DEFF Research Database (Denmark)
Rocchi, E; Khodjakov, A; Volk, E L
2000-01-01
by Western blot and immunohistochemistry. This protein is highly overexpressed in several drug-resistant cell lines and localizes predominantly to the plasma membrane, instead of to intracellular membranes as seen with all other known half-transporters. Therefore, BCRP/MXR is unique among the ABC half......The products of the ABC gene family can be generally classified as either full-transporters of half-transporters. Full-transporters are expressed in the plasma membrane, whereas half-transporters are usually found in intracellular membranes. Recently, an ABC half-transporter, the ABCG2 gene product......-transporters by being localized to the plasma membrane....
The role of half-transporters in multidrug resistance
DEFF Research Database (Denmark)
Bates, S E; Robey, R; Miyake, K
2001-01-01
in the role of drug transporters in clinical drug resistance. These newly identified transporters include additional members of the MRP family, ABC2, and a new half-transporter, MXR/BCRP/ABCP1. This half-transporter confers high levels of resistance to mitoxantrone, anthracyclines, and the camptothecins SN-38...
Bioinformatic survey of ABC transporters in dermatophytes.
Gadzalski, Marek; Ciesielska, Anita; Stączek, Paweł
2016-01-15
ATP binding cassette (ABC) transporters constitute a very large and ubiquitous superfamily of membrane proteins. They are responsible for ATP hydrolysis driven translocation of countless substrates. Being a very old and diverse group of proteins present in all organisms they share a common feature, which is the presence of an evolutionary conservative nucleotide binding domain (NBD)--the engine that drives the transport. Another common domain is a transmembrane domain (TMD) which consists of several membrane-spanning helices. This part of protein is substrate-specific, thus it is much more variable. ABC transporters are known for driving drug efflux in many pathogens and cancer cells, therefore they are the subject of extensive studies. There are many examples of conferring a drug resistance phenotype in fungal pathogens by ABC transporters, however, little is known about these proteins in dermatophytes--a group of fungi causing superficial mycoses. So far only a single ABC transporter has been extensively studied in this group of pathogens. We analyzed available genomic sequences of seven dermatophyte species in order to provide an insight into dermatophyte ABC protein inventory. Phylogenetic studies of ABC transporter genes and their products were conducted and included ABC transporters of other fungi. Our results show that each dermatophyte genome studied possesses a great variety of ABC transporter genes. Detailed analysis of selected genes and their products indicates that relatively recent duplication of ABC transporter genes could lead to novel substrate specificity. Copyright © 2015 Elsevier B.V. All rights reserved.
Isolation and Characterization of the Colletotrichum acutatum ABC Transporter CaABC1
Directory of Open Access Journals (Sweden)
Suyoung Kim
2014-12-01
Full Text Available Fungi tolerate exposure to various abiotic stresses, including cytotoxic compounds and fungicides, via their ATP-driven efflux pumps belonging to ATP-binding cassette (ABC transporters. To clarify the molecular basis of interaction between the fungus and various abiotic stresses including fungicides, we constructed a cDNA library from germinated conidia of Colletotrichum acutatum, a major anthracnose pathogen of pepper (Capsicum annum L.. Over 1,000 cDNA clones were sequenced, of which single clone exhibited significant nucleotide sequence homology to ABC transporter genes. We isolated three fosmid clones containing the C. acutatum ABC1 (CaABC1 gene in full-length from genomic DNA library screening. The CaABC1 gene consists of 4,059 bp transcript, predicting a 1,353-aa protein. The gene contains the typical ABC signature and Walker A and B motifs. The 5′-flanking region contains a CAAT motif, a TATA box, and a Kozak region. Phylogenetic and structural analysis suggested that the CaABC1 is a typical ABC transporter gene highly conserved in various fungal species, as well as in Chromista, Metazoans, and Viridiplantae. We also found that CaABC1 was up-regulated during conidiation and a minimal medium condition. Moreover, CaABC1 was induced in iprobenfos, kresoxim-methyl, thiophanate-methyl, and hygromycin B. These results demonstrate that CaABC1 is necessary for conidiation, abiotic stress, and various fungicide resistances. These results will provide the basis for further study on the function of ABC transporter genes in C. acutatum.
Asymmetric switching in a homodimeric ABC transporter: a simulation study.
Directory of Open Access Journals (Sweden)
Jussi Aittoniemi
2010-04-01
Full Text Available ABC transporters are a large family of membrane proteins involved in a variety of cellular processes, including multidrug and tumor resistance and ion channel regulation. Advances in the structural and functional understanding of ABC transporters have revealed that hydrolysis at the two canonical nucleotide-binding sites (NBSs is co-operative and non-simultaneous. A conserved core architecture of bacterial and eukaryotic ABC exporters has been established, as exemplified by the crystal structure of the homodimeric multidrug exporter Sav1866. Currently, it is unclear how sequential ATP hydrolysis arises in a symmetric homodimeric transporter, since it implies at least transient asymmetry at the NBSs. We show by molecular dynamics simulation that the initially symmetric structure of Sav1866 readily undergoes asymmetric transitions at its NBSs in a pre-hydrolytic nucleotide configuration. MgATP-binding residues and a network of charged residues at the dimer interface are shown to form a sequence of putative molecular switches that allow ATP hydrolysis only at one NBS. We extend our findings to eukaryotic ABC exporters which often consist of two non-identical half-transporters, frequently with degeneracy substitutions at one of their two NBSs. Interestingly, many residues involved in asymmetric conformational switching in Sav1866 are substituted in degenerate eukaryotic NBS. This finding strengthens recent suggestions that the interplay of a consensus and a degenerate NBS in eukaroytic ABC proteins pre-determines the sequence of hydrolysis at the two NBSs.
Dermauw, Wannes; Van Leeuwen, Thomas
2014-02-01
About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Jeong, Chang-Bum; Kim, Bo-Mi; Lee, Jae-Seong; Rhee, Jae-Sung
2014-08-05
The ATP-binding cassette (ABC) transporter superfamily is one of the largest transporter gene families and is observed in all animal taxa. Although a large set of transcriptomic data was recently assembled for several species of crustaceans, identification and annotation of the large ABC transporter gene family have been very challenging. In the intertidal copepod Tigriopus japonicus, 46 putative ABC transporters were identified using in silico analysis, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that the 46 T. japonicus ABC transporters are classified into eight subfamilies (A-H) that include all the members of all ABC subfamilies, consisting of five ABCA, five ABCB, 17 ABCC, three ABCD, one ABCE, three ABCF, seven ABCG, and five ABCH subfamilies. Of them, unique isotypic expansion of two clades of ABCC1 proteins was observed. Real-time RT-PCR-based heatmap analysis revealed that most T. japonicus ABC genes showed temporal transcriptional expression during copepod development. The overall transcriptional profile demonstrated that half of all T. japonicus ABC genes were strongly associated with at least one developmental stage. Of them, transcripts TJ-ABCH_88708 and TJ-ABCE1 were highly expressed during all developmental stages. The whole set of T. japonicus ABC genes and their phylogenetic relationships will provide a better understanding of the comparative evolution of essential gene family resources in arthropods, including the crustacean copepods.
DEFF Research Database (Denmark)
Møllgård, Kjeld; Dziegielewska, Katarzyna M.; Holst, Camilla B.
2017-01-01
Adult brain is protected from entry of drugs and toxins by specific mechanisms such as ABC (ATP-binding Cassette) efflux transporters. Little is known when these appear in human brain during development. Cellular distribution of three main ABC transporters (ABCC1, ABCG2, ABCB1) was determined...... at blood-brain barriers and interfaces in human embryos and fetuses in first half of gestation. Antibodies against claudin-5 and-11 and antibodies to α-fetoprotein were used to describe morphological and functional aspects of brain barriers. First exchange interfaces to be established, probably at 4...... three transporters. Results provide evidence for sequential establishment of brain exchange interfaces and spatial and temporal timetable for three main ABC transporters in early human brain....
The ABC transporters in Candidatus Liberibacter asiaticus.
Li, Wenlin; Cong, Qian; Pei, Jimin; Kinch, Lisa N; Grishin, Nick V
2012-11-01
Candidatus Liberibacter asiaticus (Ca. L. asiaticus) is a Gram-negative bacterium and the pathogen of Citrus Greening disease (Huanglongbing, HLB). As a parasitic bacterium, Ca. L. asiaticus harbors ABC transporters that play important roles in exchanging chemical compounds between Ca. L. asiaticus and its host. Here, we analyzed all the ABC transporter-related proteins in Ca. L. asiaticus. We identified 14 ABC transporter systems and predicted their structures and substrate specificities. In-depth sequence and structure analysis including multiple sequence alignment, phylogenetic tree reconstruction, and structure comparison further support their function predictions. Our study shows that this bacterium could use these ABC transporters to import metabolites (amino acids and phosphates) and enzyme cofactors (choline, thiamine, iron, manganese, and zinc), resist to organic solvent, heavy metal, and lipid-like drugs, maintain the composition of the outer membrane (OM), and secrete virulence factors. Although the features of most ABC systems could be deduced from the abundant experimental data on their orthologs, we reported several novel observations within ABC system proteins. Moreover, we identified seven nontransport ABC systems that are likely involved in virulence gene expression regulation, transposon excision regulation, and DNA repair. Our analysis reveals several candidates for further studies to understand and control the disease, including the type I virulence factor secretion system and its substrate that are likely related to Ca. L. asiaticus pathogenicity and the ABC transporter systems responsible for bacterial OM biosynthesis that are good drug targets. Copyright © 2012 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Moon Yuseok
2009-01-01
Full Text Available Abstract Background ATP binding cassette (ABC transporter secretes the protein through inner and outer membranes simultaneously in gram negative bacteria. Thermostable lipase (TliA of Pseudomonas fluorescens SIK W1 is secreted through the ABC transporter. TliA has four glycine-rich repeats (GGXGXD in its C-terminus, which appear in many ABC transporter-secreted proteins. From a homology model of TliA derived from the structure of P. aeruginosa alkaline protease (AprA, lipase ABC transporter domains (LARDs were designed for the secretion of fusion proteins. Results The LARDs included four glycine-rich repeats comprising a β-roll structure, and were added to the C-terminus of test proteins. Either Pro-Gly linker or Factor Xa site was added between fusion proteins and LARDs. We attached different length of LARDs such as LARD0, LARD1 or whole TliA (the longest LARD to three types of proteins; green fluorescent protein (GFP, epidermal growth factor (EGF and cytoplasmic transduction peptide (CTP. These fusion proteins were expressed in Escherichia coli together with ABC transporter of either P. fluorescens or Erwinia chrysanthemi. Export of fusion proteins with the whole TliA through the ABC transporter was evident on the basis of lipase enzymatic activity. Upon supplementation of E. coli with ABC transporter, GFP-LARDs and EGF-LARDs were excreted into the culture supernatant. Conclusion The LARDs or whole TliA were attached to C-termini of model proteins and enabled the export of the model proteins such as GFP and EGF in E. coli supplemented with ABC transporter. These results open the possibility for the extracellular production of recombinant proteins in Pseudomonas using LARDs or TliA as a C-terminal signal sequence.
Abc1: a new ABC transporter from the fission yeast Schizosaccharomyces pombe
DEFF Research Database (Denmark)
Christensen, P U; Davis, K; Nielsen, O
1997-01-01
We have isolated the abc1 gene from the fission yeast Schizosaccharomyces pombe. Sequence analysis suggests that the Abc1 protein is a member of the ABC superfamily of transporters and is composed of two structurally homologous halves, each consisting of a hydrophobic region of six transmembrane...
Zhao, L X; Zhou, C J; Tanaka, A; Nakata, M; Hirabayashi, T; Amachi, T; Shioda, S; Ueda, K; Inagaki, N
2000-01-01
The ABC1 (ABCA) subfamily of the ATP-binding cassette (ABC) transporter superfamily has a structural feature that distinguishes it from other ABC transporters. Here we report the cloning, molecular characterization and tissue distribution of ABC2/ABCA2, which belongs to the ABC1 subfamily. Rat ABC2 is a protein of 2434 amino acids that has 44.5%, 40.0% and 40.8% identity with mouse ABC1/ABCA1, human ABC3/ABCA3 and human ABCR/ABCA4 respectively. Immunoblot analysis showed that proteins of 260 ...
Polymorphism in ABC transporter genes of Dirofilaria immitis
Directory of Open Access Journals (Sweden)
Thangadurai Mani
2017-08-01
Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis
Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance
Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin
2015-04-28
The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.
Directory of Open Access Journals (Sweden)
Nicholas P. Greene
2018-05-01
Full Text Available The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking.
Greene, Nicholas P.; Kaplan, Elise; Crow, Allister; Koronakis, Vassilis
2018-01-01
The MacB ABC transporter forms a tripartite efflux pump with the MacA adaptor protein and TolC outer membrane exit duct to expel antibiotics and export virulence factors from Gram-negative bacteria. Here, we review recent structural and functional data on MacB and its homologs. MacB has a fold that is distinct from other structurally characterized ABC transporters and uses a unique molecular mechanism termed mechanotransmission. Unlike other bacterial ABC transporters, MacB does not transport substrates across the inner membrane in which it is based, but instead couples cytoplasmic ATP hydrolysis with transmembrane conformational changes that are used to perform work in the extra-cytoplasmic space. In the MacAB-TolC tripartite pump, mechanotransmission drives efflux of antibiotics and export of a protein toxin from the periplasmic space via the TolC exit duct. Homologous tripartite systems from pathogenic bacteria similarly export protein-like signaling molecules, virulence factors and siderophores. In addition, many MacB-like ABC transporters do not form tripartite pumps, but instead operate in diverse cellular processes including antibiotic sensing, cell division and lipoprotein trafficking. PMID:29892271
Directory of Open Access Journals (Sweden)
Cheng-Yi Chuang
Full Text Available The peroxisome is a single membrane-bound organelle in eukaryotic cells involved in lipid metabolism, including β-oxidation of fatty acids. The human genetic disorder X-linked adrenoleukodystrophy (X-ALD is caused by mutations in the ABCD1 gene (encoding ALDP, a peroxisomal half ATP-binding cassette [ABC] transporter. This disease is characterized by defective peroxisomal β-oxidation and a large accumulation of very long-chain fatty acids in brain white matter, adrenal cortex, and testis. ALDP forms a homodimer proposed to be the functional transporter, whereas the peroxisomal transporter in yeast is a heterodimer comprising two half ABC transporters, Pxa1p and Pxa2p, both orthologs of human ALDP. While the carboxyl-terminal domain of ALDP is engaged in dimerization, it remains unknown whether the same region is involved in the interaction between Pxa1p and Pxa2p.Using a yeast two-hybrid assay, we found that the carboxyl-terminal region (CT of Pxa2p, but not of Pxa1p, is required for their interaction. Further analysis indicated that the central part of the CT (designated CT2 of Pxa2p was indispensable for its interaction with the carboxyl terminally truncated Pxa1_NBD. An interaction between the CT of Pxa2p and Pxa1_NBD was not detected, but could be identified in the presence of Pxa2_NBD-CT1. A single mutation of two conserved residues (aligned with X-ALD-associated mutations at the same positions in ALDP in the CT2 of the Pxa2_NBD-CT protein impaired its interaction with Pxa1_NBD or Pxa1_NBD-CT, resulting in a mutant protein that exhibited a proteinase K digestion profile different from that of the wild-type protein. Functional analysis of these mutant proteins on oleate plates indicated that they were defective in transporter function.The CT of Pxa2p is involved in its interaction with Pxa1p and in transporter function. This concept may be applied to human ALDP studies, helping to establish the pathological mechanism for CT-related X
Directory of Open Access Journals (Sweden)
Anja S Strauss
Full Text Available Insects evolved ingenious adaptations to use extraordinary food sources. Particularly, the diet of herbivores enriched with noxious plant secondary metabolites requires detoxification mechanisms. Sequestration, which involves the uptake, transfer, and concentration of occasionally modified phytochemicals into specialized tissues or hemolymph, is one of the most successful detoxification strategies found in most insect orders. Due to the ability of ATP-binding cassette (ABC carriers to transport a wide range of molecules including phytochemicals and xenobiotics, it is highly likely that they play a role in this sequestration process. To shed light on the role of ABC proteins in sequestration, we describe an inventory of putative ABC transporters in various tissues in the sequestering juvenile poplar leaf beetle, Chrysomela populi.In the transcriptome of C. populi, we predicted 65 ABC transporters. To link the proteins with a possible function, we performed comparative phylogenetic analyses with ABC transporters of other insects and of humans. While tissue-specific profiling of each ABC transporter subfamily suggests that ABCB, C and G influence the plant metabolite absorption in the gut, ABCC with 14 members is the preferred subfamily responsible for the excretion of these metabolites via Malpighian tubules. Moreover, salicin, which is sequestered from poplar plants, is translocated into the defensive glands for further deterrent production. In these glands and among all identified ABC transporters, an exceptionally high transcript level was observed only for Cpabc35 (Cpmrp. RNAi revealed the deficiency of other ABC pumps to compensate the function of CpABC35, demonstrating its key role during sequestration.We provide the first comprehensive phylogenetic study of the ABC family in a phytophagous beetle species. RNA-seq data from different larval tissues propose the importance of ABC pumps to achieve a homeostasis of plant-derived compounds and
Evolutionary Trajectories of Entomopathogenic Fungi ABC Transporters.
Baral, Bikash
2017-01-01
The ABC protein superfamily-also called traffic ATPases-are energy-dependent ubiquitous proteins, representing one of the crucial and the largest family in the fungal genomes. The ATP-binding cassette endows a characteristic 200-250 amino acids and is omnipresent in all organisms ranging from prokaryotes to eukaryotes. Unlike in bacteria with nutrient import functions, ABC transporters in fungal entomopathogens serve as effective efflux pumps that are largely involved in the shuttle of metabolites across the biological membranes. Thus, the search for ABC proteins may prove of immense importance in elucidating the functional and molecular mechanism at the host-pathogen (insect-fungus) interface. Their sequence homology, domain topology, and functional traits led to the actual identification of nine different families in fungal entomopathogens. Evolutionary relationships within the ABC superfamily are discussed, concentrating on computational approaches for comparative identification of ABC transporters in insect-pathogenic fungi (entomopathogens) with those of animals, plants, and their bacterial orthologs. Ancestors of some fungal candidates have duplicated extensively in some phyla, while others were lost in one lineage or the other, and predictions for the cause of their duplications and/or loss in some phyla are made. ABC transporters of fungal insect-pathogens serve both defensive and offensive functions effective against land-dwelling and ground foraging voracious insects. This study may help to unravel the molecular cascades of ABC proteins to illuminate the means through which insects cope with fungal infection and fungal-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
ABC transporters in fish species: a review
Directory of Open Access Journals (Sweden)
Marta eFerreira
2014-07-01
Full Text Available ATP-binding cassette (ABC proteins were first recognized for their role in multidrug resistance (MDR in chemotherapeutic treatments, which is a major impediment for the successful treatment of many forms of malignant tumors in humans. These proteins, highly conserved throughout vertebrate species, were later related to cellular detoxification and accounted as responsible for protecting aquatic organisms from xenobiotic insults in the so-called multixenobiotic resistance mechanism (MXR. In recent years, research on these proteins in aquatic species has highlighted their importance in the detoxification mechanisms in fish thus it is of extreme added value to continue these studies. Several transporters have been pointed out as relevant in the ecotoxicological context associated to the transport of xenobiotics, such as P-glycoproteins (Pgps, multidrug-resistance-associated proteins (MRPs 1-5 and breast resistance associated protein (BCRP. In mammals, several nuclear receptors have been identified as mediators of phase I and II metabolizing enzymes and ABC transporters. In aquatic species, knowledge on co-regulation of detoxification mechanism is scarce and needs to be addressed. The interaction of emergent contaminants, with chemosensitizer potential, with ABC transporters in aquatic organisms can compromise detoxification processes and have population effects and should be studied in more detail. This review intends to summarize the recent advances in research on MXR mechanisms in fish species, focusing in 1 regulation and functioning of ABC proteins; 2 cooperation with phase I and II biotransformation enzymes; and 3 ecotoxicological relevance and information on emergent pollutants with ability to modulate ABC transporters expression and activity. Several lines of evidence are clear suggesting the important role of these transporters in detoxification mechanisms and must be further investigated in fish.
Phylogenetic analysis of fungal ABC transporters.
Kovalchuk, Andriy; Driessen, Arnold J M
2010-03-16
The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.
Jonsson, Ing-Marie; Juuti, Jarmo T.; Francois, Patrice; AlMajidi, Rana; Pietiainen, Milla; Girard, Myriam; Lindholm, Catharina; Saller, Manfred J.; Driessen, Arnold J. M.; Kuusela, Pentti; Bokarewa, Maria; Schrenzel, Jacques; Kontinen, Vesa P.
2010-01-01
Background: Ecs is an ATP-binding cassette (ABC) transporter present in aerobic and facultative anaerobic Gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s)
Flechsig, Holger
2016-02-01
ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter
ATP-binding cassette (ABC) transporters in normal and pathological lung
van der Deen, M; de Vries, EGE; Timens, W; Scheper, RJ; Timmer-Bosscha, H; Postma, DS
2005-01-01
ATP-binding cassette ( ABC) transporters are a family of transmembrane proteins that can transport a wide variety of substrates across biological membranes in an energy-dependent manner. Many ABC transporters such as P-glycoprotein ( P-gp), multidrug resistance-associated protein 1 ( MRP1) and
Frequent down-regulation of ABC transporter genes in prostate cancer.
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-10-12
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.
Frequent down-regulation of ABC transporter genes in prostate cancer
International Nuclear Information System (INIS)
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-01-01
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users
ABC transporters in Arthropods: genomic comparison and role in insecticide transport and resistance
Dermauw, W.; Van Leeuwen, T.
2014-01-01
About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority
International Nuclear Information System (INIS)
Ethayathulla, Abdul S.; Bessho, Yoshitaka; Shinkai, Akeo; Padmanabhan, Balasundaram; Singh, Tej P.; Kaur, Punit; Yokoyama, Shigeyuki
2008-01-01
The putative ABC transporter ATP-binding protein TM0222 from T. maritima was cloned, overproduced, purified and crystallized. A complete MAD diffraction data set has been collected to 2.3 Å resolution. Adenosine triphosphate (ATP) binding cassette transporters (ABC transporters) are ATP hydrolysis-dependent transmembrane transporters. Here, the overproduction, purification and crystallization of the putative ABC transporter ATP-binding protein TM0222 from Thermotoga maritima are reported. The protein was crystallized in the hexagonal space group P6 4 22, with unit-cell parameters a = b = 148.49, c = 106.96 Å, γ = 120.0°. Assuming the presence of two molecules in the asymmetric unit, the calculated V M is 2.84 Å 3 Da −1 , which corresponds to a solvent content of 56.6%. A three-wavelength MAD data set was collected to 2.3 Å resolution from SeMet-substituted TM0222 crystals. Data sets were collected on the BL38B1 beamline at SPring-8, Japan
Energy Coupling Factor-Type ABC Transporters for Vitamin Uptake in Prokaryotes
Erkens, Guus B.; Dosz-Majsnerowska, Maria; ter Beek, Josy; Slotboom, Dirk Jan
2012-01-01
Energy coupling factor (ECF) transporters are a subgroup of ATP-binding cassette (ABC) transporters involved in the uptake of vitamins and micronutrients in prokaryotes. In contrast to classical ABC importers, ECF transporters do not make use of water-soluble substrate binding proteins or domains
Single liposome analysis of peptide translocation by the ABC transporter TAPL.
Zollmann, Tina; Moiset, Gemma; Tumulka, Franz; Tampé, Robert; Poolman, Bert; Abele, Rupert
2015-02-17
ATP-binding cassette (ABC) transporters use ATP to drive solute transport across biological membranes. Members of this superfamily have crucial roles in cell physiology, and some of the transporters are linked to severe diseases. However, understanding of the transport mechanism, especially of human ABC exporters, is scarce. We reconstituted the human lysosomal polypeptide ABC transporter TAPL, expressed in Pichia pastoris, into lipid vesicles (liposomes) and performed explicit transport measurements. We analyzed solute transport at the single liposome level by monitoring the coincident fluorescence of solutes and proteoliposomes in the focal volume of a confocal microscope. We determined a turnover number of eight peptides per minute, which is two orders of magnitude higher than previously estimated from macroscopic measurements. Moreover, we show that TAPL translocates peptides against a large concentration gradient. Maximal filling is not limited by an electrochemical gradient but by trans-inhibition. Countertransport and reversibility studies demonstrate that peptide translocation is a strictly unidirectional process. Altogether, these data are included in a refined model of solute transport by ABC exporters.
Hayashi, Tomohiko; Chiba, Shuntaro; Kaneta, Yusuke; Furuta, Tadaomi; Sakurai, Minoru
2014-11-06
ATP binding cassette (ABC) proteins belong to a superfamily of active transporters. Recent experimental and computational studies have shown that binding of ATP to the nucleotide binding domains (NBDs) of ABC proteins drives the dimerization of NBDs, which, in turn, causes large conformational changes within the transmembrane domains (TMDs). To elucidate the active substrate transport mechanism of ABC proteins, it is first necessary to understand how the NBD dimerization is driven by ATP binding. In this study, we selected MalKs (NBDs of a maltose transporter) as a representative NBD and calculated the free-energy change upon dimerization using molecular mechanics calculations combined with a statistical thermodynamic theory of liquids, as well as a method to calculate the translational, rotational, and vibrational entropy change. This combined method is applied to a large number of snapshot structures obtained from molecular dynamics simulations containing explicit water molecules. The results suggest that the NBD dimerization proceeds with a large gain of water entropy when ATP molecules bind to the NBDs. The energetic gain arising from direct NBD-NBD interactions is canceled by the dehydration penalty and the configurational-entropy loss. ATP hydrolysis induces a loss of the shape complementarity between the NBDs, which leads to the dissociation of the dimer, due to a decrease in the water-entropy gain and an increase in the configurational-entropy loss. This interpretation of the NBD dimerization mechanism in concert with ATP, especially focused on the water-mediated entropy force, is potentially applicable to a wide variety of the ABC transporters.
International Nuclear Information System (INIS)
Faria, J.N.; Balan, A.; Paes Leme, A.F.
2012-01-01
Full text: Xanthomonas citri is a phytopathogenic bacterium that infects citrus plants causing significant losses for the economy. In our group, we have focused on the identification and characterization of ABC transport proteins of this bacterium, in order to determinate their function for growth in vitro and in vivo, during infection. ABC transporters represent one of the largest families of proteins, which transport since small molecules as ions up to oligopeptides and sugars. In prokaryotic cells many works have reported the ABC transport function in pathogenesis, resistance, biofilm formation, infectivity and DNA repair, but until our knowledge, there is no data related to these transporters and X. citri. So, In order to determinate which transporters are expressed in X. citri, we started a proteomic analysis based on mono and bi-dimensional gels associated to mass spectrometry analyses. After growing X. citri and two different mutants deleted for ssuA and nitA genes in LB and minimum media, cellular extracts were obtained and used for preparation of mono and bi-dimensional gels. Seven bands covering the expected mass of ABC transporter components (20 kDa to 50 kDa) in SDS-PAGE were cut off the gel, treated with trypsin and submitted to the MS for protein identification. The results of 2D gels were good enough and will serve as a standard for development of similar experiments in large scale. (author)
Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans
2013-01-16
The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.
Identification of ABC transporters acting in vitamin B12 metabolism in Caenorhabditis elegans.
McDonald, Megan K; Fritz, Julie-Anne; Jia, Dongxin; Scheuchner, Deborah; Snyder, Floyd F; Stanislaus, Avalyn; Curle, Jared; Li, Liang; Stabler, Sally P; Allen, Robert H; Mains, Paul E; Gravel, Roy A
2017-12-01
Vitamin B 12 (cobalamin, Cbl) is a micronutrient essential to human health. Cbl is not utilized as is but must go through complex subcellular and metabolic processing to generate two cofactor forms: methyl-Cbl for methionine synthase, a cytosolic enzyme; and adenosyl-Cbl for methylmalonyl-CoA mutase, a mitochondrial enzyme. Some 10-12 human genes have been identified responsible for the intracellular conversion of Cbl to cofactor forms, including genes that code for ATP-binding cassette (ABC) transporters acting at the lysosomal and plasma membranes. However, the gene for mitochondrial uptake is not known. We hypothesized that ABC transporters should be candidates for other uptake and efflux functions, including mitochondrial transport, and set out to screen ABC transporter mutants for blocks in Cbl utilization using the nematode roundworm Caenorhabditis elegans. Thirty-seven mutant ABC transporters were screened for the excretion of methylmalonic acid (MMA), which should result from loss of Cbl transport into the mitochondria. One mutant, wht-6, showed elevated MMA excretion and reduced [ 14 C]-propionate incorporation, pointing to a functional block in methylmalonyl-CoA mutase. In contrast, the wht-6 mutant appeared to have a normal cytosolic pathway based on analysis of cystathionine excretion, suggesting that cytosolic methionine synthase was functioning properly. Further, the MMA excretion in wht-6 could be partially reversed by including vitamin B 12 in the assay medium. The human ortholog of wht-6 is a member of the G family of ABC transporters. We propose wht-6 as a candidate for the transport of Cbl into mitochondria and suggest that a member of the corresponding ABCG family of ABC transporters has this role in humans. Our ABC transporter screen also revealed that mrp-1 and mrp-2 mutants excreted lower MMA than wild type, suggesting they were concentrating intracellular Cbl, consistent with the cellular efflux defect proposed for the mammalian MRP1 ABC
Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng
2015-01-01
The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.
Insight into Two ABC Transporter Families Involved in Lantibiotic Resistance
Directory of Open Access Journals (Sweden)
Rebecca Clemens
2018-01-01
Full Text Available Antimicrobial peptides, which contain (methyl-lanthionine-rings are called lantibiotics. They are produced by several Gram-positive bacteria and are mainly active against these bacteria. Although these are highly potent antimicrobials, some human pathogenic bacteria express specific ABC transporters that confer resistance and counteract their antimicrobial activity. Two distinct ABC transporter families are known to be involved in this process. These are the Cpr- and Bce-type ABC transporter families, named after their involvement in cationic peptide resistance in Clostridium difficile, and bacitracin efflux in Bacillus subtilis, respectively. Both resistance systems differentiate to each other in terms of the proteins involved. Here, we summarize the current knowledge and describe the divergence as well as the common features present in both the systems to confer lantibiotic resistance.
Phylogenetic analysis of fungal ABC transporters
Kovalchuk, A.; Driessen, A.J.M.
2010-01-01
Background: The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The
Krumpochova, P; Sapthu, S.; Brouwers, J.F.H.M.; de Haas, M.; de Vos, R.; Borst, P.; van de Wetering, K.
2013-01-01
ABSTRACT The ATP-binding cassette (ABC) genes encode the largest family of transmembrane proteins. ABC transporters translocate a wide variety of substrates across membranes, but their physiological function is often incompletely understood. We describe a new method to study the substrate spectrum
Tian, Lixia; Song, Tianxue; He, Rongjun; Zeng, Yang; Xie, Wen; Wu, Qingjun; Wang, Shaoli; Zhou, Xuguo; Zhang, Youjun
2017-04-26
ABC transporter superfamily is one of the largest and ubiquitous groups of proteins. Because of their role in detoxification, insect ABC transporters have gained more attention in recent years. In this study, we annotated ABC transporters from a newly sequenced sweetpotato whitefly genome. Bemisia tabaci Q biotype is an emerging global invasive species that has caused extensive damages to field crops as well as ornamental plants. A total of 55 ABC transporters containing all eight described subfamilies (A to H) were identified in the B. tabaci Q genome, including 8 ABCAs, 3 ABCBs, 6 ABCCs, 2 ABCDs, 1 ABCE, 3 ABCFs, 23 ABCGs and 9 ABCHs. In comparison to other species, subfamilies G and H in both phloem- and blood-sucking arthropods are expanded. The temporal expression profiles of these 55 ABC transporters throughout B. tabaci developmental stages and their responses to imidacloprid, a neonicotinoid insecticide, were investigated using RNA-seq analysis. Furthermore, the mRNA expression of 24 ABC transporters (44% of the total) representing all eight subfamilies was confirmed by the quantitative real-time PCR (RT-qPCR). Furthermore, mRNA expression levels estimated by RT-qPCR and RNA-seq analyses were significantly correlated (r = 0.684, p analysis of the entire repertoire of ABC transporters in B. tabaci. The identification of these ABC transporters, their temporal expression profiles during B. tabaci development, and their response to a neonicotinoid insecticide lay the foundation for functional genomic understanding of their contribution to the invasiveness of B. tabaci.
Lipid dependence of ABC transporter localization and function
Klappe, Karin; Hummel, Ina; Hoekstra, Dick; Kok, Jan Willem
2009-01-01
Lipid rafts have been implicated in many cellular functions, including protein and lipid transport and signal transduction. ATP-binding cassette (ABC) transporters have also been localized in these membrane domains. In this review the evidence for this specific localization will be evaluated and
Plant ABC transporters enable many unique aspects of a terrestrial plant's lifestyle
DEFF Research Database (Denmark)
Hwang, Jae-Ung; Song, Won-Yong; Hong, Daewoong
2016-01-01
Terrestrial plants have two to four times more ATP-binding cassette (ABC) transporter genes than other organisms, including their ancestral microalgae. Recent studies found that plants harboring mutations in these transporters exhibit dramatic phenotypes, many of which are related to developmental...... to propose that diverse ABC transporters enabled many unique and essential aspects of a terrestrial plant's lifestyle, by transporting various compounds across specific membranes of the plant....
Evidence for an ABC-Type Riboflavin Transporter System in Pathogenic Spirochetes
Deka, Ranjit K.; Brautigam, Chad A.; Biddy, Brent A.; Liu, Wei Z.; Norgard, Michael V.
2013-01-01
ABSTRACT Bacterial transporter proteins are involved in the translocation of many essential nutrients and metabolites. However, many of these key bacterial transport systems remain to be identified, including those involved in the transport of riboflavin (vitamin B2). Pathogenic spirochetes lack riboflavin biosynthetic pathways, implying reliance on obtaining riboflavin from their hosts. Using structural and functional characterizations of possible ligand-binding components, we have identified an ABC-type riboflavin transport system within pathogenic spirochetes. The putative lipoprotein ligand-binding components of these systems from three different spirochetes were cloned, hyperexpressed in Escherichia coli, and purified to homogeneity. Solutions of all three of the purified recombinant proteins were bright yellow. UV-visible spectra demonstrated that these proteins were likely flavoproteins; electrospray ionization mass spectrometry and thin-layer chromatography confirmed that they contained riboflavin. A 1.3-Å crystal structure of the protein (TP0298) encoded by Treponema pallidum, the syphilis spirochete, demonstrated that the protein’s fold is similar to the ligand-binding components of ABC-type transporters. The structure also revealed other salient details of the riboflavin binding site. Comparative bioinformatics analyses of spirochetal genomes, coupled with experimental validation, facilitated the discovery of this new ABC-type riboflavin transport system(s). We denote the ligand-binding component as riboflavin uptake transporter A (RfuA). Taken together, it appears that pathogenic spirochetes have evolved an ABC-type transport system (RfuABCD) for survival in their host environments, particularly that of the human host. PMID:23404400
Glycolysis inhibition inactivates ABC transporters to restore drug sensitivity in malignant cells.
Directory of Open Access Journals (Sweden)
Ayako Nakano
Full Text Available Cancer cells eventually acquire drug resistance largely via the aberrant expression of ATP-binding cassette (ABC transporters, ATP-dependent efflux pumps. Because cancer cells produce ATP mostly through glycolysis, in the present study we explored the effects of inhibiting glycolysis on the ABC transporter function and drug sensitivity of malignant cells. Inhibition of glycolysis by 3-bromopyruvate (3BrPA suppressed ATP production in malignant cells, and restored the retention of daunorubicin or mitoxantrone in ABC transporter-expressing, RPMI8226 (ABCG2, KG-1 (ABCB1 and HepG2 cells (ABCB1 and ABCG2. Interestingly, although side population (SP cells isolated from RPMI8226 cells exhibited higher levels of glycolysis with an increased expression of genes involved in the glycolytic pathway, 3BrPA abolished Hoechst 33342 exclusion in SP cells. 3BrPA also disrupted clonogenic capacity in malignant cell lines including RPMI8226, KG-1, and HepG2. Furthermore, 3BrPA restored cytotoxic effects of daunorubicin and doxorubicin on KG-1 and RPMI8226 cells, and markedly suppressed subcutaneous tumor growth in combination with doxorubicin in RPMI8226-implanted mice. These results collectively suggest that the inhibition of glycolysis is able to overcome drug resistance in ABC transporter-expressing malignant cells through the inactivation of ABC transporters and impairment of SP cells with enhanced glycolysis as well as clonogenic cells.
Directory of Open Access Journals (Sweden)
Marisa Fabiana Nicolás
2007-01-01
Full Text Available ABC transporters represent one of the largest superfamilies of active membrane transport proteins (MTPs with a highly conserved ATPase domain that binds and hydrolyzes ATP, supplying energy for the uptake of a variety of nutrients and for the extrusion of drugs and metabolic wastes. The complete genomes of a non-pathogenic (J and pathogenic (7448 strain of Mycoplasma hyopneumoniae, as well as of a pathogenic (53 strain of Mycoplasma synoviae have been recently sequenced. A detailed study revealed a high percentage of CDSs encoding MTPs in M. hyopneumoniae strains J (13.4%, 7448 (13.8%, and in M. synoviae 53 (11.2%, and the ABC systems represented from 85.0 to 88.6% of those CDSs. Uptake systems are mainly involved in cell nutrition and some might be associated with virulence. Exporter systems include both drug and multidrug resistant systems (MDR, which may represent mechanisms of resistance to toxic molecules. No relation was found between the phylogeny of the ATPase domains and the lifestyle or pathogenicity of Mycoplasma, but several proteins, potentially useful as targets for the control of infections, were identified.
The AbcA Transporter of Staphylococcus aureus Affects Cell Autolysis
Schrader-Fischer, Gesine; Berger-Bächi, Brigitte
2001-01-01
Increased production of penicillin-binding protein PBP 4 is known to increase peptidoglycan cross-linking and contributes to methicillin resistance in Staphylococcus aureus. The pbp4 gene shares a 400-nucleotide intercistronic region with the divergently transcribed abcA gene, encoding an ATP-binding cassette transporter of unknown function. Our study revealed that methicillin stimulated abcA transcription but had no effects on pbp4 transcription. Analysis of abcA expression in mutants defective for global regulators showed that abcA is under the control of agr. Insertional inactivation of abcA by an erythromycin resistance determinant did not influence pbp4 transcription, nor did it alter resistance to methicillin and other cell wall-directed antibiotics. However, abcA mutants showed spontaneous partial lysis on plates containing subinhibitory concentrations of methicillin due to increased spontaneous autolysis. Since the autolytic zymograms of cell extracts were identical in mutants and parental strains, we postulate an indirect role of AbcA in control of autolytic activities and in protection of the cells against methicillin. PMID:11158733
Lebedeva, Irina V; Pande, Praveen; Patton, Wayne F
2011-01-01
An underlying mechanism for multi drug resistance (MDR) is up-regulation of the transmembrane ATP-binding cassette (ABC) transporter proteins. ABC transporters also determine the general fate and effect of pharmaceutical agents in the body. The three major types of ABC transporters are MDR1 (P-gp, P-glycoprotein, ABCB1), MRP1/2 (ABCC1/2) and BCRP/MXR (ABCG2) proteins. Flow cytometry (FCM) allows determination of the functional expression levels of ABC transporters in live cells, but most dyes used as indicators (rhodamine 123, DiOC(2)(3), calcein-AM) have limited applicability as they do not detect all three major types of ABC transporters. Dyes with broad coverage (such as doxorubicin, daunorubicin and mitoxantrone) lack sensitivity due to overall dimness and thus may yield a significant percentage of false negative results. We describe two novel fluorescent probes that are substrates for all three common types of ABC transporters and can serve as indicators of MDR in flow cytometry assays using live cells. The probes exhibit fast internalization, favorable uptake/efflux kinetics and high sensitivity of MDR detection, as established by multidrug resistance activity factor (MAF) values and Kolmogorov-Smirnov statistical analysis. Used in combination with general or specific inhibitors of ABC transporters, both dyes readily identify functional efflux and are capable of detecting small levels of efflux as well as defining the type of multidrug resistance. The assay can be applied to the screening of putative modulators of ABC transporters, facilitating rapid, reproducible, specific and relatively simple functional detection of ABC transporter activity, and ready implementation on widely available instruments.
ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells
Energy Technology Data Exchange (ETDEWEB)
Chen, Mingli; Yin, Huancai; Bai, Pengli [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Miao, Peng [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Deng, Xudong [Department of Chemical Engineering, McMaster University, Hamilton, Ontario, L8S 4L7 (Canada); Xu, Yingxue [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Hu, Jun [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Yin, Jian, E-mail: yinj@sibet.ac.cn [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China)
2016-07-15
This paper aimed to investigate the role of adenosine triphosphate-binding cassette (ABC) transporters on the efflux and the toxicity of nanoparticles in liver and kidney cells. In this study, we synthesized CdTe quantum dots (QDs) that were monodispersed and emitted green fluorescence (maximum peak at 530 nm). Such QDs tended to accumulate in human hepatocellular carcinoma cells (HepG2), human kidney cells 2 (HK-2), and Madin-Darby canine kidney (MDCK) cells, and cause significant toxicity in all the three cell lines. Using specific inhibitors and inducers of P-glycoprotein (Pgp) and multidrug resistance associated proteins (Mrps), the cellular accumulation and subsequent toxicity of QDs in HepG2 and HK-2 cells were significantly affected, while only slight changes appeared in MDCK cells, corresponding well with the functional expressions of ABC transporters in cells. Moreover, treatment of QDs caused concentration- and time- dependent induction of ABC transporters in HepG2 and HK-2 cells, but such phenomenon was barely found in MDCK cells. Furthermore, the effects of CdTe QDs on ABC transporters were found to be greater than those of CdCl{sub 2} at equivalent concentrations of cadmium, indicating that the effects of QDs should be a combination of free Cd{sup 2+} and specific properties of QDs. Overall, these results indicated a strong dependence between the functional expressions of ABC transporters and the efflux of QDs, which could be an important reason for the modulation of QDs toxicity by ABC transporters. - Highlights: • ABC transporters contributed actively to the cellular efflux of CdTe quantum dots. • ABC transporters affected the cellular toxicity of CdTe quantum dots. • Treatment of CdTe quantum dots induced the gene expression of ABC transporters. • Free Cd{sup 2+} should be partially involved in the effects of QDs on ABC transporters. • Cellular efflux of quantum dots could be an important modulator for its toxicity.
