chicken and duck breast.

Science.gov (United States)

Liao, G Z; Wang, G Y; Xu, X L; Zhou, G H

2010-05-01

Heterocyclic aromatic amines (HAAs), potent mutagens/carcinogens, are pyrolysis formed during the cooking of meat and fish. In the present study, the effects of various cooking methods, pan-frying, deep-frying, charcoal grilling and roasting on the formation of HAAs in chicken breast and duck breast were studied. The various HAAs formed during cooking were isolated by solid-phase extraction and analyzed by high-performance liquid chromatography (HPLC). Results showed that chicken breast cooked by charcoal grilling contained the highest content of total HAAs, as high as 112 ng/g, followed by pan-fried duck breast (53.3 ng/g), charcoal grilled duck breast (32 ng/g), pan-fried chicken breast (27.4 ng/g), deep-fried chicken breast (21.3 ng/g), deep-fried duck breast (14 ng/g), roasted duck breast (7 ng/g) and roasted chicken breast (4 ng/g). For individual HAA, the most abundant HAA was 9H-pyrido-[4,3-b]indole (Norharman), which was detected in charcoal grilled chicken breast at content as high as 32.2 ng/g, followed by 1-methyl-9H-pyrido[4,3-b] indole (Harman) and 2-amino-1-methyl-6-phenylimidazo[4,5-f]pyridine(PhIP) at 32 and 31.1 ng/g in charcoal grilled chicken breast, respectively. The content of PhIP in pan-fried duck and chicken breast were 22 and 18.3 ng/g, respectively. Generally, the type and content of HAAs in cooked poultry meat varies with cooking method and cooking conditions. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Water-Quality Constituents, Dissolved-Organic-Carbon Fractions, and Disinfection By-Product Formation in Water from Community Water-Supply Wells in New Jersey, 1998-99

Science.gov (United States)

Hopple, Jessica A.; Barringer, Julia L.; Koleis, Janece

2007-01-01

to a pH of 7, dosed with sodium hypochlorite, and incubated for 168 hours (seven days) at 25 ?C to form disinfection by-products (DBPs). Concentrations of the DBPs-trihalomethanes, haloacetic acids, haloacetonitriles, and chlorate-were measured. Concentrations of these compounds, with few exceptions, were higher in water from Coastal Plain wells than from wells in glacial and bedrock aquifers. The organic-carbon fractions were dosed with sodium hypochlorite, incubated for 168 hours at 25 ?C, and analyzed for trihalomethanes, haloacetic acids, haloacetonitriles, and chlorate. Concentrations of trihalomethanes and haloacetic acids were higher in most of the hydrophobic organic-acid fractions than in the hydrophilic fractions, with the highest concentrations in samples from Coastal Plain aquifers. Traces of haloacetonitriles were measured, mostly in the hydrophilic fraction. The aromaticity of the precursor DOC, as estimated by measurements of the absorbance of ultraviolet light at 254 nanometers, apparently is a factor in the DBP formation potentials determined, as aromaticity was greater in the samples that developed high concentrations of DBPs. VOCs may have contributed to the organic carbon present in some of the samples, but much of the DOC present in water from the 20 wells appeared to be natural in origin. The sediments of the Coastal Plain aquifers, in particular, contain substantial amounts of organic matter, which contribute ammonia, organic nitrogen, and aromatic DOC compounds to the ground water. Thus, the geologic characteristics of the aquifers appear to be a major factor in the potential for ground water to form DBPs when chlorinated.

Arachidonic acid metabolism in silica-stimulated bovine alveolar macrophages

International Nuclear Information System (INIS)

Englen, M.D.

1989-01-01

The in vitro production of arachidonic acid (AA) metabolites in adherent bovine alveolar macrophages (BAM) incubated with silica was investigated. BAM were pre-labelled with 3 H-AA, and lipid metabolites released into the culture medium were analyzed by high performance liquid chromatography (HPLC). Lactate dehydrogenase (LDH) release was simultaneously assayed to provide an indication of cell injury. Increasing doses of silica selectively stimulated the 5-lipoxygenase pathway of AA metabolism, while cyclooxygenase metabolite output was suppressed. LDH release increased in a linear, dose-dependent fashion over the range of silica doses used. Moreover, within 15 min following addition of a high silica dose, a shift to the production of 5-lipoxygenase metabolites occurred, accompanied by a reduction in cyclooxygenase products. This rapid alteration in AA metabolism preceded cell injury. To examine the relationship between cytotoxicity and AA metabolite release by BAM exposed to silicas with different cytotoxic and fibrogenic activities, BAM were exposed to different doses of DQ-12, Minusil-5, and Sigma silicas, and carbonyl iron beads. The median effective dose (ED 50 ) of each particulate to stimulate the release of AA metabolites and LDH was calculated. The ED 50 values for DQ-12, Minusil-5, and Sigma silica showed that the relative cytotoxicities of the different silicas for BAM corresponded to the relative potencies of the silicas to elicit 5-lipoxygenase metabolites from BAM. These results indicate that the cytotoxic, and presumed fibrogenic potential, of a silica is correlated with the potency to stimulate the release of leukotrienes from AM

The Effect of Trihalomethane and Haloacetic Acid Exposure on Fetal Growth in a Maryland County

National Research Council Canada - National Science Library

Porter, Chad K; Putman, Shannon D; Hunting, Katherine L; Riddle, Mark R

2005-01-01

As water flows from treatment plants to the tap, chlorine, used to disinfect surface water meant for residential use, reacts with residual organic and inorganic matter, creating chlorine disinfection by-products...

Formation of heterocyclic amines in Chinese marinated meat: effects of animal species and ingredients (rock candy, soy sauce and rice wine).

Science.gov (United States)

Wang, Pan; Hong, Yanting; Ke, Weixin; Hu, Xiaosong; Chen, Fang

2017-09-01

Heterocyclic aromatic amines (HAAs) are one type of neo-formed contaminants in protein-rich foods during heat processing. Recently, accumulative studies have focused on the formation of HAs in Western foods. However, there is little knowledge about the occurrence of HAAs in traditional Chinese foods. The objective of this study was to determinate the contents of main HAs in traditional marinated meat products by UPLC-MS/MS, and to investigate the effects of animal species and the ingredients (soy sauce, rock candy, and rice wine) on the formation of HAAs in marinated meats. Five HAs - 2-amino-3-methylimidazo[4,5-f]-quinolone (IQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3,4-dimethylimidazo[4,5-f]quinoxaline (MeIQ), 9H-pyrido[3,4-b]indole (Norharman) and l-methyl-9H-pyrido[3,4-b]indole (Harman) - were detected in 12 marinated meats, but 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) was only found in three chicken marinates. The animal species and ingredients (soy sauce, rock candy and rice wine) have significant influence on the formation of HAAs in meat marinates. Beef had the highest content of total HAAs compared with pork, mutton and chicken. Meanwhile, soy sauce contributed to the formation of HAAs more greatly than rock candy, soy sauce, and rice wine. Choice of raw materials and optimisation of ingredients recipe should be become a critical point to control the HAAs formation in marinated meats. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Sources and characteristics of organic matter in the Clackamas River, Oregon, related to the formation of disinfection by-products in treated drinking water

Science.gov (United States)

Carpenter, Kurt D.; Kraus, Tamara E.C.; Goldman, Jami H.; Saraceno, John Franco; Downing, Bryan D.; Bergamaschi, Brian A.; McGhee, Gordon; Triplett, Tracy

2013-01-01

This study characterized the amount and quality of organic matter in the Clackamas River, Oregon, to gain an understanding of sources that contribute to the formation of chlorinated and brominated disinfection by-products (DBPs), focusing on regulated DBPs in treated drinking water from two direct-filtration treatment plants that together serve approximately 100,000 customers. The central hypothesis guiding this study was that natural organic matter leaching out of the forested watershed, in-stream growth of benthic algae, and phytoplankton blooms in the reservoirs contribute different and varying proportions of organic carbon to the river. Differences in the amount and composition of carbon derived from each source affects the types and concentrations of DBP precursors entering the treatment plants and, as a result, yield varying DBP concentrations and species in finished water. The two classes of DBPs analyzed in this study-trihalomethanes (THMs) and haloacetic acids (HAAs)-form from precursors within the dissolved and particulate pools of organic matter present in source water. The five principal objectives of the study were to (1) describe the seasonal quantity and character of organic matter in the Clackamas River; (2) relate the amount and composition of organic matter to the formation of DBPs; (3) evaluate sources of DBP precursors in the watershed; (4) assess the use of optical measurements, including in-situ fluorescence, for estimating dissolved organic carbon (DOC) concentrations and DBP formation; and (5) assess the removal of DBP precursors during treatment by conducting treatability "jar-test" experiments at one of the treatment plants. Data collection consisted of (1) monthly sampling of source and finished water at two drinking-water treatment plants; (2) event-based sampling in the mainstem, tributaries, and North Fork Reservoir; and (3) in-situ continuous monitoring of fluorescent dissolved organic matter (FDOM), turbidity, chlorophyll-a, and

Laboratory Characterization Tests for Antimisting Fuel.

Science.gov (United States)

1987-03-01

Por hdi cal lv, clean wtith chromic acid to reTove traces r! rt c ,t r al e t 1t,’ t t I irt ft tf,(- viscomter C t! tC. ’o( +( .fl50( ,r,, .. , i:t...bath to bel ow 3.9o C. Bubbl e gaseous sul1fur dioxid’e (SO-) through rocetatdsul furic acid (S( 4 ,sp gr 1 .84-) into th, coo led mixture . (’out :oue...qeyce. .t d ’ŕ X oku.4 ict t ,Avenue., NW 3034 W! I. Mr. ,. Thris Meldrum Mr. James H. O’Mara Texdao Company Rohm and Haas P.O. Box 430 727

Arachidonic acid-mediated inhibition of a potassium current in the giant neurons of Aplysia

International Nuclear Information System (INIS)

Carlson, R.O.

1990-01-01

Biochemical and electrophysiological approaches were used to investigate the role of arachidonic acid (AA) in the modulation of an inwardly rectifying potassium current (I R ) in the giant neurons of the marine snail, Aplysia californica. Using [ 3 H]AA as tracer, the intracellular free AA pool in Aplysia ganglia was found to be in a state of constant and rapid turnover through deacylation and reacylation of phospholipid, primarily phosphatidyl-inositol. This constant turnover was accompanied by a constant release of free AA and eicosanoids into the extracellular medium. The effects of three pharmacological agents were characterized with regard to AA metabolism in Aplysia ganglia. 4-O-tetra-decanoylphorbol 13-acetate (TPA), an activator of protein kinase C, stimulated liberation of AA from phospholipid, and 4-bromophenacylbromide (BPB), an inhibitor of phospholipate A 2 , inhibited this liberation. Indomethacin at 250 μM was found to inhibit uptake of AA, likely through inhibition of acyl-CoA synthetase. These agents were also found to modulate I R in ways which were consistent with their biological effects: TPA inhibited I R , and both BPB and indomethacin stimulated I R . Modulation of I R by these substances was found not to involve cAMP metabolism. Acute application of exogenous AA did not affect I R ; however, I R in giant neurons was found to be inhibited after dialysis with AA or other unsaturated fatty acids. Also, after perfusion with BSA overnight, a treatment which strips the giant neurons of AA in lipid storage, I R was found to have increased over 2-fold. This perfusion-induced increase was inhibited by the presence of AA or by pretreatment of the giant neurons with BPB. These results suggest AA, provided through constant turnover from phospholipid, mediates constitutive inhibition of I R

Hepatic artery aneurysms (HAAs)

International Nuclear Information System (INIS)

Nosratini, H.

2004-01-01

The hepatic artery aneurysms are rare, especially in interahepatic branches, The frequency consists of 75-80% extrahepatic and 20-25% intrahepatic. Catheterization is achieved usually from common femoral artery, other methods implemented in the case of unsuccessful catheterization from femoral artery, are translumbar and brachial catheterization. The study consist of 565 patients that were referred to the angiography ward, During seven years of assessment, five cases of hepatic artery aneurysm were found; this is a rare condition reported in the English literature. In the literature as well as in this case report the hepatic artery aneurysms are rare. In reported series the extrahepatic artery aneurysms are found more often than in the intrahepatic artery aneurysm but in this case report intrahepatic artery aneurysms are more than extrahepatic one. (author)

Glucocorticoid regulation of gonadotropin release from gonadotropes of ovine pituitary gland in vitro

International Nuclear Information System (INIS)

Nangalama, A.W.

1989-01-01

In order to understand the role of glucocorticoids in the regulation of gonadotropin release by the pituitary gland, the short-term effects of cortisol perifusion (1.5 h to 8 hrs) on GnRH-induced LH secretion were investigated. To determine the biochemical mechanism(s) by which cortisol can act to modulate GnRH-induced LH release, the interactions of cortisol and arachidonic acid in GnRH-stimulated LH release were examined. Cortisol perifusion for 1.5 hr had no effect on GnRH-induced LH release, but longer treatment periods (4 hr-8 hrs) significantly reduced GnRH-stimulated LH release (4.0 hr, p -4 M AA was administered for 20 min before a 10 min, 10 -10 M GnRH pulse. Like cortisol, chloroquine also failed to inhibit AA-induced LH release. Perifusion with 10 -6 M cortisol for 6.0 hours significantly (p 3 ]AA release 24% below the basal (100%) [ 3 H]AA secretion. Reduction of [ 3 H]AA release was accompanied by decreased GnRH-stimulated LH secretion

Preferential induction of the AhR gene battery in HepaRG cells after a single or repeated exposure to heterocyclic aromatic amines

International Nuclear Information System (INIS)

Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Laurent, Veronique; Loyer, Pascal; Robin, Marie-Anne; Guillouzo, Andre

2010-01-01

2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) are two of the most common heterocyclic aromatic amines (HAA) produced during cooking of meat, fish and poultry. Both HAA produce different tumor profiles in rodents and are suspected to be carcinogenic in humans. In order to better understand the molecular basis of HAA toxicity, we have analyzed gene expression profiles in the metabolically competent human HepaRG cells using pangenomic oligonucleotide microarrays, after either a single (24-h) or a repeated (28-day) exposure to 10 μM PhIP or MeIQx. The most responsive genes to both HAA were downstream targets of the arylhydrocarbon receptor (AhR): CYP1A1 and CYP1A2 after both time points and CYP1B1 and ALDH3A1 after 28 days. Accordingly, CYP1A1/1A2 induction in HAA-treated HepaRG cells was prevented by chemical inhibition or small interference RNA-mediated down-regulation of the AhR. Consistently, HAA induced activity of the CYP1A1 promoter, which contains a consensus AhR-related xenobiotic-responsive element (XRE). In addition, several other genes exhibited both time-dependent and compound-specific expression changes with, however, a smaller magnitude than previously reported for the prototypical AhR target genes. These changes concerned genes mainly related to cell growth and proliferation, apoptosis, and cancer. In conclusion, these results identify the AhR gene battery as the preferential target of PhIP and MeIQx in HepaRG cells and further support the hypothesis that intake of HAA in diet might increase human cancer risk.

Trace Analysis of Mutagenic Heterocyclic Aromatic Amines in Cigarette Smoke Condensate and its Base Fractions via Silylation-GC-MS

Directory of Open Access Journals (Sweden)

Liu S

2014-12-01

Full Text Available Among the more than 5000 chemicals reported in cigarette smoke condensate (CSC, heterocyclic aromatic amines (HAAs are considered to be a contributor to observed biological activity. HAAs are non-volatile and are reported at ppb levels in CSC. A new method for HAA analysis at the trace level is reported here. N, O-Bis(trimethylsilyl trifluoroacetamide (BSTFA containing 1% trimethylchlorosilane was employed to derivatize amino groups by heating the reagent containing a sample of CSC at 80 °C for 30 min followed by analysis employing gas chromatography-mass spectroscopy (GC-MS in the selected-ion-monitoring (SIM mode. This derivatization method afforded symmetrical peak shapes on a ZB-50 stationary phase and achieved instrumental limits of quantification (LOQ at 10:1 S/N from -1 ng/mL for AαC to120 ng/mL for Glu-P-1. The chemical identity of each derivative was confirmed by comparison of retention time and mass spectra of standards. The latter were characterized by the following ions: M·+ or [M-1]+, [M-15]+, and m/z 73 (i.e., trimethylsilyl. CSC and its base sub-fractions were studied using the GC-MS method. Ten HAAs were screened and five were quantified in cigarette smoke condensate, while 2-5 HAAs were quantified in each of three base sub-fractions. Values obtained with the new procedure agree well with values reported in the literature and with results obtained from a commercial laboratory via a different analytical method. The potential contribution of each HAA to the overall mutagenic activity observed for CSC and its base fractions is discussed. When considered together, HAAs account for only a small portion (-7.8% of the observed mutagenicity of the CSC.

Reducing effect of artichoke extract on heterocyclic aromatic amine formation in beef and chicken breast meat.

Science.gov (United States)

Tengilimoglu-Metin, Mercan Merve; Kizil, Mevlude

2017-12-01

The aim of this study was to investigate the inhibitory effect of different levels of artichoke extract (0, 0.5, and 1.0%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast meat cooked by either pan-frying or oven-roasting. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of 12 HAAs (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2) were assessed. The total HAA content in beef and chicken breast ranged from not detectable to 49.26ng/g, and not detectable to 83.06ng/g, respectively. The inhibitory effects of 0.5 and 1.0% artichoke extracts on total HAAs levels were found to be 6-46% and 25-98% in beef, and 5-97% and 14-95% in chicken breast, respectively. The present study showed that artichoke extracts could mitigate HAA formation especially in oven-roasted beef and chicken breast meat. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cooking does not decrease hydrophilic antioxidant capacity of wild blueberries.

Science.gov (United States)

Murphy, Rebecca Ree; Renfroe, Michael H; Brevard, Patricia Bowling; Lee, Robert E; Gloeckner, Janet W

2009-01-01

The present study examined the effects of domestic cooking methods on the hydrophilic antioxidant activity (HAA) of wild blueberries. Baked, microwaved, simmered, and pan-fried frozen wild blueberries, and a thawed uncooked control, were analyzed for HAA using an ABTS/H(2)O(2)/HRP decoloration method. All cooking treatments were derived from recipes using wild blueberries, and were performed in triplicate. A randomized block design was used to determine whether there were statistical differences in antioxidant content after cooking and between each of the trials. There were no statistically significant decreases after cooking the thawed berries. On both a fresh weight and a dry weight basis, pan-fried blueberries had significantly higher HAA than baked, simmered, and control blueberries (Pcooked berries retained significant HAA. Cooked wild blueberries can be recommended as a good source of dietary antioxidants.

Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

Indian Academy of Sciences (India)

(TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

Effect of Permanganate Preoxidation to Natural Organic Matter and Disinfection by-Products Formation Potential Removal

Science.gov (United States)

Hidayah, E. N.; Yeh, H. H.

2018-01-01

Laboratory scale experiments was conducted to examine effect of permanganate (KMnO4) peroxidation in characterizing and to remove natural organic matter (NOM) in source water. The experimental results shows that increasing permanganate dosage could decreased aromatic matter, as indicated by decreasing UV254 and SUVA value about 23% and 28%, respectively. It seems that permanganate preoxidation caused the breakdown of high molecular weight (MW) organics into low MW ones, as represented by increasing NPDOC about 10%. Further, disinfection by-products formation potential (DBPFP) in terms of trihalomethanes formation potential (THMFP) and haloacetic acid formation potential (HAAP) decreased about 15% and 23%, respectively. HAAFP removal is higher than THMFP removal and that DPBFP removal is consistent with UV254 and NPDOC removal.

Genotoxicity and induction of DNA damage responsive genes by food-borne heterocyclic aromatic amines in human hepatoma HepG2 cells.

Science.gov (United States)

Pezdirc, Marko; Žegura, Bojana; Filipič, Metka

2013-09-01

Heterocyclic aromatic amines (HAAs) are potential human carcinogens formed in well-done meats and fish. The most abundant are 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-Amino-3,4,8-trimethyl-3H-imidazo[4,5-f]quinoxaline (4,8-DiMeIQx) and 2-Amino-3-methyl-3H-imidazo[4,5-f]quinoline (IQ). HAAs exert genotoxic activity after metabolic transformation by CYP1A enzymes, that is well characterized, however the genomic and intervening responses are not well explored. We have examined cellular and genomic responses of human hepatoma HepG2 cells after 24h exposure to HAAs. Comet assay revealed increase in formation of DNA strand breaks by PhIP, MeIQx and IQ but not 4,8-DiMeIQx, whereas increased formation of micronuclei was not observed. The four HAAs up-regulated expression of genes encoding metabolic enzymes CYP1A1, CYP1A2 and UGT1A1 and expression of TP53 and its downstream regulated genes CDKN1A, GADD45α and BAX. Consistent with the up-regulation of CDKN1A and GADD45α the cell-cycle analysis showed arrest in S-phase by PhIP and IQ, and in G1-phase by 4,8-DiMeIQx and MeIQx. The results indicate that upon exposure to HAAs the cells respond with the cell-cycle arrest, which enables cells to repair the damage or eliminate them by apoptosis. However, elevated expression of BCL2 and down-regulation of BAX may indicate that HAAs could suppress apoptosis meaning higher probability of damaged cells to survive and mutate. Copyright © 2013 Elsevier Ltd. All rights reserved.

Quantitative evaluation of interstitial pneumonia using 3D-curved high-resolution CT imaging parallel to the chest wall: A pilot study.

Directory of Open Access Journals (Sweden)

Hiroyasu Umakoshi

Full Text Available To quantify the imaging findings of patients with interstitial pneumonia (IP and emphysema using three-dimensional curved high-resolution computed tomography (3D-cHRCT at a constant depth from the chest wall, and compare the results to visual assessment of IP and each patient's diffusing capacity of the lungs for carbon monoxide (DLco.We retrospectively reviewed the axial CT findings and pulmonary function test results of 95 patients with lung cancer (72 men and 23 women, aged 45-84 years with or without IP, as follows: non-IP (n = 47, mild IP (n = 31, and moderate IP (n = 17. The 3D-cHRCT images of the lung at a 1-cm depth from the chest wall were reconstructed automatically using original software; total area (TA, high-attenuation area (HAA >-500 HU, and low-attenuation area (LAA <-950 HU were calculated on a workstation. The %HAA and %LAA were calculated as follows: [Formula: see text], and [Formula: see text].The %HAA and %LAA respective values were 3.2±0.9 and 27.7±8.2, 3.9±1.2 and 27.6±5.9, and 6.9±2.2 and 25.4±8.7 in non-IP, mild IP, and moderate IP patients, respectively. There were significant differences in %HAA between the 3 groups of patients (P<0.001, but no differences in %LAA (P = 0.558. Multiple linear regression analysis revealed that %HAA and %LAA were negatively correlated with predicted DLco (standard partial regression coefficient [b*] = -0.453, P<0.001; b* = -0.447, P<0.001, respectively.The %HAA and %LAA values computed using 3D-cHRCT were significantly correlated with DLco and may be important quantitative parameters for both IP and emphysema.

Meie esimesed naisfotograafid / Annika Haas

Index Scriptorium Estoniae

Haas, Annika, 1974-

2016-01-01

Tallinna fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kuraatorid Betty Ester-Väljaots, Merili Reinpalu, kunstnik Lilian Juhkam. Eesti naisfotograafide Anna Kuke ja Evi Lembergi eluloolisi andmeid, nende looming

Meie esimesed naisfotograafid / Annika Haas

Index Scriptorium Estoniae

Haas, Annika, 1974-

2015-01-01

Eesti naisfotograafid Hilja Riet ja Lydia Tarem. Fotomuuseumi aastanäitus "Varjust välja. Esimesed naisfotograafid Eestis", kus tutvustatakse Hilja Rieti, Lydia Taremi, Anna Kuke ja Evi Lembergi loomingut. Näituse kuraatorid Betty Ester-Väljaots, Merili Reinpalu

Breast cancer, heterocyclic aromatic amines from meat and N-acetyltransferase 2 genotype.

Science.gov (United States)

Delfino, R J; Sinha, R; Smith, C; West, J; White, E; Lin, H J; Liao, S Y; Gim, J S; Ma, H L; Butler, J; Anton-Culver, H

2000-04-01

Breast cancer risk has been hypothesized to increase with exposure to heterocyclic aromatic amines (HAAs) formed from cooking meat at high temperature. HAAs require enzymatic activation to bind to DNA and initiate carcinogenesis. N-acetyltransferase 2 (NAT2) enzyme activity may play a role, its rate determined by a polymorphic gene. We examined the effect of NAT2 genetic polymorphisms on breast cancer risk from exposure to meat by cooking method, doneness and estimated HAA [2-amino-1-methyl-6-phenylimidazole[4,5-b]pyridine (PhIP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) and 2-amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline (DiMeIQx)] intake. Women were recruited with suspicious breast masses and questionnaire data were collected prior to biopsy to blind subjects and interviewers to diagnoses. For 114 cases with breast cancer and 280 controls with benign breast disease, NAT2 genotype was determined using allele-specific PCR amplification to detect slow acetylator mutations. HAAs were estimated from interview data on meat type, cooking method and doneness, combined with a quantitative HAA database. Logistic regression models controlled for known risk factors, first including all controls, then 108 with no or low risk (normal breast or no hyperplasia) and finally 149 with high risk (hyperplasia, atypical hyperplasia, complex fibroadenomas). Meat effects were examined within NAT2 strata to assess interactions. We found no association between NAT2 and breast cancer. These Californian women ate more white than red meat (control median 46 versus 8 g/day). There were no significant associations of breast cancer with red meat for any doneness. White meat was significantly protective (>67 versus chicken, including well done, pan fried and barbecued chicken. MeIQx and DiMeIQx were not associated with breast cancer. A protective effect of PhIP was confounded after controlling for well done chicken. Results were unchanged using low or high risk controls or dropping

Purification and Characterization of Hemagglutinating Proteins from Poker-Chip Venus (Meretrix lusoria and Corbicula Clam (Corbicula fluminea

Directory of Open Access Journals (Sweden)

Chin-Fu Cheng

2012-01-01

Full Text Available Hemagglutinating proteins (HAPs were purified from Poker-chip Venus (Meretrix lusoria and Corbicula clam (Corbicula fluminea using gel-filtration chromatography on a Sephacryl S-300 column. The molecular weights of the HAPs obtained from Poker-chip Venus and Corbicula clam were 358 kDa and 380 kDa, respectively. Purified HAP from Poker-chip Venus yielded two subunits with molecular weights of 26 kDa and 29 kDa. However, only one HAP subunit was purified from Corbicula clam, and its molecular weight was 32 kDa. The two Poker-chip Venus HAPs possessed hemagglutinating ability (HAA for erythrocytes of some vertebrate animal species, especially tilapia. Moreover, HAA of the HAP purified from Poker-chip Venus was higher than that of the HAP of Corbicula clam. Furthermore, Poker-chip Venus HAPs possessed better HAA at a pH higher than 7.0. When the temperature was at 4°C–10°C or the salinity was less than 0.5‰, the two Poker-chip Venus HAPs possessed better HAA compared with that of Corbicula clam.

Family Reintegration Following Guard Deployment

Science.gov (United States)

2010-09-20

Somalia Peacekeepers. Journal of Consulting and Clinical Psychology, 72(5), 909-913. Haas DM . Pazdernik LA. Olsen CH. A cross-sectional survey of the...relationship between partner deployment and stress in pregnancy during wartime. Haas DM . Pazdernik LA. Partner deployment and stress in pregnant...Identify 3-5 key words relating to the proposal. (Required) I used MESH Headings instead of the CRISP Thesaurus for key

Separation of beryllium and mercury from lithium chloride solution by gaseous extraction

International Nuclear Information System (INIS)

Sevast'yanov, A.I.; Chepovol, V.I.

1989-01-01

The possibility is shown of extracting beryllium and mercury by acetylacetone (HAA) from lithium chloride solution by passing argon through the solution and the optimum conditions have been determined. The dependence of the degree of extraction and the distribution coefficients on various parameters of the liquid phase are presented, viz. the initial pH value, the lithium chloride concentration, and the initial HAA content

Determination of the minor disinfection by-products formed in the water plant of Sant Joan Despi (Barcelona, Spain); Determinacion de los subproductos de desinfeccion minoritarios formados en la planta de Sant Joan Despi (Barcelona)

Energy Technology Data Exchange (ETDEWEB)

Cancho, B.; Galceran, M.T. [Universitat de Barcelona (Spain); Ventura, F. [AGBAR. Societat General d` Aigues de Barcelona, S.A. (Spain)

1997-09-01

Chlorine is widely used in drinking water disinfection due to be a powerful and not expense disinfection. Although the benefits of disinfection, the formation of stable disinfection by-products of the health concern, is the result of the interaction of aqueous chlorine with natural organic matter presents in water. Disinfection by-products generated in major concentration are trihalomethane and haloacetic acids. Disinfection by-products generated in minor concentration are haloacetonitriles, haloketones,chloral hydrate and chloropicrin and some new groups such as cyanogen halides and trihaloacetaldydes. In this work two analytical methods.: headspace/gas chromatography/electron capture detector and liquid-liquid microextraction/gas chromatography/electron capture detector are studied and compared to determine the minor by-products and to establish finally, a systematic control of them in the different stages of the Water Treatment Plant of San Joan Despi (Barcelona, Spain). (Author) 12 refs.

Formation of secondary products in water purification. ; Toxicological evaluation of mutagenic chlorination by-products during drinking water treatment. Josui shori ni okeru fukuseiseibutsu. ; Josui shori ni okeru hen'i genseibusshitsu no dokusei hyoka

Energy Technology Data Exchange (ETDEWEB)

Nakamuro, K [Setsunan Univ., Osaka (Japan). Faculty of Pharmaceutical Sciences; Sayato, Y [Setsunan Univ., Osaka (Japan)

1993-12-10

The biological effects of acute toxicity, chronic toxicity, carcinogenicity, etc. of chlorination by-products detected in drinking water in Japan are discussed. The biological effects of representative chlorination by-products such as trihalomethane, haloacetic acid, haloaldehyde, haloacetonitrile, chlorophenol, chloropicrin, etc. as well as the evaluation of mutagenicity in drinking water purification process, for which Ames Salmonella/microsome assay is used for safety evaluation of drinking water, are discussed. The extent of the contribution of mutagenicity of chlorination disinfection by-products to the mutagenicity of drinking water is investigated. It must be admitted that biological evaluation of the safety of water quality is impossible currently by using only the known chemical substances contained in drinking water. The effects of chlorination and ozone treatment which are often applied to drinking water treatment are different each other. 58 refs., 1 fig., 4 tabs.

Characterization and removal of natural organic matter from slow sand filter effluent followed by alum coagulation

Science.gov (United States)

Hidayah, Euis Nurul; Chou, Yung-Chen; Yeh, Hsuan-Hsien

2018-03-01

Characterization and removal of natural organic matter, which is contained in the effluent of slow sand filters, was observed by alum coagulation under various dosages. In addition to non-purgedable dissolved organic carbon (NPDOC), trihalomethanes formation potential (THMFP) and haloacetic acid formation potential (HAAFP) measurement, high-performance size-exclusion chromatography (HPSEC) with ultraviolet/visible and dissolved organic carbon (DOC) detectors was used to characterize the various organic fractions contained in the water before and after coagulation. The results show that alum coagulation could effectively remove hydrophobic aromatic, which forms mainly humic substances. The reduction in THMFP was found to be higher than that of NPDOC and HAAFP under specific alum dosage, and the former was also found to be proportional to the corresponding reduction in the area of hydrophobic aromatic fraction, mostly humic subtances, as obtained from HPSEC chromatogram with peak-fitting.

Embolization of Isolated Hypogastric Artery Aneurysm: A Case Report and a Review of the Literature

International Nuclear Information System (INIS)

Medici, Lorenzo de; Bucci, Federico; Nesi, Fabrizio; Rabitti, Giorgio

2006-01-01

A 75-year-old man with arterial hypertension, coronary artery disease, and myocardial infarction was referred to our service because of an asymptomatic hypogastric artery aneurysm (HAA) detected by a routine compued tomography (CT) scan. As shown on the angio-CT the maximum transverse diameter (m.t.d.) of the HAA was 47 mm. There were no symptoms of distal embolization or compression on the pelvic structures. We performed the successful complete thrombosis of the aneurysm using vascular plugs via a controlateral femoral approach. The control angiogram was satisfactory and there were no intraoperative complications. A CT-angiography done 4 months after the procedure showed no signs of refilling of the aneurysm sac. This case illustrates some possible advantages of vascular plugs in the treatment of isolated HAA

2,2',4,4'-Tetrachlorobiphenyl upregulates cyclooxygenase-2 in HL-60 cells via p38 mitogen-activated protein kinase and NF-κB

International Nuclear Information System (INIS)

Bezdecny, Steven A.; Karmaus, Peer; Roth, Robert A.; Ganey, Patricia E.

