Interactions, Disorder and Dephasing in Superconducting Films and Quantum Hall Systems
International Nuclear Information System (INIS)
Auerbach, A.
1999-01-01
It is shown that a large class of two dimensional Superconductor to Insulator (SC-I), and (Quantum Hall to Insulator (QH-I) transitions can be understood by assuming that the thermodynamic transition in the clean system is first order. The finite correlation lengths at that transition yield a natural separation of the disorder into short and long wavelengths which are then straightforward to incorporate perturbatively and semi classically respectively. This approach reduces problems of disorder+interactions to puddle network models, whose studies have already yielded insight into experiments of QH-I and SC-I. For the CQH-I, the difference between Landauer-Buttiker and Boltzman theories highlights effects of dephasing
Mani, Arjun; Benjamin, Colin
2016-04-13
On the surface of 2D topological insulators, 1D quantum spin Hall (QSH) edge modes occur with Dirac-like dispersion. Unlike quantum Hall (QH) edge modes, which occur at high magnetic fields in 2D electron gases, the occurrence of QSH edge modes is due to spin-orbit scattering in the bulk of the material. These QSH edge modes are spin-dependent, and chiral-opposite spins move in opposing directions. Electronic spin has a larger decoherence and relaxation time than charge. In view of this, it is expected that QSH edge modes will be more robust to disorder and inelastic scattering than QH edge modes, which are charge-dependent and spin-unpolarized. However, we notice no such advantage accrues in QSH edge modes when subjected to the same degree of contact disorder and/or inelastic scattering in similar setups as QH edge modes. In fact we observe that QSH edge modes are more susceptible to inelastic scattering and contact disorder than QH edge modes. Furthermore, while a single disordered contact has no effect on QH edge modes, it leads to a finite charge Hall current in the case of QSH edge modes, and thus a vanishing of the pure QSH effect. For more than a single disordered contact while QH states continue to remain immune to disorder, QSH edge modes become more susceptible--the Hall resistance for the QSH effect changes sign with increasing disorder. In the case of many disordered contacts with inelastic scattering included, while quantization of Hall edge modes holds, for QSH edge modes a finite charge Hall current still flows. For QSH edge modes in the inelastic scattering regime we distinguish between two cases: with spin-flip and without spin-flip scattering. Finally, while asymmetry in sample geometry can have a deleterious effect in the QSH case, it has no impact in the QH case.
International Nuclear Information System (INIS)
Mani, Arjun; Benjamin, Colin
2016-01-01
On the surface of 2D topological insulators, 1D quantum spin Hall (QSH) edge modes occur with Dirac-like dispersion. Unlike quantum Hall (QH) edge modes, which occur at high magnetic fields in 2D electron gases, the occurrence of QSH edge modes is due to spin–orbit scattering in the bulk of the material. These QSH edge modes are spin-dependent, and chiral-opposite spins move in opposing directions. Electronic spin has a larger decoherence and relaxation time than charge. In view of this, it is expected that QSH edge modes will be more robust to disorder and inelastic scattering than QH edge modes, which are charge-dependent and spin-unpolarized. However, we notice no such advantage accrues in QSH edge modes when subjected to the same degree of contact disorder and/or inelastic scattering in similar setups as QH edge modes. In fact we observe that QSH edge modes are more susceptible to inelastic scattering and contact disorder than QH edge modes. Furthermore, while a single disordered contact has no effect on QH edge modes, it leads to a finite charge Hall current in the case of QSH edge modes, and thus a vanishing of the pure QSH effect. For more than a single disordered contact while QH states continue to remain immune to disorder, QSH edge modes become more susceptible—the Hall resistance for the QSH effect changes sign with increasing disorder. In the case of many disordered contacts with inelastic scattering included, while quantization of Hall edge modes holds, for QSH edge modes a finite charge Hall current still flows. For QSH edge modes in the inelastic scattering regime we distinguish between two cases: with spin-flip and without spin-flip scattering. Finally, while asymmetry in sample geometry can have a deleterious effect in the QSH case, it has no impact in the QH case. (paper)
Tunneling Spectroscopy of Quantum Hall States in Bilayer Graphene
Wang, Ke; Harzheim, Achim; Watanabe, Kenji; Taniguchi, Takashi; Kim, Philip
In the quantum Hall (QH) regime, ballistic conducting paths along the physical edges of a sample appear, leading to quantized Hall conductance and vanishing longitudinal magnetoconductance. These QH edge states are often described as ballistic compressible strips separated by insulating incompressible strips, the spatial profiles of which can be crucial in understanding the stability and emergence of interaction driven QH states. In this work, we present tunneling transport between two QH edge states in bilayer graphene. Employing locally gated device structure, we guide and control the separation between the QH edge states in bilayer graphene. Using resonant Landau level tunneling as a spectroscopy tool, we measure the energy gap in bilayer graphene as a function of displacement field and probe the emergence and evolution of incompressible strips.
Propagation of superconducting coherence via chiral quantum-Hall edge channels.
Park, Geon-Hyoung; Kim, Minsoo; Watanabe, Kenji; Taniguchi, Takashi; Lee, Hu-Jong
2017-09-08
Recently, there has been significant interest in superconducting coherence via chiral quantum-Hall (QH) edge channels at an interface between a two-dimensional normal conductor and a superconductor (N-S) in a strong transverse magnetic field. In the field range where the superconductivity and the QH state coexist, the coherent confinement of electron- and hole-like quasiparticles by the interplay of Andreev reflection and the QH effect leads to the formation of Andreev edge states (AES) along the N-S interface. Here, we report the electrical conductance characteristics via the AES formed in graphene-superconductor hybrid systems in a three-terminal configuration. This measurement configuration, involving the QH edge states outside a graphene-S interface, allows the detection of the longitudinal and QH conductance separately, excluding the bulk contribution. Convincing evidence for the superconducting coherence and its propagation via the chiral QH edge channels is provided by the conductance enhancement on both the upstream and the downstream sides of the superconducting electrode as well as in bias spectroscopy results below the superconducting critical temperature. Propagation of superconducting coherence via QH edge states was more evident as more edge channels participate in the Andreev process for high filling factors with reduced valley-mixing scattering.
Type QH-200 conveyor-belt nuclear scale
International Nuclear Information System (INIS)
Li Shuming; Dong Shiyuan; Li Furong; Wan Zemin
1991-01-01
Type QH-200 conveyor-belt nuclear scale is a reliable and on-line device that weighs solids mass flow continuously by γ-ray absorption and scattering. The operation principle and measuring method are described. And some factors influencing the accuracy are discussed. The full scale total weight of type QH-200 nuclear scale is 10 6 t. The result of calibration in the industrial field shows that the accuracy of QH-200 is better than ±1.0% for typical belt loading
International Nuclear Information System (INIS)
Lal, Siddhartha
2007-09-01
Motivated by surprises in recent experimental findings, we study transport in a model of a quantum Hall edge system with a gate-voltage controlled constriction. A finite backscattered current at finite edge-bias is explained as arising from the splitting of edge current caused by the difference in the filling fractions of the bulk (ν 1 ) and constriction (ν 2 ) quantum Hall fluid regions. We develop a hydrodynamic theory for bosonic edge modes inspired by this model. The constriction region splits the incident long-wavelength chiral edge density-wave excitations among the transmitting and reflecting edge states encircling it. The competition between two interedge tunneling processes taking place inside the constriction, related by a quasiparticle-quasihole (qp-qh) symmetry, is accounted for by computing the boundary theories of the system. This competition is found to determine the strong coupling configuration of the system. A separatrix of qp-qh symmetric gapless critical states is found to lie between the relevant RG flows to a metallic and an insulating configuration of the constriction system. This constitutes an interesting generalisation of the Kane-Fisher quantum impurity model. The features of the RG phase diagram are also confirmed by computing various correlators and chiral linear conductances of the system. In this way, our results find excellent agreement with many recent puzzling experimental results for the cases of ν 1 = 1/3, 1. We also discuss and make predictions for the case of a constriction system with ν 2 = 5/2. (author)
Density-Imbalance Stability Diagram of the νT = 1 Bilayer Electron System at Full Spin Polarization
International Nuclear Information System (INIS)
Takase, Keiko; Muraki, Koji
2011-01-01
We investigate the evolution of the total Landau level filling factor ν T = 1 bilayer quantum Hall (QH) state versus density imbalance at full spin polarization under a tilted magnetic field. When the system is well below the compressible-incompressible transition point at the balanced density, the ν T = 1 QH state extends widely versus density imbalance, continuously merging into the single-layer ν = 1 QH state. In the vicinity of the transition point, the ν T = 1 QH state is only weakly developed at small imbalance but increases in strength toward ν T = 1/3 + 2/3, where it is clearly separated from the single-layer ν = 1 QH state. These results suggest that the system at the imbalance of Δν = 1/3 undergoes a transition from the correlated ν T = 1 QH state to single-layer fractional QH states with increasing density.
Topological phase transitions and quantum Hall effect in the graphene family
Ledwith, P.; Kort-Kamp, W. J. M.; Dalvit, D. A. R.
2018-04-01
Monolayer staggered materials of the graphene family present intrinsic spin-orbit coupling and can be driven through several topological phase transitions using external circularly polarized lasers and static electric or magnetic fields. We show how topological features arising from photoinduced phase transitions and the magnetic-field-induced quantum Hall effect coexist in these materials and simultaneously impact their Hall conductivity through their corresponding charge Chern numbers. We also show that the spectral response of the longitudinal conductivity contains signatures of the various phase-transition boundaries, that the transverse conductivity encodes information about the topology of the band structure, and that both present resonant peaks which can be unequivocally associated with one of the four inequivalent Dirac cones present in these materials. This complex optoelectronic response can be probed with straightforward Faraday rotation experiments, allowing the study of the crossroads between quantum Hall physics, spintronics, and valleytronics.
Quantum spin/valley Hall effect and topological insulator phase transitions in silicene
Tahir, M.
2013-04-26
We present a theoretical realization of quantum spin and quantum valley Hall effects in silicene. We show that combination of an electric field and intrinsic spin-orbit interaction leads to quantum phase transitions at the charge neutrality point. This phase transition from a two dimensional topological insulator to a trivial insulating state is accompanied by a quenching of the quantum spin Hall effect and the onset of a quantum valley Hall effect, providing a tool to experimentally tune the topological state of silicene. In contrast to graphene and other conventional topological insulators, the proposed effects in silicene are accessible to experiments.
Quantum spin/valley Hall effect and topological insulator phase transitions in silicene
Tahir, M.; Manchon, Aurelien; Sabeeh, K.; Schwingenschlö gl, Udo
2013-01-01
We present a theoretical realization of quantum spin and quantum valley Hall effects in silicene. We show that combination of an electric field and intrinsic spin-orbit interaction leads to quantum phase transitions at the charge neutrality point. This phase transition from a two dimensional topological insulator to a trivial insulating state is accompanied by a quenching of the quantum spin Hall effect and the onset of a quantum valley Hall effect, providing a tool to experimentally tune the topological state of silicene. In contrast to graphene and other conventional topological insulators, the proposed effects in silicene are accessible to experiments.
Sequence Data: QH06665 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH06665 KG_XK2747 c/t tggttgaatgaaaaacaaacaaaaaaaagaaattgcaaatcaataygtagactatggtcttatttatgtaaa...tataatattaatgatgacaatctgctctaaagatgaaattgtctggttataacatggtcctgctgccttaggattgataagggaaggggaaaaagagagtgacaaaaggggaagaaaatgaaaaagggaggagaaggtaataaaaa
Sequence Data: QH13367 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH13367 KG00D1960 c/t tgccttcaaagtaaaaccacaagtactttaggataatttttcaagagtgtacaaaaagacaaaaattaaaaacttctaaa...tgaggacagtctagtttaygaattatttaaaacttctaaattttaatgattcataagtgtgtagaaaacaggcaacaaatttcttcaa
Sequence Data: QH12765 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH12765 KG00D1789 a/g aagaggtatttgcacctctgaaagggcacaaaaaaaragagagagagagaaagagaaagaaagaaaaaagaaataaagaaagaaa...aagagagaaagtggtacaagcagttcttataaaaaataaaactatgtgtcactatttcaacttgtctttattgaaactgca
Sequence Data: QH06556 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH06556 KG11K2604 c/t cacaaaaataagtccttgtccagcaaaaatcacctttacacaggtttgcaagacagaccacagataaaa...cattttcaatgcatttaagaaaagggttgatgtccctaataaactaaaaatgaataacytacctactaatcaatataaaaagagtacttttcagaatcgttttagatttttacaacgacatgtgccattaaaaaca
Sequence Data: QH12123 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH12123 KG00D1694 a/g tcccatagaaaggacccaaaaaaggggtggggcaaagggtgataaagacatggtatcaccatagaaaaa...tgrcatcaccatagaaaaaataaaaatcctatgaagagtaactggaaactctctttggaaattagttatccatgtggtcagataacagtgggga
Sequence Data: QH12843 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH12843 KG00D1861 c/t aaacaaaagttaaaaccaaacaaacccatgggagtaaataagyctgtagagggaacagaaaatatacagagtaaagatgaaa...gtctaaggcagaattctaagaaacaaccatagatgttaaaatgtaaaccaacaaaatggcagaaatatgattga
Photo-modulation of the spin Hall conductivity of mono-layer transition metal dichalcogenides
Energy Technology Data Exchange (ETDEWEB)
Sengupta, Parijat; Bellotti, Enrico [Department of Electrical and Computer Engineering, Boston University, Boston, MA 02215 (United States)
2016-05-23
We report on a possible optical tuning of the spin Hall conductivity in mono-layer transition metal dichalcogenides. Light beams of frequencies much higher than the energy scale of the system (the off-resonant condition) do not excite electrons but rearrange the band structure. The rearrangement is quantitatively established using the Floquet formalism. For such a system of mono-layer transition metal dichalcogenides, the spin Hall conductivity (calculated with the Kubo expression in presence of disorder) exhibits a drop at higher frequencies and lower intensities. Finally, we compare the spin Hall conductivity of the higher spin-orbit coupled WSe{sub 2} to MoS{sub 2}; the spin Hall conductivity of WSe{sub 2} was found to be larger.
Sequence Data: QH01692 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH01692 KG00B1408 a/g aagtgggggctgggattgttacatatggccaaaaatttaagcttctttcaatagtattagtattgaaataatacatctttaaaa...cgcttgagggattagatagggaaagaaaaggcacgtacaaaaaaatccaaccgatgccgatcctgtgatttacgtaacaccacaaacttgcaaaaggcaaaaaa...tcagaagcaaaaatccataaaccatcaaaatrcagaaaccaaaaatcccaagccaccacaccagaaagaaaaaaacccagaacaacagcaaaaacccctgtcctaaataaaaataaagcaaatgaacccaccgaaaa
Sequence Data: QH04613 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH04613 KG00M1523 c/t tgttttcactgtttaaagaaagtttgataaaaaattggcttaaattaaaaattaaaatacttaataattttttaaaa...tgtagaacaagtgtgcagaatactggccgtcaatggaagagggyactcgggcttttggagatgttgttgtaaagatcaaccagcacaaaagatgtccagattacatcattcagaaa...ttgaacattgtaaatgtgagtttgctttttacataatttttgttttgatacttttttataaaaatataattatggaatattaaaagtgagaaaa
Sequence Data: QH15563 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH15563 KG07K6447 c/g tgctgtctcatcttcaagacagtcaatttaaagtgaaggactsagaaatagagcttctaagggctgaaaa...cattttggtctaatttagacattaaaacgtcaattttaaatattatacaaaaaaactgccttatgtttttccccgttttaattttcagaattattgaagtaaatcaaaatcaaaa...gcaggtggaacaggatattaaagttgctatatttacactgatggtagaaataaataaaaaaggaaaagctctactgcatcagttagaggtaagtgactgcccatgggatagtata
Sequence Data: QH12621 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH12621 KG00G2325 a/g ctcaaccacacacacacacccctcaaacaccacacacccacctcaaacaccacacacacatatccctcaaacactacaaaaacac...acacacacacctcaaacaccacacatgcacacacacctgaaacaccacacacctgcctcaaacactccacacacaccacacacagacacgtacaca...gccccccgcacccagccacagcttacacgcacacagacacgcgtacgcaggagaaagggtgtcaaagcttttgctagtcgtgaaggaaragcccgcagtccatggggctgcacggttttc
Sequence Data: QH04051 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH04051 KG00K1394 at/-- ttattcctactgccctgatagttggtctggctcctagaaattcagatnntttcttccctccaggtgagawtatgcgaagaaa...ggaacactggcaaaattatttccctgattttcttctctcaggctgtctttccctcccctttaagattgtgtactccgtctcaaaaaaaaaagaaaaaaaaaa...gattgtagacccagcctataaattcataggatcaagaattcttactaacactttttctaacaaccttaaatctctgatagtagcacccac...ttgacttcgttttgtatggatagatttattctaatctctctgtagattgttttaatcccaagcaaatgcgagagcataaaa...tagtgtatttgccctccctccaggcttttctggtagtattttgtctgtgaaactaaaaggctctagctgcttttaaaaaagggaaggagtaaggatgagcttttgaaaaaaaaaaaaaaaaaaaaaccccggggggaaa
Sequence Data: QH05435 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH05435 KG00T2450 a/g tgtcacccaaaatgtacatccaaagtacaaaaagttaaaggtaaatcacgaagtattaaaaaa...tcttgttgtgcagattttgagtgtttggaaaacagtaaaaaagatgtggcattctgttattcatgccagttgttctgccaaaaatattttagctgtggaagagrg...tcatttgcaacccacggaacttctaattggaaaaaaaccctggaaaaattcagaaagcatgaaaaaagtgaaatgcatttgaagtcattggaattttggagagaatac...caattttgtgatggagctgtcagtgacgatttatctattcattcgaaacagattgagggaaataaaaagtacctaaagcttataattgaaaatattttatttcttggaaagcagtgtttaccc
Valley polarized quantum Hall effect and topological insulator phase transitions in silicene
Tahir, M.; Schwingenschlö gl, Udo
2013-01-01
encountered for graphene, in particular the zero band gap and weak spin orbit interaction. We demonstrate a valley polarized quantum Hall effect and topological insulator phase transitions. We use the Kubo formalism to discuss the Hall conductivity and address
Sequence Data: QH11734 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH11734 KG00K5232 c/t aaataatgagtgaccagcggtttagacgggttgcaaaggacccgagattttgggaaatgccagaaaaggatcgaaaagtcaaaa...ttgacaagagatttcgagccatgtttcatgacaagaagttcaagttgaactatgccgtggataaaagagggcgccccattagcc...ayagcactacagaggatttgaagcgtttttacgacctttcagattctgattccaatctctctggtgaagatagcaaagcattgagtcaaaagaaaataaagaagaaaaaaacccagactaaaaaagaaa...tcgattcaaaaaatctagttgagaaaaagaaagaaaccaagaaggctaatcacaagggttctgaaaataaaa...ctgatttagataattctataggaattaaaaaaatgaaaacctcatgtaaatttaagatagattcaaacataagtccgaagaaggatagcaaagaatttacacaaaaaaataagaaa
Sequence Data: QH10971 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH10971 KG06G1920 a/g ggccccaataccatcccggttaaaattgaataaaaggaaacttgcaggtcatcaggagacttctaccaaaa...gtagtgagactggatccacaaaagataattttatacaaaataatccttgtaatagtaatcctgagaaggataatgcattggctagtgatttaactaaaaccactcgtggagcttttgaaaa...taaaacacccacagatggttttatagactgtcactttggagatggracgttagaaactgagcagtcctttggactatatggaaataaatacacacttagagccaaa...cgcaaggtaaattatgagactgaagacagtgagtcaagttttgtaactcacaactcaaaaa...ttagtctacctcatcccatggaaattggtgaaagtttagatggaactctcaaatcccgaaaacgaagaaaaatgtctaaaaagctgccccctgtcatcataaagta
Sequence Data: QH03807 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH03807 KG00K1582 c/t ctctaagtatacatttttatgtagccttgacagttgaatcattttaatattttacatttccaaaaaataagtatgaggagataaa...cctaaaaataaatataaataaaaccaataaatctaatgatatattacattgattcaatgcctacaaagaattaaaaaactctcagtggtgtatattctaaggaaaaaa...gtaagatattggaaaaaattagatattgaacttaagttaatttggtatagcttacaaaacctgtatgttgatatttgggggtg...ctagtgttccatttgtggaagacaggaaatataaacatgggatggaggtgttgcagtcttgttgtctgaggtattaccygagctctttgtctaatgaccaagaaaa...ttaaggaccatggacaccaaaggtgaagctggggcaaaggtttaataagcaaaataggaaagctctttgcagtagaaggggga
Sequence Data: QH09606 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH09606 KG07G1736 a/t cctttctaaagatggaaggaaggtacaaggttgatacctgagtgcatgtaaattattgtgtttaaaatgcaccaaagaaaaaa...gtaagctagcatatgcaagtataaaaatgcttttctcaatgcaaaaaatgtttttggaaatttgttaaagtgttaagaaaacaaaaatgcattagaaaatatgaaaa...ttgttgacagtgatagctcaataaaaatttwaaaaattatgcaagttctatctgataaaagtgatatttaataaacttttagtttcttgtcattagctcttttgaaaa...tgatttttttgtattcagaacacagactccagtttagaaactaatacaaattttacctattcaagtgcttaattttacagcaaa...atggaaagtaaattttgttttgcctttatttctacagaagccactggtctcccccagacagtagtctgttataacccagaccagattcctccagaaaa
Sequence Data: QH13192 [dbQSNP[Archive
Lifescience Database Archive (English)
Full Text Available QH13192 KG00G2416 c/t aaatgttttgtgaccttctctatgagtatcaaataaatagctcaaaaytgaaatatttaaaatgagactagaaaa...gtatttcttaaatatggtaaagagaatataaaataaaaaattaacattacctgtaacagaaaaacattagagaaacccttcttaaaaacaagatcaaaa...tatgggcgcacattgttaccacaggtaatgctgtcctgggtattcttatatgaaaatgaaataacaagactagtaatttaaagataaaaatgttattacactgtttaaataccaggaaaaatcaaa...tactaagaaatctgaaaaataaaaattatctagaaatttcactaacaaaggtaaccaggaatagataaacaattaaa...gatcaacttcattcaagttaattaaaacctctaaatagaaattataacacttctgcagaaatgattaaataaaaaggaggtatctcagggaggtggacctgaaagaaagattaattatatattttattagatagcacattcattcttaattatcagcagaa
Spin-Hall effect and emergent antiferromagnetic phase transition in n-Si
Lou, Paul C.; Kumar, Sandeep
2018-04-01
Spin current experiences minimal dephasing and scattering in Si due to small spin-orbit coupling and spin-lattice interactions is the primary source of spin relaxation. We hypothesize that if the specimen dimension is of the same order as the spin diffusion length then spin polarization will lead to non-equilibrium spin accumulation and emergent phase transition. In n-Si, spin diffusion length has been reported up to 6 μm. The spin accumulation in Si will modify the thermal transport behavior of Si, which can be detected with thermal characterization. In this study, we report observation of spin-Hall effect and emergent antiferromagnetic phase transition behavior using magneto-electro-thermal transport characterization. The freestanding Pd (1 nm)/Ni80Fe20 (75 nm)/MgO (1 nm)/n-Si (2 μm) thin film specimen exhibits a magnetic field dependent thermal transport and spin-Hall magnetoresistance behavior attributed to Rashba effect. An emergent phase transition is discovered using self-heating 3ω method, which shows a diverging behavior at 270 K as a function of temperature similar to a second order phase transition. We propose that spin-Hall effect leads to the spin accumulation and resulting emergent antiferromagnetic phase transition. We propose that the length scale for Rashba effect can be equal to the spin diffusion length and two-dimensional electron gas is not essential for it. The emergent antiferromagnetic phase transition is attributed to the site inversion asymmetry in diamond cubic Si lattice.
Transit-time instability in Hall thrusters
International Nuclear Information System (INIS)
Barral, Serge; Makowski, Karol; Peradzynski, Zbigniew; Dudeck, Michel
2005-01-01
Longitudinal waves characterized by a phase velocity of the order of the velocity of ions have been recurrently observed in Hall thruster experiments and simulations. The origin of this so-called ion transit-time instability is investigated with a simple one-dimensional fluid model of a Hall thruster discharge in which cold ions are accelerated between two electrodes within a quasineutral plasma. A short-wave asymptotics applied to linearized equations shows that plasma perturbations in such a device consist of quasineutral ion acoustic waves superimposed on a background standing wave generated by discharge current oscillations. Under adequate circumstances and, in particular, at high ionization levels, acoustic waves are amplified as they propagate, inducing strong perturbation of the ion density and velocity. Responding to the subsequent perturbation of the column resistivity, the discharge current generates a standing wave, the reflection of which sustains the generation of acoustic waves at the inlet boundary. A calculation of the frequency and growth rate of this resonance mechanism for a supersonic ion flow is proposed, which illustrates the influence of the ionization degree on their onset and the approximate scaling of the frequency with the ion transit time. Consistent with experimental reports, the traveling wave can be observed on plasma density and velocity perturbations, while the plasma potential ostensibly oscillates in phase along the discharge
Investigation of Supercurrent in the Quantum Hall Regime in Graphene Josephson Junctions
Draelos, Anne W.; Wei, Ming Tso; Seredinski, Andrew; Ke, Chung Ting; Mehta, Yash; Chamberlain, Russell; Watanabe, Kenji; Taniguchi, Takashi; Yamamoto, Michihisa; Tarucha, Seigo; Borzenets, Ivan V.; Amet, François; Finkelstein, Gleb
2018-06-01
In this study, we examine multiple encapsulated graphene Josephson junctions to determine which mechanisms may be responsible for the supercurrent observed in the quantum Hall (QH) regime. Rectangular junctions with various widths and lengths were studied to identify which parameters affect the occurrence of QH supercurrent. We also studied additional samples where the graphene region is extended beyond the contacts on one side, making that edge of the mesa significantly longer than the opposite edge. This is done in order to distinguish two potential mechanisms: (a) supercurrents independently flowing along both non-contacted edges of graphene mesa, and (b) opposite sides of the mesa being coupled by hybrid electron-hole modes flowing along the superconductor/graphene boundary. The supercurrent appears suppressed in extended junctions, suggesting the latter mechanism.
Observation of the Zero Hall Plateau in a Quantum Anomalous Hall Insulator
Energy Technology Data Exchange (ETDEWEB)
Feng, Yang; Feng, Xiao; Ou, Yunbo; Wang, Jing; Liu, Chang; Zhang, Liguo; Zhao, Dongyang; Jiang, Gaoyuan; Zhang, Shou-Cheng; He, Ke; Ma, Xucun; Xue, Qi-Kun; Wang, Yayu
2015-09-16
We report experimental investigations on the quantum phase transition between the two opposite Hall plateaus of a quantum anomalous Hall insulator. We observe a well-defined plateau with zero Hall conductivity over a range of magnetic field around coercivity when the magnetization reverses. The features of the zero Hall plateau are shown to be closely related to that of the quantum anomalous Hall effect, but its temperature evolution exhibits a significant difference from the network model for a conventional quantum Hall plateau transition. We propose that the chiral edge states residing at the magnetic domain boundaries, which are unique to a quantum anomalous Hall insulator, are responsible for the novel features of the zero Hall plateau.
Integer Quantum Magnon Hall Plateau-Plateau Transition in a Spin Ice Model
Xu, Baolong; Ohtsuki, Tomi; Shindou, Ryuichi
2016-01-01
Low-energy magnon bands in a two-dimensional spin ice model become integer quantum magnon Hall bands. By calculating the localization length and the two-terminal conductance of magnon transport, we show that the magnon bands with disorders undergo a quantum phase transition from an integer quantum magnon Hall regime to a conventional magnon localized regime. Finite size scaling analysis as well as a critical conductance distribution shows that the quantum critical point belongs to the same un...
Mode transition of a Hall thruster discharge plasma
International Nuclear Information System (INIS)
Hara, Kentaro; Sekerak, Michael J.; Boyd, Iain D.; Gallimore, Alec D.
2014-01-01
A Hall thruster is a cross-field plasma device used for spacecraft propulsion. An important unresolved issue in the development of Hall thrusters concerns the effect of discharge oscillations in the range of 10–30 kHz on their performance. The use of a high speed Langmuir probe system and ultra-fast imaging of the discharge plasma of a Hall thruster suggests that the discharge oscillation mode, often called the breathing mode, is strongly correlated to an axial global ionization mode. Stabilization of the global oscillation mode is achieved as the magnetic field is increased and azimuthally rotating spokes are observed. A hybrid-direct kinetic simulation that takes into account the transport of electronically excited atoms is used to model the discharge plasma of a Hall thruster. The predicted mode transition agrees with experiments in terms of the mean discharge current, the amplitude of discharge current oscillation, and the breathing mode frequency. It is observed that the stabilization of the global oscillation mode is associated with reduced electron transport that suppresses the ionization process inside the channel. As the Joule heating balances the other loss terms including the effects of wall loss and inelastic collisions, the ionization oscillation is damped, and the discharge oscillation stabilizes. A wide range of the stable operation is supported by the formation of a space charge saturated sheath that stabilizes the electron axial drift and balances the Joule heating as the magnetic field increases. Finally, it is indicated from the numerical results that there is a strong correlation between the emitted light intensity and the discharge current.
Hong, Changki; Park, Jinhong; Chung, Yunchul; Choi, Hyungkook; Umansky, Vladimir
2017-11-01
Transmission through a quantum point contact (QPC) in the quantum Hall regime usually exhibits multiple resonances as a function of gate voltage and high nonlinearity in bias. Such behavior is unpredictable and changes sample by sample. Here, we report the observation of a sharp transition of the transmission through an open QPC at finite bias, which was observed consistently for all the tested QPCs. It is found that the bias dependence of the transition can be fitted to the Fermi-Dirac distribution function through universal scaling. The fitted temperature matches quite nicely to the electron temperature measured via shot-noise thermometry. While the origin of the transition is unclear, we propose a phenomenological model based on our experimental results that may help to understand such a sharp transition. Similar transitions are observed in the fractional quantum Hall regime, and it is found that the temperature of the system can be measured by rescaling the quasiparticle energy with the effective charge (e*=e /3 ). We believe that the observed phenomena can be exploited as a tool for measuring the electron temperature of the system and for studying the quasiparticle charges of the fractional quantum Hall states.
Valley polarized quantum Hall effect and topological insulator phase transitions in silicene
Tahir, M.
2013-01-25
The electronic properties of silicene are distinct from both the conventional two dimensional electron gas and the famous graphene due to strong spin orbit interaction and the buckled structure. Silicene has the potential to overcome limitations encountered for graphene, in particular the zero band gap and weak spin orbit interaction. We demonstrate a valley polarized quantum Hall effect and topological insulator phase transitions. We use the Kubo formalism to discuss the Hall conductivity and address the longitudinal conductivity for elastic impurity scattering in the first Born approximation. We show that the combination of an electric field with intrinsic spin orbit interaction leads to quantum phase transitions at the charge neutrality point, providing a tool to experimentally tune the topological state. Silicene constitutes a model system for exploring the spin and valley physics not accessible in graphene due to the small spin orbit interaction.
Magnetohydrodynamic simulations of Gamble I POS with Hall effect
International Nuclear Information System (INIS)
Roderick, N.F.; Frese, M.H.; Peterkin, R.E.; Payne, S.S.
1989-01-01
Two dimensional single fluid magnetohydrodynamic simulations have been conducted to investigate the effects of the Hall electric field on magnetic field transport in plasma opening switches of the type used on Gamble I. The Hall terms were included in the magnetic field transport equation in the two dimensional simulation code MACH2 through the use of a generalized Ohm's law. Calculations show the Hall terms augment the field transport previously observed to occur through ion fluid motion and diffusion. For modest values of microturbulent collision frequency, board current channels were observed . Results also show the magnetic field transport to be affected by the cathode boundary conditions with the Hall terms included. In all cases center of mass motion was slight
Advances towards QH-mode viability for ELM-stable operation in ITER
International Nuclear Information System (INIS)
Garofalo, A.M.; Burrell, K.H.; DeBoo, J.C.; Schaffer, M.J.; Snyder, P.B.; Solomon, W.M.; Park, J.-K.; Lanctot, M.J.; Reimerdes, H.; McKee, G.R.; Schmitz, L.
2011-01-01
The application of static, non-axisymmetric, nonresonant magnetic fields (NRMFs) to high beta DIII-D plasmas has allowed sustained operation with a quiescent H-mode (QH-mode) edge and both toroidal rotation and neutral beam injected torque near zero. Previous studies have shown that QH-mode operation can be accessed only if sufficient radial shear in the plasma flow is produced near the plasma edge. In past experiments, this flow shear was produced using neutral beam injection (NBI) to provide toroidal torque. In recent experiments, this torque was nearly completely replaced by the torque from applied NRMFs. The application of the NRMFs does not degrade the global energy confinement of the plasma. Conversely, the experiments show that the energy confinement quality increases with lower plasma rotation. Furthermore, the NRMF torque increases plasma resilience to locked modes at low rotation. These results open a path towards QH-mode utilization as an edge-localized mode (ELM)-stable H-mode in the self-heated burning plasma scenario, where toroidal momentum input from NBI may be small or absent.
High Input Voltage Hall Thruster Discharge Converter, Phase I
National Aeronautics and Space Administration — The overall scope of this Phase I/II effort is the development of a high efficiency 15kW (nominal) Hall thruster discharge converter. In Phase I, Busek Co. Inc. will...
Hall-effect characterization of the metamagnetic transition in FeRh
International Nuclear Information System (INIS)
De Vries, M A; Loving, M; Lewis, L H; Mihai, A P; Marrows, C H; Heiman, D
2013-01-01
The antiferromagnetic ground state and the metamagnetic transition to the ferromagnetic state of CsCl-ordered FeRh epilayers have been characterized using Hall and magnetoresistance measurements. On cooling into the ground state, the metamagnetic transition is found to coincide with a suppression in carrier density of at least an order of magnitude below the typical metallic level that is shown by the ferromagnetic state. The carrier density in the antiferromagnetic state is limited by intrinsic doping from Fe/Rh substitution defects, with approximately two electrons per pair of atoms swapped, showing that the decrease in carrier density could be even larger in more perfect specimens. The surprisingly large change in carrier density is a clear quantitative indication of the extent of change at the Fermi surface at the metamagnetic transition, confirming that entropy release at the transition is of electronic origin, and hence that an electronic transition underlies the metamagnetic transition. Regarding the nature of this electronic transition, it is suggested that an orbital selective Mott transition, selective to strongly-correlated Fe 3d electrons, could cause the reduction in the Fermi surface and change in sign of the magnetic exchange from FM to AF on cooling. (paper)
Directory of Open Access Journals (Sweden)
Salin Moyses Jorge
1976-12-01
Full Text Available Os autores registram um caso de retardo neuromotor em paciente com cromossomo 1qh+. A análise cromossômica do paciente e três familiares revelou igualmente em todos, aumento do braço longo do cromossomo n.° 1. Entretanto, é considerada a possibilidade de que o quadro clínico do paciente seja subordinado também a outros fatores, não genéticos.A case of neuromotor retardation in association with chromosome 1qh+ is reported. Chromosomes analysis of the patient and three relatives showed increased long arm of the n.° 1 chromosome, in all of them. However it is emphasized that the clinical feature could be secondary to various non genetics factors, also.
Scaling behavior and variable hopping conductivity in the quantum Hall plateau transition
International Nuclear Information System (INIS)
Tu, Tao; Zhao, Yong-Jie; Guo, Guo-Ping; Hao, Xiao-Jie; Guo, Guang-Can
2007-01-01
We have measured the temperature dependence of the longitudinal resistivity ρ xx of a two-dimensional electron system in the regime of the quantum Hall plateau transition. We extracted the quantitative form of scaling function for ρ xx and compared it with the results of ordinary scaling theory and variable range hopping based theory. We find that the two alternative theoretically proposed scaling functions are valid in different regions
Strong quasi-particle tunneling study in the paired quantum Hall states
Nomura, Kentaro; Yoshioka, Daijiro
2001-01-01
The quasi-particle tunneling phenomena in the paired fractional quantum Hall states are studied. A single point-contact system is first considered. Because of relevancy of the quasi-particle tunneling term, the strong tunneling regime should be investigated. Using the instanton method it is shown that the strong quasi-particle tunneling regime is described as the weak electron tunneling regime effectively. Expanding to the network model the paired quantum Hall liquid to insulator transition i...
Quantum phase transitions and anomalous Hall effect in frustrated Kondo lattices
Paschen, Silke; Grefe, Sarah Elaine; Ding, Wenxin; Si, Qimiao
Among the pyrochlore iridates, the metallic compound Pr2 Ir2O7 (Pr-227) has shown characteristics of a possible chiral spin liquid state and quantum criticality. An important question surrounding the significant anomalous Hall response observed in Pr-227 is the nature of the f-electron local moments, including their Kondo coupling with the conduction d-electrons. The heavy effective mass and related thermodynamic characteristics indicate the involvement of the Kondo effect in this system's electronic properties. In this work, we study the effects of Kondo coupling on candidate time-reversal-symmetry-breaking spin liquid states on frustrated lattices. Representing the f-moments as slave fermions Kondo-coupled to conduction electrons, we study the competition between Kondo-singlet formation and chiral spin correlations. We derive an effective chiral interaction between the local moments and the conduction electrons and calculate the anomalous Hall response across the quantum phase transition from the Kondo destroyed phase to the Kondo screened phase. We discuss our results' implications for Pr-227 and related frustrated Kondo-lattice systems.
Gaussian free fields at the integer quantum Hall plateau transition
Energy Technology Data Exchange (ETDEWEB)
Bondesan, R., E-mail: roberto.bondesan@phys.ox.ac.uk [Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Wieczorek, D.; Zirnbauer, M.R. [Institut für Theoretische Physik, Universität zu Köln, Zülpicher Straße 77, 50937 Köln (Germany)
2017-05-15
In this work we put forward an effective Gaussian free field description of critical wavefunctions at the transition between plateaus of the integer quantum Hall effect. To this end, we expound our earlier proposal that powers of critical wave intensities prepared via point contacts behave as pure scaling fields obeying an Abelian operator product expansion. Our arguments employ the framework of conformal field theory and, in particular, lead to a multifractality spectrum which is parabolic. We also derive a number of old and new identities that hold exactly at the lattice level and hinge on the correspondence between the Chalker–Coddington network model and a supersymmetric vertex model.
Skew scattering dominated anomalous Hall effect in Co<i>x>(MgO)100-<i>x> granular thin films
Zhang, Qiang; Wen, Yan; Zhao, Yuelei; Li, Peng; He, Xin; Zhang, Junli; He, Yao; Peng, Yong; Yu, Ronghai; Zhang, Xixiang
2017-01-01
We investigated the mechanism(s) of the anomalous Hall effect (AHE) in magnetic granular materials by fabricating 100-nm-thick thin films of Co<i>x>(MgO)100-<i>x> with a Co volume fraction of 34≤<i>x>≤100 using co
Quantum critical behaviour of the plateau-insulator transition in the quantum Hall regime
International Nuclear Information System (INIS)
Visser, A de; Ponomarenko, L A; Galistu, G; Lang, D T N de; Pruisken, A M M; Zeitler, U; Maude, D
2006-01-01
High-field magnetotransport experiments provide an excellent tool to investigate the plateau-insulator phase transition in the integral quantum Hall effect. Here we review recent low-temperature high-field magnetotransport studies carried out on several InGaAs/InP heterostructures and an InGaAs/GaAs quantum well. We find that the longitudinal resistivity ρ xx near the critical filling factor ν c ∼ 0.5 follows the universal scaling law ρ xx (ν, T) ∝ exp(-Δν/(T/T 0 ) κ ), where Δν = ν-ν c . The critical exponent κ equals 0.56 ± 0.02, which indicates that the plateau-insulator transition falls in a non-Fermi liquid universality class
Quantum Hall Valley Nematics: From Field Theories to Microscopic Models
Parameswaran, Siddharth
The interplay between quantum Hall ordering and spontaneously broken ``internal'' symmetries in two-dimensional electron systems with spin or pseudospin degrees of freedom gives rise to a variety of interesting phenomena, including novel phases, phase transitions, and topological excitations. I will discuss a theory of broken-symmetry quantum Hall states, applicable to a class of multivalley systems, where the symmetry at issue is a point-group element that combines a spatial rotation with a permutation of valley indices. I will explore its ramifications for the phase diagram of a variety of experimental systems, such as AlAs and Si quantum wells and the surface states of bismuth. I will also discuss unconventional transport phenomena in these phases in the presence of quenched randomness, and the possible mechanisms of selection between degenerate broken-symmetry phases in clean systems. I acknowledge support from NSF DMR-1455366.
Sung, C.; Rhodes, T. L.; Staebler, G. M.; Yan, Z.; McKee, G. R.; Smith, S. P.; Osborne, T. H.; Peebles, W. A.
2018-05-01
For the first time, we report increased edge electron temperature and density turbulence levels ( T˜ e and n˜ e) in Edge Localized Mode free Quiescent H-mode (ELM-free QH-mode) plasmas as compared to the ELMing time period. ELMs can severely damage plasma facing components in fusion plasma devices due to their large transient energy transport, making ELM-free operation a highly sought after goal. The QH-mode is a candidate for this goal as it is ELM-free for times limited only by hardware constraints. It is found that the driving gradients decrease during the QH-mode compared to the ELMing phase, however, a significant decrease in the ExB shearing rate is also observed that taken together is consistent with the increased turbulence. These results are significant as the prediction and control of ELM-free H-mode regimes are crucial for the operation of future fusion devices such as ITER. The changes in the linear growth rates calculated by CGYRO [Candy et al., J. Comput. Phys. 324, 73 (2016)] and the measured ExB shearing rate between ELMing and QH-mode phases are qualitatively consistent with these turbulence changes. Comparison with ELMing and 3D fields ELM suppressed H-mode finds a similar increase in T˜ e and n˜ e, however, with distinctly different origins, the increased driving gradients rather than the changes in the ExB shearing rate in 3D fields ELM suppressed the H-mode. However, linear gyrokinetic calculation results are generally consistent with the increased turbulence in both ELM-controlled discharges.
Axial Hall effect and universality of holographic Weyl semi-metals
Energy Technology Data Exchange (ETDEWEB)
Copetti, Christian; Fernández-Pendás, Jorge; Landsteiner, Karl [Instituto de Física Teórica UAM/CSIC,c/ Nicolás Cabrera 13-15, Cantoblanco, 28049 Madrid (Spain)
2017-02-28
The holographic Weyl semimetal is a model of a strongly coupled topological semi-metal. A topological quantum phase transition separates a topological phase with non-vanishing anomalous Hall conductivity from a trivial state. We investigate how this phase transition depends on the parameters of the scalar potential (mass and quartic self coupling) finding that the quantum phase transition persists for a large region in parameter space. We then compute the axial Hall conductivity. The algebraic structure of the axial anomaly predicts it to be 1/3 of the electric Hall conductivity. We find that this holds once a non-trivial renormalization effect on the external axial gauge fields is taken into account. Finally we show that the phase transition also occurs in a top-down model based on a consistent truncation of type IIB supergravity.
Directory of Open Access Journals (Sweden)
N. Jedrecy
2016-08-01
Full Text Available We show that the well-established universal scaling σxyAHE ∼ σxx1.6 between anomalous Hall and longitudinal conductivities in the low conductivity regime (σxx < 104 Ω−1 cm−1 transforms into the scaling σxyAHE ∼ σxx2 at the onset of strong electron localization. The crossover between the two relations is observed in magnetite-derived ZnxFe3-xO4 thin films where an insulating/hopping regime follows a bad metal/hopping regime below the Verwey transition temperature Tv. Our results demonstrate that electron localization effects come into play in the anomalous Hall effect (AHE modifying significantly the scaling exponent. In addition, the thermal evolution of the anomalous Hall resistivity suggests the existence of spin polarons whose size would decrease below Tv.
Quantum phase transitions and anomalous Hall effect in a pyrochlore Kondo lattice
Grefe, Sarah; Ding, Wenxin; Si, Qimiao
The metallic variant of the pyrochlore iridates Pr2Ir2O7 has shown characteristics of a possible chiral spin liquid state [PRL 96 087204 (2006), PRL 98, 057203 (2007), Nature 463, 210 (2010)] and quantum criticality [Nat. Mater. 13, 356 (2014)]. An important question surrounding the significant anomalous Hall response observed in Pr2Ir2O7 is the nature of the f-electron local moments, including their Kondo coupling with the conduction d-electrons. The heavy effective mass and related thermodynamic characteristics indicate the involvement of the Kondo effect in this system's electronic properties. In this work, we study the effects of Kondo coupling on candidate time-reversal-symmetry-breaking spin liquid states on the pyrochlore lattice. Representing the f-moments as slave fermions Kondo-coupled to conduction electrons, we study the competition between Kondo-singlet formation and chiral spin correlations and determine the zero-temperature phase diagram. We derive an effective chiral interaction between the local moments and the conduction electrons and calculate the anomalous Hall response across the quantum phase transition from the Kondo destroyed phase to the Kondo screened phase. We discuss our results' implications for Pr2Ir2O7 and related frustrated Kondo-lattice systems.
Makise, Kazumasa; Ichikawa, Fusao; Asano, Takayuki; Shinozaki, Bunju
2018-02-01
We report on the superconductor-insulator transitions (SITs) of disordered molybdenum nitride (MoN) thin films on (1 0 0) MgO substrates as a function of the film thickness and magnetic fields. The T c of the superconducting MoN films, which exhibit a sharp superconducting transition, monotonically decreases as the normal state R sq increases with a decreasing film thickness. For several films with different thicknesses, we estimate the critical field H c and the product zν ≃ 0.6 of the dynamical exponent z and the correlation length exponent ν using a finite scaling analysis. The value of this product can be explained by the (2 + 1) XY model. We found that the Hall resistance ΔR xy (H) is maximized when the magnetic field satisfies H HP(T) \\propto |1 - T/T C0| in the superconducting state and also in the normal states owning to the superconducting fluctuation corresponding to the ghost critical magnetic field. We measured the Hall conductivity δσ xy (H) = σ xy (H) - σ xyn and fit the Gaussian approximation theory for δσ xy (H) to the experimental data. Agreement between the data and the theory beyond H c suggests the survival of the Cooper pair in the insulating region of the SIT.
Optical probing of quantum Hall effect of composite fermions and of the liquid-insulator transition
International Nuclear Information System (INIS)
Rossella, F; Bellani, V; Dionigi, F; Amado, M; Diez, E; Kowalik, K; Biasiol, G; Sorba, L
2011-01-01
In the photoluminescence spectra of a two-dimensional electron gas in the fractional quantum Hall regime we observe the states at filling factors ν = 4/5, 5/7, 4/11 and 3/8 as clear minima in the intensity or area emission peak. The first three states are described as interacting composite fermions in fractional quantum Hall regime. The minimum in the intensity at ν 3/8, which is not explained within this picture, can be an evidence of a suppression of the screening of the Coulomb interaction among the effective quasi-particles involved in this intriguing state. The magnetic field energy dispersion at very low temperatures is also discussed. At low field the emission follows a Landau dispersion with a screened magneto-Coulomb contribution. At intermediate fields the hidden symmetry manifests. At high field above ν = 1/3 the electrons correlate into an insulating phase, and the optical emission behaviour at the liquid-insulator transition is coherent with a charge ordering driven by Coulomb correlations.
The infrared Hall effect in YBCO: Temperature and frequency dependence of Hall scattering
International Nuclear Information System (INIS)
Grayson, M.; Cerne, J.; Drew, H.D.; Schmadel, D.C.; Hughes, R.; Preston, J.S.; Kung, P.J.; Vale, L.
1999-01-01
The authors measure the Hall angle, θ H , in YBCO films in the far- and mid-infrared to determine the temperature and frequency dependence of the Hall scattering. Using novel modulation techniques they measure both the Faraday rotation and ellipticity induced by these films in high magnetic fields to deduce the complex conductivity tensor. They observe a strong temperature dependence of the mid-infrared Hall conductivity in sharp contrast to the weak dependence of the longitudinal conductivity. By fitting the frequency dependent normal state Hall angle to a Lorentzian θ H (ω) = ω H /(γ H minus iω) they find the Hall frequency, ω H , is nearly independent of temperature. The Hall scattering rate, γ H , is consistent with γ H ∼ T 2 up to 200 K and is remarkably independent of IR frequency suggesting non-Fermi liquid behavior
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Guterding, Daniel; Jeschke, Harald O; Valentí, Roser
2016-05-17
Electronic states with non-trivial topology host a number of novel phenomena with potential for revolutionizing information technology. The quantum anomalous Hall effect provides spin-polarized dissipation-free transport of electrons, while the quantum spin Hall effect in combination with superconductivity has been proposed as the basis for realizing decoherence-free quantum computing. We introduce a new strategy for realizing these effects, namely by hole and electron doping kagome lattice Mott insulators through, for instance, chemical substitution. As an example, we apply this new approach to the natural mineral herbertsmithite. We prove the feasibility of the proposed modifications by performing ab-initio density functional theory calculations and demonstrate the occurrence of the predicted effects using realistic models. Our results herald a new family of quantum anomalous Hall and quantum spin Hall insulators at affordable energy/temperature scales based on kagome lattices of transition metal ions.
Temperature dependence of collapse of quantized hall resistance
International Nuclear Information System (INIS)
Tanaka, Hiroyasu; Kawashima, Hironori; Iizuka, Hisamitsu; Fukuda, Hideaki; Kawaji, Shinji
2006-01-01
Similarity is observed in the deviation of Hall resistance from the quantized value with the increase in the source-drain current I SD in our butterfly-type Hall bars and in the Hall bars used by Jeanneret et al., while changes in the diagonal resistivity ρ xx with I SD are significantly different between these Hall bars. The temperature dependence of the critical Hall electric field F cr (T) for the collapse of R H (4) measured in these Hall bars is approximated using F cr (T) = F cr (0)(1 - (T/T cr ) 2 ). Here, the critical Hall electric field at zero temperature depends on the magnetic field B as F cr (0) ∝ B 3/2 . Theoretical considerations are given on F cr (T) on the basis of a temperature-dependent mobility edge model and a schema of temperature-dependent inter-Landau level tunneling probability arising from the Fermi distribution function. The former does not fit in with the I SD dependence of activation energy in ρ xx . (author)
Theory of the quantized Hall effect. Pt. 3
International Nuclear Information System (INIS)
Levine, H.; Pruisken, A.M.M.; Libby, S.B.
1984-01-01
In the previous paper, we have demonstrated the need for a phase transition as a function of theta in the non-liner sigma-model describing the quantized Hall effect. In this work, we present arguments for the occurrence of exactly such a transition. We make use of a dilute gas instanton approximation as well as present a more rigorous duality argument to show that the usual scaling of the conductivity to zero at large distances is altered whenever sigmasub(xy)sup((0)) approx.= 1/2ne 2 /h, n integer. This then completes our theory of the quantized Hall effect. (orig.)
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Unconventional quantum Hall effect in Floquet topological insulators
Tahir, M.
2016-07-27
We study an unconventional quantum Hall effect for the surface states of ultrathin Floquet topological insulators in a perpendicular magnetic field. The resulting band structure is modified by photon dressing and the topological property is governed by the low-energy dynamics of a single surface. An exchange of symmetric and antisymmetric surface states occurs by reversing the lights polarization. We find a novel quantum Hall state in which the zeroth Landau level undergoes a phase transition from a trivial insulator state, with Hall conductivity αyx = 0 at zero Fermi energy, to a Hall insulator state with αyx = e2/2h. These findings open new possibilities for experimentally realizing nontrivial quantum states and unusual quantum Hall plateaus at (±1/2,±3/2,±5/2, ...)e2/h. © 2016 IOP Publishing Ltd Printed in the UK.
Unconventional quantum Hall effect in Floquet topological insulators
Tahir, M.; Vasilopoulos, P.; Schwingenschlö gl, Udo
2016-01-01
We study an unconventional quantum Hall effect for the surface states of ultrathin Floquet topological insulators in a perpendicular magnetic field. The resulting band structure is modified by photon dressing and the topological property is governed by the low-energy dynamics of a single surface. An exchange of symmetric and antisymmetric surface states occurs by reversing the lights polarization. We find a novel quantum Hall state in which the zeroth Landau level undergoes a phase transition from a trivial insulator state, with Hall conductivity αyx = 0 at zero Fermi energy, to a Hall insulator state with αyx = e2/2h. These findings open new possibilities for experimentally realizing nontrivial quantum states and unusual quantum Hall plateaus at (±1/2,±3/2,±5/2, ...)e2/h. © 2016 IOP Publishing Ltd Printed in the UK.
Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.
Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B
1995-01-01
Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.
AdS/QHE: towards a holographic description of quantum Hall experiments
International Nuclear Information System (INIS)
Bayntun, Allan; Burgess, C P; Lee, Sung-Sik; Dolan, Brian P
2011-01-01
Transitions among quantum Hall plateaux share a suite of remarkable experimental features, such as semicircle laws and duality relations, whose accuracy and robustness are difficult to explain directly in terms of the detailed dynamics of the microscopic electrons. They would naturally follow if the low-energy transport properties were governed by an emergent discrete duality group relating the different plateaux, but no explicit examples of interacting systems having such a group are known. Recent progress using the AdS/CFT correspondence has identified examples with similar duality groups, but without the dc ohmic conductivity characteristic of quantum Hall experiments. We use this to propose a simple holographic model for low-energy quantum Hall systems, with a nonzero dc conductivity that automatically exhibits all of the observed consequences of duality, including the existence of the plateaux and the semicircle transitions between them. The model can be regarded as a strongly coupled analogue of the old 'composite boson' picture of quantum Hall systems. Non-universal features of the model can be used to test whether it describes actual materials, and we comment on some of these in our proposed model. In particular, the model indicates the value 2/5 for low-temperature scaling exponents for transitions among quantum Hall plateaux, in agreement with the measured value 0.42±0.01.
Ideue, T.; Checkelsky, J. G.; Bahramy, M. S.; Murakawa, H.; Kaneko, Y.; Nagaosa, N.; Tokura, Y.
2014-10-01
BiTeI is a polar semiconductor with gigantic Rashba spin-split bands in bulk. We have investigated the effect of pressure on the electronic structure of this material via magnetotransport. Periods of Shubunikov-de Haas (SdH) oscillations originating from the spin-split outer Fermi surface and inner Fermi surface show disparate responses to pressure, while the carrier number derived from the Hall effect is unchanged with pressure. The associated parameters which characterize the spin-split band structure are strongly dependent on pressure, reflecting the pressure-induced band deformation. We find the SdH oscillations and transport response are consistent with the theoretically proposed pressure-induced band deformation leading to a topological phase transition. Our analysis suggests the critical pressure for the quantum phase transition near Pc=3.5 GPa.
Magnetotransport properties of Ni-Mn-In Heusler Alloys: Giant Hall angle
Energy Technology Data Exchange (ETDEWEB)
Dubenko, I; Pathak, A K; Ali, N [Department of Physics, Southern Illinois University, Carbondale, IL 62901 (United States); Kovarskii, Y A; Prudnikov, V N; Perov, N S; Granovsky, A B, E-mail: granov@magn.r [Faculty of Physics, Moscow State University, Moscow, 111991 (Russian Federation)
2010-01-01
We report experimental results on phase transitions, magnetic properties, resistivity, and Hall effect in Ni{sub 50}Mn{sub 50-x}In{sub x} (15
Characterization of the Quantized Hall Insulator Phase in the Quantum Critical Regime
Song, Juntao; Prodan, Emil
2013-01-01
The conductivity $\\sigma$ and resistivity $\\rho$ tensors of the disordered Hofstadter model are mapped as functions of Fermi energy $E_F$ and temperature $T$ in the quantum critical regime of the plateau-insulator transition (PIT). The finite-size errors are eliminated by using the non-commutative Kubo-formula. The results reproduce all the key experimental characteristics of this transition in Integer Quantum Hall (IQHE) systems. In particular, the Quantized Hall Insulator (QHI) phase is det...
Helical edge states and fractional quantum Hall effect in a graphene electron-hole bilayer.