Andrade, A.C.; Nistelrooy, van J.G.M.; Peery, R.B.; Skatrud, P.L.; Waard, de M.A.
2000-01-01
This paper describes the characterization of atrC and atrD (ABC transporters C and D), two novel ABC transporter-encoding genes from the filamentous fungus Aspergillus nidulans, and provides evidence for the involvement of atrD in multidrug transport and antibiotic production. BLAST analysis of the
Directory of Open Access Journals (Sweden)
Choi Cheol-Hee
2005-10-01
Full Text Available Abstract One of the major problems related with anticancer chemotherapy is resistance against anticancer drugs. The ATP-binding cassette (ABC transporters are a family of transporter proteins that are responsible for drug resistance and a low bioavailability of drugs by pumping a variety of drugs out cells at the expense of ATP hydrolysis. One strategy for reversal of the resistance of tumor cells expressing ABC transporters is combined use of anticancer drugs with chemosensitizers. In this review, the physiological functions and structures of ABC transporters, and the development of chemosensitizers are described focusing on well-known proteins including P-glycoprotein, multidrug resistance associated protein, and breast cancer resistance protein.
Single liposome analysis of peptide translocation by the ABC transporter TAPL
Zollmann, Tina; Moiset Coll, Gemma; Tumulka, Franz; Tampé, Robert; Poolman, Bert; Abele, Rupert
2015-01-01
ATP-binding cassette (ABC) transporters use ATP to drive solute transport across biological membranes. Members of this superfamily have crucial roles in cell physiology, and some of the transporters are linked to severe diseases. However, understanding of the transport mechanism, especially of human
Liu, Shikai; Li, Qi; Liu, Zhanjiang
2013-01-01
Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.
ABC transporters of the wheat pathogen Mycosphaerella graminicola
Zwiers, L.H.
2002-01-01
A
DEFF Research Database (Denmark)
Robey, R W; Medina-Pérez, W Y; Nishiyama, K
2001-01-01
We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....
Directory of Open Access Journals (Sweden)
Ing-Marie Jonsson
2010-12-01
Full Text Available Ecs is an ATP-binding cassette (ABC transporter present in aerobic and facultative anaerobic gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s transported by Ecs is (are still unknown.In this study we mutated the ecsAB operon in two Staphylococcus aureus strains, Newman and LS-1. Phenotypic and functional characterization of these Ecs deficient mutants revealed a defect in growth, increased autolysis and lysostaphin sensitivity, altered composition of cell wall proteins including the precursor form of staphylokinase and an altered bacterial surface texture. DNA microarray analysis indicated that the Ecs deficiency changed expression of the virulence factor regulator protein Rot accompanied by differential expression of membrane transport proteins, particularly ABC transporters and phosphate-specific transport systems, protein A, adhesins and capsular polysaccharide biosynthesis proteins. Virulence of the ecs mutants was studied in a mouse model of hematogenous S. aureus infection. Mice inoculated with the ecs mutant strains developed markedly milder infections than those inoculated with the wild-type strains and had consequently lower mortality, less weight loss, milder arthritis and decreased persistence of staphylococci in the kidneys. The ecs mutants had higher susceptibility to ribosomal antibiotics and plant alkaloids chelerythrine and sanguinarine.Our results show that Ecs is essential for staphylococcal virulence and antimicrobial resistance probably since the transport function of Ecs is essential for the normal structure and function of the cell wall. Thus targeting Ecs may be a new approach in combating staphylococcal infection.
Jonsson, Ing-Marie; Juuti, Jarmo T; François, Patrice; AlMajidi, Rana; Pietiäinen, Milla; Girard, Myriam; Lindholm, Catharina; Saller, Manfred J; Driessen, Arnold J M; Kuusela, Pentti; Bokarewa, Maria; Schrenzel, Jacques; Kontinen, Vesa P
2010-12-02
Ecs is an ATP-binding cassette (ABC) transporter present in aerobic and facultative anaerobic gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s) transported by Ecs is (are) still unknown. In this study we mutated the ecsAB operon in two Staphylococcus aureus strains, Newman and LS-1. Phenotypic and functional characterization of these Ecs deficient mutants revealed a defect in growth, increased autolysis and lysostaphin sensitivity, altered composition of cell wall proteins including the precursor form of staphylokinase and an altered bacterial surface texture. DNA microarray analysis indicated that the Ecs deficiency changed expression of the virulence factor regulator protein Rot accompanied by differential expression of membrane transport proteins, particularly ABC transporters and phosphate-specific transport systems, protein A, adhesins and capsular polysaccharide biosynthesis proteins. Virulence of the ecs mutants was studied in a mouse model of hematogenous S. aureus infection. Mice inoculated with the ecs mutant strains developed markedly milder infections than those inoculated with the wild-type strains and had consequently lower mortality, less weight loss, milder arthritis and decreased persistence of staphylococci in the kidneys. The ecs mutants had higher susceptibility to ribosomal antibiotics and plant alkaloids chelerythrine and sanguinarine. Our results show that Ecs is essential for staphylococcal virulence and antimicrobial resistance probably since the transport function of Ecs is essential for the normal structure and function of the cell wall. Thus targeting Ecs may be a new approach in combating staphylococcal infection.
ABC- and SLC-Transporters in Murine and Bovine Mammary Epithelium
DEFF Research Database (Denmark)
Yagdiran, Yagmur; Oskarsson, Agneta; Knight, Christopher H.
2016-01-01
Some chemicals are ligands to efflux transporters which may result in high concentrations in milk. Limited knowledge is available on the influence of maternal exposure to chemicals on the expression and function of transporters in the lactating mammary gland. We determined gene expression of ABC ...
Purification and biochemical characterisation of the yeast ABC transporter Pdr11p
DEFF Research Database (Denmark)
Laub, Katrine Rude
Sterols constitute an essential lipid class in eukaryotic membranes where intracellular distributions are highly regulated. In the yeast Saccharomyces cerevisiae sterol uptake has been attributed to the two plasma membrane-localised ATP-binding cassette (ABC) transporters, Aus1p and Pdr11p...... of the yeast ABC transporter Pdr11p. This includes optimising its overexpression utilising the galactose induction system in S. cerevisiae, screening for the best detergent to extract the protein from the membrane, and establishing purification and reconstitution protocols. By providing a purification...
Yuan, Lilai; Lv, Biping; Zha, Jinmiao; Wang, Zijian
2014-05-01
In the present study, the cDNA fragments of five ABC transporter genes (ABCB1, ABCB11, ABCC1, ABCC2, and ABCG2) in the rare minnow were cloned, and their tissue-specific expression patterns were evaluated across eight rare minnow tissues (liver, gill, intestine, kidney, spleen, brain, skin, and muscle). Furthermore, the transcriptional effects on these ABC transporter genes and five xenobiotic-metabolizing enzyme genes (CYP1A, GSTm, GSTp1, GCLC, and UGT1a) were determined in the rare minnow liver after 12 days of pyrene exposure. Basal expression analysis showed that the tissues with high expression of the ABC transporters included the liver, kidney, and intestine. Moreover, the most highly expressed of the ABC genes were ABCB1 and ABCC2 in all eight of the tissues tested. The ABCB11 gene was almost exclusively expressed in the liver of the rare minnow, whereas ABCC1 and ABCG2 showed weak expression in all eight tissues compared to ABCB1 and ABCC2. Our results provide the first thorough examination of the expression patterns of toxicologically relevant ABC transporters in the rare minnow and serve as a necessary basis for further studies of these ABC transporters in fish. Furthermore, synergistic up-regulation of CYP1A, GSTp1, GCLC, UGT1a, and ABCC2 was observed in the rare minnow liver following pyrene exposure, while GSTm, ABCB1, ABCB11, ABCC1, and ABCG2 were not significantly affected (p ABC transporters by pyrene suggests a possible involvement and cooperation of these genes in the detoxification process in rare minnows. Copyright © 2014 Elsevier B.V. All rights reserved.
Neurosteroid Transport in the Brain: Role of ABC and SLC Transporters
Directory of Open Access Journals (Sweden)
Markus Grube
2018-04-01
Full Text Available Neurosteroids, comprising pregnane, androstane, and sulfated steroids can alter neuronal excitability through interaction with ligand-gated ion channels and other receptors and have therefore a therapeutic potential in several brain disorders. They can be formed in brain cells or are synthesized by an endocrine gland and reach the brain by penetrating the blood–brain barrier (BBB. Especially sulfated steroids such as pregnenolone sulfate (PregS and dehydroepiandrosterone sulfate (DHEAS depend on transporter proteins to cross membranes. In this review, we discuss the involvement of ATP-binding cassette (ABC- and solute carrier (SLC-type membrane proteins in the transport of these compounds at the BBB and in the choroid plexus (CP, but also in the secretion from neurons and glial cells. Among the ABC transporters, especially BCRP (ABCG2 and several MRP/ABCC subfamily members (MRP1, MRP4, MRP8 are expressed in the brain and known to efflux conjugated steroids. Furthermore, several SLC transporters have been shown to mediate cellular uptake of steroid sulfates. These include members of the OATP/SLCO subfamily, namely OATP1A2 and OATP2B1, as well as OAT3 (SLC22A3, which have been reported to be expressed at the BBB, in the CP and in part in neurons. Furthermore, a role of the organic solute transporter OSTα-OSTβ (SLC51A/B in brain DHEAS/PregS homeostasis has been proposed. This transporter was reported to be localized especially in steroidogenic cells of the cerebellum and hippocampus. To date, the impact of transporters on neurosteroid homeostasis is still poorly understood. Further insights are desirable also with regard to the therapeutic potential of these compounds.
Directory of Open Access Journals (Sweden)
Ravi S Kasinathan
2014-10-01
Full Text Available Parasitic flatworms of the genus Schistosoma cause schistosomiasis, a neglected tropical disease that affects hundreds of millions. Treatment of schistosomiasis depends almost entirely on the drug praziquantel (PZQ. Though essential to treating and controlling schistosomiasis, a major limitation of PZQ is that it is not active against immature mammalian-stage schistosomes. Furthermore, there are reports of field isolates with heritable reductions in PZQ susceptibility, and researchers have selected for PZQ-resistant schistosomes in the laboratory. P-glycoprotein (Pgp; ABCB1 and other ATP binding cassette (ABC transporters remove a wide variety of toxins and xenobiotics from cells, and have been implicated in multidrug resistance (MDR. Changes in ABC transporter structure or expression levels are also associated with reduced drug susceptibility in parasitic helminths, including schistosomes. Here, we show that the activity of PZQ against schistosome adults and juveniles ex vivo is potentiated by co-administration of either the highly potent Pgp inhibitor tariquidar or combinations of inhibitors targeting multiple ABC multidrug transporters. Adult worms exposed to sublethal PZQ concentrations remain active, but co-administration of ABC transporter inhibitors results in complete loss of motility and disruption of the tegument. Notably, juvenile schistosomes (3-4 weeks post infection, normally refractory to 2 µM PZQ, become paralyzed when transporter inhibitors are added in combination with the PZQ. Experiments using the fluorescent PZQ derivative (R-PZQ-BODIPY are consistent with the transporter inhibitors increasing effective intraworm concentrations of PZQ. Adult worms in which expression of ABC transporters has been suppressed by RNA interference show increased responsiveness to PZQ and increased retention of (R-PZQ-BODIPY consistent with an important role for these proteins in setting levels of PZQ susceptibility. These results indicate that
Valenzuela-Muñoz, Valentina; Sturm, Armin; Gallardo-Escárate, Cristian
2015-04-09
ATP-binding cassette (ABC) protein family encode for membrane proteins involved in the transport of various biomolecules through the cellular membrane. These proteins have been identified in all taxa and present important physiological functions, including the process of insecticide detoxification in arthropods. For that reason the ectoparasite Caligus rogercresseyi represents a model species for understanding the molecular underpinnings involved in insecticide drug resistance. llumina sequencing was performed using sea lice exposed to 2 and 3 ppb of deltamethrin and azamethiphos. Contigs obtained from de novo assembly were annotated by Blastx. RNA-Seq analysis was performed and validated by qPCR analysis. From the transcriptome database of C. rogercresseyi, 57 putative members of ABC protein sequences were identified and phylogenetically classified into the eight subfamilies described for ABC transporters in arthropods. Transcriptomic profiles for ABC proteins subfamilies were evaluated throughout C. rogercresseyi development. Moreover, RNA-Seq analysis was performed for adult male and female salmon lice exposed to the delousing drugs azamethiphos and deltamethrin. High transcript levels of the ABCB and ABCC subfamilies were evidenced. Furthermore, SNPs mining was carried out for the ABC proteins sequences, revealing pivotal genomic information. The present study gives a comprehensive transcriptome analysis of ABC proteins from C. rogercresseyi, providing relevant information about transporter roles during ontogeny and in relation to delousing drug responses in salmon lice. This genomic information represents a valuable tool for pest management in the Chilean salmon aquaculture industry.
Li, Xiaolu; Zhuo, Wei; Yu, Jie; Ge, Jingpeng; Gu, Jinke; Feng, Yue; Yang, Maojun; Wang, Linfang; Wang, Na
2013-02-01
Dipeptide permease (Dpp), which belongs to an ABC transport system, imports peptides consisting of two or three L-amino acids from the matrix to the cytoplasm in microbes. Previous studies have indicated that haem competes with dipeptides to bind DppA in vitro and in vivo and that the Dpp system can also translocate haem. Here, the crystal structure of DppD, the nucleotide-binding domain (NBD) of the ABC-type dipeptide/oligopeptide/nickel-transport system from Thermoanaerobacter tengcongensis, bound with ATP, Mg(2+) and a [4Fe-4S] iron-sulfur cluster is reported. The N-terminal domain of DppD shares a similar structural fold with the NBDs of other ABC transporters. Interestingly, the C-terminal domain of DppD contains a [4Fe-4S] cluster. The UV-visible absorbance spectrum of DppD was consistent with the presence of a [4Fe-4S] cluster. A search with DALI revealed that the [4Fe-4S] cluster-binding domain is a novel structural fold. Structural analysis and comparisons with other ABC transporters revealed that this iron-sulfur cluster may act as a mediator in substrate (dipeptide or haem) binding by electron transfer and may regulate the transport process in Dpp ABC transport systems. The crystal structure provides a basis for understanding the properties of ABC transporters and will be helpful in investigating the functions of NBDs in the regulation of ABC transporter activity.
Martin, Audrey; Daniel, Jaiyanth
2018-02-05
Mycobacterium tuberculosis (Mtb), which causes tuberculosis, is capable of accumulating triacylglycerol (TAG) by utilizing fatty acids from host cells. ATP-binding cassette (ABC) transporters are involved in transport processes in all organisms. Among the classical ABC transporters in Mtb none have been implicated in fatty acid import. Since the transport of fatty acids from the host cell is important for dormancy-associated TAG synthesis in the pathogen, mycobacterial ABC transporter(s) could potentially be involved in this process. Based on sequence identities with a bacterial ABC transporter that mediates fatty acid import for TAG synthesis, we identified Rv1272c, a hitherto uncharacterized ABC-transporter in Mtb that also shows sequence identities with a plant ABC transporter involved in fatty acid transport. We expressed Rv1272c in E. coli and show that it enhances the import of radiolabeled fatty acids. We also show that Rv1272c causes a significant increase in the metabolic incorporation of radiolabeled long-chain fatty acids into cardiolipin, a tetra-acylated phospholipid, and phosphatidylglycerol in E. coli. This is the first report on the function of Rv1272c showing that it displays a long-chain fatty acid transport function. Copyright © 2018 Elsevier Inc. All rights reserved.
The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-01-01
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689
Denecke, Shane; Fusetto, Roberto; Batterham, Philip
2017-12-01
ABC transporters have a well-established role in drug resistance, effluxing xenobiotics from cells and tissues within the organism. More recently, research has been dedicated to understanding the role insect ABC transporters play in insecticide toxicity, but progress in understanding the contribution of specific transporters has been hampered by the lack of functional genetic tools. Here, we report knockouts of three Drosophila melanogaster ABC transporter genes, Mdr49, Mdr50, and Mdr65, that are homologous to the well-studied mammalian ABCB1 (P-glycoprotein). Each knockout mutant was created in the same wild type background and tested against a panel of insecticides representing different chemical classes. Mdr65 knockouts were more susceptible to all neuroactive insecticides tested, but Mdr49 and Mdr50 knockouts showed increased susceptibility or resistance depending on the insecticide used. Mdr65 was chosen for further analysis. Calculation of LC 50 values for the Mdr65 knockout allowed the substrate specificity of this transporter to be examined. No obvious distinguishing structural features were shared among MDR65 substrates. A role for Mdr65 in insecticide transport was confirmed by testing the capacity of the knockout to synergize with the ABC inhibitor verapamil and by measuring the levels of insecticide retained in the body of knockout flies. These data unambiguously establish the influence of ABC transporters on the capacity of wild type D. melanogaster to tolerate insecticide exposure and suggest that both tissue and substrate specificity underpin this capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)
2013-06-15
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.
2013-06-01
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
International Nuclear Information System (INIS)
Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.
2013-01-01
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
Emission of volatile organic compounds from petunia flowers is facilitated by an ABC transporter.
Adebesin, Funmilayo; Widhalm, Joshua R; Boachon, Benoît; Lefèvre, François; Pierman, Baptiste; Lynch, Joseph H; Alam, Iftekhar; Junqueira, Bruna; Benke, Ryan; Ray, Shaunak; Porter, Justin A; Yanagisawa, Makoto; Wetzstein, Hazel Y; Morgan, John A; Boutry, Marc; Schuurink, Robert C; Dudareva, Natalia
2017-06-30
Plants synthesize a diversity of volatile molecules that are important for reproduction and defense, serve as practical products for humans, and influence atmospheric chemistry and climate. Despite progress in deciphering plant volatile biosynthesis, their release from the cell has been poorly understood. The default assumption has been that volatiles passively diffuse out of cells. By characterization of a Petunia hybrida adenosine triphosphate-binding cassette (ABC) transporter, PhABCG1, we demonstrate that passage of volatiles across the plasma membrane relies on active transport. PhABCG1 down-regulation by RNA interference results in decreased emission of volatiles, which accumulate to toxic levels in the plasma membrane. This study provides direct proof of a biologically mediated mechanism of volatile emission. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Alzheimer's and ABC transporters--new opportunities for diagnostics and treatment.
Pahnke, Jens; Langer, Oliver; Krohn, Markus
2014-12-01
Much has been said about the increasing number of demented patients and the main risk factor 'age'. Frustratingly, we do not know the precise pattern and all modulating factors that provoke the pathologic changes in the brains of affected elderly. We have to diagnose early to be able to stop the progression of diseases that irreversibly destroy brain substance. Familiar AD cases have mislead some researchers for almost 20 years, which has unfortunately narrowed the scientific understanding and has, thus, lead to insufficient funding of independent approaches. Therefore, basic researchers hardly have been able to develop causative treatments and clinicians still do not have access to prognostic and early diagnostic tools. During the recent years it became clear that insufficient Aβ export, physiologically facilitated by the ABC transporter superfamily at the brain's barriers, plays a fundamental role in disease initiation and progression. Furthermore, export mechanisms that are deficient in affected elderly are new targets for activation and, thus, treatment, but ideally also for prevention. In sporadic AD disturbed clearance of β-amyloid from the brain is so far the most important factor for its accumulation in the parenchyma and vessel walls. Here, we review findings about the contribution of ABC transporters and of the perivascular drainage/glymphatic system on β-amyloid clearance. We highlight their potential value for innovative early diagnostics using PET and describe recently described, effective ABC transporter-targeting agents as potential causative treatment for neurodegenerative proteopathies/dementias. Copyright © 2014 Elsevier Inc. All rights reserved.
ABC transporters from Botrytis cinerea in biotic and abiotic interactions
Schoonbeek, H.
2004-01-01
Botrytis cinereais the causal agent of grey mould disease on a wide variety of crop plants. It is relatively insensitive to natural and synthetic fungitoxic compounds. This thesis describes how ABC (ATP-binding cassette) transporters contribute to protection by actively
Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.
2017-01-01
PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the
Arai, Naoki; Furuta, Tadaomi; Sakurai, Minoru
2017-01-01
Upon the binding of ATP molecules to nucleotide binding domains (NBDs), ATP-binding cassette (ABC) exporters undergo a conformational transition from an inward-facing (IF) to an outward-facing (OF) state. This molecular event is a typical example of chemo-mechanical coupling. However, the underlying mechanism remains unclear. In this study, we analyzed the IF→OF transition of a representative ABC exporter, MsbA, by solving the equation of motion under an elastic network model (ENM). ATP was represented as a single node in ENM or replaced by external forces. When two ATP nodes were added to the ENM of the IF state protein, the two NBDs dimerized; subsequently, the two transmembrane domains opened toward the extracellular side, resulting in the formation of the OF structure. Such a conformational transition was also reproduced by applying external forces, which caused the rotational motion of the NBDs instead of the addition of ATP nodes. The process of the conformational transition was analyzed in detail using cross-correlation maps for node-node interactions. More importantly, it was revealed that the ATP binding energy is converted into distortion energy of several transmembrane helices. These results are useful for understanding the chemo-mechanical coupling in ABC transporters.
Directory of Open Access Journals (Sweden)
Peter M Jones
Full Text Available ABC transporters are integral membrane pumps that are responsible for the import or export of a diverse range of molecules across cell membranes. ABC transporters have been implicated in many phenomena of medical importance, including cystic fibrosis and multidrug resistance in humans. The molecular architecture of ABC transporters comprises two transmembrane domains and two ATP-binding cassettes, or nucleotide-binding domains (NBDs, which are highly conserved and contain motifs that are crucial to ATP binding and hydrolysis. Despite the improved clarity of recent structural, biophysical, and biochemical data, the seemingly simple process of ATP binding and hydrolysis remains controversial, with a major unresolved issue being whether the NBD protomers separate during the catalytic cycle. Here chemical cross-linking data is presented for the bacterial ABC multidrug resistance (MDR transporter LmrA. These indicate that in the absence of nucleotide or substrate, the NBDs come into contact to a significant extent, even at 4°C, where ATPase activity is abrogated. The data are clearly not in accord with an inward-closed conformation akin to that observed in a crystal structure of V. cholerae MsbA. Rather, they suggest a head-to-tail configuration 'sandwich' dimer similar to that observed in crystal structures of nucleotide-bound ABC NBDs. We argue the data are more readily reconciled with the notion that the NBDs are in proximity while undergoing intra-domain motions, than with an NBD 'Switch' mechanism in which the NBD monomers separate in between ATP hydrolysis cycles.
Kim, Hokyun; Yim, Bora; Kim, Jisoo; Kim, Haeyeon; Lee, Young-Mi
2017-11-30
ATP-binding cassette (ABC) transporters participate in transporting various substances, including xenobiotics, in or out of cells. However, their genetic information and function in ciliates remain still unclear. In this study, we sequenced and characterized two ABC transporter genes (EcABCB and EcABCC), and investigated the effect of cadmium (Cd) and benzo[a]pyrene (B[a]P) on their function and gene expression, using efflux assay and real-time reverse transcription-polymerase chain reaction (qRT-PCR), respectively, in the marine ciliate, Euplotes crassus. Sequencing analysis and efflux assay showed that EcABCB and EcABCC are typical ABC transporters, possessing conserved function. Exposure to Cd (≥5mg/L) and B[a]P (≥50.5μg/L) enhanced accumulation of a substrate. A significant increase in the expression of EcABCB and EcABC mRNA was observed at lower concentration in response to Cd and B[a]P. Our findings indicate that Cd and B[a]P could inhibit the efflux function of ABC transporters, leading to cellular toxicity in the ciliate. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q
2015-03-30
The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.
ABC transporters van Botrytis cinerea in biotische en abiotische interacties
Schoonbeek, H.
2005-01-01
Op 29 november 2004 promoveerde Henk-jan Schoonbeek aan Wageningen Universiteit op het proefschrift getiteld 'ABC transporters from Botrytis cinerea in biotic and abiotic interactions'. Promotor was Prof. dr. ir. P.J.G.M. de Wit en co-promotor was dr.ir. M.A. de Waard, leerstoelgroep Fytopathologie,
Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731
Directory of Open Access Journals (Sweden)
Xiang Liu
Full Text Available The ATP-binding cassette (ABC gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Are lipid rafts involved in ABC transporter-mediated drug resistance of tumor cells?
Kok, Jan Willem; Klappe, Karin; Hummel, Ina; Kroesen, Bart-Jan; Sietsma, Hannie; Meszaros, Peter
2008-01-01
Since their discovery, lipid rafts have been implicated in several cellular functions, including protein transport in polarized cells and signal transduction. Also in multidrug resistance lipid rafts may be important with regard to the localization of ATP-binding cassette (ABC) transporters in these
Directory of Open Access Journals (Sweden)
Ting-Ting Song
Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.
Gangliosides do not affect ABC transporter function in human neuroblastoma cells
Dijkhuis, Anne-Jan; Klappe, Karin; Kamps, Willem; Sietsma, Hannie; Kok, Jan Willem
Previous studies have indicated a role for glucosylceramide synthase (GCS) in multidrug resistance (MDR), either related to turnover of ceramide (Cer) or generation of gangliosides, which modulate apoptosis and/or the activity of ABC transporters. This study challenges the hypothesis that
Fulyani, Faizah; Schuurman-Wolters, Gea K.; Vujicic - Zagar, Andreja; Guskov, Albert; Slotboom, Dirk-Jan; Poolman, Bert
2013-01-01
The ATP-binding cassette (ABC) transporter GInPQ is an essential uptake system for amino acids in gram-positive pathogens and related nonpathogenic bacteria. The transporter has tandem substrate-binding domains (SBDs) fused to each transmembrane domain, giving rise to four SBDs per functional
Obstacles to Brain Tumor Therapy: Key ABC Transporters
Directory of Open Access Journals (Sweden)
Juwina Wijaya
2017-11-01
Full Text Available The delivery of cancer chemotherapy to treat brain tumors remains a challenge, in part, because of the inherent biological barrier, the blood–brain barrier. While its presence and role as a protector of the normal brain parenchyma has been acknowledged for decades, it is only recently that the important transporter components, expressed in the tightly knit capillary endothelial cells, have been deciphered. These transporters are ATP-binding cassette (ABC transporters and, so far, the major clinically important ones that functionally contribute to the blood–brain barrier are ABCG2 and ABCB1. A further limitation to cancer therapy of brain tumors or brain metastases is the blood–tumor barrier, where tumors erect a barrier of transporters that further impede drug entry. The expression and regulation of these two transporters at these barriers, as well as tumor derived alteration in expression and/or mutation, are likely obstacles to effective therapy.
Half collision resonance phenomena in molecules
International Nuclear Information System (INIS)
Maximo Garcia-Sucre; Raseev, G.; Ross, S.C.
1991-01-01
The Escuela Latinoamericana de Fisica (ELAF) is a series of meeting s that for 28 years has played an important role in research-level teaching of physics in Latin America. This book contains the proceedings of ELAF 90 which was held at the Instituto Venezolano de Investigaciones Cientificas (IVIC) in Caracas, Venezuela from July 23 to August 3, 1990, as part of the commemoration of the 30th anniversary of IVIC. In contrast to previous ELAF's that were of general scope, ELAF 90 centered on a particular subject matter: '' Half Collisional Resonance Phenomena in Molecules, Experimental and Theoretical Approaches. ''The term ''Half Collision'' refers to the fragmentation of a molecular system following is excitation by light. The lack of an incident fragmentation of a molecular system following is excitation by light. The lack of an incident particle (other than the photon) in the fragmentation process is what leads to the term. The purpose of this volume is to present current results in the experimental and theoretical study of half collisions and also to include pedagogical papers at an introductory or intermediate level. The contributions are grouped into several sections; light sources; ionization; dissociation-experimental; dissociation-theory; competition between ionization and dissociation; and particle-molecule collisions
Directory of Open Access Journals (Sweden)
Linda J Gahan
2010-12-01
Full Text Available Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.
Gahan, Linda J; Pauchet, Yannick; Vogel, Heiko; Heckel, David G
2010-12-16
Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt) are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.
A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae.
Dermauw, Wannes; Osborne, Edward John; Clark, Richard M; Grbić, Miodrag; Tirry, Luc; Van Leeuwen, Thomas
2013-05-10
The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters have often been associated with resistance to drugs and toxic compounds, within the Arthropoda ABC gene families have only been characterized in detail in several insects and a crustacean. In this study, we report a genome-wide survey and expression analysis of the ABC gene superfamily in the spider mite, Tetranychus urticae, a chelicerate ~ 450 million years diverged from other Arthropod lineages. T. urticae is a major agricultural pest, and is among of the most polyphagous arthropod herbivores known. The species resists a staggering array of toxic plant secondary metabolites, and has developed resistance to all major classes of pesticides in use for its control. We identified 103 ABC genes in the T. urticae genome, the highest number discovered in a metazoan species to date. Within the T. urticae ABC gene set, all members of the eight currently described subfamilies (A to H) were detected. A phylogenetic analysis revealed that the high number of ABC genes in T. urticae is due primarily to lineage-specific expansions of ABC genes within the ABCC, ABCG and ABCH subfamilies. In particular, the ABCC subfamily harbors the highest number of T. urticae ABC genes (39). In a comparative genomic analysis, we found clear orthologous relationships between a subset of T. urticae ABC proteins and ABC proteins in both vertebrates and invertebrates known to be involved in fundamental cellular processes. These included members of the ABCB-half transporters, and the ABCD, ABCE and ABCF families. Furthermore, one-to-one orthologues could be distinguished between T. urticae proteins and human ABCC10, ABCG5 and ABCG8, the Drosophila melanogaster sulfonylurea receptor and ecdysone-regulated transporter E
Schoonbeek, H.; Nistelrooy, van J.G.M.; Waard, de M.A.
2003-01-01
The role of multiple ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes from the plant pathogenic fungus Botrytis cinerea in protection against natural fungitoxic compounds was studied by expression analysis and phenotyping of gene-replacement mutants. The
Influence of detergents on the activity of the ABC transporter LmrA
Infed, Nacera; Hanekop, Nils; Driessen, Arnold J. M.; Smits, Sander H. J.; Schmitt, Lutz
The ABC transporter LmrA from Lactococcus lactis has been intensively studied and a role in multidrug resistance was proposed. Here, we performed a comprehensive detergent screen to analyze the impact of detergents for a successful solubilization, purification and retention of functional properties
Kropf, Christian; Segner, Helmut; Fent, Karl
2016-01-01
Embryos of oviparous fish, in contrast to (ovo) viviparous species, develop in the aquatic environment, and therefore need solute transport systems at their body surfaces for maintaining internal homeostasis and defending against potentially harmful substances. We hypothesized that solute transporters undergo changes in tissue distribution from the embryo to the larval stage. We therefore studied the mRNA profiles of eight ABC transporters (abcb1a, abcb1b, abcc1, abcc2, abcc3, abcc4, abcc5, abcg2) and three solute carriers (oatp1d, putative oatp2 putative, mate1) in different body regions (head, yolk sac epithelium, abdominal viscera, skin/muscles) of developing rainbow trout. Additionally, we investigated mRNA levels of phase I (cyp1a, cyp3a) and phase II (gstp, putative ugt1, putative ugt2) biotransformation enzymes. The study covered the developmental period from the eleuthero-embryo stage to the first-feeding larval stage (1-20days post-hatch, dph). At 1dph, transcripts of abcc2, abcc4, abcg2, cyp3a, gstp, putative mate1, and putative oatp2 occurred primarily in the yolk sac epithelium, whereas at later stages expression of these genes was predominantly observed in the abdominal viscera. The functional activity of ABC transporters in fish early life stages was assessed by rhodamine B accumulation assays. Finally, we investigated the potential impact of xenobiotics (clotrimazole, clofibric acid) on the ABC and biotransformation systems of trout early life stages. While clofibric acid had no effect, clotrimazole lead to an increased rhodamine B accumulation. The results provide evidence that the transition from the eleuthero-embryo to the larval stage is accompanied by a major alteration in tissue expression of ABC transporters. Copyright © 2016 Elsevier Inc. All rights reserved.
Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming
2015-06-06
Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC
Poudyal, Bandita; Sauer, Karin
2018-02-01
A hallmark of biofilms is their tolerance to killing by antimicrobial agents. In Pseudomonas aeruginosa , biofilm drug tolerance requires the c-di-GMP-responsive MerR transcriptional regulator BrlR. However, the mechanism by which BrlR mediates biofilm drug tolerance has not been elucidated. Here, we demonstrate that BrlR activates the expression of at least 7 ABC transport systems, including the PA1874-PA1875-PA1876-PA1877 (PA1874-77) operon, with chromatin immunoprecipitation and DNA binding assays confirming BrlR binding to the promoter region of PA1874-77. Insertional inactivation of the 7 ABC transport systems rendered P. aeruginosa PAO1 biofilms susceptible to tobramycin or norfloxacin. Susceptibility was linked to drug accumulation, with BrlR contributing to norfloxacin accumulation in a manner dependent on multidrug efflux pumps and the PA1874-77 ABC transport system. Inactivation of the respective ABC transport system, furthermore, eliminated the recalcitrance of biofilms to killing by tobramycin but not norfloxacin, indicating that drug accumulation is not linked to biofilm drug tolerance. Our findings indicate for the first time that BrlR, a MerR-type transcriptional activator, activates genes encoding several ABC transport systems, in addition to multiple multidrug efflux pump genes. Moreover, our data confirm a BrlR target contributing to drug tolerance, likely countering the prevailing dogma that biofilm tolerance arises from a multiplicity of factors. Copyright © 2018 American Society for Microbiology.
Simpson, Brent W; Owens, Tristan W; Orabella, Matthew J; Davis, Rebecca M; May, Janine M; Trauger, Sunia A; Kahne, Daniel; Ruiz, Natividad
2016-10-18
The surface of most Gram-negative bacteria is covered with lipopolysaccharide (LPS), creating a permeability barrier against toxic molecules, including many antimicrobials. To assemble LPS on their surface, Gram-negative bacteria must extract newly synthesized LPS from the inner membrane, transport it across the aqueous periplasm, and translocate it across the outer membrane. The LptA to -G proteins assemble into a transenvelope complex that transports LPS from the inner membrane to the cell surface. The Lpt system powers LPS transport from the inner membrane by using a poorly characterized ATP-binding cassette system composed of the ATPase LptB and the transmembrane domains LptFG. Here, we characterize a cluster of residues in the groove region of LptB that is important for controlling LPS transport. We also provide the first functional characterization of LptFG and identify their coupling helices that interact with the LptB groove. Substitutions at conserved residues in these coupling helices compromise both the assembly and function of the LptB 2 FG complex. Defects in LPS transport conferred by alterations in the LptFG coupling helices can be rescued by changing a residue in LptB that is adjacent to functionally important residues in the groove region. This suppression is achieved by increasing the ATPase activity of the LptB 2 FG complex. Taken together, these data identify a specific binding site in LptB for the coupling helices of LptFG that is responsible for coupling of ATP hydrolysis by LptB with LptFG function to achieve LPS extraction. Lipopolysaccharide (LPS) is synthesized at the cytoplasmic membrane of Gram-negative bacteria and transported across several compartments to the cell surface, where it forms a barrier that protects these organisms from antibiotics. The LptB 2 FG proteins form an ATP-binding cassette (ABC) transporter that uses energy from ATP hydrolysis in the cytoplasm to facilitate extraction of LPS from the outer face of the
Staud, Frantisek; Cerveny, Lukas; Ceckova, Martina
2012-11-01
Pharmacotherapy during pregnancy is often inevitable for medical treatment of the mother, the fetus or both. The knowledge of drug transport across placenta is, therefore, an important topic to bear in mind when deciding treatment in pregnant women. Several drug transporters of the ABC and SLC families have been discovered in the placenta, such as P-glycoprotein, breast cancer resistance protein, or organic anion/cation transporters. It is thus evident that the passage of drugs across the placenta can no longer be predicted simply on the basis of their physical-chemical properties. Functional expression of placental drug transporters in the trophoblast and the possibility of drug-drug interactions must be considered to optimize pharmacotherapy during pregnancy. In this review we summarize current knowledge on the expression and function of ABC and SLC transporters in the trophoblast. Furthermore, we put this data into context with medical conditions that require maternal and/or fetal treatment during pregnancy, such as gestational diabetes, HIV infection, fetal arrhythmias and epilepsy. Proper understanding of the role of placental transporters should be of great interest not only to clinicians but also to pharmaceutical industry for future drug design and development to control the degree of fetal exposure.
Diversity and evolution of ABC proteins in mycorrhiza-forming fungi.
Kovalchuk, Andriy; Kohler, Annegret; Martin, Francis; Asiegbu, Fred O
2015-12-28
Transporter proteins are predicted to have an important role in the mycorrhizal symbiosis, due to the fact that this type of an interaction between plants and fungi requires a continuous nutrient and signalling exchange. ABC transporters are one of the large groups of transporter proteins found both in plants and in fungi. The crucial role of plant ABC transporters in the formation of the mycorrhizal symbiosis has been demonstrated recently. Some of the fungal ABC transporter-encoding genes are also induced during the mycorrhiza formation. However, no experimental evidences of the direct involvement of fungal ABC transporters in this process are available so far. To facilitate the identification of fungal ABC proteins with a potential role in the establishment of the mycorrhizal symbiosis, we have performed an inventory of the ABC protein-encoding genes in the genomes of 25 species of mycorrhiza-forming fungi. We have identified, manually annotated and curated more than 1300 gene models of putative ABC protein-encoding genes. Out of those, more than 1000 models are predicted to encode functional proteins, whereas about 300 models represent gene fragments or putative pseudogenes. We have also performed the phylogenetic analysis of the identified sequences. The sets of ABC proteins in the mycorrhiza-forming species were compared to the related saprotrophic or plant-pathogenic fungal species. Our results demonstrate the high diversity of ABC genes in the genomes of mycorrhiza-forming fungi. Via comparison of transcriptomics data from different species, we have identified candidate groups of ABC transporters that might have a role in the process of the mycorrhiza formation. Results of our inventory will facilitate the identification of fungal transporters with a role in the mycorrhiza formation. We also provide the first data on ABC protein-coding genes for the phylum Glomeromycota and for orders Pezizales, Atheliales, Cantharellales and Sebacinales, contributing to
Menges, R; Muth, G; Wohlleben, W; Stegmann, E
2007-11-01
All known gene clusters for glycopeptide antibiotic biosynthesis contain a conserved gene supposed to encode an ABC-transporter. In the balhimycin-producer Amycolatopsis balhimycina this gene (tba) is localised between the prephenate dehydrogenase gene pdh and the peptide synthetase gene bpsA. Inactivation of tba in A. balhimycina by gene replacement did not interfere with growth and did not affect balhimycin resistance. However, in the supernatant of the tba mutant RM43 less balhimycin was accumulated compared to the wild type; and the intra-cellular balhimycin concentration was ten times higher in the tba mutant RM43 than in the wild type. These data suggest that the ABC transporter encoded in the balhimycin biosynthesis gene cluster is not involved in resistance but is required for the efficient export of the antibiotic. To elucidate the activity of Tba it was heterologously expressed in Escherichia coli with an N-terminal His-tag and purified by nickel chromatography. A photometric assay revealed that His(6)-Tba solubilised in dodecylmaltoside possesses ATPase activity, characteristic for ABC-transporters.
DEFF Research Database (Denmark)
Xu, Deyang; Veres, Dorottya; Belew, Zeinu Mussa
2016-01-01
the question whether the oocytes system is suitable to express and characterize ABC transporters. Thus we have selected AtABCG25, previously characterized in insect cells as the exporter of commercially valuable abscisic acid—as case study for optimizing of characterization in Xenopus oocytes. The tools...
Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou
2012-07-01
The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.
Ligand Binding and Crystal Structures of the Substrate-Binding Domain of the ABC Transporter OpuA
Wolters, Justina C.; Berntsson, Ronnie P-A.; Gul, Nadia; Karasawa, Akira; Thunnissen, Andy-Mark W. H.; Slotboom, Dirk-Jan; Poolman, Bert
2010-01-01
The ABC transporter OpuA from Lactococcus lactis transports glycine betaine upon activation by threshold values of ionic strength. In this study, the ligand binding characteristics of purified OpuA in a detergent-solubilized state and of its substrate-binding domain produced as soluble protein
International Nuclear Information System (INIS)
Fuchs, Dominik; Daniel, Volker; Sadeghi, Mahmoud; Opelz, Gerhard; Naujokat, Cord
2010-01-01
Leukemia stem cells are known to exhibit multidrug resistance by expression of ATP-binding cassette (ABC) transporters which constitute transmembrane proteins capable of exporting a wide variety of chemotherapeutic drugs from the cytosol. We show here that human promyeloblastic leukemia KG-1a cells exposed to the histone deacetylase inhibitor phenylbutyrate resemble many characteristics of leukemia stem cells, including expression of functional ABC transporters such as P-glycoprotein, BCRP and MRP8. Consequently, KG-1a cells display resistance to the induction of apoptosis by various chemotherapeutic drugs. Resistance to apoptosis induction by chemotherapeutic drugs can be reversed by cyclosporine A, which effectively inhibits the activity of P-glycoprotein and BCRP, thus demonstrating ABC transporter-mediated drug resistance in KG-1a cells. However, KG-1a are highly sensitive to apoptosis induction by salinomycin, a polyether ionophore antibiotic that has recently been shown to kill human breast cancer stem cell-like cells and to induce apoptosis in human cancer cells displaying multiple mechanisms of drug and apoptosis resistance. Whereas KG-1a cells can be adapted to proliferate in the presence of apoptosis-inducing concentrations of bortezomib and doxorubicin, salinomycin does not permit long-term adaptation of the cells to apoptosis-inducing concentrations. Thus, salinomycin should be regarded as a novel and effective agent for the elimination of leukemia stem cells and other tumor cells exhibiting ABC transporter-mediated multidrug resistance.