2007-01-01

Polychlorinated biphenyls (PCBs) are ubiquitous, persistent environmental contaminants that affect a number of cellular systems, including neutrophils. Among the effects caused by the noncoplanar PCB 2,2',4,4'-tetrachlorobiphenyl (2244-TCB) in granulocytic HL-60 cells are increases in superoxide anion production, activation of phospholipase A 2 with subsequent release of arachidonic acid (AA) and upregulation of the inflammatory gene cyclooxygenase-2 (COX-2). The objective of this study was to determine the signal transduction pathways involved in the upregulation of COX-2 by 2244-TCB. Treatment of HL-60 cells with 2244-TCB led to increased expression of COX-2 mRNA. This increase was prevented by the transcriptional inhibitor actinomycin D in cells pretreated with 2244-TCB for 10 min. The increase in COX-2 mRNA was associated with release of 3 H-AA, phosphorylation of p38 and extracellular signal-regulated kinase (ERK) mitogen-activated protein (MAP) kinases, increased levels of nuclear NF-κB and increased superoxide anion production. Bromoenol lactone, an inhibitor of the calcium-independent phospholipase A 2 , reduced 3 H-AA release but had no effect on COX-2 mRNA, protein or activity. Pretreatment with SB-202190 or SB-203580, inhibitors of the p38 MAP kinase pathway, prevented the 2244-TCB-mediated induction of COX-2 and phosphorylation of p38 and ERK MAP kinases. These inhibitors did not alter 3 H-AA release. Treatment with PD 98059 or U 0126, inhibitors of the MAP/ERK (MEK) pathway, prevented the 2244-TCB-mediated activation of ERK but had no effect on COX-2 induction or p38 phosphorylation. 2244-TCB treatment did not affect c-Jun N-terminal kinase (JNK) phosphorylation. 2244-TCB exposure increased the amount of nuclear NF-κB. This increase was prevented by pretreatment with p38 MAP kinase inhibitors, but not by pretreatment with MEK inhibitors. Pretreatment with inhibitors of NF-κB prevented the 2244-TCB-mediated induction of COX-2 mRNA. 2244-TCB

Detection of genotoxic effects of drinking water disinfection by-products using Vicia faba bioassay.

Science.gov (United States)

Hu, Yu; Tan, Li; Zhang, Shao-Hui; Zuo, Yu-Ting; Han, Xue; Liu, Na; Lu, Wen-Qing; Liu, Ai-Lin

2017-01-01

Plant-based bioassays have gained wide use among the toxicological and/or ecotoxicological assessment procedures because of their simplicity, sensitivity, low cost, and reliability. The present study describes the use of Vicia faba (V. faba) micronucleus (MN) test and V. faba comet assay in the evaluation of the genotoxic potential of disinfection by-products (DBPs) commonly found in chlorine-disinfected drinking water. Five haloacetic acids and three halogenated acetonitriles were chosen as representatives of DBPs in this study because they are of potentially great public health risk. Results of the MN test indicated that monochloroacetic acid (MCA), monobromoacetic acid (MBA), dichloroacetic acid (DCA), dibromoacetic acid (DBA), trichloroacetic acid (TCA), and trichloroacetonitrile (TCAN) caused a statistically significant increase in MN frequency in V. faba root tip cells. However, no genotoxic response was observed for dichloroacetonitrile (DCAN) and dibromoacetonitrile (DBAN). Results of the comet assay showed that all tested DBPs induced a statistically significant increase in genomic DNA damage to V. faba root tip cells. On considering the capacity to detect genomic damage of a different nature, we suggest that a combination of V. faba MN test and V. faba comet assay is a useful tool for the detection of genotoxic effects of DBPs. It is worthy of assessing the feasibility of using V. faba comet assay combined with V. faba MN test to screen for the genotoxic activity of chlorinated drinking water in future work.

GRAPHICAL DETERMINATION OF DISSOCIATION CONSTANT ...

African Journals Online (AJOL)

DR. AMINU

conform to the general equation of straight – line graph; y = mx + c, where y = pH, m = slope, x = log. [HA]/[A] and C = intercept = pKa. Thus the pKa is obtained as the intercept of the graph of pH versus – log [HA]/[A] as shown in Figures 1,2 and 3 for glycine, alanine and valine respectively. The values obtained were 9.87 ...

Occupational Exposures and Subclinical Interstitial Lung Disease. The MESA (Multi-Ethnic Study of Atherosclerosis) Air and Lung Studies.

Science.gov (United States)

Sack, Coralynn S; Doney, Brent C; Podolanczuk, Anna J; Hooper, Laura G; Seixas, Noah S; Hoffman, Eric A; Kawut, Steven M; Vedal, Sverre; Raghu, Ganesh; Barr, R Graham; Lederer, David J; Kaufman, Joel D

2017-10-15

The impact of a broad range of occupational exposures on subclinical interstitial lung disease (ILD) has not been studied. To determine whether occupational exposures to vapors, gas, dust, and fumes (VGDF) are associated with high-attenuation areas (HAA) and interstitial lung abnormalities (ILA), which are quantitative and qualitative computed tomography (CT)-based measurements of subclinical ILD, respectively. We performed analyses of participants enrolled in MESA (Multi-Ethnic Study of Atherosclerosis), a population-based cohort aged 45-84 years at recruitment. HAA was measured at baseline and on serial cardiac CT scans in 5,702 participants. ILA was ascertained in a subset of 2,312 participants who underwent full-lung CT scanning at 10-year follow-up. Occupational exposures were assessed by self-reported VGDF exposure and by job-exposure matrix (JEM). Linear mixed models and logistic regression were used to determine whether occupational exposures were associated with log-transformed HAA and ILA. Models were adjusted for age, sex, race/ethnicity, education, employment status, tobacco use, and scanner technology. Each JEM score increment in VGDF exposure was associated with 2.64% greater HAA (95% confidence interval [CI], 1.23-4.19%). Self-reported vapors/gas exposure was associated with an increased odds of ILA among those currently employed (1.76-fold; 95% CI, 1.09-2.84) and those less than 65 years old (1.97-fold; 95% CI, 1.16-3.35). There was no consistent evidence that occupational exposures were associated with progression of HAA over the follow-up period. JEM-assigned and self-reported exposures to VGDF were associated with measurements of subclinical ILD in community-dwelling adults.

High performance liquid chromatography-charged aerosol detection applying an inverse gradient for quantification of rhamnolipid biosurfactants.

Science.gov (United States)

Behrens, Beate; Baune, Matthias; Jungkeit, Janek; Tiso, Till; Blank, Lars M; Hayen, Heiko

2016-07-15

A method using high performance liquid chromatography coupled to charged-aerosol detection (HPLC-CAD) was developed for the quantification of rhamnolipid biosurfactants. Qualitative sample composition was determined by liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). The relative quantification of different derivatives of rhamnolipids including di-rhamnolipids, mono-rhamnolipids, and their precursors 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs) differed for two compared LC-MS instruments and revealed instrument dependent responses. Our here reported HPLC-CAD method provides uniform response. An inverse gradient was applied for the absolute quantification of rhamnolipid congeners to account for the detector's dependency on the solvent composition. The CAD produces a uniform response not only for the analytes but also for structurally different (nonvolatile) compounds. It was demonstrated that n-dodecyl-β-d-maltoside or deoxycholic acid can be used as alternative standards. The method of HPLC-ultra violet (UV) detection after a derivatization of rhamnolipids and HAAs to their corresponding phenacyl esters confirmed the obtained results but required additional, laborious sample preparation steps. Sensitivity determined as limit of detection and limit of quantification for four mono-rhamnolipids was in the range of 0.3-1.0 and 1.2-2.0μg/mL, respectively, for HPLC-CAD and 0.4 and 1.5μg/mL, respectively, for HPLC-UV. Linearity for HPLC-CAD was at least 0.996 (R(2)) in the calibrated range of about 1-200μg/mL. Hence, the here presented HPLC-CAD method allows absolute quantification of rhamnolipids and derivatives. Copyright © 2016 Elsevier B.V. All rights reserved.

Technical expertise on the safety of the proposed geological repository sites. Planning for geological deep repositories, step 1; Sicherheitstechnisches Gutachten zum Vorschlag geologischer Standortgebiete. Sachplan geologische Tiefenlager, Etappe 1

Energy Technology Data Exchange (ETDEWEB)

NONE

2010-01-15

On October 17, 2010, on request of those Swiss government institutions responsible for the disposal of radioactive wastes, the National Co-operative for the Disposal of Radioactive Waste (NAGRA) presented its project concerning geological sites for the foreseen disposal of radioactive wastes to the Federal Authorities. According to the present disposal concept, two types of repository are foreseen: one for highly radioactive wastes (HAA) and the other for low radioactive and intermediate-level radioactive wastes (SMA). If a site fulfils the necessary conditions for both HAA as well as for SMA, a combined site for both types of waste may be chosen. As a qualified control authority in Switzerland, the Federal Nuclear Safety Inspectorate (ENSI) has to examine the quality of the NAGRA proposals from the point of view of the nuclear safety of the sites. The project for deep underground waste disposal first defines the process and the criteria according to which sites for the geological storage of all types of radioactive wastes in Switzerland have to be chosen. The choice is based on the actual knowledge of Swiss geology. After dividing the wastes into SMA and HAA, some large-scale areas are to be identified according to their suitability from the geological and tectonic points of view. NAGRA's division of waste into SMA and HAA is based on calculations of the long-term safety for a broad range of different rock types and geological situations and takes the different properties of all waste types into account. As a conclusion, a small portion of SMA has to be stored with {alpha}-toxic wastes in the HAA repository. The estimation of the total volume of wastes to be stored is based on 60 years of operation of the actual nuclear power plants, augmented with the wastes from possible replacement plants with a total power of 5 GW{sub e} during a further 60 years. The safety concept of the repository is based on passive systems using technical and natural barriers. The

Developing the Navy’s NC Flying Boats: Transforming Aeronautical Engineering for the First Transatlantic Flight

Science.gov (United States)

2011-12-01

Silberg , David J. Haas w ^m^e^ä^ Approved for Public Release; distribution is unlimited. f REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188...PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Eric Silberg , David Haas 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 99-2-5300-010-12 17...THIS PAGE UNCLASSIFIED 17. LIMITATION OF ABSTRACT UL 18. NUMBER OF PAGES 2 7 19a. NAME OF RESPONSIBLE PERSON Eric Silberg 19b. TELEPHONE

Dietary exposure to heterocyclic amines in a Chinese population.

Science.gov (United States)

Wong, Kin-Yoke; Su, Jin; Knize, Mark G; Koh, Woon-Puay; Seow, Adeline

2005-01-01

Heterocyclic aromatic amines (HAAs) formed in meat during high-temperature cooking have been associated with risk of colorectal and breast cancer. Incidence of these cancers is increasing in Singapore, a country with 77% ethnic Chinese. The purpose of this study was to estimate HAA levels in the Chinese diet and individual levels of exposure to these compounds because little is known. Twenty-five samples (each pooled from three sources) of meat and fish, cooked as commonly consumed, were analyzed by high-performance liquid chromatography for concentrations (ng/g) of 2-amino-3-methylimidazo[4,5-f]quinoline, 2-amino-3, 4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-3, 4,8-trimethylimidazo[4,5-f]quinoxaline (4,8-DiMeIQx), 2- amino-3,7,8-trimethylimidazo[4,5-f]quinoxaline, 2-amino -1,6-dimethylfuro[3,2-e]imidazo[4,5-b]pyridine, and 2- amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). Dietary meat consumption data (g/day), including meat type and cooking method, were gathered from food-frequency questionnaires completed by 497 randomly sampled Chinese men and women aged 20-59 yr. PhIP, MeIQx, and 4,8-DiMeIQx were the most abundant HAAs detected. Total HAA concentrations ranged from roasted pork had the highest levels. The estimated mean daily exposure to HAA was 49.95 ng/day (P10 14.0 ng/day, P90 95.8 ng/day); this was 50% higher among younger (20-39 yr) compared with older individuals. Seven specific meat-cooking method combinations contributed 90.1% of this intake, namely, pan-fried fish, pork, and chicken, deep-fried chicken as well as fish, roasted/barbecued pork, and grilled minced beef.

Volatiles and Nonvolatiles in Flourensia campestris Griseb. (Asteraceae), How Much Do Capitate Glandular Trichomes Matter?

Science.gov (United States)

Piazza, Leonardo A; López, Daniela; Silva, Mariana P; López Rivilli, Marisa J; Tourn, Mónica G; Cantero, Juan J; Scopel, Ana L

2018-03-01

The distribution and ultrastructure of capitate glandular trichomes (GTs) in Flourensia species (Asteraceae) have been recently elucidated, but their metabolic activity and potential biological function remain unexplored. Selective nonvolatile metabolites from isolated GTs were strikingly similar to those found on leaf surfaces. The phytotoxic allelochemical sesquiterpene (-)-hamanasic acid A ((-)-HAA) was the major constituent (ca. 40%) in GTs. Although GTs are quaternary ammonium compounds (QACs)-accumulating species, glycine betaine was not found in GTs; it was only present in the leaf mesophyll. Two (-)-HAA accompanying surface secreted products: compounds 4-hydroxyacetophenone (piceol; 1) and 2-hydroxy-5-methoxyacetophenone (2), which were isolated and fully characterized (GC/MS, NMR), were present in the volatiles found in GTs. The essential oils of fresh leaves revealed ca. 33% monoterpenes, 26% hydrocarbon- and 30% oxygenated sesquiterpenes, most of them related to cadinene and bisabolene derivatives. Present results suggest a main role of GTs in determining the volatile and nonvolatile composition of F. campestris leaves. Based on the known activities of the compounds identified, it can be suggested that GTs in F. campestris would play key ecological functions in plant-pathogen and plant-plant interactions. In addition, the strikingly high contribution of compounds derived from cadinene and bisabolene pathways, highlights the potential of this species as a source of high-valued bioproducts. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

Science.gov (United States)

de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

2014-04-21

A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

Inhibitory effect of cellulose fibers on the formation of heterocyclic aromatic amines in grilled beef patties.

Science.gov (United States)

Gibis, Monika; Weiss, Jochen

2017-08-15

Microcrystalline cellulose (MCC) or carboxymethyl cellulose (CMC) can be used as fat replacers; both are nondigestible fibers. As water-holding compounds, the impact of added CMC or MCC was studied concerning the formation of heterocyclic amines (HAAs). Low-fat patties with 0.5-3% MCC/CMC were prepared using 90% of beef and 10% of an aqueous fiber dispersion and were determined for HAA-levels after grilling. The HAAs in patties containing CMC(MCC) were found in the following concentrations; MeIQx (2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline) 0.6-2.7 (0.9-3.3)ng/g, 4,8-DiMeIQx (2-Amino-3,4,8-trimethylimidazo[4,5-f]quinoxaline) n.d.-1.5 (n.d.-2.2)ng/g and PhIP (2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine) 0.03-0.3 (0.06-0.2)ng/g. The patties clearly contained lower HAA-levels with increasing addition of CMC or MCC. A continuous increase of the concentrations of comutagenic harman was observed (CMC: 1.2-13.2; MCC: 5.2-11.4ng/g) for increasing levels of fibers and a slight decrease of the content of norharman for MCC (0.5-1.6ng/g). No clear tendency was found for norharman using CMC (0.3-1.1ng/g). Copyright © 2017 Elsevier Ltd. All rights reserved.

Prospects for Closer Israeli-NATO Cooperation

Science.gov (United States)

2015-09-01

Actions and Arab Perceptions.” In The Middle East and the United States, 5th ed., edited by David W. Lesch and Mark L. Haas, 177–96. Boulder, CO...Ibid. 110 David W. Lesch, Mark L. Haas, eds., The Middle East and the United States, 5th ed. (Boulder, CO, Westview Press, 2014), 2 21 beginning...to Israel in 2005, NATO Secretary General Jaap de Hoop Scheffer stated, “the interplay of Middle Eastern and transatlantic security is becoming

A nanocomposite disk prepared from reduced graphene oxide and gold nanoparticles for the preconcentration of heterocyclic aromatic amines prior to their determination by HPLC

International Nuclear Information System (INIS)

Tan, Connieal; Wang, Yiru; Deng, Zhuo; Xu, Na; Song, Xinhong; Liu, Haihong; Rong, Mingcong; Chen, Xi

2014-01-01

We report on a preconcentration disk for the determination of trace amounts of heterocyclic aromatic amines (HAAs) in the groups of quinoline and quinoxaline congeners as possible human carcinogens. The disk is based on nanocomposite (NC) prepared from graphene oxide as the precursor and from gold nanoparticles that act as building blocks to form a three-dimensional NC. If deposited in the sampling valve of a HPLC system, the material displays excellent extraction capability for HAAs owing to its large surface and π-π stacking interaction. Following an optimization of the extraction parameters, the method was successfully applied to the simultaneous determination of polar HAAs in meat samples with detection limit of 0.09 to 0.16 ng g −1 and recoveries of 69.5 to 122.7 %. The disk was used in more than 150 subsequent preconcentration cycles without obvious loss of the absorption capability. The results reveal that this new NC represents an excellent sorbent for purposes of preconcentration. (author)

Effect of structural disorder on quantum oscillations in graphite

Energy Technology Data Exchange (ETDEWEB)

Camargo, B. C., E-mail: b.c-camargo@yahoo.com.br; Kopelevich, Y. [Instituto de Fisica Gleb Wataghin, Universidade Estadual de Campinas, Unicamp 13083-970, Campinas, São Paulo (Brazil); Usher, A.; Hubbard, S. B. [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom)

2016-01-18

We have studied the effect of structural disorder on the de Haas van Alphen and Shubnikov de Haas quantum oscillations measured in natural, Kish, and highly oriented pyrolytic graphite samples at temperatures down to 30 mK and at magnetic fields up to 14 T. The measurements were performed on different samples characterized by means of x-ray diffractometry, transmission electron microscopy, and atomic-force microscopy techniques. Our results reveal a correlation between the amplitude of quantum oscillations and the sample surface roughness.

Aerosol behaviour modeling and measurements

Energy Technology Data Exchange (ETDEWEB)

Gieseke, J A; Reed, L D [Batelle Memorial Institute, Columbus, OH (United States)

1977-01-01

Aerosol behavior within Liquid Metal Fast Breeder Reactor (LMFBR) containments is of critical importance since most of the radioactive species are expected to be associated with particulate forms and the mass of radiologically significant material leaked to the ambient atmosphere is directly related to the aerosol concentration airborne within the containment. Mathematical models describing the behavior of aerosols in closed environments, besides providing a direct means of assessing the importance of specific assumptions regarding accident sequences, will also serve as the basic tool with which to predict the consequences of various postulated accident situations. Consequently, considerable efforts have been recently directed toward the development of accurate and physically realistic theoretical aerosol behavior models. These models have accounted for various mechanisms affecting agglomeration rates of airborne particulate matter as well as particle removal rates from closed systems. In all cases, spatial variations within containments have been neglected and a well-mixed control volume has been assumed. Examples of existing computer codes formulated from the mathematical aerosol behavior models are the Brookhaven National Laboratory TRAP code, the PARDISEKO-II and PARDISEKO-III codes developed at Karlsruhe Nuclear Research Center, and the HAA-2, HAA-3, and HAA-3B codes developed by Atomics International. Because of their attractive short computation times, the HAA-3 and HAA-3B codes have been used extensively for safety analyses and are attractive candidates with which to demonstrate order of magnitude estimates of the effects of various physical assumptions. Therefore, the HAA-3B code was used as the nucleus upon which changes have been made to account for various physical mechanisms which are expected to be present in postulated accident situations and the latest of the resulting codes has been termed the HAARM-2 code. It is the primary purpose of the HAARM

Features of Hepatitis in Hepatitis-associated Aplastic Anemia: Clinical and Histopathologic Study.

Science.gov (United States)

Patel, Kalyani R; Bertuch, Alison; Sasa, Ghadir S; Himes, Ryan W; Wu, Hao

2017-01-01

Hepatitis-associated aplastic anemia (HAA) is a rare variant of aplastic anemia in which patients present with severe pancytopenia after an episode of acute hepatitis. The marrow failure is often rapid, severe, and usually fatal if untreated. The preceding hepatitis is largely under-studied. Retrospective study of the clinical and histopathologic features of hepatitis in pediatric patients who subsequently developed aplastic anemia and comparison with consecutive cases of acute liver failure and random cases of autoimmune hepatitis during the same time frame. All 7 patients of HAA had significant elevations in aminotransferases and conjugated hyperbilirubinemia at initial presentation. Echoing liver function indices, cholestatic hepatitis with sinusoidal obstruction-type endothelial injury was seen histomorphologically. Autoimmune hepatitis serology such as anti-F-actin, anti-liver/kidney microsome, and hypergammaglobulinemia was negative in all patients. Five of 7 patients (71.4%) had, however, elevated antinuclear antibody, all with a speckled pattern. Hepatitis virus serology was negative in all patients. By immunohistochemical staining, the lobular CD8/CD4 lymphocyte ratio was markedly elevated in all of the initial samples with significant reduction in this ratio (P = 0.03) in 3 patients post treatment (ursodiol, antibiotics, and/or immunosuppressive therapy). Hepatitis preceding HAA is characterized by marked elevation of aminotransferases, conjugated hyperbilirubinemia, elevated antinuclear antibody with a speckled pattern, cholestatic hepatitis with sinusoidal obstruction morphology, and CD8 dominant lobular infiltrates. The present study suggests HAA may result from cytotoxic T-cell-mediated sinusoidal endothelial and hepatocytic injury.

78 FR 20029 - Castor Oil, Polymer With Adipic Acid, Linoleic Acid, Oleic Acid and Ricinoleic Acid; Tolerance...

Science.gov (United States)

2013-04-03

..., Polymer With Adipic Acid, Linoleic Acid, Oleic Acid and Ricinoleic Acid; Tolerance Exemption AGENCY... from the requirement of a tolerance for residues of castor oil, polymer with adipic acid, linoleic acid... pesticide formulation. Advance Polymer Technology submitted a petition to EPA under the Federal Food, Drug...

The isolation of beryllium and mercury from lithium chloride solution by means of gas extraction

International Nuclear Information System (INIS)

Sevast'yanov, A.I.; Chepovoj, V.I.

1988-01-01

The possibility and optimal conditions of beryllium and mercury extraction using acetylacetone (HAA) from lithium chloride solution by argon blowing through the solution are determined. Dependences of extraction degrees and distribution coefficients on different parameters of liquid phase: initial pH value, lithium chloride concentration and initial content of HAA, are presented. The degree of beryllium extraction reaches the maximum at liquid phase pH of 4.4-5.25 and concentration of lithium chloride of 8.5 mol/l. Distribution coefficient changes in inverse proportion to the extraction degree

[Studies on interaction of acid-treated nanotube titanic acid and amino acids].

Science.gov (United States)

Zhang, Huqin; Chen, Xuemei; Jin, Zhensheng; Liao, Guangxi; Wu, Xiaoming; Du, Jianqiang; Cao, Xiang

2010-06-01

Nanotube titanic acid (NTA) has distinct optical and electrical character, and has photocatalysis character. In accordance with these qualities, NTA was treated with acid so as to enhance its surface activity. Surface structures and surface groups of acid-treated NTA were characterized and analyzed by Transmission Electron Microscope (TEM) and Fourier Transform Infrared Spectrometry (FT-IR). The interaction between acid-treated NTA and amino acids was investigated. Analysis results showed that the lengths of acid-treated NTA became obviously shorter. The diameters of nanotube bundles did not change obviously with acid-treating. Meanwhile, the surface of acid-treated NTA was cross-linked with carboxyl or esterfunction. In addition, acid-treated NTA can catch amino acid residues easily, and then form close combination.

Ibotenic acid and thioibotenic acid

DEFF Research Database (Denmark)

Hermit, Mette B; Greenwood, Jeremy R; Nielsen, Birgitte

2004-01-01

In this study, we have determined and compared the pharmacological profiles of ibotenic acid and its isothiazole analogue thioibotenic acid at native rat ionotropic glutamate (iGlu) receptors and at recombinant rat metabotropic glutamate (mGlu) receptors expressed in mammalian cell lines....... Thioibotenic acid has a distinct pharmacological profile at group III mGlu receptors compared with the closely structurally related ibotenic acid; the former is a potent (low microm) agonist, whereas the latter is inactive. By comparing the conformational energy profiles of ibotenic and thioibotenic acid...... with the conformations preferred by the ligands upon docking to mGlu1 and models of the other mGlu subtypes, we propose that unlike other subtypes, group III mGlu receptor binding sites require a ligand conformation at an energy level which is prohibitively expensive for ibotenic acid, but not for thioibotenic acid...

Polybrominated diphenyl ether (PBDE) effects in rat neuronal cultures: 14C-PBDE accumulation, biological effect, and structure-activity relationships

Energy Technology Data Exchange (ETDEWEB)

Kodavanti, P.R.; Ward, T. [Neurotoxicology Div., NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States); Burka, T. [National Insts. of Environmental Health Sciences, Research Triangle Park, NC (United States); Ludewig, G.; Robertson, L. [The Univ. of Iowa Coll. of Public Health, Iowa City, IA (United States); Birnbaum, L. [Experimental Toxicology Div., NHEERL/ORD, U.S. Environmental Protection Agency, Research Triangle Park, NC (United States)

2004-09-15

Polybrominated diphenyl ethers (PBDEs) are used as flame-retardants in many types of consumer products such as electrical equipment, plastics, and building materials. PBDEs are structurally similar to dichlorodiphenyltrichloroethane (DDT) and polychlorinated biphenyls (PCBs). PBDEs are now ubiquitous; they can be found in air, water, fish, birds, marine mammals, and humans, and in many cases, they are increasing over time. In spite of their widespread occurrence in the environment, only limited information is available on the toxicology of PBDEs. Recent studies showed that PBDE exposure caused aberrations in spontaneous behavior and reduced learning and memory in mice these effects are similar to those seen after exposure to DDT or PCBs. However, the mode of action for this group of chemicals remains unclear. Previously, we demonstrated that PCBs, which are known to cause neurotoxic effects, affected intracellular signaling pathways including [{sup 3}H]arachidonic acid ([{sup 3}H]AA) release, calcium homeostasis, and translocation of protein kinase C (PKC). Regarding PBDEs, we have reported that PBDEs altered [{sup 3}H]AA release in neuronal cultures like PCBs. These signaling pathways have been associated with learning and memory, and the development of the nervous system. The objectives of the present study were to test: (a) whether biologically relevant PBDE congeners affected PKC translocation in neuronal cultures in a similar way to those of other organohalogens; (b) compare the potency and efficacy of PBDE congeners with their 14C-accumulation; and (c) understand the structure-activity relationships among PBDE congeners.

Capturing Labile Sulfenamide and Sulfinamide Serum Albumin Adducts of Carcinogenic Arylamines by Chemical Oxidation

Science.gov (United States)

Peng, Lijuan; Turesky, Robert J.

2013-01-01

Aromatic amines and heterocyclic aromatic amines (HAAs) are a class of structurally related carcinogens that are formed during the combustion of tobacco or during the high temperature cooking of meats. These procarcinogens undergo metabolic activation by N-oxidation of the exocyclic amine group to produce N-hydroxylated metabolites, which are critical intermediates implicated in toxicity and DNA damage. The arylhydroxylamines and their oxidized arylnitroso derivatives can also react with cysteine (Cys) residues of glutathione or proteins to form, respectively, sulfenamide and sulfinamide adducts. However, sulfur-nitrogen linked adducted proteins are often difficult to detect because they are unstable and undergo hydrolysis during proteolytic digestion. Synthetic N-oxidized intermediates of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), a carcinogenic HAA produced in cooked meats, and 4-aminobiphenyl, a carcinogenic aromatic amine present in tobacco smoke were reacted with human serum albumin (SA) and formed labile sulfenamide or sulfinamide adducts at the Cys34 residue. Oxidation of the carcinogen-modified SA with m-chloroperoxybenzoic acid (m-CPBA) produced the arylsulfonamide adducts, which were stable to heat and the chemical reduction conditions employed to denature SA. The sulfonamide adducts of PhIP and 4-ABP were identified, by liquid chromatography/mass spectrometry, in proteolytic digests of denatured SA. Thus, selective oxidation of arylamine-modified SA produces stable arylsulfonamide-SA adducts, which may serve as biomarkers of these tobacco and dietary carcinogens. PMID:23240913

An efficient method for the synthesis of phenacyl ester-protected dipeptides using neutral alumina-supported sodium carbonate 'Na2 CO3 /n-Al2 O3 '.

Science.gov (United States)

Hashimoto, Chikao; Sugimoto, Kazuhiro; Takahashi, Youhei; Kodomari, Mitsuo

2013-10-01

In the synthesis of dipeptides (Boc-AA(1)-AA(2)-OPac: AA(1) and AA(2) represent amino acids) protected by phenacyl (Pac) ester, amines and solid bases as the base for the conversion of the trifluoroacetic acid (TFA) salt of the amino component (TFA·H-AA(2)-OPac) into the corresponding free amino component (H-AA(2)-OPac) were examined. The synthesis of a dipeptide (Boc-Ala-Gly-OPac) using amines for the conversion afforded an unsatisfactory yield with by-products. On the other hand, the use of neutral alumina-supported Na(2) CO(3) (Na(2)CO(3) /n-Al(2)O(3)) as a solid base for the conversion provided the dipeptide in a quantitative yield without by-products. The application of Na(2)CO(3) /n-Al2 O3 to the synthesis of some dipeptides protected by Pac ester gave the desired peptides in excellent yields. Copyright © 2013 European Peptide Society and John Wiley & Sons, Ltd.

[Acids in coffee. XI. The proportion of individual acids in the total titratable acid].

Science.gov (United States)

Engelhardt, U H; Maier, H G

1985-07-01

22 acids in ground roast coffees and instant coffees were determined by GLC of their silyl derivatives (after preseparation by gel electrophoresis) or isotachophoresis. The contribution to the total acidity (which was estimated by titration to pH 8 after cation exchange of the coffee solutions) was calculated for each individual acid. The mentioned acids contribute with 67% (roast coffee) and 72% (instant coffee) to the total acidity. In the first place citric acid (12.2% in roast coffee/10.7% in instant coffee), acetic acid (11.2%/8.8%) and the high molecular weight acids (8%/9%) contribute to the total acidity. Also to be mentioned are the shares of chlorogenic acids (9%/4.8%), formic acid (5.3%/4.6%), quinic acid (4.7%/5.9%), malic acid (3.9%/3%) and phosphoric acid (2.5%/5.2%). A notable difference in the contribution to total acidity between roast and instant coffee was found for phosphoric acid and pyrrolidonecarboxylic acid (0.7%/1.9%). It can be concluded that those two acids are formed or released from e.g. their esters in higher amounts than other acids during the production of instant coffee.

Flexible Airspace Management (FAM) Research 2010 Human-in-the-Loop Simulation

Science.gov (United States)

Lee, Paul U.; Brasil, Connie; Homola, Jeffrey; Kessell, Angela; Prevot, Thomas; Smith, Nancy

2011-01-01

A human-in-the-Ioop (HITL) simulation was conducted to assess potential user and system benefits of Flexible Airspace Management (FAM) concept, as well as designing role definitions, procedures, and tools to support the FAM operations in the mid-term High Altitude Airspace (HAA) environment. The study evaluated the benefits and feasibility of flexible airspace reconfiguration in response to traffic overload caused by weather deviations, and compared them to those in a baseline condition without the airspace reconfiguration. The test airspace consisted of either four sectors in one Area of Specialization or seven sectors across two Areas. The test airspace was assumed to be at or above FL340 and fully equipped Vvith data communications (Data Comm). Other assumptions were consistent with those of the HAA concept. Overall, results showed that FAM operations with multiple Traffic Management Coordinators, Area Supervisors, and controllers worked remarkably well. The results showed both user and system benefits, some of which include the increased throughput, decreased flight distance, more manageable sector loads, and better utilized airspace. Also, the roles, procedures, airspace designs, and tools were all very well received. Airspace configuration options that resulted from a combination of algorithm-generated airspace configurations with manual modifications were well acceptec and posed little difficuIty and/or workload during airspace reconfiguration process. The results suggest a positive impact of FAM operations in HAA. Further investigation would be needed to evaluate if the benefits and feasibility would extend in either non-HAA or mixed equipage environment.