Sanchez-Yamagishi, Javier D; Luo, Jason Y; Young, Andrea F; Hunt, Benjamin M; Watanabe, Kenji; Taniguchi, Takashi; Ashoori, Raymond C; Jarillo-Herrero, Pablo
2017-02-01
Helical 1D electronic systems are a promising route towards realizing circuits of topological quantum states that exhibit non-Abelian statistics. Here, we demonstrate a versatile platform to realize 1D systems made by combining quantum Hall (QH) edge states of opposite chiralities in a graphene electron-hole bilayer at moderate magnetic fields. Using this approach, we engineer helical 1D edge conductors where the counterpropagating modes are localized in separate electron and hole layers by a tunable electric field. These helical conductors exhibit strong non-local transport signals and suppressed backscattering due to the opposite spin polarizations of the counterpropagating modes. Unlike other approaches used for realizing helical states, the graphene electron-hole bilayer can be used to build new 1D systems incorporating fractional edge states. Indeed, we are able to tune the bilayer devices into a regime hosting fractional and integer edge states of opposite chiralities, paving the way towards 1D helical conductors with fractional quantum statistics.
Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmad, Ashfaq; Ahmadov, Faig; Aielli, Giulio; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Sarah; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batkova, Lucia; Batley, Richard; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertolucci, Federico; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Branchini, Paolo; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Gareth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Kevin; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collins-Tooth, Christopher; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; De Zorzi, Guido; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Degenhardt, James; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobos, Daniel; Dobson, Ellie; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gandrajula, Reddy Pratap; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Grybel, Kai; Guan, Liang; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Gunther, Jaroslav; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageboeck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Heisterkamp, Simon; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hofmann, Julia Isabell; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idarraga, John; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Ivarsson, Jenny; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Karnevskiy, Mikhail; Karpov, Sergey; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Keener, Paul; Kehoe, Robert; Keil, Markus; Keller, John; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kitamura, Takumi; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le, Bao Tran; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Jean-Pierre; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Matricon, Pierre; Matsushita, Takashi; Mättig, Peter; Mättig, Stefan; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Moeller, Victoria; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newcomer, Mitchel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novakova, Jana; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Ohshima, Takayoshi; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petteni, Michele; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospelov, Guennady; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romeo, Gaston; Romero Adam, Elena; Rompotis, Nikolaos; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Christopher; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Sherwood, Peter; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snow, Joel; Snyder, Scott; Sobie, Randall; Socher, Felix; Sodomka, Jaromir; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sopko, Bruno; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spighi, Roberto; Spigo, Giancarlo; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steele, Genevieve; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramania, Halasya Siva; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tamsett, Matthew; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thoma, Sascha; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Triplett, Nathan; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Berg, Richard; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Wolfgang; Wagner, Peter; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watanabe, Ippei; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wilson, Alan; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zaytsev, Alexander; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz
2014-01-01
A search is performed for flavour-changing neutral currents in the decay of a top quark to an up-type ($c, u$) quark and a Higgs boson, where the Higgs boson decays to two photons. The proton-proton collision data set used corresponds to 4.7 fb$^{-1}$ at $\\sqrt{s}$ = 7 TeV and 20.3 fb$^{-1}$ at $\\sqrt{s}$ = 8 TeV collected by the ATLAS experiment at the LHC. Top quark pair events are searched for in which one top quark decays to $qH$ and the other decays to $bW$. Both the hadronic and the leptonic decay modes of the $W$ boson are used. No significant signal is observed and an upper limit is set on the $t\\rightarrow qH$ branching ratio of 0.79% at the 95% confidence level. The corresponding limit on the $tqH$ coupling combination $\\sqrt{\\lambda_{tcH}^{2} + \\lambda_{tuH}^{2}}$ is 0.17.
Šmidrkalová, Nina
2012-01-01
Tato diplomová práce se zabývá problematikou měřících systémů, především užívajících metody Q/H charakteristiky. Popisuje ostrohranné přelivy a zmiňuje se i o měrných žlabech. Uvádí možnosti monitorování průtoků v napevno nainstalovaných profilech s volnou hladinou. Součástí práce je i experiment, který je zaměřen na simulaci nestandardních přítokových proudových poměrů před instalovaným přelivem pro stanovení jejich vlivu na Q/H charakteristiku. Experiment je proveden na pravoúhlém ostrohran...
Mesoscopic effects in the quantum Hall regime
Indian Academy of Sciences (India)
. When band mixing between multiple Landau levels is present, mesoscopic effects cause a crossover from a sequence of quantum Hall transitions for weak disorder to classical behavior for strong disorder. This behavior may be of relevance ...
Associação de retardo neuromotor e cromossomo 1qh +: registro de um caso
Directory of Open Access Journals (Sweden)
Salin Moyses Jorge
1976-12-01
Full Text Available Os autores registram um caso de retardo neuromotor em paciente com cromossomo 1qh+. A análise cromossômica do paciente e três familiares revelou igualmente em todos, aumento do braço longo do cromossomo n.° 1. Entretanto, é considerada a possibilidade de que o quadro clínico do paciente seja subordinado também a outros fatores, não genéticos.
The Iodine Satellite (iSAT) Hall Thruster Demonstration Mission Concept and Development
Dankanich, John W.; Polzin, Kurt A.; Calvert, Derek; Kamhawi, Hani
2014-01-01
The use of iodine propellant for Hall thrusters has been studied and proposed by multiple organizations due to the potential mission benefits over xenon. In 2013, NASA Marshall Space Flight Center competitively selected a project for the maturation of an iodine flight operational feed system through the Technology Investment Program. Multiple partnerships and collaborations have allowed the team to expand the scope to include additional mission concept development and risk reduction to support a flight system demonstration, the iodine Satellite (iSAT). The iSAT project was initiated and is progressing towards a technology demonstration mission preliminary design review. The current status of the mission concept development and risk reduction efforts in support of this project is presented.
Dual Mode Low Power Hall Thruster, Phase I
National Aeronautics and Space Administration — Sample and return missions desire and missions like Saturn Observer require a low power Hall thruster that can operate at high thrust to power as well as high...
International Nuclear Information System (INIS)
Brochen, Stéphane; Feuillet, Guy; Pernot, Julien
2014-01-01
In this work, statistical formulations of the temperature dependence of ionized and neutral impurity concentrations in a semiconductor, needed in the charge balance equation and for carrier scattering calculations, have been developed. These formulations have been used in order to elucidate a confusing situation, appearing when compensating acceptor (donor) levels are located sufficiently close to the conduction (valence) band to be thermally ionized and thereby to emit (capture) an electron to (from) the conduction (valence) band. In this work, the temperature dependent Hall carrier density and Hall mobility data adjustments are performed in an attempt to distinguish the presence of a deep acceptor or a deep donor level, coexisting with a shallower donor level and located near the conduction band. Unfortunately, the present statistical developments, applied to an n-type hydrothermal ZnO sample, lead in both cases to consistent descriptions of experimental Hall carrier density and mobility data and thus do not allow to determine the nature, donor or acceptor, of the deep level. This demonstration shows that the emission of an electron in the conduction band, generally assigned to a (0/+1) donor transition from a donor level cannot be applied systematically and could also be attributed to a (−1/0) donor transition from an acceptor level. More generally, this result can be extended for any semiconductor and also for deep donor levels located close to the valence band (acceptor transition)
Energy Technology Data Exchange (ETDEWEB)
Jedrecy, N., E-mail: jedrecy@insp.jussieu.fr; Hamieh, M.; Hebert, C.; Escudier, M.; Becerra, L.; Perriere, J. [Institut des Nano Sciences de Paris, UPMC-Sorbonne Universités, CNRS-UMR7588, 4 Place Jussieu, 75252 Paris Cedex 05 (France)
2016-08-15
We show that the well-established universal scaling σ{sub xy}{sup AHE} ∼ σ{sub xx}{sup 1.6} between anomalous Hall and longitudinal conductivities in the low conductivity regime (σ{sub xx} < 10{sup 4} Ω{sup −1} cm{sup −1}) transforms into the scaling σ{sub xy}{sup AHE} ∼ σ{sub xx}{sup 2} at the onset of strong electron localization. The crossover between the two relations is observed in magnetite-derived Zn{sub x}Fe{sub 3-x}O{sub 4} thin films where an insulating/hopping regime follows a bad metal/hopping regime below the Verwey transition temperature T{sub v}. Our results demonstrate that electron localization effects come into play in the anomalous Hall effect (AHE) modifying significantly the scaling exponent. In addition, the thermal evolution of the anomalous Hall resistivity suggests the existence of spin polarons whose size would decrease below T{sub v}.
Extrinsic spin Hall effect in graphene
Rappoport, Tatiana
The intrinsic spin-orbit coupling in graphene is extremely weak, making it a promising spin conductor for spintronic devices. In addition, many applications also require the generation of spin currents in graphene. Theoretical predictions and recent experimental results suggest one can engineer the spin Hall effect in graphene by greatly enhancing the spin-orbit coupling in the vicinity of an impurity. The extrinsic spin Hall effect then results from the spin-dependent skew scattering of electrons by impurities in the presence of spin-orbit interaction. This effect can be used to efficiently convert charge currents into spin-polarized currents. I will discuss recent experimental results on spin Hall effect in graphene decorated with adatoms and metallic cluster and show that a large spin Hall effect can appear due to skew scattering. While this spin-orbit coupling is small if compared with what it is found in metals, the effect is strongly enhanced in the presence of resonant scattering, giving rise to robust spin Hall angles. I will present our single impurity scattering calculations done with exact partial-wave expansions and complement the analysis with numerical results from a novel real-space implementation of the Kubo formalism for tight-binding Hamiltonians. The author acknowledges the Brazilian agencies CNPq, CAPES, FAPERJ and INCT de Nanoestruturas de Carbono for financial support.
Yang, Kun
2017-12-01
We consider an interface separating the Moore-Read state and Halperin 331 state in a half-filled Landau level, which can be realized in a double quantum well system with varying interwell tunneling and/or interaction strengths. In the presence of electron tunneling and strong Coulomb interactions across the interface, we find that all charge modes localize and the only propagating mode left is a chiral Majorana fermion mode. Methods to probe this neutral mode are proposed. A quantum phase transition between the Moore-Read and Halperin 331 states is described by a network of such Majorana fermion modes. In addition to a direct transition, they may also be separated by a phase in which the Majorana fermions are delocalized, realizing an incompressible state which exhibits quantum Hall charge transport and bulk heat conduction.
Engineering the quantum anomalous Hall effect in graphene with uniaxial strains
Energy Technology Data Exchange (ETDEWEB)
Diniz, G. S., E-mail: ginetom@gmail.com; Guassi, M. R. [Institute of Physics, University of Brasília, 70919-970 Brasília-DF (Brazil); Qu, F. [Institute of Physics, University of Brasília, 70919-970 Brasília-DF (Brazil); Department of Physics, The University of Texas at Austin, Austin, Texas 78712 (United States)
2013-12-28
We theoretically investigate the manipulation of the quantum anomalous Hall effect (QAHE) in graphene by means of the uniaxial strain. The values of Chern number and Hall conductance demonstrate that the strained graphene in presence of Rashba spin-orbit coupling and exchange field, for vanishing intrinsic spin-orbit coupling, possesses non-trivial topological phase, which is robust against the direction and modulus of the strain. Besides, we also find that the interplay between Rashba and intrinsic spin-orbit couplings results in a topological phase transition in the strained graphene. Remarkably, as the strain strength is increased beyond approximately 7%, the critical parameters of the exchange field for triggering the quantum anomalous Hall phase transition show distinct behaviors—decrease (increase) for strains along zigzag (armchair) direction. Our findings open up a new platform for manipulation of the QAHE by an experimentally accessible strain deformation of the graphene structure, with promising application on novel quantum electronic devices with high efficiency.
Engineering the quantum anomalous Hall effect in graphene with uniaxial strains
International Nuclear Information System (INIS)
Diniz, G. S.; Guassi, M. R.; Qu, F.
2013-01-01
We theoretically investigate the manipulation of the quantum anomalous Hall effect (QAHE) in graphene by means of the uniaxial strain. The values of Chern number and Hall conductance demonstrate that the strained graphene in presence of Rashba spin-orbit coupling and exchange field, for vanishing intrinsic spin-orbit coupling, possesses non-trivial topological phase, which is robust against the direction and modulus of the strain. Besides, we also find that the interplay between Rashba and intrinsic spin-orbit couplings results in a topological phase transition in the strained graphene. Remarkably, as the strain strength is increased beyond approximately 7%, the critical parameters of the exchange field for triggering the quantum anomalous Hall phase transition show distinct behaviors—decrease (increase) for strains along zigzag (armchair) direction. Our findings open up a new platform for manipulation of the QAHE by an experimentally accessible strain deformation of the graphene structure, with promising application on novel quantum electronic devices with high efficiency
A holographic model for the fractional quantum Hall effect
Energy Technology Data Exchange (ETDEWEB)
Lippert, Matthew [Institute for Theoretical Physics, University of Amsterdam,Science Park 904, 1090GL Amsterdam (Netherlands); Meyer, René [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo,Kashiwa, Chiba 277-8568 (Japan); Taliotis, Anastasios [Theoretische Natuurkunde, Vrije Universiteit Brussel andThe International Solvay Institutes,Pleinlaan 2, B-1050 Brussels (Belgium)
2015-01-08
Experimental data for fractional quantum Hall systems can to a large extent be explained by assuming the existence of a Γ{sub 0}(2) modular symmetry group commuting with the renormalization group flow and hence mapping different phases of two-dimensional electron gases into each other. Based on this insight, we construct a phenomenological holographic model which captures many features of the fractional quantum Hall effect. Using an SL(2,ℤ)-invariant Einstein-Maxwell-axio-dilaton theory capturing the important modular transformation properties of quantum Hall physics, we find dyonic diatonic black hole solutions which are gapped and have a Hall conductivity equal to the filling fraction, as expected for quantum Hall states. We also provide several technical results on the general behavior of the gauge field fluctuations around these dyonic dilatonic black hole solutions: we specify a sufficient criterion for IR normalizability of the fluctuations, demonstrate the preservation of the gap under the SL(2,ℤ) action, and prove that the singularity of the fluctuation problem in the presence of a magnetic field is an accessory singularity. We finish with a preliminary investigation of the possible IR scaling solutions of our model and some speculations on how they could be important for the observed universality of quantum Hall transitions.
A holographic model for the fractional quantum Hall effect
Lippert, Matthew; Meyer, René; Taliotis, Anastasios
2015-01-01
Experimental data for fractional quantum Hall systems can to a large extent be explained by assuming the existence of a Γ0(2) modular symmetry group commuting with the renormalization group flow and hence mapping different phases of two-dimensional electron gases into each other. Based on this insight, we construct a phenomenological holographic model which captures many features of the fractional quantum Hall effect. Using an -invariant Einstein-Maxwell-axio-dilaton theory capturing the important modular transformation properties of quantum Hall physics, we find dyonic diatonic black hole solutions which are gapped and have a Hall conductivity equal to the filling fraction, as expected for quantum Hall states. We also provide several technical results on the general behavior of the gauge field fluctuations around these dyonic dilatonic black hole solutions: we specify a sufficient criterion for IR normalizability of the fluctuations, demonstrate the preservation of the gap under the action, and prove that the singularity of the fluctuation problem in the presence of a magnetic field is an accessory singularity. We finish with a preliminary investigation of the possible IR scaling solutions of our model and some speculations on how they could be important for the observed universality of quantum Hall transitions.
Overview of Iodine Propellant Hall Thruster Development Activities at NASA Glenn Research Center
Kamhawi, Hani; Benavides, Gabriel; Haag, Thomas; Hickman, Tyler; Smith, Timothy; Williams, George; Myers, James; Polzin, Kurt; Dankanich, John; Byrne, Larry;
2016-01-01
NASA is continuing to invest in advancing Hall thruster technologies for implementation in commercial and government missions. There have been several recent iodine Hall propulsion system development activities performed by the team of the NASA Glenn Research Center, the NASA Marshall Space Flight Center, and Busek Co. Inc. In particular, the work focused on qualification of the Busek BHT-200-I, 200 W and the continued development of the BHT-600-I Hall thruster propulsion systems. This presentation presents an overview of these development activities and also reports on the results of short duration tests that were performed on the engineering model BHT-200-I and the development model BHT-600-I Hall thrusters.
Doping dependent nonlinear Hall effect in SmFeAsO1-xFx
International Nuclear Information System (INIS)
Riggs, Scott C; Kemper, J B; Stegen, Z; Boebinger, G S; McDonald, R D; Balakirev, F F; Kohama, Y; Migliori, A; Chen, H; Liu, R H; Chen, X H
2009-01-01
We report the Hall resistivity, ρ xy , of polycrystalline SmFeAsO 1-x F x for four different fluorine concentrations from the onset of superconductivity through the collapse of the structural phase transition. For the two more highly doped samples, ρ xy is linear in magnetic field up to 50 T with only weak temperature dependence, reminiscent of a simple Fermi liquid. For the lightly doped samples with x xy (H) being both nonlinear in magnetic field and strongly temperature-dependent even though the Hall angle is small. The onset temperature for this nonlinear regime is in the vicinity of the structural phase (SPT)/magnetic ordering (MO) transitions. The temperature dependence of the Hall resistivity is consistent with a thermal activation of carriers across an energy gap. The evolution of the energy gap with doping is reported. (fast track communication)
Plasma pressure tensor effects on reconnection: Hybrid and Hall-magnetohydrodynamics simulations
International Nuclear Information System (INIS)
Yin Lin; Winske, Dan
2003-01-01
Collisionless reconnection is studied using two-dimensional (2-D) hybrid (particle ions, massless fluid electrons) and Hall-magnetohydrodynamics (Hall-MHD) simulations. Both use the full electron pressure tensor instead of a localized resistivity in Ohm's law to initiate reconnection; an initial perturbation or boundary driving to the equilibrium is used. The initial configurations include one-dimensional (1-D) and 2-D current sheets both with and without a guide field. Electron dynamics from the two calculations are compared, and overall agreement is found between the calculations in both reconnection rate and global configuration [L. Yin et al., J. Geophys. Res. 106, 10761 (2001)]. It is shown that the electron drifts in the small-transverse-scale fields near the X point cause the electron motion to decouple from the ion motion, and that reconnection occurs due to electron viscous effects contained in the off-diagonal terms of the electron pressure tensor. Comparing the hybrid and Hall-MHD simulations shows that effects of the off-diagonal terms in the ion pressure tensor, i.e., the ion gyro-radius effects, are necessary in order to model correctly the ion out-of-plane motion. It is shown that these effects can be modeled efficiently in a particle Hall-MHD simulation in which particle ions are used in a predictor/corrector manner to implement ion gyro-radius corrections [L. Yin et al., Phys. Plasmas 9, 2575 (2002)]. For modeling reconnection in large systems, a new integrated approach is examined in which Hall-MHD calculations using a full electron pressure tensor model is embedded inside a MHD simulation. The embedded simulation of current sheet thinning and reconnection dynamics in a realistic 2-D magnetotail equilibrium exhibits smooth transitions of plasma and field quantities between the two regions, with small-scale physics represented well in the compressed current sheet and in the near-X-point region
Transition I efficiency and victory in volleyball matches
Directory of Open Access Journals (Sweden)
Herbert Ugrinowitsch
2014-03-01
Full Text Available The present study investigated the correlation between Transition Iwith victory in volleyball matches. The 2002 South-American Youth Men's Championship was recorded and the Transition I was analyzed and classified as negative, null or positive. Results of the efficiency in Transition I was calculated using t test for independent samples and compared to the efficiency between teams during each set and matches. Spearman correlation assessed the relationship between efficiency in each set and results of the matches with the final ranking in the championship. The results showed that the winning teams exhibited higher efficiency in Transition I, as well as a positive relationship of higher efficiency in Transition I with all of their results. The higher efficiency in Transition I is related to victory in volleyball matches.
Prediction of a quantum anomalous Hall state in Co-decorated silicene
Kaloni, Thaneshwor P.
2014-01-09
Based on first-principles calculations, we demonstrate that Co-decorated silicene can host a quantum anomalous Hall state. The exchange field induced by the Co atoms combined with the strong spin-orbit coupling of the silicene opens a nontrivial band gap at the K point. As compared to other transition metals, Co-decorated silicene is unique in this respect, since usually hybridization and spin-polarization induced in the silicene suppress a quantum anomalous Hall state.
Prediction of a quantum anomalous Hall state in Co-decorated silicene
Kaloni, Thaneshwor P.; Schwingenschlö gl, Udo; Singh, Nirpendra
2014-01-01
Based on first-principles calculations, we demonstrate that Co-decorated silicene can host a quantum anomalous Hall state. The exchange field induced by the Co atoms combined with the strong spin-orbit coupling of the silicene opens a nontrivial band gap at the K point. As compared to other transition metals, Co-decorated silicene is unique in this respect, since usually hybridization and spin-polarization induced in the silicene suppress a quantum anomalous Hall state.
Stuart Hall on Racism and the Importance of Diasporic Thinking
Rizvi, Fazal
2015-01-01
In this article, I want to show how my initial encounter with the work of Stuart Hall was grounded in my reading of the later philosophy of Ludwig Wittgenstein, and was shaped by my interest in understanding the nature of racism across the three countries in which I had lived. Over the years, Hall's various writings have helped me to make sense of…
Transition probabilities for the alkali isoelectronic sequences Li I, Na I, K I, Rb I, Cs I, FR I
International Nuclear Information System (INIS)
Lindgard, A.; Nielsen, S.E.
1977-01-01
Dipole transition probabilities, oscillator strengths, lifetimes (mean lives), and branching ratios derived from a numerical Coulomb approximation are presented for experimentally identified (and some extrapolated) states n< or =12, l< or =4 for each of the following members of the alkali sequences (Z/sub net/ is the net charge of the corresponding ion): Li I Z/sub net/=1-15, 17-24 Rb I Z/sub net/=1-6 Na I Z/sub net/=1-24 Cs I Z/sub net/=1-5 K I Z/sub net/=1-7 Fr I Z/sub net/=2,4. The results are presented in transition diagrams and in tables giving energy-level values and transition wavelengths as well. An appendix on hydrogen results for 5< or =n< or =12, 4< or =l< or =11 is included to represent the high-angular-momentum states of all members of the alkali isoelectronic sequences
Levitation of current carrying states in the lattice model for the integer quantum Hall effect.
Koschny, T; Potempa, H; Schweitzer, L
2001-04-23
The disorder driven quantum Hall to insulator transition is investigated for a two-dimensional lattice model. The Hall conductivity and the localization length are calculated numerically near the transition. For uncorrelated and weakly correlated disorder potentials the current carrying states are annihilated by the negative Chern states originating from the band center. In the presence of correlated disorder potentials with correlation length larger than approximately half the lattice constant the floating up of the critical states in energy without merging is observed. This behavior is similar to the levitation scenario proposed for the continuum model.
Four-dimensional Hall mechanics as a particle on CP3
International Nuclear Information System (INIS)
Bellucci, Stefano; Casteill, Pierre-Yves; Nersessian, Armen
2003-01-01
In order to establish an explicit connection between four-dimensional Hall effect on S 4 and six-dimensional Hall effect on CP 3 , we perform the Hamiltonian reduction of a particle moving on CP 3 in a constant magnetic field to the four-dimensional Hall mechanics (i.e., a-bar particle on S 4 in a SU(2) instanton field). This reduction corresponds to fixing the isospin of the latter system
Useful Pedagogical Applications of the Classical Hall Effect
Houari, Ahmed
2007-01-01
One of the most known phenomena in physics is the Hall effect. This is mainly due to its simplicity and to the wide range of its theoretical and practical applications. To complete the pedagogical utility of the Hall effect in physics teaching, I will apply it here to determine the Faraday constant as a fundamental physical number and the number…
Overview of NASA Iodine Hall Thruster Propulsion System Development
Smith, Timothy D.; Kamhawi, Hani; Hickman, Tyler; Haag, Thomas; Dankanich, John; Polzin, Kurt; Byrne, Lawrence; Szabo, James
2016-01-01
NASA is continuing to invest in advancing Hall thruster technologies for implementation in commercial and government missions. The most recent focus has been on increasing the power level for large-scale exploration applications. However, there has also been a similar push to examine applications of electric propulsion for small spacecraft in the range of 300 kg or less. There have been several recent iodine Hall propulsion system development activities performed by the team of the NASA Glenn Research Center, the NASA Marshall Space Flight Center, and Busek Co. Inc. In particular, the work focused on qualification of the Busek 200-W BHT-200-I and development of the 600-W BHT-600-I systems. This paper discusses the current status of iodine Hall propulsion system developments along with supporting technology development efforts.
Real-space mapping of a disordered two-dimensional electron system in the quantum Hall regime
International Nuclear Information System (INIS)
Hashimoto, K; Hirayama, Y; Wiebe, J; Wiesendanger, R; Inaoka, T; Morgenstern, M
2011-01-01
By using scanning tunnelling spectroscopy, we study the influence of potential disorder on an adsorbate-induced two-dimensional electron system in the integer quantum Hall regime. The real-space imaged local density of states exhibits transition from localized drift states encircling the potential minima to another type of localized drift states encircling the potential maxima. While the former states show regular round shapes, the latter have irregular-shaped patterns. This difference is induced by different sources for the potential minima and maxima, i.e., substrate donors and an inhomogeneous distribution of the adsorbates, respectively.
Quasiparticle Aggregation in the Fractional Quantum Hall Effect
Laughlin, R. B.
1984-10-10
Quasiparticles in the Fractional Quantum Hall Effect behave qualitatively like electrons confined to the lowest landau level, and can do everything electrons can do, including condense into second generation Fractional Quantum Hall ground states. I review in this paper the reasoning leading to variational wavefunctions for ground state and quasiparticles in the 1/3 effect. I then show how two-quasiparticle eigenstates are uniquely determined from symmetry, and how this leads in a natural way to variational wavefunctions for composite states which have the correct densities (2/5, 2/7, ...). I show in the process that the boson, anyon and fermion representations for the quasiparticles used by Haldane, Halperin, and me are all equivalent. I demonstrate a simple way to derive Halperin`s multiple-valued quasiparticle wavefunction from the correct single-valued electron wavefunction. (auth)
Experimental halls workshop summary
International Nuclear Information System (INIS)
Thorndike, A.
1976-01-01
On May 26 and 27, 1976, approximately 50 people met for an informal workshop on plans for experimental halls for ISABELLE. Plans as they exist in the May 1976 version of the ISABELLE proposal were presented. Discussions were held on the following four general topics by separate working groups: (1) pros and cons of open areas as compared with enclosed halls; (2) experimental hall needs of ep, anti pp, and other options; (3) hall for the lepton detector; and (4) hall for the hadron spectrometer. The planning for experimental halls at PEP, the hall for the lepton detector, the hadron spectrometer, and open areas are discussed
Hall current effects in dynamic magnetic reconnection solutions
International Nuclear Information System (INIS)
Craig, I.J.D.; Heerikhuisen, J.; Watson, P.G.
2003-01-01
The impact of Hall current contributions on flow driven planar magnetic merging solutions is discussed. The Hall current is important if the dimensionless Hall parameter (or normalized ion skin depth) satisfies c H >η, where η is the inverse Lundquist number for the plasma. A dynamic analysis of the problem shows, however, that the Hall current initially manifests itself, not by modifying the planar reconnection field, but by inducing a non-reconnecting perpendicular 'separator' component in the magnetic field. Only if the stronger condition c H 2 >η is satisfied can Hall currents be expected to affect the planar merging. These analytic predictions are then tested by performing a series of numerical experiments in periodic geometry, using the full system of planar magnetohydrodynamic (MHD) equations. The numerical results confirm that the nature of the merging changes dramatically when the Hall coupling satisfies c H 2 >η. In line with the analytic treatment of sheared reconnection, the coupling provided by the Hall term leads to the emergence of multiple current layers that can enhance the global Ohmic dissipation at the expense of the reconnection rate. However, the details of the dissipation depend critically on the symmetries of the simulation, and when the merging is 'head-on' (i.e., comprises fourfold symmetry) the reconnection rate can be enhanced
Experimental halls workshop summary
International Nuclear Information System (INIS)
Thorndike, A.
1976-01-01
A brief discussion is given of: (1) pros and cons of open areas as compared with enclosed halls; (2) experimental hall needs of ep, anti p p, and other options; (3) hall for the lepton detector; and, (4) hall for the hadron spectrometer
Experimental halls workshop summary
International Nuclear Information System (INIS)
Thorndike, A.
1976-01-01
At the experimental halls workshop, discussions were held on: (1) open areas as compared with enclosed halls; (2) the needs of ep, anti pp, and other options; (3) the hall for the lepton detector; and (4) the hall for the hadron spectrometer. The value of different possibilities for the future experimental program was explored. A number of suggestions emerged which will be used as the design of the experimental halls progresses
All Optical Measurement Proposed for the Photovoltaic Hall Effect
International Nuclear Information System (INIS)
Oka, Takashi; Aoki, Hideo
2011-01-01
We propose an all optical way to measure the recently proposed p hotovoltaic Hall effect , i.e., a Hall effect induced by a circularly polarized light in the absence of static magnetic fields. This is done in a pump-probe experiment with the Faraday rotation angle being the probe. The Floquet extended Kubo formula for photo-induced optical response is formulated and the ac-Hall conductivity is calculated. We also point out the possibility of observing the effect in two layered graphene, three-dimensional graphite, and more generally in multi-band systems such as materials described by the dp-model.
ε-iron nitrides: Intrinsic anomalous Hall ferromagnets
Directory of Open Access Journals (Sweden)
Guo-Ke Li
2015-02-01
Full Text Available The anomalous Hall effect in ε-iron nitrides (ε-Fe3-xN, 0 ≤ x ≤ 1 has been systematically investigated taking advantage of the fact that the exchange splitting of ε-Fe3-xN can be continuously tuned through the nitrogen concentration. It has been found that the anomalous Hall conductivity, σ x y A H , is proportional to the saturation magnetization MS, i.e., σ x y A H = S H M S , across significant variations in the saturation magnetization (96–1146 emu/cc. This relationship is in excellent agreement with the intrinsic mechanism as well as with the unified theory of AHE. Our results also demonstrate that the anomalous Hall conductivity is sensitive to the exchange splitting of the band structure.
Scattering Effect on Anomalous Hall Effect in Ferromagnetic Transition Metals
Zhang, Qiang
2017-11-30
The anomalous Hall effect (AHE) has been discovered for over a century, but its origin is still highly controversial theoretically and experimentally. In this study, we investigated the scattering effect on the AHE for both exploring the underlying physics and technical applications. We prepared Cox(MgO)100-x granular thin films with different Co volume fraction (34≤≤100) and studied the interfacial scattering effect on the AHE. The STEM HAADF images confirmed the inhomogeneous granular structure of the samples. As decreases from 100 to 34, the values of longitudinal resistivity () and anomalous Hall resistivity (AHE) respectively increase by about four and three orders in magnitude. The linear scaling relation between the anomalous Hall coefficient () and the measured at 5 K holds in both the as-prepared and annealed samples, which suggests a skew scattering dominated mechanism in Cox(MgO)100-x granular thin films. We prepared (Fe36//Au12/), (Ni36//Au12/) and (Ta12//Fe36/) multilayers to study the interfacial scattering effect on the AHE. The multilayer structures were characterized by the XRR spectra and TEM images of cross-sections. For the three serials of multilayers, both the and AHE increase with , which clearly shows interfacial scattering effect. The intrinsic contribution decreases with increases in the three serials of samples, which may be due to the crystallinity decaying or the finite size effect. In the (Fe36//Au12/) samples, the side-jump contribution increases with , which suggests an interfacial scattering-enhanced side jump. In the (Ni36//Au12/) samples, the side-jump contribution decreases with increases, which could be explained by the opposite sign of the interfacial scattering and grain boundary scattering contributed side jump. In the (Ta12//Fe36/) multilayers, the side-jump contribution changed from negative to positive, which is also because of the opposite sign of the interfacial scattering and grain boundary scattering
Anomalous Hall effect from vortex motion in high-Tc superconductors
International Nuclear Information System (INIS)
Chen, J.L.; Yang, T.J.
1994-01-01
In this work, the unusual Seebeck effect is taken into consideration in explaining the possible origin of the anomalous Hall effect for high-T c superconductors. Combining Maki's theory of transport entropy and Tinkham's theory of resistive transition, we explain why the anomalous Hall effect can be observed in high-T c superconductors, but is absent in most conventional superconductors. The behavior of ρ xy (H,T) in our theory is qualitatively consistent with experiments. In addition, our theory not only predicts that ρ xy will become positive from ρ xy xy |∝ρ xx 2 in the region of ρ xy xy will diminish with increasing defect concentration
Topological Hall and spin Hall effects in disordered skyrmionic textures
Ndiaye, Papa Birame; Akosa, Collins Ashu; Manchon, Aurelien
2017-01-01
We carry out a thorough study of the topological Hall and topological spin Hall effects in disordered skyrmionic systems: the dimensionless (spin) Hall angles are evaluated across the energy-band structure in the multiprobe Landauer-Büttiker formalism and their link to the effective magnetic field emerging from the real-space topology of the spin texture is highlighted. We discuss these results for an optimal skyrmion size and for various sizes of the sample and find that the adiabatic approximation still holds for large skyrmions as well as for nanoskyrmions. Finally, we test the robustness of the topological signals against disorder strength and show that the topological Hall effect is highly sensitive to momentum scattering.
Topological Hall and spin Hall effects in disordered skyrmionic textures
Ndiaye, Papa Birame
2017-02-24
We carry out a thorough study of the topological Hall and topological spin Hall effects in disordered skyrmionic systems: the dimensionless (spin) Hall angles are evaluated across the energy-band structure in the multiprobe Landauer-Büttiker formalism and their link to the effective magnetic field emerging from the real-space topology of the spin texture is highlighted. We discuss these results for an optimal skyrmion size and for various sizes of the sample and find that the adiabatic approximation still holds for large skyrmions as well as for nanoskyrmions. Finally, we test the robustness of the topological signals against disorder strength and show that the topological Hall effect is highly sensitive to momentum scattering.
Anomalous Hall effect in the van der Waals bonded ferromagnet Fe3 -xGeTe2
Liu, Yu; Stavitski, Eli; Attenkofer, Klaus; Petrovic, C.
2018-04-01
We report the anomalous Hall effect (AHE) in single crystals of a quasi-two-dimensional Fe3 -xGeTe2 (x ≈0.36 ) ferromagnet grown by the flux method which induces defects on the Fe site and bad metallic resistivity. Fe K-edge x-ray absorption spectroscopy was measured to provide information on the local atomic environment in such crystals. The dc and ac magnetic susceptibility measurements indicate a second-stage transition below 119 K in addition to the paramagnetic to ferromagnetic transition at 153 K. A linear scaling behavior between the modified anomalous Hall resistivity ρx y/μ0Heff and longitudinal resistivity ρxx 2M /μ0Heff implies that the AHE in Fe3 -xGeTe2 should be dominated by the intrinsic Karplus-Luttinger mechanism rather than the extrinsic skew-scattering and side-jump mechanisms. The observed deviation in the linear-M Hall conductivity σxy A below 30 K is in line with its transport characteristic at low temperatures, implying the scattering of conduction electrons due to magnetic disorder and the evolution of the Fermi surface induced by a possible spin-reorientation transition.
A portable Hall magnetometer probe for characterization of magnetic iron oxide nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Araujo, Jefferson F.D.F.; Costa, Mateus C.; Louro, Sonia R.W.; Bruno, Antonio C., E-mail: acbruno@puc-rio.br
2017-03-15
We have built a portable Hall magnetometer probe, for measuring magnetic properties of iron oxide nanoparticles, that can be used for bulk materials and liquid samples as well. The magnetometer probe consists of four voltage-programmable commercial Hall sensors and a thin acrylic plate for positioning the sensors. In order to operate, it needs to be attached to a pole of an electromagnet and connected to an AD converter and a computer. It acquires a complete magnetization curve in a couple of minutes and has a magnetic moment sensitivity of 3.5×10{sup −7} Am{sup 2}. We tested its performance with magnetic nanoparticles containing an iron oxide core and having coating layers with different sizes. The magnetization results obtained were compared with measurements performed on commercial stand-alone magnetometers, and exhibited errors of about ±0.2 Am{sup 2}/kg (i.e 0.4%) at saturation and below 0.5 Am{sup 2}/kg (i.e. 10%) at remanence. - Highlights: • A low-cost portable Hall magnetometer probe has been built. • The Hall magnetometer probe can be attached to any electromagnet. • The Hall probe was calibrated and successfully compared to industry standard magnetometers. • The Hall probe was able to measure iron oxide nanoparticles with different coatings.
A portable Hall magnetometer probe for characterization of magnetic iron oxide nanoparticles
International Nuclear Information System (INIS)
Araujo, Jefferson F.D.F.; Costa, Mateus C.; Louro, Sonia R.W.; Bruno, Antonio C.
2017-01-01
We have built a portable Hall magnetometer probe, for measuring magnetic properties of iron oxide nanoparticles, that can be used for bulk materials and liquid samples as well. The magnetometer probe consists of four voltage-programmable commercial Hall sensors and a thin acrylic plate for positioning the sensors. In order to operate, it needs to be attached to a pole of an electromagnet and connected to an AD converter and a computer. It acquires a complete magnetization curve in a couple of minutes and has a magnetic moment sensitivity of 3.5×10 −7 Am 2 . We tested its performance with magnetic nanoparticles containing an iron oxide core and having coating layers with different sizes. The magnetization results obtained were compared with measurements performed on commercial stand-alone magnetometers, and exhibited errors of about ±0.2 Am 2 /kg (i.e 0.4%) at saturation and below 0.5 Am 2 /kg (i.e. 10%) at remanence. - Highlights: • A low-cost portable Hall magnetometer probe has been built. • The Hall magnetometer probe can be attached to any electromagnet. • The Hall probe was calibrated and successfully compared to industry standard magnetometers. • The Hall probe was able to measure iron oxide nanoparticles with different coatings.
International Nuclear Information System (INIS)
Avdonin, A.; Skupiński, P.; Grasza, K.
2016-01-01
A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.
Energy Technology Data Exchange (ETDEWEB)
Avdonin, A., E-mail: avdonin@ifpan.edu.pl [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Skupiński, P. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Grasza, K. [Institute of Physics, Polish Academy of Sciences, Al. Lotników 32/46, 02-668 Warszawa (Poland); Institute of Electronic Materials Technology, ul. Wólczyńska 133, 01-919 Warszawa (Poland)
2016-02-15
A simple description of the Hall effect in the hopping regime of conductivity in semiconductors is presented. Expressions for the Hall coefficient and Hall mobility are derived by considering averaged equilibrium electron transport in a single triangle of localization sites in a magnetic field. Dependence of the Hall coefficient is analyzed in a wide range of temperature and magnetic field values. Our theoretical result is applied to our experimental data on temperature dependence of Hall effect and Hall mobility in ZnO. - Highlights: • Expressions for Hall coefficient and mobility for hopping conductivity are derived. • Theoretical result is compared with experimental curves measured on ZnO. • Simultaneous action of free and hopping conduction channels is considered. • Non-linearity of hopping Hall coefficient is predicted.
Local orbitals approach to the anomalous Hall and Nernst effects in itinerant ferromagnets
Directory of Open Access Journals (Sweden)
Středa Pavel
2014-07-01
Full Text Available Linear response of the orbital momentum to the gradient of the chemical potential is used to obtain anomalous Hall conductivity. Transition from the ideal Bloch system for which the conductivity is determined by the Berry phase curvatures to the case of strong disorder for which the conductivity becomes dependent on the relaxation time is analysed. Presented tight-binding model reproduces experimentally observed qualitative features of the anomalous Hall conductivity and the transverse Peltier coefficient in the so called bad-metal and scattering-independent regimes.
Tunable spin-charge conversion through topological phase transitions in zigzag nanoribbons
Li, Hang
2016-06-29
We study spin-orbit torques and charge pumping in magnetic quasi-one-dimensional zigzag nanoribbons with a hexagonal lattice, in the presence of large intrinsic spin-orbit coupling. Such a system experiences a topological phase transition from a trivial band insulator to a quantum spin Hall insulator by tuning of either the magnetization direction or the intrinsic spin-orbit coupling. We find that the spin-charge conversion efficiency (i.e., spin-orbit torque and charge pumping) is dramatically enhanced at the topological transition, displaying a substantial angular anisotropy.
Tunable spin-charge conversion through topological phase transitions in zigzag nanoribbons
Li, Hang; Manchon, Aurelien
2016-01-01
We study spin-orbit torques and charge pumping in magnetic quasi-one-dimensional zigzag nanoribbons with a hexagonal lattice, in the presence of large intrinsic spin-orbit coupling. Such a system experiences a topological phase transition from a trivial band insulator to a quantum spin Hall insulator by tuning of either the magnetization direction or the intrinsic spin-orbit coupling. We find that the spin-charge conversion efficiency (i.e., spin-orbit torque and charge pumping) is dramatically enhanced at the topological transition, displaying a substantial angular anisotropy.
Yang, Yuan; Yang, Jian; Li, Xiaobing; Zhao, Yue
2018-03-01
We investigate the topological phase transitions in an anisotropic square-octagon lattice in the presence of spin-orbit coupling and exchange field. On the basis of the Chern number and spin Chern number, we find a number of topologically distinct phases with tuning the exchange field, including time-reversal-symmetry-broken quantum spin Hall phases, quantum anomalous Hall phases and a topologically trivial phase. Particularly, we observe a coexistent state of both the quantum spin Hall effect and quantum anomalous Hall effect. Besides, by adjusting the exchange filed, we find the phase transition from time-reversal-symmetry-broken quantum spin Hall phase to spin-imbalanced and spin-polarized quantum anomalous Hall phases, providing an opportunity for quantum spin manipulation. The bulk band gap closes when topological phase transitions occur between different topological phases. Furthermore, the energy and spin spectra of the edge states corresponding to different topological phases are consistent with the topological characterization based on the Chern and spin Chern numbers.
Yang, Wei-Wei; Li, Lei; Zhao, Jing-Sheng; Liu, Xiao-Xiong; Deng, Jian-Bo; Tao, Xiao-Ma; Hu, Xian-Ru
2018-05-01
By doing calculations based on density functional theory, we predict that the two-dimensional anti-ferromagnetic (AFM) NiOsCl6 as a Chern insulator can realize the quantum anomalous Hall (QAH) effect. We investigate the magnetocrystalline anisotropy energies in different magnetic configurations and the Néel AFM configuration is proved to be ground state. When considering spin–orbit coupling (SOC), this layered material with spins perpendicular to the plane shows properties as a Chern insulator characterized by an inversion band structure and a nonzero Chern number. The nontrivial band gap is 37 meV and the Chern number C = ‑1, which are induced by a strong SOC and AFM order. With strong SOC, the NiOsCl6 system performs a continuous topological phase transition from the Chern insulator to the trivial insulator upon the increasing Coulomb repulsion U. The critical U c is indicated as 0.23 eV, at which the system is in a metallic phase with . Upon increasing U, the E g reduces linearly with C = ‑1 for 0 U c . At last we analysis the QAH properties and this continuous topological phase transition theoretically in a two-band model. This AFM Chern insulator NiOsCl6 proposes not only a promising way to realize the QAH effect, but also a new material to study the continuous topological phase transition.
Carpentier, David
1998-01-01
Using the renormalisation group (RG) we study two dimensional electromagnetic coulomb gas and extended Sine-Gordon theories invariant under the modular group SL(2,Z). The flow diagram is established from the scaling equations, and we derive the critical behaviour at the various transition points of the diagram. Following proposal for a SL(2,Z) duality between different quantum Hall fluids, we discuss the analogy between this flow and the global quantum Hall phase diagram.
International Nuclear Information System (INIS)
Sánchez-Arriaga, G.
2013-01-01
The existence of discontinuities within the double-adiabatic Hall-magnetohydrodynamics (MHD) model is discussed. These solutions are transitional layers where some of the plasma properties change from one equilibrium state to another. Under the assumption of traveling wave solutions with velocity C and propagation angle θ with respect to the ambient magnetic field, the Hall-MHD model reduces to a dynamical system and the waves are heteroclinic orbits joining two different fixed points. The analysis of the fixed points rules out the existence of rotational discontinuities. Simple considerations about the Hamiltonian nature of the system show that, unlike dissipative models, the intermediate shock waves are organized in branches in parameter space, i.e., they occur if a given relationship between θ and C is satisfied. Electron-polarized (ion-polarized) shock waves exhibit, in addition to a reversal of the magnetic field component tangential to the shock front, a maximum (minimum) of the magnetic field amplitude. The jumps of the magnetic field and the relative specific volume between the downstream and the upstream states as a function of the plasma properties are presented. The organization in parameter space of localized structures including in the model the influence of finite Larmor radius is discussed
Contribution of the study of the Hall Effect. Hall Effect of powder products
International Nuclear Information System (INIS)
Cherville, Jean
1961-01-01
This research thesis reports the development of an apparatus aimed at measuring the Hall Effect and the magneto-resistance of powders at room temperature and at the liquid nitrogen temperature. The author also proposes a theoretical contribution to the Hall Effect and reports the calculation of conditions to be met to obtain a correct value for the Hall constant. Results are experimentally verified. The method is then applied to the study of a set of powdered pre-graphitic graphites. The author shows that their Hall coefficient confirms the model already proposed by Mrozowski. The study of the Hall Effect of any kind of powders can thus be performed, and the Hall Effect can therefore be a mean to study mineral and organic compounds, and notably powdered biological molecules [fr
Cryogenic microsize Hall sensors
International Nuclear Information System (INIS)
Kvitkovic, J.; Polak, M.
1993-01-01
Hall sensors have a variety of applications in magnetic field measurements. The active area of the Hall sensor does not play an important role in measuring of homogeneous magnetic field. Actually Hall sensors are widely used to measure profiles of magnetic fields produced by magnetization currents in samples of HTC superconductors, as well as of LTC ones. Similar techniques are used to measure magnetization of both HTC and LTC superconductors. In these cases Hall sensor operates in highly inhomogeneous magnetic fields. Because of that, Hall sensors with very small active area are required. We developed and tested Hall sensors with active area 100 μm x 100 μm - type M and 50 μm x 50 μm - type V. Here we report on the most imporant parameters of these units, as well as on their properties as differential magnetometer. (orig.)
Nagaosa, Naoto; Sinova, Jairo; Onoda, Shigeki; MacDonald, A. H.; Ong, N. P.
2010-04-01
The anomalous Hall effect (AHE) occurs in solids with broken time-reversal symmetry, typically in a ferromagnetic phase, as a consequence of spin-orbit coupling. Experimental and theoretical studies of the AHE are reviewed, focusing on recent developments that have provided a more complete framework for understanding this subtle phenomenon and have, in many instances, replaced controversy by clarity. Synergy between experimental and theoretical works, both playing a crucial role, has been at the heart of these advances. On the theoretical front, the adoption of the Berry-phase concepts has established a link between the AHE and the topological nature of the Hall currents. On the experimental front, new experimental studies of the AHE in transition metals, transition-metal oxides, spinels, pyrochlores, and metallic dilute magnetic semiconductors have established systematic trends. These two developments, in concert with first-principles electronic structure calculations, strongly favor the dominance of an intrinsic Berry-phase-related AHE mechanism in metallic ferromagnets with moderate conductivity. The intrinsic AHE can be expressed in terms of the Berry-phase curvatures and it is therefore an intrinsic quantum-mechanical property of a perfect crystal. An extrinsic mechanism, skew scattering from disorder, tends to dominate the AHE in highly conductive ferromagnets. The full modern semiclassical treatment of the AHE is reviewed which incorporates an anomalous contribution to wave-packet group velocity due to momentum-space Berry curvatures and correctly combines the roles of intrinsic and extrinsic (skew-scattering and side-jump) scattering-related mechanisms. In addition, more rigorous quantum-mechanical treatments based on the Kubo and Keldysh formalisms are reviewed, taking into account multiband effects, and demonstrate the equivalence of all three linear response theories in the metallic regime. Building on results from recent experiment and theory, a
Field theory of anyons and the fractional quantum Hall effect
International Nuclear Information System (INIS)
Viefers, S.F.
1997-11-01
The thesis is devoted to a theoretical study of anyons, i.e. particles with fractional statistics moving in two space dimensions, and the quantum Hall effect. The latter constitutes the only known experimental realization of anyons in that the quasiparticle excitations in the fractional quantum Hall system are believed to obey fractional statistics. First, the properties of ideal quantum gases in two dimensions and in particular the equation of state of the free anyons gas are discussed. Then, a field theory formulation of anyons in a strong magnetic field is presented and later extended to a system with several species of anyons. The relation of this model to fractional exclusion statistics, i.e. intermediate statistics introduced by a generalization of the Pauli principle, and to the low-energy excitations at the edge of the quantum Hall system is discussed. Finally, the Chern-Simons-Landau-Ginzburg theory of the fractional quantum Hall effect is studied, mainly focusing on edge effects; both the ground state and the low-energy edge excitations are examined in the simple one-component model and in an extended model which includes spin effects
Topological Hall and Spin Hall Effects in Disordered Skyrmionic Textures
N'diaye, P. B.; Akosa, C. A.; Manchon, A.
2016-01-01
We carry out a throughout study of the topological Hall and topological spin Hall effects in disordered skyrmionic systems: the dimensionless (spin) Hall angles are evaluated across the energy band structure in the multiprobe Landauer-B\\"uttiker formalism and their link to the effective magnetic field emerging from the real space topology of the spin texture is highlighted. We discuss these results for an optimal skyrmion size and for various sizes of the sample and found that the adiabatic a...
Tuning giant anomalous Hall resistance ratio in perpendicular Hall balance
Energy Technology Data Exchange (ETDEWEB)
Zhang, J. Y.; Yang, G. [Department of Materials Physics and Chemistry, University of Science and Technology Beijing, Beijing 100083 (China); State Key Laboratory of Magnetism, Beijing National Laboratory for Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Wang, S. G., E-mail: sgwang@iphy.ac.cn, E-mail: ghyu@mater.ustb.edu.cn [State Key Laboratory of Magnetism, Beijing National Laboratory for Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Liu, J. L. [State Key Laboratory of Magnetism, Beijing National Laboratory for Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China); Wang, R. M. [Department of Physics, Beijing University of Aeronautics and Astronautics, Beijing 100191 (China); Amsellem, E.; Kohn, A. [Department of Materials Engineering, Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer-Sheva 84105 (Israel); Yu, G. H., E-mail: sgwang@iphy.ac.cn, E-mail: ghyu@mater.ustb.edu.cn [Department of Materials Physics and Chemistry, University of Science and Technology Beijing, Beijing 100083 (China)
2015-04-13
Anomalous Hall effect at room temperature in perpendicular Hall balance with a core structure of [Pt/Co]{sub 4}/NiO/[Co/Pt]{sub 4} has been tuned by functional CoO layers, where [Pt/Co]{sub 4} multilayers exhibit perpendicular magnetic anisotropy. A giant Hall resistance ratio up to 69 900% and saturation Hall resistance (R{sub S}{sup P}) up to 2590 mΩ were obtained in CoO/[Pt/Co]{sub 4}/NiO/[Co/Pt]{sub 4}/CoO system, which is 302% and 146% larger than that in the structure without CoO layers, respectively. Transmission electron microscopy shows highly textured [Co/Pt]{sub 4} multilayers and oxide layers with local epitaxial relations, indicating that the crystallographic structure has significant influence on spin dependent transport properties.
Tunnelling anomalous and planar Hall effects (Conference Presentation)
Matos-Abiague, Alex; Scharf, Benedikt; Han, Jong E.; Hankiewicz, Ewelina M.; Zutic, Igor
2016-10-01
We theoretically show how the interplay between spin-orbit coupling (SOC) and magnetism can result in a finite tunneling Hall conductance, transverse to the applied bias. For two-dimensional tunnel junctions with a ferromagnetic lead and magnetization perpendicular to the current flow, the detected anomalous Hall voltage can be used to extract information not only about the spin polarization but also about the strength of the interfacial SOC. In contrast, a tunneling current across a ferromagnetic barrier on the surface of a three-dimensional topological insulator (TI) can induce a planar Hall response even when the magnetization is oriented along the current flow[1]. The tunneling nature of the states contributing to the planar Hall conductance can be switched from the ordinary to the Klein regimes by the electrostatic control of the barrier strength. This allows for an enhancement of the transverse response and a giant Hall angle, with the tunneling planar Hall conductance exceeding the longitudinal component. Despite the simplicity of a single ferromagnetic region, the TI/ferromagnet system exhibits a variety of functionalities. In addition to a spin-valve operation for magnetic sensing and storing information, positive, negative, and negative differential conductances can be tuned by properly adjusting the barrier potential and/or varying the magnetization direction. Such different resistive behaviors in the same system are attractive for potential applications in reconfigurable spintronic devices. [1] B. Scharf, A. Matos-Abiague, J. E. Han, E. M. Hankiewicz, and I. Zutic, arXiv:1601.01009 (2016).
Improving the Q:H strength ratio in women using plyometric exercises.
Tsang, Kavin K W; DiPasquale, Angela A
2011-10-01
Plyometric training programs have been implemented in anterior cruciate ligament injury prevention programs. Plyometric exercises are designed to aid in the improvement of muscle strength and neuromuscular control. Our purpose was to examine the effects of plyometric training on lower leg strength in women. Thirty (age = 20.3 ± 1.9 years) recreationally active women were divided into control and experimental groups. The experimental group performed a plyometric training program for 6 weeks, 3 d·wk(-1). All subjects attended 4 testing sessions: before the start of the training program and after weeks 2, 4, and 6. Concentric quadriceps and hamstring strength (dominant leg) was assessed using an isokinetic dynamometer at speeds of 60 and 120°·s(-1). Peak torque, average peak torque, and average power (AvgPower) were measured. The results revealed a significant (p plyometric group than in the control group at testing session 4 and that AvgPower was greater in the plyometric group than in the control group in testing sessions 2-4. Our results indicate that the plyometric training program increased hamstring strength while maintaining quadriceps strength, thereby improving the Q:H strength ratio.
Szabo, James J.
2015-01-01
This Phase II project is developing a magnesium (Mg) Hall effect thruster system that would open the door for in situ resource utilization (ISRU)-based solar system exploration. Magnesium is light and easy to ionize. For a Mars- Earth transfer, the propellant mass savings with respect to a xenon Hall effect thruster (HET) system are enormous. Magnesium also can be combusted in a rocket with carbon dioxide (CO2) or water (H2O), enabling a multimode propulsion system with propellant sharing and ISRU. In the near term, CO2 and H2O would be collected in situ on Mars or the moon. In the far term, Mg itself would be collected from Martian and lunar regolith. In Phase I, an integrated, medium-power (1- to 3-kW) Mg HET system was developed and tested. Controlled, steady operation at constant voltage and power was demonstrated. Preliminary measurements indicate a specific impulse (Isp) greater than 4,000 s was achieved at a discharge potential of 400 V. The feasibility of delivering fluidized Mg powder to a medium- or high-power thruster also was demonstrated. Phase II of the project evaluated the performance of an integrated, highpower Mg Hall thruster system in a relevant space environment. Researchers improved the medium power thruster system and characterized it in detail. Researchers also designed and built a high-power (8- to 20-kW) Mg HET. A fluidized powder feed system supporting the high-power thruster was built and delivered to Busek Company, Inc.
The fluctuation Hall conductivity and the Hall angle in type-II superconductor under magnetic field
Energy Technology Data Exchange (ETDEWEB)
Tinh, Bui Duc, E-mail: tinhbd@hnue.edu.vn [Institute of Research and Development, Duy Tan University, K7/25 Quang Trung, Danang (Viet Nam); Department of Physics, Hanoi National University of Education, 136 Xuan Thuy, Cau Giay, Hanoi (Viet Nam); Hoc, Nguyen Quang; Thu, Le Minh [Department of Physics, Hanoi National University of Education, 136 Xuan Thuy, Cau Giay, Hanoi (Viet Nam)
2016-02-15
Highlights: • The time-dependent Ginzburg–Landau was used to calculate fluctuation Hall conductivity and Hall angle in type-II superconductor in 2D and 3D. • We obtain analytical expressions for the fluctuation Hall conductivity and the Hall angle summing all Landau levels without need to cutoff higher Landau levels to treat arbitrary magnetic field. • The results were compared to the experimental data on YBCO. - Abstract: The fluctuation Hall conductivity and the Hall angle, describing the Hall effect, are calculated for arbitrary value of the imaginary part of the relaxation time in the frame of the time-dependent Ginzburg–Landau theory in type II-superconductor with thermal noise describing strong thermal fluctuations. The self-consistent Gaussian approximation is used to treat the nonlinear interaction term in dynamics. We obtain analytical expressions for the fluctuation Hall conductivity and the Hall angle summing all Landau levels without need to cutoff higher Landau levels to treat arbitrary magnetic field. The results are compared with experimental data on high-T{sub c} superconductor.