International Nuclear Information System (INIS)
Kjaerulff, Soren; Mueller, Sven; Jensen, Martin Roland
2005-01-01
To examine whether the fission yeast Mam1 ABC transporter can be used for secretion of heterologous proteins, thereby bypassing the classical secretion pathway, we have analyzed chimeric forms of the M-factor precursor. It was demonstrated that GFP can be exported when fused to both the amino-terminal prosequence from mfm1 and a CaaX motif. This secretion was dependent on the Mam1 transporter and not the classical secretion pathway. The secretion efficiency of GFP, however, was relatively low and most of the reporter protein was trapped in the vacuolar membranes. Our findings suggest that the Mam1 ABC protein is a promiscuous peptide transporter that can accommodate globular proteins of a relatively large size. Furthermore, our results help in defining the sequences required for processing and secretion of natural M-factor
ABC Transporter for Corrinoids in Halobacterium sp. Strain NRC-1†
Woodson, Jesse D.; Reynolds, April A.; Escalante-Semerena, Jorge C.
2005-01-01
We report evidence for the existence of a putative ABC transporter for corrinoid utilization in the extremely halophilic archaeon Halobacterium sp. strain NRC-1. Results from genetic and nutritional analyses of Halobacterium showed that mutants with lesions in open reading frames (ORFs) Vng1370G, Vng1371Gm, and Vng1369G required a 105-fold higher concentration of cobalamin for growth than the wild-type or parent strain. The data support the conclusion that these ORFs encode orthologs of the b...
Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc
2017-05-04
Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1 mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Sergi Vaquer
2014-08-01
Full Text Available Abstract Microgravity has been shown to influence the expression of ABC (ATP-Binding Cassette transporters in bacteria, fungi and mammals, but also to modify the activity of certain cellular components with structural and functional similarities to ABC transporters. Changes in activity of ABC transporters could lead to important metabolic disorders and undesired pharmacological effects during spaceflights. However, no current means exist to study the functionality of these transporters in microgravity. To this end, a Vesicular Transport Assay® (Solvo Biotechnology, Hungary was adapted to evaluate multi-drug resistance-associated protein 2 (MRP2 trans-membrane estradiol-17-β-glucuronide (E17βG transport activity, when activated by adenosine-tri-phosphate (ATP during parabolic flights. Simple diffusion, ATP-independent transport and benzbromarone inhibition were also evaluated. A high accuracy engineering system was designed to perform, monitor and synchronize all procedures. Samples were analysed using a validated high sensitivity drug detection protocol. Experiments were performed in microgravity during parabolic flights, and compared to 1g on ground results using identical equipment and procedures in all cases. Our results revealed that sufficient equipment accuracy and analytical sensitivity were reached to detect transport activity in both gravitational conditions. Additionally, transport activity levels of on ground samples were within commercial transport standards, proving the validity of the methods and equipment used. MRP2 net transport activity was significantly reduced in microgravity, so was signal detected in simple diffusion samples. Ultra-structural changes induced by gravitational stress upon vesicle membranes or transporters could explain the current results, although alternative explanations are possible. Further research is needed to provide a conclusive answer in this regard. Nevertheless, the present validated technology
A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae
Dermauw, W.; Osborne, E.J.; Clark, R.M.; Grbić, M.; Tirry, L.; Van Leeuwen, T.
2013-01-01
Background: The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters
DEFF Research Database (Denmark)
Sonne, Jacob; Kandt, C.; Peters, Günther H.j.
2007-01-01
The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...
Directory of Open Access Journals (Sweden)
Sabrina Llop
Full Text Available The genetic background may influence methylmercury (MeHg metabolism and neurotoxicity. ATP binding cassette (ABC transporters actively transport various xenobiotics across biological membranes.To investigate the role of ABC polymorphisms as modifiers of prenatal exposure to MeHg.The study population consisted of participants (n = 1651 in two birth cohorts, one in Italy and Greece (PHIME and the other in Spain (INMA. Women were recruited during pregnancy in Italy and Spain, and during the perinatal period in Greece. Total mercury concentrations were measured in cord blood samples by atomic absorption spectrometry. Maternal fish intake during pregnancy was determined from questionnaires. Polymorphisms (n = 5 in the ABC genes ABCA1, ABCB1, ABCC1 and ABCC2 were analysed in both cohorts.ABCB1 rs2032582, ABCC1 rs11075290, and ABCC2 rs2273697 modified the associations between maternal fish intake and cord blood mercury concentrations. The overall interaction coefficient between rs2032582 and log2-transformed fish intake was negative for carriers of GT (β = -0.29, 95%CI -0.47, -0.12 and TT (β = -0.49, 95%CI -0.71, -0.26 versus GG, meaning that for a doubling in fish intake of the mothers, children with the rs2032582 GG genotype accumulated 35% more mercury than children with TT. For rs11075290, the interaction coefficient was negative for carriers of TC (β = -0.12, 95%CI -0.33, 0.09, and TT (β = -0.28, 95%CI -0.51, -0.06 versus CC. For rs2273697, the interaction coefficient was positive when combining GA+AA (β = 0.16, 95%CI 0.01, 0.32 versus GG.The ABC transporters appear to play a role in accumulation of MeHg during early development.
Trumpi, K.; Emmink, B. L.; Prins, A. M.; van Oijen, M. G. H.; van Diest, P. J.; Punt, C. J. A.; Koopman, M.; Kranenburg, O.; Borel Rinkes, I. H. M.
2015-01-01
Background: Active efflux of irinotecan by ATP-binding cassette (ABC)-transporters, in particular ABCB1 and ABCG2, is a well-established drug resistance mechanism in vitro and in pre-clinical mouse models, but its relevance in colorectal cancer (CRC) patients is unknown. Therefore, we assessed the
Velaei, Kobra; Samadi, Nasser; Soltani, Sina; Barazvan, Balal; Soleimani Rad, Jafar
2017-07-01
Shedding light on chemoresistance biology of breast cancer could contribute to enhance the clinical outcome. Intrinsic or acquired resistance to chemotherapy is a major problem in breast cancer treatment. The NFκB pathway by siRNAP65 and JSH-23 as a translocational inhibitor of NFκBP65 in the doxorubicin-resistant MCF-7 (MCF-7/Dox) and MCF-7 cells was blocked. Then, the ABC transporter expression and function were assessed by real-time qRT-PCR and flow cytometry, respectively. Induction of apoptosis was evaluated after inhibition of the NFΚB pathway as well. Our study underlined the upregulation of NFκBP65 and anti-apoptotic Bcl-2 and downregulation of pro-apoptotic Bax in the MCF-7/Dox cells compared with control MCF-7 cells. Here, we showed that interplay between nuclear factor kappa B P65 (NFkBP65) as a transcriptional regulator and ABC transporters in the MCF-7/Dox cancer cells. We found that inhibition of the elevated expression of NFκBP65 in the resistant breast cancer, whether translocational inhibition or silencing by siRNA, decreased the expression and function of MDR1 and MRP1 efflux pumps. Furthermore, the blockade of NFκBP65 promoted apoptosis via modulating Bcl-2 and BAX expression. After inhibition of the NFκBP65 signaling pathway, elevated baseline expression of survival Bcl-2 gene in the resistant breast cells significantly decreased. Suppression of the NFκB pathway has a profound dual impact on promoting the intrinsic apoptotic pathway and reducing ABC transporter function and expression, which are some of the chemoresistance features. It was speculated that the NFκB pathway directly acts on doxorubicin-induced MDR1 and MRP1 expression in MCF-7/Dox cells.
Molybdate transporter ModABC is important for Pseudomonas aeruginosa chronic lung infection.
Périnet, Simone; Jeukens, Julie; Kukavica-Ibrulj, Irena; Ouellet, Myriam M; Charette, Steve J; Levesque, Roger C
2016-01-12
Mechanisms underlying the success of Pseudomonas aeruginosa in chronic lung infection among cystic fibrosis (CF) patients are poorly defined. The modA gene was previously linked to in vivo competitiveness of P. aeruginosa by a genetic screening in the rat lung. This gene encodes a subunit of transporter ModABC, which is responsible for extracellular uptake of molybdate. This compound is essential for molybdoenzymes, including nitrate reductases. Since anaerobic growth conditions are known to occur during CF chronic lung infection, inactivation of a molybdate transporter could inhibit proliferation through the inactivation of denitrification enzymes. Hence, we performed phenotypic characterization of a modA mutant strain obtained by signature-tagged mutagenesis (STM_modA) and assessed its virulence in vivo with two host models. The STM_modA mutant was in fact defective for anaerobic growth and unable to use nitrates in the growth medium for anaerobic respiration. Bacterial growth and nitrate usage were restored when the medium was supplemented with molybdate. Most significantly, the mutant strain showed reduced virulence compared to wild-type strain PAO1 according to a competitive index in the rat model of chronic lung infection and a predation assay with Dictyostelium discoideum amoebae. As the latter took place in aerobic conditions, the in vivo impact of the mutation in modA appears to extend beyond its effect on anaerobic growth. These results support the modABC-encoded transporter as important for the pathogenesis of P. aeruginosa, and suggest that enzymatic machinery implicated in anaerobic growth during chronic lung infection in CF merits further investigation as a potential target for therapeutic intervention.
Engineering of Ion Sensing by the Cystathionine beta-Synthase Module of the ABC Transporter OpuA
Mahmood, Nik A. B. N.; Biemans-Oldehinkel, Esther; Poolman, Bert
2009-01-01
We have previously shown that the C-terminal cystathionine beta-synthase (CBS) domains of the nucleotide-binding domains of the ABC transporter OpuA, in conjunction with an anionic membrane surface function, act as sensor of internal ionic strength (I(in)). Here, we show that a surface-exposed
Sook, Brian R; Block, Darci R; Sumithran, Suganya; Montañez, Griselle E; Rodgers, Kenton R; Dawson, John H; Eichenbaum, Zehava; Dixon, Dabney W
2008-02-26
Many pathogenic bacteria require heme and obtain it from their environment. Heme transverses the cytoplasmic membrane via an ATP binding cassette (ABC) pathway. Although a number of heme ABC transport systems have been described in pathogenic bacteria, there is as yet little biophysical characterization of the proteins in these systems. The sia (hts) gene cluster encodes a heme ABC transporter in the Gram positive Streptococcus pyogenes. The lipoprotein-anchored heme binding protein (HBP) of this transporter is SiaA (HtsA). In the current study, resonance Raman (rR), magnetic circular dichroism (MCD), and nuclear magnetic resonance (NMR) spectroscopies were used to determine the coordination state and spin state of both the ferric and ferrous forms of this protein. Identifiers from these techniques suggest that the heme is six-coordinate and low-spin in both oxidation states of the protein, with methionine and histidine as axial ligands. SiaA has a pKa of 9.7 +/- 0.1, attributed to deprotonation of the axial histidine. Guanidinium titration studies show that the ferric state is less stable than the ferrous state, with DeltaG(H2O) values for the oxidized and reduced proteins of 7.3 +/- 0.8 and 16.0 +/- 3.6 kcal mol-1, respectively. The reductive and oxidative midpoint potentials determined via spectroelectrochemistry are 83 +/- 3 and 64 +/- 3 mV, respectively; the irreversibility of heme reduction suggests that redox cycling of the heme is coupled to a kinetically sluggish change in structure or conformation. The biophysical characterization described herein will significantly advance our understanding of structure-function relationships in HBP.
Directory of Open Access Journals (Sweden)
Natalia Brzozowska
2016-05-01
Full Text Available Cannabidiol (CBD is currently being investigated as a novel therapeutic for the treatment of CNS disorders like schizophrenia and epilepsy. ABC transporters such as P-glycoprotein (P-gp and breast cancer resistance protein (Bcrp mediate pharmacoresistance in these disorders. P-gp and Bcrp are expressed at the blood brain barrier (BBB and reduce the brain uptake of substrate drugs including various antipsychotics and anticonvulsants. It is therefore important to assess whether CBD is prone to treatment resistance mediated by P-gp and Bcrp. Moreover, it has become common practice in the drug development of CNS agents to screen against ABC transporters to help isolate lead compounds with optimal pharmacokinetic properties. The current study aimed to assess whether P-gp and Bcrp impacts the brain transport of CBD by comparing CBD tissue concentrations in wild-type (WT mice versus mice devoid of ABC transporter genes. P-gp knockout (Abcb1a/b−∕−, Bcrp knockout (Abcg2−∕−, combined P-gp/Bcrp knockout (Abcb1a/b−∕−Abcg2−∕− and WT mice were injected with CBD, before brain and plasma samples were collected at various time-points. CBD results were compared with the positive control risperidone and 9-hydroxy risperidone, antipsychotic drugs that are established ABC transporter substrates. Brain and plasma concentrations of CBD were not greater in P-gp, Bcrp or P-gp/Bcrp knockout mice than WT mice. In comparison, the brain/plasma concentration ratios of risperidone and 9-hydroxy risperidone were profoundly higher in P-gp knockout mice than WT mice. These results suggest that CBD is not a substrate of P-gp or Bcrp and may be free from the complication of reduced brain uptake by these transporters. Such findings provide favorable evidence for the therapeutic development of CBD in the treatment of various CNS disorders.
Directory of Open Access Journals (Sweden)
Massomeh Rafiei-Demneh
2016-09-01
Full Text Available In plants, there are complex network of transport, chelation, and sequestration processes that functions in maintaining concentrations of essential metal ions in different cellular compartments, thus minimizing the damage caused by entry of non-essential metal ions into the cytosol. In the presence of toxic ones, arbuscular mycorrhizal (AM fungi are able to alleviate metal toxicity in the plant. In this study the effect of an arbuscular mycorrhizal fungi Funneliformis intraradices on growth, Nickel tolerance, and ABC transporter and metallothionein expression in leaves and roots of tall fescue (Festuca arundinacea plants cultivated in Ni polluted soil were evaluated. The fungi infected (M+ and uninfected (M- fescue plants were cultivated in soil under different Ni concentrations (0, 30, 90 and 180 ppm for 3 months. Results demonstrated the positive effect of fungi colonization on the increase in growth and reduction in Ni uptake (90 and 180 ppm and Ni translocation from roots to shoot of tall fescue under Ni stress. The results also demonstrated that the level of ABC transporterand metallothionein transcripts accumulation in roots was considerably higher for both M- and M+ plants compared to the control. Also, M+ plants showed less ABC and MET expression compared to the M- plants. These results demonstrated the importance of mycorrhizal colonization of F. intraradices in reduction of Ni transport from root to shoot of tall fescue which alleviates Ni-induced stress.
Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi
2005-10-01
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.
Quantum transport through organic molecules
International Nuclear Information System (INIS)
Maiti, Santanu K.
2007-01-01
We investigate the electronic transport for the model of benzene-1, 4-dithiolate (BDT) molecule and some other geometric models of benzene molecule attached with two semi-infinite metallic electrodes by the use of Green's function technique. An analytic approach for the electronic transport through the molecular bridges is presented, based on the tight-binding model. Transport of electrons in such molecular bridges is strongly affected by the geometry of the molecules and their coupling strength with the electrodes. Conductance (g) shows resonance peaks associated with the molecular energy eigenstates. In the weak molecule-to-electrodes coupling limit current (I) passing through the molecules shows staircase-like behavior with sharp steps, while, it varies quite continuously in the limit of strong molecular coupling with the applied bias voltage (V). In presence of the transverse magnetic field conductance gives oscillatory behavior with flux φ, threaded by the molecular ring, showing φ 0 ( = ch/e) flux-quantum periodicity. Though conductance changes with the application of transverse magnetic field, but the current-voltage characteristics remain same in presence of this magnetic field for these molecular bridge systems
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina
2015-01-01
AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...
A Neisseria meningitidis fbpABC mutant is incapable of using nonheme iron for growth.
Khun, H H; Kirby, S D; Lee, B C
1998-05-01
The neisserial fbpABC locus has been proposed to act as an iron-specific ABC transporter system. To confirm this assigned function, we constructed an fbpABC mutant in Neisseria meningitidis by insertional inactivation of fbpABC with a selectable antibiotic marker. The mutant was unable to use iron supplied from human transferrin, human lactoferrin, or iron chelates. However, the use of iron from heme and human hemoglobin was unimpaired. These results support the obligatory participation of fbpABC in neisserial periplasmic iron transport and do not indicate a role for this genetic locus in the heme iron pathway.
Sanz, Y; Toldra, F; Renault, P; Poolman, B
2003-01-01
The genome sequence of Lactococcus lactis IL1403 revealed the presence of a putative peptide-binding protein-dependent ABC-transporter (Dpp). The genes for two peptide-binding proteins (dppA and dppP) precede the membrane components, which include two transmembrane protein genes (dppB and dppC) and
Inventory and analysis of ATP-binding cassette (ABC) systems in Brugia malayi.
Ardelli, B F; Stitt, L E; Tompkins, J B
2010-07-01
ABC systems are one of the largest described protein superfamilies. These systems have a domain organization that may contain 1 or more transmembrane domains (ABC_TM1F) and 1 or 2 ATP-binding domains (ABC_2). The functions (e.g., import, export and DNA repair) of these proteins distinguish the 3 classes of ABC systems. Mining and PCR-based cloning were used to identify 33 putative ABC systems from the Brugia malayi genome. There were 31 class 2 genes, commonly called ABC transporters, and 2 class 3 genes. The ABC transporters were divided into subfamilies. Three belonged to subfamily A, 16 to subfamily B, 5 to subfamily C, 1 to subfamily E and 3 to subfamilies F and G, respectively. None were placed in subfamilies D and H. Similar to other ABC systems, the ABC_2 domain of B. malayi genes was conserved and contained the Walker A and B motifs, the signature sequence/linker region and the switch region with the conserved histidine. The ABC_TM1F domain was less conserved. The relative abundance of ABC systems was quantified using real-time reverse transcription PCR and was significantly higher in female adults of B. malayi than in males and microfilaria, particularly those in subfamilies B and C, which are associated with drug resistance.
Liu, Cong; Krishnan, J; Xu, Xiao Yun
2013-03-01
In this paper we systematically investigate the effects of acquired drug resistance at the cellular and tissue scale, with a specific focus on ATP-binding cassette (ABC) transporter-based mechanisms and contrast this with other representative intracellular resistance mechanisms. This is done by developing in silico models wherein the drug resistance mechanism is overlaid on a coarse-grained description of apoptosis; these cellular models are coupled with interstitial drug transport, allowing for a transparent examination of the effect of acquired drug resistances at the tissue level. While ABC transporter-mediated resistance mechanisms counteract drug effect at the cellular level, its tissue-level effect is more complicated, revealing unexpected trends in tissue response as drug stimuli are systematically varied. Qualitatively different behaviour is observed in other drug resistance mechanisms. Overall the paper (i) provides insight into the tissue level functioning of a particular resistance mechanism, (ii) shows that this is very different from other resistance mechanisms of an apparently similar type, and (iii) demonstrates a concrete instance of how the functioning of a negative feedback based cellular adaptive mechanism can have unexpected higher scale effects.
75 FR 49549 - ABC & D Recycling, Inc.-Lease and Operation Exemption-a Line of Railroad in Ware, MA
2010-08-13
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. FD 35397] ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, MA ABC & D Recycling, Inc. (ABC & D..., ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, Massachusetts (STB...
Stockner, Thomas; Mullen, Anna; MacMillan, Fraser
2015-10-01
ABC transporters are primary active transporters found in all kingdoms of life. Human multidrug resistance transporter ABCB1, or P-glycoprotein, has an extremely broad substrate spectrum and confers resistance against chemotherapy drug treatment in cancer cells. The bacterial ABC transporter MsbA is a lipid A flippase and a homolog to the human ABCB1 transporter, with which it partially shares its substrate spectrum. Crystal structures of MsbA and ABCB1 have been solved in multiple conformations, providing a glimpse into the possible conformational changes the transporter could be going through during the transport cycle. Crystal structures are inherently static, while a dynamic picture of the transporter in motion is needed for a complete understanding of transporter function. Molecular dynamics (MD) simulations and electron paramagnetic resonance (EPR) spectroscopy can provide structural information on ABC transporters, but the strength of these two methods lies in the potential to characterise the dynamic regime of these transporters. Information from the two methods is quite complementary. MD simulations provide an all atom dynamic picture of the time evolution of the molecular system, though with a narrow time window. EPR spectroscopy can probe structural, environmental and dynamic properties of the transporter in several time regimes, but only through the attachment sites of an exogenous spin label. In this review the synergistic effects that can be achieved by combining the two methods are highlighted, and a brief methodological background is also presented. © 2015 Authors; published by Portland Press Limited.
Carmona-Antoñanzas, Greta; Carmichael, Stephen N; Heumann, Jan; Taggart, John B; Gharbi, Karim; Bron, James E; Bekaert, Michaël; Sturm, Armin
2015-01-01
Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance.
Energy Technology Data Exchange (ETDEWEB)
Tirado-Lee, Leidamarie; Lee, Allen; Rees, Douglas C.; Pinkett, Heather W. (CIT); (NWU)
2014-10-02
molA (HI1472) from H. influenzae encodes a periplasmic binding protein (PBP) that delivers substrate to the ABC transporter MolB{sub 2}C{sub 2} (formerly HI1470/71). The structures of MolA with molybdate and tungstate in the binding pocket were solved to 1.6 and 1.7 {angstrom} resolution, respectively. The MolA-binding protein binds molybdate and tungstate, but not other oxyanions such as sulfate and phosphate, making it the first class III molybdate-binding protein structurally solved. The {approx}100 {mu}M binding affinity for tungstate and molybdate is significantly lower than observed for the class II ModA molybdate-binding proteins that have nanomolar to low micromolar affinity for molybdate. The presence of two molybdate loci in H. influenzae suggests multiple transport systems for one substrate, with molABC constituting a low-affinity molybdate locus.
Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther
2011-06-17
The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter.
ABC Technology Development Program
International Nuclear Information System (INIS)
1994-01-01
The Accelerator-Based Conversion (ABC) facility will be designed to accomplish the following mission: 'Provide a weapon's grade plutonium disposition capability in a safe, economical, and environmentally sound manner on a prudent schedule for [50] tons of weapon's grade plutonium to be disposed on in [20] years.' This mission is supported by four major objectives: provide a reliable plutonium disposition capability within the next [15] years; provide a level of safety and of safety assurance that meets or exceeds that afforded to the public by modern commercial nuclear power plants; meet or exceed all applicable federal, state, and local regulations or standards for environmental compliance; manage the program in a cost effective manner. The ABC Technology Development Program defines the technology development activities that are required to accomplish this mission. The technology development tasks are related to the following topics: blanket system; vessel systems; reactivity control systems; heat transport system components; energy conversion systems; shutdown heat transport systems components; auxiliary systems; technology demonstrations - large scale experiments
DEFF Research Database (Denmark)
Zhu, Xinna; Long, Fei; Chen, Yonghui
2008-01-01
Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC...... the same amount of biofilm biomass as the wild-type strain. Furthermore, transcription of the downstream lm.G_1770 was not influenced by the upstream Tn917 insertion, and the presence of Tn917 has no effect on biofilm formation. These results suggest that lm.G_1771 was solely responsible for the negative...
Purification, crystallization and preliminary X-ray diffraction analysis of an archaeal ABC-ATPase
Verdon, Grégory; Albers, Sonja-V.; Dijkstra, Bauke W.; Driessen, Arnold J.M.; Thunnissen, Andy-Mark W.H.
2002-01-01
In the archaeon Sulfolobus solfataricus glucose uptake is mediated by an ABC transport system. The ABC-ATPase of this transporter (GlcV) has been overproduced in Escherichia coli and purified. Crystals of GlcV suitable for data collection were obtained in the absence of nucleotide by microseeding
Energy Technology Data Exchange (ETDEWEB)
Kergueris, Ch
1998-12-17
We investigate the electrical transport through a very few molecules connected to metallic electrodes at room temperature. First, the state of the art in molecular electronics is outlined. We present the most convincing molecular devices reported so far in the literature and the theoretical tools available to analyze the electron transport mechanism through a molecular junction. Second, we describe the use of mechanically controllable break junctions to investigate the electron transport properties through a metal-molecule-metal junction. Two kindsof molecules were adsorbed on the two facing gold electrodes, dodecane-thiol (DT) and bis-thiol-ter-thiophene ({alpha},{omega} T3), that are basically expected to behave as an insulator and as a molecular wire, respectively. In the latter case, we study the chemical reactivity of the molecule and show that {alpha},{omega} T3 is chemically adsorbed on gold electrodes. Current-voltage characteristics of the junction were observed at room temperature. The Gold-DT-Gold junction behaves as a simple metal-insulator-metal junction. On the other hand, the electron transport through a Gold-{alpha},{omega} T3-Gold junction explicitly involves the electronic structure of the molecule which gives rise to step-like features in the current-voltage characteristics. The measured zero bias conductance is interpreted using the scattering theory. At high bias, we discuss two different models: a coherent model where the electron has no time to be completely re-localized in the molecule and a sequential model where the electron is localized in the molecule during the transfer. Finally, we show that the mechanical action of decreasing the inter-electrodes spacing can be used to induce a strong modification of the current-voltage characteristics. (author)
Nguyen, Van Ngoc Tuyet; Moon, Sunok; Jung, Ki-Hong
2014-09-01
Although the super family of ATP-binding cassette (ABC) proteins plays key roles in the physiology and development of plants, the functions of members of this interesting family mostly remain to be clarified, especially in crop plants. Thus, systematic analysis of this family in rice (Oryza sativa), a major model crop plant, will be helpful in the design of effective strategies for functional analysis. Phylogenomic analysis that integrates anatomy and stress meta-profiling data based on a large collection of rice Affymetrix array data into the phylogenic context provides useful clues into the functions for each of the ABC transporter family members in rice. Using anatomy data, we identified 17 root-preferred and 16-shoot preferred genes at the vegetative stage, and 3 pollen, 2 embryo, 2 ovary, 2 endosperm, and 1 anther-preferred gene at the reproductive stage. The stress data revealed significant up-regulation or down-regulation of 47 genes under heavy metal treatment, 16 genes under nutrient deficient conditions, and 51 genes under abiotic stress conditions. Of these, we confirmed the differential expression patterns of 14 genes in root samples exposed to drought stress using quantitative real-time PCR. Network analysis using RiceNet suggests a functional gene network involving nine rice ABC transporters that are differentially regulated by drought stress in root, further enhancing the prediction of biological function. Our analysis provides a molecular basis for the study of diverse biological phenomena mediated by the ABC family in rice and will contribute to the enhancement of crop yield and stress tolerance. Copyright © 2014 Elsevier GmbH. All rights reserved.
Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong
2017-02-01
The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families. Copyright © 2016 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Kurashima-Ito, Kaori [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Ikeya, Teppei [National Institute of Advanced Industrial Science and Technology (AIST), (Japan); Senbongi, Hiroshi [Mitochondrial Diseases Group, MRC Dunn Human NutritionUnit (United Kingdom); Tochio, Hidehito [International Graduate School of Arts and Sciences, Supramolecular Biology, Yokohama City University, Molecular Biophysics Laboratory (Japan); Mikawa, Tsutomu [RIKEN, Cellular and Molecular Biology Laboratory (Japan); Shibata, Takehiko [RIKEN, Shibata Distinguished Senior Scientist Laboratory (Japan); Ito, Yutaka [RIKEN, Cellular and Molecular Biology Laboratory (Japan)], E-mail: ito-yutaka@center.tmu.ac.jp
2006-05-15
Human ATP-binding cassette, sub-family B, member 6 (ABCB6) is a mitochondrial ABC transporter, and presumably contributes to iron homeostasis. Aimed at understanding the structural basis for the conformational changes accompanying the substrate-transportation cycle, we have studied the C-terminal nucleotide-binding domain of ABCB6 (ABCB6-C) in both the nucleotide-free and ADP-bound states by heteronuclear multidimensional NMR and homology modelling. A non-linear sampling scheme was utilised for indirectly acquired {sup 13}C and {sup 15}N dimensions of all 3D triple-resonance NMR experiments, in order to overcome the instability and the low solubility of ABCB6-C. The backbone resonances for approximately 25% of non-proline residues, which are mostly distributed around the functionally important loops and in the Helical domain, were not observed for nucleotide-free form of ABCB6-C. From the pH, temperature and magnetic field strength dependencies of the resonance intensities, we concluded that this incompleteness in the assignments is mainly due to the exchange between multiple conformations at an intermediate rate on the NMR timescale. These localised conformational dynamics remained in ADP-bound ABCB6-C except for the loops responsible for adenine base and {alpha}/{beta}-phosphate binding. These results revealed that the localised dynamic cooperativity, which was recently proposed for a prokaryotic ABC MJ1267, also exists in a higher eukaryotic ABC, and is presumably shared by all members of the ABC family. Since the Helical domain is the putative interface to the transmembrane domain, this cooperativity may explain the coupled functions between domains in the substrate-transportation cycle.
Zhang, Xuebin; de Marcos Lousa, Carine; Schutte-Lensink, Nellie; Ofman, Rob; Wanders, Ronald J.; Baldwin, Stephen A.; Baker, Alison; Kemp, Stephan; Theodoulou, Frederica L.
2011-01-01
ABC (ATP-binding cassette) subfamily D transporters are found in all eukaryotic kingdoms and are known to play essential roles in mammals and plants; however, their number, organization and physiological contexts differ. Via cross-kingdom expression experiments, we have explored the conservation of
75 FR 11991 - ABC & D Recycling, Inc.-Lease and Operation Exemption-a Line of Railroad in Ware, MA
2010-03-12
... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [STB Finance Docket No. 35356] ABC & D Recycling, Inc.--Lease and Operation Exemption--a Line of Railroad in Ware, MA ABC & D Recycling, Inc. (ABC & D), a noncarrier, has filed a verified notice of exemption under 49 CFR 1150.31 to lease from O...
Evolutionary relationships of ATP-Binding Cassette (ABC) uptake porters.
Zheng, Wei Hao; Västermark, Åke; Shlykov, Maksim A; Reddy, Vamsee; Sun, Eric I; Saier, Milton H
2013-05-06
The ATP-Binding Cassette (ABC) functional superfamily includes integral transmembrane exporters that have evolved three times independently, forming three families termed ABC1, ABC2 and ABC3, upon which monophyletic ATPases have been superimposed for energy-coupling purposes [e.g., J Membr Biol 231(1):1-10, 2009]. The goal of the work reported in this communication was to understand how the integral membrane constituents of ABC uptake transporters with different numbers of predicted or established transmembrane segments (TMSs) evolved. In a few cases, high resolution 3-dimensional structures were available, and in these cases, their structures plus primary sequence analyses allowed us to predict evolutionary pathways of origin. All of the 35 currently recognized families of ABC uptake proteins except for one (family 21) were shown to be homologous using quantitative statistical methods. These methods involved using established programs that compare native protein sequences with each other, after having compared each sequence with thousands of its own shuffled sequences, to gain evidence for homology. Topological analyses suggested that these porters contain numbers of TMSs ranging from four or five to twenty. Intragenic duplication events occurred multiple times during the evolution of these porters. They originated from a simple primordial protein containing 3 TMSs which duplicated to 6 TMSs, and then produced porters of the various topologies via insertions, deletions and further duplications. Except for family 21 which proved to be related to ABC1 exporters, they are all related to members of the previously identified ABC2 exporter family. Duplications that occurred in addition to the primordial 3 → 6 duplication included 5 → 10, 6 → 12 and 10 → 20 TMSs. In one case, protein topologies were uncertain as different programs gave discrepant predictions. It could not be concluded with certainty whether a 4 TMS ancestral protein or a 5 TMS ancestral protein
Meeds, E.; Leenders, R.; Welling, M.; Meila, M.; Heskes, T.
2015-01-01
Approximate Bayesian computation (ABC) is a powerful and elegant framework for performing inference in simulation-based models. However, due to the difficulty in scaling likelihood estimates, ABC remains useful for relatively lowdimensional problems. We introduce Hamiltonian ABC (HABC), a set of
Shah, Abdul Haseeb; Banerjee, Atanu; Rawal, Manpreet Kaur; Saxena, Ajay Kumar; Mondal, Alok Kumar; Prasad, Rajendra
2015-08-01
The ABC transporter Cdr1 protein of Candida albicans, which plays a major role in antifungal resistance, has two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs). The 12 transmembrane helices of TMDs that are interconnected by extracellular and intracellular loops (ICLs) mainly harbor substrate recognition sites where drugs bind while cytoplasmic NBDs hydrolyze ATP which powers drug efflux. The coupling of ATP hydrolysis to drug transport requires proper communication between NBDs and TMDs typically accomplished by ICLs. This study examines the role of cytoplasmic ICLs of Cdr1p by rationally predicting the critical residues on the basis of their interatomic distances. Among nine pairs that fall within a proximity of trafficking. These results point to a new role for ICL/NBD interacting residues in PDR ABC transporters in protein folding and trafficking. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Vibrationally coupled electron transport through single-molecule junctions
Energy Technology Data Exchange (ETDEWEB)
Haertle, Rainer
2012-04-26
Single-molecule junctions are among the smallest electric circuits. They consist of a molecule that is bound to a left and a right electrode. With such a molecular nanocontact, the flow of electrical currents through a single molecule can be studied and controlled. Experiments on single-molecule junctions show that a single molecule carries electrical currents that can even be in the microampere regime. Thereby, a number of transport phenomena have been observed, such as, for example, diode- or transistor-like behavior, negative differential resistance and conductance switching. An objective of this field, which is commonly referred to as molecular electronics, is to relate these transport phenomena to the properties of the molecule in the contact. To this end, theoretical model calculations are employed, which facilitate an understanding of the underlying transport processes and mechanisms. Thereby, one has to take into account that molecules are flexible structures, which respond to a change of their charge state by a profound reorganization of their geometrical structure or may even dissociate. It is thus important to understand the interrelation between the vibrational degrees of freedom of a singlemolecule junction and the electrical current flowing through the contact. In this thesis, we investigate vibrational effects in electron transport through singlemolecule junctions. For these studies, we calculate and analyze transport characteristics of both generic and first-principles based model systems of a molecular contact. To this end, we employ a master equation and a nonequilibrium Green's function approach. Both methods are suitable to describe this nonequilibrium transport problem and treat the interactions of the tunneling electrons on the molecular bridge non-perturbatively. This is particularly important with respect to the vibrational degrees of freedom, which may strongly interact with the tunneling electrons. We show in detail that the resulting
Reilman, E.; Mars, R. A. T.; van Dijl, J. M.; Denham, Emma
2014-01-01
Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology,...
Setia, Namrata; Abbas, Ossama; Sousa, Yessica; Garb, Jane L; Mahalingam, Meera
2012-08-01
Distinct ABCB5 forms and ABCF2, members of the ATP-binding cassette (ABC) superfamily of transporters, are normally expressed in various tissues and cells, and enhanced expression of both has been demonstrated in select cancers. In melanoma cell lines, gene expression profiling of ABC transporters has revealed enhanced expression of melanocyte-specific ABCB5 and ABCF2 proteins. Given this, our primary aim was to ascertain immunohistochemical expression of the ABC transporters ABCB5 and ABCF2 and, the stem cell marker, nestin in a spectrum of benign and malignant nevomelanocytic proliferations, including nevi (n=30), in situ (n=31) and invasive (n=24) primary cutaneous melanomas to assess their role in the stepwise development of malignancy. In addition, their expression was compared with established melanoma prognosticators to ascertain their utility as independent prognosticators. A semiquantitative scoring system was utilized by deriving a cumulative score (based on percentage positivity cells and intensity of expression) and statistical analyses was carried out using analysis of variance with linear contrasts. Mean cumulative score in nevi, in situ and invasive melanoma were as follows: 3.8, 4.4 and 5.3 for ABCB5, respectively (P1, after controlling for the presence of ulceration and mitotic activity, the expression of both proteins did not significantly correlate with known melanoma prognosticators. The gradual increase in the expression of ABCB5 from benign nevus to in situ to invasive melanoma suggests that it plays a role in melanomagenesis. On the basis of our findings, a prospective study with follow-up data is required to ascertain the utility of ABCB5 as a therapeutic target.
Serum albumin promotes ATP-binding cassette transporter-dependent sterol uptake in yeast
DEFF Research Database (Denmark)
Marek, Magdalena; Silvestro, Daniele; Fredslund, Maria D.
2014-01-01
Sterol uptake in fungi is a multistep process that involves interaction between external sterols and the cell wall, incorporation of sterol molecules into the plasma membrane, and subsequent integration into intracellular membranes for turnover. ATP-binding cassette (ABC) transporters have been...
Improved alternating gradient transport and focusing of neutral molecules
International Nuclear Information System (INIS)
Kalnins, Juris; Lambertson, Glen; Gould, Harvey
2001-01-01
Polar molecules, in strong-field seeking states, can be transported and focused by an alternating sequence of electric field gradients that focus in one transverse direction while defocusing in the other. We show by calculation and numerical simulation, how one may greatly improve the alternating gradient transport and focusing of molecules. We use a new optimized multipole lens design, a FODO lattice beam transport line, and lenses to match the beam transport line to the beam source and the final focus. We derive analytic expressions for the potentials, fields, and gradients that may be used to design these lenses. We describe a simple lens optimization procedure and derive the equations of motion for tracking molecules through a beam transport line. As an example, we model a straight beamline that transports a 560 m/s jet-source beam of methyl fluoride molecules 15 m from its source and focuses it to 2 mm diameter. We calculate the beam transport line acceptance and transmission, for a beam with velocity spread, and estimate the transmitted intensity for specified source conditions. Possible applications are discussed
Energy Technology Data Exchange (ETDEWEB)
Sarkan, M; Mikusova, K; Kordulakova, J [Univerzita Komenskeho v Bratislave, Prirodovedecka fakulta, Katedra biochemie, 84215 Bratislava (Slovakia)
2012-04-25
The bacterium Mycobacterium tuberculosis - the originator of tuberculosis in humans - is characterized by a complex cell wall, which is responsible for a high bacteria resistant to adverse external environmental conditions, as well as to the common antibiotics. The structure of the cell wall components and enzymes involved into its biosynthesis are relatively well described, but there is no information on the transfer of intermediate products of its biosynthetic across the plasmatic membrane. Orthologues of genes rv1459c-rv1458c-rv1457c-rv1456c of M. tuberculosis are in the same configuration in genomes of all previously sequenced mycobacterial strains. Rv1459c gene encodes a probable glycosyltransferases and genes rv1458c, rv1457c rv1456c code nucleotide binding and transmembrane subunits of expected ABC transporter. In our work we focused on the study of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c, through analysis of phenotypes of strains M. Smegmatis. They have orthologues of genes encoding the transmembrane subunits of this transporter suspended by fragment encoding resistance to kanamycin. (authors)
Yang, Xiaoyu; Wang, Fengqiang; Zhang, Ying; Wang, Larry; Antonenko, Svetlana; Zhang, Shuli; Zhang, Yi Wei; Tabrizifard, Mohammad; Ermakov, Grigori; Wiswell, Derek; Beaumont, Maribel; Liu, Liming; Richardson, Daisy; Shameem, Mohammed; Ambrogelly, Alexandre
2015-12-01
IgG4 antibodies are evolving as an important class of cancer immunotherapies. However, human IgG4 can undergo Fab arm (half molecule) exchange with other IgG4 molecules in vivo. The hinge modification by a point mutation (S228P) prevents half molecule exchange of IgG4. However, the experimental confirmation is still expected by regulatory agencies. Here, we report for the first time the extensive analysis of half molecule exchange for a hinge-modified therapeutic IgG4 molecule, pembrolizumab (Keytruda) targeting programmed death 1 (PD1) receptor that was approved for advanced melanoma. Studies were performed in buffer or human serum using multiple exchange partners including natalizumab (Tysabri) and human IgG4 pool. Formation of bispecific antibodies was monitored by fluorescence resonance energy transfer, exchange with Fc fragments, mixed mode chromatography, immunoassays, and liquid chromatography-mass spectrometry. The half molecule exchange was also examined in vivo in SCID (severe combined immunodeficiency) mice. Both in vitro and in vivo results indicate that the hinge modification in pembrolizumab prevented half molecule exchange, whereas the unmodified counterpart anti-PD1 wt showed active exchange activity with other IgG4 antibodies or self-exchange activity with its own molecules. Our work, as an example expected for meeting regulatory requirements, contributes to establish without ambiguity that hinge-modified IgG4 antibodies are suitable for biotherapeutic applications. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.
Zaidi, Arsalan Haseeb; Bakkes, Patrick J.; Lubelski, Jacek; Agustiandari, Herfita; Kuipers, Oscar P.; Driessen, Arnold J. M.
2008-01-01
Upon prolonged exposure to cholate and other toxic compounds, Lactococcus lactis develops a multidrug resistance phenotype that has been attributed to an elevated expression of the heterodimeric ABC-type multidrug transporter LmrCD. To investigate the molecular basis of bile acid resistance in L.
International Nuclear Information System (INIS)
Xi, L.; Du, J.H.; Ma, J.H.; Wang, Z.; Zuo, Y.L.; Xue, D.S.
2013-01-01
Highlights: ► Spin-dependent transport property of LSMO/oleic acid nanoparticles is investigated. ► Transport properties and MR measured by Cu/nanoparticle assembly/elargol device. ► Non-linear I–V curve indicates a tunneling type transport properties. ► Tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting I–V curves. ► LFMR of LSMO/oleic acid molecules value reaches −18% with current of 0.1 μA at 10 K. - Abstract: Spin-dependent transport property through molecules is investigated using a monolayer of oleic acid molecule self-assembled half metallic La 0.7 Sr 0.3 MnO 3 (LSMO) nanoparticles, which was synthesized using a coprecipitation method. Fourier transform infrared spectroscopy was used to confirm that one-monolayer oleic acid molecules chemically bond to the LSMO nanoparticles. The transport properties and magnetoresistance (MR) effect of the oleic acid molecule coated LSMO nanoparticles were measured by a direct current four probes method using a Cu/nanoparticle assembly/elargol electrode sandwich device with various temperatures and bias voltages. The non-linear I–V curve indicates a tunneling type transport properties. The tunnel barrier height around 1.3 ± 0.15 eV was obtained by fitting the I–V curve according to the Simmons equation. The magnetoresistance curves can be divided to high-field MR and low-field MR (LFMR) parts. The former is ascribed to the influence of spin disorder or canting within the LSMO nanoparticle surface and the latter one with strong bias dependence is attributed to the spin-dependent tunneling effect through the insulating surface layer of LSMO and oleic acid molecules. The enhanced LFMR effect for oleic acid coated LSMO with respect to the bare LSMO was attributed to the enhanced tunneling transport and weak spin scattering in oleic acid molecule barrier.