Seltskond : [fotod] / tekst ja fotod Annika Haas

Index Scriptorium Estoniae

2008-01-01

8. dets. esitles Helle Michelson Eesti Lastekirjanduse Keskuses mälestusteraamatut "Lehitsetud leheküljed: Meenutusi elust ja lastekirjandusest" (Tallinn : Tänapäev, 2008) Kohal viibisid lastekirjanikud Ellen Niit, Jaak Urmet jt.

USA kiidetud noise-rock Eestis / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2008-01-01

Müra-rock'i viljelevast USA duost Magik Markers (ansambel osaleb režissöör Veiko Õunapuu uue mängufilmi "Püha Tõnu kiusamine" võtetel ja annab kaks kontserti - 13. nov. Tallinnas klubis Tapper ja 15. nov. Tartus klubis Trehv)

Seltskond : [fotod] / tekst ja fotod Annika Haas

Index Scriptorium Estoniae

2008-01-01

29. mail tutvustasid autorid oma lasteraamatuid Eesti Lastekirjanduse Keskuses: Kass, Kristiina. Petra lood. [Tallinn] : Tänapäev, 2008 ; Vainola, Kätlin. Mia, Konrad ja avanevad uksed : [jutustus] / pildid joonistanud Toomas Pääsuke. [Tallinn] : Tänapäev, 2008 ; Saarna, Meelike. Mattias ja mamma. [Tallinn] : Tänapäev, 2008

Magneto-transporte em sistemas semicondutores com gas de eletrons bidimensional

OpenAIRE

Alvaro Guedes Soares

1994-01-01

Resumo: O objetivo básico deste trabalho foi a implantação de técnicas de magneto-transporte em heteroestruturas semicondutoras que apresentam gás de elétron bidimensional (2-DEG), particularmente, o Efeito Shubnikov-de Haas (SdH) e Efeito Hall Quântico (QHE). Neste sentido foi realizada a recuperação de uma bobina supercondutora (criostato e sistema de controle) que permite medidas em campo magnético de até 14 Tesla. Medidas de oscilações Shubnikov-de Haas e Efeito Hall Quântico foram fei...

The acidic functional groups of humic acid

Energy Technology Data Exchange (ETDEWEB)

Shanxiang, Li; Shuhe, Sun; Zhai Zongxi, Wu Qihu

1983-09-01

The acidic functional groups content, pK value, DELTAH and DELTAS of humic acid (HA) and nitro-humic acid (NHA) were determined by potentiometry, conductometry and calorimetric titration. The thermodynamic parameters of carboxylic groups and phenolic hydroxyl groups of humic acid are similar to that of simple hydroxy-benzoic acid. The configuration sites of acidic functional groups in humic acid from different coals are different. The carbonyl groups on aromatic rings are probably ortho to phenolic -OH for HA and NHA extracted from Huangxian's brown coal and Japanese lignite, while those from Lingshi's weathered coal are not. The weak -COOH groups of the latter possess higher chemical activity. The -COOH content in HA increases, phenolic -OH group decreases and the chemical acidity of acidic functional groups increases when HA is oxidized by nitric acid. (14 refs.)

Disinfection Pilot Trial for Little Miami WWTP | Science ...

Science.gov (United States)

There is a serious interest growing nationally towards the use of PAA at various stages of public waste water treatment facilities; one of such use is secondary waste water treatment. MSDGC is currently interested in improving efficiency and economic aspects of waste water treatment. MSDGC requested for ORD’s support to evaluate alternative cost-effective disinfectants. This report herein is based on the data generated from the field pilot test conducted at the Little Miami Wastewater Treatment Plant. Chlorine assisted disinfection of wastewaters created the concern regarding the formation of high levels of toxic halogenated disinfection byproducts (DBPs) detrimental to aquatic life and public health. Peracetic acid is emerging as a green alternative to chlorine and claimed to have economic and social benefits. In addition, it is a relatively simple retrofit to the existing chlorine treated wastewater treatment facilities. PAA is appealed to possess a much lower aquatic toxicity profile than chlorine and decays rapidly in the environment, even if overdosed. As a result, PAA generally does not need a quenching step, such as dechlorination, reducing process complexity, sodium pollution and cost. PAA treatment does not result in the formation of chlorinated disinfection by-products such as trihalomethanes (THMs), haloacetic acids and other byproducts such as cyanide and n-Nitrosodimethylamine (NDMA).

Occurrence of regulated and emerging iodinated DBPs in the Shanghai drinking water.

Directory of Open Access Journals (Sweden)

Xiao Wei

Full Text Available Drinking water chlorination plays a pivotal role in preventing pathogen contamination against water-borne disease. However, chemical disinfection leads to the formation of halogenated disinfection by products (DBPs. Many DBPs are highly toxic and are of health concern. In this study, we conducted a comprehensive measurements of DBPs, including iodoacetic acid (IAA, iodoform (IF, nine haloacetic acids and four trihalomethanes in drinking waters from 13 water plants in Shanghai, China. The results suggested that IAA and IF were found in all the water treatment plants, with maximum levels of 1.66 µg/L and 1.25 µg/L for IAA and IF, respectively. Owing to deterioration of water quality, the Huangpu River has higher IAA and IF than the Yangtze River. Our results also demonstrated that low pH, high natural organic matter, ammonia nitrogen, and iodide in source waters increased IAA and IF formation. Compared to chlorine, chloramines resulted in higher concentration of iodinated DBP, but reduced the levels of trihalomethanes. This is the first study to reveal the widespread occurrence of IAA and IF in drinking water in China. The data provide a better understanding on the formation of iodinated disinfection byproducts and the findings should be useful for treatment process improvement and disinfection byproducts controls.

Selective One-Pot Production of High-Grade Diesel-Range Alkanes from Furfural and 2-Methylfuran over Pd/NbOPO4.

Science.gov (United States)

Xia, Qineng; Xia, Yinjiang; Xi, Jinxu; Liu, Xiaohui; Zhang, Yongguang; Guo, Yong; Wang, Yanqin

2017-02-22

A one-pot method for the selective production of high-grade diesel-range alkanes from biomass-derived furfural and 2-methylfuran (2-MF) was developed by combining the hydroxyalkylation/alkylation (HAA) condensation of furfural with 2-MF and the subsequent hydrodeoxygenation (HDO) over a multifunctional Pd/NbOPO 4 catalyst. The effects of various reaction conditions as well as a variety of solid-acid catalysts and metal-loaded NbOPO 4 catalysts were systematically investigated to optimize the reaction conditions for both reactions. Under the optimal reaction conditions up to 89.1 % total yield of diesel-range alkanes was obtained from furfural and 2-MF by this one-pot method. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Acid-Base Titration of a Very Weak Acid: Boric Acid

Science.gov (United States)

Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

2012-01-01

A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

Usnic acid controls the acidity tolerance of lichens

International Nuclear Information System (INIS)

Hauck, Markus; Juergens, Sascha-Rene

2008-01-01

The hypotheses were tested that, firstly, lichens producing the dibenzofuran usnic acid colonize substrates characterized by specific pH ranges, secondly, this preferred pH is in a range where soluble usnic acid and its corresponding anion occur in similar concentrations, and thirdly, usnic acid makes lichens vulnerable to acidity. Lichens with usnic acid prefer an ambient pH range between 3.5 and 5.5 with an optimum between 4.0 and 4.5. This optimum is close to the pK a1 value of usnic acid of 4.4. Below this optimum pH, dissolved SO 2 reduces the chlorophyll fluorescence yield more in lichens with than without their natural content of usnic acid. This suggests that usnic acid influences the acidity tolerance of lichens. The putative mechanism of the limited acidity tolerance of usnic acid-containing lichens is the acidification of the cytosol by molecules of protonated usnic acid shuttling protons through the plasma membrane at an apoplastic pH a1 . - Combined field and experimental data suggest that usnic acid makes lichens sensitive to acidity at pH <3.5

[Teichoic acids from lactic acid bacteria].

Science.gov (United States)

Livins'ka, O P; Harmasheva, I L; Kovalenko, N K

2012-01-01

The current view of the structural diversity of teichoic acids and their involvement in the biological activity of lactobacilli has been reviewed. The mechanisms of effects of probiotic lactic acid bacteria, in particular adhesive and immunostimulating functions have been described. The prospects of the use of structure data of teichoic acid in the assessment of intraspecific diversity of lactic acid bacteria have been also reflected.

Preparation of fulvic acid and low-molecular organic acids by oxidation of weathered coal humic acid

Energy Technology Data Exchange (ETDEWEB)

Shinozuka, T.; Ito, A.; Sasaki, O.; Yazawa, Y.; Yamaguchi, T. [Chiba Institute of Technolgy, Chiba (Japan). Dept. of Industrial Chemistry

2002-07-01

Weathered coal contains much humic acid and a little fulvic acid. Therefore, the production of fulvic acid, the most valuable humic substance because of its water-solubility, was examined by ozone and hydrogen peroxide oxidation of humic acid extracted form Xinjiang (China) weathered coal. The resulting products of the oxidation were water soluble fulvic acid and organic acids, mainly formic acid and oxalic acid. The product yield of fulvic acid was 20 (C%) and that of organic acids were 39 (C%) for formic and acid 13 (C%) for oxalic acid. The formed fulvic acid showed a higher content of oxygen and carboxyl groups, than those of the extracted one from the original weathered coal.

Acid Rain

Science.gov (United States)

Bricker, Owen P.; Rice, Karen C.

1995-01-01

Although acid rain is fading as a political issue in the United States and funds for research in this area have largely disappeared, the acidity of rain in the Eastern United States has not changed significantly over the last decade, and it continues to be a serious environmental problem. Acid deposition (commonly called acid rain) is a term applied to all forms of atmospheric deposition of acidic substances - rain, snow, fog, acidic dry particulates, aerosols, and acid-forming gases. Water in the atmosphere reacts with certain atmospheric gases to become acidic. For example, water reacts with carbon dioxide in the atmosphere to produce a solution with a pH of about 5.6. Gases that produce acids in the presence of water in the atmosphere include carbon dioxide (which converts to carbonic acid), oxides of sulfur and nitrogen (which convert to sulfuric and nitric acids}, and hydrogen chloride (which converts to hydrochloric acid). These acid-producing gases are released to the atmosphere through natural processes, such as volcanic emissions, lightning, forest fires, and decay of organic matter. Accordingly, precipitation is slightly acidic, with a pH of 5.0 to 5.7 even in undeveloped areas. In industrialized areas, most of the acid-producing gases are released to the atmosphere from burning fossil fuels. Major emitters of acid-producing gases include power plants, industrial operations, and motor vehicles. Acid-producing gases can be transported through the atmosphere for hundreds of miles before being converted to acids and deposited as acid rain. Because acids tend to build up in the atmosphere between storms, the most acidic rain falls at the beginning of a storm, and as the rain continues, the acids "wash out" of the atmosphere.

Antioxidant activity of rice plants sprayed with herbicides

Directory of Open Access Journals (Sweden)

Marcos André Nohatto

2016-03-01

Full Text Available Understanding the physiological defense behavior of plants subjected to herbicide application may help to identify products with higher or lower capacity to cause oxidative stress in crops. This study aimed at evaluating the effect of herbicides in the antioxidant activity of rice plants. The experimental design was completely randomized, with six replications. Treatments consisted of the herbicides bentazon (photosystem II inhibitor; 960 g ha-1, penoxsulam (acetolactate synthase inhibitor; 60 g ha-1, cyhalofop-butyl (acetyl coenzyme-A carboxylase inhibitor; 315 g ha-1 and a control. After the herbicides application, samples of rice shoots were collected at 12, 24, 48 and 96 hours after application (HAA. The components evaluated were hydrogen peroxide (H2O2, lipid peroxidation and activity of the antioxidant enzymes superoxide dismutase (SOD and catalase (CAT. Bentazon (up to 24 HAA and penoxsulam (48 and 96 HAA reduced the CAT activity. Moreover, these herbicides increased the levels of H2O2, lipid peroxidation and SOD activity, indicating a condition of oxidative stress in rice plants. The cyhalofop-butyl herbicide did not alter the antioxidant activity, showing that it causes less stress to the crop.

RNA aptamers targeted for human αA-crystallin do not bind αB-crystallin, and spare the α-crystallin domain.

Science.gov (United States)

Mallik, Prabhat K; Shi, Hua; Pande, Jayanti

2017-09-16

The molecular chaperones, α-crystallins, belong to the small heat shock protein (sHSP) family and prevent the aggregation and insolubilization of client proteins. Studies in vivo have shown that the chaperone activity of the α-crystallins is raised or lowered in various disease states. Therefore, the development of tools to control chaperone activity may provide avenues for therapeutic intervention, as well as enable a molecular understanding of chaperone function. The major human lens α-crystallins, αA- (HAA) and αB- (HAB), share 57% sequence identity and show similar activity towards some clients, but differing activities towards others. Notably, both crystallins contain the "α-crystallin domain" (ACD, the primary client binding site), like all other members of the sHSP family. Here we show that RNA aptamers selected for HAA, in vitro, exhibit specific affinity to HAA but do not bind HAB. Significantly, these aptamers also exclude the ACD. This study thus demonstrates that RNA aptamers against sHSPs can be designed that show high affinity and specificity - yet exclude the primary client binding region - thereby facilitating the development of RNA aptamer-based therapeutic intervention strategies. Copyright © 2017 Elsevier Inc. All rights reserved.

Spontaneous correction of anterior crossbite by RPE anchored on deciduous teeth in the early mixed dentition.

Science.gov (United States)

Rosa, M; Lucchi, P; Mariani, L; Caprioglio, A

2012-09-01

The purpose of this study was to evaluate the effectiveness of Haas RPE anchored on deciduous teeth in the early mixed dentition, for inducing the spontaneous correction of permanent incisor's crossbite, without compliance, without post bite-plane and no involvement of the permanent teeth. The sample group comprised 50 consecutive patients (mean age 8y 5m, SD 2y 1m), 31 males, 19 females. They showed a cross-bite affecting one or more permanent incisors, for a total of 70 teeth. The patients were treated with Haas RPE appliance anchored on second deciduous molars and bonded on deciduous canines. No direct forces were applied on the permanent teeth. Anterior crossbite self-corrected 'spontaneously' in 84% of the cases. Lateral incisors had a higher rate of self-correction than central incisors. All hyper-divergent subjects showed a spontaneous crossbite self-correction. The early maxillary expansion by Haas RPE anchored on deciduous teeth is an efficient and effective procedure to induce the anterior crossbite self-correction in the early mixed dentition without the need of a bite-plane, no involvement of the permanent teeth and without compliance.

Enzymatic formation of hexadecenoic acid from palmitic acid

International Nuclear Information System (INIS)

Nakano, Masao; Fujino, Yasuhiko

1975-01-01

Desaturation of palmitic acid was investigated in an enzyme system prepared from rat liver. 2-trans-Hexadecenoic acid as well as 9-cis-gexadecenoic acid (palmitoleic acid) were found to be formed as monoenoic acid in this system. (author)

Sequential injection redox or acid-base titration for determination of ascorbic acid or acetic acid.

Science.gov (United States)

Lenghor, Narong; Jakmunee, Jaroon; Vilen, Michael; Sara, Rolf; Christian, Gary D; Grudpan, Kate

2002-12-06

Two sequential injection titration systems with spectrophotometric detection have been developed. The first system for determination of ascorbic acid was based on redox reaction between ascorbic acid and permanganate in an acidic medium and lead to a decrease in color intensity of permanganate, monitored at 525 nm. A linear dependence of peak area obtained with ascorbic acid concentration up to 1200 mg l(-1) was achieved. The relative standard deviation for 11 replicate determinations of 400 mg l(-1) ascorbic acid was 2.9%. The second system, for acetic acid determination, was based on acid-base titration of acetic acid with sodium hydroxide using phenolphthalein as an indicator. The decrease in color intensity of the indicator was proportional to the acid content. A linear calibration graph in the range of 2-8% w v(-1) of acetic acid with a relative standard deviation of 4.8% (5.0% w v(-1) acetic acid, n=11) was obtained. Sample throughputs of 60 h(-1) were achieved for both systems. The systems were successfully applied for the assays of ascorbic acid in vitamin C tablets and acetic acid content in vinegars, respectively.

Glycosyltransferase glycosylating flavokermesic acid and/or kermesic acid

DEFF Research Database (Denmark)

2016-01-01

An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I) : conjugating glucose to flavokermesic acid (FK); and/or (II) : conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....

GLYCOSYLTRANSFERASE GLYCOSYLATING FLAVOKERMESIC ACID AND/OR KERMESIC ACID

DEFF Research Database (Denmark)

2015-01-01

An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid.......An isolated glycosyltransferase (GT) polypeptide capable of: (I): conjugating glucose to flavokermesic acid (FK); and/or (II): conjugating glucose to kermesic acid (KA) and use of this GT to e.g. make Carminic acid....

Specific bile acid radioimmunoassays for separate determinations of unconjugated cholic acid, conjugated cholic acid and conjugated deoxycholic acid in serum and their clinical application

International Nuclear Information System (INIS)

Matern, S.; Gerok, W.

1977-01-01

Specific radioimmunoassays for separate determinations of serum unconjugated cholic, conjugated cholic and conjugated deoxycholic acids have been developed. Prior to the radioimmunoassay, extraction of serum bile acids was performed with Amberlite XAD-2. Unconjugated cholic acid was separated from glyco- and taurocholic acids by thin-layer chromatography. At 50% displacement of bound labeled glyco[ 3 H]cholic acid using antiserum obtained after immunization with cholic acid-bovine serum albumin-conjugate the cross-reactivity of taurocholic acid was 100%, cholic acid 80%, glycochenodeoxycholic acid 10%, chenodeoxycholic acid 7%, conjugated deoxycholic acid 3%, and conjugated lithocholic acid 3 H]cholic acid was linear on a logit-log plot from 5 to 80 pmol of unlabeled glycocholic acid. Fasting serum conjugated cholic acid in healthy subjects was 0.68 +- 0.34 μmol/l. Unconjugated cholic acid was determined by a solid phase radioimmunoassay using the cholic acid antibody chemically bound to Sepharose. The displacement curve of [ 3 H]cholic acid in the solid phase radioimmunoassay was linear on a logit-log plot from 5 to 200 pmol of unlabeled cholic acid. The coefficient of variation between samples was 5%. Fasting serum conjugated deoxycholic acid concentrations in 10 healthy subjects ranged from 0.18 to 0.92 μmol/l determined by a radioimmunoassay using antiserum obtained after immunization with deoxycholic acid-bovine serum albumin-conjugate. The clinical application of these bile acid radioimmunoassays is shown by an 'oral cholate tolerance test' as a sensitive indicator of liver function and by an 'oral cholyglycine tolerance test' as a useful test for bile acid absorption. (orig.) [de

Amino acids in the sedimentary humic and fulvic acids

Digital Repository Service at National Institute of Oceanography (India)

Sardessai, S.

acids in the coastal Arabian Sea sediments: whereas amino acids content of fulvic acids was lower than that of humic acids in the coastal sediments of Bay of Bengal. Slope sedimentary humic acids were relatively enriched in amino acids as compared...

Effect of propionic acid on citric acid fermentation in an integrated citric acid-methane fermentation process.

Science.gov (United States)

Xu, Jian; Bao, Jia-Wei; Su, Xian-Feng; Zhang, Hong-Jian; Zeng, Xin; Tang, Lei; Wang, Ke; Zhang, Jian-Hua; Chen, Xu-Sheng; Mao, Zhong-Gui

2016-03-01

In this study, an integrated citric acid-methane fermentation process was established to solve the problem of wastewater treatment in citric acid production. Citric acid wastewater was treated through anaerobic digestion and then the anaerobic digestion effluent (ADE) was further treated and recycled for the next batch citric acid fermentation. This process could eliminate wastewater discharge and reduce water resource consumption. Propionic acid was found in the ADE and its concentration continually increased in recycling. Effect of propionic acid on citric acid fermentation was investigated, and results indicated that influence of propionic acid on citric acid fermentation was contributed to the undissociated form. Citric acid fermentation was inhibited when the concentration of propionic acid was above 2, 4, and 6 mM in initial pH 4.0, 4.5 and, 5.0, respectively. However, low concentration of propionic acid could promote isomaltase activity which converted more isomaltose to available sugar, thereby increasing citric acid production. High concentration of propionic acid could influence the vitality of cell and prolong the lag phase, causing large amount of glucose still remaining in medium at the end of fermentation and decreasing citric acid production.

A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

Energy Technology Data Exchange (ETDEWEB)

Arceo, Elena; Ellman, Jonathan; Bergman, Robert

2010-05-03

An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

Removal of disinfection by-product precursors by coagulation and an innovative suspended ion exchange process.

Science.gov (United States)

Metcalfe, David; Rockey, Chris; Jefferson, Bruce; Judd, Simon; Jarvis, Peter

2015-12-15

This investigation aimed to compare the disinfection by-product formation potentials (DBPFPs) of three UK surface waters (1 upland reservoir and 2 lowland rivers) with differing characteristics treated by (a) a full scale conventional process and (b) pilot scale processes using a novel suspended ion exchange (SIX) process and inline coagulation (ILCA) followed by ceramic membrane filtration (CMF). Liquid chromatography-organic carbon detection analysis highlighted clear differences between the organic fractions removed by coagulation and suspended ion exchange. Pretreatments which combined SIX and coagulation resulted in significant reductions in dissolved organic carbon (DOC), UV absorbance (UVA), trihalomethane and haloacetic acid formation potential (THMFP, HAAFP), in comparison with the SIX or coagulation process alone. Further experiments showed that in addition to greater overall DOC removal, the processes also reduced the concentration of brominated DBPs and selectively removed organic compounds with high DBPFP. The SIX/ILCA/CMF process resulted in additional removals of DOC, UVA, THMFP, HAAFP and brominated DBPs of 50, 62, 62, 62% and 47% respectively compared with conventional treatment. Copyright © 2015. Published by Elsevier Ltd.

Determination of several common disinfection by-products in frozen foods.

Science.gov (United States)

Cardador, Maria Jose; Gallego, Mercedes

2018-01-01

Disinfected water and/or disinfectants are commonly used by the freezing industry in such processes as sanitising, washing, blanching, cooling and transporting the final product. For this reason, disinfection by-products (DBPs) can be expected in frozen foods. This study focused on the presence of DBPs in a wide variety of frozen vegetables, meats and fish. For this purpose, the 14 halogenated DBPs more prevalent in disinfected water were selected (four trihalomethanes, seven haloacetic acids, two haloacetonitriles and trichloronitromethane). Up to seven DBPs were found in vegetables, whereas only four DBPs were present in meats and fish, and at lower concentrations, since their contact with disinfected water is lower than in frozen vegetables. It is important to emphasise that trichloronitromethane (the most abundant nitrogenous DBP in disinfected water) was found for the first time in foods. Finally, it was concluded that the freezing process can keep the compounds stable longer than other preservation processes (viz. sanitising, canning) and, therefore, frozen foods present higher DBP concentrations than other food categories (minimally processed vegetables, or canned vegetables and meats).

Catalytic acetoxylation of lactic acid to 2-acetoxypropionic acid, en route to acrylic acid

NARCIS (Netherlands)

Beerthuis, R.; Granollers, M.; Brown, D.R.; Salavagione, H.J.; Rothenberg, G.; Shiju, N.R.

2015-01-01

We present an alternative synthetic route to acrylic acid, starting from the platform chemical lactic acid and using heterogeneous catalysis. To improve selectivity, we designed an indirect dehydration reaction that proceeds via acetoxylation of lactic acid to 2-acetoxypropionic acid. This

[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

Science.gov (United States)

Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

2016-03-01

Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

[Regulating acid stress resistance of lactic acid bacteria--a review].

Science.gov (United States)

Wu, Chongde; Huang, Jun; Zhou, Rongqing

2014-07-04

As cell factories, lactic acid bacteria are widely used in food, agriculture, pharmaceutical and other industries. Acid stress is one the important survival challenges encountered by lactic acid bacteria both in fermentation process and in the gastrointestinal tract. Recently, the development of systems biology and metabolic engineering brings unprecedented opportunity for further elucidating the acid tolerance mechanisms and improving the acid stress resistance of lactic acid bacteria. This review addresses physiological mechanisms of lactic acid bacteria during acid stress. Moreover, strategies to improve the acid stress resistance of lactic acid were proposed.

Preparation and characterization Al3+-bentonite Turen Malang for esterification fatty acid (palmitic acid, oleic acid and linoleic acid)

Science.gov (United States)

Abdulloh, Abdulloh; Aminah, Nanik Siti; Triyono, Mudasir, Trisunaryanti, Wega

2016-03-01

Catalyst preparation and characterization of Al3+-bentonite for esterification of palmitic acid, oleic acid and linoleic acid has been done. Al3+-bentonite catalyst was prepared from natural bentonite of Turen Malang through cation exchange reaction using AlCl3 solution. The catalysts obtained were characterized by XRD, XRF, pyridine-FTIR and surface area analyser using the BET method. Catalyst activity test of Al3+-bentonite for esterification reaction was done at 65°C using molar ratio of metanol-fatty acid of 30:1 and 0.25 g of Al3+-bentonite catalyst for the period of ½, 1, 2, 3, 4 and 5 hours. Based on the characterization results, the Al3+-bentonite Turen Malang catalyst has a d-spacing of 15.63 Ǻ, acid sites of Brönsted and Lewis respectively of 230.79 µmol/g and 99.39 µmol/g, surface area of 507.3 m2/g and the average of radius pore of 20.09 Å. GC-MS analysis results of the oil phase after esterification reaction showed the formation of biodiesel (FAME: Fatty acid methyl ester), namely methyl palmitate, methyl oleate and methyl linoleate. The number of conversions resulted in esterification reaction using Al3+-bentonite Turen Malang catalyst was 74.61%, 37.75%, and 20, 93% for the esterification of palmitic acid, oleic acid and linoleic acid respectively.

Efficacy of Lactic Acid, Lactic Acid-Acetic Acid Blends, and Peracetic Acid To Reduce Salmonella on Chicken Parts under Simulated Commercial Processing Conditions.

Science.gov (United States)

Ramirex-Hernandez, Alejandra; Brashears, Mindy M; Sanchez-Plata, Marcos X

2018-01-01

The poultry processing industry has been undergoing a series of changes as it modifies processing practices to comply with new performance standards for chicken parts and comminuted poultry products. The regulatory approach encourages the use of intervention strategies to prevent and control foodborne pathogens in poultry products and thus improve food safety and protect human health. The present studies were conducted to evaluate the efficacy of antimicrobial interventions for reducing Salmonella on inoculated chicken parts under simulated commercial processing conditions. Chicken pieces were inoculated by immersion in a five-strain Salmonella cocktail at 6 log CFU/mL and then treated with organic acids and oxidizing agents on a commercial rinsing conveyor belt. The efficacy of spraying with six different treatments (sterile water, lactic acid, acetic acid, buffered lactic acid, acetic acid in combination with lactic acid, and peracetic acid) at two concentrations was evaluated on skin-on and skin-off chicken thighs at three application temperatures. Skinless chicken breasts were used to evaluate the antimicrobial efficacy of lactic acid and peracetic acid. The color stability of treated and untreated chicken parts was assessed after the acid interventions. The lactic acid and buffered lactic acid treatments produced the greatest reductions in Salmonella counts. Significant differences between the control and water treatments were identified for 5.11% lactic acid and 5.85% buffered lactic acid in both skin-on and skin-off chicken thighs. No significant effect of treatment temperature for skin-on chicken thighs was found. Lactic acid and peracetic acid were effective agents for eluting Salmonella cells attached to chicken breasts.

Quantitation of 13 heterocyclic aromatic amines in cooked beef, pork, and chicken by liquid chromatography-electrospray ionization/tandem mass spectrometry.

Science.gov (United States)

Ni, Weijuan; McNaughton, Lynn; LeMaster, David M; Sinha, Rashmi; Turesky, Robert J

2008-01-09

The concentrations of heterocyclic aromatic amines (HAAs) were determined, by liquid chromatography-electrospray ionization/tandem mass spectrometry (LC-ESI-MS/MS), in 26 samples of beef, pork, and chicken cooked to various levels of doneness. The HAAs identified were 2-amino-3-methylimidazo[4,5- f]quinoline, 2-amino-1-methylimidazo[4,5- b]quinoline, 2-amino-1-methylimidazo[4,5- g]quinoxaline (I gQx), 2-amino-3-methylimidazo[4,5- f]quinoxaline, 2-amino-1,7-dimethylimidazo[4,5- g]quinoxaline (7-MeI gQx), 2-amino-3,8-dimethylimidazo[4,5- f]quinoxaline, 2-amino-1,6-dimethyl-furo[3,2- e]imidazo[4,5- b]pyridine, 2-amino-1,6,7-trimethylimidazo[4,5- g]quinoxaline, 2-amino-3,4,8-trimethylimidazo[4,5- f]quinoxaline, 2-amino-1,7,9-trimethylimidazo[4,5- g]quinoxaline, 2-amino-1-methyl-6-phenylimidazo[4,5- b]pyridine (PhIP), 2-amino-9 H-pyrido[2,3- b]indole, and 2-amino-3-methyl-9 H-pyrido[2,3- b]indole. The concentrations of these compounds ranged from chicken (up to 305 microg/kg), broiled bacon (16 microg/kg), and pan-fried bacon (4.9 microg/kg). 7-MeI gQx was the most abundant HAA formed in very well done pan-fried beef and steak, and in beef gravy, at concentrations up to 30 microg/kg. Several other linear tricyclic ring HAAs containing the I gQx skeleton are formed at concentrations in cooked meats that are relatively high in comparison to the concentrations of their angular tricyclic ring isomers, the latter of which are known experimental animal carcinogens and potential human carcinogens. The toxicological properties of these recently discovered I gQx derivatives warrant further investigation and assessment.

Preoperative Planning and Intraoperative Technique for Accurate Translation of a Distal First Metatarsal Osteotomy.

Science.gov (United States)

Wynes, Jacob; Lamm, Bradley M; Andrade, Bijan J; Malay, D Scot

2016-01-01

We used preoperative radiographic and intraoperative anatomic measurements to predict and achieve, respectively, the precise amount of capital fragment lateral translation required to restore anatomic balance to the first metatarsophalangeal joint. Correlation was used to relate the amount of capital fragment translation and operative reduction of the first intermetatarsal angle (IMA), hallux abductus angle (HAA), tibial sesamoid position (TSP), metatarsus adductus angle, and first metatarsal length. The mean capital fragment lateral translation was 5.54 ± 1.64 mm, and the mean radiographic reductions included a first IMA of 5.04° ± 2.85°, an HAA of 9.39° ± 8.38°, and a TSP of 1.38 ± 0.9. These changes were statistically (p < .001) and clinically (≥32.55%) significant. The mean reduction of the metatarsus adductus angle was 0.66° ± 4.44° and that for the first metatarsal length was 0.33 ± 7.27 mm, and neither of these were statistically (p = .5876 and 0.1247, respectively) or clinically (≤3.5%) significant. Pairwise correlations between the amount of lateral translation of the capital fragment and the first IMA, HAA, and TSP values were moderately positive and statistically significant (r = 0.4412, p = .0166; r = 0.5391, p = .0025; and r = 0.3729, p = .0463; respectively). In contrast, the correlation with metatarsus adductus and the first metatarsal shortening were weak and not statistically significant (r = 0.2296, p = .2308 and r = -0.2394, p = .2109, respectively). The results of our study indicate that predicted preoperative and executed intraoperative lateral translation of the capital fragment correlates with statistically and clinically significant reductions in the first IMA, HAA, and TSP. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

Differential toxicity of heterocyclic aromatic amines and their mixture in metabolically competent HepaRG cells

International Nuclear Information System (INIS)

Dumont, Julie; Josse, Rozenn; Lambert, Carine; Antherieu, Sebastien; Le Hegarat, Ludovic; Aninat, Caroline; Robin, Marie-Anne; Guguen-Guillouzo, Christiane

2010-01-01

Human exposure to heterocyclic aromatic amines (HAA) usually occurs through mixtures rather than individual compounds. However, the toxic effects and related mechanisms of co-exposure to HAA in humans remain unknown. We compared the effects of two of the most common HAA, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), individually or in combination, in the metabolically competent human hepatoma HepaRG cells. Various endpoints were measured including cytotoxicity, apoptosis, oxidative stress and DNA damage by the comet assay. Moreover, the effects of PhIP and/or MeIQx on mRNA expression and activities of enzymes involved in their activation and detoxification pathways were evaluated. After a 24 h treatment, PhIP and MeIQx, individually and in combination, exerted differential effects on apoptosis, oxidative stress, DNA damage and cytochrome P450 (CYP) activities. Only PhIP induced DNA damage. It was also a stronger inducer of CYP1A1 and CYP1B1 expression and activity than MeIQx. In contrast, only MeIQx exposure resulted in a significant induction of CYP1A2 activity. The combination of PhIP with MeIQx induced an oxidative stress and showed synergistic effects on apoptosis. However, PhIP-induced genotoxicity was abolished by a co-exposure with MeIQx. Such an inhibitory effect could be explained by a significant decrease in CYP1A2 activity which is responsible for PhIP genotoxicity. Our findings highlight the need to investigate interactions between HAA when assessing risks for human health and provide new insights in the mechanisms of interaction between PhIP and MeIQx.