First principles calculation of anomalous Hall conductivity in ferromagnetic bcc Fe
Czech Academy of Sciences Publication Activity Database
Yao, Y.; Kleinman, L.; MacDonald, A. H.; Sinova, J.; Jungwirth, Tomáš; Wang, D. S.; Wang, E.; Niu, Q.
2004-01-01
Roč. 92, č. 3 (2004), 037204/1-037204/4 ISSN 0031-9007 R&D Projects: GA ČR GA202/02/0912 Institutional research plan: CEZ:AV0Z1010914 Keywords : transition metal ferromagnet * anomalous Hall effect Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.218, year: 2004
Yakunin, M.V.; Galistu, G.; de Visser, A.
2008-01-01
Rich patterns of transformations in the structure of quantum Hall (QH) effect and magnetoresistivity under tilted magnetic fields were obtained in the InxGa1-xAs/GaAs double quantum well at mK temperatures. Local features correspond to the calculated intersections of Landau levels from different
Quantum Hall Electron Nematics
MacDonald, Allan
In 2D electron systems hosted by crystals with hexagonal symmetry, electron nematic phases with spontaneously broken C3 symmetry are expected to occur in the quantum Hall regime when triplets of Landau levels associated with three different Fermi surface pockets are partially filled. The broken symmetry state is driven by intravalley Coulombic exchange interactions that favor spontaneously polarized valley occupations. I will discuss three different examples of 2D electron systems in which this type of broken symmetry state is expected to occur: i) the SnTe (111) surface, ii) the Bi (111) surface. and iii) unbalanced bilayer graphene. This type of quantum Hall electron nematic state has so far been confirmed only in the Bi (111) case, in which the anisotropic quasiparticle wavefunctions of the broken symmetry state were directly imaged. In the SnTe case the nematic state phase boundary is controlled by a competition between intravalley Coulomb interactions and intervalley scattering processes that increase in relative strength with magnetic field. An in-plane Zeeman field alters the phase diagram by lifting the three-fold Landau level degeneracy, yielding a ground state energy with 2 π/3 periodicity as a function of Zeeman-field orientation angle. I will comment on the possibility of observing similar states in the absence of a magnetic field. Supported by DOE Division of Materials Sciences and Engineering Grant DE-FG03-02ER45958.
The role of the men's hall in the development of the Anglo-Saxon superego.
Earl, J W
1983-05-01
This paper is a historical study of ritual space--a bit of psychoanalytic anthropology applied to a particular case, the evolution of the men's hall among the early Anglo-Saxons. I focus particularly on the ritual functions of poetry in the hall, the same poetry which is our major evidence regarding the hall, especially the epic Beowulf. I define the hall as a cultural institution, and redefine the native poetic tradition in relation to the hall's varied ritual life, with which the poetry is so occupied. Though my argument is focused on the hall, it includes a framework of theoretical concerns. Early Anglo-Saxon culture is of anthropological interest chiefly because of its rapid and dramatic emergence from Germanic tribal prehistory into a leading role in the civilization of Christian Europe. The conquest of Britain by the Anglo-Saxons in the fifth and sixth centuries, and their conversion soon afterward, is a case history of the transformations of a tribal society suddenly introduced to the special forces of civilization and the higher religions that control them. The Anglo-Saxons are fascinating in this regard because of the fortuitous developments that prepared for this transformation and made it so successful.
Giant Planar Hall Effect in the Dirac Semimetal ZrTe5
Li, Peng
2018-03-03
Exploration and understanding of exotic topics in quantum physics such as Dirac and Weyl semimetals have become highly popular in the area of condensed matter. It has recently been predicted that a theoretical giant planar Hall effect can be induced by a chiral anomaly in Dirac and Weyl semimetals. ZrTe5 is considered an intriguing Dirac semimetal at the boundary of weak and strong topological insulators, though this claim is still controversial. In this study, we report the observation in ZrTe5 of giant planar Hall resistivity. We have also noted three different dependences of this resistivity on the magnetic field, as predicted by theory, maximum planar Hall resistivity occurs at the Lifshitz transition temperature. In addition, we have discovered a nontrivial Berry phase, as well as a chiral-anomaly-induced negative longitudinal and a giant in-plane anisotropic magnetoresistance. All these experimental observations coherently demonstrate that ZrTe5 is a Dirac semimetal.
Kim, Bom Soo
2018-05-01
We discuss the contribution of magnetic Skyrmions to the Hall viscosity and propose a simple way to identify it in experiments. The topological Skyrmion charge density has a distinct signature in the electric Hall conductivity that is identified in existing experimental data. In an electrically neutral system, the Skyrmion charge density is directly related to the thermal Hall conductivity. These results are direct consequences of the field theory Ward identities, which relate various physical quantities based on symmetries and have been previously applied to quantum Hall systems.
International Nuclear Information System (INIS)
Erkarslan, U; Oylumluoglu, G; Grayson, M; Siddiki, A
2012-01-01
The influence of the incompressible strips on the integer quantized Hall effect (IQHE) is investigated, considering a cleaved-edge overgrown (CEO) sample as an experimentally realizable sharp edge system. We propose a set of experiments to clarify the distinction between the large-sample limit when bulk disorder defines the IQHE plateau width and the small-sample limit smaller than the disorder correlation length, when self-consistent edge electrostatics define the IQHE plateau width. The large-sample or bulk quantized Hall (QH) regime is described by the usual localization picture, whereas the small-sample or edge regime is discussed within the compressible/incompressible strips picture, known as the screening theory of QH edges. Utilizing the unusually sharp edge profiles of the CEO samples, a Hall bar design is proposed to manipulate the edge potential profile from smooth to extremely sharp. By making use of a side-gate perpendicular to the two-dimensional electron system, it is shown that the plateau widths can be changed or even eliminated altogether. Hence, the visibility of IQHE is strongly influenced when adjusting the edge potential profile and/or changing the dc current direction under high currents in the nonlinear transport regime. As a second investigation, we consider two different types of ohmic contacts, namely highly transmitting (ideal) and highly reflecting (non-ideal) contacts. We show that if the injection contacts are non-ideal, but still ohmic, it is possible to measure directly the non-quantized transport taking place at the bulk of the CEO samples. The results of the experiments we propose will clarify the influence of the edge potential profile and the quality of the contacts, under QH conditions. (paper)
Simulations of Hall reconnection in partially ionized plasmas
Innocenti, Maria Elena; Jiang, Wei; Lapenta, Giovanni
2017-04-01
Magnetic reconnection occurs in the Hall, partially ionized regime in environments as diverse as molecular clouds, protostellar disks and regions of the solar chromosphere. While much is known about Hall reconnection in fully ionized plasmas, Hall reconnection in partially ionized plasmas is, in comparison, still relatively unexplored. This notwithstanding the fact that partial ionization is expected to affect fundamental processes in reconnection such as the transition from the slow, fluid to the fast, kinetic regime, the value of the reconnection rate and the dimensions of the diffusion regions [Malyshkin and Zweibel 2011 , Zweibel et al. 2011]. We present here the first, to our knowledge, fully kinetic simulations of Hall reconnection in partially ionized plasmas. The interaction of electrons and ions with the neutral background is realistically modelled via a Monte Carlo plug-in coded into the semi-implicit, fully kinetic code iPic3D [Markidis 2010]. We simulate a plasma with parameters compatible with the MRX experiments illustrated in Zweibel et al. 2011 and Lawrence et al. 2013, to be able to compare our simulation results with actual experiments. The gas and ion temperature is T=3 eV, the ion to electron temperature ratio is Tr=0.44, ion and electron thermal velocities are calculated accordingly resorting to a reduced mass ratio and a reduced value of the speed of light to reduce the computational costs of the simulations. The initial density of the plasma is set at n= 1.1 1014 cm-3 and is then left free to change during the simulation as a result of gas-plasma interaction. A set of simulations with initial ionisation percentage IP= 0.01, 0.1, 0.2, 0.6 is presented and compared with a reference simulation where no background gas is present (full ionization). In this first set of simulations, we assume to be able to externally control the initial relative densities of gas and plasma. Within this parameter range, the ion but not the electron population is
Exploring 4D quantum Hall physics with a 2D topological charge pump.
Lohse, Michael; Schweizer, Christian; Price, Hannah M; Zilberberg, Oded; Bloch, Immanuel
2018-01-03
The discovery of topological states of matter has greatly improved our understanding of phase transitions in physical systems. Instead of being described by local order parameters, topological phases are described by global topological invariants and are therefore robust against perturbations. A prominent example is the two-dimensional (2D) integer quantum Hall effect: it is characterized by the first Chern number, which manifests in the quantized Hall response that is induced by an external electric field. Generalizing the quantum Hall effect to four-dimensional (4D) systems leads to the appearance of an additional quantized Hall response, but one that is nonlinear and described by a 4D topological invariant-the second Chern number. Here we report the observation of a bulk response with intrinsic 4D topology and demonstrate its quantization by measuring the associated second Chern number. By implementing a 2D topological charge pump using ultracold bosonic atoms in an angled optical superlattice, we realize a dynamical version of the 4D integer quantum Hall effect. Using a small cloud of atoms as a local probe, we fully characterize the nonlinear response of the system via in situ imaging and site-resolved band mapping. Our findings pave the way to experimentally probing higher-dimensional quantum Hall systems, in which additional strongly correlated topological phases, exotic collective excitations and boundary phenomena such as isolated Weyl fermions are predicted.
Exploring 4D quantum Hall physics with a 2D topological charge pump
Lohse, Michael; Schweizer, Christian; Price, Hannah M.; Zilberberg, Oded; Bloch, Immanuel
2018-01-01
The discovery of topological states of matter has greatly improved our understanding of phase transitions in physical systems. Instead of being described by local order parameters, topological phases are described by global topological invariants and are therefore robust against perturbations. A prominent example is the two-dimensional (2D) integer quantum Hall effect: it is characterized by the first Chern number, which manifests in the quantized Hall response that is induced by an external electric field. Generalizing the quantum Hall effect to four-dimensional (4D) systems leads to the appearance of an additional quantized Hall response, but one that is nonlinear and described by a 4D topological invariant—the second Chern number. Here we report the observation of a bulk response with intrinsic 4D topology and demonstrate its quantization by measuring the associated second Chern number. By implementing a 2D topological charge pump using ultracold bosonic atoms in an angled optical superlattice, we realize a dynamical version of the 4D integer quantum Hall effect. Using a small cloud of atoms as a local probe, we fully characterize the nonlinear response of the system via in situ imaging and site-resolved band mapping. Our findings pave the way to experimentally probing higher-dimensional quantum Hall systems, in which additional strongly correlated topological phases, exotic collective excitations and boundary phenomena such as isolated Weyl fermions are predicted.
Energy Technology Data Exchange (ETDEWEB)
Mironov, O.A.; Myronov, M.; Durov, S.; Drachenko, O.; Leotin, J
2004-04-30
Microminiature Hall probes with sensitive area down to 33x115 {mu}m and based on n-InSb/i-GaAs optimized Sn-doped MBE-grown heterostructures are reported. The 'metallurgical' thicknesses of the n-InSb epilayers lie in the range d{sup m}=1.1-10.5 {mu}m giving room-temperature mobilities of (9-15)x10{sup 3} cm{sup 2}/Vs with carrier densities of (0.96-2.56)x10{sup 18} cm{sup -3}. Characterization of the devices was performed by magnetotransport measurements in quasi-static and pulsed magnetic fields. In the temperature range 1.1-300 K and in magnetic fields up to 12 T (static) and up to 52 T (pulsed, {tau}=120 mS), transport measurements yield remarkable linearity of the Hall voltage up to 52 T and sensitivity, as well as demonstrating the high-temperature stability of the Hall voltage, the offset voltage and the device resistivity. No significant effect of the high current up to 150 mA on either the sensitivity or the resistivity is observed.
Energy consumption of sport halls
Energy Technology Data Exchange (ETDEWEB)
1983-01-01
The energy consumption of Finland's sports halls (ball games halls, ice hockey halls and swimming halls) represent approximately 1% of that of the country's whole building stock. In the light of the facts revealed by the energy study the potential energy saving rate in sports halls is 15-25%. The total savings would be something like FIM 30-40 million per annum, of which about a half would be achieved without energy-economic investments only by changing utilization habits and by automatic control measures. The energy-economic investments are for the most part connected with ventilation and their repayment period is from one to five years. On the basis of the energy study the following specific consumption are presented as target values: swimming halls: heat (kWh/m*H3/a)100, electricity (kWh/m*H3/a)35, water (l/m*H3/a)1000 icehockey halls (warm): heat (kWh/m*H3/a)25, electricity (kWh/m*H3/a)15, water (l/m*H3/a)200, ball games halls (multi-purpose halls): heat (kWh/m*H3/a)30, electricity (kWh/m*H3/a)25, water (l/m*H3/a)130. In the study the following points proved to be the central areas of energy saving in sports halls: 1. Flexible regulation of the temperature in sports spaces on the basis of the sport in question. 2. The ventilation of swimming halls should be adjusted in such a way that the humidity of the hall air would comply with the limit humidity curve determined by the quality of structures and the temperature of the outdoor air. 3. An ice skating hall is an establishment producing condensing energy from 8 to 9 months a year worth of approx. 100.000-150.000 Finnmarks. The development of the recovery of condensing energy has become more important. 4. The ventilation of ball games halls may account for over 50% of the energy consumption of the whole building. Therefore special attention should be paid to the optimatization of ventilation as a whole.
Fractional Quantum Hall Effect in n = 0 Landau Band of Graphene with Chern Number Matrix
Kudo, Koji; Hatsugai, Yasuhiro
2018-06-01
Fully taking into account the honeycomb lattice structure, fractional quantum Hall states of graphene are considered by a pseudopotential projected into the n = 0 Landau band. By using chirality as an internal degree of freedom, the Chern number matrices are defined and evaluated numerically. Quantum phase transition induced by changing a range of the interaction is demonstrated that is associated with chirality ferromagnetism. The chirality-unpolarized ground state is consistent with the Halperin 331 state of the bilayer quantum Hall system.
Ultra-Compact Center-Mounted Hollow Cathodes for Hall Effect Thrusters, Phase I
National Aeronautics and Space Administration — The proposed innovation is a long lifetime, compact hollow cathode that can be mounted along the axis of a 600 W-class Hall effect thruster. Testing at kilowatt...
Crossover between spin swapping and Hall effect in disordered systems
Saidaoui, Hamed Ben Mohamed
2015-07-16
We theoretically study the crossover between spin Hall effect and spin swapping, a recently predicted phenomenon that consists of the interchange between the current flow and its spin polarization directions [M. B. Lifshits and M. I. Dyakonov, Phys. Rev. Lett. 103, 186601 (2009)]. Using a tight-binding model with spin-orbit coupled disorder, spin Hall effect, spin relaxation, and spin swapping are treated on equal footing. We demonstrate that spin swapping and spin Hall effect present very different dependencies as a function of the spin-orbit coupling and disorder strengths and confirm that the former exceeds the latter in the parameter range considered. Three setups are proposed for the experimental observation of the spin swapping effect.
Crossover between spin swapping and Hall effect in disordered systems
Saidaoui, Hamed Ben Mohamed; Otani, Y.; Manchon, Aurelien
2015-01-01
We theoretically study the crossover between spin Hall effect and spin swapping, a recently predicted phenomenon that consists of the interchange between the current flow and its spin polarization directions [M. B. Lifshits and M. I. Dyakonov, Phys. Rev. Lett. 103, 186601 (2009)]. Using a tight-binding model with spin-orbit coupled disorder, spin Hall effect, spin relaxation, and spin swapping are treated on equal footing. We demonstrate that spin swapping and spin Hall effect present very different dependencies as a function of the spin-orbit coupling and disorder strengths and confirm that the former exceeds the latter in the parameter range considered. Three setups are proposed for the experimental observation of the spin swapping effect.
Krivoruchko, D. D.; Skrylev, A. V.
2018-01-01
The article deals with investigation of the excited states populations distribution of a low-temperature xenon plasma in the thruster with closed electron drift at 300 W operating conditions were investigated by laser-induced fluorescence (LIF) over the 350-1100 nm range. Seven xenon ions (Xe II) transitions were analyzed, while for neutral atoms (Xe I) just three transitions were explored, since the majority of Xe I emission falls into the ultraviolet or infrared part of the spectrum and are difficult to measure. The necessary spontaneous emission probabilities (Einstein coefficients) were calculated. Measurements of the excited state distribution were made for points (volume of about 12 mm3) all over the plane perpendicular to thruster axis in four positions on it (5, 10, 50 and 100 mm). Measured LIF signal intensity have differences for each location of researched point (due to anisotropy of thruster plume), however the structure of states populations distribution persisted at plume and is violated at the thruster exit plane and cathode area. Measured distributions show that for describing plasma of Hall thruster one needs to use a multilevel kinetic model, classic model can be used just for far plume region or for specific electron transitions.
Pumping conductance, the intrinsic anomalous Hall effect, and statistics of topological invariants
Dahlhaus, Jan; Ilan, Roni; Freed, Daniel; Freedman, Michael; Moore, Joel E.
2015-06-01
The pumping conductance of a disordered two-dimensional Chern insulator scales with increasing size and fixed disorder strength to sharp plateau transitions at well-defined energies between ordinary and quantum Hall insulators. When the disorder strength is scaled to zero as system size increases, the "metallic" regime of fluctuating Chern numbers can extend over the whole band. A simple argument leads to a sort of weighted equipartition of Chern number over minibands in a finite system with periodic boundary conditions: even though there must be strong fluctuations between disorder realizations, the mean Chern number at a given energy is determined by the clean Berry curvature distribution, as in the intrinsic anomalous Hall effect formula for metals. This estimate is compared to numerical results using recently developed operator algebra methods, and indeed the dominant variation of average Chern number is explained by the intrinsic anomalous Hall formula. A mathematical appendix provides more precise definitions and a model for the full distribution of Chern numbers.
Scanning vector Hall probe microscopy
International Nuclear Information System (INIS)
Cambel, V.; Gregusova, D.; Fedor, J.; Kudela, R.; Bending, S.J.
2004-01-01
We have developed a scanning vector Hall probe microscope for mapping magnetic field vector over magnetic samples. The microscope is based on a micromachined Hall sensor and the cryostat with scanning system. The vector Hall sensor active area is ∼5x5 μm 2 . It is realized by patterning three Hall probes on the tilted faces of GaAs pyramids. Data from these 'tilted' Hall probes are used to reconstruct the full magnetic field vector. The scanning area of the microscope is 5x5 mm 2 , space resolution 2.5 μm, field resolution ∼1 μT Hz -1/2 at temperatures 10-300 K
Scaling relation of the anomalous Hall effect in (Ga,Mn)As
Glunk, M.; Daeubler, J.; Schoch, W.; Sauer, R.; Limmer, W.
2009-09-01
We present magnetotransport studies performed on an extended set of (Ga,Mn)As samples at 4.2 K with longitudinal conductivities σxx ranging from the low-conductivity to the high-conductivity regime. The anomalous Hall conductivity σxy(AH) is extracted from the measured longitudinal and Hall resistivities. A transition from σxy(AH)=20Ω-1cm-1 due to the Berry phase effect in the high-conductivity regime to a scaling relation σxy(AH)∝σxx1.6 for low-conductivity samples is observed. This scaling relation is consistent with a recently developed unified theory of the anomalous Hall effect in the framework of the Keldysh formalism. It turns out to be independent of crystallographic orientation, growth conditions, Mn concentration, and strain, and can therefore be considered universal for low-conductivity (Ga,Mn)As. The relation plays a crucial role when deriving values of the hole concentration from magnetotransport measurements in low-conductivity (Ga,Mn)As. In addition, the hole diffusion constants for the high-conductivity samples are determined from the measured longitudinal conductivities.
Islam, M. F.; Canali, C. M.; Pertsova, A.; Balatsky, A.; Mahatha, S. K.; Carbone, C.; Barla, A.; Kokh, K. A.; Tereshchenko, O. E.; Jiménez, E.; Brookes, N. B.; Gargiani, P.; Valvidares, M.; Schatz, S.; Peixoto, T. R. F.; Bentmann, H.; Reinert, F.; Jung, J.; Bathon, T.; Fauth, K.; Bode, M.; Sessi, P.
2018-04-01
The quantum anomalous Hall effect (QAHE) has recently been reported to emerge in magnetically doped topological insulators. Although its general phenomenology is well established, the microscopic origin is far from being properly understood and controlled. Here, we report on a detailed and systematic investigation of transition metal (TM) doped Sb2Te3 . By combining density functional theory calculations with complementary experimental techniques, i.e., scanning tunneling microscopy, resonant photoemission, and x-ray magnetic circular dichroism, we provide a complete spectroscopic characterization of both electronic and magnetic properties. Our results reveal that the TM dopants not only affect the magnetic state of the host material, but also significantly alter the electronic structure by generating impurity-derived energy bands. Our findings demonstrate the existence of a delicate interplay between electronic and magnetic properties in TM doped topological insulators. In particular, we find that the fate of the topological surface states critically depends on the specific character of the TM impurity: while V- and Fe-doped Sb2Te3 display resonant impurity states in the vicinity of the Dirac point, Cr and Mn impurities leave the energy gap unaffected. The single-ion magnetic anisotropy energy and easy axis, which control the magnetic gap opening and its stability, are also found to be strongly TM impurity dependent and can vary from in plane to out of plane depending on the impurity and its distance from the surface. Overall, our results provide general guidelines for the realization of a robust QAHE in TM doped Sb2Te3 in the ferromagnetic state.
Magnetization and Hall effect under high pressure in NaV 6O 11
Naka, T.; Matsumoto, T.; Kanke, Y.; Murata, K.
1995-02-01
We have investigated the pressure dependences of magnetization and the Hall coefficient in the ferromagnetic vanadium oxide NaV 6O 11 up to 1.2 GPa. Structural transitions (hexagonal-hexagonal-orthorhombic) occur at TH = 245 K and TL = 35 K at ambient pressure. Meanwhile, the susceptibility obeys the Curie-Weiss law X = C/( T - θ) with antiferromagnetic correlation of θ TH, with ferromagnetic correlation of θ TH. The spontaneous magnetization appears below Tc = 64.2 K. With increasing pressure, Tc and magnetization M( T TH increases. The sign of the Hall coefficient changes continuously (negative-positive-negative) at around T ≈ 170 K and 75 K.
Nematic and Valley Ordering in Anisotropic Quantum Hall Systems
Parameswaran, S. A.; Abanin, D. A.; Kivelson, S. A.; Sondhi, S. L.
2010-03-01
We consider a multi-valley two dimensional electron system in the quantum Hall effect (QHE) regime. We focus on QHE states that arise due to spontaneous breaking of the valley symmetry by the Coulomb interactions. We show that the anisotropy of the Fermi surface in each valley, which is generally present in such systems, favors states where all the electrons reside in one of the valleys. In a clean system, the valley ordering occurs via a finite temperature Ising-like phase transition, which, owing to the Fermi surface anisotropy, is accompanied by the onset of nematic order. In a disordered system, domains of opposite polarization are formed, and therefore long-range valley order is destroyed, however, the resulting state is still compressible. We discuss the transport properties in ordered and disordered regimes, and point out the possible relation of our results to recent experiments in AlAs [1]. [1] Y. P. Shkolnikov, S. Misra, N. C. Bishop, E. P. De Poortere, and M. Shayegan, Observation of Quantum Hall ``Valley Skyrmions", Phys. Rev. Lett. 95, 068809 (2005)[2] D.A. Abanin, S.A. Parameswaran, S.A. Kivelson and S.L. Sondhi, Nematic and Valley Ordering in Anisotropic Quantum Hall Systems, to be published.
Hamaoka Atomic Energy Hall, Chubu Electric Power Co., Inc
International Nuclear Information System (INIS)
Kawasaki, Yukio
1979-01-01
Hamaoka Nuclear Power Station was constructed in the very large site of about 1.6 million m 2 surrounded by sand dunes and pine forests at the southern tip of Shizuoka Prefecture. Hamaoka Atomic Energy Hall was built on the right side of this power station. This hall had been planned as a part of the works commemorating the 20th anniversary of the founding of the company, and was opened in August, 1972. The building is of steel frame type, and has two floors of 1135 m 2 total area. The first floor comprises cinema room, power generation corner and open gallery, and the second floor comprises meeting room, native land corner and observation room. Moreover, there is observation platform on the roof. The purpose of the hall is coexistence and coprosperity with the regional residents, and 13 persons make explanations to visitors having reached to 1.9 million as of the end of June, 1979. It is incorporated in the sightseeing route centering around the Omaezaki lighthouse. The cinema hall accommodates 120 men, and the films concerning nuclear power generation and the construction of a nuclear power plant are shown. In the power generation corner, the explanation on nuclear power generation is made with models and panels. The third hall is being built now as energy corner, and it will be completed in autumn, 1979. (Kako, I.)
Hall effect and the magnetotransport properties of Co2MnSi1-xAlx Heusler alloys
Prestigiacomo, Joseph C.; Young, David P.; Adams, Philip W.; Stadler, Shane
2014-01-01
We have investigated the transport properties of the quaternary Heusler alloys Co2MnSi1-xAlx (0≤x≤1), which have been theoretically predicted to develop a half-metallic band structure as x →0. Resistivity versus temperature measurements as a function of Al concentration (x) revealed a systematic reduction in the residual resistivity ratio as well as a transition from weakly localized to half-metallic conduction as x →0. From measurements of the ordinary and anomalous Hall effects, the charge carrier concentration was found to increase, while the anomalous Hall coefficient decreased by nearly an order of magnitude with each sample as x →0 (Δx=0.25.). Scaling of the anomalous Hall effect with longitudinal resistivity reveals that both the skew-scattering and intrinsic contributions grow quickly as x →1, indicating that disorder and band-structure effects cause the large anomalous Hall effect magnitudes observed for Co2MnAl.
Light-Induced Type-II Band Inversion and Quantum Anomalous Hall State in Monolayer FeSe
Wang, Z. F.; Liu, Zhao; Yang, Jinlong; Liu, Feng
2018-04-01
Coupling a quantum anomalous Hall (QAH) state with a superconducting state offers an attractive approach to detect the signature alluding to a topological superconducting state [Q. L. He et al., Science 357, 294 (2017), 10.1126/science.aag2792], but its explanation could be clouded by disorder effects in magnetic doped QAH materials. On the other hand, an antiferromagnetic (AFM) quantum spin Hall (QSH) state is identified in the well-known high-temperature 2D superconductor of monolayer FeSe [Z. F. Wang et al., Nat. Mater. 15, 968 (2016), 10.1038/nmat4686]. Here, we report a light-induced type-II band inversion (BI) and a QSH-to-QAH phase transition in the monolayer FeSe. Depending on the handedness of light, a spin-tunable QAH state with a high Chern number of ±2 is realized. In contrast to the conventional type-I BI resulting from intrinsic spin-orbital coupling (SOC), which inverts the band an odd number of times and respects time reversal symmetry, the type-II BI results from a light-induced handedness-dependent effective SOC, which inverts the band an even number of times and does not respect time reversal symmetry. The interplay between these two SOC terms makes the spin-up and -down bands of an AFM QSH state respond oppositely to a circularly polarized light, leading to the type-II BI and an exotic topological phase transition. Our finding affords an exciting opportunity to detect Majorana fermions in one single material without magnetic doping.
Not your grandfather's concert hall
Cooper, Russell; Malenka, Richard; Griffith, Charles; Friedlander, Steven
2004-05-01
The opening of Judy and Arthur Zankel Hall on 12 September 2003, restores Andrew Carnegie's original 1891 concept of having three outstanding auditoriums of different sizes under one roof, and creates a 21st-century venue for music performance and education. With concerts ranging from early music to avant-garde multimedia productions, from jazz to world music, and from solo recitals to chamber music, Zankel Hall expands the breadth and depth of Carnegie Hall's offerings. It allows for the integration of programming across three halls with minifestivals tailored both to the size and strengths of each hall and to the artists and music to be performed. The new flexible space also provides Carnegie Hall with an education center equipped with advanced communications technology. This paper discusses the unique program planned for this facility and how the architects, theatre consultants, and acousticians developed a design that fulfilled the client's expectations and coordinated the construction of the facility under the floor of the main Isaac Stern Auditorium without having to cancel a single performance.
Electrical control of the anomalous valley Hall effect in antiferrovalley bilayers
Tong, Wen-Yi; Duan, Chun-Gang
2017-08-01
In analogy to all-electric spintronics, all-electric valleytronics, i.e., valley manipulation via electric means, becomes an exciting new frontier as it may bring revolutions in the field of data storage with ultra-high speed and ultra-low power consumption. The existence of the anomalous valley Hall effect in ferrovalley materials demonstrates the possibility of electrical detection for valley polarization. However, in previously proposed valley-polarized monolayers, the anomalous valley Hall effect is controlled by external magnetic fields. Here, through elaborate structural design, we propose the antiferrovally bilayer as an ideal candidate for realizing all-electric valleytronic devices. Using the minimal k.p model, we show that the energy degeneracy between valley indexes in such system can be lifted by electric approaches. Subsequently, the anomalous valley Hall effect strongly depends on the electric field as well. Taking the bilayer VSe2 as an example, all-electric tuning and detecting of anomalous valley Hall effect is confirmed by density-functional theory calculations, indicating that the valley information in such antiferrovalley bilayer can be reversed by an electric field perpendicular to the plane of the system and easily probed through the sign of the Hall voltage.
Hall-effect-controlled gas dynamics in protoplanetary disks. I. Wind solutions at the inner disk
International Nuclear Information System (INIS)
Bai, Xue-Ning
2014-01-01
The gas dynamics of protoplanetary disks (PPDs) is largely controlled by non-ideal magnetohydrodynamic (MHD) effects including Ohmic resistivity, the Hall effect, and ambipolar diffusion. Among these the role of the Hall effect is the least explored and most poorly understood. In this series, we have included, for the first time, all three non-ideal MHD effects in a self-consistent manner to investigate the role of the Hall effect on PPD gas dynamics using local shearing-box simulations. In this first paper, we focus on the inner region of PPDs, where previous studies (Bai and Stone 2013; Bai 2013) excluding the Hall effect have revealed that the inner disk up to ∼10 AU is largely laminar, with accretion driven by a magnetocentrifugal wind. We confirm this basic picture and show that the Hall effect modifies the wind solutions depending on the polarity of the large-scale poloidal magnetic field B 0 threading the disk. When B 0 ⋅Ω>0, the horizontal magnetic field is strongly amplified toward the disk interior, leading to a stronger disk wind (by ∼50% or less in terms of the wind-driven accretion rate). The enhanced horizontal field also leads to much stronger large-scale Maxwell stress (magnetic braking) that contributes to a considerable fraction of the wind-driven accretion rate. When B 0 ⋅Ω<0, the horizontal magnetic field is reduced, leading to a weaker disk wind (by ≲ 20%) and negligible magnetic braking. Under fiducial parameters, we find that when B 0 ⋅Ω>0, the laminar region extends farther to ∼10-15 AU before the magnetorotational instability sets in, while for B 0 ⋅Ω<0, the laminar region extends only to ∼3-5 AU for a typical accretion rate of ∼10 –8 to10 –7 M ☉ yr –1 . Scaling relations for the wind properties, especially the wind-driven accretion rate, are provided for aligned and anti-aligned field geometries.
Hall-effect-controlled gas dynamics in protoplanetary disks. I. Wind solutions at the inner disk
Energy Technology Data Exchange (ETDEWEB)
Bai, Xue-Ning, E-mail: xbai@cfa.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, MS-51, Cambridge, MA 02138 (United States)
2014-08-20
The gas dynamics of protoplanetary disks (PPDs) is largely controlled by non-ideal magnetohydrodynamic (MHD) effects including Ohmic resistivity, the Hall effect, and ambipolar diffusion. Among these the role of the Hall effect is the least explored and most poorly understood. In this series, we have included, for the first time, all three non-ideal MHD effects in a self-consistent manner to investigate the role of the Hall effect on PPD gas dynamics using local shearing-box simulations. In this first paper, we focus on the inner region of PPDs, where previous studies (Bai and Stone 2013; Bai 2013) excluding the Hall effect have revealed that the inner disk up to ∼10 AU is largely laminar, with accretion driven by a magnetocentrifugal wind. We confirm this basic picture and show that the Hall effect modifies the wind solutions depending on the polarity of the large-scale poloidal magnetic field B{sub 0} threading the disk. When B{sub 0}⋅Ω>0, the horizontal magnetic field is strongly amplified toward the disk interior, leading to a stronger disk wind (by ∼50% or less in terms of the wind-driven accretion rate). The enhanced horizontal field also leads to much stronger large-scale Maxwell stress (magnetic braking) that contributes to a considerable fraction of the wind-driven accretion rate. When B{sub 0}⋅Ω<0, the horizontal magnetic field is reduced, leading to a weaker disk wind (by ≲ 20%) and negligible magnetic braking. Under fiducial parameters, we find that when B{sub 0}⋅Ω>0, the laminar region extends farther to ∼10-15 AU before the magnetorotational instability sets in, while for B{sub 0}⋅Ω<0, the laminar region extends only to ∼3-5 AU for a typical accretion rate of ∼10{sup –8} to10{sup –7} M {sub ☉} yr{sup –1}. Scaling relations for the wind properties, especially the wind-driven accretion rate, are provided for aligned and anti-aligned field geometries.
Report of experimental hall subworking group
International Nuclear Information System (INIS)
Miyake, K.; Ohama, T.; Takahashi, K.
1982-01-01
The general plan of constructing the TRISTAN e + e - colliding beam experimental halls may be divided into two parts. The first step is to construct two test-experimental halls associated with the 6.5 GeV x 6.5 GeV e + e - accumulator ring, and the second step is to build four experimental halls at the 30 GeV x 30 GeV e + e - TRISTAN main ring. At this workshop, extensive discussions on the detailed design of the four main ring experimental halls have been made. Four experimental areas will be built at the main ring, and two test-experimental halls at the accumulating ring. Among the four areas at the main ring, two will be used for electron-proton possible as well as electron-positron colliding beam experiment. The other two will be used exclusively for e + e - colliding experiments. Only a preliminary design has been made for these four experimental areas. A tentative plan of a larger experimental hall includes a counting and data processing room, a utility room, and a radiation safety control room. Two smaller halls have simpler structure. The figures of the experimental halls are presented. The two test-experimental halls at the accumulator ring will be used to test the detectors for e + e - colliding experiments before the final installation. The utility rooms designed for the halls are used to supply coolant and electric power of superconducting magnets. At the workshop, various ideas concerning the preliminary plan are presented. (Kato, T.)
2010-02-19
... Rita C. Hall; Notice of Application Accepted for Filing With the Commision, Soliciting Motions To.... Project No.: 13652-000. c. Date filed: January 11, 2010. d. Applicant: Gary E. Hall and Rita C. Hall. e... Policies Act of 1978, 16 U.S.C. 2705, 2708. h. Applicant Contact: Mr. Gary E. Hall and Ms. Rita C. Hall, P...
Hall Effect Gyrators and Circulators
Viola, Giovanni; DiVincenzo, David P.
2014-04-01
The electronic circulator and its close relative the gyrator are invaluable tools for noise management and signal routing in the current generation of low-temperature microwave systems for the implementation of new quantum technologies. The current implementation of these devices using the Faraday effect is satisfactory but requires a bulky structure whose physical dimension is close to the microwave wavelength employed. The Hall effect is an alternative nonreciprocal effect that can also be used to produce desired device functionality. We review earlier efforts to use an Ohmically contacted four-terminal Hall bar, explaining why this approach leads to unacceptably high device loss. We find that capacitive coupling to such a Hall conductor has much greater promise for achieving good circulator and gyrator functionality. We formulate a classical Ohm-Hall analysis for calculating the properties of such a device, and show how this classical theory simplifies remarkably in the limiting case of the Hall angle approaching 90°. In this limit, we find that either a four-terminal or a three-terminal capacitive device can give excellent circulator behavior, with device dimensions far smaller than the ac wavelength. An experiment is proposed to achieve GHz-band gyration in millimeter (and smaller) scale structures employing either semiconductor heterostructure or graphene Hall conductors. An inductively coupled scheme for realizing a Hall gyrator is also analyzed.
Hall effect of K-doped superconducting thin films
Energy Technology Data Exchange (ETDEWEB)
Son, Eunseon; Lee, Nam Hoon; Kang, Won Nam [Dept. of physics, Sungkyunkwan University, Suwon (Korea, Republic of); Hwang, Tae Jong; Kim, Dong Ho [Dept. of physics, Yeungnam University, Gyeongsan(Korea, Republic of)
2013-09-15
We have studied Hall effect for potassium (K)-doped BaFe{sub 2}As{sub 2}superconducting thin films by analyzing the relation between the longitudinal resistivity (ρ{sub xy}) and the Hall resistivity (ρ{sub xy}). The thin films used in this study were fabricated on Al{sub O3} (000l) substrates by using an ex-situ pulsed laser deposition (PLD) technique under a high-vacuum condition of ∼10{sup -6} Torr. The samples showed the high superconducting transition temperatures (T{sub C}) of ∼40 K. The ρ{sub xx} and ρ{sub xy}the for K-doped BaFeAs{sub 2} thin films were measured by using a physical property measurement system (PPMS) with a temperature sweep (T-sweep) mode at an applied current density of 100 A/cm{sup 2} and at magnetic fields from 0 up to 9 T. We report the T-sweep results of the ρ{sub xx} and the ρ{sub xy} to investigate Hall scaling behavior on the basis of the relation of ρ{sub xy} = A(ρ{sub xy}){sup β}. The ρ{sub xx} values are 3.0 ± 0.2 in the c-axis-oriented K-doped BaFeAs{sub 2} thin films, whereas the thin films with various oriented-directions like a polycrystal showed slightly lower β than that of c-axis-oriented thin films. Interestingly, the β value is decreased with increasing magnetic fields.
Particle-in-cell simulations of Hall plasma thrusters
Miranda, Rodrigo; Ferreira, Jose Leonardo; Martins, Alexandre
2016-07-01
Hall plasma thrusters can be modelled using particle-in-cell (PIC) simulations. In these simulations, the plasma is described by a set of equations which represent a coupled system of charged particles and electromagnetic fields. The fields are computed using a spatial grid (i.e., a discretization in space), whereas the particles can move continuously in space. Briefly, the particle and fields dynamics are computed as follows. First, forces due to electric and magnetic fields are employed to calculate the velocities and positions of particles. Next, the velocities and positions of particles are used to compute the charge and current densities at discrete positions in space. Finally, these densities are used to solve the electromagnetic field equations in the grid, which are interpolated at the position of the particles to obtain the acting forces, and restart this cycle. We will present numerical simulations using software for PIC simulations to study turbulence, wave and instabilities that arise in Hall plasma thrusters. We have sucessfully reproduced a numerical simulation of a SPT-100 Hall thruster using a two-dimensional (2D) model. In addition, we are developing a 2D model of a cylindrical Hall thruster. The results of these simulations will contribute to improve the performance of plasma thrusters to be used in Cubesats satellites currenty in development at the Plasma Laboratory at University of Brasília.
Numerical studies of the fractional quantum Hall effect in systems with tunable interactions
International Nuclear Information System (INIS)
Papić, Z; Bhatt, R N; Abanin, D A; Barias, Y
2012-01-01
The discovery of the fractional quantum Hall effect in GaAs-based semiconductor devices has lead to new advances in condensed matter physics, in particular the possibility for exotic, topological phases of matter that possess fractional, and even non-Abelian, statistics of quasiparticles. One of the main limitations of the experimental systems based on GaAs has been the lack of tunability of the effective interactions between two-dimensional electrons, which made it difficult to stabilize some of the more fragile states, or induce phase transitions in a controlled manner. Here we review the recent studies that have explored the effects of tunability of the interactions offered by alternative two-dimensional systems, characterized by non-trivial Berry phases and including graphene, bilayer graphene and topological insulators. The tunability in these systems is achieved via external fields that change the mass gap, or by screening via dielectric plate in the vicinity of the device. Our study points to a number of different ways to manipulate the effective interactions, and engineer phase transitions between quantum Hall liquids and compressible states in a controlled manner.
Discharge Oscillations in a Permanent Magnet Cylindrical Hall-Effect Thruster
Polzin, K. A.; Sooby, E. S.; Raitses, Y.; Merino, E.; Fisch, N. J.
2009-01-01
Measurements of the discharge current in a cylindrical Hall thruster are presented to quantify plasma oscillations and instabilities without introducing an intrusive probe into the plasma. The time-varying component of the discharge current is measured using a current monitor that possesses a wide frequency bandwidth and the signal is Fourier transformed to yield the frequency spectra present, allowing for the identification of plasma oscillations. The data show that the discharge current oscillations become generally greater in amplitude and complexity as the voltage is increased, and are reduced in severity with increasing flow rate. The breathing mode ionization instability is identified, with frequency as a function of discharge voltage not increasing with discharge voltage as has been observed in some traditional Hall thruster geometries, but instead following a scaling similar to a large-amplitude, nonlinear oscillation mode recently predicted in for annular Hall thrusters. A transition from lower amplitude oscillations to large relative fluctuations in the oscillating discharge current is observed at low flow rates and is suppressed as the mass flow rate is increased. A second set of peaks in the frequency spectra are observed at the highest propellant flow rate tested. Possible mechanisms that might give rise to these peaks include ionization instabilities and interactions between various oscillatory modes.
Sinova, Jairo; Valenzuela, Sergio O.; Wunderlich, J.; Back, C. H.; Jungwirth, T.
2015-10-01
Spin Hall effects are a collection of relativistic spin-orbit coupling phenomena in which electrical currents can generate transverse spin currents and vice versa. Despite being observed only a decade ago, these effects are already ubiquitous within spintronics, as standard spin-current generators and detectors. Here the theoretical and experimental results that have established this subfield of spintronics are reviewed. The focus is on the results that have converged to give us the current understanding of the phenomena, which has evolved from a qualitative to a more quantitative measurement of spin currents and their associated spin accumulation. Within the experimental framework, optical-, transport-, and magnetization-dynamics-based measurements are reviewed and linked to both phenomenological and microscopic theories of the effect. Within the theoretical framework, the basic mechanisms in both the extrinsic and intrinsic regimes are reviewed, which are linked to the mechanisms present in their closely related phenomenon in ferromagnets, the anomalous Hall effect. Also reviewed is the connection to the phenomenological treatment based on spin-diffusion equations applicable to certain regimes, as well as the spin-pumping theory of spin generation used in many measurements of the spin Hall angle. A further connection to the spin-current-generating spin Hall effect to the inverse spin galvanic effect is given, in which an electrical current induces a nonequilibrium spin polarization. This effect often accompanies the spin Hall effect since they share common microscopic origins. Both can exhibit the same symmetries when present in structures comprising ferromagnetic and nonmagnetic layers through their induced current-driven spin torques or induced voltages. Although a short chronological overview of the evolution of the spin Hall effect field and the resolution of some early controversies is given, the main body of this review is structured from a pedagogical
Spin Chern number and topological phase transition on the Lieb lattice with spin–orbit coupling
International Nuclear Information System (INIS)
Chen, Rui; Zhou, Bin
2017-01-01
We propose that quantum anomalous Hall effect may occur in the Lieb lattice, when Rashba spin–orbit coupling, spin-independent and spin-dependent staggered potentials are introduced into the lattice. It is found that spin Chern numbers of two degenerate flat bands change from 0 to ±2 due to Rashba spin–orbit coupling effect. The inclusion of Rashba spin–orbit coupling and two kinds of staggered potentials opens a gap between the two flat bands. The topological property of the gap is determined by the amplitudes of Rashba spin–orbit coupling and staggered potentials, and thus the topological phase transition from quantum anomalous Hall effect to normal insulator can occur. Finally, the topological phase transition from quantum spin Hall state to normal insulator is discussed when Rashba spin–orbit coupling and intrinsic spin–orbit coupling coexist in the Lieb lattice. - Highlights: • Spin Chern numbers of the bulk states on the Lieb lattice are calculated. • RSOC plays an important role on the topological phase transition on the Lieb lattice. • Quantum anomalous Hall effect can occur due to RSOC and staggered potentials. • Topological phase transition can occur when ISOC and RSOC coexist.
Energy Technology Data Exchange (ETDEWEB)
Owerre, S. A., E-mail: solomon@aims.ac.za [African Institute for Mathematical Sciences, 6 Melrose Road, Muizenberg, Cape Town 7945, South Africa and Perimeter Institute for Theoretical Physics, 31 Caroline St. N., Waterloo, Ontario N2L 2Y5 (Canada)
2016-07-28
Quite recently, the magnon Hall effect of spin excitations has been observed experimentally on the kagome and pyrochlore lattices. The thermal Hall conductivity κ{sup xy} changes sign as a function of magnetic field or temperature on the kagome lattice, and κ{sup xy} changes sign upon reversing the sign of the magnetic field on the pyrochlore lattice. Motivated by these recent exciting experimental observations, we theoretically propose a simple realization of the magnon Hall effect in a two-band model on the honeycomb lattice. The magnon Hall effect of spin excitations arises in the usual way via the breaking of inversion symmetry of the lattice, however, by a next-nearest-neighbour Dzyaloshinsky-Moriya interaction. We find that κ{sup xy} has a fixed sign for all parameter regimes considered. These results are in contrast to the Lieb, kagome, and pyrochlore lattices. We further show that the low-temperature dependence on the magnon Hall conductivity follows a T{sup 2} law, as opposed to the kagome and pyrochlore lattices. These results suggest an experimental procedure to measure thermal Hall conductivity within a class of 2D honeycomb quantum magnets and ultracold atoms trapped in a honeycomb optical lattice.
Integrated Stirling Convertor and Hall Thruster Test Conducted
Mason, Lee S.
2002-01-01
An important aspect of implementing Stirling Radioisotope Generators on future NASA missions is the integration of the generator and controller with potential spacecraft loads. Some recent studies have indicated that the combination of Stirling Radioisotope Generators and electric propulsion devices offer significant trip time and payload fraction benefits for deep space missions. A test was devised to begin to understand the interactions between Stirling generators and electric thrusters. An electrically heated RG- 350 (350-W output) Stirling convertor, designed and built by Stirling Technology Company of Kennewick, Washington, under a NASA Small Business Innovation Research agreement, was coupled to a 300-W SPT-50 Hall-effect thruster built for NASA by the Moscow Aviation Institute (RIAME). The RG-350 and the SPT-50 shown, were installed in adjacent vacuum chamber ports at NASA Glenn Research Center's Electric Propulsion Laboratory, Vacuum Facility 8. The Stirling electrical controller interfaced directly with the Hall thruster power-processing unit, both of which were located outside of the vacuum chamber. The power-processing unit accepted the 48 Vdc output from the Stirling controller and distributed the power to all the loads of the SPT-50, including the magnets, keeper, heater, and discharge. On February 28, 2001, the Glenn test team successfully operated the Hall-effect thruster with the Stirling convertor. This is the world's first known test of a dynamic power source with electric propulsion. The RG-350 successfully managed the transition from the purely resistive load bank within the Stirling controller to the highly capacitive power-processing unit load. At the time of the demonstration, the Stirling convertor was operating at a hot temperature of 530 C and a cold temperature of -6 C. The linear alternator was producing approximately 250 W at 109 Vac, while the power-processing unit was drawing 175 W at 48 Vdc. The majority of power was delivered to the
Tunneling Anomalous and Spin Hall Effects.
Matos-Abiague, A; Fabian, J
2015-07-31
We predict, theoretically, the existence of the anomalous Hall effect when a tunneling current flows through a tunnel junction in which only one of the electrodes is magnetic. The interfacial spin-orbit coupling present in the barrier region induces a spin-dependent momentum filtering in the directions perpendicular to the tunneling current, resulting in a skew tunneling even in the absence of impurities. This produces an anomalous Hall conductance and spin Hall currents in the nonmagnetic electrode when a bias voltage is applied across the tunneling heterojunction. If the barrier is composed of a noncentrosymmetric material, the anomalous Hall conductance and spin Hall currents become anisotropic with respect to both the magnetization and crystallographic directions, allowing us to separate this interfacial phenomenon from the bulk anomalous and spin Hall contributions. The proposed effect should be useful for proving and quantifying the interfacial spin-orbit fields in metallic and metal-semiconductor systems.
Quantum hall effect. A perspective
International Nuclear Information System (INIS)
Aoki, Hideo
2006-01-01
Novel concepts and phenomena are emerging recently in the physics of quantum Hall effect. This article gives an overview, which starts from the fractional quantum Hall system viewed as an extremely strongly correlated system, and move on to present various phenomena involving internal degrees of freedom (spin and layer), non-equilibrium and optical properties, and finally the spinoff to anomalous Hall effect and the rotating Bose-Einstein condensate. (author)
Planar Hall effect bridge magnetic field sensors
DEFF Research Database (Denmark)
Henriksen, A.D.; Dalslet, Bjarke Thomas; Skieller, D.H.
2010-01-01
Until now, the planar Hall effect has been studied in samples with cross-shaped Hall geometry. We demonstrate theoretically and experimentally that the planar Hall effect can be observed for an exchange-biased ferromagnetic material in a Wheatstone bridge topology and that the sensor signal can...... Hall effect bridge sensors....
Deep learning the quantum phase transitions in random two-dimensional electron systems
International Nuclear Information System (INIS)
Ohtsuki, Tomoki; Ohtsuki, Tomi
2016-01-01
Random electron systems show rich phases such as Anderson insulator, diffusive metal, quantum Hall and quantum anomalous Hall insulators, Weyl semimetal, as well as strong/weak topological insulators. Eigenfunctions of each matter phase have specific features, but owing to the random nature of systems, determining the matter phase from eigenfunctions is difficult. Here, we propose the deep learning algorithm to capture the features of eigenfunctions. Localization-delocalization transition, as well as disordered Chern insulator-Anderson insulator transition, is discussed. (author)
Hall viscosity of hierarchical quantum Hall states
Fremling, M.; Hansson, T. H.; Suorsa, J.
2014-03-01
Using methods based on conformal field theory, we construct model wave functions on a torus with arbitrary flat metric for all chiral states in the abelian quantum Hall hierarchy. These functions have no variational parameters, and they transform under the modular group in the same way as the multicomponent generalizations of the Laughlin wave functions. Assuming the absence of Berry phases upon adiabatic variations of the modular parameter τ, we calculate the quantum Hall viscosity and find it to be in agreement with the formula, given by Read, which relates the viscosity to the average orbital spin of the electrons. For the filling factor ν =2/5 Jain state, which is at the second level in the hierarchy, we compare our model wave function with the numerically obtained ground state of the Coulomb interaction Hamiltonian in the lowest Landau level, and find very good agreement in a large region of the complex τ plane. For the same example, we also numerically compute the Hall viscosity and find good agreement with the analytical result for both the model wave function and the numerically obtained Coulomb wave function. We argue that this supports the notion of a generalized plasma analogy that would ensure that wave functions obtained using the conformal field theory methods do not acquire Berry phases upon adiabatic evolution.
Bending strain study of Bi-2223/Ag tapes using Hall sensor magnetometry
International Nuclear Information System (INIS)
Lahtinen, M.; Paasi, J.; Sarkaniemi, J.; Han, Z.; Freltoft, T.
1996-01-01
The influence of room temperature bending on critical current (I c ) of Bi-2223/Ag tapes is studied by Hall sensor magnetometry, four-point method and scanning electron microscopy. Hall sensor magnetometry allows one to assess tape homogeneity and the amount of mechanical damage caused by bending. The microstructure of the Bi-2223 ceramic is found to strongly affect the tape behavior under bending strain. In a tape with moderate I c = 6.1 A at 77 K and a porous ceramic core, crack propagation took place normal to the Ag-ceramic interface, whereas in tapes with dense core, I c above 10 A at 77 K, cracks propagated in the tape plane. In monofilamentary tapes core homogeneity correlated with good bending strain performance. In multifilamentary tapes crack propagation between filaments was prohibited by the Ag matrix, thus leading to enhanced strain tolerance. In the high I c tapes studied, bending to 25 mm radius resulted in 1%--2% I c degradation
Spin Hall effect by surface roughness
Zhou, Lingjun
2015-01-08
The spin Hall and its inverse effects, driven by the spin orbit interaction, provide an interconversion mechanism between spin and charge currents. Since the spin Hall effect generates and manipulates spin current electrically, to achieve a large effect is becoming an important topic in both academia and industries. So far, materials with heavy elements carrying a strong spin orbit interaction, provide the only option. We propose here a new mechanism, using the surface roughness in ultrathin films, to enhance the spin Hall effect without heavy elements. Our analysis based on Cu and Al thin films suggests that surface roughness is capable of driving a spin Hall angle that is comparable to that in bulk Au. We also demonstrate that the spin Hall effect induced by surface roughness subscribes only to the side-jump contribution but not the skew scattering. The paradigm proposed in this paper provides the second, not if only, alternative to generate a sizable spin Hall effect.
Phase transitions of antibiotic clarithromycin forms I, IV and new form VII crystals.
Ito, Masataka; Shiba, Rika; Watanabe, Miteki; Iwao, Yasunori; Itai, Shigeru; Noguchi, Shuji
2018-06-01
Metastable crystal form I of the antibiotic clarithromycin has a pharmaceutically valuable characteristic that its crystalline phase transition can be applied for its sustained release from tablets. The phase transition of form I was investigated in detail by single crystal and powder X-ray analyses, dynamic vapor sorption analysis and thermal analysis. The single crystal structure of form I revealed that form I was not an anhydrate crystal but contained a partially occupied water molecule in the channel-like void space. Dynamic vapor sorption (DVS) analysis demonstrated that form I crystals reversibly sorbed water molecules in two steps when the relative humidity (RH) increased and finally transited to hydrate form IV at 95% RH. DVS analysis also showed that when the RH decreased form IV crystals lost water molecules at 40% RH and transited to the newly identified anhydrate crystal form VII. Form VII reversibly transited to form IV at lower RH than form I, suggesting that form I is more suitable for manufacturing a sustained-release tablet of CAM utilizing the crystalline phase transition. Copyright © 2018 Elsevier B.V. All rights reserved.
Gauge invariance and fractional quantized Hall effect
International Nuclear Information System (INIS)
Tao, R.; Wu, Y.S.
1984-01-01
It is shown that gauge invariance arguments imply the possibility of fractional quantized Hall effect; the Hall conductance is accurately quantized to a rational value. The ground state of a system showing the fractional quantized Hall effect must be degenerate; the non-degenerate ground state can only produce the integral quantized Hall effect. 12 references
Assessment of bilayer silicene to probe as quantum spin and valley Hall effect
Rehman, Majeed Ur; Qiao, Zhenhua
2018-02-01
Silicene takes precedence over graphene due to its buckling type structure and strong spin orbit coupling. Motivated by these properties, we study the silicene bilayer in the presence of applied perpendicular electric field and intrinsic spin orbit coupling to probe as quantum spin/valley Hall effect. Using analytical approach, we calculate the spin Chern-number of bilayer silicene and then compare it with monolayer silicene. We reveal that bilayer silicene hosts double spin Chern-number as compared to single layer silicene and therefore accordingly has twice as many edge states in contrast to single layer silicene. In addition, we investigate the combined effect of intrinsic spin orbit coupling and the external electric field, we find that bilayer silicene, likewise single layer silicene, goes through a phase transitions from a quantum spin Hall state to a quantum valley Hall state when the strength of the applied electric field exceeds the intrinsic spin orbit coupling strength. We believe that the results and outcomes obtained for bilayer silicene are experimentally more accessible as compared to bilayer graphene, because of strong SO coupling in bilayer silicene.