Molecular electronics--resonant transport through single molecules.
Lörtscher, Emanuel; Riel, Heike
2010-01-01
The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.
Implementation of the ABC Model in a Company Dealing with Extraction of Raw Materials
Directory of Open Access Journals (Sweden)
Radoslav Bajus
2014-06-01
Full Text Available ABC method is a new system for accurate product pricing, cost analysis of the causes of individual products and their optimization. The prices of products are accurately taken into account according to all relevant overhead costs in their actual context and relationships. Except of product costs, ABC method follows costs regarding customers, suppliers, distribution, transport, manufacturing, operational and security processes, management processes and other business activities. ABC method sees the company as a complex of interrelated activities and processes. ABC method represents more precise cost calculation for the product. The aim of the present article is to highlight the introduction of the ABC method to the enterprise and compare it with the traditional method. The result is to reduce costs by introducing ABC method to the enterprise.
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
Half-metallicity in 2D organometallic honeycomb frameworks
Sun, Hao; Li, Bin; Zhao, Jin
2016-10-01
Half-metallic materials with a high Curie temperature (T C) have many potential applications in spintronics. Magnetic metal free two-dimensional (2D) half-metallic materials with a honeycomb structure contain graphene-like Dirac bands with π orbitals and show excellent aspects in transport properties. In this article, by investigating a series of 2D organometallic frameworks with a honeycomb structure using first principles calculations, we study the origin of forming half-metallicity in this kind of 2D organometallic framework. Our analysis shows that charge transfer and covalent bonding are two crucial factors in the formation of half-metallicity in organometallic frameworks. (i) Sufficient charge transfer from metal atoms to the molecules is essential to form the magnetic centers. (ii) These magnetic centers need to be connected through covalent bonding, which guarantee the strong ferromagnetic (FM) coupling. As examples, the organometallic frameworks composed by (1,3,5)-benzenetricarbonitrile (TCB) molecules with noble metals (Au, Ag, Cu) show half-metallic properties with T C as high as 325 K. In these organometallic frameworks, the strong electronegative cyano-groups (CN groups) drive the charge transfer from metal atoms to the TCB molecules, forming the local magnetic centers. These magnetic centers experience strong FM coupling through the d-p covalent bonding. We propose that most of the 2D organometallic frameworks composed by molecule—CN—noble metal honeycomb structures contain similar half metallicity. This is verified by replacing TCB molecules with other organic molecules. Although the TCB-noble metal organometallic framework has not yet been synthesized, we believe the development of synthesizing techniques and facility will enable the realization of them. Our study provides new insight into the 2D half-metallic material design for the potential applications in nanotechnology.
Half-metallicity in 2D organometallic honeycomb frameworks
International Nuclear Information System (INIS)
Sun, Hao; Li, Bin; Zhao, Jin
2016-01-01
Half-metallic materials with a high Curie temperature (T C ) have many potential applications in spintronics. Magnetic metal free two-dimensional (2D) half-metallic materials with a honeycomb structure contain graphene-like Dirac bands with π orbitals and show excellent aspects in transport properties. In this article, by investigating a series of 2D organometallic frameworks with a honeycomb structure using first principles calculations, we study the origin of forming half-metallicity in this kind of 2D organometallic framework. Our analysis shows that charge transfer and covalent bonding are two crucial factors in the formation of half-metallicity in organometallic frameworks. (i) Sufficient charge transfer from metal atoms to the molecules is essential to form the magnetic centers. (ii) These magnetic centers need to be connected through covalent bonding, which guarantee the strong ferromagnetic (FM) coupling. As examples, the organometallic frameworks composed by (1,3,5)-benzenetricarbonitrile (TCB) molecules with noble metals (Au, Ag, Cu) show half-metallic properties with T C as high as 325 K. In these organometallic frameworks, the strong electronegative cyano-groups (CN groups) drive the charge transfer from metal atoms to the TCB molecules, forming the local magnetic centers. These magnetic centers experience strong FM coupling through the d – p covalent bonding. We propose that most of the 2D organometallic frameworks composed by molecule—CN—noble metal honeycomb structures contain similar half metallicity. This is verified by replacing TCB molecules with other organic molecules. Although the TCB-noble metal organometallic framework has not yet been synthesized, we believe the development of synthesizing techniques and facility will enable the realization of them. Our study provides new insight into the 2D half-metallic material design for the potential applications in nanotechnology. (paper)
ASPECTS OF OBSTACLES FOR APPLYING ACTIVITY BASED COSTING (ABC SYSTEM IN EGYPTIAN FIRMS
Directory of Open Access Journals (Sweden)
Petru STEFEA
2013-10-01
Full Text Available The following investigation aims to determine the aspects of obstacles for applying Activity Based Costing (ABC system in the Egyptian case and the significant differences among the effects of such obstacles . The Study used the survey method to describe and analyze the obstacles in some Egyptian firms. The population of the study is Egyptian manufacturing firms. This survey used the number of 392 questionnaires that were used throughout the total of 23 Egyptian manufacturing firms, during the first half of 2013. Finally, the study found some influencing obstacles for applying this system (ABC and there were significant differences among the aspects of obstacles for applying ABC system in the Egyptian manufacturing firms.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Pan, Xia; Yang, Xiaoyan; Zang, Jinglei; Zhang, Si; Huang, Nan; Guan, Xinxin; Zhang, Jianhua; Wang, Zhihui; Li, Xi; Lei, Xiaoyong
2017-06-01
Overexpression of adenosine triphosphate-binding cassette (ABC) transport protein is emerging as a critical contributor to anticancer drug resistance. The eukaryotic translation initiation factor (eIF) 4F complex, the key modulator of mRNA translation, is regulated by the phosphoinositide 3-kinase-AKT-mammalian target of rapamycin pathway in anticancer drug-resistant tumors. The present study demonstrated the roles of ABC translation protein alterations in the acquisition of the Adriamycin (ADM)-resistant phenotype of MCF-7 human breast cells. Quantitative polymerase chain reaction and western blot analysis were applied to examine the differences in mRNA and protein levels, respectively. It was found that the expression of the ABC sub-family B member 1, ABC sub-family C member 1 and ABC sub-family G member 2 transport proteins were upregulated in MCF-7/ADR cells. An MTT assay was used to detect the cell viability, from the results MCF-7/ADR cells were less sensitive to ADM, tamoxifen (TAM) and taxol (TAX) treatment compared with MCF-7 cells. We predicted that the 3'-untranslated region of eukaryotic translation initiation factor 4-γ 1 (eIF4G) contains a potential miRNA binding site for microRNA (miR)-503 through using computational programs. These binding sites were confirmed by luciferase reporter assays. eIF4G mRNA degradation was accelerated in cells transfected with miR-503 mimics. Furthermore, it was demonstrated that eIF4G and ABC translation proteins were significantly downregulated in MCF-7/ADR cells after transfection with miR-503. It was found that miR-503 mimics could sensitize the cells to treatment with ADM, TAM and TAX. These findings demonstrated for the first time that eIF4G acted as a key factor in MCF-7/ADR cells, and may be an efficient agent for preventing and reversing multi-drug resistance in breast cancer.
Functional characterization of the human multidrug transporter, ABCG2, expressed in insect cells
DEFF Research Database (Denmark)
Ozvegy, C.; Litman, Thomas; Szakacs, G.
2001-01-01
ABCG2 (also called MXR (3), BCRP (4), or ABCP (5) is a recently-identified ABC half-transporter, which causes multidrug resistance in cancer. Here we report that the expression of the ABCG2 protein in Sf9 insect cells resulted in a high-capacity, vanadate-sensitive ATPase activity in isolated...
International Nuclear Information System (INIS)
Němcová-Fürstová, Vlasta; Kopperová, Dana; Balušíková, Kamila; Ehrlichová, Marie; Brynychová, Veronika; Václavíková, Radka; Daniel, Petr; Souček, Pavel; Kovář, Jan
2016-01-01
Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of long-term proliferation in 100 nM and 300 nM paclitaxel, respectively. Application of these concentrations leads to cell death in the original counterpart cells. Both sublines are cross-resistant to doxorubicin, indicating the presence of the MDR phenotype. Interestingly, resistance in both paclitaxel-resistant sublines is circumvented by the second-generation taxane SB-T-1216. Moreover, we demonstrated that it was not possible to establish sublines of SK-BR-3 and MCF-7 cells resistant to this taxane. It means that at least the tested breast cancer cells are unable to develop resistance to some taxanes. Employing mRNA expression profiling of all known human ABC transporters and subsequent Western blot analysis of the expression of selected transporters, we demonstrated that only the ABCB1/PgP and ABCC3/MRP3 proteins were up-regulated in both paclitaxel-resistant sublines. We found up-regulation of ABCG2/BCRP and ABCC4 proteins only in paclitaxel-resistant SK-BR-3 cells. In paclitaxel-resistant MCF-7 cells, ABCB4/MDR3 and ABCC2/MRP2 proteins were up-regulated. Silencing of ABCB1 expression using specific siRNA increased significantly, but did not completely restore full sensitivity to both paclitaxel and doxorubicin. Thus we showed a key, but not exclusive, role for ABCB1 in mechanisms of paclitaxel resistance. It suggests the involvement of multiple mechanisms in paclitaxel resistance in tested breast cancer cells. - Highlights: • Expression of all ABC transporters in paclitaxel-resistant sublines of SK-BR-3 and MCF-7 cells was analyzed. • SK-BR-3 and MCF-7 cells are unable to develop resistance to some taxanes. • Some taxanes are able to overcome developed resistance to
Energy Technology Data Exchange (ETDEWEB)
Němcová-Fürstová, Vlasta, E-mail: vlasta.furstova@lf3.cuni.cz [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Kopperová, Dana; Balušíková, Kamila [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Ehrlichová, Marie; Brynychová, Veronika; Václavíková, Radka [Toxicogenomics Unit, National Institute of Public Health, Prague (Czech Republic); Daniel, Petr [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic); Souček, Pavel [Toxicogenomics Unit, National Institute of Public Health, Prague (Czech Republic); Kovář, Jan [Division of Cell and Molecular Biology, Third Faculty of Medicine, Charles University, Prague (Czech Republic)
2016-11-01
Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of long-term proliferation in 100 nM and 300 nM paclitaxel, respectively. Application of these concentrations leads to cell death in the original counterpart cells. Both sublines are cross-resistant to doxorubicin, indicating the presence of the MDR phenotype. Interestingly, resistance in both paclitaxel-resistant sublines is circumvented by the second-generation taxane SB-T-1216. Moreover, we demonstrated that it was not possible to establish sublines of SK-BR-3 and MCF-7 cells resistant to this taxane. It means that at least the tested breast cancer cells are unable to develop resistance to some taxanes. Employing mRNA expression profiling of all known human ABC transporters and subsequent Western blot analysis of the expression of selected transporters, we demonstrated that only the ABCB1/PgP and ABCC3/MRP3 proteins were up-regulated in both paclitaxel-resistant sublines. We found up-regulation of ABCG2/BCRP and ABCC4 proteins only in paclitaxel-resistant SK-BR-3 cells. In paclitaxel-resistant MCF-7 cells, ABCB4/MDR3 and ABCC2/MRP2 proteins were up-regulated. Silencing of ABCB1 expression using specific siRNA increased significantly, but did not completely restore full sensitivity to both paclitaxel and doxorubicin. Thus we showed a key, but not exclusive, role for ABCB1 in mechanisms of paclitaxel resistance. It suggests the involvement of multiple mechanisms in paclitaxel resistance in tested breast cancer cells. - Highlights: • Expression of all ABC transporters in paclitaxel-resistant sublines of SK-BR-3 and MCF-7 cells was analyzed. • SK-BR-3 and MCF-7 cells are unable to develop resistance to some taxanes. • Some taxanes are able to overcome developed resistance to
Hadjithomas, Michalis; Chen, I-Min Amy; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Szeto, Ernest; Huang, Jinghua; Reddy, T B K; Cimermančič, Peter; Fischbach, Michael A; Ivanova, Natalia N; Markowitz, Victor M; Kyrpides, Nikos C; Pati, Amrita
2015-07-14
In the discovery of secondary metabolites, analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of computational platforms that enable such a systematic approach on a large scale. In this work, we present IMG-ABC (https://img.jgi.doe.gov/abc), an atlas of biosynthetic gene clusters within the Integrated Microbial Genomes (IMG) system, which is aimed at harnessing the power of "big" genomic data for discovering small molecules. IMG-ABC relies on IMG's comprehensive integrated structural and functional genomic data for the analysis of biosynthetic gene clusters (BCs) and associated secondary metabolites (SMs). SMs and BCs serve as the two main classes of objects in IMG-ABC, each with a rich collection of attributes. A unique feature of IMG-ABC is the incorporation of both experimentally validated and computationally predicted BCs in genomes as well as metagenomes, thus identifying BCs in uncultured populations and rare taxa. We demonstrate the strength of IMG-ABC's focused integrated analysis tools in enabling the exploration of microbial secondary metabolism on a global scale, through the discovery of phenazine-producing clusters for the first time in Alphaproteobacteria. IMG-ABC strives to fill the long-existent void of resources for computational exploration of the secondary metabolism universe; its underlying scalable framework enables traversal of uncovered phylogenetic and chemical structure space, serving as a doorway to a new era in the discovery of novel molecules. IMG-ABC is the largest publicly available database of predicted and experimental biosynthetic gene clusters and the secondary metabolites they produce. The system also includes powerful search and analysis tools that are integrated with IMG's extensive genomic/metagenomic data and analysis tool kits. As new research on biosynthetic gene clusters and secondary metabolites is published and more genomes are sequenced, IMG-ABC will continue to
Genome-wide comparative analysis of ABC systems in the Bdellovibrio-and-like organisms.
Li, Nan; Chen, Huan; Williams, Henry N
2015-05-10
Bdellovibrio-and-like organisms (BALOs) are gram-negative, predatory bacteria with wide variations in genome sizes and GC content and ecological habitats. The ATP-binding cassette (ABC) systems have been identified in several prokaryotes, fungi and plants and have a role in transport of materials in and out of cells and in cellular processes. However, knowledge of the ABC systems of BALOs remains obscure. A total of 269 putative ABC proteins were identified in BALOs. The genes encoding these ABC systems occupy nearly 1.3% of the gene content in freshwater Bdellovibrio strains and about 0.7% in their saltwater counterparts. The proteins found belong to 25 ABC system families based on their structural characteristics and functions. Among these, 16 families function as importers, 6 as exporters and 3 are involved in various cellular processes. Eight of these 25 ABC system families were deduced to be the core set of ABC systems conserved in all BALOs. All Bacteriovorax strains have 28 or less ABC systems. On the contrary, the freshwater Bdellovibrio strains have more ABC systems, typically around 51. In the genome of Bdellovibrio exovorus JSS (CP003537.1), 53 putative ABC systems were detected, representing the highest number among all the BALO genomes examined in this study. Unexpected high numbers of ABC systems involved in cellular processes were found in all BALOs. Phylogenetic analysis suggests that the majority of ABC proteins can be assigned into many separate families with high bootstrap supports (>50%). In this study, a general framework of sequence-structure-function connections for the ABC systems in BALOs was revealed providing novel insights for future investigations. Copyright © 2015 Elsevier B.V. All rights reserved.
Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L
2014-10-01
Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Lifescience Database Archive (English)
Full Text Available 15241548 Lipopolysaccharide-binding molecules: transporters, blockers and sensors. ...binding molecules: transporters, blockers and sensors. PubmedID 15241548 Title Lipopolysaccharide-binding molecules: transport...Chaby R. Cell Mol Life Sci. 2004 Jul;61(14):1697-713. (.png) (.svg) (.html) (.csml) Show Lipopolysaccharide-
Karim MAMDOUH ABBAS
2014-01-01
The present investigation aims to determine the factors affecting evolution of Activity Based Costing (ABC) system in Egyptian case. The study used the survey method to describe and analyze these factors in some Egyptian firms. The population of the study is Egyptian manufacturing firms. Accordingly, the number of received questionnaires was 392 (23 Egyptian manufacturing firms) in the first half of 2013. Finally, the study stated some influencing factors for evolution this system (ABC) in Eg...
Reversal of resistance by GF120918 in cell lines expressing the ABC half-transporter, MXR
DEFF Research Database (Denmark)
de Bruin, M; Miyake, K; Litman, Thomas
1999-01-01
-80, a subline expressing a newly identified mitoxantrone transporter, MXR. GF120918 was ineffective in sensitizing MRP-overexpressing MCF-7 VP-16 cells to etoposide as determined by cytotoxicity studies. In flow cytometry experiments, rhodamine 123 efflux in S1-B1-20 cells was decreased at GF120918...
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind
2015-01-01
transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...
Directory of Open Access Journals (Sweden)
Karim MAMDOUH ABBAS
2014-04-01
Full Text Available The present investigation aims to determine the factors affecting evolution of Activity Based Costing (ABC system in Egyptian case. The study used the survey method to describe and analyze these factors in some Egyptian firms. The population of the study is Egyptian manufacturing firms. Accordingly, the number of received questionnaires was 392 (23 Egyptian manufacturing firms in the first half of 2013. Finally, the study stated some influencing factors for evolution this system (ABC in Egyptian manufacturing firms.
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Gether, Ulrik; Litman, Thomas
2005-01-01
The ATP binding cassette (ABC) half-transporter ABCG2 (MXR/BCRP/ABCP) is associated with mitoxantrone resistance accompanied by cross-resistance to a broad spectrum of cytotoxic drugs. Here we investigate the functional consequences of mutating a highly conserved lysine in the Walker A motif...
Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.
2015-01-01
In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new
Directory of Open Access Journals (Sweden)
Flavio Alves Lara
Full Text Available In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA, a well-known inhibitor of ATP binding cassette (ABC transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may
Sheehan, Lauren M; Caswell, Clayton C
2017-06-06
In Brucella abortus , two small RNAs (sRNAs), AbcR1 and AbcR2, are responsible for regulating transcripts encoding ABC-type transport systems. AbcR1 and AbcR2 are required for Brucella virulence, as a double chromosomal deletion of both sRNAs results in attenuation in mice. Although these sRNAs are responsible for targeting transcripts for degradation, the mechanism utilized by the AbcR sRNAs to regulate mRNA in Brucella has not been described. Here, two motifs (M1 and M2) were identified in AbcR1 and AbcR2, and complementary motif sequences were defined in AbcR-regulated transcripts. Site-directed mutagenesis of M1 or M2 or of both M1 and M2 in the sRNAs revealed transcripts to be targeted by one or both motifs. Electrophoretic mobility shift assays revealed direct, concentration-dependent binding of both AbcR sRNAs to a target mRNA sequence. These experiments genetically and biochemically characterized two indispensable motifs within the AbcR sRNAs that bind to and regulate transcripts. Additionally, cellular and animal models of infection demonstrated that only M2 in the AbcR sRNAs is required for Brucella virulence. Furthermore, one of the M2-regulated targets, BAB2_0612, was found to be critical for the virulence of B. abortus in a mouse model of infection. Although these sRNAs are highly conserved among Alphaproteobacteria , the present report displays how gene regulation mediated by the AbcR sRNAs has diverged to meet the intricate regulatory requirements of each particular organism and its unique biological niche. IMPORTANCE Small RNAs (sRNAs) are important components of bacterial regulation, allowing organisms to quickly adapt to changes in their environments. The AbcR sRNAs are highly conserved throughout the Alphaproteobacteria and negatively regulate myriad transcripts, many encoding ABC-type transport systems. In Brucella abortus , AbcR1 and AbcR2 are functionally redundant, as only a double abcR1 abcR2 ( abcR1 / 2 ) deletion results in attenuation in
Accelerated bridge construction (ABC) decision making and economic modeling tool.
2011-12-01
In this FHWA-sponsored pool funded study, a set of decision making tools, based on the Analytic Hierarchy Process (AHP) was developed. This tool set is prepared for transportation specialists and decision-makers to determine if ABC is more effective ...
Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli
2013-09-10
The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions. Copyright © 2013 Elsevier B.V. All rights reserved.
Euske, K.J.; Vercio, Alan
2007-01-01
The purpose of the ABC Cross was to portray both a cost and process view of an organization as simply as possible. Unfortunately, the model’s simplified form does not capture the real value of activity-based costing (ABC) for cost accounting that emerged in the mid-1980s. Here we present several ABC models that can help functional and process managers make better decisions.
ATP-binding cassette transporters in reproduction: a new frontier
Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.
2016-01-01
BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and
IMG-ABC: An Atlas of Biosynthetic Gene Clusters to Fuel the Discovery of Novel Secondary Metabolites
Energy Technology Data Exchange (ETDEWEB)
Chen, I-Min; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Huang, Jinghua; Reddy, T. B.K.; Cimermancic, Peter; Fischbach, Michael; Ivanova, Natalia; Markowitz, Victor; Kyrpides, Nikos; Pati, Amrita
2014-10-28
In the discovery of secondary metabolites (SMs), large-scale analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of relevant computational resources. We present IMG-ABC (https://img.jgi.doe.gov/abc/) -- An Atlas of Biosynthetic gene Clusters within the Integrated Microbial Genomes (IMG) system1. IMG-ABC is a rich repository of both validated and predicted biosynthetic clusters (BCs) in cultured isolates, single-cells and metagenomes linked with the SM chemicals they produce and enhanced with focused analysis tools within IMG. The underlying scalable framework enables traversal of phylogenetic dark matter and chemical structure space -- serving as a doorway to a new era in the discovery of novel molecules.
Fischer, Stephan; Loncar, Jovica; Zaja, Roko; Schnell, Sabine; Schirmer, Kristin; Smital, Tvrtko; Luckenbach, Till
2011-01-25
Permanent fish cell lines have become common model systems for determining ecotoxicological effects of pollutants. For these cell lines little is known on the cellular active transport mechanisms that control the amount of a compound entering the cell, such as the MXR (multixenobiotic resistance) system mediated by ATP binding cassette (ABC) transport proteins. Therefore, for toxic evaluation of chemicals with those cells information on MXR is important. We here present data on constitutive mRNA expression and protein activity levels of a series of ABC efflux transporters in seven permanent cell lines derived from liver (RTL-W1; R1) and liver hepatoma (RTH-149), gill (RTgill-W1), gonad (RTG-2), gut (RTgutGC) and brain (RTbrain) of rainbow trout (Oncorhynchus mykiss). In addition to known transporters abcb1 (designated here abcb1a), abcb11, abcc1-3, abcc5 and abcg2, we quantified expression levels of a newly identified abcb1 isoform (abcb1b) and abcc4, previously unknown in trout. Quantitative real time PCR (qPCR) indicated that mRNA of the examined ABC transporters was constitutively expressed in all cell lines. Transporter mRNA expression patterns were similar in all cell lines, with expression levels of abcc transporters being 80 to over 1000 fold higher than for abcg2, abcb1a/b and abcb11 (abcc1-5>abcg2>abcb1a/b, 11). Transporter activity in the cell lines was determined by measuring uptake of transporter type specific fluorescent substrates in the presence of activity inhibitors. The combination of the ABCB1 and ABCC transporter substrate calcein-AM with inhibitors cyclosporine A, PSC833 and MK571 resulted in a concentration-dependent fluorescence increase of up to 3-fold, whereas reversin 205 caused a slight, but not concentration-dependent fluorescence increase. Accumulation of the dyes Hoechst 33342 and 2',7'-dichlorodihydrofluorescein diacetate was basically unchanged in the presence of Ko134 and taurocholate, respectively, indicating low Abcg2 and Abcb11
Monoenergetic neutral particle transport in an anisotropically scattering half-space
International Nuclear Information System (INIS)
Ganapol, B.D.; Garth, J.C.; Woolf, S.
1995-01-01
During the past several years, a considerable effort has been underway to develop reliable analytical benchmark solutions to the one-speed transport equation in various geometries. The reader may well ask open-quotes whyclose quotes such a task has been undertaken, given the recent rapid advances in numerical transport theory. The simple answer is that reliable numerical solutions do not yet exist, and their development still represents a mathematical challenge. However, regardless of how mathematically challenging the development is, there are more compelling reasons for this effort which are rooted in the very fundamentals of science and technology. In particular, these solutions, which are highly accurate numerical evaluations of analytical solution representations, serve as open-quotes industry standardsclose quotes to which other more approximate methods or approximations can be compared. Thus analytical benchmarks are part of the process control and continuous improvement of numerical transport methods and are therefore integral components in TQM (Total Quality Management) as applied to transport methods development. With the above reasoning in mind, the authors begin the development and application of a new analytical solution and evaluation for a half-space featuring anisotropic scattering. This work is an extension of previous efforts in which isotropically scattering half-spaces were treated. The previous benchmarks were obtained most conveniently via a numerical Laplace transform inversion which could be applied in a straightforward manner to the case of isotropic scattering. The application of the Laplace transform method is problematical for anisotropic scattering and does not admit to the direct identification of the scalar flux from integral transport theory
Sustaining an Effective ABC-ABM System
Directory of Open Access Journals (Sweden)
Gary COKINS
2011-02-01
Full Text Available The purpose of this paper is to describe the Activity- Based Costing (ABC and Activity-Based Management (ABM system and techniques to sustain them as a permanent and repeatable production reporting system, not just for one-off analysis. A comparison is made between ABC/ABM modeling software that extracts source data and business systems that include ABC/ABM modeling features. There are presented the stages of updating, running and rerunning the ABC/ABM system. The resulting information calculated and provided by the ABC/ABM system are analyzed and interpreted in terms of a multidimensional data analysis. The article ends with the authors' conclusions about the benefits of continued operation of sustaining the ABC/ABM system.
V.G. Narayanan; Ratna G. Sarkar
1999-01-01
In this paper, we seek to provide empirical documentation of the effect of Activity-Based Costing (ABC) information on product and customer-related decisions made by managers in a company. Proponents of ABC argue that when an entity implements ABC, it reaps at least two important benefits: process improvements that promote more efficient use of resources and hence reduce costs, and a set of overhead cost numbers that, relative to traditional volume-based methods of costing, better represent t...
S. HOOZÉE; M. VANHOUCKE; W. BRUGGEMAN; -
2010-01-01
This paper compares the accuracy of traditional ABC and time-driven ABC in complex and dynamic environments through simulation analysis. First, when unit times in time-driven ABC are known or can be flawlessly estimated, time-driven ABC coincides with the benchmark system and in this case our results show that the overall accuracy of traditional ABC depends on (1) existing capacity utilization, (2) diversity in the actual mix of productive work, and (3) error in the estimated percentage mix. ...
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Tournier, Nicolas; Declèves, Xavier; Saubaméa, Bruno; Scherrmann, Jean-Michel; Cisternino, Salvatore
2011-01-01
Some of the ATP-binding cassette (ABC) transporters like P-glycoprotein (P-gp; ABCB1, MDR1), BCRP (ABCG2) and MRPs (ABCCs) that are present at the blood-brain barrier (BBB) influence the brain pharmacokinetics (PK) of their substrates by restricting their uptake or enhancing their clearance from the brain into the blood, which has consequences for their CNS pharmacodynamics (PD). Opioid drugs have been invaluable tools for understanding the PK-PD relationships of these ABC-transporters. The effects of morphine, methadone and loperamide on the CNS are modulated by P-gp. This review examines the ways in which other opioid drugs and some of their active metabolites interact with ABC transporters and suggests new mechanisms that may be involved in the variability of the response of the CNS to these drugs like carrier-mediated system belonging to the solute carrier (SLC) superfamily. Exposure to opioids may also alter the expression of ABC transporters. P-gp can be overproduced during morphine treatment, suggesting that the drug has a direct or, more likely, an indirect action. Variations in cerebral neurotransmitters during exposure to opioids and the release of cytokines during pain could be new endogenous stimuli affecting transporter synthesis. This review concludes with an analysis of the pharmacotherapeutic and clinical impacts of the interactions between ABC transporters and opioids.
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; Zant, Herre S. J. van der
2015-08-01
It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the molecule is reduced resulting into a ten-fold increase in the off-resonant differential conductance. Theoretical calculations link the change in differential conductance to a reduction-induced change in conjugation, thereby lifting destructive interference of transport pathways.
Directory of Open Access Journals (Sweden)
Ali Raza
2016-08-01
Full Text Available This study investigated the interaction of ATP binding cassette (ABC transport proteins with ivermectin (IVM and levamisole (LEV in larvae of susceptible and resistant isolates of Haemonchus contortus in vitro by measuring transcription patterns following exposure to these anthelmintics. Furthermore, we studied the consequences of drug exposure by measuring the sensitivity of L3 to subsequent exposure to higher drug concentrations using larval migration assays. The most highly transcribed transporter genes in both susceptible and resistant L3 were pgp-9.3, abcf-1, mrp-5, abcf-2, pgp-3, and pgp-10. The resistant isolate showed significantly higher transcription of pgp-1, pgp-9.1 and pgp-9.2 compared to the susceptible isolate. Five P-gp genes and the haf-6 gene showed significantly higher transcription (up to 12.6-fold after 3 h exposure to IVM in the resistant isolate. Similarly, five P-gp genes, haf-6 and abcf-1 were transcribed at significantly higher levels (up to 10.3-fold following 3 h exposure to LEV in this isolate. On the other hand, there were no significant changes in transcriptional patterns of all transporter genes in the susceptible isolate following 3 and 6 h exposure to IVM or LEV. In contrast to these isolate-specific transcription changes, both isolates showed an increase in R-123 efflux following exposure to the drugs, suggesting that the drugs stimulated activity of existing transporter proteins in both isolates. Exposure of resistant larvae to IVM or LEV resulted, in some instances, in an increase in the proportion of the population able to migrate at the highest IVM concentrations in subsequent migration assays. The significant increase in transcription of some ABC transporter genes following 3 h exposure to both IVM and LEV in the resistant isolate only, suggests that an ability to rapidly upregulate protective pathways in response to drugs may be a component of the resistance displayed by this isolate.
Energy Technology Data Exchange (ETDEWEB)
Molenaar, G. [Jacobs Canada Inc., Calgary, AB (Canada); Henning, A.; Kobussen, S. [Jacobs Nederland BV, Hoogvliet (Netherlands)
2009-07-01
Oil sands bitumen contains approximately 4 to 5 per cent sulphur by weight and the bitumen is upgraded to produce lighter fractions. During coking the bitumen is heated and cracked into lighter molecules and a mixture of kerosene, naphtha and gas oil is recovered via fractionation. Then, the vapors leaving the fractionator are processed through hydrodesulphurization, followed by removal by amine based sweetening units. The acid gas from the ASUs is sent to the sulphur recovery units (SRUs) where most of the sulphur is recovered as elemental sulphur. The oil sands industry faces many challenges with respect to environmental impact, energy use and greenhouse gas emissions including the recovery of sulphur and minimizing hydrogen sulfide (H{sub 2}S) and sulphur dioxide (SO{sub 2}) emissions from the oil sands production facilities. In order to improve the SRU control response to acid gas feed variations, Jacobs Comprimo Sulphur Solutions implemented advanced burner control+ (ABC+) at Suncor's Simonette Gas Plant's SRU in northern Alberta. This control system used an acid gas feed analyzer and dynamic algorithms to control the combustion air to the reaction furnace. The analyzer measures H{sub 2}S, total hydrocarbons, carbon dioxide (CO{sub 2}) and water (H{sub 2}O) accurately and quickly, which is important for having effective and fast air-to-acid gas ratio control. The paper provided background information on the Suncor Simonette Gas Plant and discussed ABC+ versus conventional control. An overview of the simplified ABC and ABC+ systems was then illustrated and presented. The ABB multiwave process photometer was also explained. Last, a dynamic simulation of the potential benefits of ABC+ was discussed and the ABC+ benefits for oil sands were presented. It was concluded that ABC+ provides improved SRU performance, reduced SO{sub 2} emissions and violations, and reduced flaring. 1 tab., 3 figs.
Wang, Charles Y; Patel, Nisha; Wholey, Wei-Yun; Dawid, Suzanne
2018-06-19
The opportunistic pathogen Streptococcus pneumoniae (pneumococcus) uses natural genetic competence to increase its adaptability through horizontal gene transfer. One method of acquiring DNA is through predation of neighboring strains with antimicrobial peptides called "bacteriocins." Competence and production of the major family of pneumococcal bacteriocins, pneumocins, are regulated by the quorum-sensing systems com and blp , respectively. In the classical paradigm, the ABC transporters ComAB and BlpAB each secretes its own system's signaling pheromone and in the case of BlpAB also secretes the pneumocins. While ComAB is found in all pneumococci, only 25% of strains encode an intact version of BlpAB [BlpAB(+)] while the rest do not [BlpAB(-)]. Contrary to the classical paradigm, it was previously shown that BlpAB(-) strains can activate blp through ComAB-mediated secretion of the blp pheromone during brief periods of competence. To better understand the full extent of com - blp crosstalk, we examined the contribution of each transporter to competence development and pneumocin secretion. We found that BlpAB(+) strains have a greater capacity for competence activation through BlpAB-mediated secretion of the com pheromone. Similarly, we show that ComAB and BlpAB are promiscuous and both can secrete pneumocins. Consequently, differences in pneumocin secretion between BlpAB(+) and BlpAB(-) strains derive from the regulation and kinetics of transporter expression rather than substrate specificity. We speculate that BlpAB(-) strains (opportunists) use pneumocins mainly in a narrowly tailored role for DNA acquisition and defense during competence while BlpAB(+) strains (aggressors) expand their use for the general inhibition of rival strains. Copyright © 2018 the Author(s). Published by PNAS.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2007-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plu...
Ligand binding and crystal structures of the substrate-binding domain of the ABC transporter OpuA.
Directory of Open Access Journals (Sweden)
Justina C Wolters
2010-04-01
Full Text Available The ABC transporter OpuA from Lactococcus lactis transports glycine betaine upon activation by threshold values of ionic strength. In this study, the ligand binding characteristics of purified OpuA in a detergent-solubilized state and of its substrate-binding domain produced as soluble protein (OpuAC was characterized.The binding of glycine betaine to purified OpuA and OpuAC (K(D = 4-6 microM did not show any salt dependence or cooperative effects, in contrast to the transport activity. OpuAC is highly specific for glycine betaine and the related proline betaine. Other compatible solutes like proline and carnitine bound with affinities that were 3 to 4 orders of magnitude lower. The low affinity substrates were not noticeably transported by membrane-reconstituted OpuA. OpuAC was crystallized in an open (1.9 A and closed-liganded (2.3 A conformation. The binding pocket is formed by three tryptophans (Trp-prism coordinating the quaternary ammonium group of glycine betaine in the closed-liganded structure. Even though the binding site of OpuAC is identical to that of its B. subtilis homolog, the affinity for glycine betaine is 4-fold higher.Ionic strength did not affect substrate binding to OpuA, indicating that regulation of transport is not at the level of substrate binding, but rather at the level of translocation. The overlap between the crystal structures of OpuAC from L.lactis and B.subtilis, comprising the classical Trp-prism, show that the differences observed in the binding affinities originate from outside of the ligand binding site.
Sustaining an Effective ABC-ABM System
Gary COKINS; Sorinel CĂPUŞNEANU
2011-01-01
The purpose of this paper is to describe the Activity- Based Costing (ABC) and Activity-Based Management (ABM) system and techniques to sustain them as a permanent and repeatable production reporting system, not just for one-off analysis. A comparison is made between ABC/ABM modeling software that extracts source data and business systems that include ABC/ABM modeling features. There are presented the stages of updating, running and rerunning the ABC/ABM system. The resul...
McGarritty, Ian
1985-01-01
Discusses the Australian Broadcasting Corporation's (ABC) utilization of the AUSSAT telecommunications satellite to extend its television and radio transmission range to reach remote Australian audiences; the satellite's program gathering and interchange capabilities; and ABC's generation of other benefits to offset cost of satellite services.…
Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; van der Zant, Herre S. J.
It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa
2008-02-01
RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABC(RNAi) mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABC(RNAi) gene class. Genetic complementation tests reveal functions for ABC(RNAi) transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABC(RNAi) proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABC(RNAi) mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABC(RNAi) gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABC(RNAi) transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity.
Browning, Lauren M; Lee, Kerry J; Cherukuri, Pavan K; Huang, Tao; Songkiatisak, Preeyaporn; Warren, Seth; Xu, Xiao-Hong Nancy
2018-03-26
ATP-binding cassette (ABC) membrane transporters serve as self-defense transport apparatus in many living organisms and they can selectively extrude a wide variety of substrates, leading to multidrug resistance (MDR). The detailed molecular mechanisms remain elusive. Single nanoparticle plasmonic spectroscopy highly depends upon their sizes, shapes, chemical and surface properties. In our previous studies, we have used the size-dependent plasmonic spectra of single silver nanoparticles (Ag NPs) to study the real-time efflux kinetics of the ABC (BmrA) transporter and MexAB-OprM transporter in single live cells (Gram-positive and Gram-negative bacterium), respectively. In this study, we prepared and used purified, biocompatible and stable (non-aggregated) gold nanoparticles (Au NPs) (12.4 ± 0.9 nm) to study the efflux kinetics of single BmrA membrane transporters of single live Bacillus subtillis cells, aiming to probe chemical dependent efflux functions of BmrA transporters and their potential chemical sensing capability. Similar to those observed using Ag NPs, accumulation of the intracellular Au NPs in single live cells (WT and ΔBmrA) highly depends upon the cellular expression of BmrA and the NP concentration (0.7 and 1.4 nM). The lower accumulation of intracellular Au NPs in WT (normal expression of BmrA) than ΔBmrA (deletion of bmrA) indicates that BmrA extrudes the Au NPs out of the WT cells. The accumulation of Au NPs in the cells increases with NP concentration, suggesting that the Au NPs most likely passively diffuse into the cells, similar to antibiotics. The result demonstrates that such small Au NPs can serve as imaging probes to study the efflux function of the BmrA membrane transporter in single live cells. Furthermore, the dependence of the accumulation rate of intracellular Au NPs in single live cells upon the expression of BmrA and the concentration of the NPs is about twice higher than that of the same sized Ag NPs. This interesting finding
ABC Kinga kauplused = ABC King shoe stores
2011-01-01
Tallinnas Kristiine keskuses, Tartu Kaubamajas ja Pärnus Port Artur 2 asuvate ABC Kinga kaupluste sisekujundusest. Sisearhitekid Andres Labi ja Janno Roos (Ruumilabor OÜ), loetletud nende ühiselt tehtud töid
YehZYXW of Escherichia coli Is a Low-Affinity, Non-Osmoregulatory Betaine-Specific ABC Transporter.
Lang, Shenhui; Cressatti, Marisa; Mendoza, Kris E; Coumoundouros, Chelsea N; Plater, Samantha M; Culham, Doreen E; Kimber, Matthew S; Wood, Janet M
2015-09-22
Transporter-mediated osmolyte accumulation stimulates the growth of Escherichia coli in high-osmolality environments. YehZYXW was predicted to be an osmoregulatory transporter because (1) osmotic and stationary phase induction of yehZYXW is mediated by RpoS, (2) the Yeh proteins are homologous to the components of known osmoregulatory ABC transporters (e.g., ProU of E. coli), and (3) YehZ models based on the structures of periplasmic betaine-binding proteins suggested that YehZ retains key betaine-binding residues. The betaines choline-O-sulfate, glycine betaine, and dimethylsulfoniopropionate bound YehZ and ProX with millimolar and micromolar affinities, respectively, as determined by equilibrium dialysis and isothermal titration calorimetry. The crystal structure of the YehZ apoprotein, determined at 1.5 Å resolution (PDB ID: 4WEP ), confirmed its similarity to other betaine-binding proteins. Small and nonpolar residues in the hinge region of YehZ (e.g., Gly223) pack more closely than the corresponding residues in ProX, stabilizing the apoprotein. Betaines bound YehZ-Gly223Ser an order of magnitude more tightly than YehZ, suggesting that weak substrate binding in YehZ is at least partially due to apo state stabilization. Neither ProX nor YehZ bound proline. Assays based on osmoprotection or proline auxotrophy failed to detect YehZYXW-mediated uptake of proline, betaines, or other osmolytes. However, transport assays revealed low-affinity glycine betaine uptake, mediated by YehZYXW, that was inhibited at high salinity. Thus, YehZYXW is a betaine transporter that shares substrate specificity, but not an osmoregulatory function, with homologues like E. coli ProU. Other work suggests that yehZYXW may be an antivirulence locus whose expression promotes persistent, asymptomatic bacterial infection.
Spontaneous radiation of a chiral molecule located near a half-space of a bi-isotropic material
Guzatov, D. V.; Klimov, V. V.; Poprukailo, N. S.
2013-04-01
Analytical expressions for the rate of spontaneous emission from a chiral (optically active) molecule located near a half-space occupied by a chiral (bi-isotropic) material have been obtained and analyzed in detail. It is established that the rates of spontaneous emission from the "right" and "left" enantiomers of molecules occurring near the chiral medium may significantly differ in cases of chiral materials with (i) both negative dielectric permittivity and magnetic permeability (DNG metamaterial) and (ii) negative permeability and positive permittivity (MNG metamaterial). Based on this phenomenon, DMG and MNG metamaterials can be used to create devices capable of separating right and left enantiomers in racemic mixtures.
Spontaneous radiation of a chiral molecule located near a half-space of a bi-isotropic material
Energy Technology Data Exchange (ETDEWEB)
Guzatov, D. V., E-mail: vklimov@sci.lebedev.ru [Yanka Kupala Grodno State University (Belarus); Klimov, V. V., E-mail: klimov256@gmail.com [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Poprukailo, N. S. [Yanka Kupala Grodno State University (Belarus)
2013-04-15
Analytical expressions for the rate of spontaneous emission from a chiral (optically active) molecule located near a half-space occupied by a chiral (bi-isotropic) material have been obtained and analyzed in detail. It is established that the rates of spontaneous emission from the 'right' and 'left' enantiomers of molecules occurring near the chiral medium may significantly differ in cases of chiral materials with (i) both negative dielectric permittivity and magnetic permeability (DNG metamaterial) and (ii) negative permeability and positive permittivity (MNG metamaterial). Based on this phenomenon, DMG and MNG metamaterials can be used to create devices capable of separating right and left enantiomers in racemic mixtures.