Molecular interaction of pinic acid with sulfuric acid

DEFF Research Database (Denmark)

Elm, Jonas; Kurtén, Theo; Bilde, Merete

2014-01-01

We investigate the molecular interactions between the semivolatile α-pinene oxidation product pinic acid and sulfuric acid using computational methods. The stepwise Gibbs free energies of formation have been calculated utilizing the M06-2X functional, and the stability of the clusters is evaluated...... cluster. The involvement of more than one pinic acid molecule in a single cluster is observed to lead to the formation of favorable (pinic acid)2(H2SO4) and (pinic acid)2(H2SO4)2 clusters. The identified most favorable growth paths starting from a single pinic acid molecule lead to closed structures...

Effect of acetic acid on citric acid fermentation in an integrated citric acid-methane fermentation process.

Science.gov (United States)

Xu, Jian; Chen, Yang-Qiu; Zhang, Hong-Jian; Tang, Lei; Wang, Ke; Zhang, Jian-Hua; Chen, Xu-Sheng; Mao, Zhong-Gui

2014-09-01

An integrated citric acid-methane fermentation process was proposed to solve the problem of extraction wastewater in citric acid fermentation process. Extraction wastewater was treated by anaerobic digestion and then recycled for the next batch of citric acid fermentation to eliminate wastewater discharge and reduce water resource consumption. Acetic acid as an intermediate product of methane fermentation was present in anaerobic digestion effluent. In this study, the effect of acetic acid on citric acid fermentation was investigated and results showed that lower concentration of acetic acid could promote Aspergillus niger growth and citric acid production. 5-Cyano-2,3-ditolyl tetrazolium chloride (CTC) staining was used to quantify the activity of A. niger cells, and the results suggested that when acetic acid concentration was above 8 mM at initial pH 4.5, the morphology of A. niger became uneven and the part of the cells' activity was significantly reduced, thereby resulting in deceasing of citric acid production. Effects of acetic acid on citric acid fermentation, as influenced by initial pH and cell number in inocula, were also examined. The result indicated that inhibition by acetic acid increased as initial pH declined and was rarely influenced by cell number in inocula.

New Acid Combination for a Successful Sandstone Acidizing

Science.gov (United States)

Shafiq, M. U.; Mahmud, H. K. B.; Rezaee, R.

2017-05-01

With the development of new enhanced oil recovery techniques, sandstone acidizing has been introduced and played a pivotal role in the petroleum industry. Different acid combinations have been applied, which react with the formation, dissolve the soluble particles; thus increase the production of hydrocarbons. To solve the problems which occurred using current preflush sandstone acidizing technology (hydrochloric acid); a new acid combination has been developed. Core flooding experiments on sandstone core samples with dimensions 1.5 in. × 3 in. were conducted at a flow rate of 2 cm3/min. A series of hydrochloric-acetic acid mixtures with different ratios were tested under 150°F temperature. The core flooding experiments performed are aimed to dissolve carbonate, sodium, potassium and calcium particles from the core samples. These experiments are followed by few important tests which include, porosity-permeability, pH value, Inductively Coupled Plasma (ICP) analysis and Nuclear Magnetic Resonance (NMR measurements). All the results are compared with the results of conventional hydrochloric acid technology. NMR and porosity analysis concluded that the new acid combination is more effective in creating fresh pore spaces and thus increasing the reservoir permeability. It can be seen from the pore distribution before and after the acidizing. Prior applying acid; the large size of pores appears most frequently in the pore distribution while with the applied acid, it was found that the small pore size is most the predominant of the pore distribution. These results are validated using ICP analysis which shows the effective removal of calcium and other positive ions from the core sample. This study concludes that the combination of acetic-hydrochloric acid can be a potential candidate for the preflush stage of sandstone acidizing at high temperature reservoirs.

Application of citric acid in acid stimulation treatments

Energy Technology Data Exchange (ETDEWEB)

Alkhaldi, M.H.; Sarma, H.K. [Adelaide Univ., Adelaide (Australia); Nasr-el-Din, H.A. [Texas A and M Univ., College Station, TX (United States)

2009-07-01

A rotating disk apparatus was used to investigate mass transfer during the reaction of citric acid with calcite. The study evaluated the effects of initial acid concentrations, temperature, and disk rotational speed on the effective diffusion coefficient of citric acid. The diffusion coefficient was calculated at 25, 40, and 50 degrees C using various citric acid concentrations. The study indicated that the coefficient was a function of the interactions between calcium citrate precipitation and counter calcium ions. At high acid concentrations, the effects of calcium citrate precipitation and counter calcium ions were significant. The calculated citric acid diffusion coefficients were not comparable with measured effective diffusion coefficients using the rotating disk. At lower initial citric acid concentrations, the effects of both calcium citrate precipitation and counter calcium ions on citric acid diffusivity were minimal. It was concluded that temperature effects on the diffusion coefficient followed Arrhenius law. Activation energy was equal to 37.9 kJ/mol. 34 refs., 4 tabs., 13 figs.

Acid distribution in phosphoric acid fuel cells

Energy Technology Data Exchange (ETDEWEB)

Okae, I.; Seya, A.; Umemoto, M. [Fuji Electric Co., Ltd., Chiba (Japan)

1996-12-31

Electrolyte acid distribution among each component of a cell is determined by capillary force when the cell is not in operation, but the distribution under the current load conditions had not been clear so far. Since the loss of electrolyte acid during operation is inevitable, it is necessary to store enough amount of acid in every cell. But it must be under the level of which the acid disturbs the diffusion of reactive gases. Accordingly to know the actual acid distribution during operation in a cell is very important. In this report, we carried out experiments to clarify the distribution using small single cells.

Determination of dissociation constants or propionic acid and lactic acid (2-hydroxypropionic acid) by potentiometry and conductometry

International Nuclear Information System (INIS)

Saeeduddin; Khanzada, A.W.K.

2004-01-01

Dissociation constants of propionic acid and 2-hydroxypropionic acid (lactic acid) have been studied at different temperatures between 25 to 50 deg. C interval. Propionic acid is analyzed by conductometry while 2-hydroxypropionic acid is analyzed by potentiometry. Both investigated compounds are symmetrical carboxylic acids having same length of carbon chain but are markedly different in ionic behavior. We were interested to see how the hydroxyl group (-OH) induction in propionic acid affects on pKa values of 2-hydroxypropionic acid. We observed that as temperature increases pKa values increase. The increase is observed for both the investigated compounds. PKa values of 2-hydroxypropionic acid are lower as compared to propionic acid because of electron withdrawing (-OH). (author)

Observation of Rashba zero-field spin splitting in a strained germanium 2D hole gas

International Nuclear Information System (INIS)

Morrison, C.; Rhead, S. D.; Foronda, J.; Leadley, D. R.; Myronov, M.; Wiśniewski, P.

2014-01-01

We report the observation, through Shubnikov-de Haas oscillations in the magnetoresistance, of spin splitting caused by the Rashba spin-orbit interaction in a strained Ge quantum well epitaxially grown on a standard Si(001) substrate. The Shubnikov-de Haas oscillations display a beating pattern due to the spin split Landau levels. The spin-orbit parameter and Rashba spin-splitting energy are found to be 1.0 × 10 −28   eVm 3 and 1.4 meV, respectively. This energy is comparable to 2D electron gases in III-V semiconductors, but substantially larger than in Si, and illustrates the suitability of Ge for modulated hole spin transport devices.

Acid Rain, pH & Acidity: A Common Misinterpretation.

Science.gov (United States)

Clark, David B.; Thompson, Ronald E.

1989-01-01

Illustrates the basis for misleading statements about the relationship between pH and acid content in acid rain. Explains why pH cannot be used as a measure of acidity for rain or any other solution. Suggests that teachers present acidity and pH as two separate and distinct concepts. (RT)

Chlorogenic acid and caffeic acid are absorbed in humans

NARCIS (Netherlands)

Olthof, Margreet R.; Hollman, Peter C H; Katan, Martijn B.

2001-01-01

Chlorogenic acid, an ester of caffeic acid and quinic acid, is a major phenolic compound in coffee; daily intake in coffee drinkers is 0.5-1 g. Chlorogenic acid and caffeic acid are antioxidants in vitro and might therefore contribute to the prevention of cardiovascular disease. However, data on the

Comparison of Buffer Effect of Different Acids During Sandstone Acidizing

International Nuclear Information System (INIS)

Shafiq, Mian Umer; Mahmud, Hisham Khaled Ben; Hamid, Mohamed Ali

2015-01-01

The most important concern of sandstone matrix acidizing is to increase the formation permeability by removing the silica particles. To accomplish this, the mud acid (HF: HCl) has been utilized successfully for many years to stimulate the sandstone formations, but still it has many complexities. This paper presents the results of laboratory investigations of different acid combinations (HF: HCl, HF: H 3 PO 4 and HF: HCOOH). Hydrofluoric acid and fluoboric acid are used to dissolve clays and feldspar. Phosphoric and formic acids are added as a buffer to maintain the pH of the solution; also it allows the maximum penetration of acid into the core sample. Different tests have been performed on the core samples before and after the acidizing to do the comparative study on the buffer effect of these acids. The analysis consists of permeability, porosity, color change and pH value tests. There is more increase in permeability and porosity while less change in pH when phosphoric and formic acids were used compared to mud acid. From these results it has been found that the buffer effect of phosphoric acid and formic acid is better than hydrochloric acid. (paper)

Electrolytic nature of aqueous sulfuric acid. 2. Acidity.

Science.gov (United States)

Fraenkel, Dan

2012-09-27

In part 1 of this study, I reported that the Debye-Hückel limiting law and the smaller-ion shell (SiS) model of strong electrolyte solutions fit nicely with the experimental mean ionic activity coefficient (γ(±)) of aqueous sulfuric acid as a function of concentration and of temperature when the acid is assumed to be a strong 1-3 electrolyte. Here, I report that the SiS-derived activity coefficient of H(+), γ(H(+)), of the 1-3 acid is comparable to that of aqueous HCl. This agrees with titration curves showing, as well-known, that sulfuric acid in water is parallel in strength to aqueous HCl. The calculated pH is in good accord with the Hammett acidity function, H(0), of aqueous sulfuric acid at low concentration, and differences between the two functions at high concentration are discussed and explained. This pH-H(0) relation is consistent with the literature showing that the H(0) of sulfuric acid (in the 1-9 M range) is similar to those of HCl and the other strong mineral monoprotic acids. The titration of aqueous sulfuric acid with NaOH does not agree with the known second dissociation constant of 0.010 23; rather, the constant is found to be ~0.32 and the acid behaves upon neutralization as a strong diprotic acid practically dissociating in one step. A plausible reaction pathway is offered to explain how the acid may transform, upon base neutralization, from a dissociated H(4)SO(5) (as 3H(+) and HSO(5)(3-)) to a dissociated H(2)SO(4) even though the equilibrium constant of the reaction H(+) + HSO(5)(3-) ↔ SO(4)(2-) + H(2)O, at 25 °C, is 10(-37) (part 1).

Aspartic acid

Science.gov (United States)

... we eat. Aspartic acid is also called asparaginic acid. Aspartic acid helps every cell in the body work. It ... release Normal nervous system function Plant sources of aspartic acid include: avocado, asparagus, and molasses. Animal sources of ...

Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

International Nuclear Information System (INIS)

Punnonen, K.; Puustinen, T.; Jansen, C.T.

1986-01-01

Human keratinocytes in culture were labelled with 14 C-dihomo-gamma-linolenic acid, 14 C-arachidonic acid or 14 C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes

High altitude dermatology

Directory of Open Access Journals (Sweden)

G K Singh

2017-01-01

Full Text Available Approximately, 140 million people worldwide live permanently at high altitudes (HAs and approximately another 40 million people travel to HA area (HAA every year for reasons of occupation, sports or recreation. In India, whole of Ladakh region, part of Northwest Kashmir, Northern part of Sikkim and Tenga valley of Arunachal are considered inhabited areas of HAA. The low quantity of oxygen, high exposure of ultraviolet (UV light, very low humidity, extreme subzero temperature in winter, high wind velocity, make this region difficult for lowlanders as well as for tourists. Acute mountain sickness, HA pulmonary edema, HA cerebral edema, and thromboembolic conditions are known to occur in HA. However, enough knowledge has not been shared on dermatoses peculiar to this region. Xerosis, UV-related skin disorders (tanning, photomelanosis, acute and chronic sunburn, polymorphic light eruption, chronic actinic dermatitis, actinic cheilitis, etc., cold injuries (frostbite, chilblains, acrocyanosis, erythrocyanosis, etc. nail changes (koilonychias, airborne contact dermatitis, insect bite reaction, and skin carcinoma (basal cell carcinomas, squamous cell carcinomas, and also rarely malignant melanoma are the dermatoses seen in HAAs. Early diagnosis and knowledge of HA dermatoses may prevent serious consequences of disease and improve the quality of life for the visitors as well as for native of the place.

Methemoglobin Formation and Characterization of Hemoglobin Adducts of Carcinogenic Aromatic Amines and Heterocyclic Aromatic Amines.

Science.gov (United States)

Pathak, Khyatiben V; Chiu, Ting-Lan; Amin, Elizabeth Ambrose; Turesky, Robert J

2016-03-21

Arylamines (AAs) and heterocyclic aromatic amines (HAAs) are structurally related carcinogens formed during the combustion of tobacco or cooking of meat. They undergo cytochrome P450 mediated N-hydroxylation to form metabolites which bind to DNA and lead to mutations. The N-hydroxylated metabolites of many AAs also can undergo a co-oxidation reaction with oxy-hemolgobin (HbO2) to form methemoglobin (met-Hb) and the arylnitroso intermediates, which react with the β-Cys(93) chain of Hb to form Hb-arylsulfinamide adducts. The biochemistry of arylamine metabolism has been exploited to biomonitor certain AAs through their Hb arylsulfinamide adducts in humans. We examined the reactivity of HbO2 with the N-hydroxylated metabolites of 4-aminobiphenyl (ABP, HONH-ABP), aniline (ANL, HONH-ANL), and the HAAs 2-amino-9H-pyrido[2,3-b]indole (AαC, HONH-AαC), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP, HONH-PhIP), and 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx, HONH-MeIQx). HONH-ABP, HO-ANL, and HONH-AαC induced methemoglobinemia and formed Hb sulfinamide adducts. However, HONH-MeIQx and HONH-PhIP did not react with the oxy-heme complex, and met-Hb formation and chemical modification of the β-Cys(93) residue were negligible. Molecular modeling studies showed that the distances between the H-ON-AA or H-ON-HAA substrates and the oxy-heme complex of HbO2 were too far away to induce methemoglobinemia. Different conformational changes in flexible helical and loop regions around the heme pocket induced by the H-ON-AA or H-ON-HAAs may explain the different proclivities of these chemicals to induce methemoglobinemia. Hb-Cys(93β) sulfinamide and sulfonamide adducts of ABP, ANL, and AαC were identified, by Orbitrap MS, following the proteolysis of Hb with trypsin, Glu-C, or Lys-C. Hb sulfinamide and sulfonamide adducts of ABP were identified in the blood of mice exposed to ABP, by Orbitrap MS. This is the first report of the identification of intact Hb

Uracil in formic acid hydrolysates of deoxyribonucleic acid

Science.gov (United States)

Schein, Arnold H.

1966-01-01

1. When DNA is hydrolysed with formic acid for 30min. at 175° and the hydrolysate is chromatographed on paper with propan-2-ol–2n-hydrochloric acid, in addition to expected ultraviolet-absorbing spots corresponding to guanine, adenine, cytosine and thymine, an ultraviolet-absorbing region with RF similar to that of uracil can be detected. Uracil was separated from this region and identified by its spectra in acid and alkali, and by its RF in several solvent systems. 2. Cytosine, deoxyribocytidine and deoxyribocytidylic acid similarly treated with formic acid all yielded uracil, as did a mixture of deoxyribonucleotides. 3. Approx. 4% of deoxyribonucleotide cytosine was converted into uracil by the formic acid treatment. ImagesFig. 1. PMID:5949371

Reactive extraction and recovery of levulinic acid, formic acid and furfural from aqueous solutions containing sulphuric acid

NARCIS (Netherlands)

Brouwer, Thomas; Blahusiak, Marek; Babic, Katarina; Schuur, Boelo

2017-01-01

Levulinic acid (LA) can be produced from lignocellulosic materials via hydroxylation followed by an acid-catalyzed conversion of hexoses. Inorganic homogeneous catalysts are mostly used, in particular sulphuric acid, yielding a mixture of LA with sulphuric acid, formic acid (FA) and furfural.

Well acidizing

Energy Technology Data Exchange (ETDEWEB)

Street, E H

1980-01-23

The apparatus relates in particular to a well-treating process in which an aqueous acid solution having a pH of < 2 is injected into a subterranean reservoir in a manner such that materials that contain ferric ions are present in the acid and, as the acid reacts within the reservoir and attains a pH exceeding 3, tend to be precipitated as ferric ion-containing solid materials that may plug the pores of the reservoir. Such a precipitation is prevented by dissolving in the acid solution an amount of 5-sulfosalicylic acid which is at least sufficient to sequester significant proportions of ferric ions when the pH of the acid is from 0.5 to 3 but is less than enough to cause a significant salting-out of solid materials, and an amount of citric acid which is at least sufficient to sequester significant proportions of ferric ions when the pH of the acid is from 3 to 6 but is less than enough to precipitate a significant amount of calcium citrate. The amount of the 5-sulfosalicylic acid may be from 0.01 to 0.05 moles/l and the amount of citric acid is from 0.001 to 0.009 moles/l. 11 claims.

Aasta pressifotod žürii perspektiivist / Annika Haas

Index Scriptorium Estoniae

Haas, Annika, 1974-

2015-01-01

Konkursist "Aasta pressifoto", pressifotograafide igapäevatööst. "Aasta pressifoto 2014" peapreemia pälvis Dmitri Kotjuhi "Noored suusatajad", portreefoto kategooria võitis Renee Altrovi "Eesti Vabariigi president", uudisfoto kategooria Margus Ansu "Klassijuhataja tunnid", olemusfoto kategooria Priit Simsoni "Kaotatud sõda"

Chemistry and electrochemistry in trifluoroacetic acid. Comparison with acetic acid

International Nuclear Information System (INIS)

Petit, Gerard

1972-01-01

As the trifluoroacetic acid is, with the acetic acid, one of most often used carboxylic acids as solvent, notably in organic chemistry, this research thesis addresses some relatively simple complexing and redox reactions to highlight the peculiar feature of this acid, and to explain its very much different behaviour with respect to acetic acid. The author develops the notion of acidity level in solvents of low dielectric constant. The second part addresses a specific solvent: BF 3 (CH 3 COOH) 2 . The boron trifluoride strengthens the acidity of acetic acid and modifies its chemical and physical-chemical properties. In the third part, the author compares solvent properties of CF 3 COOH and CH 3 COOH. Noticed differences explain why the trifluoroacetic acid is a more interesting reaction environment than acetic acid for reactions such as electrophilic substitutions or protein solubilisation [fr

Role of sialic acid in synaptosomal transport of amino acid transmitters

International Nuclear Information System (INIS)

Zaleska, M.M.; Erecinska, M.

1987-01-01

Active, high-affinity, sodium-dependent uptake of [ 14 C]-aminobutyric acid and of the acidic amino acid D-[ 3 H]-aspartate was inhibited by pretreatment of synaptosomes with neuraminidase from Vibrio cholerae. Inhibition was of a noncompetitive type and was related to the amount of sialic acid released. The maximum accumulation ratios of both amino acids (intracellular [amino acid]/extracellular [amino acid]) remained largely unaltered. Treatment with neuraminidase affected neither the synaptosomal energy levels nor the concentration of internal potassium. It is suggested that the γ-aminobutyric acid and acidic amino acid transporters are glycosylated and that sialic acid is involved in the operation of the carrier proteins directly and not through modification of driving forces responsible for amino acid uptake

Distillation Separation of Hydrofluoric Acid and Nitric Acid from Acid Waste Using the Salt Effect on Vapor-Liquid Equilibrium

Science.gov (United States)

Yamamoto, Hideki; Sumoge, Iwao

2011-03-01

This study presents the distillation separation of hydrofluoric acid with use of the salt effect on the vapor-liquid equilibrium for acid aqueous solutions and acid mixtures. The vapor-liquid equilibrium of hydrofluoric acid + salt systems (fluorite, potassium nitrate, cesium nitrate) was measured using an apparatus made of perfluoro alkylvinylether. Cesium nitrate showed a salting-out effect on the vapor-liquid equilibrium of the hydrofluoric acid-water system. Fluorite and potassium nitrate showed a salting-in effect on the hydrofluoric acid-water system. Separation of hydrofluoric acid from an acid mixture containing nitric acid and hydrofluoric acid was tested by the simple distillation treatment using the salt effect of cesium nitrate (45 mass%). An acid mixture of nitric acid (5.0 mol · dm-3) and hydrofluoric acid (5.0 mol · dm-3) was prepared as a sample solution for distillation tests. The concentration of nitric acid in the first distillate decreased from 5.0 mol · dm-3 to 1.13 mol · dm-3, and the concentration of hydrofluoric acid increased to 5.41 mol · dm-3. This first distillate was further distilled without the addition of salt. The concentrations of hydrofluoric acid and nitric acid in the second distillate were 7.21 mol · dm-3 and 0.46 mol · dm-3, respectively. It was thus found that the salt effect on vapor-liquid equilibrium of acid mixtures was effective for the recycling of acids from acid mixture wastes.

17,21-Secohopanoic acids, 25-norhopanoic acids, and 28-norhopanoic acids in source rocks and crude oils

Energy Technology Data Exchange (ETDEWEB)

Xueming Pan; Philp, R.P. [University of Oklahoma, Norman, OK (United States). School of Geology and Geophysics

2006-09-15

The presence of three families of hopanoic acids, 17,21-secohopanoic acids, 25-norhopanoic acids, and 28-norhopanoic acids, is discussed. Oils from West Siberia and tar balls from the Seychelles Islands were found to contain relatively high proportions of 17,21-secohopanoic acids. These acids have not been previously reported in any oils or source rocks. A heavily biodegraded West Siberian oil, was found to contain an homologous series of 25-norhopanoic acids co-occurring with the 25-norhopanes as previously reported in only a small number of oils from Campos Basin, Brazil. 28-Norhopanoic acids have been reported in various sediments and extracts of the Monterey Shale, but in this study their occurrence has been extended to oils, degraded oils, and tar balls sourced from the Monterey Shale. The primary purpose herein is to report the occurrence of these acids and possible relationships between the acids and corresponding hydrocarbons. (Author)

Process for the preparation of lactic acid and glyceric acid

Science.gov (United States)

Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

2008-12-02

Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

The bile acids, deoxycholic acid and ursodeoxycholic acid, regulate colonic epithelial wound healing.

Science.gov (United States)

Mroz, Magdalena S; Lajczak, Natalia K; Goggins, Bridie J; Keely, Simon; Keely, Stephen J

2018-03-01

The intestinal epithelium constitutes an innate barrier which, upon injury, undergoes self-repair processes known as restitution. Although bile acids are known as important regulators of epithelial function in health and disease, their effects on wound healing processes are not yet clear. Here we set out to investigate the effects of the colonic bile acids, deoxycholic acid (DCA) and ursodeoxycholic acid (UDCA), on epithelial restitution. Wound healing in T 84 cell monolayers grown on transparent, permeable supports was assessed over 48 h with or without bile acids. Cell migration was measured in Boyden chambers. mRNA and protein expression were measured by RT-PCR and Western blotting. DCA (50-150 µM) significantly inhibited wound closure in cultured epithelial monolayers and attenuated cell migration in Boyden chamber assays. DCA also induced nuclear accumulation of the farnesoid X receptor (FXR), whereas an FXR agonist, GW4064 (10 µM), inhibited wound closure. Both DCA and GW4064 attenuated the expression of CFTR Cl - channels, whereas inhibition of CFTR activity with either CFTR- inh -172 (10 µM) or GlyH-101 (25 µM) also prevented wound healing. Promoter/reporter assays revealed that FXR-induced downregulation of CFTR is mediated at the transcriptional level. In contrast, UDCA (50-150 µM) enhanced wound healing in vitro and prevented the effects of DCA. Finally, DCA inhibited and UDCA promoted mucosal healing in an in vivo mouse model. In conclusion, these studies suggest bile acids are important regulators of epithelial wound healing and are therefore good targets for development of new drugs to modulate intestinal barrier function in disease treatment. NEW & NOTEWORTHY The secondary bile acid, deoxycholic acid, inhibits colonic epithelial wound healing, an effect which appears to be mediated by activation of the nuclear bile acid receptor, FXR, with subsequent downregulation of CFTR expression and activity. In contrast, ursodeoxycholic acid promotes

Effects of dietary conjugated linoleic acid and linoleic:linolenic acid ratio on polyunsaturated fatty acid status in laying hens.

Science.gov (United States)

Du, M; Ahn, D U; Sell, J L

2000-12-01

A study was conducted to determine the effects of dietary conjugated linoleic acid (CLA) and the ratio of linoleic:linolenic acid on long-chain polyunsaturated fatty acid status. Thirty-two 31-wk-old White Leghorn hens were randomly assigned to four diets containing 8.2% soy oil, 4.1% soy oil + 2.5% CLA (4.1% CLA source), 4.1% flax oil + 2.5% CLA, or 4.1% soy oil + 4.1% flax oil. Hens were fed the diets for 3 wk before eggs and tissues were collected for the study. Lipids were extracted from egg yolk and tissues, classes of egg yolk lipids were separated, and fatty acid concentrations of total lipids, triglyceride, phosphatidylethanolamine, and phosphatidylcholine were analyzed by gas chromatography. The concentrations of monounsaturated fatty acids and non-CLA polyunsaturated fatty acids were reduced after CLA feeding. The amount of arachidonic acid was decreased after CLA feeding in linoleic acid- and linolenic acid-rich diets, but amounts of eicosapentaenoic acid and docosahexaenoic acid were increased in the linolenic-rich diet, indicating that the synthesis or deposition of long-chain n-3 fatty acids was accelerated after CLA feeding. The increased docosahexaenoic acid and eicosapentaenoic acid contents in lipid may be compensation for the decreased arachidonic acid content. Dietary supplementation of linoleic acid increased n-6 fatty acid levels in lipids, whereas linolenic acid increased n-3 fatty acid levels. Results also suggest that CLA might not be elongated to synthesize long-chain fatty acids in significant amounts. The effect of CLA in reducing the level of n-6 fatty acids and promoting the level of n-3 fatty acids could be related to the biological effects of CLA.

Classical bile acids in animals, beta-phocaecholic acid in ducks.

Science.gov (United States)

Jirsa, M; Klinot, J; Klinotová, E; Ubik, K; Kucera, K

1989-01-01

1. Bile samples of different animals were analysed and the percentage content of classical bile acids was determined. 2. Herbivorous birds mostly excreted a large proportion of chenodeoxycholic acid. 3. The anteater (Myrmecophaga tridactyla) excreted deoxycholic acid most probably as a primary bile acid. 4. In the bile of ducks (Anas platyrhynchos) a large amount of (23R)3 alpha, 7 alpha, 23-trihydroxy-5 beta-cholan-24-oic acid (beta-phocaecholic acid) was found.

Decontamination effectiveness of mixtures of citric acid, oxalic acid and EDTA

International Nuclear Information System (INIS)

Speranzini, R.A.

1990-01-01

An experimental study of the decontamination effectiveness of citric acid, oxalic acid and EDTA mixtures was conducted to assess whether oxalic acid could be removed from decontamination solutions to minimize corrosion. In loop experiments, radioactive specimens from two boiling water reactors and one pressurized water reactor were suspended in solutions of single acids or in mixtures of reagents at total reagent concentrations of less than 0.1 wt% under conditions similar to those used to decontaminate reactor systems. Rate constants for dissolution of oxides and decontamination factors were measured. Based on the results, it was concluded that under certain conditions, oxalic acid was the most effective reagent for the dissolution of oxides. It was also found, however, that conditions under which effective dissolution occurred in solutions of oxalic acid and/or citric acid were difficult to define and control. EDTA was found to be an effective reagent for dissolution of oxides such that rates of dissolution in EDTA containing solutions at 117 degrees Celsius were comparable to rates in oxalic acid containing solutions. At 90 degrees Celsius, EDTA acted synergistically with oxalic acid such that the rate of dissolution of oxides in citric-acid/oxalic-acid/EDTA solutions was higher than in citric-acid/EDTA solutions. The rates of dissolution of oxides were significantly reduced when 60 mg/kg of ferric ion was added to the citric-acid/oxalic-acid, citric-acid/EDTA and citric-acid/oxalic-acid/EDTA solutions. It was concluded that effective decontaminations of BWR and PWR systems could be achieved with mixtures of citric acid and EDTA

Estimating the temporal evolution of Alzheimer's disease pathology with autopsy data.

Science.gov (United States)

Royall, Donald R; Palmer, Raymond F

2012-01-01

The temporal growth of Alzheimer's disease (AD) neuropathology cannot be easily determined because autopsy data are available only after death. We combined autopsy data from 471 participants in the Honolulu-Asia Aging Study (HAAS) into latent factor measures of neurofibrillary tangle and neuritic plaque counts. These were associated with intercept and slope parameters from a latent growth curve (LGC) model of 9-year change in cognitive test performance in 3244 autopsied and non-autopsied HAAS participants. Change in cognition fully mediated the association between baseline cognitive performance and AD lesions counts. The mediation effect of cognitive change on both AD lesion models effectively dates them within the period of cognitive surveillance. Additional analyses could lead to an improved understanding of lesion propagation in AD.

Radioimmunoassay of conjugated cholic acid, chenodeoxycholic acid, and deoxycholic acid from human serum, with use of 125I-labeled ligands

International Nuclear Information System (INIS)

Maeentausta, O.; Jaenne, O.