Nondestructive hall coefficient measurements using ACPD techniques
Velicheti, Dheeraj; Nagy, Peter B.; Hassan, Waled
2018-04-01
Hall coefficient measurements offer great opportunities as well as major challenges for nondestructive materials characterization. The Hall effect is produced by the magnetic Lorentz force acting on moving charge carriers in the presence of an applied magnetic field. The magnetic perturbation gives rise to a Hall current that is normal to the conduction current but does not directly perturb the electric potential distribution. Therefore, Hall coefficient measurements usually exploit the so-called transverse galvanomagnetic potential drop effect that arises when the Hall current is intercepted by the boundaries of the specimen and thereby produce a measurable potential drop. In contrast, no Hall potential is produced in a large plate in the presence of a uniform normal field at quasi-static low frequencies. In other words, conventional Hall coefficient measurements are inherently destructive since they require cutting the material under tests. This study investigated the feasibility of using alternating current potential drop (ACPD) techniques for nondestructive Hall coefficient measurements in plates. Specifically, the directional four-point square-electrode configuration is investigated with superimposed external magnetic field. Two methods are suggested to make Hall coefficient measurements in large plates without destructive machining. At low frequencies, constraining the bias magnetic field can replace constraining the dimensions of the specimen, which is inherently destructive. For example, when a cylindrical permanent magnet is used to provide the bias magnetic field, the peak Hall voltage is produced when the diameter of the magnet is equal to the diagonal of the square ACPD probe. Although this method is less effective than cutting the specimen to a finite size, the loss of sensitivity is less than one order of magnitude even at very low frequencies. In contrast, at sufficiently high inspection frequencies the magnetic field of the Hall current induces a
Resource Review Board Celebrates the Magnet and Liquid Argon Barrel Tests in Hall 180
Jenni, P.
2004-01-01
Address by the Director-General, R. Aymar, in front of the barrel cryostat. On 25th October 2004 many RRB delegates and guests, ATLAS National Contact Physicists, and colleagues from far and from CERN working on the Liquid Argon calorimeter and the magnet system were gathering in Hall 180 to celebrate the major milestones reached during the past months in this hall: the successful cold tests of the first barrel toroid coil, of the solenoid, and of the barrel Liquid Argon calorimeter. About 250 people spent a relaxing evening after the speeches by the Director-General R. Aymar and by the spokesperson who gave the following address: 'It is a great pleasure for me to welcome you all here in Hall 180 in the name of the ATLAS Collaboration! With a few words I would like to recall why we are actually here today to share, what I hope, is a relaxed and joyful moment. To concentrate it all in one sentence I could say: To thank cordially all the main actors for the enormous work accomplished here over many years,...
Quasiparticle-mediated spin Hall effect in a superconductor.
Wakamura, T; Akaike, H; Omori, Y; Niimi, Y; Takahashi, S; Fujimaki, A; Maekawa, S; Otani, Y
2015-07-01
In some materials the competition between superconductivity and magnetism brings about a variety of unique phenomena such as the coexistence of superconductivity and magnetism in heavy-fermion superconductors or spin-triplet supercurrent in ferromagnetic Josephson junctions. Recent observations of spin-charge separation in a lateral spin valve with a superconductor evidence that these remarkable properties are applicable to spintronics, although there are still few works exploring this possibility. Here, we report the experimental observation of the quasiparticle-mediated spin Hall effect in a superconductor, NbN. This compound exhibits the inverse spin Hall (ISH) effect even below the superconducting transition temperature. Surprisingly, the ISH signal increases by more than 2,000 times compared with that in the normal state with a decrease of the injected spin current. The effect disappears when the distance between the voltage probes becomes larger than the charge imbalance length, corroborating that the huge ISH signals measured are mediated by quasiparticles.
Mean field theory of dynamic phase transitions in ferromagnets
International Nuclear Information System (INIS)
Idigoras, O.; Vavassori, P.; Berger, A.
2012-01-01
We have studied the second order dynamic phase transition (DPT) of the two-dimensional kinetic Ising model by means of numerical calculations. While it is well established that the order parameter Q of the DPT is the average magnetization per external field oscillation cycle, the possible identity of the conjugate field has been addressed only recently. In this work, we demonstrate that our entire set of numerical data is fully consistent with the applied bias field H b being the conjugate field of order parameter Q. For this purpose, we have analyzed the Q(H b )-dependence and we have found that it follows the expected power law behavior with the same critical exponent as the mean field equilibrium case.
Silicon Carbide (SiC) Power Processing Unit (PPU) for Hall Effect Thrusters, Phase I
National Aeronautics and Space Administration — In this SBIR project, APEI, Inc. is proposing to develop a high efficiency, rad-hard 3.8 kW silicon carbide (SiC) Power Processing Unit (PPU) for Hall Effect...
Topologically induced fractional Hall steps in the integer quantum Hall regime of MoS 2
Firoz Islam, SK; Benjamin, Colin
2016-09-01
The quantum magnetotransport properties of a monolayer of molybdenum disulfide are derived using linear response theory. In particular, the effect of topological terms on longitudinal and Hall conductivity is analyzed. The Hall conductivity exhibits fractional steps in the integer quantum Hall regime. Further complete spin and valley polarization of the longitudinal conductivitity is seen in presence of these topological terms. Finally, the Shubnikov-de Hass oscillations are suppressed or enhanced contingent on the sign of these topological terms.
Hall magnetohydrodynamics of neutral layers
International Nuclear Information System (INIS)
Huba, J.D.; Rudakov, L.I.
2003-01-01
New analytical and numerical results of the dynamics of inhomogeneous, reversed field current layers in the Hall limit (i.e., characteristic length scales < or approx. the ion inertial length) are presented. Specifically, the two- and three-dimensional evolution of a current layer that supports a reversed field plasma configuration and has a density gradient along the current direction is studied. The two-dimensional study demonstrates that a density inhomogeneity along the current direction can dramatically redistribute the magnetic field and plasma via magnetic shock-like or rarefaction waves. The relative direction between the density gradient and current flow plays a critical role in the evolution of the current sheet. One important result is that the current sheet can become very thin rapidly when the density gradient is directed opposite to the current. The three-dimensional study uses the same plasma and field configuration as the two-dimensional study but is also initialized with a magnetic field perturbation localized along the current channel upstream of the plasma inhomogeneity. The perturbation induces a magnetic wave structure that propagates in the direction of the electron drift (i.e., opposite to the current). The propagating wave structure is a Hall phenomenon associated with magnetic field curvature. The interaction between the propagating wave structure and the evolving current layer can lead to rapid magnetic field line reconnection. The results are applied to laboratory and space plasma processes
International Nuclear Information System (INIS)
Entin-Wohlman, O.
2005-01-01
Full Text:The spin-Hall effect is described. The Rashba and Dresselhaus spin-orbit interactions are both shown to yield the low temperature spin-Hall effect for strongly localized electrons coupled to phonons. A frequency-dependent electric field E(ω) generates a spin-polarization current, normal to E, due to interference of hopping paths. At zero temperature the corresponding spin-Hall conductivity is real and is proportional to ω 2 . At non-zero temperatures the coupling to the phonons yields an imaginary term proportional to ω. The interference also yields persistent spin currents at thermal equilibrium, at E = 0. The contributions from the Dresselhaus and Rashba interactions to the interference oppose each other
E × B electron drift instability in Hall thrusters: Particle-in-cell simulations vs. theory
Boeuf, J. P.; Garrigues, L.
2018-06-01
The E × B Electron Drift Instability (E × B EDI), also called Electron Cyclotron Drift Instability, has been observed in recent particle simulations of Hall thrusters and is a possible candidate to explain anomalous electron transport across the magnetic field in these devices. This instability is characterized by the development of an azimuthal wave with wavelength in the mm range and velocity on the order of the ion acoustic velocity, which enhances electron transport across the magnetic field. In this paper, we study the development and convection of the E × B EDI in the acceleration and near plume regions of a Hall thruster using a simplified 2D axial-azimuthal Particle-In-Cell simulation. The simulation is collisionless and the ionization profile is not-self-consistent but rather is given as an input parameter of the model. The aim is to study the development and properties of the instability for different values of the ionization rate (i.e., of the total ion production rate or current) and to compare the results with the theory. An important result is that the wavelength of the simulated azimuthal wave scales as the electron Debye length and that its frequency is on the order of the ion plasma frequency. This is consistent with the theory predicting destruction of electron cyclotron resonance of the E × B EDI in the non-linear regime resulting in the transition to an ion acoustic instability. The simulations also show that for plasma densities smaller than under nominal conditions of Hall thrusters the field fluctuations induced by the E × B EDI are no longer sufficient to significantly enhance electron transport across the magnetic field, and transit time instabilities develop in the axial direction. The conditions and results of the simulations are described in detail in this paper and they can serve as benchmarks for comparisons between different simulation codes. Such benchmarks would be very useful to study the role of numerical noise (numerical
Henry, Annette
2015-01-01
Much has been written about Stuart Hall's intellectual and theoretical contributions especially after the mid-1960s. This interpretive and social biography places Stuart Hall's life from 1932 to 1959 in a socio-historical context, beginning with his childhood in Jamaica and his early years in England. I draw on Hall's own biographical reflections…
Nguyen, Dung Xuan; Gromov, Andrey; Son, Dam Thanh
2018-05-01
We perform a detailed comparison of the Dirac composite fermion and the recently proposed bimetric theory for a quantum Hall Jain states near half filling. By tuning the composite Fermi liquid to the vicinity of a nematic phase transition, we find that the two theories are equivalent to each other. We verify that the single mode approximation for the response functions and the static structure factor becomes reliable near the phase transition. We show that the dispersion relation of the nematic mode near the phase transition can be obtained from the Dirac brackets between the components of the nematic order parameter. The dispersion is quadratic at low momenta and has a magnetoroton minimum at a finite momentum, which is not related to any nearby inhomogeneous phase.
Mode Transitions in Hall Effect Thrusters
2013-07-01
1 voltage divider that was calibrated with a BK Precision 5491A multimeter. Mean discharge current ( )I I tD D= where denotes the average was...computing the 2-D DFT of bDj a Hamming window is used. E. Support for Local Light Intensity Correlation to Local Discharge Current The most direct
Experimental probes of emergent symmetries in the quantum Hall system
Lutken, C A
2011-01-01
Experiments studying renormalization group flows in the quantum Hall system provide significant evidence for the existence of an emergent holomorphic modular symmetry Gamma(0)(2). We briefly review this evidence and show that, for the lowest temperatures, the experimental determination of the position of the quantum critical points agrees to the parts per mille level with the prediction from Gamma(0)(2). We present evidence that experiments giving results that deviate substantially from the symmetry predictions are not cold enough to be in the quantum critical domain. We show how the modular symmetry extended by a non-holomorphic particle hole duality leads to an extensive web of dualities related to those in plateau insulator transitions, and we derive a formula relating dual pairs (B, B(d)) of magnetic field strengths across any transition. The experimental data obtained for the transition studied so far is in excellent agreement with the duality relations following from this emergent symmetry, and rule out...
Federal Laboratory Consortium — Hall C's initial complement of equipment (shown in the figure), includes two general-purpose magnetic spectrometers. The High Momentum Spectrometer (HMS) has a large...
Federal Laboratory Consortium — The instrumentation in Hall A at the Thomas Jefferson National Accelerator Facility was designed to study electroand photo-induced reactions at very high luminosity...
Matrix effective theories of the fractional quantum Hall effect
International Nuclear Information System (INIS)
Cappelli, Andrea; Rodriguez, Ivan D
2009-01-01
The present understanding of nonperturbative ground states in the fractional quantum Hall effect is based on effective theories of the Jain 'composite fermion' excitations. We review the approach based on matrix variables, i.e. D0 branes, originally introduced by Susskind and Polychronakos. We show that the Maxwell-Chern-Simons matrix gauge theory provides a matrix generalization of the quantum Hall effect, where the composite-fermion construction naturally follows from gauge invariance. The matrix ground states obtained by suitable projections of higher Landau levels are found to be in one-to-one correspondence with the Laughlin and Jain hierarchical states. The matrix theory possesses a physical limit for commuting matrices that could be reachable while staying in the same phase.
Quantum spin Hall effect and topological phase transition in InN x Bi y Sb1-x-y /InSb quantum wells
Song, Zhigang; Bose, Sumanta; Fan, Weijun; Zhang, Dao Hua; Zhang, Yan Yang; Shen Li, Shu
2017-07-01
Quantum spin Hall (QSH) effect, a fundamentally new quantum state of matter and topological phase transitions are characteristics of a kind of electronic material, popularly referred to as topological insulators (TIs). TIs are similar to ordinary insulator in terms of their bulk bandgap, but have gapless conducting edge-states that are topologically protected. These edge-states are facilitated by the time-reversal symmetry and they are robust against nonmagnetic impurity scattering. Recently, the quest for new materials exhibiting non-trivial topological state of matter has been of great research interest, as TIs find applications in new electronics and spintronics and quantum-computing devices. Here, we propose and demonstrate as a proof-of-concept that QSH effect and topological phase transitions can be realized in {{InN}}x{{Bi}}y{{Sb}}1-x-y/InSb semiconductor quantum wells (QWs). The simultaneous incorporation of nitrogen and bismuth in InSb is instrumental in lowering the bandgap, while inducing opposite kinds of strain to attain a near-lattice-matching conducive for lattice growth. Phase diagram for bandgap shows that as we increase the QW thickness, at a critical thickness, the electronic bandstructure switches from a normal to an inverted type. We confirm that such transition are topological phase transitions between a traditional insulator and a TI exhibiting QSH effect—by demonstrating the topologically protected edge-states using the bandstructure, edge-localized distribution of the wavefunctions and edge-state spin-momentum locking phenomenon, presence of non-zero conductance in spite of the Fermi energy lying in the bandgap window, crossover points of Landau levels in the zero-mode indicating topological band inversion in the absence of any magnetic field and presence of large Rashba spin-splitting, which is essential for spin-manipulation in TIs.
MID-INFRARED SPECTRA OF TRANSITIONAL DISKS IN THE CHAMAELEON I CLOUD
International Nuclear Information System (INIS)
Kim, K. H.; Watson, Dan M.; Manoj, P.; Forrest, W. J.; Sargent, B.; McClure, M. K.; Green, J. D.; Harrold, Samuel T.; Furlan, E.; Najita, J.; Espaillat, C.; Calvet, N.; Luhman, K. L.
2009-01-01
We present 5-40 μm Spitzer Infrared Spectrograph spectra of a collection of transitional disks, objects for which the spectral energy distribution (SED) indicates central clearings (holes) or gaps in the dust distribution, in the Chamaeleon I star-forming region. Like their counterparts in the Taurus-Auriga star-forming region that we have previously observed, the spectra of these young objects (1-3 Myr old) reveal that the central clearings or gaps are very sharp-edged, and are surrounded by optically thick dusty disks similar to those around other classical T Tauri stars in the Chamaeleon I association. Also like the Taurus transitional disks, the Chamaeleon I transitional disks have extremely large depletion factors for small dust grains in their gaps, compared to the full accretion disks whose SEDs are represented by the median SED of Class II objects in the region. We find that the fraction of transitional disks in the Chamaeleon I cloud is somewhat higher than that in the Taurus-Auriga cloud, possibly indicating that the frequency of transitional disks, on average, increases with cluster age. We also find a significant correlation between the stellar mass and the radius of the outer edge of the gap. We discuss the disk structures implied by the spectra and the constraints they place on gap-formation mechanisms in protoplanetary disks.
Transport in constricted quantum Hall systems: beyond the Kane-Fisher paradigm
International Nuclear Information System (INIS)
Lal, Siddhartha
2007-08-01
A simple model of edge transport in a constricted quantum Hall system with a lowered local fi lling factor is studied. The current backscattered from the constriction is explained from a matching of the properties of the edge-current excitations in the constriction (ν 2 ) and bulk (ν 1 ) regions. We develop a hydrodynamic theory for bosonic edge modes inspired by this model, stressing the importance of boundary conditions in elucidating the nature of current transport. By invoking a generalised quasiparticle-quasihole symmetry of the quantum Hall circuit system, we fi nd that a competition between two tunneling process determines the fate of the low-bias transmission conductance. A novel generalisation of the Kane-Fisher quantum impurity model is found, describing transitions from a weak-coupling theory at partial transmission to strong- coupling theories for perfect transmission and reflection as well as a new symmetry dictated fixed point. These results provide satisfactory explanations for recent experimental results at fi lling-factors of 1/3 and 1. (author)
Assignment of multipolarity for ΔI= 0 γ transitions from polarization measurements
International Nuclear Information System (INIS)
Ali, Sajad; Rajbanshi, S.; Chattopadhyay, S.
2017-01-01
It is well known that the determination of the polarization for the γ transition will lead to the unique spin-parity assignments of the nuclear states. The electric and magnetic nature of the γ-rays are distinguishes by the direction of the electric vector of electromagnetic radiation with respect to the beam detector plane. The difference between the perpendicular and parallely scattered events due to the Compton scattering depends on the direction of electric vector of the emitted γ radiation. The difference is positive for electric type transition and negative for magnetic type transitions while for a mixed transitions it is almost zero. However, for the ΔI =0 γ transitions it can be shown theoretically that the difference is positive for magnetic type of transitions and negative for electric type of transitions. This opposite results of the polarization asymmetry for the ΔI =0 γ transitions may sometimes resulted in different assignments of the nuclear states
75 FR 22770 - Gary E. Hall and Rita Hall; Notice of Availability of Environmental Assessment
2010-04-30
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Project No. 13652-000-Montana] Gary E. Hall and Rita Hall; Notice of Availability of Environmental Assessment April 22, 2010. In accordance with the National Environmental Policy Act of 1969, as amended, and the Federal Energy Regulatory...
Charge carrier coherence and Hall effect in organic semiconductors
Yi, H. T.; Gartstein, Y. N.; Podzorov, V.
2016-01-01
Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force acting on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor. PMID:27025354
Charge carrier coherence and Hall effect in organic semiconductors.
Yi, H T; Gartstein, Y N; Podzorov, V
2016-03-30
Hall effect measurements are important for elucidating the fundamental charge transport mechanisms and intrinsic mobility in organic semiconductors. However, Hall effect studies frequently reveal an unconventional behavior that cannot be readily explained with the simple band-semiconductor Hall effect model. Here, we develop an analytical model of Hall effect in organic field-effect transistors in a regime of coexisting band and hopping carriers. The model, which is supported by the experiments, is based on a partial Hall voltage compensation effect, occurring because hopping carriers respond to the transverse Hall electric field and drift in the direction opposite to the Lorentz force acting on band carriers. We show that this can lead in particular to an underdeveloped Hall effect observed in organic semiconductors with substantial off-diagonal thermal disorder. Our model captures the main features of Hall effect in a variety of organic semiconductors and provides an analytical description of Hall mobility, carrier density and carrier coherence factor.
Energy Technology Data Exchange (ETDEWEB)
1984-08-01
This report demonstrates the economic viability of an exterior rewrap retrofit performed on a public community facility for the performing arts. This facility originally consisted of two mess halls built by the American army. The exterior retrofit consisted of constructing a super-insulated passageway to link the two halls as well as completely wrapping the facility with six millimetre polyethylene to provide an airtight barrier. The roofs and walls were reinsulated and insulation levels were increased to RSI 10.5 in the ceilings and RSI 7.7 in the walls. The installation of a propane fuelled furnace was also included in the retrofit package. Prior to the renovations and retrofitting, the Guild Hall facility was almost unusable. The demonstration project transformed the cold, drafty buildings into an attractive, comfortable and functional centre for the performing arts. Heating requirements have been reduced to 500 MJ/m {sup 2} of floor space annually compared to a predicted 1,760 MJ/m{sup 2} of floor space based on HOTCAN analysis of the heating requirements without the energy conservation measures. 9 figs., 10 tabs.
Hall effect measurements of high-quality M n3CuN thin films and the electronic structure
Matsumoto, Toshiki; Hatano, Takafumi; Urata, Takahiro; Iida, Kazumasa; Takenaka, Koshi; Ikuta, Hiroshi
2017-11-01
The physical properties of M n3CuN were studied using thin films. We found that an annealing process was very effective to improve the film quality, the key of which was the use of Ti that prevented the formation of oxide impurities. Using these high-quality thin films, we found strong strain dependence for the ferromagnetic transition temperature (TC) and a sign change of the Hall coefficient at TC. The analysis of Hall coefficient data revealed a sizable decrease of hole concentration and a large increase of electron mobility below TC, which is discussed in relation to the electronic structure of this material.
Coxon, Bruce
2011-01-01
An account is given of the life, scientific contributions, and passing of Laurance David Hall (1938-2009), including his early history and education at the University of Bristol, UK, and the synthesis and NMR spectroscopy of carbohydrates and other natural products during ∼20 years of research and teaching at the University of British Columbia in Vancouver, Canada. Lists of graduate students, post-doctoral fellows, and sabbatical visitors are provided for this period. Following a generous endowment by Dr. Herchel Smith, Professor Hall built a new Department of Medicinal Chemistry at Cambridge University, UK, and greatly expanded his researches into the technology and applications of magnetic resonance imaging (MRI) and zero quantum NMR. MRI technology was applied both to medical problems such as the characterization of cartilage degeneration in knee joints, the measurement of ventricular function, lipid localization in animal models of atherosclerosis, paramagnetic metal complexes of polysaccharides as contrast agents, and studies of many other anatomical features, but also to several aspects of materials analysis, including food analyses, process control, and the elucidation of such physical phenomena as the flow of liquids through porous media, defects in concrete, and the visualization of fungal damage to wood. Professor Hall's many publications, patents, lectures, and honors and awards are described, and also his successful effort to keep the Asilomar facility in Pacific Grove, California as the alternating venue for the annual Experimental NMR Conference. Two memorial services for Professor Hall are remembered. Copyright © 2011 Elsevier Inc. All rights reserved.
The Hall instability of unsteady inhomogeneous axially symmetric magnetized plasmas
International Nuclear Information System (INIS)
Shtemler, Yuri M.; Mond, Michael; Liverts, Edward
2004-01-01
The Hall instability in cylindrically symmetric resistive magnetized plasmas in vacuum is investigated. The unperturbed self-similar equilibrium solutions for imploding Z-pinches with time-dependent total current I t ∼t S ,S>1/3, are subjected by short-wave sausage perturbations. The instability criterion is derived in slow-time, frozen-radius approximation. In cylindrically symmetric configurations the instability is driven by the magnetic field curvature. The near-axis and near-edge branches of the neutral curve in the plane of the inverse Hall parameter and phase velocity with the frozen radial coordinate as a parameter are separated by the critical point, where the modified gradient from the unperturbed number density changes sign. The critical radius may be treated as a new characteristic size of the Z-pinch that emerges due to the instability: the pinch is envisaged restructured by the short-scale high-frequency Hall instability, in which a central stable core is surrounded by an outer shell. Such a modified equilibrium may explain the observed enhanced stability against magnetohydrodynamic modes
Diagnostics Systems for Permanent Hall Thrusters Development
Ferreira, Jose Leonardo; Soares Ferreira, Ivan; Santos, Jean; Miranda, Rodrigo; Possa, M. Gabriela
and thus turning this thruster into a specially good option when it comes to space usage for longer and deep space missions, where solar panels and electric energy storage on batteries is a limiting factor. Two prototype models of permanent magnets Hall Thrusters PHALL I and II were already developed and tested with different permanent magnets systems. From the first studies in Russia (former USSR) soon it became clear that the closed electron drift current (Hall current) inside the source channel was generated by the crossed electric and magnetic (radial) field configuration inside the cylindrical channel. The radial magnetic field action on the circular Hall current inside the channel, combined with the electric field action on the ions, is believed to be the main physical process responsible for plasma acceleration. However a good understanding of the acceleration mechanism and the steady-state plasma dynamics is still missing, and many issues concerning the role of electron transport, plasma fluctuations and instabilities are still open. In this work we describe an integrated diagnostic system used to elucidate these aspects such. Ion energy spectrum, plasma potential profiles, plasma instabilities spectrum, and electron distribution function are some of the plasma diagnosticis needed to undestand the main physics issues on Permanent Magnet Hall Thrusters.
Shot-noise evidence of fractional quasiparticle creation in a local fractional quantum Hall state.
Hashisaka, Masayuki; Ota, Tomoaki; Muraki, Koji; Fujisawa, Toshimasa
2015-02-06
We experimentally identify fractional quasiparticle creation in a tunneling process through a local fractional quantum Hall (FQH) state. The local FQH state is prepared in a low-density region near a quantum point contact in an integer quantum Hall (IQH) system. Shot-noise measurements reveal a clear transition from elementary-charge tunneling at low bias to fractional-charge tunneling at high bias. The fractional shot noise is proportional to T(1)(1-T(1)) over a wide range of T(1), where T(1) is the transmission probability of the IQH edge channel. This binomial distribution indicates that fractional quasiparticles emerge from the IQH state to be transmitted through the local FQH state. The study of this tunneling process enables us to elucidate the dynamics of Laughlin quasiparticles in FQH systems.
The Other Hall Effect: College Board Physics
Sheppard, Keith; Gunning, Amanda M.
2013-01-01
Edwin Herbert Hall (1855-1938), discoverer of the Hall effect, was one of the first winners of the AAPT Oersted Medal for his contributions to the teaching of physics. While Hall's role in establishing laboratory work in high schools is widely acknowledged, his position as chair of the physics section of the Committee on College Entrance…
Anomalous Hall effect in polycrystalline Ni films
Guo, Zaibing
2012-02-01
We systematically studied the anomalous Hall effect in a series of polycrystalline Ni films with thickness ranging from 4 to 200 nm. It is found that both the longitudinal and anomalous Hall resistivity increased greatly as film thickness decreased. This enhancement should be related to the surface scattering. In the ultrathin films (46 nm thick), weak localization corrections to anomalous Hall conductivity were studied. The granular model, taking into account the dominated intergranular tunneling, has been employed to explain this phenomenon, which can explain the weak dependence of anomalous Hall resistivity on longitudinal resistivity as well. © 2011 Elsevier Ltd. All rights reserved.
Elementary theory of quantum Hall effect
Directory of Open Access Journals (Sweden)
Keshav N. Shrivastava
2008-04-01
Full Text Available The Hall effect is the generation of a current perpendicular to both the direction of the applied electric as well as magnetic field in a metal or in a semiconductor. It is used to determine the concentration of electrons. The quantum Hall effect with integer quantization was discovered by von Klitzing and fractionally charged states were found by Tsui, Stormer and Gossard. Robert Laughlin explained the quantization of Hall current by using “flux quantization” and introduced incompressibility to obtain the fractional charge. We have developed the theory of the quantum Hall effect by using the theory of angular momentum. Our predicted fractions are in accord with those measured. We emphasize our explanation of the observed phenomena. We use spin to explain the fractional charge and hence we discover spin-charge locking.
A RICH detector for strangeness physics in Hall A at Jefferson Lab
International Nuclear Information System (INIS)
Cusanno, F.; Garibaldi, F.; Cisbani, E.; Colilli, S.; De Cataldo, G.; De Leo, R.; Giuliani, F.; Gricia, M.; Lagamba, L.; Lucentini, M.; Reitz, B.; Santavenere, F.; Urciuoli, G.M.
2004-01-01
The high-resolution hypernuclear spectroscopy experiment at Jefferson Lab, Hall A (E94-107), needs unambiguous kaon identification. Due to the huge pion and proton background, the standard Hall A hadron particle identification, based on a time of flight and two aerogel threshold Cherenkov detectors, is not sufficient. For this task a proximity focusing C 6 F 14 /CsI RICH has been built. Recently, after some improvements to the mechanical structure of its wire chamber and to its electronics rate capability, the RICH has been tested with cosmic rays. This paper represents a status report of the RICH detector
Generic superweak chaos induced by Hall effect
Ben-Harush, Moti; Dana, Itzhack
2016-05-01
We introduce and study the "kicked Hall system" (KHS), i.e., charged particles periodically kicked in the presence of uniform magnetic (B ) and electric (E ) fields that are perpendicular to each other and to the kicking direction. We show that for resonant values of B and E and in the weak-chaos regime of sufficiently small nonintegrability parameter κ (the kicking strength), there exists a generic family of periodic kicking potentials for which the Hall effect from B and E significantly suppresses the weak chaos, replacing it by "superweak" chaos (SWC). This means that the system behaves as if the kicking strength were κ2 rather than κ . For E =0 , SWC is known to be a classical fingerprint of quantum antiresonance, but it occurs under much less generic conditions, in particular only for very special kicking potentials. Manifestations of SWC are a decrease in the instability of periodic orbits and a narrowing of the chaotic layers, relative to the ordinary weak-chaos case. Also, for global SWC, taking place on an infinite "stochastic web" in phase space, the chaotic diffusion on the web is much slower than the weak-chaos one. Thus, the Hall effect can be relatively stabilizing for small κ . In some special cases, the effect is shown to cause ballistic motion for almost all parameter values. The generic global SWC on stochastic webs in the KHS appears to be the two-dimensional closest analog to the Arnol'd web in higher dimensional systems.
International Nuclear Information System (INIS)
El-Arabi, N. M.
1993-01-01
Transport phenomena in two dimensional semiconductors have revealed unusual properties. In this thesis these systems are considered and discussed. The theories explain the Integral Quantum Hall Effect (IQHE) and the Fractional Quantum Hall Effect (FQHE). The thesis is composed of five chapters. The first and the second chapters lay down the theory of the IQHE, the third and fourth consider the theory of the FQHE. Chapter five deals with the statistics of particles in two dimension. (author). Refs
International Nuclear Information System (INIS)
Greiter, M.
1992-01-01
This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8
Reed, Kathlyn L
2005-01-01
Herbert James Hall, MD (1870-1923), was a pioneer in the systematic and organized study of occupation as therapy for persons with nervous and mental disorders that he called the "work cure." He began his work in 1904 during the early years of the Arts and Crafts Movement in the United States. His primary interest was the disorder neurasthenia, a condition with many symptoms including chronic fatigue, stress, and inability to work or perform everyday tasks. The prevailing treatment of the day was absolute bed rest known as the "rest cure." Hall believed that neurasthenia was not caused by overwork but by faulty living habits that could be corrected through an ordered life schedule and selected occupations. He identified several principles of therapy that are still used today including graded activity and energy conservation. Dr. Adolph Meyer credits Hall for organizing the ideas on the therapeutic use of occupation (Meyer, 1922). Hall also provided the name American Occupational Therapy Association for the professional organization and served as the fourth president. For his many contributions to the profession Hall deserves to be recognized as a major contributor to the development and organization of occupational therapy.
Absolute Kr I and Kr II transition probabilities
International Nuclear Information System (INIS)
Brandt, T.; Helbig, V.; Nick, K.P.
1982-01-01
Transition probabilities for 11 KrI and 9 KrII lines between 366.5 and 599.3nm were obtained from measurements with a wall-stabilised arc at atmospheric pressure in pure krypton. The population densities of the excited krypton levels were calculated under the assumption of LTE from electron densities measured by laser interferometry. The uncertainties for the KrI and the KrII data are 15 and 25% respectively. (author)
Jha, Rajveer; Higashinaka, Ryuji; Matsuda, Tatsuma D.; Ribeiro, Raquel A.; Aoki, Yuji
2018-05-01
We report on a systematic study of Hall effect using high quality single crystals of type-II Weyl semimetal WTe2 with the applied magnetic field B//c. The residual resistivity ratio of 1330 and the large magnetoresistance of 1.5 × 106 % in 9 T at 2 K, being in the highest class in the literature, attest to their high quality. Based on a simple two-carrier model, the densities (ne and nh) and mobilities (μe and μh) for electron and hole carriers have been uniquely determined combining both Hall- and electrical-resistivity data. The difference between ne and nh is 1% at 2 K, indicating that the system is in an compensated condition. The negative Hall resistivity growing rapidly below 20 K is due to a rapidly increasing μh/μe approaching one. Below 3 K in a low field region, we found the Hall resistivity becomes positive, reflecting that μh/μe finally exceeds one in this region. These anomalous behaviors of the carrier densities and mobilities might be associated with the existence of a Lifshitz transition and/or the spin texture on the Fermi surface.
Emerging Varieties of Capitalism in Transition Countries: Literature Review
Directory of Open Access Journals (Sweden)
Leszczyński Dariusz
2015-12-01
Full Text Available The systemic transformation of post-socialist countries from central planning to a market economy was a very complex and unprecedented undertaking. In this study we critically examine three influential classifications proposed by Coates [2000, 2006], Hall and Soskice [2001], and Amable [2003], within the “comparative capitalisms” literature stream, and argue that they are unsuitable for evaluating the progress made by transition economies since 1990. The basis of the criticism stems from timing: these theoretical frameworks were developed primarily to evaluate the growth of advanced and mature capitalist countries. Thus, they fail to capture the unique features of transition economies and the complexity of the transformation process that led to the emergence of different market-based systems. From this vantage point, we discusses and also critique a recent classification developed by Myant and Drahokoupil [2011, 2015], who distinguish five ideal models (i.e. “varieties of capitalism” that have evolved within transition countries. In our conclusion we point to areas within the field that may be explored by future research.
Anomalous Hall effect scaling in ferromagnetic thin films
Grigoryan, Vahram L.
2017-10-23
We propose a scaling law for anomalous Hall effect in ferromagnetic thin films. Our approach distinguishes multiple scattering sources, namely, bulk impurity, phonon for Hall resistivity, and most importantly the rough surface contribution to longitudinal resistivity. In stark contrast to earlier laws that rely on temperature- and thickness-dependent fitting coefficients, this scaling law fits the recent experimental data excellently with constant parameters that are independent of temperature and film thickness, strongly indicating that this law captures the underlying physical processes. Based on a few data points, this scaling law can even fit all experimental data in full temperature and thickness range. We apply this law to interpret the experimental data for Fe, Co, and Ni and conclude that (i) the phonon-induced skew scattering is unimportant as expected; (ii) contribution from the impurity-induced skew scattering is negative; (iii) the intrinsic (extrinsic) mechanism dominates in Fe (Co), and both the extrinsic and intrinsic contributions are important in Ni.
Anomalous Hall effect scaling in ferromagnetic thin films
Grigoryan, Vahram L.; Xiao, Jiang; Wang, Xuhui; Xia, Ke
2017-01-01
We propose a scaling law for anomalous Hall effect in ferromagnetic thin films. Our approach distinguishes multiple scattering sources, namely, bulk impurity, phonon for Hall resistivity, and most importantly the rough surface contribution to longitudinal resistivity. In stark contrast to earlier laws that rely on temperature- and thickness-dependent fitting coefficients, this scaling law fits the recent experimental data excellently with constant parameters that are independent of temperature and film thickness, strongly indicating that this law captures the underlying physical processes. Based on a few data points, this scaling law can even fit all experimental data in full temperature and thickness range. We apply this law to interpret the experimental data for Fe, Co, and Ni and conclude that (i) the phonon-induced skew scattering is unimportant as expected; (ii) contribution from the impurity-induced skew scattering is negative; (iii) the intrinsic (extrinsic) mechanism dominates in Fe (Co), and both the extrinsic and intrinsic contributions are important in Ni.
Pairing symmetry transitions in the even-denominator FQHE system
International Nuclear Information System (INIS)
Nomura, Kentaro; Yoshioka, Daijiro
2001-01-01
Transitions from a paired quantum Hall state to another quantum Hall state in bilayer systems are discussed in the framework of the edge theory. Starting from the edge theory for the Haldane-Rezayi state, it is shown that the charging effect of a bilayer system which breaks the SU (2) symmetry of the pseudospin shifts the central charge and the conformal dimensions of the fermionic fields which describe the pseudospin sector in the edge theory. This corresponds to the transition from the Haldane-Rezayi state to Halperin's 331 state, or from a singlet d-wave to a triplet p-wave ABM type paired state in the composite fermion picture. Considering interlayer tunneling, the tunneling rate-capacitance phase diagram for the ν=5/2 paired bilayer system is discussed. (author)
Pairing Symmetry Transitions in the Even-Denominator FQHE System
Nomura, Kentaro; Yoshioka, Daijiro
2001-12-01
Transitions from a paired quantum Hall state to another quantum Hall state in bilayer systems are discussed in the framework of the edge theory. Starting from the edge theory for the Haldane Rezayi state, it is shown that the charging effect of a bilayer system which breaks the SU(2) symmetry of the pseudospin shifts the central charge and the conformal dimensions of the fermionic fields which describe the pseudospin sector in the edge theory. This corresponds to the transition from the Haldane Rezayi state to Halperin's 331 state, or from a singlet d-wave to a triplet p-wave ABM type paired state in the composite fermion picture. Considering interlayer tunneling, the tunneling rate-capacitance phase diagram for the ν=5/2 paired bilayer system is discussed.
Energy Technology Data Exchange (ETDEWEB)
Chandelier, F
2003-12-01
The quantum Hall effect appears in low temperature electron systems submitted to intense magnetic fields. Electrons are trapped in a thin layer ({approx} 100.10{sup -8} cm thick) at the interface between 2 semiconductors or between a semiconductor and an insulating material. This thesis presents 3 personal contributions to the physics of plane systems and particularly to quantum Hall effect systems. The first contribution is a topological approach, it involves the study of Landau's problem in a geometry nearing that of Hall effect experiments. A mathematical formalism has been defined and by using the Kubo's formula, the quantification of the Hall conductivity can be linked to the Chern class of threaded holes. The second contribution represents a phenomenological approach based on dual symmetries and particularly on modular symmetries. This contribution uses visibility diagrams that have already produced right predictions concerning resistivity curves or band structures. The introduction of a physical equivalence has allowed us to build a phase diagram for the quantum Hall effect at zero temperature. This phase diagram agrees with the experimental facts concerning : -) the existence of 2 insulating phases, -) direct transitions between an insulating phase and any Hall phase through integer or fractionary values of the filling factor ({nu}), -) selection rules, and -) classification of the Hall states and their distribution around a metal state. The third contribution concerns another phenomenological approach based on duality symmetries. We have considered a class of (2+1)-dimensional effective models with a Maxwell-Chern-Simons part that includes a non-locality. This non-locality implies the existence of a hidden duality symmetry with a Z{sub 2} component: z {yields} 1/z. This symmetry has allowed us to meet the results of the Fisher's law concerning the components of the resistivity tensor. (A.C.)
Skew scattering dominated anomalous Hall effect in Cox(MgO)100-x granular thin films
Zhang, Qiang
2017-07-31
We investigated the mechanism(s) of the anomalous Hall effect (AHE) in magnetic granular materials by fabricating 100-nm-thick thin films of Co<i>x>(MgO)100-<i>x> with a Co volume fraction of 34≤<i>x>≤100 using co-sputtering at room temperature. We measured the temperature dependence of longitudinal resistivity (<i>ρxx>) and anomalous Hall resistivity (<i>ρ>AHE) from 5 K to 300 K in all samples. We found that when <i>x> decreases from 100 to 34, the values of <i>ρxx> and <i>ρ>AHE respectively increased by about four and three orders in magnitude. By linearly fitting the data, obtained at 5 K, of anomalous Hall coefficient (<i>Rs>) and of <i>ρxx> to log(<i>Rs)~γlog(ρxx>), we found that our results perfectly fell on a straight line with a slope of <i>γ>= 0.97±0.02. This fitting value of <i>γ> in <i>Rs∝ρxxγ> clearly suggests that skew scattering dominated the AHE in this granular system. To explore the effect of the scattering on the AHE, we performed the same measurements on annealed samples. We found that although both <i>ρxx> and <i>ρ>AHE significantly reduced after annealing, the correlation between them was almost the same, which was confirmed by the fitted value, <i>γ>=0.99±0.03. These data strongly suggest that the AHE originates from the skew scattering in Co-MgO granular thin films no matter how strong the scatterings of electrons by the interfaces and defects is. This observation may be of importance to the development of spintronic devices based on MgO.
Magnetoresistance in quantum Hall metals due to Pancharatnam ...
Indian Academy of Sciences (India)
Abstract. We derive the trial Hall resistance formula for the quantum Hall metals to address both the integer and fractional quantum Hall effects. Within the degenerate (and crossed) Landau levels, and in the presence of changing magnetic field strength, one can invoke two physical processes responsible for the electron ...
Extended Fenske-Hall LCAO MO Calculations for Mixed Methylene Dihalides
Ziemann, Hartmut; Paulun, Manfred
1988-10-01
The electronic structure of mixed methylene dihalides CH2XY (X, Y = F, Cl, Br. I) has been studied using extended Fenske-Hall LCAO MO method. The comparison with available photoelectron spectra confirmes previous assignments of all bands with binding energies <100 eV. The electronic structure changes occurring upon varying the halogen substituents are discussed.
Spin hall effect associated with SU(2) gauge field
Tao, Y.
2010-01-01
In this paper, we focus on the connection between spin Hall effect and spin force. Here we investigate that the spin force due to spin-orbit coupling, which, in two-dimensional system, is equivalent to forces of Hirsch and Chudnovsky besides constant factors 3 and frac{3}{2} respectively, is a part of classic Anandan force, and that the spin Hall effect is an anomalous Hall effect. Furthermore, we develop the method of AC phase to derive the expression for the spin force, and note that the most basic spin Hall effect indeed originate from the AC phase and is therefore an intrinsic quantum mechanical property of spin. This method differs from approach of Berry phase in the study of anomalous Hall effect , which is the intrinsic property of the perfect crystal. On the other hand, we use an elegant skill to show that the Chudnovsky-Drude model is reasonable. Here we have improved the theoretical values of spin Hall conductivity of Chudnovsky. Compared to the theoretical values of spin Hall conductivity in the Chudnovsky-Drude model, ours are in better agreement with experimentation. Finally, we discuss the relation between spin Hall effect and fractional statistics.
International Nuclear Information System (INIS)
Chandelier, F.
2003-12-01
The quantum Hall effect appears in low temperature electron systems submitted to intense magnetic fields. Electrons are trapped in a thin layer (∼ 100.10 -8 cm thick) at the interface between 2 semiconductors or between a semiconductor and an insulating material. This thesis presents 3 personal contributions to the physics of plane systems and particularly to quantum Hall effect systems. The first contribution is a topological approach, it involves the study of Landau's problem in a geometry nearing that of Hall effect experiments. A mathematical formalism has been defined and by using the Kubo's formula, the quantification of the Hall conductivity can be linked to the Chern class of threaded holes. The second contribution represents a phenomenological approach based on dual symmetries and particularly on modular symmetries. This contribution uses visibility diagrams that have already produced right predictions concerning resistivity curves or band structures. The introduction of a physical equivalence has allowed us to build a phase diagram for the quantum Hall effect at zero temperature. This phase diagram agrees with the experimental facts concerning : -) the existence of 2 insulating phases, -) direct transitions between an insulating phase and any Hall phase through integer or fractionary values of the filling factor (ν), -) selection rules, and -) classification of the Hall states and their distribution around a metal state. The third contribution concerns another phenomenological approach based on duality symmetries. We have considered a class of (2+1)-dimensional effective models with a Maxwell-Chern-Simons part that includes a non-locality. This non-locality implies the existence of a hidden duality symmetry with a Z 2 component: z → 1/z. This symmetry has allowed us to meet the results of the Fisher's law concerning the components of the resistivity tensor. (A.C.)
Hall Sensor Output Signal Fault-Detection & Safety Implementation Logic
Directory of Open Access Journals (Sweden)
Lee SangHun
2016-01-01
Full Text Available Recently BLDC motors have been popular in various industrial applications and electric mobility. Recently BLDC motors have been popular in various industrial applications and electric mobility. In most brushless direct current (BLDC motor drives, there are three hall sensors as a position reference. Low resolution hall effect sensor is popularly used to estimate the rotor position because of its good comprehensive performance such as low cost, high reliability and sufficient precision. Various possible faults may happen in a hall effect sensor. This paper presents a fault-tolerant operation method that allows the control of a BLDC motor with one faulty hall sensor and presents the hall sensor output fault-tolerant control strategy. The situations considered are when the output from a hall sensor stays continuously at low or high levels, or a short-time pulse appears on a hall sensor signal. For fault detection, identification of a faulty signal and generating a substitute signal, this method only needs the information from the hall sensors. There are a few research work on hall effect sensor failure of BLDC motor. The conventional fault diagnosis methods are signal analysis, model based analysis and knowledge based analysis. The proposed method is signal based analysis using a compensation signal for reconfiguration and therefore fault diagnosis can be fast. The proposed method is validated to execute the simulation using PSIM.
International Nuclear Information System (INIS)
Klitzing von, K.
1989-01-01
The quantized Hall effect is theoretically explained in detail as are its basic properties. The explanation is completed with the pertinent mathematical relations and illustrative figures. Experimental data are critically assessed obtained by quantum transport measurement in a magnetic field on two-dimensional systems. The results are reported for a MOSFET silicon transistor and for GaAs-Al x Ga 1-x As heterostructures. The application is discussed of the quantized Hall effect in determining the fine structure constant or in implementing the resistance standard. (M.D.). 27 figs., 57 refs
Valley-chiral quantum Hall state in graphene superlattice structure
Tian, H. Y.; Tao, W. W.; Wang, J.; Cui, Y. H.; Xu, N.; Huang, B. B.; Luo, G. X.; Hao, Y. H.
2016-05-01
We theoretically investigate the quantum Hall effect in a graphene superlattice (GS) system, in which the two valleys of graphene are coupled together. In the presence of a perpendicular magnetic field, an ordinary quantum Hall effect is found with the sequence σxy=ν e^2/h(ν=0,+/-1,+/-2,\\cdots) . At the zeroth Hall platform, a valley-chiral Hall state stemming from the single K or K' valley is found and it is localized only on one sample boundary contributing to the longitudinal conductance but not to the Hall conductivity. Our findings may shed light on the graphene-based valleytronics applications.
Air temperature gradient in large industrial hall
Karpuk, Michał; Pełech, Aleksander; Przydróżny, Edward; Walaszczyk, Juliusz; Szczęśniak, Sylwia
2017-11-01
In the rooms with dominant sensible heat load, volume airflow depends on many factors incl. pre-established temperature difference between exhaust and supply airflow. As the temperature difference is getting higher, airflow volume drops down, consequently, the cost of AHU is reduced. In high industrial halls with air exhaust grids located under the ceiling additional temperature gradient above working zone should be taken into consideration. In this regard, experimental research of the vertical air temperature gradient in high industrial halls were carried out for the case of mixing ventilation system The paper presents the results of air temperature distribution measurements in high technological hall (mechanically ventilated) under significant sensible heat load conditions. The supply airflow was delivered to the hall with the help of the swirl diffusers while exhaust grids were located under the hall ceiling. Basing on the air temperature distribution measurements performed on the seven pre-established levels, air temperature gradient in the area between 2.0 and 7.0 m above the floor was calculated and analysed.
A new CMOS Hall angular position sensor
Energy Technology Data Exchange (ETDEWEB)
Popovic, R.S.; Drljaca, P. [Swiss Federal Inst. of Tech., Lausanne (Switzerland); Schott, C.; Racz, R. [SENTRON AG, Zug (Switzerland)
2001-06-01
The new angular position sensor consists of a combination of a permanent magnet attached to a shaft and of a two-axis magnetic sensor. The permanent magnet produces a magnetic field parallel with the magnetic sensor plane. As the shaft rotates, the magnetic field also rotates. The magnetic sensor is an integrated combination of a CMOS Hall integrated circuit and a thin ferromagnetic disk. The CMOS part of the system contains two or more conventional Hall devices positioned under the periphery of the disk. The ferromagnetic disk converts locally a magnetic field parallel with the chip surface into a field perpendicular to the chip surface. Therefore, a conventional Hall element can detect an external magnetic field parallel with the chip surface. As the direction of the external magnetic field rotates in the chip plane, the output voltage of the Hall element varies as the cosine of the rotation angle. By placing the Hall elements at the appropriate places under the disk periphery, we may obtain the cosine signals shifted by 90 , 120 , or by any other angle. (orig.)
The quantum Hall effects: Philosophical approach
Lederer, P.
2015-05-01
The Quantum Hall Effects offer a rich variety of theoretical and experimental advances. They provide interesting insights on such topics as gauge invariance, strong interactions in Condensed Matter physics, emergence of new paradigms. This paper focuses on some related philosophical questions. Various brands of positivism or agnosticism are confronted with the physics of the Quantum Hall Effects. Hacking's views on Scientific Realism, Chalmers' on Non-Figurative Realism are discussed. It is argued that the difficulties with those versions of realism may be resolved within a dialectical materialist approach. The latter is argued to provide a rational approach to the phenomena, theory and ontology of the Quantum Hall Effects.
Quantum critical Hall exponents
Lütken, C A
2014-01-01
We investigate a finite size "double scaling" hypothesis using data from an experiment on a quantum Hall system with short range disorder [1-3]. For Hall bars of width w at temperature T the scaling form is w(-mu)T(-kappa), where the critical exponent mu approximate to 0.23 we extract from the data is comparable to the multi-fractal exponent alpha(0) - 2 obtained from the Chalker-Coddington (CC) model [4]. We also use the data to find the approximate location (in the resistivity plane) of seven quantum critical points, all of which closely agree with the predictions derived long ago from the modular symmetry of a toroidal sigma-model with m matter fields [5]. The value nu(8) = 2.60513 ... of the localisation exponent obtained from the m = 8 model is in excellent agreement with the best available numerical value nu(num) = 2.607 +/- 0.004 derived from the CC-model [6]. Existing experimental data appear to favour the m = 9 model, suggesting that the quantum Hall system is not in the same universality class as th...
Hall devices improve electric motor efficiency
Haeussermann, W.
1979-01-01
Efficiency of electric motors and generators is reduced by radial magnetic forces created by symmetric fields within device. Forces are sensed and counteracted by Hall devices on excitation or control windings. Hall generators directly measure and provide compensating control of anu asymmetry, eliminating additional measurements needed for calibration feedback control loop.
Graphene and the universality of the quantum Hall effect
DEFF Research Database (Denmark)
Tzalenchuk, A.; Janssen, T. J.B.M.; Kazakova, O.
2013-01-01
The quantum Hall effect allows the standard for resistance to be defined in terms of the elementary charge and Planck's constant alone. The effect comprises the quantization of the Hall resistance in two-dimensional electron systems in rational fractions of RK=h/e2=25812.8074434(84) Ω (Mohr P. J....... the unconventional quantum Hall effect and then present in detail the route, which led to the most precise quantum Hall resistance universality test ever performed.......The quantum Hall effect allows the standard for resistance to be defined in terms of the elementary charge and Planck's constant alone. The effect comprises the quantization of the Hall resistance in two-dimensional electron systems in rational fractions of RK=h/e2=25812.8074434(84) Ω (Mohr P. J....... et al., Rev. Mod. Phys., 84 (2012) 1527), the resistance quantum. Despite 30 years of research into the quantum Hall effect, the level of precision necessary for metrology, a few parts per billion, has been achieved only in silicon and III-V heterostructure devices. In this lecture we show...
Accurate micro Hall effect measurements on scribe line pads
DEFF Research Database (Denmark)
Østerberg, Frederik Westergaard; Petersen, Dirch Hjorth; Wang, Fei
2009-01-01
Hall mobility and sheet carrier density are important parameters to monitor in advanced semiconductor production. If micro Hall effect measurements are done on small pads in scribe lines, these parameters may be measured without using valuable test wafers. We report how Hall mobility can...... be extracted from micro four-point measurements performed on a rectangular pad. The dimension of the investigated pad is 400 × 430 ¿m2, and the probe pitches range from 20 ¿m to 50 ¿m. The Monte Carlo method is used to find the optimal way to perform the Hall measurement and extract Hall mobility most...
Magnetic phase transitions and anomalous transport properties in Ca-doped Eu hexaborides
International Nuclear Information System (INIS)
Rhyee, J. S.; Oh, B. H.; Cho, B. K.
2004-01-01
The temperature- and field-dependent magnetization M(T,H), electrical resistivity ρ(T,H), and Hall resistivity ρ xy (T,H) were measured for single crystals of a series of compounds Eu 1,x Ca x B 6 (x =0.0, 0.2, 0.4, 0.6, and 0.9). The ferromagnetic transition temperature of EuB 6 (T c = 12 K) was suppressed with small doping of Ca for Eu 0.8 Ca 0.2 B 6 (T c = 5.5 K) as evidenced by M(T) and a sharp drop in ρ(T). On the other hand, an antiferromagnetic transition was observed, rather than ferromagnetic transition, for Eu 0.6 Ca 0.4 B 6 (T N = 4.5 K) and Eu 0.4 Ca 0.6 B 6 (T N = 3 K). At the same time, a rapid increase of ρ(T) was found at low temperatures (T ≤ 10 K). The upturn of ρ(T) was suppressed with increasing applied magnetic field. From an analysis of the Hall resistivity ρ xy , the anomalous increase of ρ(T) and its suppression were found to be due to the dramatic variations in the charge carrier density n eff (T,H) and the Hall mobility μ H (T,H).
Optimization of Cylindrical Hall Thrusters
International Nuclear Information System (INIS)
Raitses, Yevgeny; Smirnov, Artem; Granstedt, Erik; Fisch, Nathaniel J.
2007-01-01
The cylindrical Hall thruster features high ionization efficiency, quiet operation, and ion acceleration in a large volume-to-surface ratio channel with performance comparable with the state-of-the-art annular Hall thrusters. These characteristics were demonstrated in low and medium power ranges. Optimization of miniaturized cylindrical thrusters led to performance improvements in the 50-200W input power range, including plume narrowing, increased thruster efficiency, reliable discharge initiation, and stable operation.
Optimization of Cylindrical Hall Thrusters
International Nuclear Information System (INIS)
Raitses, Yevgeny; Smirnov, Artem; Granstedt, Erik; Fi, Nathaniel J.
2007-01-01
The cylindrical Hall thruster features high ionization efficiency, quiet operation, and ion acceleration in a large volume-to-surface ratio channel with performance comparable with the state-of-the-art annular Hall thrusters. These characteristics were demonstrated in low and medium power ranges. Optimization of miniaturized cylindrical thrusters led to performance improvements in the 50-200W input power range, including plume narrowing, increased thruster efficiency, reliable discharge initiation, and stable operation
Dynamics of L-H transition and I-phase in EAST
DEFF Research Database (Denmark)
Xu, G. S.; Wang, H. Q.; Xu, M.
2014-01-01
The turbulence and flows at the plasma edge during the L-I-H, L-I-L and single-step L-H transitions have been measured directly using two reciprocating Langmuir probe systems at the outer midplane with several newly designed probe arrays in the EAST superconducting tokamak. The E × B velocity, tu...
Spin-singlet hierarchy in the fractional quantum Hall effect
Ino, Kazusumi
1999-01-01
We show that the so-called permanent quantum Hall states are formed by the integer quantum Hall effects on the Haldane-Rezayi quantum Hall state. Novel conformal field theory description along with this picture is deduced. The odd denominator plateaux observed around $\
Anisotropic intrinsic spin Hall effect in quantum wires
International Nuclear Information System (INIS)
Cummings, A W; Akis, R; Ferry, D K
2011-01-01
We use numerical simulations to investigate the spin Hall effect in quantum wires in the presence of both Rashba and Dresselhaus spin-orbit coupling. We find that the intrinsic spin Hall effect is highly anisotropic with respect to the orientation of the wire, and that the nature of this anisotropy depends strongly on the electron density and the relative strengths of the Rashba and Dresselhaus spin-orbit couplings. In particular, at low densities, when only one subband of the quantum wire is occupied, the spin Hall effect is strongest for electron momentum along the [1-bar 10] axis, which is the opposite of what is expected for the purely 2D case. In addition, when more than one subband is occupied, the strength and anisotropy of the spin Hall effect can vary greatly over relatively small changes in electron density, which makes it difficult to predict which wire orientation will maximize the strength of the spin Hall effect. These results help to illuminate the role of quantum confinement in spin-orbit-coupled systems, and can serve as a guide for future experimental work on the use of quantum wires for spin-Hall-based spintronic applications. (paper)
Thermopower, electrical and Hall conductivity of undoped and doped iron disilicide single crystals
Energy Technology Data Exchange (ETDEWEB)
Heinrich, A; Behr, G; Griessmann, H; Teichert, S; Lange, H
1997-07-01
The electrical transport properties of {beta}-FeSi{sub 2} single crystals have been investigated in dependence on the purity of the source material and on doping with 3d transition metals. The transport properties included are electrical conductivity, Hall conductivity and thermopower mainly in the temperature range from 4K to 300K. The single crystals have been prepared by chemical transport reaction in a closed system with iodine as transport agent. In undoped single crystals prepared with 5N Fe both electrical conductivity and thermopower depend on the composition within the homogeneity range of {beta}-FeSi{sub 2} which is explained by different intrinsic defects at the Si-rich and Fe-rich phase boundaries. In both undoped and doped single crystals impurity band conduction is observed at low temperatures but above 100K extrinsic behavior determined by shallow impurity states. The thermopower shows between 100K and 200K a significant phonon drag contribution which depends on intrinsic defects and additional doping. The Hall resistivity is considered mainly with respect to an anomalous contribution found in p-type and n-type single crystals and thin films. In addition doped single crystals show at temperatures below about 130K an hysteresis of the Hall voltage. These results make former mobility data uncertain. Comparison will be made between the transport properties of single crystals and polycrystalline material.