Spontaneous radiation of a chiral molecule located near a half-space of a bi-isotropic material
International Nuclear Information System (INIS)
Guzatov, D. V.; Klimov, V. V.; Poprukailo, N. S.
2013-01-01
Analytical expressions for the rate of spontaneous emission from a chiral (optically active) molecule located near a half-space occupied by a chiral (bi-isotropic) material have been obtained and analyzed in detail. It is established that the rates of spontaneous emission from the “right” and “left” enantiomers of molecules occurring near the chiral medium may significantly differ in cases of chiral materials with (i) both negative dielectric permittivity and magnetic permeability (DNG metamaterial) and (ii) negative permeability and positive permittivity (MNG metamaterial). Based on this phenomenon, DMG and MNG metamaterials can be used to create devices capable of separating right and left enantiomers in racemic mixtures.
Goudsmits, Joris M H; van Oijen, Antoine M; Slotboom, Dirk J
2017-01-01
Cells are delineated by a lipid bilayer that physically separates the inside from the outer environment. Most polar, charged, or large molecules require proteins to reduce the energetic barrier for passage across the membrane and to achieve transport rates that are relevant for life. Here, we describe techniques to visualize the functioning of membrane transport proteins with fluorescent probes at the single-molecule level. First, we explain how to produce membrane-reconstituted transporters with fluorescent labels. Next, we detail the construction of a microfluidic flow cell to image immobilized proteoliposomes on a total internal reflection fluorescence microscope. We conclude by describing the methods that are needed to analyze fluorescence movies and obtain useful single-molecule data. © 2017 Elsevier Inc. All rights reserved.
The role of the atypical kinases ABC1K7 and ABC1K8 in abscisic acid responses
Directory of Open Access Journals (Sweden)
Anna eManara
2016-03-01
Full Text Available The ABC1K family of atypical kinases (activity of bc1 complex kinase is represented in bacteria, archaea and eukaryotes. In plants they regulate diverse physiological processes in the chloroplasts and mitochondria, but their precise functions are poorly defined. ABC1K7 and ABC1K8 are probably involved in oxidative stress responses, isoprenyl lipid synthesis and distribution of iron within chloroplasts. Because reactive oxygen species take part in abscisic acid (ABA-mediated processes, we investigated the functions of ABC1K7 and ABC1K8 during germination, stomatal movement and leaf senescence. Both genes were upregulated by ABA treatment and some ABA-responsive physiological processes were affected in abc1k7 and abc1k8 mutants. Germination was more severely affected by ABA, osmotic stress and salt stress in the single and double mutants; the stomatal aperture was smaller in the mutants under standard growth conditions and was not further reduced by exogenous ABA application; ABA-induced senescence symptoms were more severe in the leaves of the single and double mutants compared to wild type leaves. Taken together, our results suggest that ABC1K7 and ABC1K8 might be involved in the cross-talk between ABA and ROS signaling.
The structure of the human ABC transporter ABCG2 reveals a novel mechanism for drug extrusion.
Khunweeraphong, Narakorn; Stockner, Thomas; Kuchler, Karl
2017-10-23
The human ABC transporter ABCG2 (Breast Cancer Resistance Protein, BCRP) is implicated in anticancer resistance, in detoxification across barriers and linked to gout. Here, we generate a novel atomic model of ABCG2 using the crystal structure of ABCG5/G8. Extensive mutagenesis verifies the structure, disclosing hitherto unrecognized essential residues and domains in the homodimeric ABCG2 transporter. The elbow helix, the first intracellular loop (ICL1) and the nucleotide-binding domain (NBD) constitute pivotal elements of the architecture building the transmission interface that borders a central cavity which acts as a drug trap. The transmission interface is stabilized by salt-bridge interactions between the elbow helix and ICL1, as well as within ICL1, which is essential to control the conformational switch of ABCG2 to the outward-open drug-releasing conformation. Importantly, we propose that ICL1 operates like a molecular spring that holds the NBD dimer close to the membrane, thereby enabling efficient coupling of ATP hydrolysis during the catalytic cycle. These novel mechanistic data open new opportunities to therapeutically target ABCG2 in the context of related diseases.
Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers
Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco
2011-03-01
The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.
Chen, Xu; Jiang, Min; Zhao, Rui-Ke; Gu, Guo-Hao
2015-01-01
ABC proteins are one key type of transport superfamilies which undertake majority of drug transport, which affect the osteosarcoma response to chemotherapeutics. Previous studies have suggested the association between ABC polymorphisms and osteosarcoma response. However, the results of previous studies remain controversial. Therefore, we perform a meta-analysis to get a more precise estimation of this association. The association between ABC polymorphisms and osteosarcoma response was assessed by odds ratios (ORs) together with their 95% confidence intervals (CIs). Three polymorphisms of ABC including ABCB1 rs1128503, ABCC3 rs4148416 and ABCC2 rs717620 polymorphism were investigated. Overall, significant association was observed between ABCC3 rs4148416 polymorphism and osteosarcoma response under allele contrast (T vs. C: OR=1.73, 95%CI=1.09-2.74, P=0.019), homozygote comparison (TT vs. CC: OR=2.00, 95%CI=1.25-3.23, P=0.004), recessive genetic model (TT vs. OR=1.80, 95%CI=1.14-2.84, P=0.011) and dominant genetic model (TT/TC vs. CC: OR=1.70, 95%CI=1.20-2.42, P=0.003). Moreover, significant association was also observed in Caucasian population rather than Asian population for ABCB1 rs1128503 polymorphism. We conclude that ABCC3 rs4148416 polymorphism was significantly associated with poor osteosarcoma response and ABCB1 rs1128503 polymorphism was significantly associated with good osteosarcoma response in Caucasian population rather than Asian population.
Genetic variation in ABC transporter A1 contributes to HDL cholesterol in the general population
DEFF Research Database (Denmark)
Frikke-Schmidt, Ruth; Nordestgaard, Børge G; Jensen, Gorm B
2004-01-01
Homozygosity for mutations in ABC transporter A1 (ABCA1) causes Tangier disease, a rare HDL-deficiency syndrome. Whether heterozygosity for genetic variation in ABCA1 also contributes to HDL cholesterol (HDL-C) levels in the general population is presently unclear. We determined whether mutations...... or single-nucleotide polymorphisms (SNPs) in ABCA1 were overrepresented in individuals with the lowest 1% (n=95) or highest 1% (n=95) HDL-C levels in the general population by screening the core promoter and coding region of ABCA1. For all nonsynonymous SNPs identified, we determined the effect of genotype...... on lipid traits in 9,259 individuals from the general population. Heterozygosity for ABCA1 mutations was identified in 10% of individuals with low HDL-C only. Three of 6 nonsynonymous SNPs (V771M, V825I, and R1587K) were associated with increases or decreases in HDL-C in women in the general population...
Diversity and evolution of ABC proteins in basidiomycetes.
Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O
2013-01-01
ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.
Directory of Open Access Journals (Sweden)
Suneeta Chimalapati
Full Text Available Lipoproteins are an important class of surface associated proteins that have diverse roles and frequently are involved in the virulence of bacterial pathogens. As prolipoproteins are attached to the cell membrane by a single enzyme, prolipoprotein diacylglyceryl transferase (Lgt, deletion of the corresponding gene potentially allows the characterisation of the overall importance of lipoproteins for specific bacterial functions. We have used a Δlgt mutant strain of Streptococcus pneumoniae to investigate the effects of loss of lipoprotein attachment on cation acquisition, growth in media containing specific carbon sources, and virulence in different infection models. Immunoblots of triton X-114 extracts, flow cytometry and immuno-fluorescence microscopy confirmed the Δlgt mutant had markedly reduced lipoprotein expression on the cell surface. The Δlgt mutant had reduced growth in cation depleted medium, increased sensitivity to oxidative stress, reduced zinc uptake, and reduced intracellular levels of several cations. Doubling time of the Δlgt mutant was also increased slightly when grown in medium with glucose, raffinose and maltotriose as sole carbon sources. These multiple defects in cation and sugar ABC transporter function for the Δlgt mutant were associated with only slightly delayed growth in complete medium. However the Δlgt mutant had significantly reduced growth in blood or bronchoalveolar lavage fluid and a marked impairment in virulence in mouse models of nasopharyngeal colonisation, sepsis and pneumonia. These data suggest that for S. pneumoniae loss of surface localisation of lipoproteins has widespread effects on ABC transporter functions that collectively prevent the Δlgt mutant from establishing invasive infection.
Directory of Open Access Journals (Sweden)
Stéphanie Coumes-Florens
2011-01-01
Full Text Available Signal transduction systems and ABC transporters often contribute jointly to adaptive bacterial responses to environmental changes. In Bacillus subtilis, three such pairs are involved in responses to antibiotics: BceRSAB, YvcPQRS and YxdJKLM. They are characterized by a histidine kinase belonging to the intramembrane sensing kinase family and by a translocator possessing an unusually large extracytoplasmic loop. It was established here using a phylogenomic approach that systems of this kind are specific but widespread in Firmicutes, where they originated. The present phylogenetic analyses brought to light a highly dynamic evolutionary history involving numerous horizontal gene transfers, duplications and lost events, leading to a great variety of Bce-like repertories in members of this bacterial phylum. Based on these phylogenetic analyses, it was proposed to subdivide the Bce-like modules into six well-defined subfamilies. Functional studies were performed on members of subfamily IV comprising BceRSAB from B. subtilis, the expression of which was found to require the signal transduction system as well as the ABC transporter itself. The present results suggest, for the members of this subfamily, the occurrence of interactions between one component of each partner, the kinase and the corresponding translocator. At functional and/or structural levels, bacitracin dependent expression of bceAB and bacitracin resistance processes require the presence of the BceB translocator loop. Some other members of subfamily IV were also found to participate in bacitracin resistance processes. Taken together our study suggests that this regulatory mechanism might constitute an important common antibiotic resistance mechanism in Firmicutes. [Supplemental material is available online at http://www.genome.org.].
Energy Technology Data Exchange (ETDEWEB)
Ganapol, B.D., E-mail: ganapol@cowboy.ame.arizona.edu [Department of Aerospace and Mechanical Engineering, University of Arizona, Tucson, AZ (United States); Mostacci, D.; Previti, A. [Montecuccolino Laboratory, University of Bologna, Via dei Colli, 16, I-40136 Bologna (Italy)
2016-07-01
We present highly accurate solutions to the neutral particle transport equation in a half-space. While our initial motivation was in response to a recently published solution based on Chandrasekhar's H-function, the presentation to follow has taken on a more comprehensive tone. The solution by H-functions certainly did achieved high accuracy but was limited to isotropic scattering and emission from spatially uniform and linear sources. Moreover, the overly complicated nature of the H-function approach strongly suggests that its extension to anisotropic scattering and general sources is not at all practical. For this reason, an all encompassing theory for the determination of highly precise benchmarks, including anisotropic scattering for a variety of spatial source distributions, is presented for particle transport in a half-space. We illustrate the approach via a collection of cases including tables of 7-place flux benchmarks to guide transport methods developers. The solution presented can be applied to a considerable number of one and two half-space transport problems with variable sources and represents a state-of-the-art benchmark solution.
Abe, Yuta; Kamiya, Koki; Osaki, Toshihisa; Sasaki, Hirotaka; Kawano, Ryuji; Miki, Norihisa; Takeuchi, Shoji
2015-08-21
This paper describes a simple microfluidic device that can generate nonlinear concentration gradients. We changed the "width" of channels that can drastically shorten the total microfluidic channel length and simplify the microfluidic network design rather than the "length" of channels. The logarithmic concentration gradients generated by the device were in good agreement with those obtained by simulation. Using this device, we evaluated a probable IC50 value of the ABC transporter proteins by the competitive transport assays at five different logarithmic concentrations. This probable IC50 value was in good agreement with an IC50 value (0.92 μM) obtained at the diluted concentrations of seven points.
Zeng, Jing; Chen, Ke-Qiu; Long, Mengqiu
2017-06-01
Recently, Zhong et al (2015 Nano Lett. 15 8091) found that two additional hydrogen atoms can be adsorbed to the opposite aza-bridging nitrogen atoms of the manganese phthalocyanine (MnPc) macrocycle when exposed to H2. Thus the symmetry of the MnPc molecule is changed from 4-fold to 2-fold. Motivated by this recent experiment, we theoretically investigate a MnPc-based single-molecule junction in this work and propose a simple and reliable way to realize the transition of its electronic properties. On the basis of spin-polarized density-functional theory calculations combined with the Keldysh nonequilibrium Green’s technique, we find that the gradual hydrogenation in MnPc molecules gives rise to the changes of the hardness of the electron density and spin-selective orbital decoupling, which eventually leads to the realization of the first ever metal → half-metal → semiconductor transition behavior in single-molecule junctions. Analysis of molecular projected self-consistent Hamiltonian, Mulliken population, and local density of states also reveals an important rule for realizing this transition behavior. Our research confirms that the hydrogenation of MnPc molecules can realize various molecular functionalities in unitary material background.
International Nuclear Information System (INIS)
Zeng, Jing; Chen, Ke-Qiu; Long, Mengqiu
2017-01-01
Recently, Zhong et al (2015 Nano Lett . 15 8091) found that two additional hydrogen atoms can be adsorbed to the opposite aza-bridging nitrogen atoms of the manganese phthalocyanine (MnPc) macrocycle when exposed to H 2 . Thus the symmetry of the MnPc molecule is changed from 4-fold to 2-fold. Motivated by this recent experiment, we theoretically investigate a MnPc-based single-molecule junction in this work and propose a simple and reliable way to realize the transition of its electronic properties. On the basis of spin-polarized density-functional theory calculations combined with the Keldysh nonequilibrium Green’s technique, we find that the gradual hydrogenation in MnPc molecules gives rise to the changes of the hardness of the electron density and spin-selective orbital decoupling, which eventually leads to the realization of the first ever metal → half-metal → semiconductor transition behavior in single-molecule junctions. Analysis of molecular projected self-consistent Hamiltonian, Mulliken population, and local density of states also reveals an important rule for realizing this transition behavior. Our research confirms that the hydrogenation of MnPc molecules can realize various molecular functionalities in unitary material background. (paper)
Learning the ABCs: Activity based costing in waste operations
International Nuclear Information System (INIS)
Zocher, Marc A.
1992-01-01
The United States Department of Energy (DOE) is facing a challenging new national role based on current world events, changing public perception and awareness, and a legacy of wastes generated in the past. Clearly, the DOE must put mechanisms in place to comply with environmental rules, regulations, and good management practices so that public health risk is minimized while programmatic costs are controlled. DOE has begun this process and has developed a Five-Year Plan to describe the activities necessary to comply with both cleanup, or environmental restoration, and waste management of existing waste streams. The focus of this paper is how to best manage the treatment, storage, disposal, and transportation of waste throughout the DOE weapons complex by using Activity Based Costing (ABC) to both plan and control expenditures in DOE Waste Management (WM). The basics of ABC, along with an example, will be detailed. (author)
Marketing Research of Construction Sites based on ABC-XYZ Analysis and Relational Data
Directory of Open Access Journals (Sweden)
Konikov Aleksandr
2017-01-01
Full Text Available ABC-XYZ analysis is well known in marketing. It allows identifying sites that yield maximum profits when sold, sites that enjoy stable demand, or sites have both qualities specified above. However, the methods are quite abstract and are not designed to study specific factors that impact the results of ABC-XYZ analysis. Meanwhile, for some applications, particularly for marketing research of construction sites, it is critical not only to identify high-profit and stable sites but also to find out what combination of technical parameters, factors related to their location, transport accessibility, etc. are typical of them. This work suggests an approach to address the issue.
Varmanen, P; Rantanen, T; Palva, A
1996-12-01
A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.
Transport mirages in single-molecule devices
Gaudenzi, R.; Misiorny, M.; Burzurí, E.; Wegewijs, M. R.; van der Zant, H. S. J.
2017-03-01
Molecular systems can exhibit a complex, chemically tailorable inner structure which allows for targeting of specific mechanical, electronic, and optical properties. At the single-molecule level, two major complementary ways to explore these properties are molecular quantum-dot structures and scanning probes. This article outlines comprehensive principles of electron-transport spectroscopy relevant to both these approaches and presents a new, high-resolution experiment on a high-spin single-molecule junction exemplifying these principles. Such spectroscopy plays a key role in further advancing our understanding of molecular and atomic systems, in particular, the relaxation of their spin. In this joint experimental and theoretical analysis, particular focus is put on the crossover between the resonant regime [single-electron tunneling] and the off-resonant regime [inelastic electron (co)tunneling spectroscopy (IETS)]. We show that the interplay of these two processes leads to unexpected mirages of resonances not captured by either of the two pictures alone. Although this turns out to be important in a large fraction of the possible regimes of level positions and bias voltages, it has been given little attention in molecular transport studies. Combined with nonequilibrium IETS—four-electron pump-probe excitations—these mirages provide crucial information on the relaxation of spin excitations. Our encompassing physical picture is supported by a master-equation approach that goes beyond weak coupling. The present work encourages the development of a broader connection between the fields of molecular quantum-dot and scanning probe spectroscopy.
Enterprise Architecture Data Pada Hotel ABC
Soesatyo, Stephanie; Wibowo, Adi; Handojo, Andreas
2015-01-01
Hotel ABC is a company engaged in hospitality management, i.e. room rental, rental of meeting rooms and coffee shop. Hotel ABC has a branch that has the same specifications of the hotel. In business process, Hotel ABC has information systems to support existing business processes. However, existing information systems have not been integrated as a whole. Based on the condition stated above, analysis and design of enterprise architecture information system is created for the company. The proce...
Odell, Anders
2011-10-03
The influence of the electrode\\'s Fermi surface on the transport properties of a photoswitching molecule is investigated with state-of-the-art ab initio transport methods. We report results for the conducting properties of the two forms of dithienylethene attached either to Ag or to nonmagnetic Ni leads. The I-V curves of the Ag/dithienylethene/Ag device are found to be very similar to those reported previously for Au. In contrast, when Ni is used as the electrode material the zero-bias transmission coefficient is profoundly different as a result of the role played by the Ni d bands in the bonding between the molecule and the electrodes. Intriguingly, despite these differences the overall conducting properties depend little on the electrode material. We thus conclude that electron transport in dithienylethene is, for the cases studied, mainly governed by the intrinsic electronic structure of the molecule. © 2011 American Physical Society.
The ABC-paradox: is Time Driven ABC relevant for small and Medium sized enterprises (SME)?
DEFF Research Database (Denmark)
Fladkjær, Henrik Find; Jensen, Erling
Several articles suggest that Activity Based Costing (ABC) has failed to succeed in practical use. It is even argued that we have an ABC-paradox. Activity Based Costing has won theoretically in nu-merous articles in journals, through books, being included in all major Business Accounting text-books...
Electron-vibron coupling effects on electron transport via a single-molecule magnet
McCaskey, A.; Yamamoto, Y.; Warnock, M.; Burzuri, E.; Van der Zant, H.S.J.; Park, K.
2015-01-01
We investigate how the electron-vibron coupling influences electron transport via an anisotropic magnetic molecule, such as a single-molecule magnet (SMM) Fe4, by using a model Hamiltonian with parameter values obtained from density-functional theory (DFT). The magnetic anisotropy parameters,
Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy
International Nuclear Information System (INIS)
Lee, Min Hyung; Song, Hyunwook
2013-01-01
We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects
Odell, Anders; Delin, Anna; Johansson, Bö rje; Ulman, Kanchan; Narasimhan, Shobhana; Rungger, Ivan; Sanvito, Stefano
2011-01-01
The influence of the electrode's Fermi surface on the transport properties of a photoswitching molecule is investigated with state-of-the-art ab initio transport methods. We report results for the conducting properties of the two forms
Membrane porters of ATP-binding cassette transport systems are polyphyletic.
Wang, Bin; Dukarevich, Maxim; Sun, Eric I; Yen, Ming Ren; Saier, Milton H
2009-09-01
The ATP-binding cassette (ABC) superfamily consists of both importers and exporters. These transporters have, by tradition, been classified according to the ATP hydrolyzing constituents, which are monophyletic. The evolutionary origins of the transmembrane porter proteins/domains are not known. Using five distinct computer programs, we here provide convincing statistical data suggesting that the transmembrane domains of ABC exporters are polyphyletic, having arisen at least three times independently. ABC1 porters arose by intragenic triplication of a primordial two-transmembrane segment (TMS)-encoding genetic element, yielding six TMS proteins. ABC2 porters arose by intragenic duplication of a dissimilar primordial three-TMS-encoding genetic element, yielding a distinctive protein family, nonhomologous to the ABC1 proteins. ABC3 porters arose by duplication of a primordial four-TMS-encoding genetic element, yielding either eight- or 10-TMS proteins. We assign each of 48 of the 50 currently recognized families of ABC exporters to one of the three evolutionarily distinct ABC types. Currently available high-resolution structural data for ABC porters are fully consistent with our findings. These results provide guides for future structural and mechanistic studies of these important transport systems.
Urea transporter proteins as targets for small-molecule diuretics.
Esteva-Font, Cristina; Anderson, Marc O; Verkman, Alan S
2015-02-01
Conventional diuretics such as furosemide and thiazides target salt transporters in kidney tubules, but urea transporters (UTs) have emerged as alternative targets. UTs are a family of transmembrane channels expressed in a variety of mammalian tissues, in particular the kidney. UT knockout mice and humans with UT mutations exhibit reduced maximal urinary osmolality, demonstrating that UTs are necessary for the concentration of urine. Small-molecule screening has identified potent and selective inhibitors of UT-A, the UT protein expressed in renal tubule epithelial cells, and UT-B, the UT protein expressed in vasa recta endothelial cells. Data from UT knockout mice and from rodents administered UT inhibitors support the diuretic action of UT inhibition. The kidney-specific expression of UT-A1, together with high selectivity of the small-molecule inhibitors, means that off-target effects of such small-molecule drugs should be minimal. This Review summarizes the structure, expression and function of UTs, and looks at the evidence supporting the validity of UTs as targets for the development of salt-sparing diuretics with a unique mechanism of action. UT-targeted inhibitors may be useful alone or in combination with conventional diuretics for therapy of various oedemas and hyponatraemias, potentially including those refractory to treatment with current diuretics.
DEFF Research Database (Denmark)
Kopp, Tine Iskov; Andersen, Vibeke; Tjonneland, Anne
2015-01-01
to assess whether polymorphisms in ABCB1, ABCC2 and ABCG2 were associated with risk of colorectal cancer (CRC) and to investigate gene-environment (dietary factors, smoking and use of non-steroidal anti-inflammatory drugs) and gene-gene interactions between previously studied polymorphisms in IL1B and IL10......The ATP-binding cassette (ABC) transporter family transports various molecules across the enterocytes in the gut protecting the intestine against potentially harmful substances. Moreover, ABC transporters are involved in mucosal immune defence through interaction with cytokines. The study aimed...... of the polymorphisms were associated with CRC, but ABCB1 and ABCG2 haplotypes were associated with risk of CRC. ABCB1/rs1045642 interacted with intake of cereals and fiber (p-Value for interaction (Pint) = 0.001 and 0.01, respectively). In a three-way analysis, both ABCB1/rs1045642 and ABCG2/rs2231137 in combination...
Radiation transport and energetics of laser-driven half-hohlraums at the National Ignition Facility
Energy Technology Data Exchange (ETDEWEB)
Moore, A. S. [Directorate Science and Technology, AWE Aldermaston, Reading (United Kingdom); Cooper, A. B.R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Schneider, M. B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); MacLaren, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Graham, P. [Directorate Science and Technology, AWE Aldermaston, Reading (United Kingdom); Lu, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Seugling, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Satcher, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Klingmann, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Comley, A. J. [Directorate Science and Technology, AWE Aldermaston, Reading (United Kingdom); Marrs, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); May, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Widmann, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Glendinning, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Castor, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Sain, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Back, C. A. [General Atomics, San Diego, CA (United States); Hund, J. [General Atomics, San Diego, CA (United States); Baker, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hsing, W. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Foster, J. [Directorate Science and Technology, AWE Aldermaston, Reading (United Kingdom); Young, B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Young, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2014-06-01
Experiments that characterize and develop a high energy-density half-hohlraum platform for use in bench-marking radiation hydrodynamics models have been conducted at the National Ignition Facility (NIF). Results from the experiments are used to quantitatively compare with simulations of the radiation transported through an evolving plasma density structure, colloquially known as an N-wave. A half-hohlraum is heated by 80 NIF beams to a temperature of 240 eV. This creates a subsonic di usive Marshak wave which propagates into a high atomic number Ta2O5 aerogel. The subsequent radiation transport through the aerogel and through slots cut into the aerogel layer is investigated. We describe a set of experiments that test the hohlraum performance and report on a range
Activity-Based Costing Application in an Urban Mass Transport Company
Directory of Open Access Journals (Sweden)
Popesko Boris
2011-12-01
Full Text Available The purpose of this paper is to provide a basic overview of the application of Activity-Based Costing in an urban mass transport company which operates land public transport via buses and trolleys within the city. The case study was conducted using the Activity-Based Methodology in order to calculate the true cost of individual operations and to measure the profitability of particular transport lines. The case study analysis showed the possible effects of the application of the Activity-Based Costing for an urban mass transport company as well as the limitations of using the ABC methodology in the service industry. With regards to the application of the ABC methodology, the primary limitation of the accuracy of the conclusions is the quality of the non-financial information which had to be gathered throughout the implementation process. A basic limitation of the accurate data acquisition is the nature of the fare system of the transport company which does not allow the identification of the route that is taken by an individual passenger. The study illustrates the technique of ABC in urban mass transport and provides a real company example of information outputs of the ABC system. The users indicated that, the ABC model is very useful for profitability reporting and profit management. Also, the paper shows specific application of the Activity-Based Methodology in conditions of urban mass transport companies with regional specifics.
abc: An extensible AspectJ compiler
DEFF Research Database (Denmark)
Avgustinov, Pavel; Christensen, Aske Simon; Hendren, Laurie
2005-01-01
checking and code generation, as well as data flow and control flow analyses. The AspectBench Compiler (abc) is an implementation of such a workbench. The base version of abc implements the full AspectJ language. Its frontend is built, using the Polyglot framework, as a modular extension of the Java...... language. The use of Polyglot gives flexibility of syntax and type checking. The backend is built using the Soot framework, to give modular code generation and analyses. In this paper, we outline the design of abc, focusing mostly on how the design supports extensibility. We then provide a general overview...
Implementation of ABC method in real company
Kazhimova, Dina
2014-01-01
The aim of this Bachelor thesis is a thorough analysis of the modern calculation method Activity-based costing (ABC), that identifies the activities that a firm performs, and then assigns indirect costs to products. An ABC system recognizes the relationship between costs, activities and products, and through this relationship assigns indirect costs to products less arbitrarily than traditional methods. Comparison ABC method with traditional methods of cost allocation. Basing on the knowledge ...
Radiation transport and energetics of laser-driven half-hohlraums at the National Ignition Facility
Energy Technology Data Exchange (ETDEWEB)
Moore, A. S., E-mail: alastair.moore@physics.org; Graham, P.; Comley, A. J.; Foster, J. [Directorate Science and Technology, AWE Aldermaston, Reading RG7 4PR (United Kingdom); Cooper, A. B. R.; Schneider, M. B.; MacLaren, S.; Lu, K.; Seugling, R.; Satcher, J.; Klingmann, J.; Marrs, R.; May, M.; Widmann, K.; Glendinning, G.; Castor, J.; Sain, J.; Baker, K.; Hsing, W. W.; Young, B. [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, California 94551-0808 (United States); and others
2014-06-15
Experiments that characterize and develop a high energy-density half-hohlraum platform for use in benchmarking radiation hydrodynamics models have been conducted at the National Ignition Facility (NIF). Results from the experiments are used to quantitatively compare with simulations of the radiation transported through an evolving plasma density structure, colloquially known as an N-wave. A half-hohlraum is heated by 80 NIF beams to a temperature of 240 eV. This creates a subsonic diffusive Marshak wave, which propagates into a high atomic number Ta{sub 2}O{sub 5} aerogel. The subsequent radiation transport through the aerogel and through slots cut into the aerogel layer is investigated. We describe a set of experiments that test the hohlraum performance and report on a range of x-ray measurements that absolutely quantify the energetics and radiation partition inside the target.
Playware ABC: Engineering Play for Everybody
DEFF Research Database (Denmark)
Lund, Henrik Hautop
2017-01-01
This paper describes the Playware ABC concept, and how it allows anybody, anywhere, anytime to be building bodies and brains, which facilitates users to construct, combine and create. The Playware ABC concept focuses engineering and IT system development on creating solutions that are usable by a...
Inelastic transport and low-bias rectification in a single-molecule diode.
Hihath, Joshua; Bruot, Christopher; Nakamura, Hisao; Asai, Yoshihiro; Díez-Pérez, Ismael; Lee, Youngu; Yu, Luping; Tao, Nongjian
2011-10-25
Designing, controlling, and understanding rectification behavior in molecular-scale devices has been a goal of the molecular electronics community for many years. Here we study the transport behavior of a single molecule diode, and its nonrectifying, symmetric counterpart at low temperatures, and at both low and high biases to help elucidate the electron-phonon interactions and transport mechanisms in the rectifying system. We find that the onset of current rectification occurs at low biases, indicating a significant change in the elastic transport pathway. However, the peaks in the inelastic electron tunneling (IET) spectrum are antisymmetric about zero bias and show no significant changes in energy or intensity in the forward or reverse bias directions, indicating that despite the change in the elastic transmission probability there is little impact on the inelastic pathway. These results agree with first principles calculations performed to evaluate the IETS, which also allow us to identify which modes are active in the single molecule junction.
An ABC analysis for power generation project
Batool Hasani; Younos Vakilalroaia
2013-01-01
One of the primary concerns on performance measurement is to know how much a particular project cost. However, using traditional method on project-based products often leads to inappropriate results. In this paper, we re-examine this issue by comparing the cost of a power station construction project using ABC versus traditional method. The results of survey show that ABC method is capable of providing better estimates for overhead costs compared with traditional method. In other words, ABC m...
Room-temperature ballistic energy transport in molecules with repeating units
Energy Technology Data Exchange (ETDEWEB)
Rubtsova, Natalia I.; Nyby, Clara M.; Zhang, Hong; Zhang, Boyu; Zhou, Xiao; Jayawickramarajah, Janarthanan; Burin, Alexander L.; Rubtsov, Igor V., E-mail: irubtsov@tulane.edu [Department of Chemistry, Tulane University, New Orleans, Louisiana 70118 (United States)
2015-06-07
In materials, energy can propagate by means of two limiting regimes: diffusive and ballistic. Ballistic energy transport can be fast and efficient and often occurs with a constant speed. Using two-dimensional infrared spectroscopy methods, we discovered ballistic energy transport via individual polyethylene chains with a remarkably high speed of 1440 m/s and the mean free path length of 14.6 Å in solution at room temperature. Whereas the transport via the chains occurs ballistically, the mechanism switches to diffusive with the effective transport speed of 130 m/s at the end-groups attached to the chains. A unifying model of the transport in molecules is presented with clear time separation and additivity among the transport along oligomeric fragments, which occurs ballistically, and the transport within the disordered fragments, occurring diffusively. The results open new avenues for making novel elements for molecular electronics, including ultrafast energy transporters, controlled chemical reactors, and sub-wavelength quantum nanoseparators.
Room-temperature ballistic energy transport in molecules with repeating units
International Nuclear Information System (INIS)
Rubtsova, Natalia I.; Nyby, Clara M.; Zhang, Hong; Zhang, Boyu; Zhou, Xiao; Jayawickramarajah, Janarthanan; Burin, Alexander L.; Rubtsov, Igor V.
2015-01-01
In materials, energy can propagate by means of two limiting regimes: diffusive and ballistic. Ballistic energy transport can be fast and efficient and often occurs with a constant speed. Using two-dimensional infrared spectroscopy methods, we discovered ballistic energy transport via individual polyethylene chains with a remarkably high speed of 1440 m/s and the mean free path length of 14.6 Å in solution at room temperature. Whereas the transport via the chains occurs ballistically, the mechanism switches to diffusive with the effective transport speed of 130 m/s at the end-groups attached to the chains. A unifying model of the transport in molecules is presented with clear time separation and additivity among the transport along oligomeric fragments, which occurs ballistically, and the transport within the disordered fragments, occurring diffusively. The results open new avenues for making novel elements for molecular electronics, including ultrafast energy transporters, controlled chemical reactors, and sub-wavelength quantum nanoseparators
DEFF Research Database (Denmark)
Danilov, Andrey; Kubatkin, Sergey; Kafanov, Sergey
2008-01-01
We report on single molecule electron transport measurements of two oligophenylenevinylene (OPV3) derivatives placed in a nanogap between gold (Au) or lead (Pb) electrodes in a field effect transistor device. Both derivatives contain thiol end groups that allow chemical binding to the electrodes....... One derivative has additional methylene groups separating the thiols from the delocalized -electron system. The insertion of methylene groups changes the open state conductance by 3-4 orders of magnitude and changes the transport mechanism from a coherent regime with finite zero-bias conductance...
A solute-binding protein for iron transport in Streptococcus iniae
Directory of Open Access Journals (Sweden)
Li Anxing
2010-12-01
Full Text Available Abstract Background Streptococcus iniae (S. iniae is a major pathogen that causes considerable morbidity and mortality in cultured fish worldwide. The pathogen's ability to adapt to the host affects the extent of infection, hence understanding the mechanisms by which S. iniae overcomes physiological stresses during infection will help to identify potential virulence determinants of streptococcal infection. Grow S. iniae under iron-restricted conditions is one approach for identifying host-specific protein expression. Iron plays an important role in many biological processes but it has low solubility under physiological condition. Many microorganisms have been shown to be able to circumvent this nutritional limitation by forming direct contacts with iron-containing proteins through ATP-binding cassette (ABC transporters. The ABC transporter superfamilies constitute many different systems that are widespread among living organisms with different functions, such as ligands translocation, mRNA translation, and DNA repair. Results An ABC transporter system, named as mtsABC (metal transport system was cloned from S. iniae HD-1, and was found to be involved in heme utilization. mtsABC is cotranscribed by three downstream genes, i.e., mtsA, mtsB, and mtsC. In this study, we cloned the first gene of the mtsABC transporter system (mtsA, and purified the corresponding recombinant protein MtsA. The analysis indicated that MtsA is a putative lipoprotein which binds to heme that can serve as an iron source for the microorganism, and is expressed in vivo during Kunming mice infection by S. iniae HD-1. Conclusions This is believed to be the first report on the cloning the ABC transporter lipoprotein from S. iniae genomic DNA. Together, our data suggested that MtsA is associated with heme, and is expressed in vivo during Kunming mice infection by S. iniae HD-1 which indicated that it can be a potential candidate for S. iniae subunit vaccine.
Cuevas Villegas, Carlos Fernando
2010-01-01
El presente artículo pretende mostrar en forma práctica la problemática de los sistemas actuales de costeo y plantear la alternativa conocida como costeo ABC, sus fundamentos, dificultades y utilidad. Así mismo se enfatiza el uso de la llamada Gerencia ABM, como complemento del costeo ABC.
Directory of Open Access Journals (Sweden)
Wee Tek Tay
2015-11-01
Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the
Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz
2015-02-20
The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Hijacking membrane transporters for arsenic phytoextraction
LeBlanc, Melissa S.; McKinney, Elizabeth C.; Meagher, Richard B.; Smith, Aaron P.
2012-01-01
Arsenic is a toxic metalloid and recognized carcinogen. Arsenate and arsenite are the most common arsenic species available for uptake by plants. As an inorganic phosphate (Pi) analog, arsenate is acquired by plant roots through endogenous Pi transport systems. Inside the cell, arsenate is reduced to the thiol-reactive form arsenite. Glutathione (GSH)-conjugates of arsenite may be extruded from the cell or sequestered in vacuoles by members of the ATP-binding cassette (ABC) family of transporters. In the present study we sought to enhance both plant arsenic uptake through Pi transporter overexpression, and plant arsenic tolerance through ABC transporter overexpression. We demonstrate that Arabidopsis thaliana plants overexpressing the high-affinity Pi transporter family members, AtPht1;1 or AtPht1;7, are hypersensitive to arsenate due to increased arsenate uptake. These plants do not exhibit increased sensitivity to arsenite. Co-overexpression of the yeast ABC transporter YCF1 in combination with AtPht1;1 or AtPht1;7 suppresses the arsenate-sensitive phenotype while further enhancing arsenic uptake. Taken together, our results support an arsenic transport mechanism in which arsenate uptake is increased through Pi transporter overexpression, and arsenic tolerance is enhanced through YCF1-mediated vacuolar sequestration. This work substantiates the viability of coupling enhanced uptake and vacuolar sequestration as a means for developing a prototypical engineered arsenic hyperaccumulator. PMID:23108027
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
How to probe transverse magnetic anisotropy of a single-molecule magnet by electronic transport?
Misiorny, M.; Burzuri, E.; Gaudenzi, R.; Park, K.; Leijnse, M.; Wegewijs, M.; Paaske, J.; Cornia, A.; van der Zant, H.
We propose an approach for in-situ determination of the transverse magnetic anisotropy (TMA) of an individual molecule by electronic transport measurements, see Phys. Rev. B 91, 035442 (2015). We study a Fe4 single-molecule magnet (SMM) captured in a gateable junction, a unique tool for addressing the spin in different redox states of a molecule. We show that, due to mixing of the spin eigenstates of the SMM, the TMA significantly manifests itself in transport. We predict and experimentally observe the pronounced intensity modulation of the Coulomb peak amplitude with the magnetic field in the linear-response transport regime, from which the TMA parameter E can be estimated. Importantly, the method proposed here does not rely on the small induced tunnelling effects and, hence, works well at temperatures and electron tunnel broadenings by far exceeding the tunnel splittings and even E itself. We deduce that the TMA for a single Fe4 molecule captured in a junction is substantially larger than the bulk value. Work supported by the Polish Ministry of Science and Education as `Iuventus Plus' project (IP2014 030973) in years 2015-2016.
Rijpma, S.R.; Velden, M. van der; Gonzalez-Pons, M.; Annoura, T.; Schaijk, B.C.L. van; Gemert, G.J.A. van; Heuvel, J.M.W. van den; Ramesar, J.; Chevalley-Maurel, S.; Ploemen, I.H.; Khan, S.M.; Franetich, J.F.; Mazier, D.; Wilt, J.H.W. de; Serrano, A.E.; Russel, F.G.; Janse, C.J.; Sauerwein, R.W.; Koenderink, J.B.; Franke-Fayard, B.M.
2016-01-01
Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC
Directory of Open Access Journals (Sweden)
Stephanie E Hesselson
2009-09-01
Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.
Interaction of spin and vibrations in transport through single-molecule magnets.
May, Falk; Wegewijs, Maarten R; Hofstetter, Walter
2011-01-01
We study electron transport through a single-molecule magnet (SMM) and the interplay of its anisotropic spin with quantized vibrational distortions of the molecule. Based on numerical renormalization group calculations we show that, despite the longitudinal anisotropy barrier and small transverse anisotropy, vibrational fluctuations can induce quantum spin-tunneling (QST) and a QST-Kondo effect. The interplay of spin scattering, QST and molecular vibrations can strongly enhance the Kondo effect and induce an anomalous magnetic field dependence of vibrational Kondo side-bands.
Korenhof, P.E.I.; Koning, Merel; Alpár, Gergely; Hoepman, J.H.; Padullés, Joan Balcells; i Martínez, Agustí Cerrillo; Poch, Miquel Peguera; López, Ismael Peña; de Moner, María José Pifarré; Solana, Mònica Vilasau
2014-01-01
Our networked society increasingly needs secure identity sys- tems. The Attribute-based credential (ABC) technology is designed to be privacy-friendlier than contemporary authentication methods, which often suffer from information leakage. So far, however, some of the wider implications of ABC have
ABCE1 is a highly conserved RNA silencing suppressor.
Directory of Open Access Journals (Sweden)
Kairi Kärblane
Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.
Characterization of molecule and particle transport through nanoscale conduits
Alibakhshi, Mohammad Amin
Nanofluidic devices have been of great interest due to their applications in variety of fields, including energy conversion and storage, water desalination, biological and chemical separations, and lab-on-a-chip devices. Although these applications cross the boundaries of many different disciplines, they all share the demand for understanding transport in nanoscale conduits. In this thesis, different elusive aspects of molecule and particle transport through nanofluidic conduits are investigated, including liquid and ion transport in nanochannels, diffusion- and reaction-governed enzyme transport in nanofluidic channels, and finally translocation of nanobeads through nanopores. Liquid or solvent transport through nanoconfinements is an essential yet barely characterized component of any nanofluidic systems. In the first chapter, water transport through single hydrophilic nanochannels with heights down to 7 nm is experimentally investigated using a new measurement technique. This technique has been developed based on the capillary flow and a novel hybrid nanochannel design and is capable of characterizing flow in both single nanoconduits as well as nanoporous media. The presence of a 0.7 nm thick hydration layer on hydrophilic surfaces and its effect on increasing the hydraulic resistance of the nanochannels is verified. Next, ion transport in a new class of nanofluidic rectifiers is theoretically and experimentally investigated. These so called nanofluidic diodes are nanochannels with asymmetric geometries which preferentially allow ion transport in one direction. A nondimensional number as a function of electrolyte concentration, nanochannel dimensions, and surface charge is derived that summarizes the rectification behavior of this system. In the fourth chapter, diffusion- and reaction-governed enzyme transport in nanofluidic channels is studied and the theoretical background necessary for understanding enzymatic activity in nanofluidic channels is presented. A
Phase-coherent electron transport through metallic atomic-sized contacts and organic molecules
Energy Technology Data Exchange (ETDEWEB)
Pauly, F.
2007-02-02
This work is concerned with the theoretical description of systems at the nanoscale, in particular the electric current through atomic-sized metallic contacts and organic molecules. In the first part, the characteristic peak structure in conductance histograms of different metals is analyzed within a tight-binding model. In the second part, an ab-initio method for quantum transport is developed and applied to single-atom and single-molecule contacts. (orig.)
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-04-01
Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.