1979-01-01

We describe a method for radioimmunoassay of conjugated cholic acid, chenodeoxycholic acid, and deoxycholic acid in serum. In the method, 125 I-labeled bile acid conjugates are used as the tracers along with antibodies raised against individual bile acid-bovine serum albumin conjugates. Antibody-bound and free bile acids were separated by polyethylene glycol precipitation (final concentration, 125 g/L). The lowest measurable amounts of the bile acids, expressed as pmol/tube, were: cholic acid conjugates, 2; chenodeoxycholic acid conjugates, 0.5; and deoxycholic acid conjugates, 2. Analytical recovery of bile acids added to bile acid-free serum ranged from 85 to 110%; intra-assay and inter-assay CVs ranged from 8.3 to 5.3% and from 5.3 to 12.2%, respectively. Concentrations (mean +- SD) of the bile acid conjugates in serum from apparently healthy women and men (in μmol/L) were: cholic acid conjugates, 0.43 +- 0.17 (n=126); chenodeoxycholic acid conjugates, 0.47 +- 0.23 (n=111); and deoxycholic acid conjugates, 0.33 +- 0.11 (n=96). The values for primary bile acids were greatly increased in patients with various hepatobiliary diseases

A Comparative Study of the Radical-scavenging Activity of the Phenolcarboxylic Acids Caffeic Acid, p-Coumaric Acid, Chlorogenic Acid and Ferulic Acid, With or Without 2-Mercaptoethanol, a Thiol, Using the Induction Period Method

Directory of Open Access Journals (Sweden)

Seiichiro Fujisawa

2008-10-01

Full Text Available Phenolcarboxylic acid antioxidants do not act in vivo as radical-scavengers in isolation, but rather together with GSH (glutathione, a coantioxidant, they constitute an intricate antioxidant network. Caffeic acid, p-coumaric acid, ferulic acid and chlorogenic acid with or without 2-mercaptoethanol (ME, as a substitute for GSH, was investigated by the induction period (IP method for polymerization of methyl methacrylate (MMA initiated by thermal decomposition of 2,2'-azobisisobutyronitrile (AIBN, a source of alkyl radicals, R. and benzoyl peroxide (BPO, a source of peroxy radicals, PhCOO. using differential scanning calorimetry (DSC. Upon PhCOO. radical scavenging, the stoichiometric factors (n, number of free radical trapped by one mole of antioxidant for caffeic acid, ferulic acid, p-coumaric acid and chlorogenic acid were 2.4, 1.8, 1.7 and 0.9, whereas upon R. radical scavenging, the corresponding values were 1.3, 1.2, 1.0 and 0.8, respectively. Antioxidants with n values close to 2 suggest the stepwise formation of semiquinone radicals and quinones. By contrast, those with n values close to 1 suggest the formation of dimers after single-electron oxidation, possibly due to recombination of corresponding aryloxy radicals. The ratio of the rate constant of inhibition to that of propagation (kinh/kp declined in the order chlorogenic acid > p-coumaric acid > ferulic acid > caffeic acid. The ratio of the observed IP for the phenolcarboxylic acid/2-mercapto-ethanol (ME mixture (1:1 molar ratio (A to the calculated IP (the simple sum of phenol acid antioxidant and ME (B was investigated. Upon R. scavenging, the caffeic acid or p-coumaric acid/ME mixture was A/B > 1, particularly the former was 1.2, suggesting a synergic effect. By contrast, upon PhCOO. scavenging, the corresponding mixture was A/B < 1, particularly the latter was 0.7, suggesting an antagonistic effect. Upon both radicals scavenging, the A/B for the ferulic acid or chlorogenic acid

Catalyzed oxidation reactions. IV. Picolinic acid catalysis of chromic acid oxidations

International Nuclear Information System (INIS)

Rocek, J.; Peng, T.Y.

1977-01-01

Picolinic acid and several closely related acids are effective catalysts in the chromic acid oxidation of primary and secondary alcohols; the oxidation of other substrates is accelerated only moderately. The reaction is first order in chromium-(VI), alcohol, and picolinic acid; it is second order in hydrogen ions at low acidity and approaches acidity independence at high perchloric acid concentrations. A primary deuterium kinetic isotope effect is observed at high but not at low acidities. At low acidity the reaction has a considerably lower activation energy and more negative activation entropy than at higher acidities. The reactive intermediate in the proposed mechanism is a negatively charged termolecular complex formed from chromic acid, picolinic acid, and alcohol. The rate-limiting step of the reaction changes with the acidity of the solution. At higher acidities the intermediate termolecular complex is formed reversibly and the overall reaction rate is determined by the rate of its decomposition into reaction products; at low acidities the formation of the complex is irreversible and hence rate limiting. Picolinic acids with a substituent in the 6 position show a greatly reduced catalytic activity. This observation is interpreted as suggesting a square pyramidal or octahedral structure for the reactive chromium (VI) intermediate. The temperature dependence of the deuterium isotope effect has been determined and the significance of the observed large values for E/sub a//sup D/ - E/sub a//sup H/ and A/sup D//A/sup H/ is discussed

Targeted metabolomics analysis reveals the association between maternal folic acid supplementation and fatty acids and amino acids profiles in rat pups.

Science.gov (United States)

Liu, Zhipeng; Liu, Rui; Chou, Jing; Yu, Jiaying; Liu, Xiaowei; Sun, Changhao; Li, Ying; Liu, Liyan

2018-07-15

Maternal diet during pregnancy can influence offspring's health by affecting development and metabolism. This study aimed to analyze the influence of maternal folic acid (FA) supplementation on the metabolism of rat pups using targeted metabolomics. Twenty female rats were randomly assigned to a FA supplementation (FAS group, n = 10) or control group (n = 10), which were fed AIN93G diet with 2 or 10 mg/kg FA, respectively. We then measured amino acids and their derivatives, biogenic amines, and fatty acids in the female rats and their pups by ultra-high performance liquid chromatography-triple quadrupole mass spectrometry (UHPLC/MS-MS) and gas chromatography-mass spectrometry (GC/MS-MS). In maternal rats, the significant changes of three metabolites (proline, γ-aminobutyric acid and esterified octadecatetraenoic acid, P acids (leucine, isoleucine, serine, proline) were obtained in FAS pups. Furthermore, there were the decreased esterified fatty acids (arachidonic acid, eicosapentaenoic acid, and docosatetraenoic acid) and free fatty acids (oleic acid, linoleic acid, γ-linolenic acid, octadecatetraenoic acid, arachidonic acid, eicosapentaenoic acid and selacholeic acid) in FAS pups. Metabolic changes in the FAS pups were characterized by changes in fatty acids and amino acids. These results suggested that FA supplementation during pregnancy influenced amino acids and fatty acids metabolism in rat pups. This study provides new insights into the regulation of amino acids and fatty acids metabolism during early life. Copyright © 2018 Elsevier B.V. All rights reserved.

Understanding Acid Rain

Science.gov (United States)

Damonte, Kathleen

2004-01-01

The term acid rain describes rain, snow, or fog that is more acidic than normal precipitation. To understand what acid rain is, it is first necessary to know what an acid is. Acids can be defined as substances that produce hydrogen ions (H+), when dissolved in water. Scientists indicate how acidic a substance is by a set of numbers called the pH…

Validation of a multi-analyte HPLC-DAD method for determination of uric acid, creatinine, homovanillic acid, niacinamide, hippuric acid, indole-3-acetic acid and 2-methylhippuric acid in human urine.

Science.gov (United States)

Remane, Daniela; Grunwald, Soeren; Hoeke, Henrike; Mueller, Andrea; Roeder, Stefan; von Bergen, Martin; Wissenbach, Dirk K

2015-08-15

During the last decades exposure sciences and epidemiological studies attracts more attention to unravel the mechanisms for the development of chronic diseases. According to this an existing HPLC-DAD method for determination of creatinine in urine samples was expended for seven analytes and validated. Creatinine, uric acid, homovanillic acid, niacinamide, hippuric acid, indole-3-acetic acid, and 2-methylhippuric acid were separated by gradient elution (formate buffer/methanol) using an Eclipse Plus C18 Rapid Resolution column (4.6mm×100mm). No interfering signals were detected in mobile phase. After injection of blank urine samples signals for the endogenous compounds but no interferences were detected. All analytes were linear in the selected calibration range and a non weighted calibration model was chosen. Bias, intra-day and inter-day precision for all analytes were below 20% for quality control (QC) low and below 10% for QC medium and high. The limits of quantification in mobile phase were in line with reported reference values but had to be adjusted in urine for homovanillic acid (45mg/L), niacinamide 58.5(mg/L), and indole-3-acetic acid (63mg/L). Comparison of creatinine data obtained by the existing method with those of the developed method showing differences from -120mg/L to +110mg/L with a mean of differences of 29.0mg/L for 50 authentic urine samples. Analyzing 50 authentic urine samples, uric acid, creatinine, hippuric acid, and 2-methylhippuric acid were detected in (nearly) all samples. However, homovanillic acid was detected in 40%, niacinamide in 4% and indole-3-acetic acid was never detected within the selected samples. Copyright © 2015 Elsevier B.V. All rights reserved.

Presidential Green Chemistry Challenge: 1996 Designing Greener Chemicals Award

Science.gov (United States)

Presidential Green Chemistry Challenge 1996 award winner, Rohm and Haas, developed Sea-Nine, a marine antifoulant to control plants and animals on ship hulls. Sea-Nine replaces persistent, toxic organotin antifoulants.

Removal of sulfamic acid from plutonium sulfamate--sulfamic acid solution

International Nuclear Information System (INIS)

Gray, L.W.

1978-10-01

Plutonium metal can be readily dissolved in aqueous solutions of sulfamic acid. When the plutonium sulfamate--sulfamic acid solutions are added to normal purex process streams, the sulfamate ion is oxidized by addition of sodium nitrite. This generates sodium sulfate which must be stored as radioactive waste. When recovery of ingrown 241 Am or storage of the dissolved plutonium must be considered, the sulfamate ion poses major and undesirable precipitation problems in the process streams. The present studies show that 40 to 80% of the sulfamate present in the dissolver solutions can be removed by precipitation as sulfamic acid by the addition of concentrated nitric acid. Addition of 64% nitric acid allows precipitation of 40 to 50% of the sulfamate; addition of 72% nitric acid allows precipitation of 50 to 60% of the sulfamate. If the solutions are chilled, additional sulfamic acid will precipitate. If the solutions are chilled to -10 0 C, about 70 to 80% of the orginal sulfamic acid in the dissolver will precipitate. A single, low-volume wash of the sulfamic acid crystals with concentrated nitric acid will decontaminate the crystals to a plutonium content of 5 dis/(min-gram)

Acid-functionalized polyolefin materials and their use in acid-promoted chemical reactions

Science.gov (United States)

Oyola, Yatsandra; Tian, Chengcheng; Bauer, John Christopher; Dai, Sheng

2016-06-07

An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphoric acid groups appended thereto.

Stream chemistry in the eastern United States. 2. Current sources of acidity in acidic and low acid-neutralizing-capacity streams

International Nuclear Information System (INIS)

Herlihy, A.T.; Kaufmann, P.R.; Mitch, M.E.

1991-01-01

The authors examined anion composition in National Stream Survey (NSS) data in order to evaluate the most probable sources of current acidity in acidic and low acid neutralizing capacity (ANC) streams in the eastern United States. Acidic streams that had almost no organic influence (less than 10% of total anions) and sulfate and nitrate concentrations indicative of evaporative concentration of atmospheric deposition were classified as acidic due to acidic deposition. These acidic streams were located in small forested watersheds in the Mid-Atlantic Highlands (an estimated 1950 km of stream length) and in the Mid-Atlantic Coastal Plain (1250 km). Acidic streams affected primarily by acidic deposition but also influenced by naturally occurring organic anions accounted for another 1180 km of acidic stream length and were located in the New Jersey Pine Barrens, plateau tops in the Mid-Atlantic and Southeast Highlands, and the Florida Panhandle. The total length of streams acidic due to acid mine drainage in the NSS (4590 km) was about the same as the total length of acidic streams likely affected by acidic deposition (4380 km). Acidic streams whose acid anion composition was dominated by organics were located in Florida and the Mid-Atlantic Coastal Plain. In Florida, most of the acidic streams were organic dominated, whereas about half of the streams in the Mid-Atlantic Coastal Plain were organic dominated. Organic-dominated acidic streams were not observed in the Mid-Atlantic and Southeast Highlands

15N NMR spectroscopic investigation of nitrous and nitric acids in sulfuric acid solutions of varying acidities

International Nuclear Information System (INIS)

Prakash, G.K.S.; Heiliger, L.; Olah, G.A.

1990-01-01

Both nitrous and nitric acids were studied in sulfuric acid solutions of varying acid strengths by 15 N NMR spectroscopy. The study gives new insights into the nature of intermediates present at different acid strengths. Furthermore, we have also discovered a novel redox reaction between NO 2 + and NO + ions involving the intermediacy of their respective acids. A mechanism is proposed to explain the observed results. 13 refs., 2 figs., 1 tab

Serum n-3 Tetracosapentaenoic Acid and Tetracosahexaenoic Acid Increase Following Higher Dietary α-Linolenic Acid but not Docosahexaenoic Acid.

Science.gov (United States)

Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Lin, Yu-Hong; Bazinet, Richard P

2017-02-01

n-3 Tetracosapentaenoic acid (24:5n-3, TPAn-3) and tetracosahexaenoic acid (24:6n-3, THA) are believed to be important intermediates to docosahexaenoic acid (DHA, 22:6n-3) synthesis. The purpose of this study is to report for the first time serum concentrations of TPAn-3 and THA and their response to changing dietary α-linolenic acid (18:3n-3, ALA) and DHA. The responses will then be used in an attempt to predict the location of these fatty acids in relation to DHA in the biosynthetic pathway. Male Long Evans rats (n = 6 per group) were fed either a low (0.1% of total fatty acids), medium (3%) or high (10%) ALA diet with no added DHA, or a low (0%), medium (0.2%) or high (2%) DHA diet with a background of 2% ALA for 8 weeks post-weaning. Serum n-3 and n-6 polyunsaturated fatty acid (PUFA) concentrations (nmol/mL ± SEM) were determined by gas chromatography-mass spectrometry. Serum THA increases from low (0.3 ± 0.1) to medium (5.8 ± 0.7) but not from medium to high (4.6 ± 0.9) dietary ALA, while serum TPAn-3 increases with increasing dietary ALA from 0.09 ± 0.04 to 0.70 ± 0.09 to 1.23 ± 0.14 nmol/mL. Following DHA feeding, neither TPAn-3 or THA change across all dietary DHA intake levels. Serum TPAn-3 demonstrates a similar response to dietary DHA. In conclusion, this is the first study to demonstrate that increases in dietary ALA but not DHA increase serum TPAn-3 and THA in rats, suggesting that both fatty acids are precursors to DHA in the biosynthetic pathway.

Parabanic acid is the singlet oxygen specific oxidation product of uric acid.

Science.gov (United States)

Iida, Sayaka; Ohkubo, Yuki; Yamamoto, Yorihiro; Fujisawa, Akio

2017-11-01

Uric acid quenches singlet oxygen physically or reacts with it, but the oxidation product has not been previously characterized. The present study determined that the product is parabanic acid, which was confirmed by LC/TOFMS analysis. Parabanic acid was stable at acidic pH (acid at neutral or alkaline pH. The total yields of parabanic acid and oxaluric acid based on consumed uric acid were ~100% in clean singlet oxygen production systems such as UVA irradiation of Rose Bengal and thermal decomposition of 3-(1,4-dihydro-1,4-epidioxy-4-methyl-1-naphthyl)propionic acid. However, the ratio of the amount of uric acid consumed to the total amount of singlet oxygen generated was less than 1/180, indicating that most of the singlet oxygen was physically quenched. The total yields of parabanic acid and oxaluric acid were high in the uric acid oxidation systems with hydrogen peroxide plus hypochlorite or peroxynitrite. They became less than a few percent in peroxyl radical-, hypochlorite- or peroxynitrite-induced oxidation of uric acid. These results suggest that parabanic acid could be an in vivo probe of singlet oxygen formation because of the wide distribution of uric acid in human tissues and extracellular spaces. In fact, sunlight exposure significantly increased human skin levels of parabanic acid.

A GC-ECD method for estimation of free and bound amino acids, gamma-aminobutyric acid, salicylic acid, and acetyl salicylic acid from Solanum lycopersicum (L.).

Science.gov (United States)

Meher, Hari Charan; Gajbhiye, Vijay T; Singh, Ghanendra

2011-01-01

A gas chromatograph with electron capture detection method for estimation of selected metabolites--amino acids (free and bound), gamma-aminobutyric acid (GABA), salicylic acid (SA), and acetyl salicylic acid (ASA) from tomato--is reported. The method is based on nitrophenylation of the metabolites by 1-fluoro-2, 4-dinitrobenzene under aqueous alkaline conditions to form dinitophenyl derivatives. The derivatives were stable under the operating conditions of GC. Analysis of bound amino acids comprised perchloric acid precipitation of protein, alkylation (carboxymethylation) with iodoacetic acid, vapor-phase hydrolysis, and derivatization with 1-fluoro-2,4-dinitrobenzene in that order. The metabolites were resolved in 35 min, using a temperature-programmed run. The method is rapid, sensitive, and precise. It easily measured the typical amino acids (aspartate, asparagine, glutamate, glutamine, alanine, leucine, lysine, and phenylalanine) used for identification and quantification of a protein, resolved amino acids of the same mass (leucine and isoleucine), satisfactorily measured sulfur amino acid (methionine, cystine, and cysteine), and quantified GABA, SA, and ASA, as well. The developed method was validated for specificity, linearity, and precision. It has been applied and recommended for estimation of 25 metabolites from Solanum lycopersicum (L.).

Synthesis and anticonvulsant activity of novel bicyclic acidic amino acids

DEFF Research Database (Denmark)

Conti, Paola; De Amici, Marco; Joppolo Di Ventimiglia, Samuele

2003-01-01

Bicyclic acidic amino acids (+/-)-6 and (+/-)-7, which are conformationally constrained homologues of glutamic acid, were prepared via a strategy based on a 1,3-dipolar cycloaddition. The new amino acids were tested toward ionotropic and metabotropic glutamate receptor subtypes; both of them...

Crystal growth and physical characterization of picolinic acid cocrystallized with dicarboxylic acids

Science.gov (United States)

Somphon, Weenawan; Haller, Kenneth J.

2013-01-01

Pharmaceutical cocrystals are multicomponent materials containing an active pharmaceutical ingredient with another component in well-defined stoichiometry within the same unit cell. Such cocrystals are important in drug design, particularly for improving physicochemical properties such as solubility, bioavailability, or chemical stability. Picolinic acid is an endogenous metabolite of tryptophan and is widely used for neuroprotective, immunological, and anti-proliferative effects within the body. In this paper we present cocrystallization experiments of a series of dicarboxylic acids, oxalic acid, succinic acid, DL-tartaric acid, pimelic acid, and phthalic acid, with picolinic acid. Characterization by FT-IR and Raman spectroscopy, DSC and TG/DTG analysis, and X-ray powder diffraction show that new compounds are formed, including a 1:1 picolinium tartrate monohydrate, a 2:1 monohydrate adduct of picolinic acid and oxalic acid, and a 2:1 picolinic acid-succinic acid monohydrate cocrystal.

40 CFR 721.3620 - Fatty acid amine condensate, polycarboxylic acid salts.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Fatty acid amine condensate... Specific Chemical Substances § 721.3620 Fatty acid amine condensate, polycarboxylic acid salts. (a... a fatty acid amine condensate, polycarboxylic acid salts. (PMN P-92-445) is subject to reporting...

Bifidobacterium breve with α-linolenic acid and linoleic acid alters fatty acid metabolism in the maternal separation model of irritable bowel syndrome.

Science.gov (United States)

Barrett, Eoin; Fitzgerald, Patrick; Dinan, Timothy G; Cryan, John F; Ross, R Paul; Quigley, Eamonn M; Shanahan, Fergus; Kiely, Barry; Fitzgerald, Gerald F; O'Toole, Paul W; Stanton, Catherine

2012-01-01

The aim of this study was to compare the impact of dietary supplementation with a Bifidobacterium breve strain together with linoleic acid & α-linolenic acid, for 7 weeks, on colonic sensitivity and fatty acid metabolism in rats. Maternally separated and non-maternally separated Sprague Dawley rats (n = 15) were orally gavaged with either B. breve DPC6330 (10(9) microorganisms/day) alone or in combination with 0.5% (w/w) linoleic acid & 0.5% (w/w) α-linolenic acid, daily for 7 weeks and compared with trehalose and bovine serum albumin. Tissue fatty acid composition was assessed by gas-liquid chromatography and visceral hypersensitivity was assessed by colorectal distension. Significant differences in the fatty acid profiles of the non-separated controls and maternally separated controls were observed for α-linolenic acid and arachidonic acid in the liver, oleic acid and eicosenoic acid (c11) in adipose tissue, and for palmitoleic acid and docosahexaenoic acid in serum (pbreve DPC6330 to MS rats significantly increased palmitoleic acid, arachidonic acid and docosahexaenoic acid in the liver, eicosenoic acid (c11) in adipose tissue and palmitoleic acid in the prefrontal cortex (pbreve DPC6330 to non separated rats significantly increased eicosapentaenoic acid and docosapentaenoic acid in serum (pbreve DPC6330 in combination with linoleic acid and α-linolenic acid to maternally separated rats significantly increased docosapentaenoic acid in the serum (pbreve DPC6330 with fatty acid supplementation to non-separated rats significantly increased liver and serum docosapentaenoic acid (pbreve DPC6330 influenced host fatty acid metabolism. Administration of B. breve DPC6330 to maternally separated rats significantly modified the palmitoleic acid, arachidonic acid and docosahexaenoic acid contents in tissues. The effect was not observed in non-separated animals.

Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia

International Nuclear Information System (INIS)

Kolpa, R.; Smith, K.

1993-07-01

This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA

Preliminary assessment report for Army Aviation Support Facility No. 3, Installation 13307, Hunter Army Airfield, Savannah, Georgia. Installation Restoration Program

Energy Technology Data Exchange (ETDEWEB)

Kolpa, R.; Smith, K.

1993-07-01

This report presents the results of the preliminary assessment (PA) conducted by Argonne National Laboratory at the Georgia Army National Guard property located on Hunter Army Airfield (HAA) near Savannah, Georgia, known as Army Aviation Support Facility (AASF) No. 3. Preliminary assessments of federal facilities are being conducted to compile the information necessary for completing preremedial activities and to provide a basis for establishing corrective actions in response to releases of hazardous substances. The principal objective of the PA is to characterize the site accurately and determine the need for further action by examining site activities, types and quantities of hazardous substances utilized, the nature and amounts of wastes generated or stored at the facility, and potential pathways by which contamination could affect public health and the environment. This PA satisfies, for the AASF No. 3 property, requirements of the Department of Defense Installation Restoration Program (IRP). The scope of this assessment is limited to the facilities and past activities contained within the area now occupied by AASF No. 3. However, this assessment report is intended to be read in conjunction with a previous IRP assessment of HAA completed in 1992 (USATHAMA 1992) and to provide comprehensive information on AASF No. 3 for incorporation with information contained in that previous assessment for the entirety of HAA.

A novel approach in acidic disinfection through inhibition of acid resistance mechanisms; Maleic acid-mediated inhibition of glutamate decarboxylase activity enhances acid sensitivity of Listeria monocytogenes.

Science.gov (United States)

Paudyal, Ranju; Barnes, Ruth H; Karatzas, Kimon Andreas G

2018-02-01

Here it is demonstrated a novel approach in disinfection regimes where specific molecular acid resistance systems are inhibited aiming to eliminate microorganisms under acidic conditions. Despite the importance of the Glutamate Decarboxylase (GAD) system for survival of Listeria monocytogenes and other pathogens under acidic conditions, its potential inhibition by specific compounds that could lead to its elimination from foods or food preparation premises has not been studied. The effects of maleic acid on the acid resistance of L. monocytogenes were investigated and found that it has a higher antimicrobial activity under acidic conditions than other organic acids, while this could not be explained by its pKa or Ka values. The effects were found to be more pronounced on strains with higher GAD activity. Maleic acid affected the extracellular GABA levels while it did not affect the intracellular ones. Maleic acid had a major impact mainly on GadD2 activity as also shown in cell lysates. Furthermore, it was demonstrated that maleic acid is able to partly remove biofilms of L. monocytogenes. Maleic acid is able to inhibit the GAD of L. monocytogenes significantly enhancing its sensitivity to acidic conditions and together with its ability to remove biofilms, make a good candidate for disinfection regimes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Acid Deposition Phenomena

International Nuclear Information System (INIS)

Ramadan, A.E.K.

2004-01-01

Acid deposition, commonly known as acid rain, occurs when emissions from the combustion of fossil fuels and other industrial processes undergo complex chemical reactions in the atmosphere and fall to the earth as wet deposition (rain, snow, cloud, fog) or dry deposition (dry particles, gas). Rain and snow are already naturally acidic, but are only considered problematic when less than a ph of 5.0 The main chemical precursors leading to acidic conditions are atmospheric concentrations of sulfur dioxide (SO 2 ) and nitrogen oxides (NO x ). When these two compounds react with water, oxygen, and sunlight in the atmosphere, the result is sulfuric (H 2 SO 4 ) and nitric acids (HNO 3 ), the primary agents of acid deposition which mainly produced from the combustion of fossil fuel and from petroleum refinery. Airborne chemicals can travel long distances from their sources and can therefore affect ecosystems over broad regional scales and in locations far from the sources of emissions. According to the concern of petroleum ministry with the environment and occupational health, in this paper we will discussed the acid deposition phenomena through the following: Types of acidic deposition and its components in the atmosphere Natural and man-made sources of compounds causing the acidic deposition. Chemical reactions causing the acidic deposition phenomenon in the atmosphere. Factors affecting level of acidic deposition in the atmosphere. Impact of acid deposition. Procedures for acidic deposition control in petroleum industry

Bifidobacterium breve with α-linolenic acid and linoleic acid alters fatty acid metabolism in the maternal separation model of irritable bowel syndrome.

Directory of Open Access Journals (Sweden)

Eoin Barrett

Full Text Available The aim of this study was to compare the impact of dietary supplementation with a Bifidobacterium breve strain together with linoleic acid & α-linolenic acid, for 7 weeks, on colonic sensitivity and fatty acid metabolism in rats. Maternally separated and non-maternally separated Sprague Dawley rats (n = 15 were orally gavaged with either B. breve DPC6330 (10(9 microorganisms/day alone or in combination with 0.5% (w/w linoleic acid & 0.5% (w/w α-linolenic acid, daily for 7 weeks and compared with trehalose and bovine serum albumin. Tissue fatty acid composition was assessed by gas-liquid chromatography and visceral hypersensitivity was assessed by colorectal distension. Significant differences in the fatty acid profiles of the non-separated controls and maternally separated controls were observed for α-linolenic acid and arachidonic acid in the liver, oleic acid and eicosenoic acid (c11 in adipose tissue, and for palmitoleic acid and docosahexaenoic acid in serum (p<0.05. Administration of B. breve DPC6330 to MS rats significantly increased palmitoleic acid, arachidonic acid and docosahexaenoic acid in the liver, eicosenoic acid (c11 in adipose tissue and palmitoleic acid in the prefrontal cortex (p<0.05, whereas feeding B. breve DPC6330 to non separated rats significantly increased eicosapentaenoic acid and docosapentaenoic acid in serum (p<0.05 compared with the NS un-supplemented controls. Administration of B. breve DPC6330 in combination with linoleic acid and α-linolenic acid to maternally separated rats significantly increased docosapentaenoic acid in the serum (p<0.01 and α-linolenic acid in adipose tissue (p<0.001, whereas feeding B. breve DPC6330 with fatty acid supplementation to non-separated rats significantly increased liver and serum docosapentaenoic acid (p<0.05, and α-linolenic acid in adipose tissue (p<0.001. B. breve DPC6330 influenced host fatty acid metabolism. Administration of B. breve DPC6330 to maternally separated

Aminocaproic Acid and Tranexamic Acid Fail to Reverse Dabigatran-Induced Coagulopathy.

Science.gov (United States)

Levine, Michael; Huang, Margaret; Henderson, Sean O; Carmelli, Guy; Thomas, Stephen H

In recent years, dabigatran has emerged as a popular alternative to warfarin for treatment of atrial fibrillation. If rapid reversal is required, however, no reversal agent has clearly been established. The primary purpose of this manuscript was to evaluate the efficacy of tranexamic acid and aminocaproic acid as agents to reverse dabigatran-induced coagulopathy. Rats were randomly assigned to 6 groups. Each rat received either dabigatran or oral placebo, followed by saline, tranexamic acid, or aminocaproic acid. An activated clotting test was used to measure the coagulopathy. Neither tranexamic acid nor aminocaproic acid successfully reversed dabigatran-induced coagulopathy. In this rodent model of dabigatran-induced coagulopathy, neither tranexamic acid nor aminocaproic acid were able to reverse the coagulopathy.

Acidizing reservoirs while chelating iron with sulfosalicylic acid

Energy Technology Data Exchange (ETDEWEB)

McLaughlin, W A; Berkshire, D C

1980-09-30

A well treating process is described in which an aqueous solution of a strong acid capable of dissolving solids in a manner increasing the permeability of a subterranean earth formation is injected into a subterranean reservoir that contains an asphaltenic oil. At least the first injected portion of the aqueous acid and a solution or homogeneous dispersion of at least enough 5-sulfosalicylic acid to chelate with and prevent the formation of iron-asphaltene solids are included with substantially all of the ferric ions that become dissolved within the strong acid solution that enters the earth formation. 10 claims.

de Fusarium isolé du fruit de tomate (Solanum lycopersicum L ...

African Journals Online (AJOL)

Dina

A phytopathogenic fungus Fusarium F-02 is isolated from rotten tomato fruit. ..... between Trichoderma harzianum and Pythium ultimum”. .... [31] - HAAS, and C. KEEL, “Regulation of antibiotic production in root-colonizing Pseudomonas spp.

Acids and bases solvent effects on acid-base strenght

CERN Document Server

Cox, Brian G

2013-01-01

Acids and bases are ubiquitous in chemistry. Our understanding of them, however, is dominated by their behaviour in water. Transfer to non-aqueous solvents leads to profound changes in acid-base strengths and to the rates and equilibria of many processes: for example, synthetic reactions involving acids, bases and nucleophiles; isolation of pharmaceutical actives through salt formation; formation of zwitter- ions in amino acids; and chromatographic separation of substrates. This book seeks to enhance our understanding of acids and bases by reviewing and analysing their behaviour in non-aqueous solvents. The behaviour is related where possible to that in water, but correlations and contrasts between solvents are also presented.

Alkyl phosphonic acids and sulfonic acids in the Murchison meteorite

Science.gov (United States)

Cooper, George W.; Onwo, Wilfred M.; Cronin, John R.

1992-01-01

Homologous series of alkyl phosphonic acids and alkyl sulfonic acids, along with inorganic orthophosphate and sulfate, are identified in water extracts of the Murchison meteorite after conversion to their t-butyl dimethylsilyl derivatives. The methyl, ethyl, propyl, and butyl compounds are observed in both series. Five of the eight possible alkyl phosphonic acids and seven of the eight possible alkyl sulfonic acids through C4 are identified. Abundances decrease with increasing carbon number as observed of other homologous series indigenous to Murchison. Concentrations range downward from approximately 380 nmol/gram in the alkyl sulfonic acid series, and from 9 nmol/gram in the alkyl phosphonic acid series.

21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Fumaric acid and salts of fumaric acid. 172.350... HUMAN CONSUMPTION Special Dietary and Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous, magnesium, potassium, and sodium salts may be safely used...

Heart and bile acids - Clinical consequences of altered bile acid metabolism.

Science.gov (United States)

Vasavan, Tharni; Ferraro, Elisa; Ibrahim, Effendi; Dixon, Peter; Gorelik, Julia; Williamson, Catherine

2018-04-01

Cardiac dysfunction has an increased prevalence in diseases complicated by liver cirrhosis such as primary biliary cholangitis and primary sclerosing cholangitis. This observation has led to research into the association between abnormalities in bile acid metabolism and cardiac pathology. Approximately 50% of liver cirrhosis cases develop cirrhotic cardiomyopathy. Bile acids are directly implicated in this, causing QT interval prolongation, cardiac hypertrophy, cardiomyocyte apoptosis and abnormal haemodynamics of the heart. Elevated maternal serum bile acids in intrahepatic cholestasis of pregnancy, a disorder which causes an impaired feto-maternal bile acid gradient, have been associated with fatal fetal arrhythmias. The hydrophobicity of individual bile acids in the serum bile acid pool is of relevance, with relatively lipophilic bile acids having a more harmful effect on the heart. Ursodeoxycholic acid can reverse or protect against these detrimental cardiac effects of elevated bile acids. Copyright © 2018 Elsevier B.V. All rights reserved.

Docosahexaenoic Acid-Derived Fatty Acid Esters of Hydroxy Fatty Acids (FAHFAs) With Anti-inflammatory Properties.