The Hall module of an exact category with duality
Young, Matthew B.
2012-01-01
We construct from a finitary exact category with duality a module over its Hall algebra, called the Hall module, encoding the first order self-dual extension structure of the category. We study in detail Hall modules arising from the representation theory of a quiver with involution. In this case we show that the Hall module is naturally a module over the specialized reduced sigma-analogue of the quantum Kac-Moody algebra attached to the quiver. For finite type quivers, we explicitly determin...
Chudnovsky, Eugene M.
2007-01-01
An extension of Drude model is proposed that accounts for spin and spin-orbit interaction of charge carriers. Spin currents appear due to combined action of the external electric field, crystal field and scattering of charge carriers. The expression for spin Hall conductivity is derived for metals and semiconductors that is independent of the scattering mechanism. In cubic metals, spin Hall conductivity $\\sigma_s$ and charge conductivity $\\sigma_c$ are related through $\\sigma_s = [2 \\pi \\hbar...
Anode sheath in Hall thrusters
International Nuclear Information System (INIS)
Dorf, L.; Semenov, V.; Raitses, Y.
2003-01-01
A set of hydrodynamic equations is used to describe quasineutral plasma in ionization and acceleration regions of a Hall thruster. The electron distribution function and Poisson equation are invoked for description of a near-anode region. Numerical solutions suggest that steady-state operation of a Hall thruster can be achieved at different anode sheath regimes. It is shown that the anode sheath depends on the thruster operating conditions, namely the discharge voltage and the mass flow rate
Quantum Hall effect in quantum electrodynamics
International Nuclear Information System (INIS)
Penin, Alexander A.
2009-01-01
We consider the quantum Hall effect in quantum electrodynamics and find a deviation from the quantum-mechanical prediction for the Hall conductivity due to radiative antiscreening of electric charge in an external magnetic field. A weak dependence of the universal von Klitzing constant on the magnetic field strength, which can possibly be observed in a dedicated experiment, is predicted
Quantized Hall conductance as a topological invariant
International Nuclear Information System (INIS)
Niu, Q.; Thouless, Ds.J.; Wu, Y.S.
1984-10-01
Whenever the Fermi level lies in a gap (or mobility gap) the bulk Hall conductance can be expressed in a topologically invariant form showing the quantization explicitly. The new formulation generalizes the earlier result by TKNN to the situation where many body interaction and substrate disorder are also present. When applying to the fractional quantized Hall effect we draw the conclusion that there must be a symmetry breaking in the many body ground state. The possibility of writing the fractionally quantized Hall conductance as a topological invariant is also carefully discussed. 19 references
Commemorative Symposium on the Hall Effect and its Applications
Westgate, C
1980-01-01
In 1879, while a graduate student under Henry Rowland at the Physics Department of The Johns Hopkins University, Edwin Herbert Hall discovered what is now universally known as the Hall effect. A symposium was held at The Johns Hopkins University on November 13, 1979 to commemorate the lOOth anniversary of the discovery. Over 170 participants attended the symposium which included eleven in vited lectures and three speeches during the luncheon. During the past one hundred years, we have witnessed ever ex panding activities in the field of the Hall effect. The Hall effect is now an indispensable tool in the studies of many branches of condensed matter physics, especially in metals, semiconductors, and magnetic solids. Various components (over 200 million!) that utilize the Hall effect have been successfully incorporated into such devices as keyboards, automobile ignitions, gaussmeters, and satellites. This volume attempts to capture the important aspects of the Hall effect and its applications. It includes t...
National Oceanic and Atmospheric Administration, Department of Commerce — Salt marsh habitats along the shoreline of Halls Lake are threatened by wave erosion, but the reconstruction of barrier islands to reduce this erosion will modify or...
Nobel Prize in physics 1985: Quantum Hall effect
International Nuclear Information System (INIS)
Herrmann, R.
1986-01-01
The conditions (like very strong magnetic fields, ultralow temperatures, and occurrence of a two-dimensional electron gas in microelectronic structures) for the measurement of the quantum Hall effect are explained. Two possible measuring methods are described. Measuring results for p-Si-MOSFET, GaAs/AlGaAs heterojuntions and grain boundaries in InSb crystals are reported. Differences between normal (integer) and fractional quantum Hall effect are discussed. One of the important consequences is that by means of the quantum Hall effect the value h/e 2 can be determined with very high accuracy. In 1985 Klaus von Klitzing was awarded the Nobel Prize for his work on the quantum Hall effect
Intrinsic superspin Hall current
Linder, Jacob; Amundsen, Morten; Risinggârd, Vetle
2017-09-01
We discover an intrinsic superspin Hall current: an injected charge supercurrent in a Josephson junction containing heavy normal metals and a ferromagnet generates a transverse spin supercurrent. There is no accompanying dissipation of energy, in contrast to the conventional spin Hall effect. The physical origin of the effect is an antisymmetric spin density induced among transverse modes ky near the interface of the superconductor arising due to the coexistence of p -wave and conventional s -wave superconducting correlations with a belonging phase mismatch. Our predictions can be tested in hybrid structures including thin heavy metal layers combined with strong ferromagnets and ordinary s -wave superconductors.
The quantum Hall's effect: A quantum electrodynamic phenomenon
International Nuclear Information System (INIS)
Arbab, A. I.
2012-01-01
We have applied Maxwell's equations to study the physics of quantum Hall's effect. The electromagnetic properties of this system are obtained. The Hall's voltage, V H = 2πħ 2 n s /em, where n s is the electron number density, for a 2-dimensional system, and h = 2πħ is the Planck's constant, is found to coincide with the voltage drop across the quantum capacitor. Consideration of the cyclotronic motion of electrons is found to give rise to Hall's resistance. Ohmic resistances in the horizontal and vertical directions have been found to exist before equilibrium state is reached. At a fundamental level, the Hall's effect is found to be equivalent to a resonant LCR circuit with L H = 2π m/e 2 n s and C H = me 2 /2πħ 2 n s satisfying the resonance condition with resonant frequency equal to the inverse of the scattering (relaxation) time, τ s . The Hall's resistance is found to be R H = √L H /C H . The Hall's resistance may be connected with the impedance that the electron wave experiences when it propagates in the 2-dimensional gas. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Spontaneous Hall effect in a chiral p-wave superconductor
Furusaki, Akira; Matsumoto, Masashige; Sigrist, Manfred
2001-08-01
In a chiral superconductor with broken time-reversal symmetry a ``spontaneous Hall effect'' may be observed. We analyze this phenomenon by taking into account the surface properties of a chiral superconductor. We identify two main contributions to the spontaneous Hall effect. One contribution originates from the Bernoulli (or Lorentz) force due to spontaneous currents running along the surfaces of the superconductor. The other contribution has a topological origin and is related to the intrinsic angular momentum of Cooper pairs. The latter can be described in terms of a Chern-Simons-like term in the low-energy field theory of the superconductor and has some similarities with the quantum Hall effect. The spontaneous Hall effect in a chiral superconductor is, however, nonuniversal. Our analysis is based on three approaches to the problem: a self-consistent solution of the Bogoliubov-de Gennes equation, a generalized Ginzburg-Landau theory, and a hydrodynamic formulation. All three methods consistently lead to the same conclusion that the spontaneous Hall resistance of a two-dimensional superconducting Hall bar is of order h/(ekFλ)2, where kF is the Fermi wave vector and λ is the London penetration depth; the Hall resistance is substantially suppressed from a quantum unit of resistance. Experimental issues in measuring this effect are briefly discussed.
Anomalous Hall effect in Fe/Gd bilayers
Xu, W. J.; Zhang, Bei; Liu, Z. X.; Wang, Z.; Li, W.; Wu, Z. B.; Yu, R. H.; Zhang, Xixiang
2010-01-01
Non-monotonic dependence of anomalous Hall resistivity on temperature and magnetization, including a sign change, was observed in Fe/Gd bilayers. To understand the intriguing observations, we fabricated the Fe/Gd bilayers and single layers of Fe and Gd simultaneously. The temperature and field dependences of longitudinal resistivity, Hall resistivity and magnetization in these films have also been carefully measured. The analysis of these data reveals that these intriguing features are due to the opposite signs of Hall resistivity/or spin polarization and different Curie temperatures of Fe and Gd single-layer films. Copyright (C) EPLA, 2010
Anomalous Hall effect in Fe/Gd bilayers
Xu, W. J.
2010-04-01
Non-monotonic dependence of anomalous Hall resistivity on temperature and magnetization, including a sign change, was observed in Fe/Gd bilayers. To understand the intriguing observations, we fabricated the Fe/Gd bilayers and single layers of Fe and Gd simultaneously. The temperature and field dependences of longitudinal resistivity, Hall resistivity and magnetization in these films have also been carefully measured. The analysis of these data reveals that these intriguing features are due to the opposite signs of Hall resistivity/or spin polarization and different Curie temperatures of Fe and Gd single-layer films. Copyright (C) EPLA, 2010
Czech Academy of Sciences Publication Activity Database
Nagaosa, N.; Sinova, Jairo; Onoda, S.; MacDonald, A. H.; Ong, N. P.
2010-01-01
Roč. 82, č. 2 (2010), s. 1539-1592 ISSN 0034-6861 Institutional research plan: CEZ:AV0Z10100521 Keywords : anomalous Hall effect * spintronics Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 51.695, year: 2010
International Nuclear Information System (INIS)
Martin, L. N.; Dmitruk, P.; Gomez, D. O.
2010-01-01
In this work we numerically test a model of Hall magnetohydrodynamics in the presence of a strong mean magnetic field: the reduced Hall magnetohydrodynamic model (RHMHD) derived by [Gomez et al., Phys. Plasmas 15, 102303 (2008)] with the addition of weak compressible effects. The main advantage of this model lies in the reduction of computational cost. Nevertheless, up until now the degree of agreement with the original Hall MHD system and the range of validity in a regime of turbulence were not established. In this work direct numerical simulations of three-dimensional Hall MHD turbulence in the presence of a strong mean magnetic field are compared with simulations of the weak compressible RHMHD model. The results show that the degree of agreement is very high (when the different assumptions of RHMHD, such as spectral anisotropy, are satisfied). Nevertheless, when the initial conditions are isotropic but the mean magnetic field is maintained strong, the results differ at the beginning but asymptotically reach a good agreement at relatively short times. We also found evidence that the compressibility still plays a role in the dynamics of these systems, and the weak compressible RHMHD model is able to capture these effects. In conclusion the weak compressible RHMHD model is a valid approximation of the Hall MHD turbulence in the relevant physical context.
Measured Early Lateral Energy Fractions in Concert Halls and Opera Houses
BARRON, M.
2000-04-01
In the 30 years since early lateral reflections were first suggested as important for concert halls, spatial impression and source broadening have become almost universally accepted as essential characteristics of halls with good acoustics. Two objective measures of source broadening have been proposed. Measured values of the best defined of these measures, the early lateral energy fraction (LF), are considered here. Results from two independent measurement surveys are discussed. Comparisons of LF values by hall show a significant link between hall mean LF and hall width. There is however considerable overlap between measured LF values in different halls so the relevance of describing halls by their mean early lateral energy fraction values is questionable. The behaviour of LF values within auditoria is discussed for different concert hall plan forms and within opera houses. A measure of source broadening including sound level is proposed and results considered in the context of auditorium design.
Destruction of the fractional quantum Hall effect by disorder
International Nuclear Information System (INIS)
Laughlin, R.B.
1985-07-01
It is suggested that Hall steps in the fractional quantum Hall effect are physically similar to those in the ordinary quantum Hall effect. This proposition leads to a simple scaling diagram containing a new type of fixed point, which is identified with the destruction of the fractional states by disorder. 15 refs., 3 figs
A Hall probe technique for characterizing high-temperature superconductors
International Nuclear Information System (INIS)
Zhang, J.; Sheldon, P.; Ahrenkiel, R.K.
1992-01-01
Thin-film GaAs Hall probes were fabricated by molecular beam epitaxy technology. A contactless technique was developed to characterize thin-film, high-temperature superconducting (HTSC) materials. The Hall probes detected the ac magnetic flux penetration through the high-temperature superconducting materials. The Hall detector has advantages over the mutual inductance magnetic flux detector
W∞ gauge theory and the quantum Hall effect
International Nuclear Information System (INIS)
Shizuya, K.
1994-05-01
It is shown that a planar system of Hall electrons coupled to an applied electromagnetic field is written in the form of a W ∞ gauge theory. The associated W ∞ gauge field is expressed nonlinearly in terms of an infinite set of multipoles of the electromagnetic field. The W ∞ transformations generate mixing among the Landau levels. They provide a systematic way to classify the electromagnetic characteristics of the Hall system according to the resolution of external probes. In particular, an exact long-wavelength connection is derived between the carrier density and the Hall conductance in the presence of electron-electron interactions. Our approach is complementary to an earlier one and reveals a dual role the W ∞ gauge symmetry plays in the Hall dynamics. (author)
Zhou, Jian; Sun, Qiang; Wang, Qian; Kawazoe, Yoshiyuki; Jena, Puru
2016-06-07
Exploring a two-dimensional intrinsic quantum spin Hall state with a large band gap as well as an anomalous Hall state in realizable materials is one of the most fundamental and important goals for future applications in spintronics, valleytronics, and quantum computing. Here, by combining first-principles calculations with a tight-binding model, we predict that Sb or Bi can epitaxially grow on a stable and ferromagnetic MnO2 thin film substrate, forming a flat honeycomb sheet. The flatness of Sb or Bi provides an opportunity for the existence of Dirac points in the Brillouin zone, with its position effectively tuned by surface hydrogenation. The Dirac points in spin up and spin down channels split due to the proximity effects induced by MnO2. In the presence of both intrinsic and Rashba spin-orbit coupling, we find two band gaps exhibiting a large band gap quantum spin Hall state and a nearly quantized anomalous Hall state which can be tuned by adjusting the Fermi level. Our findings provide an efficient way to realize both quantized intrinsic spin Hall conductivity and anomalous Hall conductivity in a single material.
Plasmon Geometric Phase and Plasmon Hall Shift
Shi, Li-kun; Song, Justin C. W.
2018-04-01
The collective plasmonic modes of a metal comprise a simple pattern of oscillating charge density that yields enhanced light-matter interaction. Here we unveil that beneath this familiar facade plasmons possess a hidden internal structure that fundamentally alters its dynamics. In particular, we find that metals with nonzero Hall conductivity host plasmons with an intricate current density configuration that sharply departs from that of ordinary zero Hall conductivity metals. This nontrivial internal structure dramatically enriches the dynamics of plasmon propagation, enabling plasmon wave packets to acquire geometric phases as they scatter. At boundaries, these phases accumulate allowing plasmon waves that reflect off to experience a nonreciprocal parallel shift. This plasmon Hall shift, tunable by Hall conductivity as well as plasmon wavelength, displaces the incident and reflected plasmon trajectories and can be readily probed by near-field photonics techniques. Anomalous plasmon geometric phases dramatically enrich the nanophotonics toolbox, and yield radical new means for directing plasmonic beams.
Signal conditioning and processing for metallic Hall sensors.
Czech Academy of Sciences Publication Activity Database
Entler, Slavomír; Ďuran, Ivan; Sládek, P.; Vayakis, G.; Kočan, M.
2017-01-01
Roč. 123, November (2017), s. 783-786 ISSN 0920-3796. [SOFT 2016: Symposium on Fusion Technology /29./. Prague, 05.09.2016-09.09.2016] R&D Projects: GA MŠk LG14002 Institutional support: RVO:61389021 Keywords : Hall sensor * Lock-in * Synchronous detection * Current spinning * Hall effect * Planar hall effect suppression Subject RIV: JF - Nuclear Energetics OBOR OECD: Nuclear related engineering Impact factor: 1.319, year: 2016 http://www.sciencedirect.com/science/article/pii/S0920379617305070
Energy spectrum, dissipation, and spatial structures in reduced Hall magnetohydrodynamic
Energy Technology Data Exchange (ETDEWEB)
Martin, L. N.; Dmitruk, P. [Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and IFIBA, CONICET, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Gomez, D. O. [Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires and IFIBA, CONICET, Ciudad Universitaria, 1428 Buenos Aires (Argentina); Instituto de Astronomia y Fisica del Espacio, CONICET, Buenos Aires (Argentina)
2012-05-15
We analyze the effect of the Hall term in the magnetohydrodynamic turbulence under a strong externally supported magnetic field, seeing how this changes the energy cascade, the characteristic scales of the flow, and the dynamics of global magnitudes, with particular interest in the dissipation. Numerical simulations of freely evolving three-dimensional reduced magnetohydrodynamics are performed, for different values of the Hall parameter (the ratio of the ion skin depth to the macroscopic scale of the turbulence) controlling the impact of the Hall term. The Hall effect modifies the transfer of energy across scales, slowing down the transfer of energy from the large scales up to the Hall scale (ion skin depth) and carrying faster the energy from the Hall scale to smaller scales. The final outcome is an effective shift of the dissipation scale to larger scales but also a development of smaller scales. Current sheets (fundamental structures for energy dissipation) are affected in two ways by increasing the Hall effect, with a widening but at the same time generating an internal structure within them. In the case where the Hall term is sufficiently intense, the current sheet is fully delocalized. The effect appears to reduce impulsive effects in the flow, making it less intermittent.
Spin disorder effect in anomalous Hall effect in MnGa
Mendonça, A. P. A.; Varalda, J.; Schreiner, W. H.; Mosca, D. H.
2017-12-01
We report on resistivity and Hall effect in MnGa thin films grown by molecular beam epitaxy on GaAs substrates. Highly (1 1 1)-textured MnGa film with L10 structure exhibits hard magnetic properties with coercivities as high as 20 kOe and spin disorder mechanisms contributing to the Hall conductivity at room temperature. Density functional theory calculations were performed to determine the intrinsic Berry curvature in the momentum space with chiral spin structure that results in an anomalous Hall conductivity of 127 (Ωcm)-1 comparable to that measured at low temperature. In addition to residual and side-jump contributions, which are enhanced by thermal activation, both anomalous Hall conductivity and Hall angle increase between 100 K and room temperature. The present results reinforce the potential of Mn-Ga system for developing Hall effect-based spintronic devices.
Fractional quantization and the quantum hall effect
International Nuclear Information System (INIS)
Guerrero, J.; Calixto, M.; Aldaya, V.
1998-01-01
Quantization with constrains is considered in a group-theoretical framework, providing a precise characterization of the set of good operators, i.e., those preserving the constrained Hilbert space, in terms of the representation of the subgroup of constraints. This machinery is applied to the quantization of the torus as symplectic manifold, obtaining that fractional quantum numbers are permitted, provided that we allow for vector valued representations. The good operators turn out to be the Wilson loops and, for certain representations of the subgroup of constraints, the modular transformations. These results are applied to the Fractional Quantum Hall Effect, where interesting implications are derived
Samson, Thomas
Nous proposons une methode permettant d'obtenir une expression pour la conductivite de Hall de structures electroniques bidimensionnelles et nous examinons celle -ci a la limite d'une temperature nulle dans le but de verifier l'effet Hall quantique. Nous allons nous interesser essentiellement a l'effet Hall quantique entier et aux effets fractionnaires inferieurs a un. Le systeme considere est forme d'un gaz d'electrons en interaction faible avec les impuretes de l'echantillon. Le modele du gaz d'electrons consiste en un gaz bidimensionnel d'electrons sans spin expose perpendiculairement a un champ magnetique uniforme. Ce dernier est decrit par le potentiel vecteur vec{rm A} defini dans la jauge de Dingle ou jauge symetrique. Conformement au formalisme de la seconde quantification, l'hamiltonien de ce gaz est represente dans la base des etats a un-corps de Dingle |n,m> et exprime ainsi en terme des operateurs de creation et d'annihilation correspondants a_sp{ rm n m}{dag} et a _{rm n m}. Nous supposons de plus que les electrons du niveau fondamental de Dingle interagissent entre eux via le potentiel coulombien. La methode utilisee fait appel a une equation mai tresse a N-corps, de nature quantique et statistique, et verifiant le second principe de la thermodynamique. A partir de celle-ci, nous obtenons un systeme d'equations differentielles appele hierarchie d'equations quantique dont la resolution nous permet de determiner une equation a un-corps, dite de Boltzmann quantique, et dictant l'evolution de la moyenne statistique de l'operateur non-diagonal a _sp{rm n m}{dag } a_{rm n}, _{rm m}, sous l'action du champ electrique applique vec{rm E}(t). C'est sa solution Tr(p(t) a _sp{rm n m}{dag} a_{rm n},_ {rm m}), qui definit la relation de convolution entre la densite courant de Hall vec{rm J}_{rm H }(t) et le champ electrique vec {rm E}(t) dont la transformee de Laplace-Fourier du noyau nous fournit l'expression de la conductivite de Hall desiree. Pour une valeur de
Anisotropic magnetoresistance and piezoelectric effect in GaAs Hall samples
Ciftja, Orion
2017-02-01
Application of a strong magnetic field perpendicular to a two-dimensional electron system leads to a variety of quantum phases ranging from incompressible quantum Hall liquid to Wigner solid, charge density wave, and exotic non-Abelian states. A few quantum phases seen in past experiments on GaAs Hall samples of electrons show pronounced anisotropic magnetoresistance values at certain weak magnetic fields. We argue that this might be due to the piezoelectric effect that is inherent in a semiconductor host such as GaAs. Such an effect has the potential to create a sufficient in-plane internal strain that will be felt by electrons and will determine the direction of high and low resistance. When Wigner solid, charge density wave, and isotropic liquid phases are very close in energy, the overall stability of the system is very sensitive to local order and, thus, can be strongly influenced even by a weak perturbation such as the piezoelectric-induced effective electron-electron interaction, which is anisotropic. In this work, we argue that an anisotropic interaction potential may stabilize anisotropic liquid phases of electrons even in a strong magnetic field regime where normally one expects to see only isotropic quantum Hall or isotropic Fermi liquid states. We use this approach to support a theoretical framework that envisions the possibility of an anisotropic liquid crystalline state of electrons in the lowest Landau level. In particular, we argue that an anisotropic liquid state of electrons may stabilize in the lowest Landau level close to the liquid-solid transition region at filling factor ν =1 /6 for a given anisotropic Coulomb interaction potential. Quantum Monte Carlo simulations for a liquid crystalline state with broken rotational symmetry indicate stability of liquid crystalline order consistent with the existence of an anisotropic liquid state of electrons stabilized by anisotropy at filling factor ν =1 /6 of the lowest Landau level.
Piezo Voltage Controlled Planar Hall Effect Devices.
Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You
2016-06-22
The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.
National Aeronautics and Space Administration — Hall thrusters are being considered for many space missions because their high specific impulse delivers a larger payload mass fraction than chemical rockets. With a...
Higher fractions theory of fractional hall effect
International Nuclear Information System (INIS)
Kostadinov, I.Z.; Popov, V.N.
1985-07-01
A theory of fractional quantum Hall effect is generalized to higher fractions. N-particle model interaction is used and the gap is expressed through n-particles wave function. The excitation spectrum in general and the mean field critical behaviour are determined. The Hall conductivity is calculated from first principles. (author)
International Nuclear Information System (INIS)
Li Juan; Wang Yifei; Gong Changde
2011-01-01
We consider the tight-binding models of electrons on a two-dimensional triangular lattice and kagome lattice under staggered modulated magnetic fields. Such fields have two components: a uniform-flux part with strength φ, and a staggered-flux part with strength Δφ. Various properties of the Hall conductances and Hofstadter butterflies are studied. When φ is fixed, variation of Δφ leads to the quantum Hall transitions and Chern numbers of Landau subbands being redistributed between neighboring pairs. The energy spectra with nonzero Δφs have similar fractal structures but quite different energy gaps compared with the original Hofstadter butterflies of Δφ = 0. Moreover, the fan-like structure of Landau levels in the low magnetic field region is also modified appreciably by Δφ.
Energy Technology Data Exchange (ETDEWEB)
Li Juan; Wang Yifei; Gong Changde, E-mail: yfwang_nju@hotmail.com [Center for Statistical and Theoretical Condensed Matter Physics, and Department of Physics, Zhejiang Normal University, Jinhua 321004 (China)
2011-04-20
We consider the tight-binding models of electrons on a two-dimensional triangular lattice and kagome lattice under staggered modulated magnetic fields. Such fields have two components: a uniform-flux part with strength {phi}, and a staggered-flux part with strength {Delta}{phi}. Various properties of the Hall conductances and Hofstadter butterflies are studied. When {phi} is fixed, variation of {Delta}{phi} leads to the quantum Hall transitions and Chern numbers of Landau subbands being redistributed between neighboring pairs. The energy spectra with nonzero {Delta}{phi}s have similar fractal structures but quite different energy gaps compared with the original Hofstadter butterflies of {Delta}{phi} = 0. Moreover, the fan-like structure of Landau levels in the low magnetic field region is also modified appreciably by {Delta}{phi}.
Experimental test of 200 W Hall thruster with titanium wall
Ding, Yongjie; Sun, Hezhi; Peng, Wuji; Xu, Yu; Wei, Liqiu; Li, Hong; Li, Peng; Su, Hongbo; Yu, Daren
2017-05-01
We designed a 200 W Hall thruster based on the technology of pushing down a magnetic field with two permanent magnetic rings. Boron nitride (BN) is an important insulating wall material for Hall thrusters. The discharge characteristics of the designed Hall thruster were studied by replacing BN with titanium (Ti). Experimental results show that the designed Hall thruster can discharge stably for a long time under a Ti channel. Experiments were performed to determine whether the channel and cathode are electrically connected. When the channel wall and cathode are insulated, the divergence angle of the plume increases, but the performance of the Hall thruster is improved in terms of thrust, specific impulse, anode efficiency, and thrust-to-power ratio. Ti exhibits a powerful antisputtering capability, a low emanation rate of gas, and a large structural strength, making it a potential candidate wall material in the design of low-power Hall thrusters.
Composite fermions in the quantum Hall effect
International Nuclear Information System (INIS)
Johnson, B.L.; Kirczenow, G.
1997-01-01
The quantum Hall effect and associated quantum transport phenomena in low-dimensional systems have been the focus of much attention for more than a decade. Recent theoretical development of interesting quasiparticles - 'composite fermions' - has led to significant advances in understanding and predicting the behaviour of two-dimensional electron systems under high transverse magnetic fields. Composite fermions may be viewed as fermions carrying attached (fictitious) magnetic flux. Here we review models of the integer and fractional quantum Hall effects, including the development of a unified picture of the integer and fractional effects based upon composite fermions. The composite fermion picture predicts remarkable new physics: the formation of a Fermi surface at high magnetic fields, and anomalous ballistic transport, thermopower, and surface acoustic wave behaviour. The specific theoretical predictions of the model, as well as the body of experimental evidence for these phenomena are reviewed. We also review recent edge-state models for magnetotransport in low-dimensional devices based on the composite fermion picture. These models explain the fractional quantum Hall effect and transport phenomena in nanoscale devices in a unified framework that also includes edge state models of the integer quantum Hall effect. The features of the composite fermion edge-state model are compared and contrasted with those of other recent edge-state models of the fractional quantum Hall effect. (author)
Magnetic Measurements of the Background Field in the Undulator Hall
International Nuclear Information System (INIS)
Fisher, Andrew
2010-01-01
The steel present in the construction of the undulator hall facility has the potential for changing the ambient fields present in the undulator hall. This note describes a measurement done to make a comparison between the fields in the hall and in the Magnetic Measurement Facility. In order for the undulators to have the proper tuning, the background magnetic field in the Undulator Hall should agree with the background field in the Magnetic Measurements Facility within .5 gauss. In order to verify that this was the case measurements were taken along the length of the undulator hall, and the point measurements were compared to the mean field which was measured on the MMF test bench.
Energy Technology Data Exchange (ETDEWEB)
WEST,WP; BURRELL,KH; deGRASSIE,JS; DOYLE,EJ; GREENFIELD,CM; LASNIER,CJ; SNYDER,PB; ZENG,L
2003-08-01
OAK-B135 The quiescent H-mode (QH-mode) is an ELM-free and stationary state mode of operation discovered on DIII-D. This mode achieves H-mode levels of confinement and pedestal pressure while maintaining constant density and radiated power. The elimination of edge localized modes (ELMs) and their large divertor loads while maintaining good confinement and good density control is of interest to next generation tokamaks. This paper reports on the correlations found between selected parameters in a QH-mode database developed from several hundred DIII-D counter injected discharges. Time traces of key plasma parameters from a QH-mode discharge are shown. On DIII-D the negative going plasma current (a) indicates that the beam injection direction is counter to the plasma current direction, a common feature of all QH-modes. The D{sub {alpha}} time behavior (c) shows that soon after high powered beam heating (b) is applied, the discharge makes a transition to ELMing H-mode, then the ELMs disappear, indicating the start of the QH period that lasts for the remainder of the high power beam heating (3.5 s). Previously published work showing density and temperature profiles indicates that long-pulse, high-triangularity QH discharges develop an internal transport barrier in combination with the QH edge barrier. These discharges are known as quiescent, double-barrier discharges (QDB). The H-factor (d) and stored energy (c) rise then saturate at a constant level and the measured axial and minimum safety factors remain above 1.0 for the entire QH duration. During QDB operation the performance of the plasma can be very good, with {beta}{sub N}*H{sub 89L} product reaching 7 for > 10 energy confinement times. These discharges show promise that a stationary state can be achieved.
International Nuclear Information System (INIS)
WEST, WP; BURRELL, KH; DeGRASSIE, JS; DOYLE, EJ; GREENFIELD, CM; LASNIER, CJ; SNYDER, PB; ZENG, L.
2003-01-01
OAK-B135 The quiescent H-mode (QH-mode) is an ELM-free and stationary state mode of operation discovered on DIII-D. This mode achieves H-mode levels of confinement and pedestal pressure while maintaining constant density and radiated power. The elimination of edge localized modes (ELMs) and their large divertor loads while maintaining good confinement and good density control is of interest to next generation tokamaks. This paper reports on the correlations found between selected parameters in a QH-mode database developed from several hundred DIII-D counter injected discharges. Time traces of key plasma parameters from a QH-mode discharge are shown. On DIII-D the negative going plasma current (a) indicates that the beam injection direction is counter to the plasma current direction, a common feature of all QH-modes. The D α time behavior (c) shows that soon after high powered beam heating (b) is applied, the discharge makes a transition to ELMing H-mode, then the ELMs disappear, indicating the start of the QH period that lasts for the remainder of the high power beam heating (3.5 s). Previously published work showing density and temperature profiles indicates that long-pulse, high-triangularity QH discharges develop an internal transport barrier in combination with the QH edge barrier. These discharges are known as quiescent, double-barrier discharges (QDB). The H-factor (d) and stored energy (c) rise then saturate at a constant level and the measured axial and minimum safety factors remain above 1.0 for the entire QH duration. During QDB operation the performance of the plasma can be very good, with β N *H 89L product reaching 7 for > 10 energy confinement times. These discharges show promise that a stationary state can be achieved
Transmutation of skyrmions to half-solitons driven by the nonlinear optical spin Hall effect.
Flayac, H; Solnyshkov, D D; Shelykh, I A; Malpuech, G
2013-01-04
We show that the spin domains, generated in the linear optical spin Hall effect by the analog of spin-orbit interaction for exciton polaritons, are associated with the formation of a Skyrmion lattice. In the nonlinear regime, the spin anisotropy of the polariton-polariton interactions results in a spatial compression of the domains and in a transmutation of the Skyrmions into oblique half-solitons. This phase transition is associated with both the focusing of the spin currents and the emergence of a strongly anisotropic emission pattern.
Interfacial scattering effect on anomalous Hall effect in Ni/Au multilayers
Zhang, Qiang
2017-04-21
The effect of interfacial scattering on anomalous Hall effect (AHE) was studied in the ${{\\\\left(\\\\text{N}{{\\\\text{i}}_{\\\\frac{36}{n}~\\\\text{nm}}}/\\\\text{A}{{\\\\text{u}}_{\\\\frac{12}{n}~\\\\text{nm}}}\\ ight)}_{n}}$ multilayers. Field-dependent Hall resistivity was measured in the temperature range of 5–300 K with the magnetic field up to 50 kOe. The anomalous Hall resistivity (${{\\ ho}_{\\\\text{AHE}}}$ ) was enhanced by more than six times at 5 K from n = 1 to n = 12 due to the increased interfacial scattering, whereas the longitudinal resistivity (${{\\ ho}_{xx}}$ ) was increased nearly three times. A scaling relation ${{\\ ho}_{\\\\text{AHE}}}\\\\sim \\ ho _{xx}^{\\\\gamma}$ with $\\\\gamma =1.85$ was obtained for ${{\\ ho}_{\\\\text{AHE}}}$ and ${{\\ ho}_{xx}}$ measured at 5 K, indicating that the dominant mechanism(s) of the AHE in these multilayers should be side-jump or/and intrinsic in nature. The new scaling relation ${{\\ ho}_{\\\\text{AHE}}}=\\\\alpha {{\\ ho}_{xx0}}+\\\\beta \\ ho _{xx0}^{2}+b\\ ho _{xx}^{2}$ (Tian et al 2009 Phys. Rev. Lett. 103 087206) has been applied to our data to identify the origin of the AHE in this type of multilayer.
Trends in preference, programming and design of concert halls for symphonic music
DEFF Research Database (Denmark)
Gade, Anders Christian
2008-01-01
This paper discusses the evolution in taste regarding concert hall acoustics and how this can be reflected in the new halls being built today. The clients' and listener's preferences are not only based on listening in existing halls; but also on listening to reproduced music recorded with microph......This paper discusses the evolution in taste regarding concert hall acoustics and how this can be reflected in the new halls being built today. The clients' and listener's preferences are not only based on listening in existing halls; but also on listening to reproduced music recorded...
Hall effect in organic layered conductors
Directory of Open Access Journals (Sweden)
R.A.Hasan
2006-01-01
Full Text Available The Hall effect in organic layered conductors with a multisheeted Fermi surfaces was considered. It is shown that the experimental study of Hall effect and magnetoresistance anisotropy at different orientations of current and a quantizing magnetic field relative to the layers makes it possible to determine the contribution of various charge carriers groups to the conductivity, and to find out the character of Fermi surface anisotropy in the plane of layers.
Shielding consideration for the SSCL experimental halls
International Nuclear Information System (INIS)
Bull, J.; Coyne, J.; Mokhov, N.; Stapleton, G.
1994-03-01
The Superconducting Super Collider which is being designed and built in Waxahachie, Texas consists Of series of proton accelerators, culminating in a 20 Te proton on proton collider. The collider will be in a tunnel which will be 87 km in circumference and. on average about 30 meters underground. The present design calls for two large interaction halls on the east side of the ring. The shielding for these halls is being designed for an interaction rate of 10 9 Hz or 10 16 interactions per year, based on 10 7 seconds per operational year. SSC guidelines require that the shielding be designed to meet the criterion of 1mSv per year for open areas off site 2mSv per year for open areas on site, and 2mSv per year for controlled areas. Only radiation workers will be routinely allowed to work in controlled areas. It should be pointed that there is a potential for an accidental full beam loss in either of the experimental halls, and this event would consist of the loss of the full circulating beam up to 4 x 10 14 protons. With the present design. the calculated dose equivalent for this event is about 10% of the annual dose equivalent for the normal p-p interactions, so that die accident condition does not control the shielding. If, for instance, local shielding within the experimental hall is introduced into the calculations, this could change. The shielding requirements presented here are controlled by the normal p-p interactions. Three important questions were addressed in the present calculations. They are (1) the thickness of the roof over the experimental halls, (2) the configuration of the shafts and adits which give access to the halls, and (3) the problem of ground water and air activation
A survey study about what an exhibition hall of nuclear power station should be
International Nuclear Information System (INIS)
Tada, Yasuyuki; Hayashi, Chikio
2001-01-01
The exhibition hall of nuclear power station contributes to understand the visitors about organizations or safety systems through displays and explanations without difficulty. In addition to that, there will be some effect that they give informations to other people after the inspection, so the exhibition hall of nuclear power station plays a vital role of public information considering tens of thousands of yearly visitors. According to that, we made inquiries to the visitors and tried to search what it should be, intending to investigate their actual situation of attitudes or needs, and to accurate effectivities of the present displays in the center of explanations about the organization of nuclear power plant. As a result, the opinion that 'I want to know the organization of nuclear power plant' accounts over 60%, differing from other data of research. And also the opinion after the inspection that 'I am satisfied with acquiring knowledge about the organization' accounts nearly 60%, much higher compared with other choices. In view of these facts, the efficiency of the exhibition hall was certified. The visitor's attitudes of nuclear power is more affirmative than public's one. Even though considering the differences of the survey method, there must be a difference from the first. Besides that, we gained a discernment that educational functions is important through researches for other company. (author)
A survey study about what an exhibition hall of nuclear power station should be
Energy Technology Data Exchange (ETDEWEB)
Tada, Yasuyuki [Institute of Nuclear Safety System Inc., Mihama, Fukui (Japan); Hayashi, Chikio [Institute of Statistical Methematics, Tokyo (Japan)
2001-09-01
The exhibition hall of nuclear power station contributes to understand the visitors about organizations or safety systems through displays and explanations without difficulty. In addition to that, there will be some effect that they give informations to other people after the inspection, so the exhibition hall of nuclear power station plays a vital role of public information considering tens of thousands of yearly visitors. According to that, we made inquiries to the visitors and tried to search what it should be, intending to investigate their actual situation of attitudes or needs, and to accurate effectivities of the present displays in the center of explanations about the organization of nuclear power plant. As a result, the opinion that 'I want to know the organization of nuclear power plant' accounts over 60%, differing from other data of research. And also the opinion after the inspection that 'I am satisfied with acquiring knowledge about the organization' accounts nearly 60%, much higher compared with other choices. In view of these facts, the efficiency of the exhibition hall was certified. The visitor's attitudes of nuclear power is more affirmative than public's one. Even though considering the differences of the survey method, there must be a difference from the first. Besides that, we gained a discernment that educational functions is important through researches for other company. (author)
Nonadiabatic effects in the Quantum Hall regime
International Nuclear Information System (INIS)
Page, D.A.; Brown, E.
1993-01-01
The authors consider the effect of a finite electric field on the states of a Bloch electron in two dimensions, with a uniform magnetic field present. They make use of the concept of electric time translation symmetry and treat the electric and magnetic fields symmetrically in a time dependent formalism. In addition to a wave vector k, the states are characterized by a frequency specifying the behavior under electric time translations. An effective Hamiltonian is employed to obtain the splitting of an isolated Bloch band into open-quotes frequencyclose quotes subbands. The time-averaged velocity and energy of the states are expressed in terms of the frequency dispersion. The relationship to the Stark ladder eigenstates in a scalar potential representation of the electric field is examined. This is seen to justify the use of the averaged energy in determining occupation of the states. In the weak electric field (adiabatic) limit, an expression is recovered for the quantized Hall conductivity of a magnetic subband as a topological invariant. A numerical procedure is outlined and results obtained over a range of electric field strengths. A transition between strong and weak field regimes is seen, with level repulsions between the frequencies playing an important role. The numerical results show how the magnetic subband structure and quantized Hall conductivity emerge as the electric field becomes weaker. In this regime, the behavior can be understood by comparison to the predictions of the adiabatic approximation. The latter predicts crossings in the frequencies at certain locations in wave vector space. Nonadiabatic effects are seen to produce gaps in the frequency spectrum at these locations. 35 refs., 14 figs
Intrinsic quantum anomalous hall effect in a two-dimensional anilato-based lattice.
Ni, Xiaojuan; Jiang, Wei; Huang, Huaqing; Jin, Kyung-Hwan; Liu, Feng
2018-06-13
Using first-principles calculations, we predict an intrinsic quantum anomalous Hall (QAH) state in a monolayer anilato-based metal-organic framework M2(C6O4X2)3 (M = Mn and Tc, X = F, Cl, Br and I). The spin-orbit coupling of M d orbitals opens a nontrivial band gap up to 18 meV at the Dirac point. The electron counting rule is used to explain the intrinsic nature of the QAH state. The calculated nonzero Chern number, gapless edge states and quantized Hall conductance all confirm the nontrivial topological properties in the anilato-based lattice. Our findings provide an organic materials platform for the realization of the QAH effect without the need for magnetic and charge doping, which are highly desirable for the development of low-energy-consumption spintronic devices.
Precision of single-engage micro Hall effect measurements
DEFF Research Database (Denmark)
Henrichsen, Henrik Hartmann; Hansen, Ole; Kjær, Daniel
2014-01-01
Recently a novel microscale Hall effect measurement technique has been developed to extract sheet resistance (RS), Hall sheet carrier density (NHS) and Hall mobility (μH) from collinear micro 4-point probe measurements in the vicinity of an insulating boundary [1]. The technique measures in less...... than a minute directly the local transport properties, which enables in-line production monitoring on scribe line test pads [2]. To increase measurement speed and reliability, a method in which 4-point measurements are performed using two different electrode pitches has been developed [3......]. In this study we calculate the measurement error on RS, NHS and μH resulting from electrode position errors, probe placement, sample size and Hall signal magnitude. We show the relationship between measurement precision and electrode pitch, which is important when down-scaling the micro 4-point probe to fit...
Localization in a quantum spin Hall system.
Onoda, Masaru; Avishai, Yshai; Nagaosa, Naoto
2007-02-16
The localization problem of electronic states in a two-dimensional quantum spin Hall system (that is, a symplectic ensemble with topological term) is studied by the transfer matrix method. The phase diagram in the plane of energy and disorder strength is exposed, and demonstrates "levitation" and "pair annihilation" of the domains of extended states analogous to that of the integer quantum Hall system. The critical exponent nu for the divergence of the localization length is estimated as nu congruent with 1.6, which is distinct from both exponents pertaining to the conventional symplectic and the unitary quantum Hall systems. Our analysis strongly suggests a different universality class related to the topology of the pertinent system.
Watanabe, Miteki; Mizoguchi, Midori; Aoki, Hajime; Iwao, Yasunori; Noguchi, Shuji; Itai, Shigeru
2016-10-15
The phase transition of active pharmaceutical ingredients should be taken into account during manufacturing, processing- and storage, because different crystal forms lead to different physical properties of formulations. The phase transition of clarithromycin (CAM) metastable form I to stable form II was investigated on heating with additives such as fatty acids or fatty acid esters. Differential scanning calorimetry analyses revealed that when form I was heated with additives, the phase transition temperature of form I decreased close to the melting points of the additives. Powder X-ray diffraction analyses indicated the tentative presence of a non-crystalline component during the transition of form I to form II on heating with additives. These observations implied that CAM form I dissolved in the melted additives on heating and the dissolved CAM crystallized to form II. Reduction of transition temperatures in the presence of additives were also observed for the crystals of nifedipine form B and carbamazepine form III. These results suggested that the phenomena can be widely applicable for simultaneous crystalline phase transition and granulation using binder additives. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kaschek, K.; Ernst, G.K.; Boetticher, W.
1984-01-01
Absolute transition probabilities of nine 5s-5p transitions of Kr I have been evaluated by using the hook method. The plasma was produced in a shock tube. The population density of the 5s-levels was calculated, under the assumption of LTE, from the electron density and the ground state number measured by means of a dual wavelength interferometer. An evaluation is given which proves the validity of the LTE assumption. (orig.)
Theoretical calculation of the Hall mobility of InNxAs1−x alloys when ...
Indian Academy of Sciences (India)
These ternary alloys are used for manufacturing infrared detectors, gas sensors and the ... of carrier concentration, the temperature dependence of Hall mobility was ..... [17] T D Veal, L F J Piper, P H Jefferson, I Mahboob, C F McConville, ...
Topological superconductivity, topological confinement, and the vortex quantum Hall effect
International Nuclear Information System (INIS)
Diamantini, M. Cristina; Trugenberger, Carlo A.
2011-01-01
Topological matter is characterized by the presence of a topological BF term in its long-distance effective action. Topological defects due to the compactness of the U(1) gauge fields induce quantum phase transitions between topological insulators, topological superconductors, and topological confinement. In conventional superconductivity, because of spontaneous symmetry breaking, the photon acquires a mass due to the Anderson-Higgs mechanism. In this paper we derive the corresponding effective actions for the electromagnetic field in topological superconductors and topological confinement phases. In topological superconductors magnetic flux is confined and the photon acquires a topological mass through the BF mechanism: no symmetry breaking is involved, the ground state has topological order, and the transition is induced by quantum fluctuations. In topological confinement, instead, electric charge is linearly confined and the photon becomes a massive antisymmetric tensor via the Stueckelberg mechanism. Oblique confinement phases arise when the string condensate carries both magnetic and electric flux (dyonic strings). Such phases are characterized by a vortex quantum Hall effect potentially relevant for the dissipationless transport of information stored on vortices.
Control of the electric-field profile in the Hall thruster
International Nuclear Information System (INIS)
Fruchtman, A.; Fisch, N.J.; Raitses, Y.
2001-01-01
Control of the electric-field profile in the Hall thruster through the positioning of an additional electrode along the channel is shown theoretically to enhance the efficiency. The reduction of the potential drop near the anode by use of the additional electrode increases the plasma density there, through the increase of the electron and ion transit times, causing the ionization in the vicinity of the anode to increase. The resulting separation of the ionization and acceleration regions increases the propellant and energy utilizations. An abrupt sonic transition is forced to occur at the axial location of the additional electrode, accompanied by the generation of a large (theoretically infinite) electric field. This ability to generate a large electric field at a specific location along the channel, in addition to the ability to specify the electric potential there, allows us further control of the electric-field profile in the thruster. In particular, when the electron temperature is high, a large abrupt voltage drop is induced at the vicinity of the additional electrode, a voltage drop that can comprise a significant part of the applied voltage
Maximilien Brice
2011-01-01
4 August 2011 - Austrian Head of Protocol, Directorate General III, Federal Ministry of Science and Research I. Friedrich (3rd from left) in the LHC superconducting magnet test hall with M. Benedkit, C. Wulz and C. Fabjan.
Observation of the anomalous Hall effect in GaAs
International Nuclear Information System (INIS)
Miah, M Idrish
2007-01-01
Devices for the direct detection of the spin current, based on the anomalous Hall effect (AHE), are fabricated on n-type GaAs bulk semiconductor materials. The AHE is observed in the device when the photoinduced spin-polarized electrons are injected into it, and it is found that the effect depends on the applied electric field. The origin of the field-dependent observed Hall effect is discussed based on the D'yakonov-Perel' (DP) spin relaxation mechanism. The spin-dependent Hall effect is also found to be enhanced with increasing doping concentration. The present experimental results might have potential applications in semiconductor spintronic devices since the effect is closely related to the spin Hall effect
Observation of the anomalous Hall effect in GaAs
Energy Technology Data Exchange (ETDEWEB)
Miah, M Idrish [Nanoscale Science and Technology Centre, School of Science, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong, Chittagong - 4331 (Bangladesh)
2007-03-21
Devices for the direct detection of the spin current, based on the anomalous Hall effect (AHE), are fabricated on n-type GaAs bulk semiconductor materials. The AHE is observed in the device when the photoinduced spin-polarized electrons are injected into it, and it is found that the effect depends on the applied electric field. The origin of the field-dependent observed Hall effect is discussed based on the D'yakonov-Perel' (DP) spin relaxation mechanism. The spin-dependent Hall effect is also found to be enhanced with increasing doping concentration. The present experimental results might have potential applications in semiconductor spintronic devices since the effect is closely related to the spin Hall effect.
Can Hall drag be observed in Coulomb coupled quantum wells in a magnetic field?
DEFF Research Database (Denmark)
Hu, Ben Yu-Kuang
1997-01-01
We study the transresistivity rho(21) (or equivalently, the drag rate) of two Coulomb-coupled quantum wells in the presence of a perpendicular magnetic field, using semi-classical transport theory. Elementary arguments seem to preclude any possibility of observation of ''Hall drag'' (i.e., a non...
Quantum Hall Ferroelectrics and Nematics in Multivalley Systems
Sodemann, Inti; Zhu, Zheng; Fu, Liang
2017-10-01
We study broken symmetry states at integer Landau-level fillings in multivalley quantum Hall systems whose low-energy dispersions are anisotropic. When the Fermi surface of individual pockets lacks twofold rotational symmetry, like in bismuth (111) [Feldman et al. , Observation of a Nematic Quantum Hall Liquid on the Surface of Bismuth, Science 354, 316 (2016), 10.1126/science.aag1715] and in Sn1 -xPbxSe (001) [Dziawa et al., Topological Crystalline Insulator States in Pb1 -xSnxSe , Nat. Mater. 11, 1023 (2012), 10.1038/nmat3449] surfaces, interactions tend to drive the formation of quantum Hall ferroelectric states. We demonstrate that the dipole moment in these states has an intimate relation to the Fermi surface geometry of the parent metal. In quantum Hall nematic states, like those arising in AlAs quantum wells, we demonstrate the existence of unusually robust Skyrmion quasiparticles.
A Novel Hall Effect Sensor Using Elaborate Offset Cancellation Method
Directory of Open Access Journals (Sweden)
Vlassis N. Petoussis
2009-01-01
Full Text Available The Hall effect is caused by a traverse force that is formed in the electrons or holes of metal element or semiconductor when are polarized by current source and simultaneously all the system it is found vertical in external magnetic field. Result is finally the production of difference of potential (Hall voltage in address vertical in that of current and magnetic field directions. In the present work is presented a new Hall sensor exploiting the former operation. In combination with his pioneering form and using dynamic spinning current technique with an elaborate sequence, it leads to satisfactory results of produced Hall voltage with small noise in a presence of external magnetic field. Anyone can see both the spinning current and anti-Hall technique in the same sensor simultaneously.
Paraconductivity and excess Hall effect of YBa2Cu3Ox thin films
International Nuclear Information System (INIS)
Gueffaf, A.
2001-10-01
and a new substrate heater which can operate reliably in air, vacuum and highly oxidizing atmospheres was built. It has been used routinely and successfully to provide substrate temperature of up to 750 deg C with 200 W power input. The paraconductivity of a number of c-axis-oriented YBa 2 Cu 3 O x thin films, with a range of c-axis lattice parameters and T c -values, was determined as a function of temperature and analyzed in terms of the paraconductivity due to direct and indirect fluctuations contributions. Results are presented for the c-axis coherence length and the phase-relaxation time at 100 K obtained from the fit to the paraconductivity data. The paraconductivity results for optimum doped films were: c-axis coherence length: ξ c (0)=1.25 A; pair breaking parameter: δ=0.05; phase-relaxation time at 100 K: τ φ =0.066 ps; and two-three dimensional crossover temperature: T + =96.6 K. These values are in good agreement with those from other published work. There was considerable scatter in the coherence length and phase relaxation time for films with different critical temperatures and oxygen contents. These results were process dependent but appear to be related to the 60 K phase transition in the T c -x phase diagram. This is reported for the first time. The excess Hall effect of a number of c-axis oriented YBa 2 Cu 3 O x thin films, with a range of T c values, was determined as a function of temperature and analysed in terms of excess Hall effect theories for the direct and indirect fluctuations of the order parameter. Results are presented for the electron-hole asymmetry parameter obtained from the fit to the excess Hall effect data. For all samples studied, β is negative and has a small magnitude, as a result, the fluctuation Hall conductivity are dominated by the Maki-Thompson (MT) process rather than the Aslamazov-Lark in (Al) process. We generally observe that the Aslamazov-Larkin (AL) contribution to the excess Hall effect is negative close to T c
Digital technology impacts on the Arnhem transfer hall structural design
Van de Straat, R.; Hofman, S.; Coenders, J.L.; Paul, J.C.
2015-01-01
The new Transfer Hall in Arnhem is one of the key projects to prepare the Dutch railways for the increased future demands for capacity. UNStudio developed a master plan in 1996 for the station area of which the completion of the Transfer Hall in 2015 will be a final milestone. The Transfer Hall is a
Energy Technology Data Exchange (ETDEWEB)
Demko, L.; Tokura, Y. [Multiferroics Project, ERATO, JST, c/o Department of Applied Physics, University of Tokyo (Japan); Schober, G.A.H. [Institute for Theoretical Physics, University of Heidelberg (Germany); Kocsis, V.; Kezsmarki, I. [Department of Physics, Budapest University of Technology and Economics and Condensed Matter Research Group of the Hungarian Academy of Sciences (Hungary); Bahramy, M.S.; Murakawa, H. [CMRG and CERG, RIKEN ASI (Japan); Lee, J.S.; Arita, R.; Nagaosa, N. [Department of Applied Physics, University of Tokyo (Japan)
2013-07-01
We study the magneto-optical (MO) response of the polar semiconducting BiTeI with giant bulk Rashba spin splitting at various carrier densities. Despite being nonmagnetic, the material is found to yield a huge MO activity in the infrared region under moderate magnetic fields (up to 3 T). Our first-principles calculations show that the enhanced MO response of BiTeI comes mainly from the intraband transitions between the Rashba-split bulk conduction bands. These transitions connecting electronic states with opposite spin directions become active due to the presence of strong spin-orbit interaction and give rise to distinct features in the MO spectra with a systematic doping dependence. We predict an even more pronounced enhancement in the low-energy MO response and dc Hall effect near the crossing (Dirac) point of the conduction bands.
Acoustic investigations of concert halls for rock music
DEFF Research Database (Denmark)
Adelman-Larsen, Niels Werner; Thompson, Eric Robert; Gade, Anders Christian
2007-01-01
Objective measurement data and subjective evaluations have been collected from 20 small-/medium-sized halls in Denmark used for amplified rhythmic music concerts (pop, rock, jazz). The purpose of the study was to obtain knowledge about optimum acoustic conditions for this type of hall. The study...... is motivated by the fact that most concert tickets sold in Denmark relate to concerts within these genres in this kind of venue. The subjective evaluations were carried out by professional musicians and sound engineers who responded on the basis of their experiences working in these (and other) halls. From...
Heng, Boon Chin; Richards, Mark; Ge, Zigang; Shu, Yimin
2010-02-01
The successful derivation of iPSC lines effectively demonstrates that it is possible to reset the 'developmental clock' of somatic cells all the way back to the initial embryonic state. Hence, it is plausible that this clock may instead be turned back half-way to a less immature developmental stage that is more directly applicable to clinical therapeutic applications or for in vitro pharmacology/toxicology screening assays. Such a suitable developmental state is postulated to be either the putative transit amplifying progenitor stage or adult stem cell stage. It is hypothetically possible to reprogram mature and terminally differentiated somatic cells back to the adult stem cell or transit amplifying progenitor stage, in a manner similar to the derivation of iPSC. It is proposed that the terminology 'Induced Adult Stem Cells' (iASC) or 'Induced Transit Amplifying Progenitor Cells' (iTAPC) be used to described such reprogrammed somatic cells. Of particular interest, is the possibility of resetting the developmental clock of mature differentiated somatic cells of the mesenchymal lineage, explanted from adipose tissue, bone marrow and cartilage. The putative adult stem cell sub-population from which these cells are derived, commonly referred to as 'mesenchymal stem cells', are highly versatile and hold much therapeutic promise in regenerative medicine, as attested to by numerous human clinical trials and animal studies. Perhaps it may be appropriate to term such reprogrammed cells as 'Induced Mesenchymal Stem Cells' (iMSC) or as 'Induced Mesenchumal Progenitor Cells' (iMPC). Given that cells from the same organ/tissue will share some commonalities in gene expression, we hypothesize that the generation of iASC or iTAPC would be more efficient as compared to iPSC generation, since a common epigenetic program must exist between the reprogrammed cells, adult stem cell or progenitor cell types and terminally differentiated cell types from the same organ/tissue.
Phase Transitions of the Polariton Condensate in 2D Dirac Materials.
Lee, Ki Hoon; Lee, Changhee; Min, Hongki; Chung, Suk Bum
2018-04-13
For the quantum well in an optical microcavity, the interplay of the Coulomb interaction and the electron-photon (e-ph) coupling can lead to the hybridizations of the exciton and the cavity photon known as polaritons, which can form the Bose-Einstein condensate above a threshold density. Additional physics due to the nontrivial Berry phase comes into play when the quantum well consists of the gapped two-dimensional Dirac material such as the transition metal dichalcogenide MoS_{2} or WSe_{2}. Specifically, in forming the polariton, the e-ph coupling from the optical selection rule due to the Berry phase can compete against the Coulomb electron-electron (e-e) interaction. We find that this competition gives rise to a rich phase diagram for the polariton condensate involving both topological and symmetry breaking phase transitions, with the former giving rise to the quantum anomalous Hall and the quantum spin Hall phases.