Interaction of spin and vibrations in transport through single-molecule magnets
Directory of Open Access Journals (Sweden)
Falk May
2011-10-01
Full Text Available We study electron transport through a single-molecule magnet (SMM and the interplay of its anisotropic spin with quantized vibrational distortions of the molecule. Based on numerical renormalization group calculations we show that, despite the longitudinal anisotropy barrier and small transverse anisotropy, vibrational fluctuations can induce quantum spin-tunneling (QST and a QST-Kondo effect. The interplay of spin scattering, QST and molecular vibrations can strongly enhance the Kondo effect and induce an anomalous magnetic field dependence of vibrational Kondo side-bands.
Directory of Open Access Journals (Sweden)
Qian Yu
2017-11-01
Full Text Available Background/Aims: ATP-binding cassette transporter E1 (ABCE1, a unique ABC superfamily member that bears two Fe-S clusters, is essential for metastatic progression in lung cancer. Fe-S clusters within ABCE1 are crucial for ribosome dissociation and translation reinitiation; however, whether these clusters promote tumor proliferation and migration is unclear. Methods: The interaction between ABCE1 and β-actin was confirmed using GST pull-down. The lung adenocarcinoma (LUAD cell line A549 was transduced with lentiviral packaging vectors overexpressing either wild-type ABCE1 or ABCE1 with Fe-S cluster deletions (ΔABCE1. The role of Fe-S clusters in the viability and migration of cancer cells was evaluated using clonogenic, MTT, Transwell and wound healing assays. Cytoskeletal rearrangement was determined using immunofluorescent techniques. Results: Fe-S clusters were the key domains in ABCE1 involved in binding to β-actin. The proliferative and migratory capacity increased in cells overexpressing ABCE1. However, the absence of Fe-S clusters reversed these effects. A549 cells overexpressing ABCE1 exhibited irregular morphology and increased levels of cytoskeletal polymerization as indicated by the immunofluorescence images. In contrast, cells expressing the Fe-S cluster deletion mutant presented opposing effects. Conclusion: These results demonstrate the indispensable role of Fe-S clusters when ABCE1 participates in the proliferation and migration of LUADs by interacting with β-actin. The Fe-S clusters of ABCE1 may be potential targets for the prevention of lung cancer metastasis.
Sustained Delivery of Chondroitinase ABC from Hydrogel System
Directory of Open Access Journals (Sweden)
Filippo Rossi
2012-03-01
Full Text Available In the injured spinal cord, chondroitin sulfate proteoglycans (CSPGs are the principal responsible of axon growth inhibition and they contribute to regenerative failure, promoting glial scar formation. Chondroitinase ABC (chABC is known for being able to digest proteoglycans, thus degrading glial scar and favoring axonal regrowth. However, its classic administration is invasive, infection-prone and clinically problematic. An agarose-carbomer (AC1 hydrogel, already used in SCI repair strategies, was here investigated as a delivery system capable of an effective chABC administration: the material ability to include chABC within its pores and the possibility to be injected into the target tissue were firstly proved. Subsequently, release kinetic and the maintenance of enzymatic activity were positively assessed: AC1 hydrogel was thus confirmed to be a feasible tool for chABC delivery and a promising device for spinal cord injury topic repair strategies.
Nonlinear Transport in Organic Thin Film Transistors with Soluble Small Molecule Semiconductor.
Kim, Hyeok; Song, Dong-Seok; Kwon, Jin-Hyuk; Jung, Ji-Hoon; Kim, Do-Kyung; Kim, SeonMin; Kang, In Man; Park, Jonghoo; Tae, Heung-Sik; Battaglini, Nicolas; Lang, Philippe; Horowitz, Gilles; Bae, Jin-Hyuk
2016-03-01
Nonlinear transport is intensively explained through Poole-Frenkel (PF) transport mechanism in organic thin film transistors with solution-processed small molecules, which is, 6,13-bis(triisopropylsilylethynyl) (TIPS) pentacene. We outline a detailed electrical study that identifies the source to drain field dependent mobility. Devices with diverse channel lengths enable the extensive exhibition of field dependent mobility due to thermal activation of carriers among traps.
International Nuclear Information System (INIS)
Bian, Tengfei; Autry, Joseph M.; Casemore, Denise; Li, Ji; Thomas, David D.; He, Gaohong; Xing, Chengguo
2016-01-01
We have developed a charge-mediated fusion method to reconstitute the sarco/endoplasmic reticulum Ca 2+ -ATPase (SERCA) in giant unilamellar vesicles (GUV). Intracellular Ca 2+ transport by SERCA controls key processes in human cells such as proliferation, signaling, and contraction. Small-molecule effectors of SERCA are urgently needed as therapeutics for Ca 2+ dysregulation in human diseases including cancer, diabetes, and heart failure. Here we report the development of a method for efficiently reconstituting SERCA in GUV, and we describe a streamlined protocol based on optimized parameters (e.g., lipid components, SERCA preparation, and activity assay requirements). ATP-dependent Ca 2+ transport by SERCA in single GUV was detected directly using confocal fluorescence microscopy with the Ca 2+ indicator Fluo-5F. The GUV reconstitution system was validated for functional screening of Ca 2+ transport using thapsigargin (TG), a small-molecule inhibitor of SERCA currently in clinical trials as a prostate cancer prodrug. The GUV system overcomes the problem of inhibitory Ca 2+ accumulation for SERCA in native and reconstituted small unilamellar vesicles (SUV). We propose that charge-mediated fusion provides a widely-applicable method for GUV reconstitution of clinically-important membrane transport proteins. We conclude that GUV reconstitution is a technological advancement for evaluating small-molecule effectors of SERCA.
Functional analysis of candidate ABC transporter proteins for sitosterol transport
DEFF Research Database (Denmark)
Albrecht, C; Elliott, J I; Sardini, A
2002-01-01
implicated in lipid movement and expressed in tissues with a role in sterol synthesis and absorption, might also be involved in sitosterol transport. Transport by the multidrug resistance P-glycoprotein (P-gp; Abcb1), the multidrug resistance-associated protein (Mrp1; Abcc1), the breast cancer resistance...
Spin-Dependent Transport through Chiral Molecules Studied by Spin-Dependent Electrochemistry
2016-01-01
Conspectus Molecular spintronics (spin + electronics), which aims to exploit both the spin degree of freedom and the electron charge in molecular devices, has recently received massive attention. Our recent experiments on molecular spintronics employ chiral molecules which have the unexpected property of acting as spin filters, by way of an effect we call “chiral-induced spin selectivity” (CISS). In this Account, we discuss new types of spin-dependent electrochemistry measurements and their use to probe the spin-dependent charge transport properties of nonmagnetic chiral conductive polymers and biomolecules, such as oligopeptides, L/D cysteine, cytochrome c, bacteriorhodopsin (bR), and oligopeptide-CdSe nanoparticles (NPs) hybrid structures. Spin-dependent electrochemical measurements were carried out by employing ferromagnetic electrodes modified with chiral molecules used as the working electrode. Redox probes were used either in solution or when directly attached to the ferromagnetic electrodes. During the electrochemical measurements, the ferromagnetic electrode was magnetized either with its magnetic moment pointing “UP” or “DOWN” using a permanent magnet (H = 0.5 T), placed underneath the chemically modified ferromagnetic electrodes. The spin polarization of the current was found to be in the range of 5–30%, even in the case of small chiral molecules. Chiral films of the l- and d-cysteine tethered with a redox-active dye, toludin blue O, show spin polarizarion that depends on the chirality. Because the nickel electrodes are susceptible to corrosion, we explored the effect of coating them with a thin gold overlayer. The effect of the gold layer on the spin polarization of the electrons ejected from the electrode was investigated. In addition, the role of the structure of the protein on the spin selective transport was also studied as a function of bias voltage and the effect of protein denaturation was revealed. In addition to
Dashboard Auditing of Activity-Based Costing (ABC)
Sorinel Capusneanu
2009-01-01
This article aims to define the dashboard auditing according to the specifics of Activity-Based Costing method (ABC). It describes the main objectives of dashboard auditing, the criteria that a dashboard auditor should meet and the step-by-step stages of the entire dashboard auditing process according to the Activity-Based Costing method (ABC).
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhaojing [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Xu, Yonghong [Institute of Ophthalmological Research, Department of Ophthalmology, Renmin Hospital of Wuhan University, 430060 Wuhan (China); Meng, Xiangning [School of Materials and Metallurgy, Northeastern University, Shenyang 110819 (China); Watari, Fumio [Department of Biomedical, Dental Materials and Engineering, Graduate School of Dental Medicine, Hokkaido University, Sapporo 060-8586 (Japan); Liu, Hudan, E-mail: hudanliu@hust.edu.cn [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China); Chen, Xiao, E-mail: mornsmile@yahoo.com [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, 430030 Wuhan (China)
2015-01-01
Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.
An ABC analysis for power generation project
Directory of Open Access Journals (Sweden)
Batool Hasani
2013-07-01
Full Text Available One of the primary concerns on performance measurement is to know how much a particular project cost. However, using traditional method on project-based products often leads to inappropriate results. In this paper, we re-examine this issue by comparing the cost of a power station construction project using ABC versus traditional method. The results of survey show that ABC method is capable of providing better estimates for overhead costs compared with traditional method. In other words, ABC method helps reduce some of the unnecessary overhead cost items and increase on some other cost components. This helps increase the relative efficiency of the system by reducing total cost of project.
Evidence of thermal transport anisotropy in stable glasses of vapor deposited organic molecules
Ràfols-Ribé, Joan; Dettori, Riccardo; Ferrando-Villalba, Pablo; Gonzalez-Silveira, Marta; Abad, Llibertat; Lopeandía, Aitor F.; Colombo, Luciano; Rodríguez-Viejo, Javier
2018-03-01
Vapor deposited organic glasses are currently in use in many optoelectronic devices. Their operation temperature is limited by the glass transition temperature of the organic layers and thermal management strategies become increasingly important to improve the lifetime of the device. Here we report the unusual finding that molecular orientation heavily influences heat flow propagation in glassy films of small molecule organic semiconductors. The thermal conductivity of vapor deposited thin-film semiconductor glasses is anisotropic and controlled by the deposition temperature. We compare our data with extensive molecular dynamics simulations to disentangle the role of density and molecular orientation on heat propagation. Simulations do support the view that thermal transport along the backbone of the organic molecule is strongly preferred with respect to the perpendicular direction. This is due to the anisotropy of the molecular interaction strength that limits the transport of atomic vibrations. This approach could be used in future developments to implement small molecule glassy films in thermoelectric or other organic electronic devices.
Pick-up, transport and release of a molecular cargo using a small-molecule robotic arm
Kassem, Salma; Lee, Alan T. L.; Leigh, David A.; Markevicius, Augustinas; Solà, Jordi
2016-02-01
Modern-day factory assembly lines often feature robots that pick up, reposition and connect components in a programmed manner. The idea of manipulating molecular fragments in a similar way has to date only been explored using biological building blocks (specifically DNA). Here, we report on a wholly artificial small-molecule robotic arm capable of selectively transporting a molecular cargo in either direction between two spatially distinct, chemically similar, sites on a molecular platform. The arm picks up/releases a 3-mercaptopropanehydrazide cargo by formation/breakage of a disulfide bond, while dynamic hydrazone chemistry controls the cargo binding to the platform. Transport is controlled by selectively inducing conformational and configurational changes within an embedded hydrazone rotary switch that steers the robotic arm. In a three-stage operation, 79-85% of 3-mercaptopropanehydrazide molecules are transported in either (chosen) direction between the two platform sites, without the cargo at any time fully dissociating from the machine nor exchanging with other molecules in the bulk.
Dashboard Auditing of Activity-Based Costing (ABC
Directory of Open Access Journals (Sweden)
Sorinel Capusneanu
2009-03-01
Full Text Available This article aims to define the dashboard auditing according to the specifics of Activity-Based Costing method (ABC. It describes the main objectives of dashboard auditing, the criteria that a dashboard auditor should meet and the step-by-step stages of the entire dashboard auditing process according to the Activity-Based Costing method (ABC.
Energy Technology Data Exchange (ETDEWEB)
Zucchi, Sara, E-mail: zucchi2@unisi.i [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Corsi, Ilaria [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy); Luckenbach, Till [UFZ - Helmholtz Centre for Environmental Research, Permoserstr. 15, D-04318 Leipzig (Germany); Bard, Shannon Mala [Environmental Programmes, Dalhousie University, 1355 Oxford Street, Life Science Centre, Room 820, Halifax, Nova Scotia, Canada B3H 4J1 (Canada); Regoli, Francesco [Department of Biochemistry, Biology and Genetics, Polytechnic University of Marches, Ancona (Italy); Focardi, Silvano [Department of Environmental Sciences ' G. Sarfatti' , University of Siena, Via Mattioli 4, 53100 Siena (Italy)
2010-08-15
Several ABC transporters have been characterized from many aquatic organisms, but no information is yet available for Antarctic fish. The aim of this work was to identify the expression of genes for ABC proteins in Trematomus bernacchii, a bioindicator species of the Southern Ocean. Partial cDNA sequences of ABCB1, ABCC1, ABCC2, ABCC4 and ABCC9 were cloned from liver. Using RACE technology, 3.5 and 2.2 kb contigs were obtained for ABCB1 and ABCC2. Considering the elevated natural bioavailability of cadmium at Terra Nova Bay, responsiveness of ABCB1 and ABCC2 to this element was investigated under laboratory conditions. ABCB1 and ABCC2 mRNA levels were approximately four-fold higher in Cd-exposed fish compared to the controls. Induction of ABCB1 protein was also found by western blot. This study provides the first identification of five ABC genes in the liver of an Antarctic key species, some of which may be involved in cellular detoxification. - The presence of five partial sequences showing homology with ABC transporters and the sensitivity of ABCB1 and ABCC2 toward cadmium were determined in the liver of T. bernacchii.
Mireku, S A; Sauer, M M; Glockshuber, R; Locher, K P
2017-10-30
Bacterial ABC importers catalyze the uptake of essential nutrients including transition metals and metal-containing co-factors. Recently, an IgG antibody targeting the external binding protein of the Staphylococcus aureus Mn(II) ABC importer was reported to inhibit transport activity and reduce bacterial cell growth. We here explored the possibility of using alpaca-derived nanobodies to inhibit the vitamin B12 transporter of Escherichia coli, BtuCD-F, as a model system by generating nanobodies against the periplasmic binding protein BtuF. We isolated six nanobodies that competed with B12 for binding to BtuF, with inhibition constants between 10 -6 and 10 -9 M. Kinetic characterization of the nanobody-BtuF interactions revealed dissociation half-lives between 1.6 and 6 minutes and fast association rates between 10 4 and 10 6 M -1 s -1 . For the tightest-binding nanobody, we observed a reduction of in vitro transport activity of BtuCD-F when an excess of nanobody over B12 was used. The structure of BtuF in complex with the most effective nanobody Nb9 revealed the molecular basis of its inhibitory function. The CDR3 loop of Nb9 reached into the substrate-binding pocket of BtuF, preventing both B12 binding and BtuCD-F complex formation. Our results suggest that nanobodies can mediate ABC importer inhibition, providing an opportunity for novel antibiotic strategies.
Directory of Open Access Journals (Sweden)
Teixeira Miguel C
2012-07-01
Full Text Available Abstract Background The understanding of the molecular basis of yeast tolerance to ethanol may guide the design of rational strategies to increase process performance in industrial alcoholic fermentations. A set of 21 genes encoding multidrug transporters from the ATP-Binding Cassette (ABC Superfamily and Major Facilitator Superfamily (MFS in S. cerevisiae were scrutinized for a role in ethanol stress resistance. Results A yeast multidrug resistance ABC transporter encoded by the PDR18 gene, proposed to play a role in the incorporation of ergosterol in the yeast plasma membrane, was found to confer resistance to growth inhibitory concentrations of ethanol. PDR18 expression was seen to contribute to decreased 3 H-ethanol intracellular concentrations and decreased plasma membrane permeabilization of yeast cells challenged with inhibitory ethanol concentrations. Given the increased tolerance to ethanol of cells expressing PDR18, the final concentration of ethanol produced during high gravity alcoholic fermentation by yeast cells devoid of PDR18 was lower than the final ethanol concentration produced by the corresponding parental strain. Moreover, an engineered yeast strain in which the PDR18 promoter was replaced in the genome by the stronger PDR5 promoter, leading to increased PDR18 mRNA levels during alcoholic fermentation, was able to attain a 6 % higher ethanol concentration and a 17 % higher ethanol production yield than the parental strain. The improved fermentative performance of yeast cells over-expressing PDR18 was found to correlate with their increased ethanol tolerance and ability to restrain plasma membrane permeabilization induced throughout high gravity fermentation. Conclusions PDR18 gene over-expression increases yeast ethanol tolerance and fermentation performance leading to the production of highly inhibitory concentrations of ethanol. PDR18 overexpression in industrial yeast strains appears to be a promising approach to
ABC/2 Method Does not Accurately Predict Cerebral Arteriovenous Malformation Volume.
Roark, Christopher; Vadlamudi, Venu; Chaudhary, Neeraj; Gemmete, Joseph J; Seinfeld, Joshua; Thompson, B Gregory; Pandey, Aditya S
2018-02-01
Stereotactic radiosurgery (SRS) is a treatment option for cerebral arteriovenous malformations (AVMs) to prevent intracranial hemorrhage. The decision to proceed with SRS is usually based on calculated nidal volume. Physicians commonly use the ABC/2 formula, based on digital subtraction angiography (DSA), when counseling patients for SRS. To determine whether AVM volume calculated using the ABC/2 method on DSA is accurate when compared to the exact volume calculated from thin-cut axial sections used for SRS planning. Retrospective search of neurovascular database to identify AVMs treated with SRS from 1995 to 2015. Maximum nidal diameters in orthogonal planes on DSA images were recorded to determine volume using ABC/2 formula. Nidal target volume was extracted from operative reports of SRS. Volumes were then compared using descriptive statistics and paired t-tests. Ninety intracranial AVMs were identified. Median volume was 4.96 cm3 [interquartile range (IQR) 1.79-8.85] with SRS planning methods and 6.07 cm3 (IQR 1.3-13.6) with ABC/2 methodology. Moderate correlation was seen between SRS and ABC/2 (r = 0.662; P ABC/2 (t = -3.2; P = .002). When AVMs were dichotomized based on ABC/2 volume, significant differences remained (t = 3.1, P = .003 for ABC/2 volume ABC/2 volume > 7 cm3). The ABC/2 method overestimates cerebral AVM volume when compared to volumetric analysis from SRS planning software. For AVMs > 7 cm3, the overestimation is even greater. SRS planning techniques were also significantly different than values derived from equations for cones and cylinders. Copyright © 2017 by the Congress of Neurological Surgeons
Electron-vibron coupling effects on electron transport via a single-molecule magnet
McCaskey, Alexander; Yamamoto, Yoh; Warnock, Michael; Burzurí, Enrique; van der Zant, Herre S. J.; Park, Kyungwha
2015-03-01
We investigate how the electron-vibron coupling influences electron transport via an anisotropic magnetic molecule, such as a single-molecule magnet (SMM) Fe4, by using a model Hamiltonian with parameter values obtained from density-functional theory (DFT). The magnetic anisotropy parameters, vibrational energies, and electron-vibron coupling strengths of the Fe4 are computed using DFT. A giant spin model is applied to the Fe4 with only two charge states, specifically a neutral state with a total spin S =5 and a singly charged state with S =9 /2 , which is consistent with our DFT result and experiments on Fe4 single-molecule transistors. In sequential electron tunneling, we find that the magnetic anisotropy gives rise to new features in the conductance peaks arising from vibrational excitations. In particular, the peak height shows a strong, unusual dependence on the direction as well as magnitude of applied B field. The magnetic anisotropy also introduces vibrational satellite peaks whose position and height are modified with the direction and magnitude of applied B field. Furthermore, when multiple vibrational modes with considerable electron-vibron coupling have energies close to one another, a low-bias current is suppressed, independently of gate voltage and applied B field, although that is not the case for a single mode with a similar electron-vibron coupling. In the former case, the conductance peaks reveal a stronger B -field dependence than in the latter case. The new features appear because the magnetic anisotropy barrier is of the same order of magnitude as the energies of vibrational modes with significant electron-vibron coupling. Our findings clearly show the interesting interplay between magnetic anisotropy and electron-vibron coupling in electron transport via the Fe4. Similar behavior can be observed in transport via other anisotropic magnetic molecules.
abc: An Extensible AspectJ Compiler
DEFF Research Database (Denmark)
Avgustinov, Pavel; Christensen, Aske Simon; Hendren, Laurie J.
2006-01-01
checking and code generation, as well as data flow and control flow analyses. The AspectBench Compiler (abc) is an implementation of such a workbench. The base version of abc implements the full AspectJ language. Its front end is built using the Polyglot framework, as a modular extension of the Java...... language. The use of Polyglot gives flexibility of syntax and type checking. The back end is built using the Soot framework, to give modular code generation and analyses. In this paper, we outline the design of abc, focusing mostly on how the design supports extensibility. We then provide a general...
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
INTEGRATING ABC AND EVA TO EVALUATE INVESTMENT DECISIONS
Directory of Open Access Journals (Sweden)
N. Chiadamrong
2017-12-01
Full Text Available The significance of investment is transparent in the world of competitive business. Traditional costing systems in which their emphasizes are for short term savings rather than long term benefits have shown some lacking in providing accurate and reliable cost data for the investment decisions. Activity-based Costing (ABC, which is developed to satisfy some of the weaknesses of the traditional costing systems, can provide valuable insights into the operating processes and come up with more accurate cost data. In this paper, ABC is used to provide significant information for investment decisions. Although, the ABC method provides accurate operating product costs, it does not identify which products are economic valued added creators and so contribute to companies’ wealth. This drawback can be overcome by applying Economic Value Added (EVA. The adoption of ABC and EVA can represent a considerable change in the managerial thinking and to corporate strategies and business performance.
Preconceptual ABC design definition and system configuration layout: Appendix A
International Nuclear Information System (INIS)
1995-03-01
The mission of the ABC system is to destroy as effectively as possible the fissile material inserted into the core without producing any new fissile material. The contents of this report are as follows: operating conditions for the steam-cycle ABC system; flow rates and component dimensions; drawings of the ABC layout; and impact of core design parameters on containment size
ABCs of Being Smart: S Is for Supporting
Foster, Joanne
2014-01-01
Joanne Foster's article "R We There Yet?" was first published in "Parenting for High Potential" ("PHP") in 2006, which became the springboard for the "ABCs of Being Smart" series of columns. At that time, Foster invited "PHP" readers to think about their own versions of the "ABCs of Being…
Transport through overlapping states in quantum dots and double dot molecules
International Nuclear Information System (INIS)
Berkovits, R.
2006-01-01
Full Text: We shall review the transport properties of interacting quantum dots with overlapping orbitals for which the orthodox Coulomb blockade picture no longer holds. We shall concentrate on he conductance through a serial double dot structure for which the inter-dot tunneling is stronger than the tunneling to the leads. When the dots are occupied by 1 or 3 electrons the usual Kondo peak is observed. For the case in which 2 electrons occupy the molecule a singlet is formed. Nevertheless, the conductance in that case has a constant non-zero value, and might even be equal to the maximum conductance of 2e 2 /h for certain values of the molecule parameters. We show that this is the result of the subtle interplay between the symmetric and anti-symmetric orbitals of the molecule caused by interactions and interference
A Compute Environment of ABC95 Array Computer Based on Multi-FPGA Chip
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
ABC95 array computer is a multi-function network's computer based on FPGA technology, The multi-function network supports processors conflict-free access data from memory and supports processors access data from processors based on enhanced MESH network.ABC95 instruction's system includes control instructions, scalar instructions, vectors instructions.Mostly net-work instructions are introduced.A programming environment of ABC95 array computer assemble language is designed.A programming environment of ABC95 array computer for VC++ is advanced.It includes load function of ABC95 array computer program and data, store function, run function and so on.Specially, The data type of ABC95 array computer conflict-free access is defined.The results show that these technologies can develop programmer of ABC95 array computer effectively.
Döring, Barbara; Petzinger, Ernst
2014-08-01
The historical phasing concept of drug metabolism and elimination was introduced to comprise the two phases of metabolism: phase I metabolism for oxidations, reductions and hydrolyses, and phase II metabolism for synthesis. With this concept, biological membrane barriers obstructing the accessibility of metabolism sites in the cells for drugs were not considered. The concept of two phases was extended to a concept of four phases when drug transporters were detected that guided drugs and drug metabolites in and out of the cells. In particular, water soluble or charged drugs are virtually not able to overcome the phospholipid membrane barrier. Drug transporters belong to two main clusters of transporter families: the solute carrier (SLC) families and the ATP binding cassette (ABC) carriers. The ABC transporters comprise seven families with about 20 carriers involved in drug transport. All of them operate as pumps at the expense of ATP splitting. Embedded in the former phase concept, the term "phase III" was introduced by Ishikawa in 1992 for drug export by ABC efflux pumps. SLC comprise 52 families, from which many carriers are drug uptake transporters. Later on, this uptake process was referred to as the "phase 0 transport" of drugs. Transporters for xenobiotics in man and animal are most expressed in liver, but they are also present in extra-hepatic tissues such as in the kidney, the adrenal gland and lung. This review deals with the function of drug carriers in various organs and their impact on drug metabolism and elimination.
Qi, Weiping; Ma, Xiaoli; He, Weiyi; Chen, Wei; Zou, Mingmin; Gurr, Geoff M; Vasseur, Liette; You, Minsheng
2016-09-27
ATP-binding cassette (ABC) transporters are one of the major transmembrane protein families found in all organisms and play important roles in transporting a variety of compounds across intra and extra cellular membranes. In some species, ABC transporters may be involved in the detoxification of substances such as insecticides. The diamondback moth, Plutella xylostella (L.), a destructive pest of cruciferous crops worldwide, is an important species to study as it is resistant to many types of insecticides as well as biological control Bacillus thuringiensis toxins. A total of 82 ABC genes were identified from our published P. xylostella genome, and grouped into eight subfamilies (ABCA-H) based on phylogenetic analysis. Genes of subfamilies ABCA, ABCC and ABCH were found to be expanded in P. xylostella compared with those in Bombyx mori, Manduca sexta, Heliconius melpomene, Danaus plexippus, Drosophila melanogaster, Tetranychus urticae and Homo sapiens. Phylogenetic analysis indicated that many of the ABC transporters in P. xylostella are orthologous to the well-studied ABC transporter genes in the seven other species. Transcriptome- and qRT-PCR-based analysis elucidated physiological effects of ABC gene expressions of P. xylostella which were developmental stage- and tissue-specific as well as being affected by whether or not the insects were from an insecticide-resistant strain. Two ABCC and one ABCA genes were preferentially expressed in midgut of the 4th-instar larvae of a susceptible strain (Fuzhou-S) suggesting their potential roles in metabolizing plant defensive chemicals. Most of the highly expressed genes in insecticide-resistant strains were also predominantly expressed in the tissues of Malpighian tubules and midgut. This is the most comprehensive study on identification, characterization and expression profiling of ABC transporter genes in P. xylostella to date. The diversified features and expression patterns of this gene family may be associated with
NRT2.4 and NRT2.5 Are Two Half-Size Transporters from the Chlamydomonas NRT2 Family
Directory of Open Access Journals (Sweden)
Jose Javier Higuera
2016-03-01
Full Text Available The NRT2 transporters mediate High Affinity Nitrate/NitriteTransport (HAN/NiT, which are essential for nitrogen acquisition from these inorganic forms. The NRT2 proteins are encoded by a multigene family in plants, and contain 12 transmembrane-spanning domains. Chlamydomonas reinhardtii has six NRT2, two of which (NRT2.5 and NRT2.4 are located in Chromosome III, in tandem head to tail. cDNAs for these genes were isolated and their sequence revealed that they correspond to half-size NRT2 transporters each containing six transmembrane domains. NRT2.5 has long N- and C- termini sequences without known homology. NRT2.4 also contains long termini sequences but smaller than NRT2.5. Expression of both studied genes occurred at a very low level, slightly in darkness, and was not modified by the N or C source. Silencing of NRT2.4 by specific artificial miRNA resulted in the inhibition of nitrite transport in the absence of other HANNiT (NRT2.1/NAR2 in the cell genetic background. Nitrite transport activity in the Hansenula polymorpha Δynt::URA3 Leu2 mutant was restored by expressing CrNRT2.4. These results indicate that half-size NRT2 transporters are present in photosynthetic organisms and that NRT2.4 is a HANiT.
ABC versus CAB for cardiopulmonary resuscitation: a prospective, randomized simulator-based trial.
Marsch, Stephan; Tschan, Franziska; Semmer, Norbert K; Zobrist, Roger; Hunziker, Patrick R; Hunziker, Sabina
2013-09-06
After years of advocating ABC (Airway-Breathing-Circulation), current guidelines of cardiopulmonary resuscitation (CPR) recommend CAB (Circulation-Airway-Breathing). This trial compared ABC with CAB as initial approach to CPR from the arrival of rescuers until the completion of the first resuscitation cycle. 108 teams, consisting of two physicians each, were randomized to receive a graphical display of either the ABC algorithm or the CAB algorithm. Subsequently teams had to treat a simulated cardiac arrest. Data analysis was performed using video recordings obtained during simulations. The primary endpoint was the time to completion of the first resuscitation cycle of 30 compressions and two ventilations. The time to execution of the first resuscitation measure was 32 ± 12 seconds in ABC teams and 25 ± 10 seconds in CAB teams (P = 0.002). 18/53 ABC teams (34%) and none of the 55 CAB teams (P = 0.006) applied more than the recommended two initial rescue breaths which caused a longer duration of the first cycle of 30 compressions and two ventilations in ABC teams (31 ± 13 vs.23 ± 6 sec; P = 0.001). Overall, the time to completion of the first resuscitation cycle was longer in ABC teams (63 ± 17 vs. 48 ± 10 sec; P ABC with an earlier start of CPR and a shorter time to completion of the first 30:2 resuscitation cycle. These findings endorse the change from ABC to CAB in international resuscitation guidelines.
International Nuclear Information System (INIS)
Zhang, Han; Rahman, Sadia; Li, Wen; Fu, Guoxing; Kaur, Parjit
2015-01-01
A novel domain, GATE (Glycine-loop And Transducer Element), is identified in the ABC protein DrrA. This domain shows sequence and structural conservation among close homologs of DrrA as well as distantly-related ABC proteins. Among the highly conserved residues in this domain are three glycines, G215, G221 and G231, of which G215 was found to be critical for stable expression of the DrrAB complex. Other conserved residues, including E201, G221, K227 and G231, were found to be critical for the catalytic and transport functions of the DrrAB transporter. Structural analysis of both the previously published crystal structure of the DrrA homolog MalK and the modeled structure of DrrA showed that G215 makes close contacts with residues in and around the Walker A motif, suggesting that these interactions may be critical for maintaining the integrity of the ATP binding pocket as well as the complex. It is also shown that G215A or K227R mutation diminishes some of the atomic interactions essential for ATP catalysis and overall transport function. Therefore, based on both the biochemical and structural analyses, it is proposed that the GATE domain, located outside of the previously identified ATP binding and hydrolysis motifs, is an additional element involved in ATP catalysis. - Highlights: • A novel domain ‘GATE’ is identified in the ABC protein DrrA. • GATE shows high sequence and structural conservation among diverse ABC proteins. • GATE is located outside of the previously studied ATP binding and hydrolysis motifs. • Conserved GATE residues are critical for stability of DrrAB and for ATP catalysis
Politseiniku lustlik ABC / Pekka Erelt
Erelt, Pekka, 1965-
1999-01-01
Politsei on välja andnud 'Politseiniku ABC', mis antakse igale politseinikule. Karikaturist Heiki Ernits on peaaegu igale taskuraamatu leheküljele joonistanud pildikese mundrimeestest kentsakates situatsioonides.
Optimization of Straight Cylindrical Turning Using Artificial Bee Colony (ABC) Algorithm
Prasanth, Rajanampalli Seshasai Srinivasa; Hans Raj, Kandikonda
2017-04-01
Artificial bee colony (ABC) algorithm, that mimics the intelligent foraging behavior of honey bees, is increasingly gaining acceptance in the field of process optimization, as it is capable of handling nonlinearity, complexity and uncertainty. Straight cylindrical turning is a complex and nonlinear machining process which involves the selection of appropriate cutting parameters that affect the quality of the workpiece. This paper presents the estimation of optimal cutting parameters of the straight cylindrical turning process using the ABC algorithm. The ABC algorithm is first tested on four benchmark problems of numerical optimization and its performance is compared with genetic algorithm (GA) and ant colony optimization (ACO) algorithm. Results indicate that, the rate of convergence of ABC algorithm is better than GA and ACO. Then, the ABC algorithm is used to predict optimal cutting parameters such as cutting speed, feed rate, depth of cut and tool nose radius to achieve good surface finish. Results indicate that, the ABC algorithm estimated a comparable surface finish when compared with real coded genetic algorithm and differential evolution algorithm.
Tanaka, Shiho; Endo, Haruka; Adegawa, Satomi; Iizuka, Ami; Imamura, Kazuhiro; Kikuta, Shingo; Sato, Ryoichi
2017-12-01
Because Bombyx mori ABC transporter C2 (BmABCC2) has 1000-fold higher potential than B. mori cadherin-like protein as a receptor for Bacillus thuringiensis Cry1Aa toxin (Tanaka et al., 2013), the gate-opening ability of the latent pore under six extracellular loops (ECLs) of BmABCC2 was expected to be the reason for its higher potential (Heckel, 2012). In this study, cell swelling assays in Sf9 cells showed that BmABCC2 mutants lacking substrate-excreting activity retained receptor activity, indicating that the gate-opening activity of BmABCC2 is not responsible for Cry1Aa toxicity. The analysis of 29 BmABCC2 mutants demonstrated that 770 DYWL 773 of ECL 4 comprise a putative binding site to Cry1Aa. This suggests that specific toxicity of Cry1Aa toxin to a restricted range of lepidopteran insects is dependent on conservation and variation in the amino acid residues around 770 DYWL 773 of ECL 4 in the ABCC2. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kawaguchi, Kosuke; Okamoto, Takumi; Morita, Masashi; Imanaka, Tsuneo
2016-07-26
We previously demonstrated that ABCD4 does not localize to peroxisomes but rather, the endoplasmic reticulum (ER), because it lacks the NH2-terminal hydrophilic region required for peroxisomal targeting. It was recently reported that mutations in ABCD4 result in a failure to release vitamin B12 from lysosomes. A similar phenotype is caused by mutations in LMBRD1, which encodes the lysosomal membrane protein LMBD1. These findings suggested to us that ABCD4 translocated from the ER to lysosomes in association with LMBD1. In this report, it is demonstrated that ABCD4 interacts with LMBD1 and then localizes to lysosomes, and this translocation depends on the lysosomal targeting ability of LMBD1. Furthermore, endogenous ABCD4 was localized to both lysosomes and the ER, and its lysosomal localization was disturbed by knockout of LMBRD1. To the best of our knowledge, this is the first report demonstrating that the subcellular localization of the ABC transporter is determined by its association with an adaptor protein.
Structure and mechanism of ATP-dependent phospholipid transporters
DEFF Research Database (Denmark)
Lopez Marques, Rosa Laura; Poulsen, Lisbeth Rosager; Bailly, Aurélien
2015-01-01
Background ATP-binding cassette (ABC) transporters and P4-ATPases are two large and seemingly unrelated families of primary active pumps involved in moving phospholipids from one leaflet of a biological membrane to the other. Scope of review This review aims to identify common mechanistic features...... in the way phospholipid flipping is carried out by two evolutionarily unrelated families of transporters. Major conclusions Both protein families hydrolyze ATP, although they employ different mechanisms to use it, and have a comparable size with twelve transmembrane segments in the functional unit. Further......, despite differences in overall architecture, both appear to operate by an alternating access mechanism and during transport they might allow access of phospholipids to the internal part of the transmembrane domain. The latter feature is obvious for ABC transporters, but phospholipids and other hydrophobic...
Application of activity-based costing (ABC) for a Peruvian NGO healthcare provider.
Waters, H; Abdallah, H; Santillán, D
2001-01-01
This article describes the application of activity-based costing (ABC) to calculate the unit costs of the services for a health care provider in Peru. While traditional costing allocates overhead and indirect costs in proportion to production volume or to direct costs, ABC assigns costs through activities within an organization. ABC uses personnel interviews to determine principal activities and the distribution of individual's time among these activities. Indirect costs are linked to services through time allocation and other tracing methods, and the result is a more accurate estimate of unit costs. The study concludes that applying ABC in a developing country setting is feasible, yielding results that are directly applicable to pricing and management. ABC determines costs for individual clinics, departments and services according to the activities that originate these costs, showing where an organization spends its money. With this information, it is possible to identify services that are generating extra revenue and those operating at a loss, and to calculate cross subsidies across services. ABC also highlights areas in the health care process where efficiency improvements are possible. Conclusions about the ultimate impact of the methodology are not drawn here, since the study was not repeated and changes in utilization patterns and the addition of new clinics affected applicability of the results. A potential constraint to implementing ABC is the availability and organization of cost information. Applying ABC efficiently requires information to be readily available, by cost category and department, since the greatest benefits of ABC come from frequent, systematic application of the methodology in order to monitor efficiency and provide feedback for management. The article concludes with a discussion of the potential applications of ABC in the health sector in developing countries.
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Javitt, Norman B
2013-01-01
Evidence is emerging that during the development of Alzheimer's disease (AD), changes in the synthesis and metabolism of cholesterol and progesterone are occurring that may or may not affect the progression of the disease. The concept arose from the recognition that dehydrocholesterol 24-reductase (DHCR24/Seladin-1), one of the nine enzymes in the endoplasmic reticulum that determines the transformation of lanosterol to cholesterol, is selectively reduced in late AD. As a consequence, the tissue level of desmosterol increases, affecting the expression of ABC transporters and the structure of lipid rafts, both determinants of amyloid-β processing. However, the former effect is considered beneficial and the latter detrimental to processing. Other determinants of desmosterol tissue levels are 24,25 epoxycholesterol and the ABCG1 and ABCG4 transporters. Progesterone and its metabolites are determinants of tissue levels of desmosterol and several other sterol intermediates in cholesterol synthesis. Animal models indicate marked elevations in the tissue levels of these sterols at early time frames in the progression of neurodegenerative diseases. The low level of neuroprogesterone and metabolites in AD are consonant with the low level of desmosterol and may have a role in amyloid-β processing. The sparse data that has accumulated appears to be a sufficient basis for proposing a systematic evaluation of the biologic roles of sterol intermediates in the slowly progressive neurodegeneration characteristic of AD.
The use of active breathing control (ABC) to reduce margin for breathing motion
International Nuclear Information System (INIS)
Wong, John W.; Sharpe, Michael B.; Jaffray, David A.; Kini, Vijay R.; Robertson, John M.; Stromberg, Jannifer S.; Martinez, Alavro A.
1999-01-01
Purpose: For tumors in the thorax and abdomen, reducing the treatment margin for organ motion due to breathing reduces the volume of normal tissues that will be irradiated. A higher dose can be delivered to the target, provided that the risk of marginal misses is not increased. To ensure safe margin reduction, we investigated the feasibility of using active breathing control (ABC) to temporarily immobilize the patient's breathing. Treatment planning and delivery can then be performed at identical ABC conditions with minimal margin for breathing motion. Methods and Materials: An ABC apparatus is constructed consisting of 2 pairs of flow monitor and scissor valve, 1 each to control the inspiration and expiration paths to the patient. The patient breathes through a mouth-piece connected to the ABC apparatus. The respiratory signal is processed continuously, using a personal computer that displays the changing lung volume in real-time. After the patient's breathing pattern becomes stable, the operator activates ABC at a preselected phase in the breathing cycle. Both valves are then closed to immobilize breathing motion. Breathing motion of 12 patients were held with ABC to examine their acceptance of the procedure. The feasibility of applying ABC for treatment was tested in 5 patients by acquiring volumetric scans with a spiral computed tomography (CT) scanner during active breath-hold. Two patients had Hodgkin's disease, 2 had metastatic liver cancer, and 1 had lung cancer. Two intrafraction ABC scans were acquired at the same respiratory phase near the end of normal or deep inspiration. An additional ABC scan near the end of normal expiration was acquired for 2 patients. The ABC scans were also repeated 1 week later for a Hodgkin's patient. In 1 liver patient, ABC scans were acquired at 7 different phases of the breathing cycle to facilitate examination of the liver motion associated with ventilation. Contours of the lungs and livers were outlined when applicable
Multidrug Resistance in Breast Cancer: From In Vitro Models to Clinical Studies
International Nuclear Information System (INIS)
Wind, N.S.; Holen, I.
2011-01-01
The development of multidrug resistance (MDR) and subsequent relapse on therapy is a widespread problem in breast cancer, but our understanding of the underlying molecular mechanisms is incomplete. Numerous studies have aimed to establish the role of drug transporter pumps in MDR and to link their expression to response to chemotherapy. The ATP-binding cassette (ABC) transporters are central to breast cancer MDR, and increases in ABC expression levels have been shown to correlate with decreases in response to various chemotherapy drugs and a reduction in overall survival. But as there is a large degree of redundancy between different ABC transporters, this correlation has not been seen in all studies. This paper provides an introduction to the key molecules associated with breast cancer MDR and summarises evidence of their potential roles reported from model systems and clinical studies. We provide possible explanations for why despite several decades of research, the precise role of ABC transporters in breast cancer MDR remains elusive
Anticipated Benefits of Care (ABC): psychometrics and predictive value in psychiatric disorders.
Warden, D; Trivedi, M H; Carmody, T J; Gollan, J K; Kashner, T M; Lind, L; Crismon, M L; Rush, A J
2010-06-01
Attitudes and expectations about treatment have been associated with symptomatic outcomes, adherence and utilization in patients with psychiatric disorders. No measure of patients' anticipated benefits of treatment on domains of everyday functioning has previously been available. The Anticipated Benefits of Care (ABC) is a new, 10-item questionnaire used to measure patient expectations about the impact of treatment on domains of everyday functioning. The ABC was collected at baseline in adult out-patients with major depressive disorder (MDD) (n=528), bipolar disorder (n=395) and schizophrenia (n=447) in the Texas Medication Algorithm Project (TMAP). Psychometric properties of the ABC were assessed, and the association of ABC scores with treatment response at 3 months was evaluated. Evaluation of the ABC's internal consistency yielded Cronbach's alpha of 0.90-0.92 for patients across disorders. Factor analysis showed that the ABC was unidimensional for all patients and for patients with each disorder. For patients with MDD, lower anticipated benefits of treatment was associated with less symptom improvement and lower odds of treatment response [odds ratio (OR) 0.72, 95% confidence interval (CI) 0.57-0.87, p=0.0011]. There was no association between ABC and symptom improvement or treatment response for patients with bipolar disorder or schizophrenia, possibly because these patients had modest benefits with treatment. The ABC is the first self-report that measures patient expectations about the benefits of treatment on everyday functioning, filling an important gap in available assessments of attitudes and expectations about treatment. The ABC is simple, easy to use, and has acceptable psychometric properties for use in research or clinical settings.