Science.gov (United States)

Kuda, Ondrej; Brezinova, Marie; Rombaldova, Martina; Slavikova, Barbora; Posta, Martin; Beier, Petr; Janovska, Petra; Veleba, Jiri; Kopecky, Jan; Kudova, Eva; Pelikanova, Terezie; Kopecky, Jan

2016-09-01

White adipose tissue (WAT) is a complex organ with both metabolic and endocrine functions. Dysregulation of all of these functions of WAT, together with low-grade inflammation of the tissue in obese individuals, contributes to the development of insulin resistance and type 2 diabetes. n-3 polyunsaturated fatty acids (PUFAs) of marine origin play an important role in the resolution of inflammation and exert beneficial metabolic effects. Using experiments in mice and overweight/obese patients with type 2 diabetes, we elucidated the structures of novel members of fatty acid esters of hydroxy fatty acids-lipokines derived from docosahexaenoic acid (DHA) and linoleic acid, which were present in serum and WAT after n-3 PUFA supplementation. These compounds contained DHA esterified to 9- and 13-hydroxyoctadecadienoic acid (HLA) or 14-hydroxydocosahexaenoic acid (HDHA), termed 9-DHAHLA, 13-DHAHLA, and 14-DHAHDHA, and were synthesized by adipocytes at concentrations comparable to those of protectins and resolvins derived from DHA in WAT. 13-DHAHLA exerted anti-inflammatory and proresolving properties while reducing macrophage activation by lipopolysaccharides and enhancing the phagocytosis of zymosan particles. Our results document the existence of novel lipid mediators, which are involved in the beneficial anti-inflammatory effects attributed to n-3 PUFAs, in both mice and humans. © 2016 by the American Diabetes Association.

Studies on the complexes of uranium(IV), thorium(IV) and lanthanum(III) acetates with p-aminobenzoic acid, m-aminobenzoic acid, benzilic acid and phthalic acid

International Nuclear Information System (INIS)

Singh, Mangal; Singh, Ajaib

1979-01-01

Complexes of acetates of U(IV), Th(IV) and La(III) with the ligands p-aminobenzoic acid, m-aminobenzoic acid, benzilic acid and phthalic acid have been prepared. Colour and chemical analytical data are recorded. They are characterised on the basis of IR and reflectance spectra and magnetic susceptibility data. (M.G.B.)

Incorporation of oxygen into abscisic acid and phaseic acid for molecular oxygen

International Nuclear Information System (INIS)

Creelman, R.A.; Zeevaart, J.A.D.

1984-01-01

Abscisic acid accumulates in detached, wilted leaves of Xanthium strumariu. When these leaves are subsequently rehydrated, phaseic acid, a catabolite of abscisic acid, accumulates. Analysis by gas chromatography-mass spectrometry of phaseic acid isolated from stressed and subsequently rehydrated leaves placed in an atmosphere containing 20% 18 O 2 and 80% N 2 indicates that one atom of 18 O is incorporated in the 6'-hydroxymethyl group of phaseic acid. This suggests that the enzyme that converts abscisic acid to phaseic acid is an oxygenase. Analysis by gas chromatography-mass spectrometry of abscisic acid isolated from stressed leaves kept in an atmosphere containing 18 O 2 indicates that one atom of 18 O is presented in the carboxyl group of abscisic acid. Thus, when abscisic acid accumulates in water-streesed leaves, only one of the four oxygens present in the abscisic acid molecule is derived from molecular oxygen. This suggest that either (a) the oxygen present in the 1'-, 4'-, and one of the two oxygens at the 1-position of abscisic acid arise from water, or (b) there exists a stored precursor with oxygen atoms already present in the 1'- and 4'-positions of abscisic acid which is converted to abscisic acid under conditions of water stress. 17 references, 2 figures, 1 tables

Incorporation of oxygen into abscisic Acid and phaseic Acid from molecular oxygen.

Science.gov (United States)

Creelman, R A; Zeevaart, J A

1984-05-01

Abscisic acid accumulates in detached, wilted leaves of Xanthium strumarium. When these leaves are subsequently rehydrated, phaseic acid, a catabolite of abscisic acid, accumulates. Analysis by gas chromatography-mass spectrometry of phaseic acid isolated from stressed and subsequently rehydrated leaves placed in an atmosphere containing 20% (18)O(2) and 80% N(2) indicates that one atom of (18)O is incorporated in the 6'-hydroxymethyl group of phaseic acid. This suggests that the enzyme that converts abscisic acid to phaseic acid is an oxygenase.Analysis by gas chromatography-mass spectrometry of abscisic acid isolated from stressed leaves kept in an atmosphere containing (18)O(2) indicates that one atom of (18)O is present in the carboxyl group of abscisic acid. Thus, when abscisic acid accumulates in water-stressed leaves, only one of the four oxygens present in the abscisic acid molecule is derived from molecular oxygen. This suggests that either (a) the oxygen present in the 1'-, 4'-, and one of the two oxygens at the 1-position of abscisic acid arise from water, or (b) there exists a stored precursor with oxygen atoms already present in the 1'- and 4'-positions of abscisic acid which is converted to abscisic acid under conditions of water stress.

Kolmekesi ühest Peipsi-äärsest asjast / Tiit Lepp

Index Scriptorium Estoniae

Lepp, Tiit

2007-01-01

Annika Haasi, Birgit Püve ja Age Petersoni fotonäitus "Prichudie, Revisited" Peipsiääre valla inimestest ja elust-olust kunstikeskuses AmbulARToorium Tartumaaal. Kommenteerinud Annika Haas, Birgit Püve, Age Peterson

Amino acid and fatty acid compositions of Rusip from fermented Anchovy fish (Stolephorussp)

Science.gov (United States)

Koesoemawardani, D.; Hidayati, S.; Subeki

2018-04-01

Rusip is a typical food of Bangka Belitung Indonesia made from fermented anchovy. This study aims to determine the properties of chemistry, microbiology, composition of amino acids and fatty acids from fermented fish spontaneously and non spontaneously. Spontaneous rusip treatment is done by anchovy fish (Stolephorussp) after cleaning and added salt 25% (w/w) and palm sugar 10% (w/w). While, non-spontaneous rusip is done by adding a culture mixture of Streptococcus, Leuconostoc, and Lactobacillus bacteria 2% (w/v). The materials are then incubated for 2 weeks. The data obtained were then performed t-test at the level of 5%. Spontaneous and non-spontaneous rusip fermentation process showed significant differences in total acid, reducing sugar, salt content, TVN, total lactic acid bacteria, total mold, and total microbial. The dominant amino acid content of spontaneous and non-spontaneous rusip are glutamic acid and aspartic acid, while the dominant fatty acids in spontaneous and non-spontaneous rusip are docosahexaenoic acid, palmitic acid, oleic acid, arachidonic acid, stearic acid, eicosapentaenoic acid, palmitoleic acid, and myristic acid.

Requirements on the provisional safety analyses and technical comparison of safety measures

International Nuclear Information System (INIS)

2010-04-01

The concept of a Geological Underground Repository (SGT) was adopted by the Swiss Federal Council on April 2 nd , 2008. It fixes the goals and the safety technical criteria as well as the procedures for the choice of the site for an underground repository. Those responsible for waste management evaluate possible site regions according to the present status of geological knowledge and based on the safety criteria defined in SGT as well as on technical feasibility. In a first step, they propose geological repository sites for high level (HAA) and for low and intermediate level (SMA) radioactive wastes and justify their choice in a report delivered to the Swiss Federal Office of Energy. The Swiss Federal Council reviews the choices presented and, in the case of positive evaluation, approves them and considers them as an initial orientation. In a second step, based on the possible sites according to step 1, the waste management institution responsible has to reduce the repositories chosen for HAA and SMA by taking into account safety aspects, technical feasibility as well as space planning and socio-economical aspects. In making this choice, safety aspects have the highest priority. The criteria used for the evaluation in the first step have to be defined using provisional quantitative safety analyses. On the basis of the whole appraisal, including space planning and socio-economical aspects, those responsible for waste management propose at least two repository sites for HAA- and SMA-waste. Their selection is then reviewed by the authorities and, in the case of a positive assesment, the selection is taken as an intermediate result. The remaining sites are further studied to examine site choice and the delivery of a request for a design license. If necessary, the requested geological knowledge has to be confirmed by new investigations. Based on the results of the choosing process and a positive evaluation by the safety authorities, the Swiss Federal Council has to

Stimulation of apical sodium-dependent bile acid transporter expands the bile acid pool and generates bile acids with positive feedback properties.

Science.gov (United States)

Rudling, Mats; Bonde, Ylva

2015-01-01

Bile acid synthesis has been considered a prototype for how a physiological process is controlled by end product feedback inhibition. By this feedback inhibition, bile acid concentrations are kept within safe ranges. However, careful examination of published rodent data strongly suggests that bile acid synthesis is also under potent positive feedback control by hydrophilic bile acids. Current concepts on the regulation of bile acid synthesis are derived from mouse models. Recent data have shown that mice have farnesoid X receptor (FXR) antagonistic bile acids capable of quenching responses elicited by FXR agonistic bile acids. This is important to recognize to understand the regulation of bile acid synthesis in the mouse, and in particular to clarify if mouse model findings are valid also in the human situation. In addition to classic end product feedback inhibition, regulation of bile acid synthesis in the mouse largely appears also to be driven by changes in hepatic levels of murine bile acids such as α- and β-muricholic acids. This has not been previously recognized. Stimulated bile acid synthesis or induction of the apical sodium-dependent bile acid transporter in the intestine, increase the availability of chenodeoxycholic acid in the liver, thereby promoting hepatic conversion of this bile acid into muricholic acids. Recognition of these mechanisms is essential for understanding the regulation of bile acid synthesis in the mouse, and for our awareness of important species differences in the regulation of bile acid synthesis in mice and humans. 2015 S. Karger AG, Basel.

Increased Bile Acid Synthesis and Impaired Bile Acid Transport in Human Obesity

OpenAIRE

Haeusler, Rebecca A.; Camastra, Stefania; Nannipieri, Monica; Astiarraga, Brenno; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Ferrannini, Ele

2015-01-01

We measured plasma bile acids, markers of bile acid synthesis, and expression of bile acid transporters in obese and nonobese subjects. We found that obesity was associated with increased bile acid synthesis and 12-hydroxylation, blunted response of plasma bile acids to insulin infusion or a mixed meal, and decreased expression of liver bile acid transporters.

21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and as...

Transformation of chenodeoxycholic acid to ursodeoxycholic acid in patients with Crohn's disease

International Nuclear Information System (INIS)

Miwa, H.; Yamamoto, M.; Nishida, T.; Yao, T.

1986-01-01

In vivo 7 beta-epimerization of chenodeoxycholic acid to ursodeoxycholic acid and the role of 7-ketolithocholic acid as an intermediate in this biotransformation were studied in 11 patients with Crohn's disease and in 5 healthy volunteers. The incorporation of deuterium into biliary ursodeoxycholic acid and 7-ketolithocholic acid was determined by computed gas chromatography-mass fragmentography after ingestion of a dideuterated chenodeoxycholic acid, chenodeoxycholic-11,12-d2 acid. The incorporation of deuterium into ursodeoxycholic acid increased to a peak level at 48 h in the patients with Crohn's disease, but was delayed in healthy volunteers. In 8 patients and 2 healthy controls there were small amounts of 7-ketolithocholic acid in bile. The incorporation of deuterium into 7-ketolithocholic acid was confirmed in only 2 patients and the peak level was noted at 48 h. These observations suggest that 7-ketolithocholic acid is an intermediate of this biotransformation in patients with Crohn's disease

Proximate composition, amino acid and fatty acid composition of fish maws.

Science.gov (United States)

Wen, Jing; Zeng, Ling; Xu, Youhou; Sun, Yulin; Chen, Ziming; Fan, Sigang

2016-01-01

Fish maws are commonly recommended and consumed in Asia over many centuries because it is believed to have some traditional medical properties. This study highlights and provides new information on the proximate composition, amino acid and fatty acid composition of fish maws of Cynoscion acoupa, Congresox talabonoides and Sciades proops. The results indicated that fish maws were excellent protein sources and low in fat content. The proteins in fish maws were rich in functional amino acids (FAAs) and the ratio of FAAs and total amino acids in fish maws ranged from 0.68 to 0.69. Among species, croaker C. acoupa contained the most polyunsaturated fatty acids, arachidonic acid, docosahexaenoic acid and eicosapntemacnioc acid, showing the lowest value of index of atherogenicity and index of thrombogenicity, showing the highest value of hypocholesterolemic/hypercholesterolemic ratio, which is the most desirable.

A Glutamic Acid-Producing Lactic Acid Bacteria Isolated from Malaysian Fermented Foods

Science.gov (United States)

Zareian, Mohsen; Ebrahimpour, Afshin; Bakar, Fatimah Abu; Mohamed, Abdul Karim Sabo; Forghani, Bita; Ab-Kadir, Mohd Safuan B.; Saari, Nazamid

2012-01-01

l-glutamaic acid is the principal excitatory neurotransmitter in the brain and an important intermediate in metabolism. In the present study, lactic acid bacteria (218) were isolated from six different fermented foods as potent sources of glutamic acid producers. The presumptive bacteria were tested for their ability to synthesize glutamic acid. Out of the 35 strains showing this capability, strain MNZ was determined as the highest glutamic-acid producer. Identification tests including 16S rRNA gene sequencing and sugar assimilation ability identified the strain MNZ as Lactobacillus plantarum. The characteristics of this microorganism related to its glutamic acid-producing ability, growth rate, glucose consumption and pH profile were studied. Results revealed that glutamic acid was formed inside the cell and excreted into the extracellular medium. Glutamic acid production was found to be growth-associated and glucose significantly enhanced glutamic acid production (1.032 mmol/L) compared to other carbon sources. A concentration of 0.7% ammonium nitrate as a nitrogen source effectively enhanced glutamic acid production. To the best of our knowledge this is the first report of glutamic acid production by lactic acid bacteria. The results of this study can be further applied for developing functional foods enriched in glutamic acid and subsequently γ-amino butyric acid (GABA) as a bioactive compound. PMID:22754309

Acetic acid extraction from aqueous solutions using fatty acids

NARCIS (Netherlands)

IJmker, H.M.; Gramblicka, M.; Kersten, Sascha R.A.; van der Ham, Aloysius G.J.; Schuur, Boelo

2014-01-01

A major challenge for production of acetic acid via bio-based routes is cost-effective concentration and purification of the acetic acid from the aqueous solutions, for which liquid–liquid extraction is a possible method. A main challenge in extraction of acetic acid from dilute aqueous solutions is

Nucleic acid-binding glycoproteins which solubilize nucleic acids in dilute acid: re-examination of the Ustilago maydis glycoproteins

Energy Technology Data Exchange (ETDEWEB)

Unrau, P.; Champ, D.R.; Young, J.L.; Grant, C.E.

1980-01-01

Holloman reported the isolation from Ustilago maydis of a glycoprotein which prevented the precipitation of nucleic acids in cold 5% trichloroacetic acid. Two glycoprotein fractions from U. maydis with this nucleic acid-solubilizing activity were isolated in our laboratory using improved purification procedures. The activity was not due to nuclease contamination. The glycoproteins are distinguished by: their ability to bind to concanavalin A-Sepharose; their differential binding to double- and single-stranded deoxyribonucleic acid, and to ribonucleic acid; their molecular weights (46,000 and 69,000); and the relative amounts present in growing versus nongrowing cells. Both fractions required sulfhydryl-reducing conditions for optimal yields, specific activity, and stability. Nucleic acid binding was cooperative, the minimum number of glycoproteins required to make a native T7 DNA molecule soluble in dilute acid being estimated at 2 and 15, respectively.

Docosahexaenoic acid affects arachidonic acid uptake in megakaryocytes

International Nuclear Information System (INIS)

Schick, P.K.; Webster, P.

1987-01-01

Dietary omega 3 fatty acids are thought to prevent atherosclerosis, possibly by modifying platelet (PT) function and arachidonic acid (20:4) metabolism. The study was designed to determine whether omega 3 fatty acids primarily affect 20:4 metabolism in megakaryocytes (MK), bone marrow precursors of PT, rather than in circulating PT. MK and PT were isolated from guinea pigs and incubated with [ 14 C]-20:4 (0.13uM). Docosahexaenoic acid (22:6) is a major omega 3 fatty acid in marine oils. The incubation of MK with 22:6 (0.1, 1.0 uM) resulted in the decrease of incorporation of [ 14 C]-20:4 into total MK phospholipids, 16% and 41% respectively. Alpha-linolenic acid (18:3), a major omega 3 fatty acid present in American diets, had no effect on 20:4 uptake in MK. 22:6 primarily affected the uptake of [ 14 C]-20:4 into phosphatidylethanolamine (PE) and phosphatidylserine (PS) in MK. In MK, 22:6 (0.1, 1.0 uM) caused a decrease of incorporation of [ 14 C]-20:4 into PE, 21% and 55% respectively; a decrease into PS, 16% and 48% respectively; but only a decrease of 4% and 18%, respectively, into phosphatidylcholine; and a decrease of 3% and 21% into phosphatidylinositol 22:6 (3.0 uM) had no effect on the uptake of AA into PT phospholipids. The study shows that 22:6 has a selective effect on AA uptake in MK and that the acylation or transacylation of PE and PS are primarily affected. 22:6 and other marine omega 3 fatty acids appear to primarily affect megakaryocytes which may result in the production of platelets with abnormal content and compartmentalization of AA

Quantum magnetotransport for the surface states of three-dimensional topological insulators in the presence of a Zeeman field

KAUST Repository

Tahir, Muhammad; Schwingenschlö gl, Udo

2013-01-01

We show that the surface states of magnetic topological insulators realize an activated behavior and Shubnikov de Haas oscillations. Applying an external magnetic field perpendicular to the surface of the topological insulator in the presence

Transport of acidic amino acids by human jejunal brush-border membrane vesicles

International Nuclear Information System (INIS)

Rajendran, V.M.; Harig, J.M.; Adams, M.B.; Ramaswamy, K.

1987-01-01

This study characterizes the transport of radiolabeled acidic amino acids into brush-border membrane vesicles prepared from human jejunum. The uptakes of L-glutamic, L-aspartic, and D-aspartic acids were stimulated by a Na + gradient. Concentrative uptake (resulting in an overshoot phenomenon) of these dicarboxylic amino acids occurred when there was an outward K + gradient. In addition, increasing K + gradients resulted in enhanced uptake of L-glutamic acid. This K + requirement is somewhat specific as Rb + and Cs + could enhance uptake to a limited extent, whereas Li + and choline + showed no enhancement. The presence of a K + gradient did not affect the affinity of the carrier system for L-glutamic acid but it did increase the V/sub max/. The presence of extravesicular anions having differing membrane permeabilities did not altar L-glutamic acid uptake indicating an absence of an effect of membrane potential on the transport process. Finally, the human transport system for L-glutamic acid appears to be specific for acidic amino acids as demonstrated by inhibition studies. The studies demonstrate a transport system in human jejunum specific for acidic amino acids that is energized by an inward Na + gradient and an outward K + gradient

SYNTHESIS OF FLAVANONE-6-CARBOXYLIC ACID DERIVATIVES FROM SALICYLIC ACID DERIVATIVE

Directory of Open Access Journals (Sweden)

Muhammad Idham Darussalam Mardjan

2012-02-01

Full Text Available Synthesis of flavanone-6-carboxylic acid derivatives had been conducted via the route of chalcone. The synthesis was carried out from salicylic acid derivative, i.e. 4-hydroxybenzoic acid, via esterification, Fries rearrangement, Claisen-Schmidt condensation and 1,4-nucleophilic addition reactions. Structure elucidation of products was performed using FT-IR, 1H-NMR, GC-MS and UV-Vis spectrometers. Reaction of 4-hydroxybenzoic acid with methanol catalyzed with sulfuric acid produced methyl 4-hydroxybenzoate in 87% yield. The acid-catalyzed-acetylation of the product using acetic anhydride gave methyl 4-acetoxybenzoate in 75% yield. Furthermore, solvent-free Fries rearrangement of methyl 4-acetoxybenzoate in the presence of AlCl3 produced 3-acetyl-4-hydroxybenzoic acid as the acetophenone derivatives in 67% yield. Then, Claisen-Schmidt condensation of the acetophenone and benzaldehyde derivatives of p-anisaldehyde and veratraldehyde in basic condition gave 2'-hydroxychalcone-5'-carboxylic acid derivatives  in 81 and 71 % yield, respectively. Finally, the ring closure reaction of the chalcone yielded the corresponding flavanone-6-carboxylic acids in 67 and 59% yield, respectively.

Extraterrestrial material analysis: loss of amino acids during liquid-phase acid hydrolysis

Science.gov (United States)

Buch, Arnaud; Brault, Amaury; Szopa, Cyril; Freissinet, Caroline

2015-04-01

Searching for building blocks of life in extraterrestrial material is a way to learn more about how life could have appeared on Earth. With this aim, liquid-phase acid hydrolysis has been used, since at least 1970 , in order to extract amino acids and other organic molecules from extraterrestrial materials (e.g. meteorites, lunar fines) or Earth analogues (e.g. Atacama desert soil). This procedure involves drastic conditions such as heating samples in 6N HCl for 24 h, either under inert atmosphere/vacuum, or air. Analysis of the hydrolyzed part of the sample should give its total (free plus bound) amino acid content. The present work deals with the influence of the 6N HCl hydrolysis on amino acid degradation. Our experiments have been performed on a standard solution of 17 amino acids. After liquid-phase acid hydrolysis (6N HCl) under argon atmosphere (24 h at 100°C), the liquid phase was evaporated and the dry residue was derivatized with N-Methyl-N-(t-butyldimethylsilyl)trifluoroacetamide (MTBSTFA) and dimethylformamide (DMF), followed by gas chromatography-mass spectrometry analysis. After comparison with derivatized amino acids from the standard solution, a significant reduction of the chromatographic peak areas was observed for most of the amino acids after liquid-phase acid hydrolysis. Furthermore, the same loss pattern was observed when the amino acids were exposed to cold 6N HCl for a short amount of time. The least affected amino acid, i.e. glycine, was found to be 73,93% percent less abundant compared to the non-hydrolyzed standard, while the most affected, i.e. histidine, was not found in the chromatograms after hydrolysis. Our experiments thereby indicate that liquid-phase acid hydrolysis, even under inert atmosphere, leads to a partial or total loss of all of the 17 amino acids present in the standard solution, and that a quick cold contact with 6N HCl is sufficient to lead to a loss of amino acids. Therefore, in the literature, the reported increase

Destruction of organic materials by pressurized microwave digestion

Energy Technology Data Exchange (ETDEWEB)

Schramel, P. (GSF - Research Center for Environment and Health, Inst. of Ecological Chemistry, Neuherberg (Germany)); Hasse, S. (GSF - Research Center for Environment and Health, Inst. of Ecological Chemistry, Neuherberg (Germany))

This paper describes the utility of pressurized microwave digestion (up to 85 bar) for a broad spectrum of organic materials (blood, urine, milk powder, tissues). The 'quality' of the sample solution was tested by the determination of Pb, Cd and Cu (additionally Ni and Co in some of the matrices) by anodic stripping voltammetry (DPASV) and Hydride Generation AAS (HAAS) for As. It is clearly shown that no universal 'cooking recipe' can be given. The necessary oxidation potential is very dependent on the type of organic matrix and therefore the use of acid combinations (HNO[sub 3]/HClO[sub 4]/H[sub 2]SO[sub 4]) is generally necessary to obtain adequate solution of the sample. In some cases the power of the microwave oven was not high enough to digest two samples simultaneoulsy. (Significant differences in the ease of solution are shown in the digestion of one or two samples). Some important improvements for sample preparation, such as moistening the powdered material with water and mixing well with the acid used before closing the digestion vessel etc., are also given. (orig.)

Creation of a Dynamical Stratospheric Turbulence Forecasting and Nowcasting Tool for High Altitude Airships and Other Aircraft

National Research Council Canada - National Science Library

Fritts, David C

2008-01-01

... for which significant wave and turbulence activity may pose an operational or functional risk. The specific goal for MDA purposes was to create a forecasting methodology for turbulence activity at the expected High Altitude Airship (HAA...

Ere täht Britta / Britta Vahur ; interv. Jüri Muttika

Index Scriptorium Estoniae

Vahur, Britta, 1984-

2006-01-01

Rubriigis "elu ühes päevas" TV 3 uues telesarjas "Helena" peaosalist kehastav Britta Vahur endast. Lisaks sarja stsenaristi Marko Lillemägi kirjutatud "Seriaalikangelanna Helena Haas (23)", mis kirjeldab seriaali Helena päeva

Acidic Ionic Liquids.

Science.gov (United States)

Amarasekara, Ananda S

2016-05-25

Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.

"JCE" Classroom Activity #109: My Acid Can Beat Up Your Acid!

Science.gov (United States)

Putti, Alice

2011-01-01

In this guided-inquiry activity, students investigate the ionization of strong and weak acids. Bead models are used to study acid ionization on a particulate level. Students analyze seven strong and weak acid models and make generalizations about the relationship between acid strength and dissociation. (Contains 1 table and 2 figures.)

Metabolic pathways regulated by abscisic acid, salicylic acid and γ-aminobutyric acid in association with improved drought tolerance in creeping bentgrass (Agrostis stolonifera).

Science.gov (United States)

Li, Zhou; Yu, Jingjin; Peng, Yan; Huang, Bingru

2017-01-01

Abscisic acid (ABA), salicylic acid (SA) and γ-aminobutyric acid (GABA) are known to play roles in regulating plant stress responses. This study was conducted to determine metabolites and associated pathways regulated by ABA, SA and GABA that could contribute to drought tolerance in creeping bentgrass (Agrostis stolonifera). Plants were foliar sprayed with ABA (5 μM), GABA (0.5 mM) and SA (10 μM) or water (untreated control) prior to 25 days drought stress in controlled growth chambers. Application of ABA, GABA or SA had similar positive effects on alleviating drought damages, as manifested by the maintenance of lower electrolyte leakage and greater relative water content in leaves of treated plants relative to the untreated control. Metabolic profiling showed that ABA, GABA and SA induced differential metabolic changes under drought stress. ABA mainly promoted the accumulation of organic acids associated with tricarboxylic acid cycle (aconitic acid, succinic acid, lactic acid and malic acid). SA strongly stimulated the accumulation of amino acids (proline, serine, threonine and alanine) and carbohydrates (glucose, mannose, fructose and cellobiose). GABA enhanced the accumulation of amino acids (GABA, glycine, valine, proline, 5-oxoproline, serine, threonine, aspartic acid and glutamic acid) and organic acids (malic acid, lactic acid, gluconic acid, malonic acid and ribonic acid). The enhanced drought tolerance could be mainly due to the enhanced respiration metabolism by ABA, amino acids and carbohydrates involved in osmotic adjustment (OA) and energy metabolism by SA, and amino acid metabolism related to OA and stress-defense secondary metabolism by GABA. © 2016 Scandinavian Plant Physiology Society.

Complexity in Acid-Base Titrations: Multimer Formation Between Phosphoric Acids and Imines.

Science.gov (United States)

Malm, Christian; Kim, Heejae; Wagner, Manfred; Hunger, Johannes

2017-08-10

Solutions of Brønsted acids with bases in aprotic solvents are not only common model systems to study the fundamentals of proton transfer pathways but are also highly relevant to Brønsted acid catalysis. Despite their importance the light nature of the proton makes characterization of acid-base aggregates challenging. Here, we track such acid-base interactions over a broad range of relative compositions between diphenyl phosphoric acid and the base quinaldine in dichloromethane, by using a combination of dielectric relaxation and NMR spectroscopy. In contrast to what one would expect for an acid-base titration, we find strong deviations from quantitative proton transfer from the acid to the base. Even for an excess of the base, multimers consisting of one base and at least two acid molecules are formed, in addition to the occurrence of proton transfer from the acid to the base and simultaneous formation of ion pairs. For equimolar mixtures such multimers constitute about one third of all intermolecular aggregates. Quantitative analysis of our results shows that the acid-base association constant is only around six times larger than that for the acid binding to an acid-base dimer, that is, to an already protonated base. Our findings have implications for the interpretation of previous studies of reactive intermediates in organocatalysis and provide a rationale for previously observed nonlinear effects in phosphoric acid catalysis. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Nocturnal weakly acidic reflux promotes aspiration of bile acids in lung transplant recipients.

Science.gov (United States)

Blondeau, Kathleen; Mertens, Veerle; Vanaudenaerde, Bart A; Verleden, Geert M; Van Raemdonck, Dirk E; Sifrim, Daniel; Dupont, Lieven J

2009-02-01

Gastroesophageal reflux (GER) and aspiration of bile acids have been implicated as non-alloimmune risk factors for the development of bronchiolitis obliterans syndrome (BOS) after lung transplantation. The aim of our study was to investigate the association between GER and gastric aspiration of bile acids and to establish which reflux characteristics may promote aspiration of bile acids into the lungs and may feature as a potential diagnostic tool in identifying lung transplantation (LTx) patients at risk for aspiration. Twenty-four stable LTx recipients were studied 1 year after transplantation. All patients underwent 24-hour ambulatory impedance-pH recording for the detection of acid (pH acidic (pH 4 to 7) reflux. On the same day, bronchoalveolar lavage fluid (BALF) was collected and then analyzed for the presence of bile acids (Bioquant enzymatic assay). Increased GER was detected in 13 patients, of whom 9 had increased acid reflux and 4 had exclusively increased weakly acidic reflux. Sixteen patients had detectable bile acids in the BALF (0.6 [0.4 to 1.5] micromol/liter). The 24-hour esophageal volume exposure was significantly increased in patients with bile acids compared to patients without bile acids in the BALF. Acid exposure and the number of reflux events (total, acid and weakly acidic) were unrelated to the presence of bile acids in the BALF. However, both nocturnal volume exposure and the number of nocturnal weakly acidic reflux events were significantly higher in patients with bile acids in the BALF. Weakly acidic reflux events, especially during the night, are associated with the aspiration of bile acids in LTx recipients and may therefore feature as a potential risk factor for the development of BOS.

Enzymatic synthesis of 11C-pyruvic acid and 11C-L-lactic acid

International Nuclear Information System (INIS)

Cohen, M.B.; Spolter, L.; Chang, C.C.; Cook, J.S.; Macdonald, N.S.

1980-01-01

L-Lactic acid is formed as the end product of glycolysis under anaerobic conditions in all cells, but this reaction is of special significance in the myocardium. L-Lactic acid is reversibly formed from and is in equilibrium with myocardial pyruvic acid, which is its sole metabolic pathway. 11 C-Pyruvic acid is synthesized from 11 C carbon dioxide using pyruvate-ferredoxin oxidoreductase and coenzymes. The 11 C-pyruvic acid is then converted to 11 -L-lactic acid by lactic acid dehydrogenase. The availability of 11 C-pyruvic acid and 11 C-L-lactic acid will permit the in vivo investigation of lactate metabolism. (author)

Acid rain. Les pluies acides

Energy Technology Data Exchange (ETDEWEB)

Curren, T

1979-11-28

This report was produced for the use of Members of Parliament and House of Commons committees. The document describes the formation of acid rain, emissions of acidifying pollutants in North America, the growth of the problem and its environmental effects on aquatic and terrestrial ecosystems, human health and man-made structures. Areas of Canada which are most susceptible are identified. Actions taken by Parliament are given, including the formation of a sub-committee on acid rain and the passing of Bill C-51 in 1980 to amend the Clean Air Act, bringing it closer to a similar law in the U.S. A chronology of government responses to acid rain at the international, national and provincial level, is given. The most recent government actions included the passing of the US Clean Air Act by the Senate, the amending of the act into law, and commencement of negotiations to develop a Canada-US Air Quality Accord. 10 refs.

Incorporation of Oxygen into Abscisic Acid and Phaseic Acid from Molecular Oxygen 1

Science.gov (United States)

Creelman, Robert A.; Zeevaart, Jan A. D.

1984-01-01

Abscisic acid accumulates in detached, wilted leaves of Xanthium strumarium. When these leaves are subsequently rehydrated, phaseic acid, a catabolite of abscisic acid, accumulates. Analysis by gas chromatography-mass spectrometry of phaseic acid isolated from stressed and subsequently rehydrated leaves placed in an atmosphere containing 20% 18O2 and 80% N2 indicates that one atom of 18O is incorporated in the 6′-hydroxymethyl group of phaseic acid. This suggests that the enzyme that converts abscisic acid to phaseic acid is an oxygenase. Analysis by gas chromatography-mass spectrometry of abscisic acid isolated from stressed leaves kept in an atmosphere containing 18O2 indicates that one atom of 18O is present in the carboxyl group of abscisic acid. Thus, when abscisic acid accumulates in water-stressed leaves, only one of the four oxygens present in the abscisic acid molecule is derived from molecular oxygen. This suggests that either (a) the oxygen present in the 1′-, 4′-, and one of the two oxygens at the 1-position of abscisic acid arise from water, or (b) there exists a stored precursor with oxygen atoms already present in the 1′- and 4′-positions of abscisic acid which is converted to abscisic acid under conditions of water stress. PMID:16663564

Synthesis and biological activity of amino acid conjugates of abscisic acid.