Phase Transitions of the Polariton Condensate in 2D Dirac Materials
Lee, Ki Hoon; Lee, Changhee; Min, Hongki; Chung, Suk Bum
2018-04-01
For the quantum well in an optical microcavity, the interplay of the Coulomb interaction and the electron-photon (e -ph) coupling can lead to the hybridizations of the exciton and the cavity photon known as polaritons, which can form the Bose-Einstein condensate above a threshold density. Additional physics due to the nontrivial Berry phase comes into play when the quantum well consists of the gapped two-dimensional Dirac material such as the transition metal dichalcogenide MoS2 or WSe2 . Specifically, in forming the polariton, the e -ph coupling from the optical selection rule due to the Berry phase can compete against the Coulomb electron-electron (e -e ) interaction. We find that this competition gives rise to a rich phase diagram for the polariton condensate involving both topological and symmetry breaking phase transitions, with the former giving rise to the quantum anomalous Hall and the quantum spin Hall phases.
Spin Hall effect on a noncommutative space
International Nuclear Information System (INIS)
Ma Kai; Dulat, Sayipjamal
2011-01-01
We study the spin-orbital interaction and the spin Hall effect of an electron moving on a noncommutative space under the influence of a vector potential A(vector sign). On a noncommutative space, we find that the commutator between the vector potential A(vector sign) and the electric potential V 1 (r(vector sign)) of the lattice induces a new term, which can be treated as an effective electric field, and the spin Hall conductivity obtains some correction. On a noncommutative space, the spin current and spin Hall conductivity have distinct values in different directions, and depend explicitly on the noncommutative parameter. Once this spin Hall conductivity in different directions can be measured experimentally with a high level of accuracy, the data can then be used to impose bounds on the value of the space noncommutativity parameter. We have also defined a new parameter, σ=ρθ (ρ is the electron concentration, θ is the noncommutativity parameter), which can be measured experimentally. Our approach is based on the Foldy-Wouthuysen transformation, which gives a general Hamiltonian of a nonrelativistic electron moving on a noncommutative space.
National Aeronautics and Space Administration — I propose to investigate the newly discovered oscillation modes specific to Magnetically Shied (MS) Hall Effect Thrusters (HET). Although HETs are classified as a...
Hole mobilities and the effective Hall factor in p-type GaAs
Wenzel, M.; Irmer, G.; Monecke, J.; Siegel, W.
1997-06-01
We prove the effective Hall factor in p-GaAs to be larger than values discussed in the literature up to now. The scattering rates for the relevant scattering mechanisms in p-GaAs have been recalculated after critical testing the existing models. These calculations allow to deduce theoretical drift and theoretical Hall mobilities as functions of temperature which can be compared with measured data. Theoretical Hall factors in the heavy and light hole bands and an effective Hall factor result. The calculated room temperature values of the drift mobility and of the effective Hall factor are 118 cm2/V s and 3.6, respectively. The fitted acoustic deformation potential E1=7.9 eV and the fitted optical coupling constant DK=1.24×1011 eV/m are close to values published before. It is shown that the measured strong dependence of the Hall mobility on the Hall concentration is not mainly caused by scattering by ionized impurities but by the dependence of the effective Hall factor on the hole concentration.
International Nuclear Information System (INIS)
Ishiyama, Toshio
1975-01-01
The geometrical isomers, cis-dichloro-trans-(methanol)(hydroquinone)(2,2'-bipyridine)ruthenium(II) and cis-dichloro-cis-(methanol)(hydroquinone)(2,2'-bipyridine)ruthenium(II), [RuCl 2 (MeOH)(QH 2 )bipy] (complex I and II), were synthesized by reduction and substitution reactions of [RuO 4 bipy] and [RuO 2 (OH) 2 bipy] with hydroquinone in hydrochloric acid solution, and methanol. cis-Chloro(hydroquinonato)bis(2,2'-bipyridine)ruthenium(II), cis-[RuCl(QH)(bipy) 2 ], was obtained from the substitution reaction of complex I or II with 2,2'-bipyridine in methanol, and cis-chloro(hydroquinone)bis(2,2'-bipyridine)ruthenium(II) chloride, cis-[RuCl(QH 2 )(bipy) 2 ]Cl, was also obtained from the substitution of cis-trans-[RuCl 2 (MeOH)(QH 2 )bipy] in methanol containing hydrochloric acid. cis-Dihydroxobis(2,2'-bipyridine)ruthenium(II), cis-[Ru(OH) 2 (bipy) 2 ], was obtained by heating an aqueous solution of cis-[RuCl(QH)(bipy) 2 ]. Trihydroxoaquo(1,10-phenanthroline)ruthenium(III), [Ru(OH) 3 (H 2 O)phen] was also synthesized from [RuO 3 phen] 2 O and [Ru(OH) 3 phen] 2 O by reduction reactions similar to those used for [RuCl 2 (MeOH)(QH 2 )bipy]. These complexes were characterized by the infrared, visible and ultraviolet absorption spectra, and also by polarographic and magnetic measurements. The structures are discussed. (auth.)
Evidence of a fractional quantum Hall nematic phase in a microscopic model
Regnault, N.; Maciejko, J.; Kivelson, S. A.; Sondhi, S. L.
2017-07-01
At small momenta, the Girvin-MacDonald-Platzman (GMP) mode in the fractional quantum Hall (FQH) effect can be identified with gapped nematic fluctuations in the isotropic FQH liquid. This correspondence would be exact as the GMP mode softens upon approach to the putative point of a quantum phase transition to a FQH nematic. Motivated by these considerations as well as by suggestive evidence of an FQH nematic in tilted field experiments, we have sought evidence of such a nematic FQHE in a microscopic model of interacting electrons in the lowest Landau level at filling factor 1/3. Using a family of anisotropic Laughlin states as trial wave functions, we find a continuous quantum phase transition between the isotropic Laughlin liquid and the FQH nematic. Results of numerical exact diagonalization also suggest that rotational symmetry is spontaneously broken, and that the phase diagram of the model contains both a nematic and a stripe phase.
Field theory approach to quantum hall effect
International Nuclear Information System (INIS)
Cabo, A.; Chaichian, M.
1990-07-01
The Fradkin's formulation of statistical field theory is applied to the Coulomb interacting electron gas in a magnetic field. The electrons are confined to a plane in normal 3D-space and also interact with the physical 3D-electromagnetic field. The magnetic translation group (MTG) Ward identities are derived. Using them it is shown that the exact electron propagator is diagonalized in the basis of the wave functions of the free electron in a magnetic field whenever the MTG is unbroken. The general tensor structure of the polarization operator is obtained and used to show that the Chern-Simons action always describes the Hall effect properties of the system. A general proof of the Streda formula for the Hall conductivity is presented. It follows that the coefficient of the Chern-Simons terms in the long-wavelength approximation is exactly given by this relation. Such a formula, expressing the Hall conductivity as a simple derivative, in combination with diagonal form of the full propagator allows to obtain a simple expressions for the filling factor and the Hall conductivity. Indeed, these results, after assuming that the chemical potential lies in a gap of the density of states, lead to the conclusion that the Hall conductivity is given without corrections by σ xy = νe 2 /h where ν is the filling factor. In addition it follows that the filling factor is independent of the magnetic field if the chemical potential remains in the gap. (author). 21 ref, 1 fig
Performance Comparison of Cross-Like Hall Plates with Different Covering Layers
Directory of Open Access Journals (Sweden)
Fei Lyu
2014-12-01
Full Text Available This paper studies the effects of the covering layers on the performance of a cross-like Hall plate. Three different structures of a cross-like Hall plate in various sizes are designed and analyzed. The Hall plate sensitivity and offset are characterized using a self-built measurement system. The effect of the P-type region over the active area on the current-related sensitivity is studied for different Hall plate designs. In addition, the correlation between the P-type covering layer and offset is analyzed. The best structure out of three designs is determined. Besides, a modified eight-resistor circuit model for the Hall plate is presented with improved accuracy by taking the offset into account.
Enhanced Performance of Cylindrical Hall Thrusters
International Nuclear Information System (INIS)
Raitses, Y.; Smirnov, A.; Fisch, N.J.
2007-01-01
The cylindrical thruster differs significantly in its underlying physical mechanisms from the conventional annular Hall thruster. It features high ionization efficiency, quiet operation, ion acceleration in a large volume-to-surface ratio channel, and performance comparable with the state-of-the-art conventional Hall thrusters. Very significant plume narrowing, accompanied by the increase of the energetic ion fraction and improvement of ion focusing, led to 50-60% increase of the thruster anode efficiency. These improvements were achieved by overrunning the discharge current in the magnetized thruster plasma
Theory of fractional quantum Hall effect
International Nuclear Information System (INIS)
Kostadinov, I.Z.
1984-09-01
A theory of the fractional quantum Hall effect is constructed by introducing 3-particle interactions breaking the symmetry for ν=1/3 according to a degeneracy theorem proved here. An order parameter is introduced and a gap in the single particle spectrum is found. The critical temperature, critical filling number and critical behaviour are determined as well as the Ginzburg-Landau equation coefficients. A first principle calculation of the Hall current is given. 3, 5, 7 electron tunneling and Josephson interference effects are predicted. (author)
International Nuclear Information System (INIS)
Kramer, T.
2006-01-01
I review some aspects of an alternative model of the quantum Hall effect, which is not based on the presence of disorder potentials. Instead, a quantization of the electronic drift current in the presence of crossed electric and magnetic fields is employed to construct a non-linear transport theory. Another important ingredient of the alternative theory is the coupling of the two-dimensional electron gas to the leads and the applied voltages. By working in a picture where the external voltages fix the chemical potential in the 2D subsystem, the experimentally observed linear relation between the voltage and the location of the quantum Hall plateaus finds an natural explanation. Also, the classical Hall effect emerges as a natural limit of the quantum Hall effect. For low temperatures (or high currents), a non-integer substructure splits higher Landau levels into sublevels. The appearance of substructure and non-integer plateaus in the resistivity is not linked to electron-electron interactions, but caused by the presence of a (linear) electric field. Some of the resulting fractions correspond exactly to half-integer plateaus. (Author)
Signatures of lattice geometry in quantum and topological Hall effect
International Nuclear Information System (INIS)
Göbel, Börge; Mook, Alexander; Mertig, Ingrid; Henk, Jürgen
2017-01-01
The topological Hall effect (THE) of electrons in skyrmion crystals (SkXs) is strongly related to the quantum Hall effect (QHE) on lattices. This relation suggests to revisit the QHE because its Hall conductivity can be unconventionally quantized. It exhibits a jump and changes sign abruptly if the Fermi level crosses a van Hove singularity. In this Paper, we investigate the unconventional QHE features by discussing band structures, Hall conductivities, and topological edge states for square and triangular lattices; their origin are Chern numbers of bands in the SkX (THE) or of the corresponding Landau levels (QHE). Striking features in the energy dependence of the Hall conductivities are traced back to the band structure without magnetic field whose properties are dictated by the lattice geometry. Based on these findings, we derive an approximation that allows us to determine the energy dependence of the topological Hall conductivity on any two-dimensional lattice. The validity of this approximation is proven for the honeycomb lattice. We conclude that SkXs lend themselves for experiments to validate our findings for the THE and—indirectly—the QHE. (paper)
Hall conductance and topological invariant for open systems.
Shen, H Z; Wang, W; Yi, X X
2014-09-24
The Hall conductivity given by the Kubo formula is a linear response of quantum transverse transport to a weak electric field. It has been intensively studied for quantum systems without decoherence, but it is barely explored for systems subject to decoherence. In this paper, we develop a formulism to deal with this issue for topological insulators. The Hall conductance of a topological insulator coupled to an environment is derived, the derivation is based on a linear response theory developed for open systems in this paper. As an application, the Hall conductance of a two-band topological insulator and a two-dimensional lattice is presented and discussed.
Determination of intrinsic spin Hall angle in Pt
Energy Technology Data Exchange (ETDEWEB)
Wang, Yi; Deorani, Praveen; Qiu, Xuepeng; Kwon, Jae Hyun; Yang, Hyunsoo, E-mail: eleyang@nus.edu.sg [Department of Electrical and Computer Engineering, National University of Singapore, 117576 (Singapore)
2014-10-13
The spin Hall angle in Pt is evaluated in Pt/NiFe bilayers by spin torque ferromagnetic resonance measurements and is found to increase with increasing the NiFe thickness. To extract the intrinsic spin Hall angle in Pt by estimating the total spin current injected into NiFe from Pt, the NiFe thickness dependent measurements are performed and the spin diffusion in the NiFe layer is taken into account. The intrinsic spin Hall angle of Pt is determined to be 0.068 at room temperature and is found to be almost constant in the temperature range of 13–300 K.
Determination of intrinsic spin Hall angle in Pt
International Nuclear Information System (INIS)
Wang, Yi; Deorani, Praveen; Qiu, Xuepeng; Kwon, Jae Hyun; Yang, Hyunsoo
2014-01-01
The spin Hall angle in Pt is evaluated in Pt/NiFe bilayers by spin torque ferromagnetic resonance measurements and is found to increase with increasing the NiFe thickness. To extract the intrinsic spin Hall angle in Pt by estimating the total spin current injected into NiFe from Pt, the NiFe thickness dependent measurements are performed and the spin diffusion in the NiFe layer is taken into account. The intrinsic spin Hall angle of Pt is determined to be 0.068 at room temperature and is found to be almost constant in the temperature range of 13–300 K.
Fast surface waves in an ideal Hall-magnetohydrodynamic plasma slab
International Nuclear Information System (INIS)
Zhelyazkov, I.; Debosscher, A.; Goossens, M.
1996-01-01
The propagation of fast sausage and kink magnetohydrodynamic (MHD) surface waves in an ideal magnetized plasma slab is studied taking into account the Hall term in the generalized Ohm close-quote s law. It is found that the Hall effect modifies the dispersion characteristics of MHD surface modes when the Hall term scaling length is not negligible (less than, but comparable to the slab thickness). The dispersion relations for both modes have been derived for parallel propagation (along the ambient equilibrium magnetic field lines).The Hall term imposes some limits on the possible wave number range. It turns out that the space distribution of almost all perturbed quantities in sausage and kink surface waves with Hall effect is rather complicated as compared to that of usual fast MHD surface waves. The applicability to solar wind aspects of the results obtained, is briefly discussed. copyright 1996 American Institute of Physics
Migrants and Their Experiences of Time: Edward T. Hall Revisited
Directory of Open Access Journals (Sweden)
Elisabeth Schilling
2009-01-01
Full Text Available In this paper we reassess the scientific heritage of Edward T. HALL and his contribution to the area of intercultural communication. The key objectives of our study are to demonstrate the applicability of HALL's theory of culture to empirical research and to establish its compatibility with other methods. Specifically, we propose that Alfred SCHÜTZ's phenomenology of sociality be taken as an extension to HALL. The connection between HALL and SCHÜTZ is made possible by the mutual emphases on the temporal dimension of culture and the temporal aspects of migration. With these foci we analyze six narratives by two groups of migrants: German and Russian. By combining HALL's theory of the cultural time with SCHÜTZ's phenomenological perspective on time and the Other and then applying them to empirical data, we show the terms in which different cultures experience time. URN: urn:nbn:de:0114-fqs0901357
Critical current in the Integral Quantum Hall Effect
International Nuclear Information System (INIS)
Kostadinov, I.Z.
1985-11-01
A multiparticle theory of the Integral Quantum Hall Effect (IQHE) was constructed operating with pairs wave function as an order parameter. The IQHE is described with bosonic macroscopic states while the fractional QHE with fermionic ones. The calculation of the critical current and Hall conductivity temperature dependence is presented. (author)
High temperature hall effect measurement system design, measurement and analysis
Berkun, Isil
-toxic thermoelectric materials made from abundant elements and are suited for power generation application in the intermediate temperature range of (600 K - 800 K). In this work the thermoelectric materials were synthesized by a solid-state reac- tion using a molten-salt sealing method. The ingots produced were then powder processed, followed by pulsed electric sintering (PECS) densification. A set of Mg2.08Si0.4--x Sn0.6Sbx (0 ≤ x ≤ 0.072) compounds were investigated and a peak ZT of 1.50 was obtained at 716 K in Mg2.08Si 0.364Sn0.6Sb0.036 [2]. The high ZT value is related to a high electrical conductivity in these samples, which are possibly caused by a magnesium deficiency in the final prod- uct. Analysis of the measured results using LabVIEW and MATLAB developed programs showed good agreement with expected results and gave insight on mixed carrier dopant concentrations. [1] I. Berkun, S. N. Demlow, N. Suwanmonkha, T. P. Hogan, and T. A. Grotjohn, "Hall Effect Measurement System for Characterization of Doped Single Crystal Diamond," in MRS Proceedings, vol. 1511, Cambridge Univ Press, 2013. [2] P. Gao, I. Berkun, R. D. Schmidt, M. F. Luzenski, X. Lu, P. B. Sarac, E. D. Case, and T. P. Hogan, "Transport and Mechanical Properties of High-ZT Mg2. 08si0. 4- x Sn0. 6sb x Thermoelectric Materials," Journal of Electronic Materials, pp. 1--14, 2013.
A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics.
Huang, Haiyun; Wang, Dejun; Xu, Yue
2015-10-27
This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS) technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.
A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics
Directory of Open Access Journals (Sweden)
Haiyun Huang
2015-10-01
Full Text Available This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.
Maximilien Brice
2002-01-01
Since 1992, after its move from the 600 MeV SC, ISOLDE is a customer of the Booster (then 1 GeV, now 1.4 GeV). The intense Booster beam (some 3E13 protons per pulse) is directed onto a target, from which a mixture of isotopes emanates. After ionization and electrostatic acceleration to 60 keV, they enter one of the 2 spectrometers (General Purpose Separator: GPS, and High Resolution Separator: HRS) from which the selected ions are directed to the experiments. The photos show: the REX-ISOLDE post accelerator; the mini-ball experiment; an overview of the ISOLDE hall. In the picture (_12) of the hall, the separators are behind the wall. From either of them, beams can be directed into any of the many beamlines towards the experiments, some of which are visible in the foreground. The elevated cubicle at the left is EBIS (Electron Beam Ion Source), which acts as a charge-state multiplier for the REX facility. The ions are further mass analzyzed and passed on to the linac which accelerates them to higher energies. T...
Modeling an Iodine Hall Thruster Plume in the Iodine Satellite (ISAT)
Choi, Maria
2016-01-01
An iodine-operated 200-W Hall thruster plume has been simulated using a hybrid-PIC model to predict the spacecraft surface-plume interaction for spacecraft integration purposes. For validation of the model, the plasma potential, electron temperature, ion current flux, and ion number density of xenon propellant were compared with available measurement data at the nominal operating condition. To simulate iodine plasma, various collision cross sections were found and used in the model. While time-varying atomic iodine species (i.e., I, I+, I2+) information is provided by HPHall simulation at the discharge channel exit, the molecular iodine species (i.e., I2, I2+) are introduced as Maxwellian particles at the channel exit. Simulation results show that xenon and iodine plasma plumes appear to be very similar under the assumptions of the model. Assuming a sticking coefficient of unity, iodine deposition rate is estimated.
International Nuclear Information System (INIS)
Lindelof, P.E.; Bruus, H.; Taboryski, R.; Soerensen, C.B.
1989-01-01
An inverted and a normal GaAs/AlGaAs interface grown back to back in a socalled selectively doped double heterostructure (SD DH) has been studied in magnetic fields up to 12 tesla and at temperatures down to 0.3 K. The longitudinal resistance goes to zero at minima of the Shubnikov-de Haas oscillations. The Hall resistivity is found to exhibit the quantum Hall effect. By etching the surface of the double heterostructure wafer we create an unbalance in the density of electrons in the two parallel two-dimensional electronic sheets. Although we in this way create only a modest change in the electron densities, we observe a significant change in the Shubnikov-de Haas oscillations, which can be interpreted as a beat between the oscillations of two electron layers with different densities. At the same time we observe a significant variation of the width of the quantum Hall steps. The most astonishing feature of our results is a clear quantum Hall plateou at 1/2 filling in each of the two parallel layers observed at temperatures below 1 K at a magnetic field above 10 T. Weak localization was also studied and such experiments are consistent with two parallel and independent two-dimensional electronic layers. (orig.)
.i.Utricularia./i. carnivory revisited: plants supply photosynthetic carbon to traps
Czech Academy of Sciences Publication Activity Database
Sirová, Dagmara; Borovec, Jakub; Šantrůčková, H.; Šantrůček, J.; Vrba, Jaroslav; Adamec, Lubomír
2010-01-01
Roč. 61, č. 1 (2010), s. 99-103 ISSN 0022-0957 R&D Projects: GA MZe(CZ) QH81012 Institutional research plan: CEZ:AV0Z60170517; CEZ:AV0Z60050516 Keywords : aquatic carnivorous plants * stable isotope labelling * carbon exudation * microbial community * Utricularia australis * Utricularia vulgaris Subject RIV: EH - Ecology, Behaviour Impact factor: 4.818, year: 2010
Prototype dining hall energy efficiency study
Energy Technology Data Exchange (ETDEWEB)
Mazzucchi, R.P.; Bailey, S.A.; Zimmerman, P.W.
1988-06-01
The energy consumption of food service facilities is among the highest of any commercial building type, owing to the special requirements for food preparation, sanitation, and ventilation. Consequently, the US Air Force Engineering and Services Center (AFESC) contracted with Pacific Northwest Laboratory (PNL) to collect and analyze end-use energy consumption data for a prototypical dining hall and make specific recommendations on cost-effective energy conservation options. This information will be used to establish or update criteria for dining hall designs and retrofits as appropriate. 6 refs., 21 figs., 23 tabs.
International Nuclear Information System (INIS)
Jager, K. de
2003-01-01
Proton knock-out is studied in a broad program in Hall A at Jefferson Lab. The first experiment performed in Hall A studied the 16 O(e,e'p) reaction. Since then proton knock-out experiments have studied a variety of aspects of that reaction, from single-nucleon properties to its mechanism, such as final-state interactions and two-body currents, in nuclei from 2 H to 16 O. In this review the accomplishments of this program will be summarized and an outlook given of expected future results. (orig.)
Quiescent H-mode operation using torque from non-axisymmetric, non-resonant magnetic fields
International Nuclear Information System (INIS)
Burrell, K.H.; Garofalo, A.M.; Osborne, T.H.; Snyder, P.B.; Solomon, W.M.; Park, J.-K.; Fenstermacher, M.E.; Orlov, D.M.
2013-01-01
Quiescent H-mode (QH-mode) sustained by magnetic torque from non-axisymmetric magnetic fields is a promising operating mode for future burning plasmas including ITER. Using magnetic torque from n = 3 fields to replace counter-I p torque from neutral beam injection, we have achieved long duration, counter-rotating QH-mode operation with neutral beam injection (NBI) torque ranging continuously from counter-I p up to co-I p values of about 1 N m. This co-I p torque is about 3 times the scaled torque that ITER will have. This range also includes operation at zero net NBI torque, applicable to rf wave heated plasmas. These n = 3 fields have been created using coils either inside or, most recently, outside the toroidal coils. Experiments utilized an ITER-relevant lower single-null plasma shape and were done with ITER-relevant values ν ped * ∼0.08, β T ped ∼ 1%$ and β N = 2. Discharges have confinement quality H 98y2 = 1.3, exceeding the value required for ITER. Initial work with low q 95 = 3.4 QH-mode plasmas transiently reached fusion gain values of G = β N H 89 /q 95 2 =0.4, which is the desired value for ITER; the limits on G have not yet been established. This paper also includes the most recent results on QH-mode plasmas run without n = 3 fields and with co-I p NBI; these shots exhibit co-I p plasma rotation and require NBI torque ⩾2 N m. The QH-mode work to date has made significant contact with theory. The importance of edge rotational shear is consistent with peeling–ballooning mode theory. We have seen qualitative and quantitative agreement with the predicted torque from neoclassical toroidal viscosity. (paper)
Energy Technology Data Exchange (ETDEWEB)
Tiwari, G.N. (Indian Inst. of Tech., New Delhi (India). Centre for Energy Studies); Lugani, N. (Indian Inst. of Tech., New Delhi (India). Centre for Energy Studies); Singh, A.K. (Indian Inst. of Tech., New Delhi (India). Centre for Energy Studies)
1993-01-01
In this communication, a design of a cinema hall suitable for climatic conditions in an arid zone has been presented. The various cooling techniques, namely evaporative cooling, wind tower, ventilation/infiltration and natural cooling, have been incorporated in the design to achieve thermal comfort during the period of operation. The design parameters have been optimized on the basis of numerical computations after establishing an energy balance for each component of a cinema hall. It is observed that cooling treatment, i.e., a wind tower with a cooling pool on the roof provides reasonable thermal comfort inside the enclosure. (orig.)
Sakai, Masamichi; Takao, Hiraku; Matsunaga, Tomoyoshi; Nishimagi, Makoto; Iizasa, Keitaro; Sakuraba, Takahito; Higuchi, Koji; Kitajima, Akira; Hasegawa, Shigehiko; Nakamura, Osamu; Kurokawa, Yuichiro; Awano, Hiroyuki
2018-03-01
We have proposed an enhancement mechanism of the Hall effect, the signal of which is amplified due to the generation of a sustaining mode of spin current. Our analytic derivations of the Hall resistivity revealed the conditions indispensable for the observation of the effect: (i) the presence of the transverse component of an effective electric field due to spin splitting in chemical potential in addition to the longitudinal component; (ii) the simultaneous presence of holes and electrons each having approximately the same characteristics; (iii) spin-polarized current injection from magnetized electrodes; (iv) the boundary condition for the transverse current (J c, y = 0). The model proposed in this study was experimentally verified by using van der Pauw-type Hall devices consisting of the nonmagnetic bipolar conductor YH x (x ≃ 2) and TbFeCo electrodes. Replacing Au electrodes with TbFeCo electrodes alters the Hall resistivity from the ordinary Hall effect to the anomalous Hall-like effect with an enhancement factor of approximately 50 at 4 T. We interpreted the enhancement phenomenon in terms of the present model.
Melinte, Sorin; Shayegan, Mansour; Bayot, Vincent
We review recent heat capacity and magnetotransport experiments on GaAs/AlGaAs heterostructures containing multilayer two-dimensional electron systems (2DESs) in the quantum Hall regime. Emphasis in this article is on the study of the heat capacity near Landau level filling factor ν=1. We also present a detailed survey of the development of the quantum Hall effect in tilted-magnetic fields for ν≲2. Among the novel phenomena we address is the strong coupling between the nuclear spins and the electrons associated with the spin phase transitions of the 2DES at ν=4/3 and near ν=1. To cite this article: S. Melinte et al., C. R. Physique 3 (2002) 667-676.
Bound values for Hall conductivity of heterogeneous medium under ...
Indian Academy of Sciences (India)
- ditions in inhomogeneous medium has been studied. It is shown that bound values for. Hall conductivity differ from bound values for metallic conductivity. This is due to the unusual character of current percolation under quantum Hall effect ...
Oguntoyinbo, Lekan
2011-01-01
Many urban and commuter universities have their sights set on students who are unlikely to connect with the college and likely to fail unless the right strategies are put in place to help them graduate. In efforts to improve retention rates, commuter colleges are looking to an unusual suspect: residence halls. The author discusses how these…
G. Stanley Hall, Child Study, and the American Public.
Young, Jacy L
2016-01-01
In the final decades of the 19th century psychologist Granville Stanley Hall was among the most prominent pedagogical experts in the nation. The author explores Hall's carefully crafted persona as an educational expert, and his engagements with the American public, from 1880 to 1900, arguably the height of his influence. Drawing from accounts of Hall's lecture circuit in the popular press, a map of his talks across the nation is constructed to assess the geographic scope of his influence. These talks to educators on the psychology underlying childhood and pedagogy, and his views and research on child life more generally, were regularly discussed in newspapers and popular periodicals. The venues in which Hall's ideas were disseminated, discussed, and in some cases, dismissed are described. His efforts to mobilize popular support for, and assistance with, his research endeavors in child study are also discussed. Such efforts were controversial both within the burgeoning field of psychology and among the public. Through his various involvements in pedagogy, and concerted efforts to engage with the American public, Hall helped establish psychology's relevance to parenting and educational practices.
Spin-Driven Emergent Antiferromagnetism and Metal-Insulator Transition in Nanoscale p-Si
Lou, Paul C.; Kumar, Sandeep
2018-04-01
The entanglement of the charge, spin and orbital degrees of freedom can give rise to emergent behavior especially in thin films, surfaces and interfaces. Often, materials that exhibit those properties require large spin orbit coupling. We hypothesize that the emergent behavior can also occur due to spin, electron and phonon interactions in widely studied simple materials such as Si. That is, large intrinsic spin-orbit coupling is not an essential requirement for emergent behavior. The central hypothesis is that when one of the specimen dimensions is of the same order (or smaller) as the spin diffusion length, then non-equilibrium spin accumulation due to spin injection or spin-Hall effect (SHE) will lead to emergent phase transformations in the non-ferromagnetic semiconductors. In this experimental work, we report spin mediated emergent antiferromagnetism and metal insulator transition in a Pd (1 nm)/Ni81Fe19 (25 nm)/MgO (1 nm)/p-Si (~400 nm) thin film specimen. The spin-Hall effect in p-Si, observed through Rashba spin-orbit coupling mediated spin-Hall magnetoresistance behavior, is proposed to cause the spin accumulation and resulting emergent behavior. The phase transition is discovered from the diverging behavior in longitudinal third harmonic voltage, which is related to the thermal conductivity and heat capacity.
Spin Hall Effect in Doped Semiconductor Structures
Tse, Wang-Kong; Das Sarma, Sankar
2006-03-01
We present a microscopic theory of the extrinsic spin Hall effect based on the diagrammatic perturbation theory. Side-jump (SJ) and skew-scattering (SS) contributions are explicitly taken into account to calculate the spin Hall conductivity, and we show their effects scale as σxy^SJ/σxy^SS ˜(/τ)/ɛF, where τ being the transport relaxation time. Motivated by recent experimental work we apply our theory to n-doped and p-doped 3D and 2D GaAs structures, obtaining analytical formulas for the SJ and SS contributions. Moreover, the ratio of the spin Hall conductivity to longitudinal conductivity is found as σs/σc˜10-3-10-4, in reasonable agreement with the recent experimental results of Kato et al. [Science 306, 1910 (2004)] in n-doped 3D GaAs system.
What is the Hallé? | Smith | Philosophical Papers
African Journals Online (AJOL)
The bulk of the paper examines the difficulty of reconciling the view that the Hallé is several individuals with two prima facie plausible theses about the manner of its persistence through time. The paper is structured around some remarks made by Peter Simons about groups, and the Hallé in particular, in his Parts.
Interaction Induced Quantum Valley Hall Effect in Graphene
Directory of Open Access Journals (Sweden)
E. C. Marino
2015-03-01
Full Text Available We use pseudo-quantum electrodynamics in order to describe the full electromagnetic interaction of the p electrons in graphene in a consistent 2D formulation. We first consider the effect of this interaction in the vacuum polarization tensor or, equivalently, in the current correlator. This allows us to obtain the T→0 conductivity after a smooth zero-frequency limit is taken in Kubo’s formula. Thereby, we obtain the usual expression for the minimal conductivity plus corrections due to the interaction that bring it closer to the experimental value. We then predict the onset of an interaction-driven spontaneous quantum valley Hall effect below an activation temperature of the order of 2 K. The transverse (Hall valley conductivity is evaluated exactly and shown to coincide with the one in the usual quantum Hall effect. Finally, by considering the effects of pseudo-quantum electrodynamics, we show that the electron self-energy is such that a set of P- and T-symmetric gapped electron energy eigenstates are dynamically generated, in association with the quantum valley Hall effect.
Hall effects and related phenomena in disordered Rashba 2DEG
International Nuclear Information System (INIS)
Inoue, Jun-ichiro; Kato, Takashi; Bauer, Gerrit E W; Molenkamp, Laurens W
2009-01-01
We review our recent work on the spin and anomalous Hall effects and other related phenomena caused by the intrinsic spin–orbit interaction. We focus our attention on disorder effects on these transport properties by adopting a model of a two-dimensional electron gas with a Rashba-type spin–orbit interaction. A spin-polarized model is adopted to calculate the anomalous Hall effect and anisotropic magnetoresistance. It is shown that the spin Hall conductivity in the ballistic transport regime is cancelled by the so-called vertex corrections for the disorder scattering, and that the anomalous Hall conductivity and anisotropic magnetoresistance vanish unless the lifetime is spin dependent. We further present results on spin accumulation under an electric field
Theory of the quantum hall effects in lattice systems
International Nuclear Information System (INIS)
Kliros, G.S.
1990-06-01
The Fractional Quantum Hall Effect is identified as an Integral Quantum Hall Effect of electrons on a lattice with an even number of statistical flux quanta. A variational wavefunction in terms of the Hofstadter lattice eigenstates is proposed. (author). 21 refs
Iodine Hall Thruster Propellant Feed System for a CubeSat
Polzin, Kurt A.
2014-01-01
There has been significant work recently in the development of iodine-fed Hall thrusters for in-space propulsion applications.1 The use of iodine as a propellant provides many advantages over present xenon-gas-fed Hall thruster systems. Iodine is a solid at ambient temperature (no pressurization required) and has no special handling requirements, making it safe for secondary flight opportunities. It has exceptionally high ?I sp (density times specific impulse), making it an enabling technology for small satellite near-term applications and providing system level advantages over mid-term high power electric propulsion options. Iodine provides thrust and efficiency that are comparable to xenonfed Hall thrusters while operating in the same discharge current and voltage regime, making it possible to leverage the development of flight-qualified xenon Hall thruster power processing units for the iodine application. Work at MSFC is presently aimed at designing, integrating, and demonstrating a flight-like iodine feed system suitable for the Hall thruster application. This effort represents a significant advancement in state-of-the-art. Though Iodine thrusters have demonstrated high performance with mission enabling potential, a flight-like feed system has never been demonstrated and iodine compatible components do not yet exist. Presented in this paper is the end-to-end integrated feed system demonstration. The system includes a propellant tank with active feedback-control heating, fill and drain interfaces, latching and proportional flow control valves (PFCV), flow resistors, and flight-like CubeSat power and control electronics. Hardware is integrated into a CubeSat-sized structure, calibrated and tested under vacuum conditions, and operated under under hot-fire conditions using a Busek BHT-200 thruster designed for iodine. Performance of the system is evaluated thorugh accurate measurement of thrust and a calibrated of mass flow rate measurement, which is a function of
Chemical properties of forest soils as affected by nests of .i.Myrmica ruginodis./i. (Formicidae)
Czech Academy of Sciences Publication Activity Database
Véle, A.; Frouz, Jan; Holuša, J.; Kalčík, Jiří
2010-01-01
Roč. 65, č. 1 (2010), s. 122-127 ISSN 0006-3088 R&D Projects: GA MZe(CZ) QH81136 Institutional research plan: CEZ:AV0Z60660521 Keywords : ant nests * Myrmica * soil chemical properties Subject RIV: EH - Ecology, Behaviour Impact factor: 0.609, year: 2010
International Nuclear Information System (INIS)
Xiu-Ming, Zhang; Yi-Shi, Duan
2010-01-01
In the light of the decomposition of the SU(2) gauge potential for I = 1/2, we obtain the SU(2) Chern-Simons current over S 4 , i.e. the vortex current in the effective field for the four-dimensional quantum Hall effect. Similar to the vortex excitations in the two-dimensional quantum Hall effect (2D FQH) which are generated from the zero points of the complex scalar field, in the 4D FQH, we show that the SU(2) Chern–Simons vortices are generated from the zero points of the two-component wave functions Ψ, and their topological charges are quantized in terms of the Hopf indices and Brouwer degrees of φ-mapping under the condition that the zero points of field Ψ are regular points. (condensed matter: electronicstructure, electrical, magnetic, and opticalproperties)
Laurent Guiraud
2000-01-01
General view of the Isotope-Separator On-Line (ISOLDE) hall. ISOLDE is dedicated to the production of a large variety of radioactive ion beams for many different experiments. Rare isotopes can be produced allowing the study of spectra for neutrino beam production.
Bulk Versus Edge in the Quantum Hall Effect
Kao, Y. -C.; Lee, D. -H.
1996-01-01
The manifestation of the bulk quantum Hall effect on edge is the chiral anomaly. The chiral anomaly {\\it is} the underlying principle of the ``edge approach'' of quantum Hall effect. In that approach, $\\sxy$ should not be taken as the conductance derived from the space-local current-current correlation function of the pure one-dimensional edge problem.
An evaluation of krypton propellant in Hall thrusters
Linnell, Jesse Allen
Due to its high specific impulse and low price, krypton has long sparked interest as an alternate Hall thruster propellant. Unfortunately at the moment, krypton's relatively poor performance precludes it as a legitimate option. This thesis presents a detailed investigation into krypton operation in Hall thrusters. These findings suggest that the performance gap can be decreased to 4% and krypton can finally become a realistic propellant option. Although krypton has demonstrated superior specific impulse, the xenon-krypton absolute efficiency gap ranges between 2 and 15%. A phenomenological performance model indicates that the main contributors to the efficiency gap are propellant utilization and beam divergence. Propellant utilization and beam divergence have relative efficiency deficits of 5 and 8%, respectively. A detailed characterization of internal phenomena is conducted to better understand the xenon-krypton efficiency gap. Krypton's large beam divergence is found to be related to a defocusing equipotential structure and a weaker magnetic field topology. Ionization processes are shown to be linked to the Hall current, the magnetic mirror topology, and the perpendicular gradient of the magnetic field. Several thruster design and operational suggestions are made to optimize krypton efficiency. Krypton performance is optimized for discharge voltages above 500 V and flow rates corresponding to an a greater than 0.015 mg/(mm-s), where alpha is a function of flow rate and discharge channel dimensions (alpha = m˙alphab/Ach). Performance can be further improved by increasing channel length or decreasing channel width for a given flow rate. Also, several magnetic field design suggestions are made to enhance ionization and beam focusing. Several findings are presented that improve the understanding of general Hall thruster physics. Excellent agreement is shown between equipotential lines and magnetic field lines. The trim coil is shown to enhance beam focusing
Magnetic field deformation due to electron drift in a Hall thruster
Directory of Open Access Journals (Sweden)
Han Liang
2017-01-01
Full Text Available The strength and shape of the magnetic field are the core factors in the design of the Hall thruster. However, Hall current can affect the distribution of static magnetic field. In this paper, the Particle-In-Cell (PIC method is used to obtain the distribution of Hall current in the discharge channel. The Hall current is separated into a direct and an alternating part to calculate the induced magnetic field using Finite Element Method Magnetics (FEMM. The results show that the direct Hall current decreases the magnetic field strength in the acceleration region and also changes the shape of the magnetic field. The maximum reduction in radial magnetic field strength in the exit plane is 10.8 G for an anode flow rate of 15 mg/s and the maximum angle change of the magnetic field line is close to 3° in the acceleration region. The alternating Hall current induces an oscillating magnetic field in the whole discharge channel. The actual magnetic deformation is shown to contain these two parts.
Current Percolation in Medium with Boundaries under Quantum Hall Effect Conditions
Directory of Open Access Journals (Sweden)
M. U. Malakeeva
2012-01-01
Full Text Available The current percolation has been considered in the medium with boundaries under quantum Hall effect conditions. It has been shown that in that case the effective Hall conductivity has a nonzero value due to percolation of the Hall current through the finite number of singular points (in our model these are corners at the phase joints.
Developments in Scanning Hall Probe Microscopy
Chouinard, Taras; Chu, Ricky; David, Nigel; Broun, David
2009-05-01
Low temperature scanning Hall probe microscopy is a sensitive means of imaging magnetic structures with high spatial resolution and magnetic flux sensitivity approaching that of a Superconducting Quantum Interference Device. We have developed a scanning Hall probe microscope with novel features, including highly reliable coarse positioning, in situ optimization of sensor-sample alignment and capacitive transducers for linear, long range positioning measurement. This has been motivated by the need to reposition accurately above fabricated nanostructures such as small superconducting rings. Details of the design and performance will be presented as well as recent progress towards time-resolved measurements with sub nanosecond resolution.
Fractional statistics and fractional quantized Hall effect
International Nuclear Information System (INIS)
Tao, R.; Wu, Y.S.
1985-01-01
The authors suggest that the origin of the odd-denominator rule observed in the fractional quantized Hall effect (FQHE) may lie in fractional statistics which govern quasiparticles in FQHE. A theorem concerning statistics of clusters of quasiparticles implies that fractional statistics do not allow coexistence of a large number of quasiparticles at fillings with an even denominator. Thus, no Hall plateau can be formed at these fillings, regardless of the presence of an energy gap. 15 references
High-performance LED luminaire for sports hall
Lee, Xuan-Hao; Yang, Jin-Tsung; Chien, Wei-Ting; Chang, Jung-Hsuan; Lo, Yi-Chien; Lin, Che-Chu; Sun, Ching-Cherng
2015-09-01
In this paper, we present a luminaire design with anti-glare and energy-saving effects for sports hall. Compared with traditional lamps using in a badminton court, the average illuminance on the ground of the proposed LED luminaire is enhanced about 300%. Besides, the uniformity is obviously enhanced and improved. The switch-on speed of lighting in sports hall is greatly reduced from 5-10 minutes to 1 second. The simulation analysis and the corresponding experiment results are demonstrated.
General vibration monitoring: Experimental hall
International Nuclear Information System (INIS)
Jendrzejczyk, J.A.; Wambsganss, M.W.; Smith, R.K.
1993-01-01
The reported vibration data were generated from measurements made on the experimental hall floor on December 2, 1992. At the time of the measurements, the ESRF hydrolevel was set-up in the Early Assembly Area (EAA) of the experimental hall and was being used to measure static displacement (settlement) of the floor. The vibration measurement area was on and adjacent to the EAA, in the vicinity of the ESRF hydrolevel test which was in progress. This report summarizes the objectives, instrumentation, measurement locations, observations, and conclusions, and provides selected results in the form of RMS vs. time plots, and power spectral densities from which frequency information can be derived. Measured response amplitudes were within the vibration criteria established for the APS
Structural study on cubic-tetragonal transition of CH3NH3PbI3
International Nuclear Information System (INIS)
Kawamura, Yukihiko; Mashiyama, Hiroyuki; Hasebe, Katsuhiko
2002-01-01
The cubic-tetragonal phase transition of CH 3 NH 3 PbI 3 was investigated by single crystal X-ray diffractometry. The crystal structure was refined at five temperatures in the tetragonal phase. The PbI 6 octahedron rotates around the c-axis alternatively to construct the SrTiO 3 -type tetragonal structure. A methylammonium ion is partially ordered; 24 disordered states in the cubic phase are reduced to 8. With decreasing temperature, the rotation angle of the octahedron increases monotonically, which indicates it is an order parameter of the cubic-tetragonal transition. (author)
Szabo, James
2015-01-01
Iodine enables dramatic mass and cost savings for lunar and Mars cargo missions, including Earth escape and near-Earth space maneuvers. The demonstrated throttling ability of iodine is important for a singular thruster that might be called upon to propel a spacecraft from Earth to Mars or Venus. The ability to throttle efficiently is even more important for missions beyond Mars. In the Phase I project, Busek Company, Inc., tested an existing Hall thruster, the BHT-8000, on iodine propellant. The thruster was fed by a high-flow iodine feed system and supported by an existing Busek hollow cathode flowing xenon gas. The Phase I propellant feed system was evolved from a previously demonstrated laboratory feed system. Throttling of the thruster between 2 and 11 kW at 200 to 600 V was demonstrated. Testing showed that the efficiency of iodine fueled BHT-8000 is the same as with xenon, with iodine delivering a slightly higher thrust-to-power (T/P) ratio. In Phase II, a complete iodine-fueled system was developed, including the thruster, hollow cathode, and iodine propellant feed system. The nominal power of the Phase II system is 8 kW; however, it can be deeply throttled as well as clustered to much higher power levels. The technology also can be scaled to greater than 100 kW per thruster to support megawatt-class missions. The target thruster efficiency for the full-scale system is 65 percent at high specific impulse (Isp) (approximately 3,000 s) and 60 percent at high thrust (Isp approximately 2,000 s).
Salatino, Maria
2017-06-01
In the current submm and mm cosmology experiments the focal planes are populated by kilopixel transition edge sensors (TESes). Varying incoming power load requires frequent rebiasing of the TESes through standard current-voltage (IV) acquisition. The time required to perform IVs on such large arrays and the resulting transient heating of the bath reduces the sky observation time. We explore a bias step method that significantly reduces the time required for the rebiasing process. This exploits the detectors' responses to the injection of a small square wave signal on top of the dc bias current and knowledge of the shape of the detector transition R(T,I). This method has been tested on two detector arrays of the Atacama Cosmology Telescope (ACT). In this paper, we focus on the first step of the method, the estimate of the TES %Rn.
Intrinsic and extrinsic spin Hall effects of Dirac electrons
International Nuclear Information System (INIS)
Fukazawa, Takaaki; Kohno, Hiroshi; Fujimoto, Junji
2017-01-01
We investigate the spin Hall effect (SHE) of electrons described by the Dirac equation, which is used as an effective model near the L-points in bismuth. By considering short-range nonmagnetic impurities, we calculate the extrinsic as well as intrinsic contributions on an equal footing. The vertex corrections are taken into account within the ladder type and the so-called skew-scattering type. The intrinsic SHE which we obtain is consistent with that of Fuseya et al. It is found that the extrinsic contribution dominates the intrinsic one when the system is metallic. The extrinsic SHE due to the skew scattering is proportional to Δ/n i u, where 2Δ is the band gap, n i is the impurity concentration, and u is the strength of the impurity potential. (author)
Strain-induced topological magnon phase transitions: applications to kagome-lattice ferromagnets
Owerre, S. A.
2018-06-01
A common feature of topological insulators is that they are characterized by topologically invariant quantity such as the Chern number and the index. This quantity distinguishes a nontrivial topological system from a trivial one. A topological phase transition may occur when there are two topologically distinct phases, and it is usually defined by a gap closing point where the topologically invariant quantity is ill-defined. In this paper, we show that the magnon bands in the strained (distorted) kagome-lattice ferromagnets realize an example of a topological magnon phase transition in the realistic parameter regime of the system. When spin–orbit coupling (SOC) is neglected (i.e. no Dzyaloshinskii–Moriya interaction), we show that all three magnon branches are dispersive with no flat band, and there exists a critical point where tilted Dirac and semi-Dirac point coexist in the magnon spectra. The critical point separates two gapless magnon phases as opposed to the usual phase transition. Upon the inclusion of SOC, we realize a topological magnon phase transition point at the critical strain , where D and J denote the perturbative SOC and the Heisenberg spin exchange interaction respectively. It separates two distinct topological magnon phases with different Chern numbers for and for . The associated anomalous thermal Hall conductivity develops an abrupt change at , due to the divergence of the Berry curvature in momentum space. The proposed topological magnon phase transition is experimentally feasible by applying external perturbations such as uniaxial strain or pressure.
Single particle detection: Phase control in submicron Hall sensors
International Nuclear Information System (INIS)
Di Michele, Lorenzo; Shelly, Connor; Gallop, John; Kazakova, Olga
2010-01-01
We present a phase-sensitive ac-dc Hall magnetometry method which allows a clear and reliable separation of real and parasitic magnetic signals of a very small magnitude. High-sensitivity semiconductor-based Hall crosses are generally accepted as a preferential solution for non-invasive detection of superparamagnetic nanobeads used in molecular biology, nanomedicine, and nanochemistry. However, detection of such small beads is often hindered by inductive pick-up and other spurious signals. The present work demonstrates an unambiguous experimental route for detection of small magnetic moments and provides a simple theoretical background for it. The reliability of the method has been tested for a variety of InSb Hall sensors in the range 600 nm-5 μm. Complete characterization of empty devices, involving Hall coefficients and noise measurements, has been performed and detection of a single FePt bead with diameter of 140 nm and magnetic moment of μ≅10 8 μ B has been achieved with a 600 nm-wide sensor.
DISK FORMATION IN MAGNETIZED CLOUDS ENABLED BY THE HALL EFFECT
International Nuclear Information System (INIS)
Krasnopolsky, Ruben; Shang, Hsien; Li Zhiyun
2011-01-01
Stars form in dense cores of molecular clouds that are observed to be significantly magnetized. A dynamically important magnetic field presents a significant obstacle to the formation of protostellar disks. Recent studies have shown that magnetic braking is strong enough to suppress the formation of rotationally supported disks in the ideal MHD limit. Whether non-ideal MHD effects can enable disk formation remains unsettled. We carry out a first study on how disk formation in magnetic clouds is modified by the Hall effect, the least explored of the three non-ideal MHD effects in star formation (the other two being ambipolar diffusion and Ohmic dissipation). For illustrative purposes, we consider a simplified problem of a non-self-gravitating, magnetized envelope collapsing onto a central protostar of fixed mass. We find that the Hall effect can spin up the inner part of the collapsing flow to Keplerian speed, producing a rotationally supported disk. The disk is generated through a Hall-induced magnetic torque. Disk formation occurs even when the envelope is initially non-rotating, provided that the Hall coefficient is large enough. When the magnetic field orientation is flipped, the direction of disk rotation is reversed as well. The implication is that the Hall effect can in principle produce both regularly rotating and counter-rotating disks around protostars. The Hall coefficient expected in dense cores is about one order of magnitude smaller than that needed for efficient spin-up in these models. We conclude that the Hall effect is an important factor to consider in studying the angular momentum evolution of magnetized star formation in general and disk formation in particular.
Photoinduced quantum spin and valley Hall effects, and orbital magnetization in monolayer MoS2
Tahir, M.
2014-09-22
We theoretically demonstrate that 100% valley-polarized transport in monolayers of MoS2 and other group-VI dichalcogenides can be obtained using off-resonant circularly polarized light. By tuning the intensity of the off-resonant light the intrinsic band gap in one valley is reduced, while it is enhanced in the other valley, enabling single valley quantum transport. As a consequence, we predict (i) enhancement of the longitudinal electrical conductivity, accompanied by an increase in the spin polarization of the flowing electrons, (ii) enhancement of the intrinsic spin Hall effect, together with a reduction of the intrinsic valley Hall effect, and (iii) enhancement of the orbital magnetic moment and orbital magnetization. These mechanisms provide appealing opportunities to the design of nanoelectronics based on dichalcogenides.
Photoinduced quantum spin and valley Hall effects, and orbital magnetization in monolayer MoS2
Tahir, M.; Manchon, Aurelien; Schwingenschlö gl, Udo
2014-01-01
We theoretically demonstrate that 100% valley-polarized transport in monolayers of MoS2 and other group-VI dichalcogenides can be obtained using off-resonant circularly polarized light. By tuning the intensity of the off-resonant light the intrinsic band gap in one valley is reduced, while it is enhanced in the other valley, enabling single valley quantum transport. As a consequence, we predict (i) enhancement of the longitudinal electrical conductivity, accompanied by an increase in the spin polarization of the flowing electrons, (ii) enhancement of the intrinsic spin Hall effect, together with a reduction of the intrinsic valley Hall effect, and (iii) enhancement of the orbital magnetic moment and orbital magnetization. These mechanisms provide appealing opportunities to the design of nanoelectronics based on dichalcogenides.
NASA HERMeS Hall Thruster Electrical Configuration Characterization
Peterson, Peter; Kamhawi, Hani; Huang, Wensheng; Yim, John; Herman, Daniel; Williams, George; Gilland, James; Hofer, Richard
2016-01-01
NASAs Hall Effect Rocket with Magnetic Shielding (HERMeS) 12.5 kW Technology Demonstration Unit-1 (TDU-1) Hall thruster has been the subject of extensive technology maturation in preparation for development into a flight ready propulsion system. Part of the technology maturation was to test the TDU-1 thruster in several ground based electrical configurations to assess the thruster robustness and suitability to successful in-space operation. The ground based electrical configuration testing has recently been demonstrated as an important step in understanding and assessing how a Hall thruster may operate differently in space compared to ground based testing, and to determine the best configuration to conduct development and qualification testing. This presentation will cover the electrical configuration testing of the TDU-1 HERMeS Hall thruster in NASA Glenn Research Centers Vacuum Facility 5. The three electrical configurations examined are the thruster body tied to facility ground, thruster floating, and finally the thruster body electrically tied to cathode common. The TDU-1 HERMeS was configured with two different exit plane boundary conditions, dielectric and conducting, to examine the influence on the electrical configuration characterization.
Inverse spin Hall effect by spin injection
Liu, S. Y.; Horing, Norman J. M.; Lei, X. L.
2007-09-01
Motivated by a recent experiment [S. O. Valenzuela and M. Tinkham, Nature (London) 442, 176 (2006)], the authors present a quantitative microscopic theory to investigate the inverse spin-Hall effect with spin injection into aluminum considering both intrinsic and extrinsic spin-orbit couplings using the orthogonalized-plane-wave method. Their theoretical results are in good agreement with the experimental data. It is also clear that the magnitude of the anomalous Hall resistivity is mainly due to contributions from extrinsic skew scattering.
Are tent halls subject to property tax?
Directory of Open Access Journals (Sweden)
Mariusz Macudziński
2016-12-01
Full Text Available The presented publication is a response to currently asked questions and interpretative doubts of taxpayers and tax authorities, namely whether tent halls are subject to property tax. General issues connected with an entity and a subject of taxation of this tax are presented herein. The answer to the question asked is then provided through the qualification of constructions works and the allocation of tent halls in the proper category of the works, with the use of the current law.
Resistive Instabilities in Hall Current Plasma Discharge
International Nuclear Information System (INIS)
Litvak, Andrei A.; Fisch, Nathaniel J.
2000-01-01
Plasma perturbations in the acceleration channel of a Hall thruster are found to be unstable in the presence of collisions. Both electrostatic lower-hybrid waves and electromagnetic Alfven waves transverse to the applied electric and magnetic field are found to be unstable due to collisions in the E X B electron flow. These results are obtained assuming a two-fluid hydrodynamic model in slab geometry. The characteristic frequencies of these modes are consistent with experimental observations in Hall current plasma thrusters
Hall Conductivity in a Quasi-Two-Dimensional Disordered Electron System
Institute of Scientific and Technical Information of China (English)
YANG Yong-Hong; WANG Yong-Gang; LIU Mei
2002-01-01
By making use of the diagrammatic techniques in perturbation theory,we have investigated the Hall effect in a quasi-two-dimensional disordered electron system.In the weakly localized regime,the analytical expression for quantum correction to Hall conductivity has been obtained using the Kubo formalism and quasiclassical approximation.The relevant dimensional crossover behavior from three dimensions to two dimensions with decreasing the interlayer hopping energy is discussed.The quantum interference effect is shown to have a vanishing correction t,o the Hall coefficient.
Algorithm and exploratory study of the Hall MHD Rayleigh-Taylor instability
International Nuclear Information System (INIS)
Gardiner, Thomas Anthony
2010-01-01
This report is concerned with the influence of the Hall term on the nonlinear evolution of the Rayleigh-Taylor (RT) instability. This begins with a review of the magnetohydrodynamic (MHD) equations including the Hall term and the wave modes which are present in the system on time scales short enough that the plasma can be approximated as being stationary. In this limit one obtains what are known as the electron MHD (EMHD) equations which support two characteristic wave modes known as the whistler and Hall drift modes. Each of these modes is considered in some detail in order to draw attention to their key features. This analysis also serves to provide a background for testing the numerical algorithms used in this work. The numerical methods are briefly described and the EMHD solver is then tested for the evolution of whistler and Hall drift modes. These methods are then applied to study the nonlinear evolution of the MHD RT instability with and without the Hall term for two different configurations. The influence of the Hall term on the mixing and bubble growth rate are analyzed.
G. Stanley Hall and The Journal of Genetic Psychology: A Note.
Hogan, John D
2016-01-01
The Journal of Genetic Psychology (originally called The Pedagogical Seminary) has a complicated history. Known primarily as a journal of development psychology, it was originally intended to be a journal of higher education. In addition, G. Stanley Hall created it, at least in part, to curry favor with Jonas Clark, the benefactor of Clark University. The journal had a cumbersome start, with irregular issues for most of its first decade. Hall was a hands-on editor, often contributing articles and reviews as well as the texts of many of his speeches. A substantial number of additional articles were written by Clark University faculty and fellows where Hall was president. After Hall.s death, the editor became Carl Murchison who eventually left Clark University with the journal and continued to publish it privately until his death. Through the years, the journal has been the source for many classic articles in developmental psychology.