Object Detection Based on Template Matching through Use of Best-So-Far ABC
Directory of Open Access Journals (Sweden)
Anan Banharnsakun
2014-01-01
Full Text Available Best-so-far ABC is a modified version of the artificial bee colony (ABC algorithm used for optimization tasks. This algorithm is one of the swarm intelligence (SI algorithms proposed in recent literature, in which the results demonstrated that the best-so-far ABC can produce higher quality solutions with faster convergence than either the ordinary ABC or the current state-of-the-art ABC-based algorithm. In this work, we aim to apply the best-so-far ABC-based approach for object detection based on template matching by using the difference between the RGB level histograms corresponding to the target object and the template object as the objective function. Results confirm that the proposed method was successful in both detecting objects and optimizing the time used to reach the solution.
The ABC of handover: impact on shift handover in the emergency department.
Farhan, Maisse; Brown, Ruth; Vincent, Charles; Woloshynowych, Maria
2012-12-01
A study was undertaken to test the impact of a new tool for shift handover, 'The ABC of Handover', in the emergency department (ED). The impact on shift handover following implementation of this structured tool, the effect on clinical and organisational aspects of the subsequent shift and the opinions of users of this new tool are reported. A prospective observational before and after study was performed to explore the effect of implementing 'The ABC of Handover' on clinical and organisational practice using a questionnaire. 41 handovers were observed before implementation of 'The ABC of Handover' and 42 were observed after. The new tool was successfully implemented and resulted in a change of practice which led to a significant increase in the operational issues mentioned at handover from a mean of 34% to a mean of 86% of essential items with the ABC method. Over the study period, middle-grade staff demonstrated improved situational awareness as they adopted proactive management of operational issues such as staffing or equipment shortages. All participants reported that 'The ABC of Handover' improved handover regardless of the seniority of the doctor giving it, and found the ABC method easy to learn. Successful implementation of 'The ABC of Handover' led to a change of practice in the ED. Improving handover resulted in better organisation of the shift and heightened awareness of potential patient safety issues. The ABC method provides a framework for organising the shift and preparing for events in the subsequent shift.
Dark states in spin-polarized transport through triple quantum dot molecules
Wrześniewski, K.; Weymann, I.
2018-02-01
We study the spin-polarized transport through a triple-quantum-dot molecule weakly coupled to ferromagnetic leads. The analysis is performed by means of the real-time diagrammatic technique, including up to the second order of perturbation expansion with respect to the tunnel coupling. The emphasis is put on the impact of dark states on spin-resolved transport characteristics. It is shown that the interplay of coherent population trapping and cotunneling processes results in a highly nontrivial behavior of the tunnel magnetoresistance, which can take negative values. Moreover, a super-Poissonian shot noise is found in transport regimes where the current is blocked by the formation of dark states, which can be additionally enhanced by spin dependence of tunneling processes, depending on the magnetic configuration of the device. The mechanisms leading to those effects are thoroughly discussed.
International Nuclear Information System (INIS)
Metwally, S.M.; Prohl, G.
2005-01-01
One of the main pathways for transporting contaminants to other parts in the environment, are rivers. This work is devoted for deriving and assessment the concentration of soluble radio contaminants along a river at any time after discharge, including the short-lived radionuclides in comparison with the discharge time interval, and prolonged half-life of the produced daughter nuclei. The assumed boundary conditions and deduced formulas can be applied either in case of accidental release or discharge under authority control. The formulas determining the produced daughter nuclei concentration require inequality of the parent and daughter nuclei half-lives. Because of the regional variation of river morphology, the assumed constancy of the flow velocity and dispersion coefficient requires dividing the river path into zones of similar hydrologic characteristics
BEAM TRANSPORT AND STORAGE WITH COLD NEUTRAL ATOMS AND MOLECULES
Energy Technology Data Exchange (ETDEWEB)
Walstrom, Peter L. [Los Alamos National Laboratory
2012-05-15
A large class of cold neutral atoms and molecules is subject to magnetic field-gradient forces. In the presence of a field, hyperfine atomic states are split into several Zeeman levels. The slopes of these curves vs. field are the effective magnetic moments. By means of optical pumping in a field, Zeeman states of neutral lithium atoms and CaH molecules with effective magnetic moments of nearly {+-} one Bohr magneton can be selected. Particles in Zeeman states for which the energy increases with field are repelled by increasing fields; particles in states for which the energy decreases with field are attracted to increasing fields. For stable magnetic confinement, field-repelled states are required. Neutral-particle velocities in the present study are on the order of tens to hundreds of m/s and the magnetic fields needed for transport and injection are on the order of in the range of 0.01-1T. Many of the general concepts of charged-particle beam transport carry over into neutral particle spin-force optics, but with important differences. In general, the role of bending dipoles in charged particle optics is played by quadrupoles in neutral particle optics; the role of quadrupoles is played by sextupoles. The neutralparticle analog of charge-exchange injection into storage rings is the use of lasers to flip the state of particles from field-seeking to field-repelled. Preliminary tracking results for two neutral atom/molecule storage ring configurations are presented. It was found that orbit instabilities limit the confinment time in a racetrack-shaped ring with discrete magnetic elements with drift spaces between them; stable behavior was observed in a toroidal ring with a continuous sextupole field. An alternative concept using a linear sextupole or octupole channel with solenoids on the ends is presently being considered.
Carella, N. A.
2006-01-01
This note imparts heuristic arguments and theorectical evidences that contradict the abc conjecture over the rational numbers. In addition, the rudimentary datails for transforming this problem into the doimain of equidistribution theory are provided.
ABC optimized RBF network for classification of EEG signal for epileptic seizure identification
Directory of Open Access Journals (Sweden)
Sandeep Kumar Satapathy
2017-03-01
Full Text Available The brain signals usually generate certain electrical signals that can be recorded and analyzed for detection in several brain disorder diseases. These small signals are expressly called as Electroencephalogram (EEG signals. This research work analyzes the epileptic disorder in human brain through EEG signal analysis by integrating the best attributes of Artificial Bee Colony (ABC and radial basis function networks (RBFNNs. We have used Discrete Wavelet Transform (DWT technique for extraction of potential features from the signal. In our study, for classification of these signals, in this paper, the RBFNNs have been trained by a modified version of ABC algorithm. In the modified ABC, the onlooker bees are selected based on binary tournament unlike roulette wheel selection of ABC. Additionally, kernels such as Gaussian, Multi-quadric, and Inverse-multi-quadric are used for measuring the effectiveness of the method in numerous mixtures of healthy segments, seizure-free segments, and seizure segments. Our experimental outcomes confirm that RBFNN with inverse-multi-quadric kernel trained with modified ABC is significantly better than RBFNNs with other kernels trained by ABC and modified ABC.
Abrasive wear behavior of heat-treated ABC-silicon carbide
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xiao Feng; Lee, Gun Y.; Chen, Da; Ritchie, Robert O.; De Jonghe, Lutgard C.
2002-06-17
Hot-pressed silicon carbide, containing aluminum, boron, and carbon additives (ABC-SiC), was subjected to three-body and two-body wear testing using diamond abrasives over a range of sizes. In general, the wear resistance of ABC-SiC, with suitable heat treatment, was superior to that of commercial SiC.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2008-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone, but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). They inhibited the binding of [125I]-Iodoarylazidoprazosin (IAAP), a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC50 values of 7.3 and 22.6 μM, respectively, but had no effect on the binding of this photoaffinity analog to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of this transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared to the control cells, suggesting that they are substrates of this transporter. Collectively, these data demonstrate for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function. PMID:18065489
Directory of Open Access Journals (Sweden)
Ana Rita Otrelo-Cardoso
2014-01-01
Full Text Available The periplasmic aldehyde oxidoreductase PaoABC from Escherichia coli is a molybdenum enzyme involved in detoxification of aldehydes in the cell. It is an example of an αβγ heterotrimeric enzyme of the xanthine oxidase family of enzymes which does not dimerize via its molybdenum cofactor binding domain. In order to structurally characterize PaoABC, X-ray crystallography and small angle X-ray scattering (SAXS have been carried out. The protein crystallizes in the presence of 20% (w/v polyethylene glycol 3350 using the hanging-drop vapour diffusion method. Although crystals were initially twinned, several experiments were done to overcome twinning and lowering the crystallization temperature (293 K to 277 K was the solution to the problem. The non-twinned crystals used to solve the structure diffract X-rays to beyond 1.80 Å and belong to the C2 space group, with cell parameters a = 109.42 Å, b = 78.08 Å, c = 151.77 Å, β = 99.77°, and one molecule in the asymmetric unit. A molecular replacement solution was found for each subunit separately, using several proteins as search models. SAXS data of PaoABC were also collected showing that, in solution, the protein is also an αβγ heterotrimer.
Transport behavior of water molecules through two-dimensional nanopores
International Nuclear Information System (INIS)
Zhu, Chongqin; Li, Hui; Meng, Sheng
2014-01-01
Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules
Byun, Hyunjong; Park, Jiyeon; Kim, Sun Chang; Ahn, Jung Hoon
2017-12-01
Efficient protein production for industrial and academic purposes often involves engineering microorganisms to produce and secrete target proteins into the culture. Pseudomonas fluorescens has a TliDEF ATP-binding cassette transporter, a type I secretion system, which recognizes C-terminal LARD3 signal sequence of thermostable lipase TliA. Many proteins are secreted by TliDEF in vivo when recombined with LARD3, but there are still others that cannot be secreted by TliDEF even when LARD3 is attached. However, the factors that determine whether or not a recombinant protein can be secreted through TliDEF are still unknown. Here, we recombined LARD3 with several proteins and examined their secretion through TliDEF. We found that the proteins secreted via LARD3 are highly negatively charged with highly-acidic isoelectric points (pI) lower than 5.5. Attaching oligo-aspartate to lower the pI of negatively-charged recombinant proteins improved their secretion, and attaching oligo-arginine to negatively-charged proteins blocked their secretion by LARD3. In addition, negatively supercharged green fluorescent protein (GFP) showed improved secretion, whereas positively supercharged GFP did not secrete. These results disclosed that proteins' acidic pI and net negative charge are major factors that determine their secretion through TliDEF. Homology modeling for TliDEF revealed that TliD dimer forms evolutionarily-conserved positively-charged clusters in its pore and substrate entrance site, which also partially explains the pI dependence of the TliDEF-dependent secretions. In conclusion, lowering the isoelectric point improved LARD3-mediated protein secretion, both widening the range of protein targets for efficient production via secretion and signifying an important aspect of ABC transporter-mediated secretions. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
MetaABC--an integrated metagenomics platform for data adjustment, binning and clustering.
Su, Chien-Hao; Hsu, Ming-Tsung; Wang, Tse-Yi; Chiang, Sufeng; Cheng, Jen-Hao; Weng, Francis C; Kao, Cheng-Yan; Wang, Daryi; Tsai, Huai-Kuang
2011-08-15
MetaABC is a metagenomic platform that integrates several binning tools coupled with methods for removing artifacts, analyzing unassigned reads and controlling sampling biases. It allows users to arrive at a better interpretation via series of distinct combinations of analysis tools. After execution, MetaABC provides outputs in various visual formats such as tables, pie and bar charts as well as clustering result diagrams. MetaABC source code and documentation are available at http://bits2.iis.sinica.edu.tw/MetaABC/ CONTACT: dywang@gate.sinica.edu.tw; hktsai@iis.sinica.edu.tw Supplementary data are available at Bioinformatics online.
The role of ATP-binding cassette transporters in neuro-inflammation: relevance for bioactive lipids
Directory of Open Access Journals (Sweden)
Gijs eKooij
2012-04-01
Full Text Available ATP-binding cassette (ABC transporters are highly expressed by brain endothelial cells that form the blood-brain barrier (BBB. These efflux pumps play an important role in maintaining brain homeostasis as they actively hinder the entry of unwanted blood-derived compounds into the central nervous system (CNS. Consequently, their high activity at the BBB has been a major hurdle for the treatment of several brain diseases, as they prevent numerous drugs to reach their site of action within the brain. Importantly, recent data indicate that endogenous substrates for ABC transporters may include inflammatory mediators, such as prostaglandins, leukotrienes, cytokines, chemokines and bioactive lipids, suggesting a potential role for ABC transporters in immunological responses, and more specifically in inflammatory brain disorders, such as multiple sclerosis (MS. In this review, we will give a comprehensive overview of recent findings that illustrate this novel role for ABC transporters in neuro-inflammatory processes. Moreover, we will provide first insights into underlying mechanisms and focus on the importance for bioactive lipids, in particular platelet-activating factor (PAF, herein. A thorough understanding of these events may form the basis for the development for selective treatment modalities to dampen the neuro-inflammatory attack in MS and thereby reducing tissue damage.
Directory of Open Access Journals (Sweden)
Estelita Pereira Lima
2014-11-01
Full Text Available The role of ATP-binding cassette (ABC transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM. The best result in the series was obtained with the addition of verapamil (40 μM, which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.
Phase behavior of model ABC triblock copolymers
Chatterjee, Joon
The phase behavior of poly(isoprene-b-styrene- b-ethylene oxide) (ISO), a model ABC triblock copolymer has been studied. This class of materials exhibit self-assembly, forming a large array of ordered morphologies at length scales of 5-100 nm. The formation of stable three-dimensionally continuous network morphologies is of special interest in this study. Since these nanostructures considerably impact the material properties, fundamental knowledge for designing ABC systems have high technological importance for realizing applications in the areas of nanofabrication, nanoporous media, separation membranes, drug delivery and high surface area catalysts. A comprehensive framework was developed to describe the phase behavior of the ISO triblock copolymers at weak to intermediate segregation strengths spanning a wide range of composition. Phases were characterized through a combination of characterization techniques, including small angle x-ray scattering, dynamic mechanical spectroscopy, transmission electron microscopy, and birefringence measurements. Combined with previous investigations on ISO, six different stable ordered state symmetries have been identified: lamellae (LAM), Fddd orthorhombic network (O70), double gyroid (Q230), alternating gyroid (Q214), hexagonal (HEX), and body-centered cubic (BCC). The phase map was found to be somewhat asymmetric around the fI = fO isopleth. This work provides a guide for theoretical studies and gives insight into the intricate effects of various parameters on the self-assembly of ABC triblock copolymers. Experimental SAXS data evaluated with a simple scattering intensity model show that local mixing varies continuously across the phase map between states of two- and three-domain segregation. Strategies of blending homopolymers with ISO triblock copolymer were employed for studying the swelling properties of a lamellar state. Results demonstrate that lamellar domains swell or shrink depending upon the type of homopolymer that
Bera, Krishnendu; Rani, Priyanka; Kishor, Gaurav; Agarwal, Shikha; Kumar, Antresh; Singh, Durg Vijay
2017-09-20
ATP-Binding cassette (ABC) transporters play an extensive role in the translocation of diverse sets of biologically important molecules across membrane. EchnocandinB (antifungal) and EcdL protein of Aspergillus rugulosus are encoded by the same cluster of genes. Co-expression of EcdL and echinocandinB reflects tightly linked biological functions. EcdL belongs to Multidrug Resistance associated Protein (MRP) subfamily of ABC transporters with an extra transmembrane domain zero (TMD0). Complete structure of MRP subfamily comprising of TMD0 domain, at atomic resolution is not known. We hypothesized that the transportation of echonocandinB is mediated via EcdL protein. Henceforth, it is pertinent to know the topological arrangement of TMD0, with other domains of protein and its possible role in transportation of echinocandinB. Absence of effective template for TMD0 domain lead us to model by I-TASSER, further structure has been refined by multiple template modelling using homologous templates of remaining domains (TMD1, NBD1, TMD2, NBD2). The modelled structure has been validated for packing, folding and stereochemical properties. MD simulation for 0.1 μs has been carried out in the biphasic environment for refinement of modelled protein. Non-redundant structures have been excavated by clustering of MD trajectory. The structural alignment of modelled structure has shown Z-score -37.9; 31.6, 31.5 with RMSD; 2.4, 4.2, 4.8 with ABC transporters; PDB ID 4F4C, 4M1 M, 4M2T, respectively, reflecting the correctness of structure. EchinocandinB has been docked to the modelled as well as to the clustered structures, which reveals interaction of echinocandinB with TMD0 and other TM helices in the translocation path build of TMDs.
Electron transport through a diatomic molecule
International Nuclear Information System (INIS)
Imran, Muhammad
2014-01-01
Electron transport through a diatomic molecular tunnel junction shows wave like interference phenomenon. By using Keldysh non-equilibrium Green's function (NEGF) theory, we have explicitly presented current and differential conductance calculation for a diatomic molecular and two isolated atoms (two atoms having zero hybridization between their energy orbitals) tunnel junctions. In case of a diatomic molecular tunnel junction, Green's function propagators entering into current and differential conductance formula interfere constructively for a molecular anti-bonding state and destructively for bonding state. Consequently, conductance through a molecular bonding state is suppressed, and to conserve current, conductance through anti-bonding state is enhanced. Therefore, current steps and differential conductance peaks amplitude show asymmetric correspondence between molecular bonding and anti-bonding states. Interestingly, for a diatomic molecule, comprising of two atoms of same energy level, these propagators interfere completely destructively for molecular bonding state and constructively for molecular anti-bonding state. Hence under such condition, a single step or a single peak is shown up in current versus voltage or differential conductance versus voltage studies.
abc: The AspectBench Compiler for AspectJ
DEFF Research Database (Denmark)
Allan, Chris; Avgustinov, Pavel; Christensen, Aske Simon
2005-01-01
abc is an extensible, optimising compiler for AspectJ. It has been designed as a workbench for experimental research in aspect-oriented programming languages and compilers. We outline a programme of research in these areas, and we review how abc can help in achieving those research goals...
Dashboard auditing of ABC (Activity-Based Costing). Theoretical approaches
Căpuşneanu, Sorinel/I
2009-01-01
This article aims to define the dashboard auditing according to the specifics of Activity-Based Costing method (ABC). It describes the main objectives of dashboard auditing, the criteria that a dashboard auditor should meet and the step-by-step stages of the entire dashboard auditing process of an enterprise from steel industry according to the Activity-Based Costing method (ABC).
Second-order nonlinear optical metamaterials: ABC-type nanolaminates
International Nuclear Information System (INIS)
Alloatti, L.; Kieninger, C.; Lauermann, M.; Köhnle, K.; Froelich, A.; Wegener, M.; Frenzel, T.; Freude, W.; Leuthold, J.; Koos, C.
2015-01-01
We demonstrate a concept for second-order nonlinear metamaterials that can be obtained from non-metallic centrosymmetric constituents with inherently low optical absorption. The concept is based on iterative atomic-layer deposition of three different materials, A = Al 2 O 3 , B = TiO 2 , and C = HfO 2 . The centrosymmetry of the resulting ABC stack is broken since the ABC and the inverted CBA sequences are not equivalent—a necessary condition for non-zero second-order nonlinearity. In our experiments, we find that the bulk second-order nonlinear susceptibility depends on the density of interfaces, leading to a nonlinear susceptibility of 0.26 pm/V at a wavelength of 800 nm. ABC-type nanolaminates can be deposited on virtually any substrate and offer a promising route towards engineering of second-order optical nonlinearities at both infrared and visible wavelengths
Spin-polarized transport through single-molecule magnet Mn6 complexes
Cremades, Eduard; Pemmaraju, C. D.; Sanvito, Stefano; Ruiz, Eliseo
2013-01-01
The coherent transport properties of a device, constructed by sandwiching a Mn6 single-molecule magnet between two gold surfaces, are studied theoretically by using the non-equilibrium Green's function approach combined with density functional theory. Two spin states of such Mn6 complexes are explored, namely the ferromagnetically coupled configuration of the six MnIII cations, leading to the S = 12 ground state, and the low S = 4 spin state. For voltages up to 1 volt the S = 12 ground state shows a current one order of magnitude larger than that of the S = 4 state. Furthermore this is almost completely spin-polarized, since the Mn6 frontier molecular orbitals for S = 12 belong to the same spin manifold. As such the high-anisotropy Mn6 molecule appears as a promising candidate for implementing, at the single molecular level, both spin-switches and low-temperature spin-valves. © 2013 The Royal Society of Chemistry.
Spin-polarized transport through single-molecule magnet Mn6 complexes
Cremades, Eduard
2013-01-01
The coherent transport properties of a device, constructed by sandwiching a Mn6 single-molecule magnet between two gold surfaces, are studied theoretically by using the non-equilibrium Green\\'s function approach combined with density functional theory. Two spin states of such Mn6 complexes are explored, namely the ferromagnetically coupled configuration of the six MnIII cations, leading to the S = 12 ground state, and the low S = 4 spin state. For voltages up to 1 volt the S = 12 ground state shows a current one order of magnitude larger than that of the S = 4 state. Furthermore this is almost completely spin-polarized, since the Mn6 frontier molecular orbitals for S = 12 belong to the same spin manifold. As such the high-anisotropy Mn6 molecule appears as a promising candidate for implementing, at the single molecular level, both spin-switches and low-temperature spin-valves. © 2013 The Royal Society of Chemistry.
Electron transport in disordered films of metal nanoparticles linked by organic molecules
International Nuclear Information System (INIS)
Mueller, K.H.; Wei, G.; Herrmann, J.; Raguse, B.; Baxter, G.
2004-01-01
Full text: We have investigated theoretically and experimentally the mechanism of electron transport in films made of ∼10 nm sized gold nanoparticles linked by alkanedithiol molecules. Conduction in these films is due to linker-molecule assisted single-electron tunnelling between neighbouring nanoparticles where electrons have to overcome the Coulomb blockade energy. Strong disorder in our films in the form of separation gap fluctuations between adjacent nanoparticles and variations in Coulomb blockade energies cause electron current percolation. We have found that the dependence of the conduction on the length of the alkanedithiol molecules is affected by the degree of disorder. In addition, we have observed that percolation leads to a non-Arrhenius-like temperature dependence of the conduction and to a film-thickness dependent conductivity. I-V characteristics at low temperatures reveal Coulomb blockade effects. The strong dependence of the electrical conduction on the separation gaps between adjacent nanoparticles can be utilized in strain gauge and gas sensor applications
Energy Technology Data Exchange (ETDEWEB)
Secker, Daniel
2008-06-03
The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)
Fungal ABC Transporter Deletion and Localization Analysis
Kovalchuk, A.; Weber, S.S.; Nijland, J.G.; Bovenberg, R.A.L.; Driessen, A.J.M.
2012-01-01
Fungal cells are highly complex as their metabolism is compartmentalized harboring various types of subcellular organelles that are bordered by one or more membranes. Knowledge about the intracellular localization of transporter proteins is often required for the understanding of their biological
SU-E-T-401: Feasibility Study of Using ABC to Gate Lung SBRT Treatment
International Nuclear Information System (INIS)
Cao, D; Xie, X; Shepard, D
2014-01-01
Purpose: The current SBRT treatment techniques include free breathing (FB) SBRT and gated FB SBRT. Gated FB SBRT has smaller target and less lung toxicity with longer treatment time. The recent development of direct connectivity between the ABC and linac allowing for automated beam gating. In this study, we have examined the feasibility of using ABC system to gate the lung SBRT treatment. Methods: A CIRS lung phantom with a 3cm sphere-insert and a moving chest plate was used in this study. Sinusoidal motion was used for the FB pattern. An ABC signal was imported to simulate breath holds. 4D-CT was taken in FB mode and average-intensity-projection (AIP) was used to create FB and 50% gated FB SBRT planning CT. A manually gated 3D CT scan was acquired for ABC gated SBRT planning.An SBRT plan was created for each treatment option. A surface-mapping system was used for 50% gating and ABC system was used for ABC gating. A manually gated CBCT scan was also performed to verify setup. Results: Among three options, the ABC gated plan has the smallest PTV of 35.94cc, which is 35% smaller comparing to that of the FB plan. Consequently, the V20 of the left lung reduced by 15% and 23% comparing to the 50% gated FB and FB plans, respectively. The FB plan took 4.7 minutes to deliver, while the 50% gated FB plan took 18.5 minutes. The ABC gated plan delivery took only 10.6 minutes. A stationary target with 3cm diameter was also obtained from the manually gated CBCT scan. Conclusion: A strategy for ABC gated lung SBRT was developed. ABC gating can significantly reduce the lung toxicity while maintaining the target coverage. Comparing to the 50% gated FB SBRT, ABC gated treatment can also provide less lung toxicity as well as improved delivery efficiency. This research is funded by Elekta
Creating an iPhone Application for Collecting Continuous ABC Data
Whiting, Seth W.; Dixon, Mark R.
2012-01-01
This paper provides an overview and task analysis for creating a continuous ABC data- collection application using Xcode on a Mac computer. Behavior analysts can program an ABC data collection system, complete with a customized list of target clients, antecedents, behaviors, and consequences to be recorded, and have the data automatically sent to…
Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan
2017-01-01
Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.
Takahashi, Toyomi
2004-07-01
After single intradiscal injection of C-ABC in rabbit inter-vertebral discs, water content in the matrix of nucleus pulposus diminished clearly. After similar injection of C-ABC in sheep discs, disc inner pressure was diminished. After single intradiscal injection of C-ABC in dog inter-vertebral discs suffering disc herniation, the syndromes coming from the herniation diminished or disappeared. Based on these observations C-ABC is expected to be a chemonucleolytic agent and a human clinical trial is now in progress.
Microarray analysis of genes affected by salt stress in tomato
African Journals Online (AJOL)
LANDA
isoforms of cytochrome P450, genes for polyamine biosynthesis (putrescine and proline) ..... CAB97048 mitochondrial half-ABC transporter [Arabidopsis thaliana] up .... AAC72194 pyruvate dehydrogenase E1 beta subunit isoform 3 [Zea mays].
Anger and the ABC model underlying Rational-Emotive Behavior Therapy.
Ziegler, Daniel J; Smith, Phillip N
2004-06-01
The ABC model underlying Ellis's Rational-Emotive Behavior Therapy predicts that people who think more irrationally should display greater trait anger than do people who think less irrationally. This study tested this prediction regarding the ABC model. 186 college students were administered the Survey of Personal Beliefs and the State-Trait Anger Expression Inventory-Second Edition to measure irrational thinking and trait anger, respectively. Students who scored higher on Overall Irrational Thinking and Low Frustration Tolerance scored significantly higher on Trait Anger than did those who scored lower on Overall Irrational Thinking and Low Frustration Tolerance. This indicates support for the ABC model, especially Ellis's construct of irrational beliefs which is central to the model.
Lee, Po-Hsien; Kuo, Kuei-Ling; Chu, Pei-Ying; Liu, Eric M; Lin, Jung-Hsin
2009-07-01
Many proteins use a long channel to guide the substrate or ligand molecules into the well-defined active sites for catalytic reactions or for switching molecular states. In addition, substrates of membrane transporters can migrate to another side of cellular compartment by means of certain selective mechanisms. SLITHER (http://bioinfo.mc.ntu.edu.tw/slither/or http://slither.rcas.sinica.edu.tw/) is a web server that can generate contiguous conformations of a molecule along a curved tunnel inside a protein, and the binding free energy profile along the predicted channel pathway. SLITHER adopts an iterative docking scheme, which combines with a puddle-skimming procedure, i.e. repeatedly elevating the potential energies of the identified global minima, thereby determines the contiguous binding modes of substrates inside the protein. In contrast to some programs that are widely used to determine the geometric dimensions in the ion channels, SLITHER can be applied to predict whether a substrate molecule can crawl through an inner channel or a half-channel of proteins across surmountable energy barriers. Besides, SLITHER also provides the list of the pore-facing residues, which can be directly compared with many genetic diseases. Finally, the adjacent binding poses determined by SLITHER can also be used for fragment-based drug design.
Dahl, Jonas; Porelius, Jesper
2006-01-01
Background: Companies of today commonly search to gain competitive advantages throughout different forms of co-operation, one of which is referred to as Supply Chain Management. Although little research has been assigned to the topic of how to manage and control this type of relation, lately a growing number of academics has been arguing that ABC is an appropriate mean of controlling this type of relationships. Purpose: The purpose of this thesis is to investigate to what degree the ongoing d...
Phylodynamic Inference with Kernel ABC and Its Application to HIV Epidemiology.
Poon, Art F Y
2015-09-01
The shapes of phylogenetic trees relating virus populations are determined by the adaptation of viruses within each host, and by the transmission of viruses among hosts. Phylodynamic inference attempts to reverse this flow of information, estimating parameters of these processes from the shape of a virus phylogeny reconstructed from a sample of genetic sequences from the epidemic. A key challenge to phylodynamic inference is quantifying the similarity between two trees in an efficient and comprehensive way. In this study, I demonstrate that a new distance measure, based on a subset tree kernel function from computational linguistics, confers a significant improvement over previous measures of tree shape for classifying trees generated under different epidemiological scenarios. Next, I incorporate this kernel-based distance measure into an approximate Bayesian computation (ABC) framework for phylodynamic inference. ABC bypasses the need for an analytical solution of model likelihood, as it only requires the ability to simulate data from the model. I validate this "kernel-ABC" method for phylodynamic inference by estimating parameters from data simulated under a simple epidemiological model. Results indicate that kernel-ABC attained greater accuracy for parameters associated with virus transmission than leading software on the same data sets. Finally, I apply the kernel-ABC framework to study a recent outbreak of a recombinant HIV subtype in China. Kernel-ABC provides a versatile framework for phylodynamic inference because it can fit a broader range of models than methods that rely on the computation of exact likelihoods. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
sphingosine-1-phosphate transport and its role in immunology
Reitsema, V.; Bouma, Hjalmar; Kok, Jan
2014-01-01
Sphingosine-1-phosphate (S1P) is a sphingolipid metabolite with many important functions in cellular and systemic physiology, including the immune system. As it cannot traverse the membrane, it is exported from cells by transporters. Several members of the ATP-binding cassette (ABC) transporter
Step 2: Know Your Diabetes ABCs
... please turn JavaScript on. Feature: Type 2 Diabetes Step 2: Know Your Diabetes ABCs Past Issues / Fall ... 2 Diabetes" Articles Diabetes Is Serious But Manageable / Step 1: Learn About Diabetes / Step 2: Know Your ...
Shahaboddin, Mohammad Esmaeil; Khajeh, Khosro; Maleki, Monireh; Golestani, Abolfazl
2017-10-01
Chondroitinase ABC I (ChABC I) has been shown to depolymerize a variety of glycosaminoglycan substrates and promote regeneration of damaged spinal cord. However, to date, intrathecal delivery methods have been suboptimal largely due to enzyme instability which necessitates repeated administration to the injured loci. Among the aromatic amino acids, tyrosine has been shown to be more effective in creation of stable clusters and further stabilize of the proteins. Bioinformatics approaches have been used to examine the effect of an extra aromatic cluster at the surface of ChABC I. In this study two amino acids i.e., Asn 806 and Gln 810 were mutated to tyrosine and to alanine as negative control. In this way, four variants i.e., N806Y/Q810Y, N806A/Q810Y, N806Y/Q810A and N806A/Q810A were created. The results showed that N806Y/Q810Y mutation improved both activity and thermal stability of the enzyme while Ala substitution reduced the enzyme activity and destabilized it. Structural analysis of mutants showed an increase in intrinsic fluorescence intensity and secondary structure content of N806Y/Q810Y mutant when compared to the wild type enzyme indicating a more rigid structure of this variant. Moreover, the N806Y/Q810Y enzyme displayed a remarkable resistance against trypsin degradation with a half-life (t 1/2 ) of 45.0min versus 32.5min of wild-type. In conclusion, the data revealed that structural features and activity of ChABC I can be improved by introducing appropriate aromatic clusters at the surface of the enzyme. Copyright © 2017 Elsevier Inc. All rights reserved.
Theoretical Investigations Regarding Single Molecules
DEFF Research Database (Denmark)
Pedersen, Kim Georg Lind
Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...
The ABCs of Student Engagement
Parsons, Seth A.; Nuland, Leila Richey; Parsons, Allison Ward
2014-01-01
Student engagement is an important consideration for teachers and administrators because it is explicitly associated with achievement. What the authors call the ABC's of engagement they outline as: Affective engagement, Behavioral engagement, and Cognitive engagement. They also present "Three Things Every Teacher Needs to Know about…
Molecular mechanism of α-tocopheryl-phosphate transport across the cell membrane
International Nuclear Information System (INIS)
Negis, Yesim; Meydani, Mohsen; Zingg, Jean-Marc; Azzi, Angelo
2007-01-01
α-Tocopheryl-phosphate (α-TP) is synthesized and hydrolyzed in animal cells and tissues where it modulates several functions. α-TP is more potent than α-T in inhibiting cell proliferation, down-regulating CD36 transcription, inhibiting atherosclerotic plaque formation. Administration of α-TP to cells or animals requires its transfer through membranes, via a transporter. We show here that α-TP is passing the plasma membrane via a system that is inhibited by glibenclamide and probenecid, inhibitors of a number of transporters. Glibenclamide and probenecid prevent dose-dependently α-TP inhibition of cell proliferation. The two inhibitors act on ATP binding cassette (ABC) and organic anion transporters (OAT). Since ABC transporters function to export solutes and α-TP is transported into cells, it may be concluded that α-TP transport may occur via an OAT family member. Due to the protection by glibenclamide and probenecid on the α-TP induced cell growth inhibition it appears that α-TP acts after its uptake inside cells
Impact of Anchoring Groups on Ballistic Transport: Single Molecule vs Monolayer Junctions
2015-01-01
Tuning the transport properties of molecular junctions by chemically modifying the molecular structure is one of the key challenges for advancing the field of molecular electronics. In the present contribution, we investigate current–voltage characteristics of differently linked metal–molecule–metal systems that comprise either a single molecule or a molecular assembly. This is achieved by employing density functional theory in conjunction with a Green’s function approach. We show that the conductance of a molecular system with a specific anchoring group is fundamentally different depending on whether a single molecule or a continuous monolayer forms the junction. This is a consequence of collective electrostatic effects that arise from dipolar elements contained in the monolayer and from interfacial charge rearrangements. As a consequence of these collective effects, the “ideal” choice for an anchoring group is clearly different for monolayer and single molecule devices. A particularly striking effect is observed for pyridine-docked systems. These are subject to Fermi-level pinning at high molecular packing densities, causing an abrupt increase of the junction current already at small voltages. PMID:26401191
Correlation and symmetry effects in transport through an artificial molecule
Energy Technology Data Exchange (ETDEWEB)
Ramirez, F. [Posgrado en Fisica de Materiales, Centro de Investigacion Cientifica y de Educacion Superior de Ensenada, Ensenada, Baja California (Mexico); Cota, E. [Centro de Ciencias de la Materia Condensada-UNAM, Ensenada, Baja California (Mexico); Ulloa, S.E. [Department of Physics and Astronomy and Condensed Matter and Surface Sciences Program, Ohio University, Athens, Ohio 45701-2979 (United States)
1999-02-01
Spectral weights and current-voltage characteristics of an artificial diatomic molecule are calculated, considering cases where the dots connected in series are in general different. The spectral weights allow us to understand the effects of correlations, their connection with selection rules for transport, and the role of excited states in the experimental conductance spectra of these coupled double dot systems (DDS). An extended Hubbard Hamiltonian with varying interdot tunneling strength is used as a model, incorporating quantum confinement in the DDS, interdot tunneling as well as intra- and interdot Coulomb interactions. We find that interdot tunneling values determine to a great extent the resulting eigenstates and corresponding spectral weights. Details of the state correlations strongly suppress most of the possible conduction channels, giving rise to effective selection rules for conductance through the molecule. Most states are found to make insignificant contributions to the total current for finite biases. We find also that the symmetry of the structure is reflected in the I-V characteristics, and is in qualitative agreement with experiment. {copyright} {ital 1999} {ital The American Physical Society}
Parents' Perspectives on Braille Literacy: Results from the ABC Braille Study
Kamei-Hannan, Cheryl; Sacks, Sharon Zell
2012-01-01
Introduction: Parents who were the primary caretakers of children in the Alphabetic and Contracted Braille Study (ABC Braille Study) revealed their perspectives about braille literacy. Methods: A 30-item questionnaire was constructed by the ABC Braille research team, and researchers conducted telephone interviews with 31 parents who were the…
ABC model and the management of costs
Directory of Open Access Journals (Sweden)
Pravdić Predrag
2016-01-01
Full Text Available When a company has multiple objectives at the same time, they all must be considered and balanced when making any business decisions. Linking the markets, capital and resources so as to thus ensure the highest yield is, In fact, the search for competitive advantage as a basic condition for survival in a market economy. In highly detailed systems based on the management of costs or ABC (activity based costing systems, the cost of activities often result in erroneous evaluation of aggregate costs of the action. Improvements in information technology and monitoring decrease of technology costs enabled the ABC system to become a feasible system calculating costs in many organizations.
ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.
Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J
2016-03-22
Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.
Single Molecule Electronics and Devices
Tsutsui, Makusu; Taniguchi, Masateru
2012-01-01
The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345
Biron, Lauren
2016-01-01
For lovers of rhymes and anthropomorphic Higgs bosons, Symmetry presents its first published board book, The ABCs of Particle Physics. Use it as an illustrated guide to basic particle- and astrophysics terms, or read it to your infant at bedtime, if you don’t mind their first word being “quark.”
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
Fano effect in the transport of an artificial molecule
Norimoto, Shota; Nakamura, Shuji; Okazaki, Yuma; Arakawa, Tomonori; Asano, Kenichi; Onomitsu, Koji; Kobayashi, Kensuke; Kaneko, Nobu-hisa
2018-05-01
The Fano effect is a ubiquitous phenomenon arising from interference between a discrete energy state and an energy continuum. We explore this effect in an artificial molecule, namely, two lateral quantum dots (QDs) fabricated from a two-dimensional electron gas system and coupled in series. When the coupling between the leads and QDs is small, the charge stability diagram of the system shows a honeycomb lattice structure that is characteristic of a double QD system. As the coupling increases, a honeycomb structure consisting of the Fano resonances emerges. A numerical simulation based on the T-matrix method can satisfactorily reproduce our experimental observation. This report constitutes a clear example of the ubiquitous nature of the Fano effect in mesoscopic transport.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
Volume-Dependent Overestimation of Spontaneous Intracerebral Hematoma Volume by the ABC/2 Formula
International Nuclear Information System (INIS)
Chih-Wei Wang; Chun-Jung Juan; Hsian-He Hsu; Hua-Shan Liu; Cheng-Yu Chen; Chun-Jen Hsueh; Hung-Wen Kao; Guo-Shu Huang; Yi-Jui Liu; Chung-Ping Lo
2009-01-01
Background: Although the ABC/2 formula has been widely used to estimate the volume of intracerebral hematoma (ICH), the formula tends to overestimate hematoma volume. The volume-related imprecision of the ABC/2 formula has not been documented quantitatively. Purpose: To investigate the volume-dependent overestimation of the ABC/2 formula by comparing it with computer-assisted volumetric analysis (CAVA). Material and Methods: Forty patients who had suffered spontaneous ICH and who had undergone non-enhanced brain computed tomography scans were enrolled in this study. The ICH volume was estimated based on the ABC/2 formula and also calculated by CAVA. Based on the ICH volume calculated by the CAVA method, the patients were divided into three groups: group 1 consisted of 17 patients with an ICH volume of less than 20 ml; group 2 comprised 13 patients with an ICH volume of 20 to 40 ml; and group 3 was composed of 10 patients with an ICH volume larger than 40 ml. Results: The mean estimated hematoma volume was 43.6 ml when using the ABC/2 formula, compared with 33.8 ml when using the CAVA method. The mean estimated difference was 1.3 ml, 4.4 ml, and 31.4 ml for groups 1, 2, and 3, respectively, corresponding to an estimation error of 9.9%, 16.7%, and 37.1% by the ABC/2 formula (P<0.05). Conclusion: The ABC/2 formula significantly overestimates the volume of ICH. A positive association between the estimation error and the volume of ICH is demonstrated
Rajabi, A; Dabiri, A
2012-01-01
Activity Based Costing (ABC) is one of the new methods began appearing as a costing methodology in the 1990's. It calculates cost price by determining the usage of resources. In this study, ABC method was used for calculating cost price of remedial services in hospitals. To apply ABC method, Shahid Faghihi Hospital was selected. First, hospital units were divided into three main departments: administrative, diagnostic, and hospitalized. Second, activity centers were defined by the activity analysis method. Third, costs of administrative activity centers were allocated into diagnostic and operational departments based on the cost driver. Finally, with regard to the usage of cost objectives from services of activity centers, the cost price of medical services was calculated. The cost price from ABC method significantly differs from tariff method. In addition, high amount of indirect costs in the hospital indicates that capacities of resources are not used properly. Cost price of remedial services with tariff method is not properly calculated when compared with ABC method. ABC calculates cost price by applying suitable mechanisms but tariff method is based on the fixed price. In addition, ABC represents useful information about the amount and combination of cost price services.
Cheung, Leanna; Flemming, Claudia L; Watt, Fujiko; Masada, Nanako; Yu, Denise M T; Huynh, Tony; Conseil, Gwenaëlle; Tivnan, Amanda; Polinsky, Alexander; Gudkov, Andrei V; Munoz, Marcia A; Vishvanath, Anasuya; Cooper, Dermot M F; Henderson, Michelle J; Cole, Susan P C; Fletcher, Jamie I; Haber, Michelle; Norris, Murray D
2014-09-01
Multidrug resistance protein 4 (MRP4/ABCC4), a member of the ATP-binding cassette (ABC) transporter superfamily, is an organic anion transporter capable of effluxing a wide range of physiologically important signalling molecules and drugs. MRP4 has been proposed to contribute to numerous functions in both health and disease; however, in most cases these links remain to be unequivocally established. A major limitation to understanding the physiological and pharmacological roles of MRP4 has been the absence of specific small molecule inhibitors, with the majority of established inhibitors also targeting other ABC transporter family members, or inhibiting the production, function or degradation of important MRP4 substrates. We therefore set out to identify more selective and well tolerated inhibitors of MRP4 that might be used to study the many proposed functions of this transporter. Using high-throughput screening, we identified two chemically distinct small molecules, Ceefourin 1 and Ceefourin 2, that inhibit transport of a broad range of MRP4 substrates, yet are highly selective for MRP4 over other ABC transporters, including P-glycoprotein (P-gp), ABCG2 (Breast Cancer Resistance Protein; BCRP) and MRP1 (multidrug resistance protein 1; ABCC1). Both compounds are more potent MRP4 inhibitors in cellular assays than the most widely used inhibitor, MK-571, requiring lower concentrations to effect a comparable level of inhibition. Furthermore, Ceefourin 1 and Ceefourin 2 have low cellular toxicity, and high microsomal and acid stability. These newly identified inhibitors should be of great value for efforts to better understand the biological roles of MRP4, and may represent classes of compounds with therapeutic application. Copyright © 2014 Elsevier Inc. All rights reserved.