Science.gov (United States)

Todoroki, Yasushi; Narita, Kenta; Muramatsu, Taku; Shimomura, Hajime; Ohnishi, Toshiyuki; Mizutani, Masaharu; Ueno, Kotomi; Hirai, Nobuhiro

2011-03-01

We prepared 19 amino acid conjugates of the plant hormone abscisic acid (ABA) and investigated their biological activity, enzymatic hydrolysis by a recombinant Arabidopsis amidohydrolases GST-ILR1 and GST-IAR3, and metabolic fate in rice seedlings. Different sets of ABA-amino acids induced ABA-like responses in different plants. Some ABA-amino acids, including some that were active in bioassays, were hydrolyzed by recombinant Arabidopsis GST-IAR3, although GST-ILR1 did not show hydrolysis activity for any of the ABA-amino acids. ABA-L-Ala, which was active in all the bioassays, an Arabidopsis seed germination, spinach seed germination, and rice seedling elongation assays, except in a lettuce seed germination assay and was hydrolyzed by GST-IAR3, was hydrolyzed to free ABA in rice seedlings. These findings suggest that some plant amidohydrolases hydrolyze some ABA-amino acid conjugates. Because our study indicates the possibility that different plants have hydrolyzing activity toward different ABA-amino acids, an ABA-amino acid may function as a species-selective pro-hormone of ABA. Copyright © 2011 Elsevier Ltd. All rights reserved.

10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, potently activates PPARγ and stimulates adipogenesis

Energy Technology Data Exchange (ETDEWEB)

Goto, Tsuyoshi, E-mail: tgoto@kais.kyoto-u.ac.jp [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Research Unit for Physiological Chemistry, The Center for the Promotion of Interdisciplinary Education and Research, Kyoto University (Japan); Kim, Young-Il; Furuzono, Tomoya [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Takahashi, Nobuyuki [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Research Unit for Physiological Chemistry, The Center for the Promotion of Interdisciplinary Education and Research, Kyoto University (Japan); Yamakuni, Kanae; Yang, Ha-Eun; Li, Yongjia [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Ohue, Ryuji [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Research Unit for Physiological Chemistry, The Center for the Promotion of Interdisciplinary Education and Research, Kyoto University (Japan); Nomura, Wataru [Laboratory of Molecular Function of Food, Division of Food Science and Biotechnology, Graduate School of Agriculture, Kyoto University, Uji 611-0011 (Japan); Sugawara, Tatsuya [Laboratory of Marine Bioproducts Technology, Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502 (Japan); Yu, Rina [Department of Food Science and Nutrition, University of Ulsan, Ulsan 680-749 (Korea, Republic of); Kitamura, Nahoko [Laboratory of Fermentation Physiology and Applied Microbiology, Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502 (Japan); and others

2015-04-17

Our previous study has shown that gut lactic acid bacteria generate various kinds of fatty acids from polyunsaturated fatty acids such as linoleic acid (LA). In this study, we investigated the effects of LA and LA-derived fatty acids on the activation of peroxisome proliferator-activated receptors (PPARs) which regulate whole-body energy metabolism. None of the fatty acids activated PPARδ, whereas almost all activated PPARα in luciferase assays. Two fatty acids potently activated PPARγ, a master regulator of adipocyte differentiation, with 10-oxo-12(Z)-octadecenoic acid (KetoA) having the most potency. In 3T3-L1 cells, KetoA induced adipocyte differentiation via the activation of PPARγ, and increased adiponectin production and insulin-stimulated glucose uptake. These findings suggest that fatty acids, including KetoA, generated in gut by lactic acid bacteria may be involved in the regulation of host energy metabolism. - Highlights: • Most LA-derived fatty acids from gut lactic acid bacteria potently activated PPARα. • Among tested fatty acids, KetoA and KetoC significantly activated PPARγ. • KetoA induced adipocyte differentiation via the activation of PPARγ. • KetoA enhanced adiponectin production and glucose uptake during adipogenesis.

10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, potently activates PPARγ and stimulates adipogenesis

International Nuclear Information System (INIS)

Goto, Tsuyoshi; Kim, Young-Il; Furuzono, Tomoya; Takahashi, Nobuyuki; Yamakuni, Kanae; Yang, Ha-Eun; Li, Yongjia; Ohue, Ryuji; Nomura, Wataru; Sugawara, Tatsuya; Yu, Rina; Kitamura, Nahoko

2015-01-01

Our previous study has shown that gut lactic acid bacteria generate various kinds of fatty acids from polyunsaturated fatty acids such as linoleic acid (LA). In this study, we investigated the effects of LA and LA-derived fatty acids on the activation of peroxisome proliferator-activated receptors (PPARs) which regulate whole-body energy metabolism. None of the fatty acids activated PPARδ, whereas almost all activated PPARα in luciferase assays. Two fatty acids potently activated PPARγ, a master regulator of adipocyte differentiation, with 10-oxo-12(Z)-octadecenoic acid (KetoA) having the most potency. In 3T3-L1 cells, KetoA induced adipocyte differentiation via the activation of PPARγ, and increased adiponectin production and insulin-stimulated glucose uptake. These findings suggest that fatty acids, including KetoA, generated in gut by lactic acid bacteria may be involved in the regulation of host energy metabolism. - Highlights: • Most LA-derived fatty acids from gut lactic acid bacteria potently activated PPARα. • Among tested fatty acids, KetoA and KetoC significantly activated PPARγ. • KetoA induced adipocyte differentiation via the activation of PPARγ. • KetoA enhanced adiponectin production and glucose uptake during adipogenesis

Uptake of actinides by sulphonated phosphinic acid resin from acid medium

International Nuclear Information System (INIS)

Jaya Mohandas; Srinivasa Rao, V.; Vijayakumar, N.; Kumar, T.; Velmurugan, S.; Narasimhan, S.V.

2014-01-01

The removal of uranium and americium from nitric acid solutions by sulphonated phosphinic acid resin has been investigated. The capacity of the sulphonated resin exceeds the capacities of phosphinic acid resin and commercial cation exchange resin. Other advantages of the sulphonated resin for uranium and americium removal include reduced sensitivity to acidity and inert salt concentration. (author)

Unsaturated fatty acids protect trophoblast cells from saturated fatty acid-induced autophagy defects.

Science.gov (United States)

Hong, Ye-Ji; Ahn, Hyo-Ju; Shin, Jongdae; Lee, Joon H; Kim, Jin-Hoi; Park, Hwan-Woo; Lee, Sung Ki

2018-02-01

Dysregulated serum fatty acids are associated with a lipotoxic placental environment, which contributes to increased pregnancy complications via altered trophoblast invasion. However, the role of saturated and unsaturated fatty acids in trophoblastic autophagy has yet to be explored. Here, we demonstrated that prolonged exposure of saturated fatty acids interferes with the invasiveness of human extravillous trophoblasts. Saturated fatty acids (but not unsaturated fatty acids) inhibited the fusion of autophagosomes and lysosomes, resulting in the formation of intracellular protein aggregates. Furthermore, when the trophoblast cells were exposed to saturated fatty acids, unsaturated fatty acids counteracted the effects of saturated fatty acids by increasing degradation of autophagic vacuoles. Saturated fatty acids reduced the levels of the matrix metalloproteinases (MMP)-2 and MMP-9, while unsaturated fatty acids maintained their levels. In conclusion, saturated fatty acids induced decreased trophoblast invasion, of which autophagy dysfunction plays a major role. Copyright © 2017 Elsevier B.V. All rights reserved.

Formation of organic acids from trace carbon in acidic oxidizing media

International Nuclear Information System (INIS)

Terrassier, C.

2003-01-01

Carbon 14 does not fully desorb as CO 2 during the hot concentrated nitric acid dissolution step of spent nuclear fuel reprocessing: a fraction is entrained in solution into the subsequent process steps as organic species. The work described in this dissertation was undertaken to identify the compounds arising from the dissolution in 3 N nitric acid of uranium carbides (selected as models of the chemical form of carbon 14 in spent fuel) and to understand their formation and dissolution mechanism. The compounds were present at traces in solution, and liquid-solid extraction on a specific stationary phase (porous graphite carbon) was selected to concentrate the monoaromatic poly-carboxylic acids including mellitic acid, which is mentioned in the literature but has not been formally identified. The retention of these species and of oxalic acid - also cited in the literature - was studied on this stationary phase as a function of the mobile phase pH, revealing an ion exchange retention mechanism similar to the one observed for benzyltrimethylammonium polystyrene resins. The desorption step was then optimized by varying the eluent pH and ionic strength. Mass spectrometry analysis of the extracts identified acetic acid, confirmed the presence of mellitic acid, and revealed compounds of high molecular weight (about 200 g/mol); the presence of oxalic acid was confirmed by combining gas chromatography and mass spectrometry. Investigating the dissolution of uranium and zirconium carbides in nitric acid provided considerable data on the reaction and suggested a reaction mechanism. The reaction is self-catalyzing via nitrous acid, and the reaction rate de pends on the acidity and nitrate ion concentration in solution. Two uranium carbide dissolution mechanisms are proposed: one involves uranium at oxidation state +IV in solution, coloring the dissolution solution dark green, and the other assumes that uranium monocarbide is converted to uranium oxide. The carboxylic acid

Synthesis of bio-based methacrylic acid by decarboxylation of itaconic acid and citric acid catalyzed by solid transition-metal catalysts.

Science.gov (United States)

Le Nôtre, Jérôme; Witte-van Dijk, Susan C M; van Haveren, Jacco; Scott, Elinor L; Sanders, Johan P M

2014-09-01

Methacrylic acid, an important monomer for the plastics industry, was obtained in high selectivity (up to 84%) by the decarboxylation of itaconic acid using heterogeneous catalysts based on Pd, Pt and Ru. The reaction takes place in water at 200-250 °C without any external added pressure, conditions significantly milder than those described previously for the same conversion with better yield and selectivity. A comprehensive study of the reaction parameters has been performed, and the isolation of methacrylic acid was achieved in 50% yield. The decarboxylation procedure is also applicable to citric acid, a more widely available bio-based feedstock, and leads to the production of methacrylic acid in one pot in 41% selectivity. Aconitic acid, the intermediate compound in the pathway from citric acid to itaconic acid was also used successfully as a substrate. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

High concentrations of the carcinogen 2-amino-1-methyl-6-phenylimidazo- [4,5-b]pyridine (PhIP) occur in chicken but are dependent on the cooking method.

Science.gov (United States)

Sinha, R; Rothman, N; Brown, E D; Salmon, C P; Knize, M G; Swanson, C A; Rossi, S C; Mark, S D; Levander, O A; Felton, J S

1995-10-15

Heterocyclic aromatic amines (HAAs) are mutagenic and carcinogenic compounds found in meats cooked at high temperatures. Although chicken is consumed in large quantities in the United States, there is little information on its HAA content. The objective of this study was to measure the five predominant HAAs (IQ, MeIQ, MeIQx, DiMeIQx, and PhIP) in chicken cooked by various methods to different degrees of doneness. Chicken breasts were panfried, oven-broiled, or grilled/barbecued. Whole chickens were roasted or stewed. Skinless, boneless chicken breasts were cooked to three degrees of doneness: just until done, well done, or very well done. High levels of PhIP (ranging from 12 to 480 ng/g cooked meat) were found in chicken breasts when panfried, oven-broiled, and grilled/barbecued but not in while roasted or stewed chicken. PhIP concentration increased in skinless, boneless chicken breast with longer cooking time, higher internal temperature, and greater degree of surface browning. PhIP concentration was also high in chicken breasts cooked with skin and bones. MeIQx and DiMeIQx levels increased with the degree of doneness, whereas IQ and MeIQ were not detectable in any of these chicken samples. Certain cooking methods produce PhIP, a known colon and breast carcinogen in rodents and possibly a human carcinogen, at substantially higher levels in chicken than has been reported previously in red meat.

Bilateral cross-bite treated by repeated rapid maxillary expansions: a 17-year follow-up case.

Science.gov (United States)

Cozzani, M; Mazzotta, L; Caprioglio, A

2014-07-01

The objective of this paper is to show the clinical results after the repeated application of a Haas expander for rapid maxillary expansion (RME) anchored onto deciduous teeth in a 7-year-old patient that presented bilateral cross-bite, superior crowding and no space for permanent lateral incisors eruption. A first Haas expander was applied to the patient. She was told to activate it once a day, each activation was equal to 0.20 mm. After the first RME, the bilateral cross-bite was solved but still there was not enough space for lateral incisor eruption. A second and then a third Haas expander were applied, with the same activation protocol as the first one, in order to gain space in the anterior region and to achieve proper eruption of the lateral incisors. The patient was then treated with fixed appliances. At debonding the patient presented well aligned arch-forms: space for lateral incisor eruption was gained and superior crowding was solved. Bilateral cross-bite was also corrected. She was seen again 10 years and 17 years after expansions: she showed no relapse and presented a good functional occlusion that had remained stable, and an aesthetically pleasant smile, however she exhibited gingival recessions. Repeated rapid maxillary expansion, anchored onto deciduous teeth, performed in early mixed dentition represents a safe and successful treatment to correct severe bilateral cross- bites and to create space for maxillary incisor eruption.

Role of nitrous acid during the dissolution of UO2 in nitric acid

International Nuclear Information System (INIS)

Deigan, N.; Pandey, N.K.; Kamachi Mudali, U.; Joshi, J.B.

2016-01-01

Understanding the dissolution behaviour of sintered UO 2 pellet in nitric acid is very important in designing an industrial scale dissolution system for the plutonium rich fast reactor MOX fuel. In the current article we have established the role of nitrous acid on the dissolution kinetics of UO 2 pellets in nitric acid. Under the chemical conditions that prevail in a typical Purex process, NO and NO 2 gases gets generated in the process streams. These gases produce nitrous acid in nitric acid medium. In addition, during the dissolution of UO 2 in nitric acid medium, nitrous acid is further produced in-situ at the pellet solution interface. As uranium dissolves oxidatively in nitric acid medium wherein it goes from U(IV) in solid to U(VI) in liquid, presence of nitrous acid (a good oxidizing agent) accelerates the reaction rate. Hence for determining the reaction mechanism of UO 2 dissolution in nitric acid medium, knowing the nitrous acid concentration profile during the course of dissolution is important. The current work involves the measurement of nitrous acid concentration during the course of dissolution of sintered UO 2 pellets in 8M starting nitric acid concentration as a function of mixing intensity from unstirred condition to 1500 RPM

Research and performance evaluation on an HA integrated acid system for sandstone acidizing

Directory of Open Access Journals (Sweden)

Liqiang Zhao

2018-03-01

Full Text Available When the conventional sandstone acidizing technologies are adopted, many slugs are needed in the injection of prepad fluid, treatment fluid and postpad fluid, and consequently the production and operation suffers inconveniences and difficulties. In view of this, a kind of HA integrated acid system which is mainly composed of organic polybasic acids (HA+HCl + HF and an efficient organic solvent was developed in this paper based on the idea of integrated acid replacing ''multiple steps'' and high efficiency and intensification. Via this HA integrated acid system, the complicated blockage in sandstone reservoirs can be removed effectively. Then, experiments were carried out on this system to evaluate its performance in terms of its retardance, organic blockage dissolution, chelating and precipitation inhibition. It is indicated that this new system can not only realize the acidizing of conventional integrated acid, but also present a good retarding performance by controlling H+ multi-stage ionization step by step and by forming silica acid-aluminum phosphonate film on the surface of clay minerals; that via this new HA integrated acid system, the organic blockage can be removed efficiently; and that it is wider in pH solution range than conventional APCs (aminopolycarboxyliates chelants, stronger in chelating capacity of Ca2+, Mg2+ and Fe3+ than conventional chelants (e.g. EDTA, NTA and DTPA, and better in precipitation inhibition on metal fluoride, fluosilicic acid alkali metal, fluoaluminic acid alkali metal and hydroxide than multi-hydrogen acid, fluoboric acid and mud acid systems. These research results provide a technical support for the plugging removal in high-temperature deep oil and gas reservoirs. Keywords: Organic polybasic acid, Integrated acid, Retardance, Chelating, Precipitation, Acidizing, Sandstone, Reservoir

Bile acid sequestrants

DEFF Research Database (Denmark)

Hansen, Morten; Sonne, David P; Knop, Filip K

2014-01-01

Bile acids are synthesized in the liver from cholesterol and have traditionally been recognized for their role in absorption of lipids and in cholesterol homeostasis. In recent years, however, bile acids have emerged as metabolic signaling molecules that are involved in the regulation of lipid...... and glucose metabolism, and possibly energy homeostasis, through activation of the bile acid receptors farnesoid X receptor (FXR) and TGR5. Bile acid sequestrants (BASs) constitute a class of drugs that bind bile acids in the intestine to form a nonabsorbable complex resulting in interruption...... of the enterohepatic circulation. This increases bile acid synthesis and consequently reduces serum low-density lipoprotein cholesterol. Also, BASs improve glycemic control in patients with type 2 diabetes. Despite a growing understanding of the impact of BASs on glucose metabolism, the mechanisms behind their glucose...

Reaction Kinetics of Monomethylhydrazine With Nitrous Acid in Perchloric Acid Solution

International Nuclear Information System (INIS)

Wei Yan; Wang Hui; Pan Yongjun; Cong Haifeng; Jiao Haiyang; Jia Yongfen; Zheng Weifang

2009-01-01

The oxidation of monomethylhydrazine (MMH) by nitrous acid was researched in perchloric acid solution with spectrophotometry. The rate equation has been determined as follows: -dc (HNO 2 ) /dt= kc (H + ) 0.9 c (MMH) 1.1 c (HNO 2 ), k is (46.0 ± 2.7) L 2 / (mol 2 · s) with the initial perchlorate concentration of 0.50 mol/L at the temperature of 4.5 degree C. The corresponding activation energy of the reaction is (42.4 ± 0.1) kJ/mol. The results indicate that oxidation of mono-methylhydrazine (MMH) by nitrous acid is fast. The higher concentration of MMH can accelerate the reduction process of nitrous acid. Higher acidity can also speed up the reduction of nitrous acid. (authors)

Bile acids: regulation of apoptosis by ursodeoxycholic acid.

Science.gov (United States)

Amaral, Joana D; Viana, Ricardo J S; Ramalho, Rita M; Steer, Clifford J; Rodrigues, Cecília M P

2009-09-01

Bile acids are a group of molecular species of acidic steroids with peculiar physical-chemical and biological characteristics. At high concentrations they become toxic to mammalian cells, and their presence is pertinent in the pathogenesis of several liver diseases and colon cancer. Bile acid cytoxicity has been related to membrane damage, but also to nondetergent effects, such as oxidative stress and apoptosis. Strikingly, hydrophilic ursodeoxycholic acid (UDCA), and its taurine-conjugated form (TUDCA), show profound cytoprotective properties. Indeed, these molecules have been described as potent inhibitors of classic pathways of apoptosis, although their precise mode of action remains to be clarified. UDCA, originally used for cholesterol gallstone dissolution, is currently considered the first choice therapy for several forms of cholestatic syndromes. However, the beneficial effects of both UDCA and TUDCA have been tested in other experimental pathological conditions with deregulated levels of apoptosis, including neurological disorders, such as Alzheimer's, Parkinson's, and Huntington's diseases. Here, we review the role of bile acids in modulating the apoptosis process, emphasizing the anti-apoptotic effects of UDCA and TUDCA, as well as their potential use as novel and alternate therapeutic agents for the treatment of apoptosis-related diseases.

[Presidendipaar Ingrid ja Arnold Rüütel] / Annika Haas

Index Scriptorium Estoniae

Haas, Annika

2007-01-01

President Arnold Rüütel ja Ingrid Rüütel Briti suursaadiku Nigel Haywoodi lahkumispeol Tallinna Teaduste Akadeemia peasaalis. Foto allkiri: Presidendipaar Ingrid ja Arnold Rüütel kuulavad Briti suursaadiku Nigel Haywoodi kiidulaulu Eesti kiire arengu aadressil

Phytanic acid-an overlooked bioactive fatty acid in dairy fat?

DEFF Research Database (Denmark)

Hellgren, Lars

2010-01-01

dissipation in skeletal muscles. Phytanic acid levels in serum are associated with an increased risk of developing prostate cancer, but the available data do not support a general causal link between circulating phytanic acid and prostate cancer risk. However, certain individuals, with specific single......Phytanic acid is a multibranched fatty acid with reported retinoid X receptor (RXR) and peroxisome proliferator-activated receptor-alpha (PPAR-alpha) agonist activity, which have been suggested to have preventive effects on metabolic dysfunctions. Serum level in man is strongly correlated...

The Polyunsaturated Fatty Acids Arachidonic Acid and Docosahexaenoic Acid Induce Mouse Dendritic Cells Maturation but Reduce T-Cell Responses In Vitro

Science.gov (United States)

Carlsson, Johan A.; Wold, Agnes E.; Sandberg, Ann-Sofie; Östman, Sofia M.

2015-01-01

Long-chain polyunsaturated fatty acids (PUFAs) might regulate T-cell activation and lineage commitment. Here, we measured the effects of omega-3 (n-3), n-6 and n-9 fatty acids on the interaction between dendritic cells (DCs) and naïve T cells. Spleen DCs from BALB/c mice were cultured in vitro with ovalbumin (OVA) with 50 μM fatty acids; α-linolenic acid, arachidonic acid (AA), eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), linoleic acid or oleic acid and thereafter OVA-specific DO11.10 T cells were added to the cultures. Fatty acids were taken up by the DCs, as shown by gas chromatography analysis. After culture with arachidonic acid or DHA CD11c+ CD11b+ and CD11c+ CD11bneg DCs expressed more CD40, CD80, CD83, CD86 and PDL-1, while IAd remained unchanged. However, fewer T cells co-cultured with these DCs proliferated (CellTrace Violetlow) and expressed CD69 or CD25, while more were necrotic (7AAD+). We noted an increased proportion of T cells with a regulatory T cell (Treg) phenotype, i.e., when gating on CD4+ FoxP3+ CTLA-4+, CD4+ FoxP3+ Helios+ or CD4+ FoxP3+ PD-1+, in co-cultures with arachidonic acid- or DHA-primed DCs relative to control cultures. The proportion of putative Tregs was inversely correlated to T-cell proliferation, indicating a suppressive function of these cells. With arachidonic acid DCs produced higher levels of prostaglandin E2 while T cells produced lower amounts of IL-10 and IFNγ. In conclusion arachidonic acid and DHA induced up-regulation of activation markers on DCs. However arachidonic acid- and DHA-primed DCs reduced T-cell proliferation and increased the proportion of T cells expressing FoxP3, indicating that these fatty acids can promote induction of regulatory T cells. PMID:26619195

Plasma amino acids

Science.gov (United States)

Amino acids blood test ... types of methods used to determine the individual amino acid levels in the blood. ... test is done to measure the level of amino acids in the blood. An increased level of a ...

Oxidative cleavage of erucic acid for the synthesis of brassylic acid

Energy Technology Data Exchange (ETDEWEB)

Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

2010-10-29

The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

Science.gov (United States)

Wang, Bin; Shao, Yanchun; Chen, Fusheng

2015-02-01

Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided.

Glutamic acid and folic acid production in aerobic and anaerobic probiotics

Directory of Open Access Journals (Sweden)

Zohre Taghi Abadi

2018-03-01

Full Text Available Introduction:From an industrial application or commercial point of view, glutamic acid is one of the most important amino acids and its microbial production has been reported from some bacteria. Regarding the role of probiotics to modulate human health and the ever-increasing demand of prebiotics in the food industry, in the current study, production of glutamic acid and folic acid from three probiotic bacteria (Bifidobacterium, Bifidobacterium bifidum, Sporolactobacillus was evaluated for the first time. Materials and methods: MRS broth and exclusive media was used for probiotic culture. The glutamic acid was identified using thin-layer chromatography and folic acid production was measured by folate kit. Each bacterium in terms of quality and quantity were measured by high pressure liquid chromatography. Results: Production of glutamic acid confirmed is based on the thin layer chromatography analysis and high pressure liquid chromatography results. In addition, it was observed that all three probiotics produce folic acid. The prevalence of folate in Bifidobacterium was measured as 315 mg/ml that was more than two other bacteria. Discussion and conclusion: To the best of our knowledge, this is the first report of microbial production of glutamic acid and folate from the probiotic bacteria. These beneficial bacteria can be used as a good source for mass production of these valuable compounds.

Folic acid and pantothenic acid protection against valproic acid-induced neural tube defects in CD-1 mice

Energy Technology Data Exchange (ETDEWEB)

Dawson, Jennifer E [Department of Pharmacology and Toxicology and School of Environmental Studies, Queen' s University, Kingston, Ontario, K7L 3N6 (Canada); Raymond, Angela M [Department of Pharmacology and Toxicology and School of Environmental Studies, Queen' s University, Kingston, Ontario, K7L 3N6 (Canada); Winn, Louise M [Department of Pharmacology and Toxicology and School of Environmental Studies, Queen' s University, Kingston, Ontario, K7L 3N6 (Canada)

2006-03-01

In utero exposure to valproic acid (VPA) during pregnancy is associated with an increased risk of neural tube defects (NTDs). Although the mechanism by which VPA mediates these effects is unknown, VPA-initiated changes in embryonic protein levels have been implicated. The objectives of this study were to investigate the effect of in utero VPA exposure on embryonic protein levels of p53, NF-{kappa}B, Pim-1, c-Myb, Bax, and Bcl-2 in the CD-1 mouse. We also evaluated the protective effects of folic acid and pantothenic acid on VPA-induced NTDs and VPA-induced embryonic protein changes in this model. Pregnant CD-1 mice were administered a teratogenic dose of VPA prior to neural tube closure and embryonic protein levels were analyzed. In our study, VPA (400 mg/kg)-induced NTDs (24%) and VPA-exposed embryos with an NTD showed a 2-fold increase in p53, and 4-fold decreases in NF-{kappa}B, Pim-1, and c-Myb protein levels compared to their phenotypically normal littermates (P < 0.05). Additionally, VPA increased the ratio of embryonic Bax/Bcl-2 protein levels (P < 0.05). Pretreatment of pregnant dams with either folic acid or pantothenic acid prior to VPA significantly protected against VPA-induced NTDs (P < 0.05). Folic acid also reduced VPA-induced alterations in p53, NF-{kappa}B, Pim-1, c-Myb, and Bax/Bcl-2 protein levels, while pantothenic acid prevented VPA-induced alterations in NF-{kappa}B, Pim-1, and c-Myb. We hypothesize that folic acid and pantothenic acid protect CD-1 embryos from VPA-induced NTDs by independent, but not mutually exclusive mechanisms, both of which may be mediated by the prevention of VPA-induced alterations in proteins involved in neurulation.

Uric acid - urine

Science.gov (United States)

... this page: //medlineplus.gov/ency/article/003616.htm Uric acid urine test To use the sharing features on ... are no risks with this test. Images Uric acid test Uric acid crystals References Burns CM, Wortmann RL. Clinical ...

Cytotoxic effect of betulinic acid and betulinic acid acetate isolated ...

African Journals Online (AJOL)

Cytotoxic effect of betulinic acid and betulinic acid acetate isolated from Melaleuca cajuput on human myeloid leukemia (HL-60) cell line. ... The cytotoxic effect of betulinic acid (BA), isolated from Melaleuca cajuput a Malaysian plant and its four synthetic derivatives were tested for their cytotoxicity in various cell line or ...

Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

Science.gov (United States)

Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

2016-07-01

Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

Kinetic study on the acid-catalyzed hydrolysis of cellulose to levulinic acid

NARCIS (Netherlands)

Girisuta, B.; Janssen, L. P. B. M.; Heeres, H. J.

2007-01-01

A variety of interesting bulk chemicals is accessible by the acid-catalyzed hydrolysis of cellulose. An interesting example is levulinic acid, a versatile precursor for fuel additives, polymers, and resins. A detailed kinetic study on the acid-catalyzed hydrolysis of cellulose to levulinic acid is

Utilization of acidic α-amino acids as acyl donors: an effective stereo-controllable synthesis of aryl-keto α-amino acids and their derivatives.

Science.gov (United States)

Wang, Lei; Murai, Yuta; Yoshida, Takuma; Okamoto, Masashi; Tachrim, Zetryana Puteri; Hashidoko, Yasuyuki; Hashimoto, Makoto

2014-05-16

Aryl-keto-containing α-amino acids are of great importance in organic chemistry and biochemistry. They are valuable intermediates for the construction of hydroxyl α-amino acids, nonproteinogenic α-amino acids, as well as other biofunctional components. Friedel-Crafts acylation is an effective method to prepare aryl-keto derivatives. In this review, we summarize the preparation of aryl-keto containing α-amino acids by Friedel-Crafts acylation using acidic α-amino acids as acyl-donors and Lewis acids or Brönsted acids as catalysts.

Molybdenum-containing acidic catalysts to convert cellulosic biomass to glycolic acid

KAUST Repository

Han, Yu; Zhang, Jizhe; Liu, Xin

2014-01-01

Embodiments of the present invention include methods and compositions related to catabolic conversion of cellulosic biomass to glycolic acid using molybdenum-containing acidic catalysts. The invention includes the use of heteropoly and isopoly acids

Effect of acute acid loading on acid-base and calcium metabolism

DEFF Research Database (Denmark)

Osther, Palle J

2006-01-01

OBJECTIVE: To investigate the acid-base and calcium metabolic responses to acute non-carbonic acid loading in idiopathic calcium stone-formers and healthy males using a quantitative organ physiological approach. MATERIAL AND METHODS: Five-h ammonium chloride loading studies were performed in 12...... male recurrent idiopathic calcium stone-formers and 12 matched healthy men using a randomized, placebo-controlled, cross-over design. Arterialized capillary blood, serum and urine were collected hourly for measurement of electrolytes, ionized calcium, magnesium, phosphate, parathyroid hormone and acid-base...... status. Concentrations of non-metabolizable base (NB) and acid (NA) were calculated from measured concentrations of non-metabolizable ions. RESULTS: The extracellular acid-base status in the stone-formers during basal conditions and acid loading was comparable to the levels in the healthy controls...

Study on Corrosion of Materials by Fluoric Acid and Silicofluoric Acid

International Nuclear Information System (INIS)

Park, Kun You; Kwon, Yeong Soo; Kuk, Myung Ho; Kim, Myun Sup

1986-01-01

The corrosion properties of 304 Stainless steel, Cupro-nickel, NiCrMo alloy in hydrofluoric acid and silicofluoric acid has been studied. The corrosion resistance of NiCrMo alloy and Cupro-nickel in hydrofluoric acid or mixed acid of hydrofluoric and sulfuric acid is excellent. Because of lower corrosion resistance of 304 Stainless steel, it would not be used for these corrosion resistant materials. The corrosion activation energy of 304 Stainless steel, Cupro-nickel and NiCrMo alloy in 40% HF solution are 42.7, 58.9 and 89.7 kJ/mol, respectively. By these values, it is assumed that the corrosion rate determining step is the chemical reaction on surface of metals. In the plastics, Teflon and polychloro tetrafluoroethylene are most excellent for corrosion resistance in hydrofluoric acid

Stomach acid test

Science.gov (United States)

Gastric acid secretion test ... of the cells in the stomach to release acid. The stomach contents are then removed and analyzed. ... 3.5). These numbers are converted to actual acid production in units of milliequivalents per hour (mEq/ ...

10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, potently activates PPARγ and stimulates adipogenesis.