Hall probe magnetometer for SSC magnet cables
International Nuclear Information System (INIS)
Cross, R.W.; Goldfarb, R.B.
1991-01-01
The authors of this paper constructed a Hall probe magnetometer to measure the magnetization hysteresis loops of Superconducting Super Collider magnet cables. The instrument uses two Hall-effect field sensors to measure the applied field H and the magnetic induction B. Magnetization M is calculated from the difference of the two quantities. The Hall probes are centered coaxially in the bore of a superconducting solenoid with the B probe against the sample's broad surface. An alternative probe arrangement, in which M is measured directly, aligns the sample probe parallel to the field. The authors measured M as a function of H and field cycle rate both with and without a dc transport current. Flux creep as a function of current was measured from the dependence of ac loss on the cycling rate and from the decay of magnetization with time. Transport currents up to 20% of the critical current have minimal effect on magnetization and flux creep
Marcelino, Edgar
2017-05-01
This paper considers a model consisting of a kinetic term, Rashba spin-orbit coupling and short-range Coulomb interaction at zero temperature. The Coulomb interaction is decoupled by a mean-field approximation in the spin channel using field theory methods. The results feature a first-order phase transition for any finite value of the chemical potential and quantum criticality for vanishing chemical potential. The Hall conductivity is also computed using the Kubo formula in a mean-field effective Hamiltonian. In the limit of infinite mass the kinetic term vanishes and all the phase transitions are of second order; in this case the spontaneous symmetry-breaking mechanism adds a ferromagnetic metallic phase to the system and features a zero-temperature quantization of the Hall conductivity in the insulating one.
Chaotic waves in Hall thruster plasma
International Nuclear Information System (INIS)
Peradzynski, Zbigniew; Barral, S.; Kurzyna, J.; Makowski, K.; Dudeck, M.
2006-01-01
The set of hyperbolic equations of the fluid model describing the acceleration of plasma in a Hall thruster is analyzed. The characteristic feature of the flow is the existence of a trapped characteristic; i.e. there exists a characteristic line, which never intersects the boundary of the flow region in the thruster. To study the propagation of short wave perturbations, the approach of geometrical optics (like WKB) can be applied. This can be done in a linear as well as in a nonlinear version. The nonlinear version describes the waves of small but finite amplitude. As a result of such an approach one obtains so called transport equation, which are governing the wave amplitude. Due to the existence of trapped characteristics this transport equation appears to have chaotic (turbulent) solutions in both, linear and nonlinear versions
The quantum Hall effect in quantum dot systems
International Nuclear Information System (INIS)
Beltukov, Y M; Greshnov, A A
2014-01-01
It is proposed to use quantum dots in order to increase the temperatures suitable for observation of the integer quantum Hall effect. A simple estimation using Fock-Darwin spectrum of a quantum dot shows that good part of carriers localized in quantum dots generate the intervals of plateaus robust against elevated temperatures. Numerical calculations employing local trigonometric basis and highly efficient kernel polynomial method adopted for computing the Hall conductivity reveal that quantum dots may enhance peak temperature for the effect by an order of magnitude, possibly above 77 K. Requirements to potentials, quality and arrangement of the quantum dots essential for practical realization of such enhancement are indicated. Comparison of our theoretical results with the quantum Hall measurements in InAs quantum dot systems from two experimental groups is also given
Energy Technology Data Exchange (ETDEWEB)
Yarmohammadi, Mohsen, E-mail: m.yarmohammadi69@gmail.com
2017-03-15
In this paper, we have investigated the effects of strain on DC transverse and spin-valley Hall conductivity (SHC-VHC) of two-dimensional buckled materials ferromagnetic graphene's analog, MoS{sub 2} and silicene due to their spin–orbit coupling. The Kubo formalism has been used to investigate the dynamics of carriers under strain along the armchair (AC) direction of systems in the context of the Kane–Mele Hamiltonian and the Dirac cone approximation. The effective mass of carriers increases with strain and this leads to the reduction of their transport. We have found that SHC-VHC changes symmetrically with respect to a critical strain around 13% and 45% for MoS{sub 2} and silicene, respectively. Furthermore, the reflection symmetry of silicene has been broken with electric field and a phase transition to topological insulator for strained ferromagnetic silicene has been seen. - Highlights: • Theoretical calculation of strain effects on band structure of MoS{sub 2} and silicene in the presence of electric field. • Investigation of DC transverse and spin-valley Hall conductivity of strained-MoS{sub 2} and silicene in the presence of electric field. • Theoretical calculation of external electric field effects on topological phase transition of silicene in the presence of strain.
Hall Thruster Thermal Modeling and Test Data Correlation
Myers, James
2016-01-01
HERMeS - Hall Effect Rocket with Magnetic Shielding. Developed through a joint effort by NASA/GRC and the Jet Propulsion Laboratory (JPL). Design goals: High power (12.5 kW) high Isp (3000 sec), high efficiency (> 60%), high throughput (10,000 kg), reduced plasma erosion and increased life (5 yrs) to support Asteroid Redirect Robotic Mission (ARRM). Further details see "Performance, Facility Pressure Effects and Stability Characterization Tests of NASAs HERMeS Thruster" by H. Kamhawi and team. Hall Thrusters (HT) inherently operate at elevated temperatures approx. 600 C (or more). Due to electric magnetic (E x B) fields used to ionize and accelerate propellant gas particles (i.e., plasma). Cooling is largely limited to radiation in vacuum environment.Thus the hardware components must withstand large start-up delta-T's. HT's are constructed of multiple materials; assorted metals, non-metals and ceramics for their required electrical and magnetic properties. To mitigate thermal stresses HT design must accommodate the differential thermal growth from a wide range of material Coef. of Thermal Expansion (CTEs). Prohibiting the use of some bolted/torqued interfaces.Commonly use spring loaded interfaces, particularly at the metal-to-ceramic interfaces to allow for slippage.However most component interfaces must also effectively conduct heat to the external surfaces for dissipation by radiation.Thus contact pressure and area are important.
Quantum Hall conductivity in a Landau type model with a realistic geometry
International Nuclear Information System (INIS)
Chandelier, F.; Georgelin, Y.; Masson, T.; Wallet, J.-C.
2003-01-01
In this paper, we revisit some quantum mechanical aspects related to the quantum Hall effect. We consider a Landau type model, paying a special attention to the experimental and geometrical features of quantum Hall experiments. The resulting formalism is then used to compute explicitly the Hall conductivity from a Kubo formula
Hamaoka Atomic Energy Hall, Chubu Electric Power Co. , Inc
Energy Technology Data Exchange (ETDEWEB)
Kawasaki, Y [Chubu Electric Power Co. Inc., Nagoya (Japan)
1979-10-01
Hamaoka Nuclear Power Station was constructed in the very large site of about 1.6 million m/sup 2/ surrounded by sand dunes and pine forests at the southern tip of Shizuoka Prefecture. Hamaoka Atomic Energy Hall was built on the right side of this power station. This hall had been planned as a part of the works commemorating the 20th anniversary of the founding of the company, and was opened in August, 1972. The building is of steel frame type, and has two floors of 1135 m/sup 2/ total area. The first floor comprises cinema room, power generation corner and open gallery, and the second floor comprises meeting room, native land corner and observation room. Moreover, there is observation platform on the roof. The purpose of the hall is coexistence and coprosperity with the regional residents, and 13 persons make explanations to visitors having reached to 1.9 million as of the end of June, 1979. It is incorporated in the sightseeing route centering around the Omaezaki lighthouse. The cinema hall accommodates 120 men, and the films concerning nuclear power generation and the construction of a nuclear power plant are shown. In the power generation corner, the explanation on nuclear power generation is made with models and panels. The third hall is being built now as energy corner, and it will be completed in autumn, 1979.
"Hall mees" Linnateatris / Triin Sinissaar
Sinissaar, Triin
1999-01-01
Tallinn Linnateatri ja Raadioteatri ühislavastus "Hall mees" Gill Adamsi näidendi järgi, lavastaja Eero Spriit, osades Helene Vannari ja Väino Laes, kunstnik Kustav - Agu Püüman. Esietendus 22. okt
Exotic Non-Abelian Topological Defects in Lattice Fractional Quantum Hall States
Liu, Zhao; Möller, Gunnar; Bergholtz, Emil J.
2017-09-01
We investigate extrinsic wormholelike twist defects that effectively increase the genus of space in lattice versions of multicomponent fractional quantum Hall systems. Although the original band structure is distorted by these defects, leading to localized midgap states, we find that a new lowest flat band representing a higher genus system can be engineered by tuning local single-particle potentials. Remarkably, once local many-body interactions in this new band are switched on, we identify various Abelian and non-Abelian fractional quantum Hall states, whose ground-state degeneracy increases with the number of defects, i.e, with the genus of space. This sensitivity of topological degeneracy to defects provides a "proof of concept" demonstration that genons, predicted by topological field theory as exotic non-Abelian defects tied to a varying topology of space, do exist in realistic microscopic models. Specifically, our results indicate that genons could be created in the laboratory by combining the physics of artificial gauge fields in cold atom systems with already existing holographic beam shaping methods for creating twist defects.
Non-commutative algebra of functions of 4-dimensional quantum Hall droplet
International Nuclear Information System (INIS)
Chen Yixin; Hou Boyu; Hou Boyuan
2002-01-01
We develop the description of non-commutative geometry of the 4-dimensional quantum Hall fluid's theory proposed recently by Zhang and Hu. The non-commutative structure of fuzzy S 4 , which is the base of the bundle S 7 obtained by the second Hopf fibration, i.e., S 7 /S 3 =S 4 , appears naturally in this theory. The fuzzy monopole harmonics, which are the essential elements in the non-commutative algebra of functions on S 4 , are explicitly constructed and their obeying the matrix algebra is obtained. This matrix algebra is associative. We also propose a fusion scheme of the fuzzy monopole harmonics of the coupling system from those of the subsystems, and determine the fusion rule in such fusion scheme. By products, we provide some essential ingredients of the theory of SO(5) angular momentum. In particular, the explicit expression of the coupling coefficients, in the theory of SO(5) angular momentum, are given. We also discuss some possible applications of our results to the 4-dimensional quantum Hall system and the matrix brane construction in M-theory
Experimental Studies of Anode Sheath Phenomena in a Hall Thruster Discharge
International Nuclear Information System (INIS)
Dorf, L.; Raitses, Y.; Fisch, N.J.
2004-01-01
Both electron-repelling and electron-attracting anode sheaths in a Hall thruster were characterized by measuring the plasma potential with biased and emissive probes [L. Dorf, Y. Raitses, V. Semenov, and N.J. Fisch, Appl. Phys. Let. 84 (2004) 1070]. In the present work, two-dimensional structures of the plasma potential, electron temperature, and plasma density in the near-anode region of a Hall thruster with clean and dielectrically coated anodes are identified. Possible mechanisms of anode sheath formation in a Hall thruster are analyzed. The path for current closure to the anode appears to be the determining factor in the anode sheath formation process. The main conclusion of this work is that the anode sheath formation in Hall thrusters differs essentially from that in the other gas discharge devices, like a glow discharge or a hollow anode, because the Hall thruster utilizes long electron residence times to ionize rather than high neutral pressures
Radiation conditions in the ring hall of the IHEP proton synchrotron
International Nuclear Information System (INIS)
Borodin, V.E.; Ermolenko, L.S.; Obryashchikova, L.P.
1975-01-01
The paper presents the results on studying the radiation conditions caused by induced radioactivity of the accelerator units in the ring hall. The data on the induced radioactivity level just on the ring vacuum chamber are reported. Radiation conditions in the most characteristic areas of the hall are considered. The changes in time of the dose rate at the internal target and at the entrance to the hall are shown
Granberg, Donald; Brown, Thad A.
1995-01-01
Examines people's behavior in the Monty Hall Dilemma (MHD), in which a person must make two decisions to win a prize. In a series of five studies, found that people misapprehend probabilities in the MHD. Discusses the MHD's relation to illusion of control, belief perseverance, and the status quo bias. (RJM)
Suitable reverberation time for halls for rock and pop music
DEFF Research Database (Denmark)
Adelman-Larsen, Niels Werner; Thompson, Eric Robert; Gade, Anders Christian
2010-01-01
The existing body of literature regarding the acoustic design of concert halls has focused almost exclusively on classical music, although there are many more performances of popular music, including rock and pop. Objective measurements were made of the acoustics of 20 rock music venues in Denmark....... The best-rated halls in the study have reverberation times that are approximately frequency independent from 0.6 to 1.2 s for hall volumes from 1000 to 6000 m3. The worst rated halls in the study had significantly higher reverberation times in the 63 and 125 Hz bands. Since most audiences at rock concerts...... are standing, absorption coefficients were measured with a standing audience from 63 Hz to 4 kHz. These measurements showed that a standing audience absorbs about five times as much energy in mid-/high-frequency bands as in low-frequency bands....
Low-Cost, High-Performance Hall Thruster Support System
Hesterman, Bryce
2015-01-01
Colorado Power Electronics (CPE) has built an innovative modular PPU for Hall thrusters, including discharge, magnet, heater and keeper supplies, and an interface module. This high-performance PPU offers resonant circuit topologies, magnetics design, modularity, and a stable and sustained operation during severe Hall effect thruster current oscillations. Laboratory testing has demonstrated discharge module efficiency of 96 percent, which is considerably higher than current state of the art.
A Small Modular Laboratory Hall Effect Thruster
Lee, Ty Davis
Electric propulsion technologies promise to revolutionize access to space, opening the door for mission concepts unfeasible by traditional propulsion methods alone. The Hall effect thruster is a relatively high thrust, moderate specific impulse electric propulsion device that belongs to the class of electrostatic thrusters. Hall effect thrusters benefit from an extensive flight history, and offer significant performance and cost advantages when compared to other forms of electric propulsion. Ongoing research on these devices includes the investigation of mechanisms that tend to decrease overall thruster efficiency, as well as the development of new techniques to extend operational lifetimes. This thesis is primarily concerned with the design and construction of a Small Modular Laboratory Hall Effect Thruster (SMLHET), and its operation on argon propellant gas. Particular attention was addressed at low-cost, modular design principles, that would facilitate simple replacement and modification of key thruster parts such as the magnetic circuit and discharge channel. This capability is intended to facilitate future studies of device physics such as anomalous electron transport and magnetic shielding of the channel walls, that have an impact on thruster performance and life. Preliminary results demonstrate SMLHET running on argon in a manner characteristic of Hall effect thrusters, additionally a power balance method was utilized to estimate thruster performance. It is expected that future thruster studies utilizing heavier though more expensive gases like xenon or krypton, will observe increased efficiency and stability.
The Hall-induced stability of gravitating fluids
Karmakar, P. K.; Goutam, H. P.
2018-05-01
We analyze the stability behavior of low-density partially ionized self-gravitating magnetized unbounded dusty plasma fluid in the presence of the Hall diffusion effects (HDEs) in the non-ideal magnetohydrodynamic (MHD) equilibrium framework. The effects of inhomogeneous self-gravity are methodically included in the basic model tapestry. Application of the Fourier plane-wave perturbative treatment decouples the structuration representative parameters into a linear generalized dispersion relation (sextic) in a judicious mean-fluid approximation. The dispersion analysis shows that the normal mode, termed as the gravito-magneto-acoustic (GMA) mode, is drastically modified due to the HDEs. This mode is highly dispersive, and driven unstable by the Hall current resulting from the symmetry-breaking of electrons and ions relative to the magnetic field. The mode feature, which is derived from a modified induction with the positive Hall, is against the ideal MHD. It is further demonstrated that the HDEs play stabilizing roles by supporting the cloud against gravitational collapse. Provided that the HDEs are concurrently switched off, the collapse occurs on the global spatial scale due to enhanced inward accretion of the gravitating dust constituents. It is seen explicitly that the enhanced dust-charge leads to stabilizing effects. Besides, the Hall-induced fluctuations, as propagatory wave modes, exhibit both normal and anomalous dispersions. The reliability checkup of the entailed results as diverse corollaries and special cases are illustratively discussed in the panoptic light of the earlier paradigmatic predictions available in the literature.
3D Quantum Hall Effect of Fermi Arc in Topological Semimetals
Wang, C. M.; Sun, Hai-Peng; Lu, Hai-Zhou; Xie, X. C.
2017-09-01
The quantum Hall effect is usually observed in 2D systems. We show that the Fermi arcs can give rise to a distinctive 3D quantum Hall effect in topological semimetals. Because of the topological constraint, the Fermi arc at a single surface has an open Fermi surface, which cannot host the quantum Hall effect. Via a "wormhole" tunneling assisted by the Weyl nodes, the Fermi arcs at opposite surfaces can form a complete Fermi loop and support the quantum Hall effect. The edge states of the Fermi arcs show a unique 3D distribution, giving an example of (d -2 )-dimensional boundary states. This is distinctly different from the surface-state quantum Hall effect from a single surface of topological insulator. As the Fermi energy sweeps through the Weyl nodes, the sheet Hall conductivity evolves from the 1 /B dependence to quantized plateaus at the Weyl nodes. This behavior can be realized by tuning gate voltages in a slab of topological semimetal, such as the TaAs family, Cd3 As2 , or Na3Bi . This work will be instructive not only for searching transport signatures of the Fermi arcs but also for exploring novel electron gases in other topological phases of matter.
Mary E. Hall: Dawn of the Professional School Librarian
Alto, Teresa
2012-01-01
A century ago, a woman named Mary E. Hall convinced school leaders of the need for the professional school librarian--a librarian who cultivated a love of reading, academic achievement, and independent learning skills. After graduating from New York City's Pratt Institute Library School in 1895, Hall developed her vision for the high school…
Acoustics in rock and pop music halls
DEFF Research Database (Denmark)
Larsen, Niels Werner; Thompson, Eric Robert; Gade, Anders Christian
2007-01-01
The existing body of literature regarding the acoustic design of concert halls has focused almost exclusively on classical music, although there are many more performances of rhythmic music, including rock and pop. Objective measurements were made of the acoustics of twenty rock music venues...... in Denmark and a questionnaire was used in a subjective assessment of those venues with professional rock musicians and sound engineers. Correlations between the objective and subjective results lead, among others, to a recommendation for reverberation time as a function of hall volume. Since the bass...
Experimental and theoretical studies of cylindrical Hall thrusters
International Nuclear Information System (INIS)
Smirnov, Artem; Raitses, Yegeny; Fisch, Nathaniel J.
2007-01-01
The Hall thruster is a mature electric propulsion device that holds considerable promise in terms of the propellant saving potential. The annular design of the conventional Hall thruster, however, does not naturally scale to low power. The efficiency tends to be lower and the lifetime issues are more aggravated. Cylindrical geometry Hall thrusters have lower surface-to-volume ratio than conventional thrusters and, thus, seem to be more promising for scaling down. The cylindrical Hall thruster (CHT) is fundamentally different from the conventional design in the way the electrons are confined and the ion space charge is neutralized. The performances of both the large (9-cm channel diameter, 600-1000 W) and miniaturized (2.6-cm channel diameter, 50-300 W) CHTs are comparable with those of the state-of-the-art conventional (annular) design Hall thrusters of similar sizes. A comprehensive experimental and theoretical study of the CHT physics has been conducted, addressing the questions of electron cross-field transport, propellant ionization, plasma-wall interaction, and formation of the electron distribution function. Probe measurements in the harsh plasma environment of the microthruster were performed. Several interesting effects, such as the unusually high ionization efficiency and enhanced electron transport, were observed. Kinetic simulations suggest the existence of the strong fluctuation-enhanced electron diffusion and predict the non-Maxwellian shape of the electron distribution function. Through the acquired understanding of the new physics, ways for further optimization of this means for low-power space propulsion are suggested. Substantial flexibility in the magnetic field configuration of the CHT is the key tool in achieving the high-efficiency operation
Quantum phase transitions of a disordered antiferromagnetic topological insulator
Baireuther, P.; Edge, J. M.; Fulga, I. C.; Beenakker, C. W. J.; Tworzydło, J.
2014-01-01
We study the effect of electrostatic disorder on the conductivity of a three-dimensional antiferromagnetic insulator (a stack of quantum anomalous Hall layers with staggered magnetization). The phase diagram contains regions where the increase of disorder first causes the appearance of surface conduction (via a topological phase transition), followed by the appearance of bulk conduction (via a metal-insulator transition). The conducting surface states are stabilized by an effective time-reversal symmetry that is broken locally by the disorder but restored on long length scales. A simple self-consistent Born approximation reliably locates the boundaries of this so-called "statistical" topological phase.
Kinetic equations for clean superconductors: Application to the flux flow hall effect
International Nuclear Information System (INIS)
Kopnin, N.B.
1994-01-01
The kinetic equations for clean superconductors (l>>ζ) are derived. expanding the equations for the time dependent Green functions in the quasiclassical parameter, the new contributions are found which contain the derivatives of the distribution functions with respect to the quasiparticle momentum. The transition from the ultra-clean case (no relaxation) to a relaxation-dominated behavior, for which the kinetic equations coincide with the usual quasiclassical approximation, occurs for the relaxation time of the order of ℎE F /Δ 2 . The kinetic equations can be used for various dynamic processes in superconductors including the flux-flow Hall effect. The derived equations, after necessary modifications for the p-wave pairing, are especially suitable for nonstationary problems in the theory of superfluidity of 3 He
Orbital magnetic moment and extrinsic spin Hall effect for iron impurities in gold
Czech Academy of Sciences Publication Activity Database
Shick, Alexander; Kolorenč, Jindřich; Janiš, Václav; Lichtenstein, A.I.
2011-01-01
Roč. 84, č. 11 (2011), "113112-1"-"113112-4" ISSN 1098-0121 R&D Projects: GA ČR(CZ) GAP204/10/0330; GA AV ČR IAA100100912 Institutional research plan: CEZ:AV0Z10100520 Keywords : spin Hall effect * XMCD Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.691, year: 2011 http://prb.aps.org/abstract/PRB/v84/i11/e113112
Novel Hall sensors developed for magnetic field imaging systems
International Nuclear Information System (INIS)
Cambel, Vladimir; Karapetrov, Goran; Novosad, Valentyn; Bartolome, Elena; Gregusova, Dagmar; Fedor, Jan; Kudela, Robert; Soltys, Jan
2007-01-01
We report here on the fabrication and application of novel planar Hall sensors based on shallow InGaP/AlGaAs/GaAs heterostructure with a two-dimensional electron gas (2DEG) as an active layer. The sensors are developed for two kinds of experiments. In the first one, magnetic samples are placed directly on the Hall sensor. Room temperature experiments of permalloy objects evaporated onto the sensor are presented. In the second experiment, the sensor scans close over a multigranular superconducting sample prepared on a YBCO thin film. Large-area and high-resolution scanning experiments were performed at 4.2 K with the Hall probe scanning system in a liquid helium flow cryostat
Energies and intensities of weak transitions in the decay of 132I
International Nuclear Information System (INIS)
Nettles, W.G.; Scoggins, R.K.; James, W.K.; Whitlock, L.C.; Subba RaoD, B.N.; Hamilton, J.H.; Ramayya, A.V.; Gunnink, R.
1978-01-01
The γ-ray spectrum of a 132 Te- 132 I equilibrium source was measured with an 18% efficiency Ge(Li) detector to search for weak transitions in the 132 I decay. A more detailed study was made of an earlier spectrum taken with a Compton suppression system and a chemically purified source. The results are compared with all available data and average values of the energies and intensities are given
Hall effect in noncommutative coordinates
International Nuclear Information System (INIS)
Dayi, Oemer F.; Jellal, Ahmed
2002-01-01
We consider electrons in uniform external magnetic and electric fields which move on a plane whose coordinates are noncommuting. Spectrum and eigenfunctions of the related Hamiltonian are obtained. We derive the electric current whose expectation value gives the Hall effect in terms of an effective magnetic field. We present a receipt to find the action which can be utilized in path integrals for noncommuting coordinates. In terms of this action we calculate the related Aharonov-Bohm phase and show that it also yields the same effective magnetic field. When magnetic field is strong enough this phase becomes independent of magnetic field. Measurement of it may give some hints on spatial noncommutativity. The noncommutativity parameter θ can be tuned such that electrons moving in noncommutative coordinates are interpreted as either leading to the fractional quantum Hall effect or composite fermions in the usual coordinates
Sammons, Morgan T; Boucher, Andrew
2016-01-01
Presents an obituary for Judy Estes Hall, who passed away on November 24, 2015. Hall served as the Executive Officer of the National Register of Health Service Psychologists until her retirement in 2013. She is a recognized expert in the development of education and training standards for the profession of psychology, she also made significant contributions in the field of international psychology, where she was a renowned expert in cross-national credentialing and an advocate for commonality in licensing standards. She was the coauthor of one edited volume and author of more than 60 journal articles, book chapters, and professional publications. A passionate advocate for the advancement of women in psychology, a devoted mother and grandmother, a connoisseur of wine and international traveler extraordinaire, she touched the personal and professional lives of many. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Effect of hall currents on thermal instability of dusty couple stress fluid
Directory of Open Access Journals (Sweden)
Aggarwal Amrish Kumar
2016-09-01
Full Text Available In this paper, effect of Hall currents on the thermal instability of couple-stress fluid permeated with dust particles has been considered. Following the linearized stability theory and normal mode analysis, the dispersion relation is obtained. For the case of stationary convection, dust particles and Hall currents are found to have destabilizing effect while couple stresses have stabilizing effect on the system. Magnetic field induced by Hall currents has stabilizing/destabilizing effect under certain conditions. It is found that due to the presence of Hall currents (hence magnetic field, oscillatory modes are produced which were non-existent in their absence.
Electron Cross-field Transport in a Miniaturized Cylindrical Hall Thruster
International Nuclear Information System (INIS)
Smirnov Artem; Raitses Yevgeny; Fisch Nathaniel J
2005-01-01
Conventional annular Hall thrusters become inefficient when scaled to low power. Cylindrical Hall thrusters, which have lower surface-to-volume ratio, are more promising for scaling down. They presently exhibit performance comparable with conventional annular Hall thrusters. The present paper gives a review of the experimental and numerical investigations of electron crossfield transport in the 2.6 cm miniaturized cylindrical Hall thruster (100 W power level). We show that, in order to explain the discharge current observed for the typical operating conditions, the electron anomalous collision frequency ν b has to be on the order of the Bohm value, ν B ∼ ω c /16. The contribution of electron-wall collisions to cross-field transport is found to be insignificant. The optimal regimes of thruster operation at low background pressure (below 10 -5 Torr) in the vacuum tank appear to be different from those at higher pressure (∼ 10 -4 Torr)
Magnetotransport properties of 8-Pmmn borophene: effects of Hall field and strain.
Islam, S K Firoz
2018-07-11
The polymorph of 8-Pmmn borophene is an anisotropic Dirac material with tilted Dirac cones at two valleys. The tilting of the Dirac cones at two valleys are in opposite directions, which manifests itself via the valley dependent Landau levels in presence of an in-plane electric field (Hall field). The valley dependent Landau levels cause valley polarized magnetotransport properties in presence of the Hall field, which is in contrast to the monolayer graphene with isotropic non-tilted Dirac cones. The longitudinal conductivity and Hall conductivity are evaluated by using linear response theory in low temperature regime. An analytical approximate form of the longitudinal conductivity is also obtained. It is observed that the tilting of the Dirac cones amplifies the frequency of the longitudinal conductivity oscillation (Shubnikov-de Haas). On the other hand, the Hall conductivity exhibits graphene-like plateaus except the appearance of valley dependent steps which are purely attributed to the Hall field induced lifting of the valley degeneracy in the Landau levels. Finally we look into the different cases when the Hall field is applied to the strained borophene and find that valley dependency is fully dominated by strain rather than Hall field. Another noticeable point is that if the real magnetic field is replaced by the strain induced pseudo magnetic field then the electric field looses its ability to cause valley polarized transport.
Anode Fall Formation in a Hall Thruster
International Nuclear Information System (INIS)
Dorf, Leonid A.; Raitses, Yevgeny F.; Smirnov, Artem N.; Fisch, Nathaniel J.
2004-01-01
As was reported in our previous work, accurate, nondisturbing near-anode measurements of the plasma density, electron temperature, and plasma potential performed with biased and emissive probes allowed the first experimental identification of both electron-repelling (negative anode fall) and electron-attracting (positive anode fall) anode sheaths in Hall thrusters. An interesting new phenomenon revealed by the probe measurements is that the anode fall changes from positive to negative upon removal of the dielectric coating, which appears on the anode surface during the course of Hall thruster operation. As reported in the present work, energy dispersion spectroscopy analysis of the chemical composition of the anode dielectric coating indicates that the coating layer consists essentially of an oxide of the anode material (stainless steel). However, it is still unclear how oxygen gets into the thruster channel. Most importantly, possible mechanisms of anode fall formation in a Hall thruster with a clean and a coated anodes are analyzed in this work; practical implication of understanding the general structure of the electron-attracting anode sheath in the case of a coated anode is also discussed
Higher (odd dimensional quantum Hall effect and extended dimensional hierarchy
Directory of Open Access Journals (Sweden)
Kazuki Hasebe
2017-07-01
Full Text Available We demonstrate dimensional ladder of higher dimensional quantum Hall effects by exploiting quantum Hall effects on arbitrary odd dimensional spheres. Non-relativistic and relativistic Landau models are analyzed on S2k−1 in the SO(2k−1 monopole background. The total sub-band degeneracy of the odd dimensional lowest Landau level is shown to be equal to the winding number from the base-manifold S2k−1 to the one-dimension higher SO(2k gauge group. Based on the chiral Hopf maps, we clarify the underlying quantum Nambu geometry for odd dimensional quantum Hall effect and the resulting quantum geometry is naturally embedded also in one-dimension higher quantum geometry. An origin of such dimensional ladder connecting even and odd dimensional quantum Hall effects is illuminated from a viewpoint of the spectral flow of Atiyah–Patodi–Singer index theorem in differential topology. We also present a BF topological field theory as an effective field theory in which membranes with different dimensions undergo non-trivial linking in odd dimensional space. Finally, an extended version of the dimensional hierarchy for higher dimensional quantum Hall liquids is proposed, and its relationship to quantum anomaly and D-brane physics is discussed.
Ma, Fengxian; Gao, Guoping; Jiao, Yalong; Gu, Yuantong; Bilic, Ante; Zhang, Haijun; Chen, Zhongfang; Du, Aijun
2016-02-01
Single layered transition metal dichalcogenides have attracted tremendous research interest due to their structural phase diversities. By using a global optimization approach, we have discovered a new phase of transition metal dichalcogenides (labelled as T''), which is confirmed to be energetically, dynamically and kinetically stable by our first-principles calculations. The new T'' MoS2 phase exhibits an intrinsic quantum spin Hall (QSH) effect with a nontrivial gap as large as 0.42 eV, suggesting that a two-dimensional (2D) topological insulator can be achieved at room temperature. Most interestingly, there is a topological phase transition simply driven by a small tensile strain of up to 2%. Furthermore, all the known MX2 (M = Mo or W; X = S, Se or Te) monolayers in the new T'' phase unambiguously display similar band topologies and strain controlled topological phase transitions. Our findings greatly enrich the 2D families of transition metal dichalcogenides and offer a feasible way to control the electronic states of 2D topological insulators for the fabrication of high-speed spintronics devices.Single layered transition metal dichalcogenides have attracted tremendous research interest due to their structural phase diversities. By using a global optimization approach, we have discovered a new phase of transition metal dichalcogenides (labelled as T''), which is confirmed to be energetically, dynamically and kinetically stable by our first-principles calculations. The new T'' MoS2 phase exhibits an intrinsic quantum spin Hall (QSH) effect with a nontrivial gap as large as 0.42 eV, suggesting that a two-dimensional (2D) topological insulator can be achieved at room temperature. Most interestingly, there is a topological phase transition simply driven by a small tensile strain of up to 2%. Furthermore, all the known MX2 (M = Mo or W; X = S, Se or Te) monolayers in the new T'' phase unambiguously display similar band topologies and strain controlled topological
Planar Hall Effect Sensors for Biodetection
DEFF Research Database (Denmark)
Rizzi, Giovanni
. In the second geometry (dPHEB) half of the sensor is used as a local negative reference to subtract the background signal from magnetic beads in suspension. In all applications below, the magnetic beads are magnetised using the magnetic field due to the bias current passed through the sensor, i.e., no external...... as labels and planar Hall effect bridge (PHEB) magnetic field sensor as readout for the beads. The choice of magnetic beads as label is motivated by the lack of virtually any magnetic background from biological samples. Moreover, magnetic beads can be manipulated via an external magnetic field...... hybridisation in real-time, in a background of suspended magnetic beads. This characteristic is employed in single nucleotide polymorphism (SNP) genotyping, where the denaturation of DNA is monitored in real-time upon washing with a stringency buffer. The sensor setup includes temperature control and a fluidic...
Fractional statistics and fractional quantized Hall effect. Revision
International Nuclear Information System (INIS)
Tao, R.; Wu, Y.S.
1984-01-01
We suggest that the origin of the odd denominator rule observed in the fractional quantized Hall effect (FQHE) may lie in fractional statistics which governs quasiparticles in FQHE. A theorem concerning statistics of clusters of quasiparticles implies that fractional statistics does not allow coexistence of a large number of quasiparticles at fillings with an even denominator. Thus no Hall plateau can be formed at these fillings, regardless of the presence of an energy gap. 15 references
Evaluation of Pressure Changes in HANARO Reactor Hall after a Reactor Shutdown
International Nuclear Information System (INIS)
Han, Geeyang; Han, Jaesam; Ahn, Gukhoon; Jung, Hoansung
2013-01-01
The major objective of this work is intended to evaluate the characteristics of the thermal behavior regarding how the decay heat will be affected by the reactor hall pressure change and the increase of pool water temperature induced in the primary coolant after a reactor shutdown. The particular reactor pool water temperature at the surface where it is evaporated owing to the decay heat resulting in the local heat transfer rate is related to the pressure change response in the reactor hall associated with the primary cooling system because of the reduction of the heat exchanger to remove the heat. The increase in the pool water temperature is proportional to the heat transfer rate in the reactor pool. Consequently, any limit on the reactor pool water temperature imposes a corresponding limit on the reactor hall pressure. At HANARO, the decay heat after a reactor shutdown is mainly removed by the natural circulation cooling in the reactor pool. This paper is written for the safety feature of the pressure change related leakage rate from the reactor hall. The calculation results show that the increase of pressure in the reactor hall will not cause any serious problems to the safety limits although the reactor hall pressure is slightly increased. Therefore, it was concluded that the pool water temperature increase is not so rapid as to cause the pressure to vary significantly in the reactor hall. Furthermore, the mathematical model developed in this work can be a useful analytical tool for scoping and parametric studies in the area of thermal transient analysis, with its proper representation of the interaction between the temperature and pressure in the reactor hall
Admittance of multiterminal quantum Hall conductors at kilohertz frequencies
International Nuclear Information System (INIS)
Hernández, C.; Consejo, C.; Chaubet, C.; Degiovanni, P.
2014-01-01
We present an experimental study of the low frequency admittance of quantum Hall conductors in the [100 Hz, 1 MHz] frequency range. We show that the frequency dependence of the admittance of the sample strongly depends on the topology of the contacts connections. Our experimental results are well explained within the Christen and Büttiker approach for finite frequency transport in quantum Hall edge channels taking into account the influence of the coaxial cables capacitance. In the Hall bar geometry, we demonstrate that there exists a configuration in which the cable capacitance does not influence the admittance measurement of the sample. In this case, we measure the electrochemical capacitance of the sample and observe its dependence on the filling factor
Admittance of multiterminal quantum Hall conductors at kilohertz frequencies
Energy Technology Data Exchange (ETDEWEB)
Hernández, C. [Departamento de Física, Universidad Militar Nueva Granada, Carrera 11 101-80 Bogotá D.C. (Colombia); Consejo, C.; Chaubet, C., E-mail: christophe.chaubet@univ-montp2.fr [Université Montpellier 2, Laboratoire Charles Coulomb UMR5221, F-34095 Montpellier, France and CNRS, Laboratoire Charles Coulomb UMR5221, F-34095 Montpellier (France); Degiovanni, P. [Université de Lyon, Fédération de Physique Andrée Marie Ampère, CNRS, Laboratoire de Physique de l' Ecole Normale Supérieure de Lyon, 46 allée d' Italie, 69364 Lyon Cedex 07 (France)
2014-03-28
We present an experimental study of the low frequency admittance of quantum Hall conductors in the [100 Hz, 1 MHz] frequency range. We show that the frequency dependence of the admittance of the sample strongly depends on the topology of the contacts connections. Our experimental results are well explained within the Christen and Büttiker approach for finite frequency transport in quantum Hall edge channels taking into account the influence of the coaxial cables capacitance. In the Hall bar geometry, we demonstrate that there exists a configuration in which the cable capacitance does not influence the admittance measurement of the sample. In this case, we measure the electrochemical capacitance of the sample and observe its dependence on the filling factor.
A highly sensitive CMOS digital Hall sensor for low magnetic field applications.
Xu, Yue; Pan, Hong-Bin; He, Shu-Zhuan; Li, Li
2012-01-01
Integrated CMOS Hall sensors have been widely used to measure magnetic fields. However, they are difficult to work with in a low magnetic field environment due to their low sensitivity and large offset. This paper describes a highly sensitive digital Hall sensor fabricated in 0.18 μm high voltage CMOS technology for low field applications. The sensor consists of a switched cross-shaped Hall plate and a novel signal conditioner. It effectively eliminates offset and low frequency 1/f noise by applying a dynamic quadrature offset cancellation technique. The measured results show the optimal Hall plate achieves a high current related sensitivity of about 310 V/AT. The whole sensor has a remarkable ability to measure a minimum ± 2 mT magnetic field and output a digital Hall signal in a wide temperature range from -40 °C to 120 °C.
Edge states and integer quantum Hall effect in topological insulator thin films.
Zhang, Song-Bo; Lu, Hai-Zhou; Shen, Shun-Qing
2015-08-25
The integer quantum Hall effect is a topological state of quantum matter in two dimensions, and has recently been observed in three-dimensional topological insulator thin films. Here we study the Landau levels and edge states of surface Dirac fermions in topological insulators under strong magnetic field. We examine the formation of the quantum plateaux of the Hall conductance and find two different patterns, in one pattern the filling number covers all integers while only odd integers in the other. We focus on the quantum plateau closest to zero energy and demonstrate the breakdown of the quantum spin Hall effect resulting from structure inversion asymmetry. The phase diagrams of the quantum Hall states are presented as functions of magnetic field, gate voltage and chemical potential. This work establishes an intuitive picture of the edge states to understand the integer quantum Hall effect for Dirac electrons in topological insulator thin films.
Spin-Hall nano-oscillator: A micromagnetic study
Energy Technology Data Exchange (ETDEWEB)
Giordano, A.; Azzerboni, B.; Finocchio, G. [Department of Electronic Engineering, Industrial Chemistry and Engineering, University of Messina, C.da di Dio, I-98166 Messina (Italy); Carpentieri, M. [Department of Electrical and Information Engineering, Politecnico of Bari, via E. Orabona 4, I-70125 Bari (Italy); Laudani, A. [Department of Engineering, University of Roma Tre, via V. Volterra 62, I-00146 Roma (Italy); Gubbiotti, G. [Istituto Officina dei Materiali del CNR (CNR-IOM), Unità di Perugia c/o Dipartimento di Fisica e Geologia, Via A. Pascoli, 06123 Perugia (Italy)
2014-07-28
This Letter studies the dynamical behavior of spin-Hall nanoscillators from a micromagnetic point of view. The model parameters have been identified by reproducing recent experimental data quantitatively. Our results indicate that a strongly localized mode is observed for in-plane bias fields such as in the experiments, while predict the excitation of an asymmetric propagating mode for large enough out-of plane bias field similarly to what observed in spin-torque nanocontact oscillators. Our findings show that spin-Hall nanoscillators can find application as spin-wave emitters for magnonic applications where spin waves are used for transmission and processing information on nanoscale.
Hall effect on magnetohydrodynamic instabilities at an elliptic magnetic stagnation line
Spies, Günther O.; Faghihi, Mustafa
1987-06-01
To answer the question whether the Hall effect removes the unphysical feature of ideal magnetohydrodynamics of predicting small wavelength kink instabilities at any elliptic magnetic stagnation line, a normal mode analysis is performed of the motion of an incompressible Hall fluid about cylindrical Z-pinch equilibria with circular cross sections. The eigenvalue loci in the complex frequency plane are derived for the equilibrium with constant current density. Every particular mode becomes stable as the Hall parameter exceeds a critical value. This value, however, depends on the mode such that it increases to infinity as the ideal growth rate decreases to zero, implying that there always remains an infinite number of slowly growing instabilities. Correspondingly, the stability criterion for equilibria with arbitrary current distributions is independent of the Hall parameter.
Hall effect on magnetohydrodynamic instabilities at an elliptic magnetic stagnation line
International Nuclear Information System (INIS)
Spies, G.O.; Faghihi, M.
1987-01-01
To answer the question whether the Hall effect removes the unphysical feature of ideal magnetohydrodynamics of predicting small wavelength kink instabilities at any elliptic magnetic stagnation line, a normal mode analysis is performed of the motion of an incompressible Hall fluid about cylindrical Z-pinch equilibria with circular cross sections. The eigenvalue loci in the complex frequency plane are derived for the equilibrium with constant current density. Every particular mode becomes stable as the Hall parameter exceeds a critical value. This value, however, depends on the mode such that it increases to infinity as the ideal growth rate decreases to zero, implying that there always remains an infinite number of slowly growing instabilities. Correspondingly, the stability criterion for equilibria with arbitrary current distributions is independent of the Hall parameter
Influence of energy bands on the Hall effect in degenerate semiconductors
International Nuclear Information System (INIS)
Wu, Chhi-Chong; Tsai, Jensan
1989-01-01
The influence of energy bands on the Hall effect and transverse magnetoresistance has been investigated according to the scattering processes of carriers in degenerate semiconductors such as InSb. Results show that the Hall angle, Hall coefficient, and transverse magnetoresistance depend on the dc magnetic field for both parabolic and nonparabolic band structures of semiconductors and also depend on the scattering processes of carriers in semiconductors due to the energy-dependent relaxation time. From their numerical analysis for the Hall effect, it is shown that the conduction electrons in degenerate semiconductors play a major role for the carrier transport phenomenon. By comparing with experimental data of the transverse magnetoresistance, it shows that the nonparabolic band model is better in agreement with the experimental work than the parabolic band model of semiconductors
1000 Hours of Testing Completed on 10-kW Hall Thruster
Mason, Lee S.
2001-01-01
Between the months of April and August 2000, a 10-kW Hall effect thruster, designated T- 220, was subjected to a 1000-hr life test evaluation. Hall effect thrusters are propulsion devices that electrostatically accelerate xenon ions to produce thrust. Hall effect propulsion has been in development for many years, and low-power devices (1.35 kW) have been used in space for satellite orbit maintenance. The T-220, shown in the photo, produces sufficient thrust to enable efficient orbital transfers, saving hundreds of kilograms in propellant over conventional chemical propulsion systems. This test is the longest operation ever achieved on a high-power Hall thruster (greater than 4.5 kW) and is a key milestone leading to the use of this technology for future NASA, commercial, and military missions.
Quantum anomalous Hall phase in a one-dimensional optical lattice
Liu, Sheng; Shao, L. B.; Hou, Qi-Zhe; Xue, Zheng-Yuan
2018-03-01
We propose to simulate and detect quantum anomalous Hall phase with ultracold atoms in a one-dimensional optical lattice, with the other synthetic dimension being realized by modulating spin-orbit coupling. We show that the system manifests a topologically nontrivial phase with two chiral edge states which can be readily detected in this synthetic two-dimensional system. Moreover, it is interesting that at the phase transition point there is a flat energy band and this system can also be in a topologically nontrivial phase with two Fermi zero modes existing at the boundaries by considering the synthetic dimension as a modulated parameter. We also show how to measure these topological phases experimentally in ultracold atoms. Another model with a random Rashba and Dresselhaus spin-orbit coupling strength is also found to exhibit topological nontrivial phase, and the impact of the disorder to the system is revealed.
Electronic transport and conduction mechanism transition in La1∕3Sr2∕3FeO3 thin films
International Nuclear Information System (INIS)
Devlin, R. C.; Krick, A. L.; Sichel-Tissot, R. J.; Xie, Y. J.; May, S. J.
2014-01-01
We report on the electronic transport properties of epitaxial La 1∕3 Sr 2∕3 FeO 3 films using temperature dependent resistivity, Hall effect, and magnetoresistance measurements. We show that the electronic phase transition, which occurs near 190 K, results in a change in conduction mechanism from nonadiabatic polaron transport at high temperatures to resistivity behavior following a power law temperature dependence at low temperatures. The phase transition is also accompanied by an abrupt increase in apparent mobility and Hall coefficient below the critical temperature (T*). We argue that the exotic low temperature transport properties are a consequence of the unusually long-range periodicity of the antiferromagnetic ordering, which also couples to the electronic transport in the form of a negative magnetoresistance below T* and a sign reversal of the Hall coefficient at T*. By comparing films of differing thicknesses, stoichiometry, and strain states, we demonstrate that the observed conduction behavior is a robust feature of La 1∕3 Sr 2∕3 FeO 3 .
Observation of the fractional quantum Hall effect in graphene.
Bolotin, Kirill I; Ghahari, Fereshte; Shulman, Michael D; Stormer, Horst L; Kim, Philip
2009-11-12
When electrons are confined in two dimensions and subject to strong magnetic fields, the Coulomb interactions between them can become very strong, leading to the formation of correlated states of matter, such as the fractional quantum Hall liquid. In this strong quantum regime, electrons and magnetic flux quanta bind to form complex composite quasiparticles with fractional electronic charge; these are manifest in transport measurements of the Hall conductivity as rational fractions of the elementary conductance quantum. The experimental discovery of an anomalous integer quantum Hall effect in graphene has enabled the study of a correlated two-dimensional electronic system, in which the interacting electrons behave like massless chiral fermions. However, owing to the prevailing disorder, graphene has so far exhibited only weak signatures of correlated electron phenomena, despite intense experimental and theoretical efforts. Here we report the observation of the fractional quantum Hall effect in ultraclean, suspended graphene. In addition, we show that at low carrier density graphene becomes an insulator with a magnetic-field-tunable energy gap. These newly discovered quantum states offer the opportunity to study correlated Dirac fermions in graphene in the presence of large magnetic fields.
Quantifying Spin Hall Angles from Spin Pumping : Experiments and Theory
Mosendz, O.; Pearson, J.E.; Fradin, F.Y.; Bauer, G.E.W.; Bader, S.D.; Hoffmann, A.
2010-01-01
Spin Hall effects intermix spin and charge currents even in nonmagnetic materials and, therefore, ultimately may allow the use of spin transport without the need for ferromagnets. We show how spin Hall effects can be quantified by integrating Ni80Fe20|normal metal (N) bilayers into a coplanar
On Tate Modern’s Turbine Hall and 'The Unilever Series'
Directory of Open Access Journals (Sweden)
Wouter Davidts
2014-07-01
Full Text Available Since the opening Tate Modern in 2000, the vast space of the Turbine Hall has hosted The Unilever Series. Widely acclaimed artists Louise Bourgeois, Juan Munõz, Anish Kapoor, Olafur Eliasson, Bruce Nauman, Rachel Whiteread, Carsten Höller and most lately Doris Salcedo accepted the invitation to ‘tackle’ what is arguably the biggest museum space in the world and realized what is invariably held to be their ‘biggest work ever.’The Unilever Series is not the only large-scale installation series. In recent years, we witnessed the worldwide launch of ever-larger art commissions for increasingly vaster spaces, resulting in all the more colossal artworks. Only recently, Paris announced its own yearly art commission for the central nave of the Grand Palais, suitably entitled Monumenta. The essay examines The Unilever Series in Tate Modern’s Turbine Hall, and discuss it within the global leap in scale and massive expansion of the art and museum world, of which the London institution and its vestibule in particular are the most blatant exponents. While it is certainly true that the spectacular expansion of art installations has occurred in tandem with a profusion of large international exhibitions and ‘destination’ museum of inordinately vast proportions, the assumption that large exhibition spaces demand an art of size is too simplistic. By examining the institutional, spatial and material disposition of the Turbine Hall, I will demonstrate that it is far more than a plain and abstract emblem of the global inflation and growth of museum and exhibition spaces. It’s a distinct architectural exponent of this tendency that essentially in and of itself has informed the inflation of the artworks that have been commissioned for it.
Familial Pallister-Hall in adulthood.
Talsania, Mitali; Sharma, Rohan; Sughrue, Michael E; Scofield, R Hal; Lim, Jonea
2017-10-01
Pallister Hall syndrome is autosomal dominant disorder usually diagnosed in infants and children. Current diagnostic criteria include presence of hypothalamic hamartoma, post axial polydactyly and positive family history, but the disease has variable manifestations. Herein we report Pallister Hall syndrome diagnosed in a family where both patients were adults. A 59 year old man developed seizures 4 years prior to our evaluation of him, at which time imaging showed a hypothalamic hamartoma. The seizures were controlled medically. He did well until he had visual changes after a traumatic head injury. Repeat MRI showed slight expansion of the mass with formal visual field testing demonstrating bitemporal hemianopsia. There was no evidence of pituitary dysfunction except for large urine volume. He underwent surgery to debulk the hamartoma and the visual field defects improved. There was no hypopituitarism post-operatively, and the polydyspia resolved. His 29 year old daughter also had seizures and hypothalamic hamartoma. Both patients had had polydactyly with prior surgical correction in childhood. The daughter underwent genetic testing, which revealed a previously undescribed heterozygous single base pair deletion in exon 13 of the GLI3 gene causing a frameshift mutation. Further investigation into family history revealed multiple members in previous generations with polydactyly and/or seizures. Pallister-Hall syndrome is caused by an inherited autosomal dominant or de novo mutation in GLI3 gene. This rare syndrome has not had prevalence defined, however. Generally, diagnoses are made in the pediatric population. Our report adds to the few cases detected in adulthood.
Hall effect in the two-dimensional Luttinger liquid
International Nuclear Information System (INIS)
Anderson, P.W.
1991-01-01
The temperature dependence of the Hall effect in the normal state is a commom theme of all the cuprate superconductors and has been one of the more puzzling observations on these puzzling materials. We describe a general scheme within the Luttinger liquid theory of these two-dimensional quantum fluids which corrrelates the anomalous Hall and resistivity observations on a wide variety of both pure and doped single crystals, especially the data in the accompanying Letter of Chien, Wang, and Ong
The effect of magnetic mirror on near wall conductivity in Hall thrusters
International Nuclear Information System (INIS)
Yu, D.; Liu, H.; Fu, H.; Cao, Y.
2008-01-01
The effect of magnetic mirror on near wall conductivity is studied in the acceleration region of Hall thrusters. The electron dynamics process in the plasma is described by test particle method, in which electrons are randomly emitted from the centerline towards the inner wall of the channel. It is found that the effective collision coefficient, i.e. the rate of electrons colliding with the wall, changes dramatically with the magnetic mirror effect being considered; and that it decreases further with the increase of magnetic mirror ratio to enhance the electron mobility accordingly. In particular, under anistropic electron velocity distribution conditions, the magnetic mirror effect becomes even more prominent. Furthermore, due to decrease in magnetic mirror ratio from the exhaust plane to the anode in Hall thrusters, the axial gradient of electron mobility with magnetic mirror effect is greater than without it. The magnetic mirror effects on electron mobility are derived analytically and the results are found in agreement with the simulation. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Main Parameters Characterization of Bulk CMOS Cross-Like Hall Structures
Directory of Open Access Journals (Sweden)
Maria-Alexandra Paun
2016-01-01
Full Text Available A detailed analysis of the cross-like Hall cells integrated in regular bulk CMOS technological process is performed. To this purpose their main parameters have been evaluated. A three-dimensional physical model was employed in order to evaluate the structures. On this occasion, numerical information on the input resistance, Hall voltage, conduction current, and electrical potential distribution has been obtained. Experimental results for the absolute sensitivity, offset, and offset temperature drift have also been provided. A quadratic behavior of the residual offset with the temperature was obtained and the temperature points leading to the minimum offset for the three Hall cells were identified.
International Nuclear Information System (INIS)
Dhar, S.; Basu, B.; Ghosh, Subir
2007-01-01
We explain the intrinsic spin Hall effect from generic anyon dynamics in the presence of external electromagnetic field. The free anyon is represented as a spinning particle with an underlying non-commutative configuration space. The Berry curvature plays a major role in the analysis
Effects of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers
Guo, Zaibing
2012-09-27
In this paper, we report the results of surface and interface scattering on anomalous Hall effect in Co/Pd multilayers with perpendicular magnetic anisotropy. The surface scattering effect has been extracted from the total anomalous Hall effect. By scaling surface scattering contribution with ρAHs∼ργss, the exponent γ has been found to decrease with the increase of surface scattering resistivity, which could account for the thickness-dependent anomalous Hall effect. Interface diffusion induced by rapid thermal annealing modifies not only the magnetization and longitudinal resistivity but also the anomalous Hall effect; a large exponent γ ∼ 5.7 has been attributed to interface scattering-dominated anomalous Hall effect.
On-tip sub-micrometer Hall probes for magnetic microscopy prepared by AFM lithography
International Nuclear Information System (INIS)
Gregusova, D.; Martaus, J.; Fedor, J.; Kudela, R.; Kostic, I.; Cambel, V.
2009-01-01
We developed a technology of sub-micrometer Hall probes for future application in scanning hall probe microscopy (SHPM) and magnetic force microscopy (MFM). First, the Hall probes of ∼9-μm dimensions are prepared on the top of high-aspect-ratio GaAs pyramids with an InGaP/AlGaAs/GaAs active layer using wet-chemical etching and non-planar lithography. Then we show that the active area of planar Hall probes can be downsized to sub-micrometer dimensions by local anodic oxidation technique using an atomic force microscope. Such planar probes are tested and their noise and magnetic field sensitivity are evaluated. Finally, the two technologies are combined to fabricate sub-micrometer Hall probes on the top of high-aspect ratio mesa for future SHPM and MFM techniques.
Room acoustic enhancement in a small hall with very low natural reverberation time
DEFF Research Database (Denmark)
Gade, Anders Christian
1996-01-01
natural combinations of room acoustic properties. Consequently, the natural reverberation time in a newly opened 350 seat multipurpose hall in Denmark was designed as low as 0.7 sec. Two different reverberation enhancement systems were considered and tested in the hall. The objective and subjective...... testing results are reported and compared with previous results obtained in another small hall supplied with a similar enhancement system. The results concerning 'realism' are also compared with acoustic properties found in 'natural' halls of different sizes and reverberation times.......In small multipurpose halls to be equipped with electronic reverberation enhancement systems, selecting a very low natural reverberation time is advantageous for several reasons. It will 1) reduce the risk of feedback, 2) increase the possible range of room acoustic variation and 3) allow for more...
Topological phase transitions in an inverted InAs/GaSb quantum well driven by tilted magnetic fields
Hsu, Hsiu-Chuan; Jhang, Min-Jyun; Chen, Tsung-Wei; Guo, Guang-Yu
2017-05-01
The helical edge states in a quantum spin Hall insulator are presumably protected by time-reversal symmetry. However, even in the presence of magnetic field which breaks time-reversal symmetry, the helical edge conduction can still exist, dubbed as pseudo quantum spin Hall effect. In this paper, the effects of the magnetic fields on the pseudo quantum spin Hall effect and the phase transitions are studied. We show that an in-plane magnetic field drives a pseudo quantum spin Hall state to a metallic state at a high field. Moreover, at a fixed in-plane magnetic field, an increasing out-of-plane magnetic field leads to a reentrance of pseudo quantum spin Hall state in an inverted InAs/GaSb quantum well. The edge state probability distribution and Chern numbers are calculated to verify that the reentrant states are topologically nontrivial. The origin of the reentrant behavior is attributed to the nonmonotonic bending of Landau levels and the Landau level mixing caused by the orbital effect induced by the in-plane magnetic field. The robustness to disorder is demonstrated by the numerically calculated quantized conductance for disordered nanowires within Landauer-Büttiker formalism.
The Hall coefficient: a tool for characterizing graphene field effect transistors
International Nuclear Information System (INIS)
Wehrfritz, Peter; Seyller, Thomas
2014-01-01
Graphene field effect transistors are considered as a candidate for future high-frequency applications. For their realization, the optimal combination of substrate, graphene preparation, and insulator deposition and composition is required. This optimization must be based on an in-depth characterization of the obtained graphene insulator metal (GIM) stack. Hall effect measurements are frequently employed to study such systems, thereby focussing primarily on the charge carrier mobility. In this work we show how an analysis of the sheet Hall coefficient can reveal further important properties of the GIM stack, like, e.g., the interface trap density and the spacial charge inhomogeneity. To that end, we provide an extensive description of the GIM diode, which leads to an accurate calculation of the sheet Hall coefficient dependent on temperature and gate voltage. The gate dependent inverse sheet Hall coefficient is discussed in detail before we introduce the concept of an equivalent temperature, which is a measure of the spacial charge inhomogeneity. In order to test the concept, we apply it to evaluate already measured Hall data taken from the literature. This evaluation allows us to determine the Drude mobility, even at the charge neutrality point, which is inaccessible with a simple one band Hall mobility analysis, and to shed light on the spacial charge inhomogeneity. The formalism is easily adaptable and provides experimentalists a powerful tool for the characterization of their graphene field effect devices. (paper)
International Nuclear Information System (INIS)
Burrell, K. H.; Garofalo, A. M; Osborne, T. H.; Schaffer, M. J.; Snyder, P. B.; Solomon, W. M.; Park, J.-K.; Fenstermacher, M. E.
2012-01-01
Results from recent experiments demonstrate that quiescent H-mode (QH-mode) sustained by magnetic torque from non-axisymmetric magnetic fields is a promising operating mode for future burning plasmas. Using magnetic torque from n=3 fields to replace counter-I p torque from neutral beam injection (NBI), we have achieved long duration, counter-rotating QH-mode operation with NBI torque ranging from counter-I p to up to co-I p values of 1-1.3 Nm. This co-I p torque is 3 to 4 times the scaled torque that ITER will have. These experiments utilized an ITER-relevant lower single-null plasma shape and were done with ITER-relevant values of ν ped * and β N ped . These discharges exhibited confinement quality H 98y2 =1.3, in the range required for ITER. In preliminary experiments using n=3 fields only from a coil outside the toroidal coil, QH-mode plasmas with low q 95 =3.4 have reached fusion gain values of G=β N H 89 /q 95 2 =0.4, which is the desired value for ITER. Shots with the same coil configuration also operated with net zero NBI torque. The limits on G and co-I p torque have not yet been established for this coil configuration. QH-mode work to has made significant contact with theory. The importance of edge rotational shear is consistent with peeling-ballooning mode theory. Qualitative and quantitative agreements with the predicted neoclassical toroidal viscosity torque is seen.
Theory of the disordered ν =5/2 quantum thermal Hall state: Emergent symmetry and phase diagram
Lian, Biao; Wang, Juven
2018-04-01
Fractional quantum Hall (FQH) system at Landau level filling fraction ν =5 /2 has long been suggested to be non-Abelian, either Pfaffian (Pf) or antiPfaffian (APf) states by numerical studies, both with quantized Hall conductance σx y=5 e2/2 h . Thermal Hall conductances of the Pf and APf states are quantized at κx y=7 /2 and κx y=3 /2 , respectively, in a proper unit. However, a recent experiment shows the thermal Hall conductance of ν =5 /2 FQH state is κx y=5 /2 . It has been speculated that the system contains random Pf and APf domains driven by disorders, and the neutral chiral Majorana modes on the domain walls may undergo a percolation transition to a κx y=5 /2 phase. In this paper, we do perturbative and nonperturbative analyses on the domain walls between Pf and APf. We show the domain wall theory possesses an emergent SO(4) symmetry at energy scales below a threshold Λ1, which is lowered to an emergent U (1 )×U (1) symmetry at energy scales between Λ1 and a higher value Λ2, and is finally lowered to the composite fermion parity symmetry Z2F above Λ2. Based on the emergent symmetries, we propose a phase diagram of the disordered ν =5 /2 FQH system and show that a κx y=5 /2 phase arises at disorder energy scales Λ >Λ1 . Furthermore, we show the gapped double-semion sector of ND compact domain walls contributes nonlocal topological degeneracy 2ND-1, causing a low-temperature peak in the heat capacity. We implement a nonperturbative method to bootstrap generic topological 1 +1 D domain walls (two-surface defects) applicable to any 2 +1 D non-Abelian topological order. We also identify potentially relevant spin topological quantum field theories (TQFTs) for various ν =5 /2 FQH states in terms of fermionic version of U (1) ±8 Chern-Simons theory ×Z8 -class TQFTs.
Sub-grid-scale effects on short-wave instability in magnetized hall-MHD plasma
International Nuclear Information System (INIS)
Miura, H.; Nakajima, N.
2010-11-01
Aiming to clarify effects of short-wave modes on nonlinear evolution/saturation of the ballooning instability in the Large Helical Device, fully three-dimensional simulations of the single-fluid MHD and the Hall MHD equations are carried out. A moderate parallel heat conductivity plays an important role both in the two kinds of simulations. In the single-fluid MHD simulations, the parallel heat conduction effectively suppresses short-wave ballooning modes but it turns out that the suppression is insufficient in comparison to an experimental result. In the Hall MHD simulations, the parallel heat conduction triggers a rapid growth of the parallel flow and enhance nonlinear couplings. A comparison between single-fluid and the Hall MHD simulations reveals that the Hall MHD model does not necessarily improve the saturated pressure profile, and that we may need a further extension of the model. We also find by a comparison between two Hall MHD simulations with different numerical resolutions that sub-grid-scales of the Hall term should be modeled to mimic an inverse energy transfer in the wave number space. (author)
International Nuclear Information System (INIS)
Wang Bo; Ma Zhongshui; Zhang, C
2012-01-01
We demonstrate that the trigonal warping observed in bilayer graphene is doubled in the presence of Rashba spin-orbit (RSO) coupling, i.e. the Dirac points along the three-fold symmetry axis are doubled. There are now seven Dirac points. Furthermore, the RSO interaction breaks the electron-hole symmetry of the magnetic band structure. The most intriguing feature is that the step of the quantum Hall plateau at zero energy is four times that at finite energy. The number of Dirac points and the zero energy Hall step are only determined by the existence of RSO coupling, but are independent of the strength of the coupling. The robustness of these phenomena suggests equivalence between the RSO coupling and the topological effect in bilayer coupling.
Hallé SHINE on Manchester: Evaluation Report and Executive Summary
Menzies, Victoria; Kasim, Adetayo; Kokotsaki, Dimitra; Hewitt, Catherine; Akhter, Nasima; Collyer, Clare; Younger, Kirsty; Wiggins, Andy; Torgerson, Carole
2016-01-01
The "Hallé SHINE on Manchester" (HSoM) programme is a Saturday school educational programme designed to increase the reading and maths attainment, as well as engagement with school, of underachieving and disadvantaged pupils at Key Stage 2. Developed in collaboration between the SHINE Trust and Hallé Orchestra, the intervention provides…
Josephson tunneling in bilayer quantum Hall system
International Nuclear Information System (INIS)
Ezawa, Z.F.; Tsitsishvili, G.; Sawada, A.
2012-01-01
A Bose–Einstein condensation is formed by composite bosons in the quantum Hall state. A composite boson carries the fundamental charge (−e). We investigate Josephson tunneling of such charges in the bilayer quantum Hall system at the total filling ν=1. We show the existence of the critical current for the tunneling current to be coherent and dissipationless. Our results explain recent experiments due to [L. Tiemann, Y. Yoon, W. Dietsche, K. von Klitzing, W. Wegscheider, Phys. Rev. B 80 (2009) 165120] and due to [Y. Yoon, L. Tiemann, S. Schmult, W. Dietsche, K. von Klitzing, Phys. Rev. Lett. 104 (2010) 116802]. We predict also how the critical current changes as the sample is tilted in the magnetic field. -- Highlights: ► Composite bosons undergo Bose–Einstein condensation to form the bilayer quantum Hall state. ► A composite boson is a single electron bound to a flux quantum and carries one unit charge. ► Quantum coherence develops due to the condensation. ► Quantum coherence drives the supercurrent in each layer and the tunneling current. ► There exists the critical input current so that the tunneling current is coherent and dissipationless.
Mesoscopic spin Hall effect in semiconductor nanostructures
Zarbo, Liviu
The spin Hall effect (SHE) is a name given to a collection of diverse phenomena which share two principal features: (i) longitudinal electric current flowing through a paramagnetic semiconductor or metallic sample leads to transverse spin current and spin accumulation of opposite sign at opposing lateral edges; (ii) SHE does not require externally applied magnetic field or magnetic ordering in the equilibrium state of the sample, instead it relies on the presence of spin-orbit (SO) couplings within the sample. This thesis elaborates on a new type of phenomenon within the SHE family, predicted in our recent studies [Phys. Rev. B 72, 075361 (2005); Phys. Rev. Lett. 95, 046601 (2005); Phys. Rev. B 72, 075335 (2005); Phys. Rev. B 73 , 075303 (2006); and Europhys. Lett. 77, 47004 (2007)], where pure spin current flows through the transverse electrodes attached to a clean finitesize two-dimensional electron gas (2DEG) due to unpolarized charge current injected through its longitudinal leads. If transverse leads are removed, the effect manifests as nonequilibrium spin Hall accumulation at the lateral edges of 2DEG wires. The SO coupling driving this SHE effect is of the Rashba type, which arises due to structural inversion asymmetry of semiconductor heterostructure hosting the 2DEG. We term the effect "mesoscopic" because the spin Hall currents and accumulations reach optimal value in samples of the size of the spin precession length---the distance over which the spin of an electron precesses by an angle pi. In strongly SO-coupled structures this scale is of the order of ˜100 nm, and, therefore, mesoscopic in the sense of being much larger than the characteristic microscopic scales (such as the Fermi wavelength, screening length, or the mean free path in disordered systems), but still much smaller than the macroscopic ones. Although the first theoretical proposal for SHE, driven by asymmetry in SO-dependent scattering of spin-up and spin-down electrons off impurities
Linear waves in a resistive plasma with Hall current
International Nuclear Information System (INIS)
Almaguer, J.A.
1992-01-01
Dispersion relations for the case of a magnetized plasma are determined taking into account the Hall current and a constant resistivity, η, in Ohm's law. It is found that the Hall effect is relevant only for parallel (to the equilibrium magnetic field) wave numbers in the case of uniform plasmas, giving place to a dispersive behavior. In particular, the cases of η→0 and small (nonzero) resistivity are discussed
Thermoelectric and Hall-effect studies in hydrogenerated nickel foils
International Nuclear Information System (INIS)
Rani, R.; Nigam, A.N.
1978-01-01
Thermo e.m.f. and Hall constant of hydrogenerated nickel foils have been measured. Termo e.m.f. shows a sign reversal which is not due to the change in sign of the charge carriers, as indicated by the Hall-effect measurements. To account for the sign reversal of thermo e.m.f., it is found necessary to take into account the surface states of chemisorbed hydrogen on nickel
Hall probe for measuring high currents in superconducting coils
International Nuclear Information System (INIS)
Ferendeci, A.M.
1986-01-01
Constructional details of a compact Hall probe for measuring high currents in superconducting coils are given. The Hall probe is easy to assemble and can be inserted or removed from the system without breaking the superconducting loop. Upper current limit of the probe can be increased by using larger magnetic core material. Shielding becomes necessary if the probe holder is to be placed near large current dependent magnetic fields
Multi-region relaxed Hall magnetohydrodynamics with flow
Energy Technology Data Exchange (ETDEWEB)
Lingam, Manasvi, E-mail: mlingam@princeton.edu [Department of Astrophysical Sciences, Princeton University, Princeton, New Jersey 08544 (United States); Abdelhamid, Hamdi M., E-mail: hamdi@ppl.k.u-tokyo.ac.jp [Graduate School of Frontier Sciences, The University of Tokyo, Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Physics Department, Faculty of Science, Mansoura University, Mansoura 35516 (Egypt); Hudson, Stuart R., E-mail: shudson@pppl.gov [Princeton Plasma Physics Laboratory, PO Box 451, Princeton, New Jersey 08543 (United States)
2016-08-15
The recent formulations of multi-region relaxed magnetohydrodynamics (MRxMHD) have generalized the famous Woltjer-Taylor states by incorporating a collection of “ideal barriers” that prevent global relaxation and flow. In this paper, we generalize MRxMHD with flow to include Hall effects, and thereby obtain the partially relaxed counterparts of the famous double Beltrami states as a special subset. The physical and mathematical consequences arising from the introduction of the Hall term are also presented. We demonstrate that our results (in the ideal MHD limit) constitute an important subset of ideal MHD equilibria, and we compare our approach against other variational principles proposed for deriving the partially relaxed states.
Anomalous field dependence of the Hall coefficient in disordered metals
International Nuclear Information System (INIS)
Tousson, E.; Ovadyahu, Z.
1988-01-01
We report on a comprehensive study of the Hall coefficient, R/sub H/, in disordered three-dimensional In 2 O/sub 3-//sub x/ films as a function of the magnetic field strength, temperature, and degree of spatial disorder. Our main result is that, at sufficiently small fields, R/sub H/ is virtually temperature, field, and disorder independent, even at the metal-insulator transition itself. On the other hand, at the limit of strong magnetic fields, R/sub H/ has an explicit temperature dependence, in apparent agreement with the prediction of Al'tshuler, Aronov, and Lee. For intermediate values of fields, R/sub H/ is field and temperature dependent. It is also shown that the behavior of the conductivity as a function of temperature, σ(T), at small fields, is qualitatively different than that measured at the limit of strong magnetic fields. The low- and high-field regimes seem to correlate with the respective regimes in terms of the Hall-coefficient behavior. It is suggested that the magnetotransport in the high-field limit is considerably influenced by Coulomb-correlation effects. However, in the low-field regime, where both correlations and weak-localization effects are, presumably, equally important (and where both theories are the more likely to be valid), is problematic; neither R/sub H/ nor σ(T) gives any unambiguous evidence to the existence of interaction effects. This problem is discussed in light of the experimental results pertaining to the behavior of R/sub H/(T) in two-dimensional In 2 O/sub 3-//sub x/ films as well as in other disordered systems
Schmitz, R. G.; Alves, M. V.; Barbosa, M. V. G.
2017-12-01
One of the most important processes that occurs in Earth's magnetosphere is known as magnetic reconnection (MR). This process can be symmetric or asymmetric, depending basically on the plasma density and magnetic field in both sides of the current sheet. A good example of symmetric reconnection in terrestrial magnetosphere occurs in the magnetotail, where these quantities are similar on the north and south lobes. In the dayside magnetopause MR is asymmetric, since the plasma regimes and magnetic fields of magnetosheath and magnetosphere are quite different. Symmetric reconnection has some unique signatures. For example, the formation of a quadrupolar structure of Hall magnetic field and a bipolar Hall electric field that points to the center of the current sheet. The different particle motions in the presence of asymmetries change these signatures, causing the quadrupolar pattern to be distorted and forming a bipolar structure. Also, the bipolar Hall electric field is modified and gives rise to a single peak pointing toward the magnetosheat, considering an example of magnetopause reconnection. The presence of a guide-field can also distort the quadrupolar pattern, by giving a shear angle across the current sheet and altering the symmetric patterns, according to previous simulations and observations. Recently, a quadrupolar structure was observed in an asymmetric guide-field MR event using MMS (Magnetospheric Multiscale) mission data [Peng et al., JGR, 2017]. This event shows clearly that the density asymmetry and the guide-field were not sufficient to form signatures of asymmetric reconnection. Using the particle-in-cell code iPIC3D [Markidis et al, Mathematics and Computers in Simulation, 2010] with the MMS data from this event used to define input parameters, we found a quadrupolar structure of Hall magnetic field and a bipolar pattern of Hall electric field in ion scales, showing that our results are in an excellent agreement with the MMS observations. To our
Mini array of quantum Hall devices based on epitaxial graphene
International Nuclear Information System (INIS)
Novikov, S.; Lebedeva, N.; Hämäläinen, J.; Iisakka, I.; Immonen, P.; Manninen, A. J.; Satrapinski, A.
2016-01-01
Series connection of four quantum Hall effect (QHE) devices based on epitaxial graphene films was studied for realization of a quantum resistance standard with an up-scaled value. The tested devices showed quantum Hall plateaux R H,2 at a filling factor v = 2 starting from a relatively low magnetic field (between 4 T and 5 T) when the temperature was 1.5 K. The precision measurements of quantized Hall resistance of four QHE devices connected by triple series connections and external bonding wires were done at B = 7 T and T = 1.5 K using a commercial precision resistance bridge with 50 μA current through the QHE device. The results showed that the deviation of the quantized Hall resistance of the series connection of four graphene-based QHE devices from the expected value of 4×R H,2 = 2 h/e 2 was smaller than the relative standard uncertainty of the measurement (<1 × 10 −7 ) limited by the used resistance bridge.
Glass transition behaviour of the quaternary ammonium type ionic liquid, {[DEME][I] + H2O} mixtures
International Nuclear Information System (INIS)
Imai, Yusuke; Abe, Hiroshi; Matsumoto, Hitoshi; Shimada, Osamu; Hanasaki, Tomonori; Yoshimura, Yukihiro
2011-01-01
By a simple DTA system, the glass transition temperatures of the quaternary ammonium type ionic liquid, {N,N-diethyl-N-methyl-N-(2-methoxyethyl) ammonium iodide, [DEME][I] + H 2 O} mixtures after quick pre-cooling were measured as a function of water concentration (x mol% H 2 O). Results were compared with the previous results of {[DEME][BF 4 ] + H 2 O} mixtures in which double glass transitions were observed in the water concentration region of (16.5 to 30.0) mol% H 2 O. Remarkably, we observed the double glass transition phenomenon in {[DEME][I] + H 2 O} mixtures too, but the two-T g s regions lie towards the water-rich side of (77.5 to 85.0) mol% H 2 O. These clearly reflect the difference in the anionic effect between BF 4 - and I - on the water structure. The end of the glass-formation region of {[DEME][I] + H 2 O} mixtures is around x = 95.0 mol% H 2 O, and this is comparable to that of {[DEME][BF 4 ] + H 2 O} mixtures (x = 96.0 mol% H 2 O).
Music hall Markneukirchen; Musikhalle in Markneukirchen
Energy Technology Data Exchange (ETDEWEB)
Anon.
1996-01-01
The article presents the new building of the music hall Markneukirchen. From the planned use of the building result very high demands on the ventilation system in order to keep to a sound power level of less than 30 dB(A) in the hall. The building services are dealt with using numerous flowsheets and diagrams: Heat supply, ventilation system, sanitary system, building management, instrumentation and control, electric and lighting systems. (BWI) [Deutsch] Der vorliegende Beitrag stellt den Neubau der Musikhalle Markneukirchen vor. Durch das Nutzungskonzept ergeben sich fuer die Einhaltung eines Schalleistungspegels von weniger als 30 dB(A) im Saalbereich an die Lueftungsanlage sehr hohe Ansprueche. Es werden die raumlufttechnischen Anlagen anhand zahlreicher Flussbilder und Abbildungen vorgestellt: Waermeversorgung, Lueftungstechnik, Sanitaertechnik, Gebaeudeleit- und MSR-Technik, Elektro- und Lichttechnik. (BWI)
Assembly Hall de la Universidad de Illinois, USA
Directory of Open Access Journals (Sweden)
Harrison & Abramovitz, Arquitectos
1970-05-01
Full Text Available The Assembly Hall of Illinois University has been constructed with an original reinforced and prestressed concrete structure. It has a seating capacity for 15,565 spectators, in addition to space for press, radio and TV. staff, for the performers, and for invalid spectators who use wheeled chairs. The seating capacity can be further extended by providing 1,500 portable chairs. This hall can be adapted to many uses, and has suitable equipment and installations for assemblies, theatrical and musical performances, ice skating, sports competitions and circus shows. The provision of this magnificent hall has made it possible to organise at the University of Illinois many activities that were not practicable before.Con una original estructura realizada a base de hormigón armado y pretensado ha sido construido el «Assembly Hall», de la Universidad de Illinois, con capacidad para 15.565 espectadores sentados —además de los espacios reservados a los representantes de la prensa, radio y T.V., artistas y espectadores inválidos que acudan en carritos de ruedas—. Puede ser ampliada colocando unas 1.500 sillas portátiles. El edificio está destinado a múltiples usos y dispone de los equipos e instalaciones adecuadas para todo tipo de celebraciones: asambleas, representaciones teatrales y musicales; espectáculos de: circo, patinaje sobre hielo, competiciones deportivas, etc., y ha permitido organizar, en el seno de la Universidad de Illinois, una serie de actividades que antes resultaban imposibles.
Hall Thruster Thermal Modeling and Test Data Correlation
Myers, James; Kamhawi, Hani; Yim, John; Clayman, Lauren
2016-01-01
The life of Hall Effect thrusters are primarily limited by plasma erosion and thermal related failures. NASA Glenn Research Center (GRC) in cooperation with the Jet Propulsion Laboratory (JPL) have recently completed development of a Hall thruster with specific emphasis to mitigate these limitations. Extending the operational life of Hall thursters makes them more suitable for some of NASA's longer duration interplanetary missions. This paper documents the thermal model development, refinement and correlation of results with thruster test data. Correlation was achieved by minimizing uncertainties in model input and recognizing the relevant parameters for effective model tuning. Throughout the thruster design phase the model was used to evaluate design options and systematically reduce component temperatures. Hall thrusters are inherently complex assemblies of high temperature components relying on internal conduction and external radiation for heat dispersion and rejection. System solutions are necessary in most cases to fully assess the benefits and/or consequences of any potential design change. Thermal model correlation is critical since thruster operational parameters can push some components/materials beyond their temperature limits. This thruster incorporates a state-of-the-art magnetic shielding system to reduce plasma erosion and to a lesser extend power/heat deposition. Additionally a comprehensive thermal design strategy was employed to reduce temperatures of critical thruster components (primarily the magnet coils and the discharge channel). Long term wear testing is currently underway to assess the effectiveness of these systems and consequently thruster longevity.
2D massless QED Hall half-integer conductivity and graphene
International Nuclear Information System (INIS)
Martínez, A Pérez; Querts, E Rodriguez; Rojas, H Pérez; Gaitan, R; Rodriguez-Romo, S
2011-01-01
Starting from the photon self-energy tensor in a magnetized medium, the 3D complete antisymmetric form of the conductivity tensor is found in the static limit of a fermion system C-non-invariant under fermion–antifermion exchange. The massless relativistic 2D fermion limit in QED is derived by using the compactification along the dimension parallel to the magnetic field. In the static limit and at zero temperature, the main features of the quantum Hall effect (QHE) are obtained: the half-integer QHE and the minimum value proportional to e 2 /h for the Hall conductivity. For typical values of graphene the plateaus of the Hall conductivity are also reproduced. (paper)
Modular invariance, universality and crossover in the quantum Hall effect
International Nuclear Information System (INIS)
Dolan, Brian P.
1999-01-01
An analytic form for the conductivity tensor in crossover between two quantum Hall plateaux is derived, which appears to be in good agreement with existing experimental data. The derivation relies on an assumed symmetry between quantum Hall states, a generalisation of the law of corresponding states from rational filling factors to complex conductivity, which has a mathematical expression in terms of an action of the modular group on the upper-half complex conductivity plane. This symmetry implies universality in quantum Hall crossovers. The assumption that the β-function for the complex conductivity is a complex analytic function, together with some experimental constraints, results in an analytic expression for the crossover, as a function of the external magnetic field
Diaphragm Effect of Steel Space Roof Systems in Hall Structures
Directory of Open Access Journals (Sweden)
Mehmet FENKLİ
2015-09-01
Full Text Available Hall structures have been used widely for different purposes. They have are reinforced concrete frames and shear wall with steel space roof systems. Earthquake response of hall structures is different from building type structures. One of the most critical nodes is diaphragm effect of steel space roof on earthquake response of hall structures. Diaphragm effect is depending on lateral stiffness capacity of steel space roof system. Lateral stiffness of steel space roof system is related to modulation geometry, support conditions, selected sections and system geometry. In current paper, three representative models which are commonly used in Turkey were taken in to account for investigation. Results of numerical tests were present comparatively
Ahn, Junyeong; Yang, Bohm-Jung
2017-04-01
We study a topological phase transition between a normal insulator and a quantum spin Hall insulator in two-dimensional (2D) systems with time-reversal and twofold rotation symmetries. Contrary to the case of ordinary time-reversal invariant systems, where a direct transition between two insulators is generally predicted, we find that the topological phase transition in systems with an additional twofold rotation symmetry is mediated by an emergent stable 2D Weyl semimetal phase between two insulators. Here the central role is played by the so-called space-time inversion symmetry, the combination of time-reversal and twofold rotation symmetries, which guarantees the quantization of the Berry phase around a 2D Weyl point even in the presence of strong spin-orbit coupling. Pair creation and pair annihilation of Weyl points accompanying partner exchange between different pairs induces a jump of a 2D Z2 topological invariant leading to a topological phase transition. According to our theory, the topological phase transition in HgTe /CdTe quantum well structure is mediated by a stable 2D Weyl semimetal phase because the quantum well, lacking inversion symmetry intrinsically, has twofold rotation about the growth direction. Namely, the HgTe /CdTe quantum well can show 2D Weyl semimetallic behavior within a small but finite interval in the thickness of HgTe layers between a normal insulator and a quantum spin Hall insulator. We also propose that few-layer black phosphorus under perpendicular electric field is another candidate system to observe the unconventional topological phase transition mechanism accompanied by the emerging 2D Weyl semimetal phase protected by space-time inversion symmetry.
A Residential Paradox?: Residence Hall Attributes and College Student Outcomes
Bronkema, Ryan; Bowman, Nicholas A.
2017-01-01
The researchers of this brief observed that few environments have the potential to shape the outcomes of college students as much as residence halls. As a result, residence halls have the capacity to foster a strong sense of community as well as other important outcomes such as college satisfaction and academic achievement. However, given the high…
Voltage transients in thin-film InSb Hall sensor
Directory of Open Access Journals (Sweden)
Alexey Bardin
Full Text Available The work is reached to study temperature transients in thin-film Hall sensors. We experimentally study InSb thin-film Hall sensor. We find transients of voltage with amplitude about 10 μV on the sensor ports after current switching. We demonstrate by direct measurements that the transients is caused by thermo-e.m.f., and both non-stationarity and heterogeneity of temperature in the film. We find significant asymmetry of temperature field for different direction of the current, which is probably related to Peltier effect. The result can be useful for wide range of scientist who works with switching of high density currents in any thin semiconductor films. 2000 MSC: 41A05, 41A10, 65D05, 65D17, Keywords: Thin-films, Semiconductors, Hall sensor, InSb, thermo-e.m.f.
Complex scattering dynamics and the quantum Hall effects
International Nuclear Information System (INIS)
Trugman, S.A.
1994-01-01
We review both classical and quantum potential scattering in two dimensions in a magnetic field, with applications to the quantum Hall effect. Classical scattering is complex, due to the approach of scattering states to an infinite number of dynamically bound states. Quantum scattering follows the classical behavior rather closely, exhibiting sharp resonances in place of the classical bound states. Extended scatterers provide a quantitative explanation for the breakdown of the QHE at a comparatively small Hall voltage as seen by Kawaji et al., and possibly for noise effects
Spin Hall magnetoresistance in antiferromagnet/normal metal bilayers
Manchon, Aurelien
2017-01-01
We investigate the emergence of spin Hall magnetoresistance in a magnetic bilayer composed of a normal metal adjacent to an antiferromagnet. Based on a recently derived drift diffusion equation, we show that the resistance of the bilayer depends on the relative angle between the direction transverse to the current flow and the Néel order parameter. While this effect presents striking similarities with the spin Hall magnetoresistance recently reported in ferromagnetic bilayers, its physical origin is attributed to the anisotropic spin relaxation of itinerant spins in the antiferromagnet.
Hypervalent Compounds as Ligands: I 3 -Anion Adducts with Transition Metal Pentacarbonyls
Rogachev, Andrey Yu.
2013-06-17
Just a couple of transition metal complexes of the familiar triiodide anion are known. To investigate the bonding in these, as well as isomeric possibilities, we examined theoretically adducts of I3 - with model organometallic fragments, [Cr(CO)5] and [Mn(CO) 5]+. Bonding energy computations were augmented by a Natural Bond Orbital (NBO) perturbation theory analysis and Energy Decomposition Analysis (EDA). The bonding between I3 - and the organometallic fragment is substantial, especially for the electrostatically driven anion-cation case. "End-on" coordination is favored by 5-13 kcal/mol over "side-on" (to the central I of I3 -), with a ∼10 kcal/mol barrier for isomerization. A developing asymmetry in the I-I bonding of "end-on" coordinated I 3 - led us to consider in some detail the obvious fragmentation to a coordinated I- and free I2. While the signs of incipient fragmentation in that direction are there, these is a definite advantage to maintaining some I- to I2 bonding in triiodide complexes. © 2013 American Chemical Society.
Spin Hall effect by surface roughness
Zhou, Lingjun; Grigoryan, Vahram L.; Maekawa, Sadamichi; Wang, Xuhui; Xiao, Jiang
2015-01-01
induced by surface roughness subscribes only to the side-jump contribution but not the skew scattering. The paradigm proposed in this paper provides the second, not if only, alternative to generate a sizable spin Hall effect.
DEFF Research Database (Denmark)
Blaabjerg, Frede; Teodorescu, Remus; Fatu, M.
2008-01-01
This paper proposes a novel hybrid motion- sensorless control system for permanent magnet synchronous motors (PMSM) using a new robust start-up method called I-f control, and a smooth transition to emf-based vector control. The I-f method is based on separate control of id, iq currents with the r......This paper proposes a novel hybrid motion- sensorless control system for permanent magnet synchronous motors (PMSM) using a new robust start-up method called I-f control, and a smooth transition to emf-based vector control. The I-f method is based on separate control of id, iq currents......-adaptive compensator to eliminate dc-offset and phase-delay. Digital simulations for PMSM start-up with full load torque are presented for different initial rotor-positions. The transitions from I-f to emf motion-sensorless vector control and back as well, at very low-speeds, are fully validated by experimental...
On electrostatic acceleration of plasmas with the Hall effect using electrode shaping
International Nuclear Information System (INIS)
Wang, Zhehui; Barnes, Cris W.
2001-01-01
Resistive magnetohydrodynamics (MHD) is used to model the electromagnetic acceleration of plasmas in coaxial channels. When the Hall effect is considered, the inclusion of resistivity is necessary to obtain physically meaningful solutions. In resistive MHD with the Hall effect, if and only if the electric current and the plasma flow are orthogonal (J·U=0), then there is a conserved quantity, in the form of U 2 /2+w+eΦ/M, along the flow, where U is the flow velocity, Φ is the electric potential, w is the enthalpy, and M is the ion mass. New solutions suggest that in coaxial geometry the Hall effect along the axial plasma flow can be balanced by proper shaping of conducting electrodes, with acceleration then caused by an electrostatic potential drop along the streamlines of the flow. The Hall effect separation of ion and electron flow then just cancels the electrostatic charge separation. Assuming particle ionization increases with energy density in the system, the resulting particle flow rates (J p ) scales with accelerator bias (V bias ) as J p ∝V bias 2 , exceeding the Child--Langmuir limit. The magnitude of the Hall effect (as determined by the Morozov Hall parameter, Ξ, which is defined as the ratio of electric current to particle current) is related to the energy needed for the creation of each ion--electron pair
Phase transition and field effect topological quantum transistor made of monolayer MoS2
Simchi, H.; Simchi, M.; Fardmanesh, M.; Peeters, F. M.
2018-06-01
We study topological phase transitions and topological quantum field effect transistor in monolayer molybdenum disulfide (MoS2) using a two-band Hamiltonian model. Without considering the quadratic (q 2) diagonal term in the Hamiltonian, we show that the phase diagram includes quantum anomalous Hall effect, quantum spin Hall effect, and spin quantum anomalous Hall effect regions such that the topological Kirchhoff law is satisfied in the plane. By considering the q 2 diagonal term and including one valley, it is shown that MoS2 has a non-trivial topology, and the valley Chern number is non-zero for each spin. We show that the wave function is (is not) localized at the edges when the q 2 diagonal term is added (deleted) to (from) the spin-valley Dirac mass equation. We calculate the quantum conductance of zigzag MoS2 nanoribbons by using the nonequilibrium Green function method and show how this device works as a field effect topological quantum transistor.
Hall mobility of free charge carriers in highly compensated p-Germanium
International Nuclear Information System (INIS)
Gavrilyuk, V.Yi.; Kirnas, Yi.G.; Balakyin, V.D.
2000-01-01
Hall mobility of free charge carriers in initial detectors Ge (Ga) is studied. It is established that an increase in the compensation factor results in the enlargement of Hall mobility in germanium highly compensated by introduction of Li ions during their drift in an electrical field
Quasi-one-dimensional Hall physics in the Harper–Hofstadter–Mott model
Kozarski, Filip; Hügel, Dario; Pollet, Lode
2018-04-01
We study the ground-state phase diagram of the strongly interacting Harper–Hofstadter–Mott model at quarter flux on a quasi-one-dimensional lattice consisting of a single magnetic flux quantum in y-direction. In addition to superfluid phases with various density patterns, the ground-state phase diagram features quasi-one-dimensional analogs of fractional quantum Hall phases at fillings ν = 1/2 and 3/2, where the latter is only found thanks to the hopping anisotropy and the quasi-one-dimensional geometry. At integer fillings—where in the full two-dimensional system the ground-state is expected to be gapless—we observe gapped non-degenerate ground-states: at ν = 1 it shows an odd ‘fermionic’ Hall conductance, while the Hall response at ν = 2 consists of the transverse transport of a single particle–hole pair, resulting in a net zero Hall conductance. The results are obtained by exact diagonalization and in the reciprocal mean-field approximation.
Paired quantum Hall states on noncommutative two-tori
Energy Technology Data Exchange (ETDEWEB)
Marotta, Vincenzo [Dipartimento di Scienze Fisiche, Universita di Napoli ' Federico II' and INFN, Sezione di Napoli, Compl. universitario M. Sant' Angelo, Via Cinthia, 80126 Napoli (Italy); Naddeo, Adele, E-mail: naddeo@sa.infn.i [CNISM, Unita di Ricerca di Salerno and Dipartimento di Fisica ' E. R. Caianiello' , Universita degli Studi di Salerno, Via Salvador Allende, 84081 Baronissi (Italy)
2010-08-01
By exploiting the notion of Morita equivalence for field theories on noncommutative tori and choosing rational values of the noncommutativity parameter theta (in appropriate units), a one-to-one correspondence between an Abelian noncommutative field theory (NCFT) and a non-Abelian theory of twisted fields on ordinary space can be established. Starting from this general result, we focus on the conformal field theory (CFT) describing a quantum Hall fluid (QHF) at paired states fillings nu=m/(pm+2) Cristofano et al. (2000) , recently obtained by means of m-reduction procedure, and show that it is the Morita equivalent of a NCFT. In this way we extend the construction proposed in Marotta and Naddeo (2008) for the Jain series nu=m/(2pm+1) . The case m=2 is explicitly discussed and the role of noncommutativity in the physics of quantum Hall bilayers is emphasized. Our results represent a step forward the construction of a new effective low energy description of certain condensed matter phenomena and help to clarify the relationship between noncommutativity and quantum Hall fluids.
ADHM and the 4d quantum Hall effect
Barns-Graham, Alec; Dorey, Nick; Lohitsiri, Nakarin; Tong, David; Turner, Carl
2018-04-01
Yang-Mills instantons are solitonic particles in d = 4 + 1 dimensional gauge theories. We construct and analyse the quantum Hall states that arise when these particles are restricted to the lowest Landau level. We describe the ground state wavefunctions for both Abelian and non-Abelian quantum Hall states. Although our model is purely bosonic, we show that the excitations of this 4d quantum Hall state are governed by the Nekrasov partition function of a certain five dimensional supersymmetric gauge theory with Chern-Simons term. The partition function can also be interpreted as a variant of the Hilbert series of the instanton moduli space, counting holomorphic sections rather than holomorphic functions. It is known that the Hilbert series of the instanton moduli space can be rewritten using mirror symmetry of 3d gauge theories in terms of Coulomb branch variables. We generalise this approach to include the effect of a five dimensional Chern-Simons term. We demonstrate that the resulting Coulomb branch formula coincides with the corresponding Higgs branch Molien integral which, in turn, reproduces the standard formula for the Nekrasov partition function.
Mission and System Advantages of Iodine Hall Thrusters
Dankanich, John W.; Szabo, James; Pote, Bruce; Oleson, Steve; Kamhawi, Hani
2014-01-01
The exploration of alternative propellants for Hall thrusters continues to be of interest to the community. Investments have been made and continue for the maturation of iodine based Hall thrusters. Iodine testing has shown comparable performance to xenon. However, iodine has a higher storage density and resulting higher ?V capability for volume constrained systems. Iodine's vapor pressure is low enough to permit low-pressure storage, but high enough to minimize potential adverse spacecraft-thruster interactions. The low vapor pressure also means that iodine does not condense inside the thruster at ordinary operating temperatures. Iodine is safe, it stores at sub-atmospheric pressure, and can be stored unregulated for years on end; whether on the ground or on orbit. Iodine fills a niche for both low power (10kW) electric propulsion regimes. A range of missions have been evaluated for direct comparison of Iodine and Xenon options. The results show advantages of iodine Hall systems for both small and microsatellite application and for very large exploration class missions.
Stuart Hall and Cultural Studies, circa 1983
Directory of Open Access Journals (Sweden)
Ann Curthoys
2017-11-01
Full Text Available Stuart Hall sought to internationalise theoretical debates and to create Cultural Studies as interdisciplinary. We chart his theoretical journey through a detailed examination of a series of lectures delivered in 1983 and now published for the first time. In these lectures, he discusses theorists such as E.P. Thompson, Raymond Williams, Louis Althusser, Levi Strauss and Antonio Gramsci, and explores the relationship between ideas and social structure, the specificities of class and race, and the legacies of slavery. We note his turn towards metaphors of divergence and dispersal and highlight how autobiographical and deeply personal Hall is in these lectures, especially in his ego histoire moment of traumatic memory recovery.
Hall magnetohydrodynamics: Conservation laws and Lyapunov stability
International Nuclear Information System (INIS)
Holm, D.D.
1987-01-01
Hall electric fields produce circulating mass flow in confined ideal-fluid plasmas. The conservation laws, Hamiltonian structure, equilibrium state relations, and Lyapunov stability conditions are presented here for ideal Hall magnetohydrodynamics (HMHD) in two and three dimensions. The approach here is to use the remarkable array of nonlinear conservation laws for HMHD that follow from its Hamiltonian structure in order to construct explicit Lyapunov functionals for the HMHD equilibrium states. In this way, the Lyapunov stability analysis provides classes of HMHD equilibria that are stable and whose linearized initial-value problems are well posed (in the sense of possessing continuous dependence on initial conditions). Several examples are discussed in both two and three dimensions
Coulomb blockade in hierarchical quantum Hall droplets
International Nuclear Information System (INIS)
Cappelli, Andrea; Georgiev, Lachezar S; Zemba, Guillermo R
2009-01-01
The degeneracy of energy levels in a quantum dot of Hall fluid, leading to conductance peaks, can be readily derived from the partition functions of conformal field theory. Their complete expressions can be found for Hall states with both Abelian and non-Abelian statistics, upon adapting known results for the annulus geometry. We analyze the Abelian states with hierarchical filling fractions, ν = m/(mp ± 1), and find a non-trivial pattern of conductance peaks. In particular, each one of them occurs with a characteristic multiplicity, which is due to the extended symmetry of the m-folded edge. Experimental tests of the multiplicity can shed more light on the dynamics of this composite edge. (fast track communication)
DEFF Research Database (Denmark)
Olsen, Thomas
2016-01-01
opportunity to change the local topology by adsorption of atoms or molecules and thus comprise an ideal platform for designing topological heterostructures. Here we apply first-principles calculations to show that the quantum spin Hall insulator 1T'-MoS2 exhibits a phase transition to a trivial insulator upon....... This is in sharp contrast to topological edge states, which typically exhibit strong dispersion that are sensitive to a particular edge termination. The heterostructure is also suggestive of a simple design of one-dimensional metallic networks in sheets of 1T'-MoS2....
Theory of fractional quantum hall effect
International Nuclear Information System (INIS)
Kostadinov, I.Z.
1985-08-01
A theory of the Fractional Quantum Hall Effect is constructed based on magnetic flux fractionization, which lead to instability of the system against selfcompression. A theorem is proved stating that arbitrary potentials fail to lift a specific degeneracy of the Landau level. For the case of 1/3 fractional filling a model 3-particles interaction is constructed breaking the symmetry. The rigid 3-particles wave function plays the role of order parameter. In a BCS type of theory the gap in the single particles spectrum is produced by the 3-particles interaction. The mean field critical behaviour and critical parameters are determined as well as the Ginsburg-Landau equation coefficients. The Hall conductivity is calculated from the first principles and its temperature dependence is found. The simultaneous tunnelling of 3,5,7 etc. electrons and quantum interference effects are predicted. (author)
Patrice Loiez
2004-01-01
To mark the 50th Anniversary of the founding of CERN, a day of tours, displays and presentations was held in October 2004. The assembly halls for the experiments that were waiting to be installed on the LHC, such as ATLAS shown here, were transformed into display areas and cafés.
Non-Abelian fractional quantum Hall states for hard-core bosons in one dimension
Paredes, Belén
2012-05-01
I present a family of one-dimensional bosonic liquids analogous to non-Abelian fractional quantum Hall states. A new quantum number is introduced to characterize these liquids, the chiral momentum, which differs from the usual angular or linear momentum in one dimension. As their two-dimensional counterparts, these liquids minimize a k-body hard-core interaction with the minimum total chiral momentum. They exhibit global order, with a hidden organization of the particles in k identical copies of a one-dimensional Laughlin state. For k=2 the state is a p-wave paired phase corresponding to the Pfaffian quantum Hall state. By imposing conservation of the total chiral momentum, an exact parent Hamiltonian is derived which involves long-range tunneling and interaction processes with an amplitude decaying with the chord distance. This family of non-Abelian liquids is shown to be in formal correspondence with a family of spin-(k)/(2) liquids which are total singlets made out of k indistinguishable resonating valence bond states. The corresponding spin Hamiltonians are obtained.
High-pressure single-crystal elasticity study of CO{sub 2} across phase I-III transition
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jin S., E-mail: zhang72@illinois.edu; Bass, Jay D. [Department of Geology, University of Illinois, Urbana-Champaign, Illinois 61801 (United States); Shieh, Sean R. [Departments of Earth Sciences and Physics and Astronomy, University of Western Ontario, London, Ontario N6A 5B7 (Canada); Dera, Przemyslaw [Hawaii Institute of Geophysics and Planetology, University of Hawaii at Manoa, Honolulu, Hawaii 96822 (United States); Prakapenka, Vitali [Center for Advanced Radiation Sources, University of Chicago, Chicago, Illinois 60637 (United States)
2014-04-07
Sound velocities and elastic moduli of solid single-crystal CO{sub 2} were measured at pressures up to 11.7(3) GPa by Brillouin spectroscopy. The aggregate adiabatic bulk modulus (K{sub S}), shear modulus (G), and their pressure derivatives for CO{sub 2} Phase I are K{sub S0} = 3.4(6) GPa, G{sub 0} = 1.8(2) GPa, (dK{sub S}/dP){sub 0} = 7.8(3), (dG/dP){sub 0} = 2.5(1), (d{sup 2}K{sub S}/dP{sup 2}){sub 0} = −0.23(3) GPa{sup −1}, and (d{sup 2}G/dP{sup 2}){sub 0} = −0.10(1) GPa{sup −1}. A small increase of elastic properties was observed between 9.8(1) and 10.5(3) GPa, in agreement with the CO{sub 2} I-III transition pressure determined from previous x-ray diffraction experiments. Above the transition pressure P{sub T}, we observed a mixture dominated by CO{sub 2}-I, with minor CO{sub 2}-III. The CO{sub 2}-I + III mixture shows slightly increased sound velocities compared to pure CO{sub 2}-I. Elastic anisotropy calculated from the single-crystal elasticity tensor exhibits a decrease with pressure beginning at 7.9(1) GPa, which is lower than P{sub T}. Our results coincide with recent X-ray Raman observations, suggesting that a pressure-induced electronic transition is related to local structural and optical changes.
Energy Technology Data Exchange (ETDEWEB)
Devlin, R. C.; Krick, A. L.; Sichel-Tissot, R. J.; Xie, Y. J.; May, S. J., E-mail: smay@coe.drexel.edu [Department of Materials Science and Engineering, Drexel University, Philadelphia, Pennsylvania 19104 (United States)
2014-06-21
We report on the electronic transport properties of epitaxial La{sub 1∕3}Sr{sub 2∕3}FeO{sub 3} films using temperature dependent resistivity, Hall effect, and magnetoresistance measurements. We show that the electronic phase transition, which occurs near 190 K, results in a change in conduction mechanism from nonadiabatic polaron transport at high temperatures to resistivity behavior following a power law temperature dependence at low temperatures. The phase transition is also accompanied by an abrupt increase in apparent mobility and Hall coefficient below the critical temperature (T*). We argue that the exotic low temperature transport properties are a consequence of the unusually long-range periodicity of the antiferromagnetic ordering, which also couples to the electronic transport in the form of a negative magnetoresistance below T* and a sign reversal of the Hall coefficient at T*. By comparing films of differing thicknesses, stoichiometry, and strain states, we demonstrate that the observed conduction behavior is a robust feature of La{sub 1∕3}Sr{sub 2∕3}FeO{sub 3}.
Sensitivity Enhancement of a Vertical-Type CMOS Hall Device for a Magnetic Sensor
Directory of Open Access Journals (Sweden)
Sein Oh
2018-01-01
Full Text Available This study presents a vertical-type CMOS Hall device with improved sensitivity to detect a 3D magnetic field in various types of sensors or communication devices. To improve sensitivity, trenches are implanted next to the current input terminal, so that the Hall current becomes maximum. The effect of the dimension and location of trenches on sensitivity is simulated in the COMSOL simulator. A vertical-type Hall device with a width of 16 μm and a height of 2 μm is optimized for maximum sensitivity. The simulation result shows that it has a 23% better result than a conventional vertical-type CMOS Hall device without a trench.
Hall viscosity of a chiral two-orbital superconductor at finite temperatures
Yazdani-Hamid, Meghdad; Shahzamanian, Mohammad Ali
2018-06-01
The Hall viscosity known as the anti-symmetric part of the viscosity fourth-rank tensor. Such dissipationless response which appears for systems with broken time reversal symmetry. We calculate this non-dissipative quantity for a chiral two-orbital superconductor placed in a viscoelastic magnetic field using the linear response theory and apply our calculations to the putative multiband chiral superconductor Sr2RuO4. The chirality origin of a multiband superconductor arises from the interorbital coupling of the superconducting state. This feature leads to the robustness of the Hall viscosity against temperature and impurity effects. We study the temperature effect on the Hall viscosity at the one-loop approximation.
AA under construction in its hall
CERN PhotoLab
1980-01-01
The Antiproton Accumulator was installed in a specially built hall. Here we see it at an "early" stage of installation, just a few magnets on the floor, no vacuum chamber at all, but: 3 months later there was circulating beam !
Complex dynamics of the integer quantum Hall effect
International Nuclear Information System (INIS)
Trugman, S.A.; Nicopoulos, V.N.; Florida Univ., Gainesville, FL
1991-01-01
We investigate both classical and quantum potential scattering in two dimensions in a magnetic field, with applications to the integer quantum Hall effect. Classical scattering is complex, due in one case to the approach of scattering states to an infinite number of bound states. We show that bound states are generic, and occur for all but extremely smooth scattering potentials (|rvec ∇| → 0). Quantum scattering follows the classical behavior rather closely, exhibiting sharp resonances rather than classical bound states. Extended scatterers provide an explanation for the breakdown of the QHE at a comparatively small Hall voltage. 16 refs., 14 figs
Quantum hall fluid on fuzzy two dimensional sphere
International Nuclear Information System (INIS)
Luo Xudong; Peng Dantao
2004-01-01
After reviewing the Haldane's description about the quantum Hall effect on the fuzzy two-sphere S 2 , authors construct the noncommutative algebra on the fuzzy sphere S 2 and the Moyal structure of the Hilbert space. By constructing noncommutative Chern-Simons theory of the incompressible Hall fluid on the fuzzy sphere and solving the Gaussian constraint with quasiparticle source, authors find the Calogero matrix on S 2 and the complete set of the Laughlin wave function for the lowest Landau level, and this wave function is expressed by the generalized Jack polynomials in terms of spinor coordinates. (author)
Anomalous Hall effect and magnetoresistance behavior in Co/Pd1−xAgx multilayers
Guo, Z. B.
2013-02-13
In this paper, we report anomalous Hall effect (AHE) correlated with the magnetoresistance behavior in [Co/Pd1-xAg x]n multilayers. For the multilayers with n = 6, the increase in Ag content from x = 0 to 0.52 induces the change in AHE sign from negative surface scattering-dominated AHE to positive interface scattering-dominated AHE, which is accompanied with the transition from anisotropy magnetoresistance (AMR) dominated transport to giant magnetoresistance (GMR) dominated transport. For n = 80, scaling analysis with Rs ∝ρ xx γ yields γ ∼ 3.44 for x = 0.52 which presents GMR-type transport, in contrast to γ ∼ 5.7 for x = 0 which presents AMR-type transport. © 2013 American Institute of Physics.
Universal intrinsic spin Hall effect
Czech Academy of Sciences Publication Activity Database
Sinova, J.; Culcer, D.; Sinitsyn, N. A.; Niu, Q.; Jungwirth, Tomáš; MacDonald, A. H.
2004-01-01
Roč. 92, č. 12 (2004), 126603/1-126603/4 ISSN 0031-9007 R&D Projects: GA ČR GA202/02/0912 Institutional research plan: CEZ:AV0Z1010914 Keywords : semiconductor quantum wells * spin-orbit interaction * spin Hall effect Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 7.218, year: 2004
SUSTAINED LIVEABILITY: A FRAMEWORK BEYOND ENERGY CONSCIOUS BUILDING CONSERVATION OF MARKET HALLS
Directory of Open Access Journals (Sweden)
Neveen Hamza
2017-11-01
Full Text Available Market halls are commonly found in contexts of cultural and heritage value. Positioned in urban centres and transport networks, these unique buildings were originally constructed in the 19th century to ensure better food distribution in growing European cities, then copied to other territories such as Egypt. We argue that leaving market halls, with their large spanning structures and indoor open space, for dilapidation is a lost opportunity for sustaining community engagement, and educating the public on the original sustainability, neighbourhood regeneration and cultural thinking that underpinned these buildings. The proposed framework extends current sustainable ‘heritage conservation frameworks’ beyond concepts of adding renewable energy technologies, recycling and sustainable goods movement, to ‘sustaining liveability and social inclusion’. We argue that market halls offer the opportunities to merge the daily activities of buying and selling food with creating local creative economies such as culinary art exhibitions, and culinary schools. The paper consists of two parts: the first discusses the historical urban context of market halls in Cairo; the second proposes a sustainable heritage conservation model for market halls.
MO-PIS-Exhibit Hall-01: Imaging: CT Dose Optimization Technologies I
Energy Technology Data Exchange (ETDEWEB)
Denison, K; Smith, S [GE Healthcare, Waukesha, WI (United States)
2014-06-15
Partners in Solutions is an exciting new program in which AAPM partners with our vendors to present practical “hands-on” information about the equipment and software systems that we use in our clinics. The imaging topic this year is CT scanner dose optimization capabilities. Note that the sessions are being held in a special purpose room built on the Exhibit Hall Floor, to encourage further interaction with the vendors. Dose Optimization Capabilities of GE Computed Tomography Scanners Presentation Time: 11:15 – 11:45 AM GE Healthcare is dedicated to the delivery of high quality clinical images through the development of technologies, which optimize the application of ionizing radiation. In computed tomography, dose management solutions fall into four categories: employs projection data and statistical modeling to decrease noise in the reconstructed image - creating an opportunity for mA reduction in the acquisition of diagnostic images. Veo represents true Model Based Iterative Reconstruction (MBiR). Using high-level algorithms in tandem with advanced computing power, Veo enables lower pixel noise standard deviation and improved spatial resolution within a single image. Advanced Adaptive Image Filters allow for maintenance of spatial resolution while reducing image noise. Examples of adaptive image space filters include Neuro 3-D filters and Cardiac Noise Reduction Filters. AutomA adjusts mA along the z-axis and is the CT equivalent of auto exposure control in conventional x-ray systems. Dynamic Z-axis Tracking offers an additional opportunity for dose reduction in helical acquisitions while SmartTrack Z-axis Tracking serves to ensure beam, collimator and detector alignment during tube rotation. SmartmA provides angular mA modulation. ECG Helical Modulation reduces mA during the systolic phase of the heart cycle. SmartBeam optimization uses bowtie beam-shaping hardware and software to filter off-axis x-rays - minimizing dose and reducing x-ray scatter. The
MO-PIS-Exhibit Hall-01: Imaging: CT Dose Optimization Technologies I
International Nuclear Information System (INIS)
Denison, K; Smith, S
2014-01-01
Partners in Solutions is an exciting new program in which AAPM partners with our vendors to present practical “hands-on” information about the equipment and software systems that we use in our clinics. The imaging topic this year is CT scanner dose optimization capabilities. Note that the sessions are being held in a special purpose room built on the Exhibit Hall Floor, to encourage further interaction with the vendors. Dose Optimization Capabilities of GE Computed Tomography Scanners Presentation Time: 11:15 – 11:45 AM GE Healthcare is dedicated to the delivery of high quality clinical images through the development of technologies, which optimize the application of ionizing radiation. In computed tomography, dose management solutions fall into four categories: employs projection data and statistical modeling to decrease noise in the reconstructed image - creating an opportunity for mA reduction in the acquisition of diagnostic images. Veo represents true Model Based Iterative Reconstruction (MBiR). Using high-level algorithms in tandem with advanced computing power, Veo enables lower pixel noise standard deviation and improved spatial resolution within a single image. Advanced Adaptive Image Filters allow for maintenance of spatial resolution while reducing image noise. Examples of adaptive image space filters include Neuro 3-D filters and Cardiac Noise Reduction Filters. AutomA adjusts mA along the z-axis and is the CT equivalent of auto exposure control in conventional x-ray systems. Dynamic Z-axis Tracking offers an additional opportunity for dose reduction in helical acquisitions while SmartTrack Z-axis Tracking serves to ensure beam, collimator and detector alignment during tube rotation. SmartmA provides angular mA modulation. ECG Helical Modulation reduces mA during the systolic phase of the heart cycle. SmartBeam optimization uses bowtie beam-shaping hardware and software to filter off-axis x-rays - minimizing dose and reducing x-ray scatter. The
Magnetic properties and Hall effect of single-crystalline YMn6Sn6
International Nuclear Information System (INIS)
Uhlirova, K.; Sechovsky, V.; Boer, F.R. de; Yoshii, S.; Yamamoto, T.; Hagiwara, M.; Lefevre, C.; Venturini, G.
2007-01-01
Magnetization behavior and Hall resistivity of YMn 6 Sn 6 , which crystallizes in the hexagonal HfFe 6 Ge 6 -type of structure, have been investigated on single crystals at various temperatures in the ordered magnetic state. The field dependence of the Hall resistivity shows anomalies, which are related to the field-induced spin reorientations occurring in YMn 6 Sn 6 . It is also found that the Hall resistivity cannot simply be described by the anomalous contribution proportional to the magnetization, but that an additional field-dependent contribution is present
Can ensemble condition in a hall be improved and measured?
DEFF Research Database (Denmark)
Gade, Anders Christian
1988-01-01
of the ceiling reflectors; and (c) changing the position of the orchestra on the platform. These variables were then tested in full scale experiments in the hall including subjective evaluation by the orchestra in order to verify their effects under practical conditions. New objective parameters, which showed......In collaboration with the Danish Broadcasting Corporation an extensive series of experiments has been carried out in The Danish Radio Concert Hall with the practical purpose of trying to improve the ensemble conditions on the platform for the resident symphony orchestra. First, a series...... very high correlations with the subjective data, also made it possible to compare the improvements with conditions as recently measured in famous European Halls. Besides providing the needed results, the experiments also shed some light on how musicians change their criteria for judging acoustic...