Science.gov (United States)

Goto, Tsuyoshi; Kim, Young-Il; Furuzono, Tomoya; Takahashi, Nobuyuki; Yamakuni, Kanae; Yang, Ha-Eun; Li, Yongjia; Ohue, Ryuji; Nomura, Wataru; Sugawara, Tatsuya; Yu, Rina; Kitamura, Nahoko; Park, Si-Bum; Kishino, Shigenobu; Ogawa, Jun; Kawada, Teruo

2015-04-17

Our previous study has shown that gut lactic acid bacteria generate various kinds of fatty acids from polyunsaturated fatty acids such as linoleic acid (LA). In this study, we investigated the effects of LA and LA-derived fatty acids on the activation of peroxisome proliferator-activated receptors (PPARs) which regulate whole-body energy metabolism. None of the fatty acids activated PPARδ, whereas almost all activated PPARα in luciferase assays. Two fatty acids potently activated PPARγ, a master regulator of adipocyte differentiation, with 10-oxo-12(Z)-octadecenoic acid (KetoA) having the most potency. In 3T3-L1 cells, KetoA induced adipocyte differentiation via the activation of PPARγ, and increased adiponectin production and insulin-stimulated glucose uptake. These findings suggest that fatty acids, including KetoA, generated in gut by lactic acid bacteria may be involved in the regulation of host energy metabolism. Copyright © 2015 Elsevier Inc. All rights reserved.

Kirju ja vastuoluline "Wien Modern 2007" / Saale Kareda

Index Scriptorium Estoniae

Kareda, Saale, 1968-

2008-01-01

Festivalist "Wien Modern 2007", festivali peaheliloojad Georg Friedrich Haas ja Luciano Berio. Pikemalt G. F. Haasi muusikast ja festivali kontsertidest. Frank Schefferi filmide retrospektiivist, pikemalt filmist "Helicopter String Quartet" - helilooja Karlheinz Stockhausenist. Järgneb nr. 3, lk. 67-75

Quantum magnetotransport properties of topological insulators under strain

KAUST Repository

Tahir, M.; Schwingenschlö gl, Udo

2012-01-01

scattering in the first Born approximation. We also calculate the Hall conductivity using the Kubo formalism. Evidence for the beating of Shubnikov–de Haas oscillations is found from the temperature and magnetic field dependence of the collisional and Hall

Transport of ascorbic acid and dehydroascorbic acid by pancreatic islet cells from neonatal rats

DEFF Research Database (Denmark)

Zhou, A; Farver, O; Thorn, N A

1991-01-01

. Dehydroascorbic acid was converted to ascorbic acid by an unknown mechanism after uptake. The uptake of both ascorbic acid and dehydroascorbic acid was inhibited by tri-iodothyronine, and uptake of ascorbic acid, but not of dehydroascorbic acid, was inhibited by glucocorticoids. Isolated secretory granules...

College Chemistry Students' Mental Models of Acids and Acid Strength

Science.gov (United States)

McClary, LaKeisha; Talanquer, Vicente

2011-01-01

The central goal of this study was to characterize the mental models of acids and acid strength expressed by advanced college chemistry students when engaged in prediction, explanation, and justification tasks that asked them to rank chemical compounds based on their relative acid strength. For that purpose we completed a qualitative research…

An Effective Acid Combination for Enhanced Properties and Corrosion Control of Acidizing Sandstone Formation

International Nuclear Information System (INIS)

Shafiq, Mian Umer; Mahmud, Hisham Khaled Ben

2016-01-01

To fulfill the demand of the world energy, more technologies to enhance the recovery of oil production are being developed. Sandstone acidizing has been introduced and it acts as one of the important means to increase oil and gas production. Sandstone acidizing operation generally uses acids, which create or enlarge the flow channels of formation around the wellbore. In sandstone matrix acidizing, acids are injected into the formation at a pressure below the formation fracturing pressure, in which the injected acids react with mineral particles that may restrict the flow of hydrocarbons. Most common combination is Hydrofluoric Acid - Hydrochloric with concentration (3% HF - 12% HCl) known as mud acid. But there are some problems associated with the use of mud acid i.e., corrosion, precipitation. In this paper several new combinations of acids were experimentally screened to identify the most effective combination. The combinations used consist of fluoboric, phosphoric, formic and hydrofluoric acids. Cores were allowed to react with these combinations and results are compared with the mud acid. The parameters, which are analyzed, are Improved Permeability Ratio, strength and mineralogy. The analysis showed that the new acid combination has the potential to be used in sandstone acidizing. (paper)

Peptide Nucleic Acids Having Amino Acid Side Chains

DEFF Research Database (Denmark)

1998-01-01

A novel class of compounds, known as peptide nucleic acids, bind complementary DNA and RNA strands more strongly than the corresponding DNA or RNA strands, and exhibit increased sequence specificity and solubility. The peptide nucleic acids comprise ligands selected from a group consisting...

40 CFR 721.6200 - Fatty acid polyamine condensate, phosphoric acid ester salts.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Fatty acid polyamine condensate... New Uses for Specific Chemical Substances § 721.6200 Fatty acid polyamine condensate, phosphoric acid... substances identified as fatty acid polyamine condensate, phosphate ester salts (PMNs P-90-1984 and P-90-1985...

Amino acids

Science.gov (United States)

... this page: //medlineplus.gov/ency/article/002222.htm Amino acids To use the sharing features on this page, please enable JavaScript. Amino acids are organic compounds that combine to form proteins . ...

Incorporation of conjugated linoleic acid (CLA and α-linolenic acid (LNA in pacu fillets

Directory of Open Access Journals (Sweden)

Deoclécio José Barilli

2014-03-01

Full Text Available The objective of this study was to evaluate the incorporation of conjugated linoleic acid and α-linolenic acid in fillets of pacu fish raised in net cages and fed diets enriched with these acids. The fish were fed for 49 days, and at the end of this period the fatty acid content in the fillets was determined by gas chromatography. Concentrations of α-linolenic acid, eicosapentaenoic acid, and the total omega-3 (n-3 fatty acid in the fillets increased, improving the n-6/n-3 ratio. In addition, the incorporation of conjugated linoleic acid in the fish fillets proved well established. This study showed that the use of diets enriched with conjugated linoleic acid and α-linolenic acid results in the incorporation of these acids in the of pacu fish fillets, improving their nutritional quality.

Method for distinctive estimation of stored acidity forms in acid mine wastes.

Science.gov (United States)

Li, Jun; Kawashima, Nobuyuki; Fan, Rong; Schumann, Russell C; Gerson, Andrea R; Smart, Roger St C

2014-10-07

Jarosites and schwertmannite can be formed in the unsaturated oxidation zone of sulfide-containing mine waste rock and tailings together with ferrihydrite and goethite. They are also widely found in process wastes from electrometallurgical smelting and metal bioleaching and within drained coastal lowland soils (acid-sulfate soils). These secondary minerals can temporarily store acidity and metals or remove and immobilize contaminants through adsorption, coprecipitation, or structural incorporation, but release both acidity and toxic metals at pH above about 4. Therefore, they have significant relevance to environmental mineralogy through their role in controlling pollutant concentrations and dynamics in contaminated aqueous environments. Most importantly, they have widely different acid release rates at different pHs and strongly affect drainage water acidity dynamics. A procedure for estimation of the amounts of these different forms of nonsulfide stored acidity in mining wastes is required in order to predict acid release rates at any pH. A four-step extraction procedure to quantify jarosite and schwertmannite separately with various soluble sulfate salts has been developed and validated. Corrections to acid potentials and estimation of acid release rates can be reliably based on this method.

Complexity in Acid?Base Titrations: Multimer Formation Between Phosphoric Acids and Imines

OpenAIRE

Malm, Christian; Kim, Heejae; Wagner, Manfred; Hunger, Johannes

2017-01-01

Abstract Solutions of Br?nsted acids with bases in aprotic solvents are not only common model systems to study the fundamentals of proton transfer pathways but are also highly relevant to Br?nsted acid catalysis. Despite their importance the light nature of the proton makes characterization of acid?base aggregates challenging. Here, we track such acid?base interactions over a broad range of relative compositions between diphenyl phosphoric acid and the base quinaldine in dichloromethane, by u...

Profile of preoperative fecal organic acids closely predicts the incidence of postoperative infectious complications after major hepatectomy with extrahepatic bile duct resection: Importance of fecal acetic acid plus butyric acid minus lactic acid gap.

Science.gov (United States)

Yokoyama, Yukihiro; Mizuno, Takashi; Sugawara, Gen; Asahara, Takashi; Nomoto, Koji; Igami, Tsuyoshi; Ebata, Tomoki; Nagino, Masato

2017-10-01

To investigate the association between preoperative fecal organic acid concentrations and the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection for biliary malignancies. The fecal samples of 44 patients were collected before undergoing hepatectomy with bile duct resection for biliary malignancies. The concentrations of fecal organic acids, including acetic acid, butyric acid, and lactic acid, and representative fecal bacteria were measured. The perioperative clinical characteristics and the concentrations of fecal organic acids were compared between patients with and without postoperative infectious complications. Among 44 patients, 13 (30%) developed postoperative infectious complications. Patient age and intraoperative bleeding were significantly greater in patients with postoperative infectious complications compared with those without postoperative infectious complications. The concentrations of fecal acetic acid and butyric acid were significantly less, whereas the concentration of fecal lactic acid tended to be greater in the patients with postoperative infectious complications. The calculated gap between the concentrations of fecal acetic acid plus butyric acid minus lactic acid gap was less in the patients with postoperative infectious complications (median 43.5 vs 76.1 μmol/g of feces, P = .011). Multivariate analysis revealed that an acetic acid plus butyric acid minus lactic acid gap acid profile (especially low acetic acid, low butyric acid, and high lactic acid) had a clinically important impact on the incidence of postoperative infectious complications in patients undergoing major hepatectomy with extrahepatic bile duct resection. Copyright © 2017. Published by Elsevier Inc.

Studies on removal of plutonium from oxalic acid containing hydrochloric acid solutions

Energy Technology Data Exchange (ETDEWEB)

Ghadse, D R; Noronha, D M; Joshi, A R [Fuel Chemistry Division, Bhabha Atomic Research Centre, Mumbai (India)

1994-06-01

Solution containing hydrochloric acid, oxalic acid and considerable quantities of plutonium may be generated while recycling of scrap produced during the metallic fuel fabrication. Plutonium from such waste is normally recovered by anion exchange method after the destruction of oxalic acid using suitable oxidising agent. Solvent extraction and ion exchange methods are being explored in this laboratory for recovery of Pu from oxalic acid containing HCl solutions without prior destruction of oxalic acid. This paper describes the results on the determination of distribution ratios for extraction of Pu(IV) from hydrochloric acid using Aliquot-336 or HDEHP under varying experimental conditions. (author). 5 refs., 5 tabs.

Synthesis of labelled compound of ferulic acid and caffeic acid with tritium

International Nuclear Information System (INIS)

Yi Mingguang; Wang Caiyun

1986-01-01

Effective components of Chinese traditional herbs consist of many compounds, but some of the compounds usually contain unsaturated carbon-carbon double bonds. The unsaturated organic compounds 3 H-Ferulic acid and 3 H-Caffeic acid are prepared with their tritiated intermediates made by electric-dischange exposure method, which ensures the compounds contaning double bonds not hydrogenated. The 3 H-Ferulic acid is composed of 3 H-vanillin and Malonic acid. The 3 H-Caffeic acid is composed of 3 H-protocatechuyl aldehyde and Malonic acid and the specific activity of the products is 0.2 mCi/mg. The radiochemicaly purity is greater than 90%

Amino acid catabolism and generation of volatiles by lactic acid bacteria.

Science.gov (United States)

Tavaria, F K; Dahl, S; Carballo, F J; Malcata, F X

2002-10-01

Twelve isolates of lactic acid bacteria, belonging to the Lactobacillus, Lactococcus, Leuconostoc, and Enterococcus genera, were previously isolated from 180-d-old Serra da Estrela cheese, a traditional Portuguese cheese manufactured from raw milk and coagulated with a plant rennet. These isolates were subsequently tested for their ability to catabolize free amino acids, when incubated independently with each amino acid in free form or with a mixture thereof. Attempts were made in both situations to correlate the rates of free amino acid uptake with the numbers of viable cells. When incubated individually, leucine, valine, glycine, aspartic acid, serine, threonine, lysine, glutamic acid, and alanine were degraded by all strains considered; arginine tended to build up, probably because of transamination of other amino acids. When incubated together, the degradation of free amino acids by each strain was dependent on pH (with an optimum pH around 6.0). The volatiles detected in ripened Serra da Estrela cheese originated mainly from leucine, phenylalanine, alanine, and valine, whereas in vitro they originated mainly from valine, phenylalanine, serine, leucine, alanine, and threonine. The wild strains tested offer a great potential for flavor generation, which might justify their inclusion in a tentative starter/nonstarter culture for that and similar cheeses.

Combination of aspartic acid and glutamic acid inhibits tumor cell proliferation.

Science.gov (United States)

Yamaguchi, Yoshie; Yamamoto, Katsunori; Sato, Yoshinori; Inoue, Shinjiro; Morinaga, Tetsuo; Hirano, Eiichi

2016-01-01

Placental extract contains several biologically active compounds, and pharmacological induction of placental extract has therapeutic effects, such as improving liver function in patients with hepatitis or cirrhosis. Here, we searched for novel molecules with an anti-tumor activity in placental extracts. Active molecules were separated by chromatographic analysis, and their antiproliferative activities were determined by a colorimetric assay. We identified aspartic acid and glutamic acid to possess the antiproliferative activity against human hepatoma cells. Furthermore, we showed that the combination of aspartic acid and glutamic acid exhibited enhanced antiproliferative activity, and inhibited Akt phosphorylation. We also examined in vivo tumor inhibition activity using the rabbit VX2 liver tumor model. The treatment mixture (emulsion of the amino acids with Lipiodol) administered by hepatic artery injection inhibited tumor cell growth of the rabbit VX2 liver. These results suggest that the combination of aspartic acid and glutamic acid may be useful for induction of tumor cell death, and has the potential for clinical use as a cancer therapeutic agent.

Fatty acid profiles in tissues of mice fed conjugated linoleic acid

DEFF Research Database (Denmark)

Gøttsche, Jesper; Straarup, Ellen Marie

2006-01-01

The incorporation of vaccenic acid (VA, 0.5 and 1.2%), conjugated linoleic acid (CLA, mixture of primarily c9,t11- and t10,c12-CLA, 1.2%), linoleic acid (LA, 1.2%) and oleic acid (OA, 1.2%) into different tissues of mice was examined. The effects on the fatty acid composition of triacylglycerols...... (TAG) and phospholipids (PL) in kidney, spleen, liver and adipose tissue were investigated. VA and CLA (c9,t11- and t10,c12-CLA) were primarily found in TAG, especially in kidney and adipose tissue, respectively. Conversion of VA to c9,t11-CLA was indicated by our results, as both fatty acids were...... incorporated into all the analyzed tissues when a diet containing VA but not c9,t11-CLA was fed. Most of the observed effects on the fatty acid profiles were seen in the CLA group, whereas only minor effects were observed in the VA groups compared with the CA group. Thus, CLA increased n-3 polyunsaturated...

Valproic Acid

Science.gov (United States)

... acid is in a class of medications called anticonvulsants. It works by increasing the amount of a ... older (about 1 in 500 people) who took anticonvulsants such as valproic acid to treat various conditions ...

Research and Development in Natural Language Understanding as Part of the Strategic Computing Program.

Science.gov (United States)

1987-04-01

facilities. BBN is developing a series of increasingly sophisticated natural language understanding systems which will serve as an integrated interface...Haas, A.R. A Syntactic Theory of Belief and Action. Artificial Intelligence. 1986. Forthcoming. [6] Hinrichs, E. Temporale Anaphora im Englischen

Counter current extraction of phosphoric acid: Food grade acid production

International Nuclear Information System (INIS)

Shlewit, H.; AlIbrahim, M.

2009-01-01

Extraction, scrubbing and stripping of phosphoric acid from the Syrian wet-phosphoric acid was carried out using Micro-pilot plant of mixer settler type of 8 l/h capacity. Tributyl phosphate (TBP)/di-isopropyl ether (DIPE) in kerosene was used as extractant. Extraction and stripping equilibrium curves were evaluated. The number of extraction and stripping stages to achieve the convenient and feasible yield was determined. Detailed flow sheet was suggested for the proposed continuous process. Data obtained include useful information for the design of phosphoric acid extraction plant. The produced phosphoric acid was characterized using different analytical techniques. (author)

Reciprocal effects of 5-(tetradecyloxy)-2-furoic acid on fatty acid oxidation.

Science.gov (United States)

Otto, D A; Chatzidakis, C; Kasziba, E; Cook, G A

1985-10-01

Under certain incubation conditions 5-(tetradecyloxy)-2-furoic acid (TOFA) stimulated the oxidation of palmitate by hepatocytes, as observed by others. A decrease in malonyl-CoA concentration accompanied the stimulation of oxidation. Under other conditions, however, TOFA inhibited fatty acid oxidation. The observed effects of TOFA depended on the TOFA and fatty acid concentrations, the cell concentration, the time of TOFA addition relative to the addition of fatty acid, and the nutritional state of the animal (fed or starved). The data indicate that only under limited incubation conditions may TOFA be used as an inhibitor of fatty acid synthesis without inhibition of fatty acid oxidation. When rat liver mitochondria were preincubated with TOFA, ketogenesis from palmitate was slightly inhibited (up to 20%) at TOFA concentrations that were less than that of CoA, but the inhibition became almost complete (up to 90%) when TOFA was greater than or equal to the CoA concentration. TOFA had only slight or no inhibitory effects on the oxidation of palmitoyl-CoA, palmitoyl(-)carnitine, or butyrate. Since TOFA can be converted to TOFyl-CoA, the data suggest that the inhibition of fatty acid oxidation from palmitate results from the decreased availability of CoA for extramitochondrial activation of fatty acids. These data, along with previous data of others, indicate that inhibition of fatty acid oxidation by CoA sequestration is a common mechanism of a group of carboxylic acid inhibitors. A general caution is appropriate with regard to the interpretation of results when using TOFA in studies of fatty acid oxidation.

Fatty acid-producing hosts

Science.gov (United States)

Pfleger, Brian F; Lennen, Rebecca M

2013-12-31

Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

Aminocaproic Acid

Science.gov (United States)

Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

The use of lactic acid-producing, malic acid-producing, or malic acid-degrading yeast strains for acidity adjustment in the wine industry.

Science.gov (United States)

Su, Jing; Wang, Tao; Wang, Yun; Li, Ying-Ying; Li, Hua

2014-03-01

In an era of economic globalization, the competition among wine businesses is likely to get tougher. Biotechnological innovation permeates the entire world and intensifies the severity of the competition of the wine industry. Moreover, modern consumers preferred individualized, tailored, and healthy and top quality wine products. Consequently, these two facts induce large gaps between wine production and wine consumption. Market-orientated yeast strains are presently being selected or developed for enhancing the core competitiveness of wine enterprises. Reasonable biological acidity is critical to warrant a high-quality wine. Many wild-type acidity adjustment yeast strains have been selected all over the world. Moreover, mutation breeding, metabolic engineering, genetic engineering, and protoplast fusion methods are used to construct new acidity adjustment yeast strains to meet the demands of the market. In this paper, strategies and concepts for strain selection or improvement methods were discussed, and many examples based upon selected studies involving acidity adjustment yeast strains were reviewed. Furthermore, the development of acidity adjustment yeast strains with minimized resource inputs, improved fermentation, and enological capabilities for an environmentally friendly production of healthy, top quality wine is presented.

Acid Balance, Dietary Acid Load, and Bone Effects—A Controversial Subject

Directory of Open Access Journals (Sweden)

Lynda Frassetto

2018-04-01

Full Text Available Modern Western diets, with higher contents of animal compared to fruits and vegetable products, have a greater content of acid precursors vs. base precursors, which results in a net acid load to the body. To prevent inexorable accumulation of acid in the body and progressively increasing degrees of metabolic acidosis, the body has multiple systems to buffer and titrate acid, including bone which contains large quantities of alkaline salts of calcium. Both in vitro and in vivo studies in animals and humans suggest that bone base helps neutralize part of the dietary net acid load. This raises the question of whether decades of eating a high acid diet might contribute to the loss of bone mass in osteoporosis. If this idea is true, then additional alkali ingestion in the form of net base-producing foods or alkalinizing salts could potentially prevent this acid-related loss of bone. Presently, data exists that support both the proponents as well as the opponents of this hypothesis. Recent literature reviews have tended to support either one side or the other. Assuming that the data cited by both sides is correct, we suggest a way to reconcile the discordant findings. This overview will first discuss dietary acids and bases and the idea of changes in acid balance with increasing age, then review the evidence for and against the usefulness of alkali therapy as a treatment for osteoporosis, and finally suggest a way of reconciling these two opposing points of view.

Inhibition studies of soybean (Glycine max) urease with heavy metals, sodium salts of mineral acids, boric acid, and boronic acids.

Science.gov (United States)

Kumar, Sandeep; Kayastha, Arvind M

2010-10-01

Various inhibitors were tested for their inhibitory effects on soybean urease. The K(i) values for boric acid, 4-bromophenylboronic acid, butylboronic acid, and phenylboronic acid were 0.20 +/- 0.05 mM, 0.22 +/- 0.04 mM, 1.50 +/- 0.10 mM, and 2.00 +/- 0.11 mM, respectively. The inhibition was competitive type with boric acid and boronic acids. Heavy metal ions including Ag(+), Hg(2+), and Cu(2+) showed strong inhibition on soybean urease, with the silver ion being a potent inhibitor (IC(50) = 2.3 x 10(-8) mM). Time-dependent inhibition studies exhibited biphasic kinetics with all heavy metal ions. Furthermore, inhibition studies with sodium salts of mineral acids (NaF, NaCl, NaNO(3), and Na(2)SO(4)) showed that only F(-) inhibited soybean urease significantly (IC(50) = 2.9 mM). Competitive type of inhibition was observed for this anion with a K(i) value of 1.30 mM.

Citric acid urine test

Science.gov (United States)

Urine - citric acid test; Renal tubular acidosis - citric acid test; Kidney stones - citric acid test; Urolithiasis - citric acid test ... No special preparation is necessary for this test. But the results ... test is usually done while you are on a normal diet. Ask your ...

The Defense-Related Isoleucic Acid Differentially Accumulates in Arabidopsis Among Branched-Chain Amino Acid-Related 2-Hydroxy Carboxylic Acids

Directory of Open Access Journals (Sweden)

Rafał P. Maksym

2018-06-01

Full Text Available The branched-chain amino acid (BCAA related 2-hydroxy carboxylic acid isoleucic acid (ILA enhances salicylic acid-mediated pathogen defense in Arabidopsis thaliana. ILA has been identified in A. thaliana as its glucose conjugate correlated with the activity of the small-molecule glucosyltransferase UGT76B1, which can glucosylate both salicylic acid and ILA in vitro. However, endogenous levels of the ILA aglycon have not yet been determined in planta. To quantify ILA as well as the related leucic acid (LA and valic acid (VA in plant extracts, a sensitive method based on the derivatization of small carboxylic acids by silylation and gas chromatography–mass spectrometric analysis was developed. ILA was present in all species tested including several monocotyledonous and dicotyledonous plants as well as broadleaf and coniferous trees, whereas LA and VA were only detectable in a few species. In A. thaliana both ILA and LA were found. However, their levels varied during plant growth and in root vs. leaves. ILA levels were higher in 2-week-old leaves and decreased in older plants, whereas LA exhibited a reverted accumulation pattern. Roots displayed higher ILA and LA levels compared to leaves. ILA was inversely related to UGT76B1 expression level indicating that UGT76B1 glucosylates ILA in planta. In contrast, LA was not affected by the expression of UGT76B1. To address the relation of both 2-hydroxy acids to plant defense, we studied ILA and LA levels upon infection by Pseudomonas syringae. LA abundance remained unaffected, whereas ILA was reduced. This change suggests an ILA-related attenuation of the salicylic acid response. Collectively, the BCAA-related ILA and LA differentially accumulated in Arabidopsis, supporting a specific role and regulation of the defense-modulating small-molecule ILA among these 2-hydroxy acids. The new sensitive method will pave the way to further unravel their role in plants.

Influence of acid diffusion on the performance of lead-acid cells

Energy Technology Data Exchange (ETDEWEB)

Kappus, W.; Bohmann, J.

1983-11-01

A model for the discharge performance of the lead-acid cell is proposed. Diffusion of acid into the porous electrodes, which is connected with diffusional polarization, is considered as the principal factor in the transport process. The end of discharge is determined either by acid depletion inside the electrodes or by exhaustion of the active material, where utilization of the active material as a function of the acid density and the specific current is determined from empirical expressions. Curves of diffusional polarizations as a function of the discharge time are presented. Calculated discharge capacities show the influence of various parameters such as electrode thickness, current, and acid density. Tubular and pasted plates are considered.

Ascorbic Acid

Science.gov (United States)

Ascorbic acid is used to prevent and treat scurvy, a disease caused by a lack of vitamin C in ... Ascorbic acid comes in extended-release (long-acting) capsules and tablets, lozenges, syrup, chewable tablets, and liquid drops to ...

Ethacrynic Acid

Science.gov (United States)

Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

Flavor Compounds in Pixian Broad-Bean Paste: Non-Volatile Organic Acids and Amino Acids

Directory of Open Access Journals (Sweden)

Hongbin Lin

2018-05-01

Full Text Available Non-volatile organic acids and amino acids are important flavor compounds in Pixian broad-bean paste, which is a traditional Chinese seasoning product. In this study, non-volatile organic acids, formed in the broad-bean paste due to the metabolism of large molecular compounds, are qualitatively and quantitatively determined by high-performance liquid chromatography (HPLC. Amino acids, mainly produced by hydrolysis of soybean proteins, were determined by the amino acid automatic analyzer. Results indicated that seven common organic acids and eighteen common amino acids were found in six Pixian broad-bean paste samples. The content of citric acid was found to be the highest in each sample, between 4.1 mg/g to 6.3 mg/g, and malic acid were between 2.1 mg/g to 3.6 mg/g ranked as the second. Moreover, fumaric acid was first detected in fermented bean pastes albeit with a low content. For amino acids, savory with lower sour taste including glutamine (Gln, glutamic acid (Glu, aspartic acid (Asp and asparagines (Asn were the most abundant, noted to be 6.5 mg/g, 4.0 mg/g, 6.4 mg/g, 4.9 mg/g, 6.2 mg/g and 10.2 mg/g, and bitter taste amino acids followed. More importantly, as important flavor materials in Pixian broad-bean paste, these two groups of substances are expected to be used to evaluate and represent the flavor quality of Pixian broad-bean paste. Moreover, the results revealed that citric acid, glutamic acid, methionine and proline were the most important flavor compounds. These findings are agreat contribution for evaluating the quality and further assessment of Pixian broad-bean paste.

Flavor Compounds in Pixian Broad-Bean Paste: Non-Volatile Organic Acids and Amino Acids.

Science.gov (United States)

Lin, Hongbin; Yu, Xiaoyu; Fang, Jiaxing; Lu, Yunhao; Liu, Ping; Xing, Yage; Wang, Qin; Che, Zhenming; He, Qiang

2018-05-29

Non-volatile organic acids and amino acids are important flavor compounds in Pixian broad-bean paste, which is a traditional Chinese seasoning product. In this study, non-volatile organic acids, formed in the broad-bean paste due to the metabolism of large molecular compounds, are qualitatively and quantitatively determined by high-performance liquid chromatography (HPLC). Amino acids, mainly produced by hydrolysis of soybean proteins, were determined by the amino acid automatic analyzer. Results indicated that seven common organic acids and eighteen common amino acids were found in six Pixian broad-bean paste samples. The content of citric acid was found to be the highest in each sample, between 4.1 mg/g to 6.3 mg/g, and malic acid were between 2.1 mg/g to 3.6 mg/g ranked as the second. Moreover, fumaric acid was first detected in fermented bean pastes albeit with a low content. For amino acids, savory with lower sour taste including glutamine (Gln), glutamic acid (Glu), aspartic acid (Asp) and asparagines (Asn) were the most abundant, noted to be 6.5 mg/g, 4.0 mg/g, 6.4 mg/g, 4.9 mg/g, 6.2 mg/g and 10.2 mg/g, and bitter taste amino acids followed. More importantly, as important flavor materials in Pixian broad-bean paste, these two groups of substances are expected to be used to evaluate and represent the flavor quality of Pixian broad-bean paste. Moreover, the results revealed that citric acid, glutamic acid, methionine and proline were the most important flavor compounds. These findings are agreat contribution for evaluating the quality and further assessment of Pixian broad-bean paste.

Determination of acetylsalicylic acid and salicylic acid in foods, using HPLC with fluorescence detection.

NARCIS (Netherlands)

Venema, D.P.; Hollman, P.C.H.; Janssen, P.L.T.M.K.; Katan, M.B.

1996-01-01

We developed a specific and sensitive HPLC method with fluorescence detection for the determination of free acetylsalicylic acid, free salicylic acid, and free salicylic acid plus salicylic acid after alkaline hydrolysis (free-plus-bound) in foods. Acetylsalicylic acid was detected after postcolumn

Comparison of clinical characteristics of chronic cough due to non-acid and acid gastroesophageal reflux.

Science.gov (United States)

Xu, Xianghuai; Yang, Zhongmin; Chen, Qiang; Yu, Li; Liang, Siwei; Lü, Hanjing; Qiu, Zhongmin

2015-04-01

Little is known about non-acid gastroesophageal reflux-induced chronic cough (GERC). The purpose of the study is to explore the clinical characteristics of non-acid GERC. Clinical symptoms, cough symptom score, capsaicin cough sensitivity, gastroesophageal reflux diagnostic questionnaire (GerdQ) score, findings of multichannel intraluminal impedance-pH monitoring (MII-pH) and response to pharmacological anti-reflux therapy were retrospectively reviewed in 38 patients with non-acid GERC and compared with those of 49 patients with acid GERC. Non-acid GERC had the similar cough character, cough symptom score, and capsaicin cough sensitivity to acid GERC. However, non-acid GERC had less frequent regurgitation (15.8% vs 57.1%, χ(2)  = 13.346, P = 0.000) and heartburn (7.9% vs 32.7%, χ(2)  = 7.686, P  = 0.006), and lower GerdQ score (7.4 ± 1.4 vs 10.6 ± 2.1, t = -6.700, P = 0.003) than acid GERC. Moreover, MII-pH revealed more weakly acidic reflux episodes, gas reflux episodes and a higher symptom association probability (SAP) for non-acid reflux but lower DeMeester score, acidic reflux episodes and SAP for acid reflux in non-acid GERC than in acid GERC. Non-acid GERC usually responded to the standard anti-reflux therapy but with delayed cough resolution or attenuation when compared with acid GERC. Fewer patients with non-acid GERC needed an augmented acid suppressive therapy or treatment with baclofen. There are some differences in the clinical manifestations between non-acid and acid GERC, but MII-pH is essential to diagnose non-acid GERC. © 2014 John Wiley & Sons Ltd.

Reactions of tritium atoms with amino acids, deuterated amino acids and mixtures of amino acids. Additivity property and isotope effect

International Nuclear Information System (INIS)

Badun, G.A.; Filatov, Eh.S.

1988-01-01

Interaction of tritium atoms with glycine (1) and leucine (2) amino acids, deuterated amino acids, their mixtures and glycylleucine (3) peptide in the 77-300 K temperature range is studied in isothermal and gradient regimes. Tagged amino acids were separated from targets after conducting the reaction. At T 150 K are associated with intermolecular transmission of free valence in the mixture of amino acids. Regularities of the reaction found for the mixture of amino acids are conserved for (3) as well, i.e. the peptide bond does not essentially affect the reaction of isotopic exchange conditioned by atomic tritium

Comparative analysis of amino acids and amino-acid derivatives in protein crystallization

International Nuclear Information System (INIS)

Ito, Len; Shiraki, Kentaro; Yamaguchi, Hiroshi

2010-01-01

New types of aggregation suppressors, such as amino acids and their derivatives, were focused on as fourth-component additives. Data were obtained that indicated that the additives promote protein crystallization. Optimal conditions for protein crystallization are difficult to determine because proteins tend to aggregate in saturated solutions. This study comprehensively evaluates amino acids and amino-acid derivatives as additives for crystallization. This fourth component of the solution increases the probability of crystallization of hen egg-white lysozyme in various precipitants owing to a decrease in aggregation. These results suggest that the addition of certain types of amino acids and amino-acid derivatives, such as Arg, Lys and esterified and amidated amino acids, is a simple method of improving the success rate of protein crystallization

Studies on the solvent extraction behaviour of Pu(IV) from nitric acid, nitric-perchloric acid and hydrochloric acids, by di,2-ethylhexyl phosphoric acid (HDEHP)