Preliminary lifetime predictions for 304 stainless steel as the LANL ABC blanket material
International Nuclear Information System (INIS)
Park, J.J.; Buksa, J.J.; Houts, M.G.; Arthur, E.D.
1997-11-01
The prediction of materials lifetime in the preconceptual Los Alamos National Laboratory (LANL) Accelerator-Based Conversion of Plutonium (ABC) is of utmost interest. Because Hastelloy N showed good corrosion resistance to the Oak Ridge National Laboratory Molten Salt Reactor Experiment fuel salt that is similar to the LANL ABC fuel salt, Hastelloy N was originally proposed for the LANL ABC blanket material. In this paper, the possibility of using 304 stainless steel as a replacement for the Hastelloy N is investigated in terms of corrosion issues and fluence-limit considerations. An attempt is made, based on the previous Fast Flux Test Facility design data, to predict the preliminary lifetime estimate of the 304 stainless steel used in the blanket region of the LANL ABC
DEFF Research Database (Denmark)
Berezin, Vladimir; Walmod, Peter Schledermann; Filippov, Mikhail
2014-01-01
Extracellular matrix (ECM) molecules, their receptors at the cell surface, and cell adhesion molecules (CAMs) involved in cell-cell or cell-ECM interactions are implicated in processes related to major diseases of the central nervous system including Alzheimer's disease (AD), epilepsy......, schizophrenia, addiction, multiple sclerosis, Parkinson's disease, and cancer. There are multiple strategies for targeting the ECM molecules and their metabolizing enzymes and receptors with antibodies, peptides, glycosaminoglycans, and other natural and synthetic compounds. ECM-targeting treatments include...... chondroitinase ABC, heparin/heparan sulfate-mimicking oligosaccharides, ECM cross-linking antibodies, and drugs stimulating expression of ECM molecules. The amount or activity of ECM-degrading enzymes like matrix metalloproteinases can be modulated indirectly via the regulation of endogenous inhibitors like...
Neuhauser, Daniel
2011-11-28
Using the recent NF (near-field) formulation for electrodynamics on the nanoscale, we simulate transport in a Y-shape gold nanostructure in the presence of 2-level molecules. NF is shown to be easily integrated with the Liouville equation, producing a simple and efficient nanopolaritons (plasmons-excitons) solver, with a large time step. Two cases are considered: coating of the gold structure with molecular layers thinner than the structure, and filling space with aligned molecules. In both cases significant effects on the radiation transport are obtained even for low molecular densities. At low densities the effects are primarily an overall reduction of the plasmonics peak, but at higher densities there is a significant selectivity control by the molecules. A redshift is predicted, especially for the space-filling case. The combined nanopolariton shows qualitative hybridization, and the spectral peaks separate with increasing coupling, i.e., with increasing molecular densities. The results open the way to "control of light by light," i.e., controlling plasmonic light transport by inducing a change in the direction of the guiding molecular dipoles through radiation or other means.
APLICATION OF ABC METHOD FROM AN OPERATOR OF WATER AND SEWERAGE
Directory of Open Access Journals (Sweden)
FÜLÖP ÁRPÁD-ZOLTÁN
2016-12-01
Full Text Available At the time of the appearance of the ABC method, many specialists considered that they found the most opportune method of calculation to allocate the overhead costs on the cost objects, otherwise said to be able to calculate the total cost of a product or service. Because the method is based on determining the total cost, we can consider that the ABC method is not a method of costing, but rather a method of cost management. Unfortunately, in the specialized literature of Roumania there are many approaches which consider that the ABC method is a method of costing in the traditional way, although in our opinion it is not. Application of ABC method to a regional operator of water and sewerage shows us the possibilities of the method, the possibilities that are offered in the field of cost and administration overhead management, respectively of the establishment of the accounting result on the different cost objects. In case of the regional operator the calculation object is the city or township in which provides the services of water and sewage.
International Nuclear Information System (INIS)
Woodworth, R.C.; Butcher, N.D.; Brown, S.A.; Brown-Mason, A.
1987-01-01
Separation of ovotransferrin into C-terminal (OTf/2C) and N-terminal (OTf/2N) half-molecules has made possible the resolution of all expected histidinyl C(2)H resonances by proton nuclear magnetic resonance at 250 MHz. The chemical shift of many of the resonances decreases with increasing pH, allowing construction of titration curves, whereas a few resonances fail to titrate. On formation of the Ga/sup III/OTf/2(C 2 O 4 ) ternary complexes, two of the low-field C(2)H resonances in each half-molecule fail to titrate. This behavior implicates the imidazole groups giving rise to these resonances as ligands to the bound metal ion. A third C(2)H resonance in each half-molecule undergoes a marked reduction in pK'/sub a/ on formation of the ternary complex. The imidazole group displaying this resonance is implicated in a proton-relay scheme involved in binding the synergistic anion, oxalate, and a water of hydration on the bound metal ion. The titration curves for the various imidazole resonances have been fit to a four-parameter equation involving estimation of the pK'/sub a/, the limiting chemical shift values, and a Hill constant n. Hill constants of 1, which suggests positive cooperativity in the titration of this residue. The basis for this behavior cannot be rationalized at this time. 13 C NMR studies of [zeta- 13 C]Arg-OTf suggest the Arg side chains may not be intimately involved in formation of the ternary complex
ABC estimation of unit costs for emergency department services.
Holmes, R L; Schroeder, R E
1996-04-01
Rapid evolution of the health care industry forces managers to make cost-effective decisions. Typical hospital cost accounting systems do not provide emergency department managers with the information needed, but emergency department settings are so complex and dynamic as to make the more accurate activity-based costing (ABC) system prohibitively expensive. Through judicious use of the available traditional cost accounting information and simple computer spreadsheets. managers may approximate the decision-guiding information that would result from the much more costly and time-consuming implementation of ABC.
Metodologia ABC: implantação numa microempresa ABC methodology: implementation on a micro firm
Directory of Open Access Journals (Sweden)
Orlando Duran
2000-08-01
Full Text Available Este trabalho relata a implantação da metodologia de custos baseados em atividades numa microempresa do ramo metalúrgico. A proposta pretende demonstrar a viabilidade de aplicar esta técnica em empresas sem importar seu tamanho, só realizando algumas adaptações que garantam baixo investimento e curto espaço de tempo para obter os resultados. Na parte final do trabalho se realiza uma análise dos resultados obtidos verificando-se o potencial da informação gerada pela metodologia e seu uso como ferramenta de gestão.This paper presents an implementation of the activity based costing (ABC methodology in a small firm. The approach presented is intended to demonstrate the feasibility of applying the ABC methodology at any sized firm, only through few adaptations for ensuring low investments fees and speed in obtaining results and information from the system. Discussion about the results obtained during the implementation case are presented and the potential of using the information generated from the system as a managing tool is commented.
The ABCs of Activity-Based Costing: A Cost Containment and Reallocation Tool.
Turk, Frederick J.
1992-01-01
This article describes activity-based costing (ABC) and how this tool may help management understand the costs of major activities and identify possible alternatives. Also discussed are the traditional costing systems used by higher education and ways of applying ABC to higher education. (GLR)
Transport through a Single Octanethiol Molecule
Kockmann, D.; Poelsema, Bene; Zandvliet, Henricus J.W.
2009-01-01
Octanethiol molecules adsorbed on Pt chains are studied with scanning tunneling microscopy and spectroscopy at 77 K. The head of the octanethiol binds to a Pt atom and the tail is lying flat down on the chain. Open-loop current time traces reveal that the molecule wags its tail and attaches to the
Finite-bias electronic transport of molecules in a water solution
Rungger, Ivan
2010-06-04
The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.
Finite-bias electronic transport of molecules in a water solution
Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo
2010-01-01
The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Zwier, M V; Baardman, M E; van Dijk, T H; Jurdzinski, A; Wisse, L J; Bloks, V W; Berger, R M F; DeRuiter, M C; Groen, A K; Plösch, T
2017-08-01
LDL receptor-related protein type 2 (LRP2) is highly expressed on both yolk sac and placenta. Mutations in the corresponding gene are associated with severe birth defects in humans, known as Donnai-Barrow syndrome. We here characterized the contribution of LRP2 and maternal plasma cholesterol availability to maternal-fetal cholesterol transport and fetal cholesterol levels in utero in mice. Lrp2 +/- mice were mated heterozygously to yield fetuses of all three genotypes. Half of the dams received a 0.5% probucol-enriched diet during gestation to decrease maternal HDL cholesterol. At E13.5, the dams received an injection of D7-labelled cholesterol and were provided with 1- 13 C acetate-supplemented drinking water. At E16.5, fetal tissues were collected and maternal cholesterol transport and fetal synthesis quantified by isotope enrichments in fetal tissues by GC-MS. The Lrp2 genotype did not influence maternal-fetal cholesterol transport and fetal cholesterol. However, lowering of maternal plasma cholesterol levels by probucol significantly reduced maternal-fetal cholesterol transport. In the fetal liver, this was associated with increased cholesterol synthesis rates. No indications were found for an interaction between the Lrp2 genotype and maternal probucol treatment. Maternal-fetal cholesterol transport and endogenous fetal cholesterol synthesis depend on maternal cholesterol concentrations but do not involve LRP2 in the second half of murine pregnancy. Our results suggest that the mouse fetus can compensate for decreased maternal cholesterol levels. It remains a relevant question how the delicate system of cholesterol transport and synthesis is regulated in the human fetus and placenta. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Analysis of ABC (D) stratification for screening patients with gastric cancer.
Kudo, Tomohiro; Kakizaki, Satoru; Sohara, Naondo; Onozato, Yasuhiro; Okamura, Shinichi; Inui, Yoshikatsu; Mori, Masatomo
2011-11-21
To evaluate the value of ABC (D) stratification [combination of serum pepsinogen and Helicobacter pylori (H. pylori) antibody] of patients with gastric cancer. Ninety-five consecutive patients with gastric cancer were enrolled into the study. The serum pepsinogen I (PG I)/pepsinogen II (PG II) and H. pylori antibody levels were measured. Patients were classified into five groups of ABC (D) stratification according to their serological status. Endoscopic findings of atrophic gastritis and histological differentiation were also analyzed in relation to the ABC (D) stratification. The mean patient age was (67.9 ± 8.9) years. Three patients (3.2%) were classified into group A, 7 patients (7.4%) into group A', 27 patients (28.4%) into group B, 54 patients (56.8%) into group C, and 4 patients (4.2%) into group D, respectively. There were only three cases in group A when the patients taking acid proton pump inhibitors and those who had undergone eradication therapy for H. pylori (group A') were excluded. These three cases had mucosal atrophy in the grey zone according to the diagnostic manual of ABC (D) stratification. Histologically, the mean age of the patients with well differentiated adenocarcinoma was significantly higher than that of the patients with poorly differentiated adenocarcinoma (P ABC (D) stratification is a good method for screening patients with gastric cancers. Endoscopy is needed for grey zone cases to check the extent of mucosal atrophy.
Hruz, Petr
2006-01-01
Transmembrane transporters mediate energy dependent or independent translocation of drugs, potentially toxic compounds, and of various endogenous substrates such as bile acids and bilirubin across membranes. In this thesis the focus is on two classes of transporters, the ATPbinding cassette (ABC) transporters, which mediate ATP dependent transport and the solute carriers (SLC) which use electrochemical gradients for their transport. The transporters are expressed on membranes o...
Strategic analysis of ABC Systems and its potential future product
Lam, Nancy M.
2006-01-01
ABC Systems Limited is a provider of data communication software. Its main product line is protocol conversion software. ABC has developed several other products including some hardware products, but the main success remains the protocol conversion software developed over 10 years ago. The company is having difficulties discovering and developing a profitable and achievable new product and target market. The need for the protocol conversion software is diminishing as the standard of TCP/IP is...
Small Molecule Membrane Transporters in the Mammalian Podocyte: A Pathogenic and Therapeutic Target
Directory of Open Access Journals (Sweden)
Cristina Zennaro
2014-11-01
Full Text Available The intriguingly complex glomerular podocyte has been a recent object of intense study. Researchers have sought to understand its role in the pathogenesis of common proteinuric diseases such as minimal change disease and focal segmental glomerular sclerosis. In particular, considerable effort has been directed towards the anatomic and functional barrier to macromolecular filtration provided by the secondary foot processes, but little attention has been paid to the potential of podocytes to handle plasma proteins beyond the specialization of the slit diaphragm. Renal membrane transporters in the proximal tubule have been extensively studied for decades, particularly in relation to drug metabolism and elimination. Recently, uptake and efflux transporters for small organic molecules have also been found in the glomerular podocyte, and we and others have found that these transporters can engage not only common pharmaceuticals but also injurious endogenous and exogenous agents. We have also found that the activity of podocyte transporters can be manipulated to inhibit pathogen uptake and efflux. It is conceivable that podocyte transporters may play a role in disease pathogenesis and may be a target for future drug development.
Yu, Yi-Lin; Lee, Meei-Shyuan; Juan, Chun-Jung; Hueng, Dueng-Yuan
2013-08-01
The ABC/2 equation is commonly applied to measure the volume of intracranial hematoma. However, the precision of ABC/2 equation in estimating the tumor volume of acoustic neuromas is less addressed. The study is to evaluate the accuracy of the ABC/2 formula by comparing with planimetry method for estimating the tumor volumes. Thirty-two patients diagnosed with acoustic neuroma received contrast-enhanced magnetic resonance imaging of brain were recruited. The volume was calculated by the ABC/2 equation and planimetry method (defined as exact volume) at the same time. The 32 patients were divided into three groups by tumor volume to avoid volume-dependent overestimation (6 ml). The tumor volume by ABC/2 method was highly correlated to that calculated by planimetry method using linear regression analysis (R2=0.985). Pearson correlation coefficient (r=0.993, pABC/2 formula is an easy method in estimating the tumor volume of acoustic neuromas that is not inferior to planimetry method. Copyright © 2013 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Litman, Thomas; Druley, T E; Stein, W D
2001-01-01
The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....
Playware ABC 2: a Disruptive Technology for Global Development
DEFF Research Database (Denmark)
Lund, Henrik Hautop
2017-01-01
, anytime. The paper gives examples of how playware becomes a disruptive technology for global development, for instance in the health sector. For instance, in Tanzania doctors and community-based rehabilitation workers are constructing and combining modular playware tiles to easily create the right kind......The Playware ABC concept is used to create solutions that are usable by all kinds of users and contexts in our globalized society. In this paper, the Playware ABC can be exemplified with the development of the modular interactive tiles for health prevention and rehabilitation of anybody, anywhere...
DEFF Research Database (Denmark)
Melsted, Wenna Nascimento; Johansen, Lasse Lindholm; Lock-Andersen, Jørgen
2017-01-01
HLA class Ia (HLA-ABC) and HLA class Ib (HLA-E, -F and -G) molecules and FOXP3+ tumor-infiltrating lymphocytes (TILs) are often reported as relevant factors of tumor immune regulation. We investigated their expression as prognostic factors in 200 patients with primary cutaneous melanoma (PCM...
Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M
2016-03-01
Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.
Influence of multidrug resistance and drug transport proteins on chemotherapy drug metabolism.
Joyce, Helena; McCann, Andrew; Clynes, Martin; Larkin, Annemarie
2015-05-01
Chemotherapy involving the use of anticancer drugs remains an important strategy in the overall management of patients with metastatic cancer. Acquisition of multidrug resistance remains a major impediment to successful chemotherapy. Drug transporters in cell membranes and intracellular drug metabolizing enzymes contribute to the resistance phenotype and determine the pharmacokinetics of anticancer drugs in the body. ATP-binding cassette (ABC) transporters mediate the transport of endogenous metabolites and xenobiotics including cytotoxic drugs out of cells. Solute carrier (SLC) transporters mediate the influx of cytotoxic drugs into cells. This review focuses on the substrate interaction of these transporters, on their biology and what role they play together with drug metabolizing enzymes in eliminating therapeutic drugs from cells. The majority of anticancer drugs are substrates for the ABC transporter and SLC transporter families. Together, these proteins have the ability to control the influx and the efflux of structurally unrelated chemotherapeutic drugs, thereby modulating the intracellular drug concentration. These interactions have important clinical implications for chemotherapy because ultimately they determine therapeutic efficacy, disease progression/relapse and the success or failure of patient treatment.
Directory of Open Access Journals (Sweden)
Hala Alshamlan
2015-01-01
Full Text Available An artificial bee colony (ABC is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR, and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO. The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems.
Alshamlan, Hala; Badr, Ghada; Alohali, Yousef
2015-01-01
An artificial bee colony (ABC) is a relatively recent swarm intelligence optimization approach. In this paper, we propose the first attempt at applying ABC algorithm in analyzing a microarray gene expression profile. In addition, we propose an innovative feature selection algorithm, minimum redundancy maximum relevance (mRMR), and combine it with an ABC algorithm, mRMR-ABC, to select informative genes from microarray profile. The new approach is based on a support vector machine (SVM) algorithm to measure the classification accuracy for selected genes. We evaluate the performance of the proposed mRMR-ABC algorithm by conducting extensive experiments on six binary and multiclass gene expression microarray datasets. Furthermore, we compare our proposed mRMR-ABC algorithm with previously known techniques. We reimplemented two of these techniques for the sake of a fair comparison using the same parameters. These two techniques are mRMR when combined with a genetic algorithm (mRMR-GA) and mRMR when combined with a particle swarm optimization algorithm (mRMR-PSO). The experimental results prove that the proposed mRMR-ABC algorithm achieves accurate classification performance using small number of predictive genes when tested using both datasets and compared to previously suggested methods. This shows that mRMR-ABC is a promising approach for solving gene selection and cancer classification problems.
Directory of Open Access Journals (Sweden)
Nélio Achão Filho
2003-01-01
Full Text Available O presente trabalho tem por objetivo conceituar o que é ABC (Activity Based Costing e apresentar, de forma sistemática, uma sugestão de critérios para aplicação em empresa de construção naval. Basicamente, o estudo pretende contribuir, através do efeito demonstração do estudo de caso, para a conscientização quanto as dificuldades e oportunidades oferecidas pela implementação de um sistema ABC, numa área carente de novas metodologias gerenciais.The objective of this article is to evaluate what ABC (Activity Based Costing is, and to present, in a systematic form, a suggestion for the implantation of criteria for aplication at a naval construction company. Basically, the study intends, through the case study demo, make executives aware of the dificulties and oportunities offered by the implementation of an ABC system, in an area in need of new managerial methods.
ABCs of Oral Health: Nutrition - Children
... for gum inflammation and cavities. More ABCs of Oral Health A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z | All Nutrition - Adults Nutrition - Children Home | InfoBites | Find a Dentist | ...
Effects of the use of ABC weapons
International Nuclear Information System (INIS)
Karl-Rueckert, E.
1980-01-01
The effects of ABC-weapons are presented. The various classes of chemical weapons and their effects are discussed. It is pointed out that there is hardly a means of protection against these weapons. (MG) [de
González-Rey, Elena; Delgado, Mario; Castanys, Santiago; Pérez-Victoria, José M.; Gamarro, Francisco
2013-01-01
Leishmaniasis is a neglected disease produced by the intracellular protozoan parasite Leishmania. In the present study, we show that LABCG2, a new ATP-binding cassette half-transporter (ABCG subfamily) from Leishmania, is involved in parasite virulence. Down-regulation of LABCG2 function upon expression of an inactive mutant version of this half-transporter (LABCG2K/M) is shown to reduce the translocation of short-chain analogues of phosphatidylserine (PS). This dominant-negative phenotype is specific for the headgroup of the phospholipid, as the movement of phospholipid analogues of phosphatidylcholine, phosphatidylethanolamine or sphingomyelin is not affected. In addition, promastigotes expressing LABCG2K/M expose less endogenous PS in the stationary phase than control parasites. Transient exposure of PS at the outer leaflet of the plasma membrane is known to be one of the mechanisms used by Leishmania to infect macrophages and to silence their immune response. Stationary phase/metacyclic promastigotes expressing LABCG2K/M are less infective for macrophages and show decreased pathogenesis in a mouse model of cutaneous leishmaniasis. Thus, mice infected with parasites expressing LABCG2K/M did not develop any lesion and showed significantly lower inflammation and parasite burden than mice infected with control parasites. Our results indicate that LABCG2 function is required for the externalization of PS in Leishmania promastigotes, a process that is involved in the virulence of the parasite. PMID:23638200
Thermophilic P-loop transport ATPases : Enzyme function and energetics at high temperature
Pretz, Monika Gyöngyi
2007-01-01
Primary transport ATPases are divided into several superfamilies; amongst others including ATPases of the ABC transporter superfamily, the F-ATPase superfamily or the motor ATPases of the General Secretory (Sec) pathway. Motor proteins from these superfamilies show a low sequence similarity, except
An Efficient ABC_DE_Based Hybrid Algorithm for Protein–Ligand Docking
Directory of Open Access Journals (Sweden)
Boxin Guan
2018-04-01
Full Text Available Protein–ligand docking is a process of searching for the optimal binding conformation between the receptor and the ligand. Automated docking plays an important role in drug design, and an efficient search algorithm is needed to tackle the docking problem. To tackle the protein–ligand docking problem more efficiently, An ABC_DE_based hybrid algorithm (ADHDOCK, integrating artificial bee colony (ABC algorithm and differential evolution (DE algorithm, is proposed in the article. ADHDOCK applies an adaptive population partition (APP mechanism to reasonably allocate the computational resources of the population in each iteration process, which helps the novel method make better use of the advantages of ABC and DE. The experiment tested fifty protein–ligand docking problems to compare the performance of ADHDOCK, ABC, DE, Lamarckian genetic algorithm (LGA, running history information guided genetic algorithm (HIGA, and swarm optimization for highly flexible protein–ligand docking (SODOCK. The results clearly exhibit the capability of ADHDOCK toward finding the lowest energy and the smallest root-mean-square deviation (RMSD on most of the protein–ligand docking problems with respect to the other five algorithms.
International Nuclear Information System (INIS)
Straka, Elisabeth; Ellinger, Isabella; Balthasar, Christina; Scheinast, Matthias; Schatz, Jasmin; Szattler, Tamara; Bleichert, Sonja; Saleh, Leila; Knöfler, Martin; Zeisler, Harald; Hengstschläger, Markus; Rosner, Margit; Salzer, Hans; Gundacker, Claudia
2016-01-01
Highlights: • It is known that MeHg is able to pass the placenta and to affect fetal brain development. • Uptake and efflux transporters were examined in human primary trophoblast cells and BeWo cells. • Involvement in mercury transfer was assessed by measurement of cellular mercury content upon siRNA mediated gene knockdown. • Localization of transporters was determined by immunofluorescence microscopy. • LAT1 and rBAT at the apical membrane of the syncytiotrophoblast (STB) are involved in MeHg uptake. • MRP1 located at basal membrane of STB mediates mercury efflux. - Abstract: Background: The capacity of the human placenta to handle exogenous stressors is poorly understood. The heavy metal mercury is well-known to pass the placenta and to affect brain development. An active transport across the placenta has been assumed. The underlying mechanisms however are virtually unknown. Objectives: Uptake and efflux transporters (17 candidate proteins) assumed to play a key role in placental mercury transfer were examined for expression, localization and function in human primary trophoblast cells and the trophoblast-derived choriocarcinoma cell line BeWo. Methods: To prove involvement of the transporters, we used small interfering RNA (siRNA) and exposed cells to methylmercury (MeHg). Total mercury contents of cells were analyzed by Cold vapor-atomic fluorescence spectrometry (CV-AFS). Localization of the proteins in human term placenta sections was determined via immunofluorescence microscopy. Results: We found the amino acid transporter subunits L-type amino acid transporter (LAT)1 and rBAT (related to b 0,+ type amino acid transporter) as well as the efflux transporter multidrug resistance associated protein (MRP)1 to be involved in mercury kinetics of trophoblast cells (t-test P < 0.05). Conclusion: The amino acid transporters located at the apical side of the syncytiotrophoblast (STB) manage uptake of MeHg. Mercury conjugated to glutathione (GSH) is
DEFF Research Database (Denmark)
Litman, Thomas; Jensen, Ulla; Hansen, Alastair
2002-01-01
Recent studies have characterized the ABC half-transporter associated with mitoxantrone resistance in human cancer cell lines. Encoded by the ABCG2 gene, overexpression confers resistance to camptothecins, as well as to mitoxantrone. We developed four polyclonal antibodies against peptides corres...
Transport proteins promoting Escherichia coli pathogenesis
Tang, Fengyi; Saier, Milton H.
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. PMID:24747185
Transport proteins promoting Escherichia coli pathogenesis.
Tang, Fengyi; Saier, Milton H
2014-01-01
Escherichia coli is a genetically diverse species infecting hundreds of millions of people worldwide annually. We examined seven well-characterized E. coli pathogens causing urinary tract infections, gastroenteritis, pyelonephritis and haemorrhagic colitis. Their transport proteins were identified and compared with each other and a non-pathogenic E. coli K12 strain to identify transport proteins related to pathogenesis. Each pathogen possesses a unique set of protein secretion systems for export to the cell surface or for injecting effector proteins into host cells. Pathogens have increased numbers of iron siderophore receptors and ABC iron uptake transporters, but the numbers and types of low-affinity secondary iron carriers were uniform in all strains. The presence of outer membrane iron complex receptors and high-affinity ABC iron uptake systems correlated, suggesting co-evolution. Each pathovar encodes a different set of pore-forming toxins and virulence-related outer membrane proteins lacking in K12. Intracellular pathogens proved to have a characteristically distinctive set of nutrient uptake porters, different from those of extracellular pathogens. The results presented in this report provide information about transport systems relevant to various types of E. coli pathogenesis that can be exploited in future basic and applied studies. Copyright © 2014 Elsevier Ltd. All rights reserved.
Regulation of Human γδ T Cells by BTN3A1 Protein Stability and ATP-Binding Cassette Transporters
Directory of Open Access Journals (Sweden)
David A. Rhodes
2018-04-01
Full Text Available Activation of human Vγ9/Vδ2 T cells by “phosphoantigens” (pAg, the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP and the endogenous isoprenoid intermediate isopentenyl pyrophosphate, requires expression of butyrophilin BTN3A molecules by presenting cells. However, the precise mechanism of activation of Vγ9/Vδ2 T cells by BTN3A molecules remains elusive. It is not clear what conformation of the three BTN3A isoforms transmits activation signals nor how externally delivered pAg accesses the cytosolic B30.2 domain of BTN3A1. To approach these problems, we studied two HLA haplo-identical HeLa cell lines, termed HeLa-L and HeLa-M, which showed marked differences in pAg-dependent stimulation of Vγ9/Vδ2 T cells. Levels of IFN-γ secretion by Vγ9/Vδ2 T cells were profoundly increased by pAg loading, or by binding of the pan-BTN3A specific agonist antibody CD277 20.1, in HeLa-M compared to HeLa-L cells. IL-2 production from a murine hybridoma T cell line expressing human Vγ9/Vδ2 T cell receptor (TCR transgenes confirmed that the differential responsiveness to HeLa-L and HeLa-M was TCR dependent. By tissue typing, both HeLa lines were shown to be genetically identical and full-length transcripts of the three BTN3A isoforms were detected in equal abundance with no sequence variation. Expression of BTN3A and interacting molecules, such as periplakin or RhoB, did not account for the functional variation between HeLa-L and HeLa-M cells. Instead, the data implicate a checkpoint controlling BTN3A1 stability and protein trafficking, acting at an early time point in its maturation. In addition, plasma membrane profiling was used to identify proteins upregulated in HMB-PP-treated HeLa-M. ABCG2, a member of the ATP-binding cassette (ABC transporter family was the most significant candidate, which crucially showed reduced expression in HeLa-L. Expression of a subset of ABC transporters, including ABCA1 and ABCG1, correlated
Regulation of Human γδ T Cells by BTN3A1 Protein Stability and ATP-Binding Cassette Transporters
Rhodes, David A.; Chen, Hung-Chang; Williamson, James C.; Hill, Alfred; Yuan, Jack; Smith, Sam; Rhodes, Harriet; Trowsdale, John; Lehner, Paul J.; Herrmann, Thomas; Eberl, Matthias
2018-01-01
Activation of human Vγ9/Vδ2 T cells by “phosphoantigens” (pAg), the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP) and the endogenous isoprenoid intermediate isopentenyl pyrophosphate, requires expression of butyrophilin BTN3A molecules by presenting cells. However, the precise mechanism of activation of Vγ9/Vδ2 T cells by BTN3A molecules remains elusive. It is not clear what conformation of the three BTN3A isoforms transmits activation signals nor how externally delivered pAg accesses the cytosolic B30.2 domain of BTN3A1. To approach these problems, we studied two HLA haplo-identical HeLa cell lines, termed HeLa-L and HeLa-M, which showed marked differences in pAg-dependent stimulation of Vγ9/Vδ2 T cells. Levels of IFN-γ secretion by Vγ9/Vδ2 T cells were profoundly increased by pAg loading, or by binding of the pan-BTN3A specific agonist antibody CD277 20.1, in HeLa-M compared to HeLa-L cells. IL-2 production from a murine hybridoma T cell line expressing human Vγ9/Vδ2 T cell receptor (TCR) transgenes confirmed that the differential responsiveness to HeLa-L and HeLa-M was TCR dependent. By tissue typing, both HeLa lines were shown to be genetically identical and full-length transcripts of the three BTN3A isoforms were detected in equal abundance with no sequence variation. Expression of BTN3A and interacting molecules, such as periplakin or RhoB, did not account for the functional variation between HeLa-L and HeLa-M cells. Instead, the data implicate a checkpoint controlling BTN3A1 stability and protein trafficking, acting at an early time point in its maturation. In addition, plasma membrane profiling was used to identify proteins upregulated in HMB-PP-treated HeLa-M. ABCG2, a member of the ATP-binding cassette (ABC) transporter family was the most significant candidate, which crucially showed reduced expression in HeLa-L. Expression of a subset of ABC transporters, including ABCA1 and ABCG1, correlated with
Webb, Alastair J S; Ullman, Natalie L; Morgan, Tim C; Muschelli, John; Kornbluth, Joshua; Awad, Issam A; Mayo, Stephen; Rosenblum, Michael; Ziai, Wendy; Zuccarrello, Mario; Aldrich, Francois; John, Sayona; Harnof, Sagi; Lopez, George; Broaddus, William C; Wijman, Christine; Vespa, Paul; Bullock, Ross; Haines, Stephen J; Cruz-Flores, Salvador; Tuhrim, Stan; Hill, Michael D; Narayan, Raj; Hanley, Daniel F
2015-09-01
The ABC/2 score estimates intracerebral hemorrhage (ICH) volume, yet validations have been limited by small samples and inappropriate outcome measures. We determined accuracy of the ABC/2 score calculated at a specialized reading center (RC-ABC) or local site (site-ABC) versus the reference-standard computed tomography-based planimetry (CTP). In Minimally Invasive Surgery Plus Recombinant Tissue-Type Plasminogen Activator for Intracerebral Hemorrhage Evacuation-II (MISTIE-II), Clot Lysis Evaluation of Accelerated Resolution of Intraventricular Hemorrhage (CLEAR-IVH) and CLEAR-III trials. ICH volume was prospectively calculated by CTP, RC-ABC, and site-ABC. Agreement between CTP and ABC/2 was defined as an absolute difference up to 5 mL and relative difference within 20%. Determinants of ABC/2 accuracy were assessed by logistic regression. In 4369 scans from 507 patients, CTP was more strongly correlated with RC-ABC (r(2)=0.93) than with site-ABC (r(2)=0.87). Although RC-ABC overestimated CTP-based volume on average (RC-ABC, 15.2 cm(3); CTP, 12.7 cm3), agreement was reasonable when categorized into mild, moderate, and severe ICH (κ=0.75; PABC (84% within 5 mL; 48% of scans within 20%) than for site-ABC (81% within 5 mL; 41% within 20%). RC-ABC had moderate accuracy for detecting ≥5 mL change in CTP volume between consecutive scans (sensitivity, 0.76; specificity, 0.86) and was more accurate with smaller ICH, thalamic hemorrhage, and homogeneous clots. ABC/2 scores at local or central sites are sufficiently accurate to categorize ICH volume and assess eligibility for the CLEAR-III and MISTIE III studies and moderately accurate for change in ICH volume. However, accuracy decreases with large, irregular, or lobar clots. URL: http://www.clinicaltrials.gov. Unique identifier: MISTIE-II NCT00224770; CLEAR-III NCT00784134. © 2015 American Heart Association, Inc.
A test of the ABC model underlying rational emotive behavior therapy.
Ziegler, Daniel J; Leslie, Yvonne M
2003-02-01
The ABC model underlying Ellis's Rational Emotive Behavior Therapy predicts that people who think more irrationally should respond to daily stressors or hassles differently than do people who think less irrationally. This study tested this aspect of the ABC model. 192 college students were administered the Survey of Personal Beliefs and the Hassles Scale to measure irrational thinking and daily hassles, respectively. Students who scored higher on overall irrational thinking reported a significantly higher frequency of hassles than did those who scored lower on overall irrational thinking, while students who scored higher on awfulizing and low frustration tolerance reported a significantly greater intensity of hassles than did those who scored lower on awfulizing and low frustration tolerance. This indicates support for the ABC model, especially Ellis's construct of irrational beliefs central to this model.
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
Applying the Post-Modern Double ABC-X Model to Family Food Insecurity
Hutson, Samantha; Anderson, Melinda; Swafford, Melinda
2015-01-01
This paper develops the argument that using the Double ABC-X model in family and consumer sciences (FCS) curricula is a way to educate nutrition and dietetics students regarding a family's perceptions of food insecurity. The Double ABC-X model incorporates ecological theory as a basis to explain family stress and the resulting adjustment and…
The reproducibility of organ position using active breathing control (ABC) during liver radiotherapy
International Nuclear Information System (INIS)
Dawson, Laura A.; Brock, Kristy K.; Kazanjian, Sahira; Fitch, Dwight; McGinn, Cornelius J.; Lawrence, Theodore S.; Haken, Randall K. ten; Balter, James
2001-01-01
Purpose: To evaluate the intrafraction and interfraction reproducibility of liver immobilization using active breathing control (ABC). Methods and Materials: Patients with unresectable intrahepatic tumors who could comfortably hold their breath for at least 20 s were treated with focal liver radiation using ABC for liver immobilization. Fluoroscopy was used to measure any potential motion during ABC breath holds. Preceding each radiotherapy fraction, with the patient setup in the nominal treatment position using ABC, orthogonal radiographs were taken using room-mounted diagnostic X-ray tubes and a digital imager. The radiographs were compared to reference images using a 2D alignment tool. The treatment table was moved to produce acceptable setup, and repeat orthogonal verification images were obtained. The positions of the diaphragm and the liver (assessed by localization of implanted radiopaque intra-arterial microcoils) relative to the skeleton were subsequently analyzed. The intrafraction reproducibility (from repeat radiographs obtained within the time period of one fraction before treatment) and interfraction reproducibility (from comparisons of the first radiograph for each treatment with a reference radiograph) of the diaphragm and the hepatic microcoil positions relative to the skeleton with repeat breath holds using ABC were then measured. Caudal-cranial (CC), anterior-posterior (AP), and medial-lateral (ML) reproducibility of the hepatic microcoils relative to the skeleton were also determined from three-dimensional alignment of repeat CT scans obtained in the treatment position. Results: A total of 262 fractions of radiation were delivered using ABC breath holds in 8 patients. No motion of the diaphragm or hepatic microcoils was observed on fluoroscopy during ABC breath holds. From analyses of 158 sets of positioning radiographs, the average intrafraction CC reproducibility (σ) of the diaphragm and hepatic microcoil position relative to the skeleton
Energy Technology Data Exchange (ETDEWEB)
Jennings, E.; Madigan, M.
2017-04-01
Given the complexity of modern cosmological parameter inference where we arefaced with non-Gaussian data and noise, correlated systematics and multi-probecorrelated data sets, the Approximate Bayesian Computation (ABC) method is apromising alternative to traditional Markov Chain Monte Carlo approaches in thecase where the Likelihood is intractable or unknown. The ABC method is called"Likelihood free" as it avoids explicit evaluation of the Likelihood by using aforward model simulation of the data which can include systematics. Weintroduce astroABC, an open source ABC Sequential Monte Carlo (SMC) sampler forparameter estimation. A key challenge in astrophysics is the efficient use oflarge multi-probe datasets to constrain high dimensional, possibly correlatedparameter spaces. With this in mind astroABC allows for massive parallelizationusing MPI, a framework that handles spawning of jobs across multiple nodes. Akey new feature of astroABC is the ability to create MPI groups with differentcommunicators, one for the sampler and several others for the forward modelsimulation, which speeds up sampling time considerably. For smaller jobs thePython multiprocessing option is also available. Other key features include: aSequential Monte Carlo sampler, a method for iteratively adapting tolerancelevels, local covariance estimate using scikit-learn's KDTree, modules forspecifying optimal covariance matrix for a component-wise or multivariatenormal perturbation kernel, output and restart files are backed up everyiteration, user defined metric and simulation methods, a module for specifyingheterogeneous parameter priors including non-standard prior PDFs, a module forspecifying a constant, linear, log or exponential tolerance level,well-documented examples and sample scripts. This code is hosted online athttps://github.com/EliseJ/astroABC
Directory of Open Access Journals (Sweden)
Ioan Bâldea
2016-03-01
Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.
DEVELOPMENT OF A STRATEGIC MANAGEMENT TOOL IN A THERMAL POWER PLANT USING ABC AND BSC MODELS
Directory of Open Access Journals (Sweden)
Rishi Dwivedi
2016-05-01
Full Text Available In today’s dynamic, uncertain and highly competitive business environment, the long term success of an organization critically depends on the perceptions, choices and actions of its managers regarding their strategies. Activity based costing (ABC and balanced scorecard (BSC are the modern day management approaches acknowledged as reliable tools for strategy formulation and implementation in an organization. In this paper, ABC and BSC models are separately proposed and applied in the merry-go-round (MGR department of an Indian thermal power plant. The results elicited from adoption of these two models in the said power plant provide more accurate, timely, and reliable operational and financial information at different activity levels of the organization, which would help in effective strategic and tactical decision making. Even though, there are limited published research papers related to application of ABC model in power plants, none of them has adopted ABC and BSC techniques in an Indian contextual environment. Additionally, an integrated ABC-BSC model is designed to harness the complementary synergies of both ABC and BSC models.
DEFF Research Database (Denmark)
Lyles, J M; Linnemann, D; Bock, E
1984-01-01
Posttranslational modifications and intracellular transport of the D2-cell adhesion molecule (D2-CAM) were examined in cultured fetal rat neuronal cells. Developmental changes in biosynthesis were studied in rat forebrain explant cultures. Two D2-CAM polypeptides with Mr of 187,000-210,000 (A...
Beharry, Seelochan; Zhong, Ming; Molday, Robert S
2004-12-24
ABCA4, a member of the family of ATP binding cassette (ABC) proteins found in rod and cone photoreceptors, has been implicated in the transport of retinoid compounds across the outer segment disk membrane following the photoactivation of rhodopsin. Mutations in the ABCA4 gene are responsible for Stargardt macular dystrophy and related retinal degenerative diseases that cause a loss in vision. To identify the retinoid substrate that interacts with ABCA4, we have isolated ABCA4 from rod outer segment disk membranes on an immunoaffinity matrix and analyzed retinoid compounds that bind to ABCA4 using high performance liquid chromatography and radiolabeling methods. When all-trans-retinal was added to ABCA4 in the presence of phosphatidylethanolamine, approximately 0.9 mol of N-retinylidene-phosphatidylethanolamine and 0.3 mol of all-trans-retinal were bound per mol of ABCA4 with an apparent K(d) of 2-5 microm. ATP and GTP released these retinoids from ABCA4, whereas ADP, GDP, and nonhydrolyzable derivatives, adenosine 5'-(beta,gamma-imido)triphosphate and guanosine 5'-(beta,gamma-imido)triphosphate, were ineffective. One mole of N-retinyl-phosphatidylethanolamine, the reduced form of N-retinylidene-phosphatidylethanolamine, bound per mol of ABCA4, whereas 0.3 mol of all-trans-retinal were bound in the absence of phosphatidylethanolamine. No binding of all-trans-retinol to ABCA4 was observed. Our results indicate that ABCA4 preferentially binds N-retinylidene-phosphatidylethanolamine with high affinity in the absence of ATP. Our studies further suggest that ATP binding and hydrolysis induces a protein conformational change that causes N-retinylidene-phosphatidylethanolamine to dissociate from ABCA4.
Energy Technology Data Exchange (ETDEWEB)
Cengiz, Bagdat Burcu; Asik, Mehmet Dogan [Hacettepe University, Nanotechnology and Nanomedicine Division (Turkey); Kara, Goknur [Hacettepe University, Biochemistry Division, Chemistry Department (Turkey); Turk, Mustafa [Kirikkale University, Bioengineering Department (Turkey); Denkbas, Emir Baki, E-mail: denkbas@hacettepe.edu.tr [Hacettepe University, Biochemistry Division, Chemistry Department (Turkey)
2015-04-15
In recent years, targeted cancer therapy strategies have begun to take the place of the conventional treatments. Inhibition of the specific genes, involved in cancer progress, via small interfering RNA (siRNA) has become one of the promising therapeutic approaches for cancer therapy. However, due to rapid nuclease degradation and poor cellular uptake of siRNA, a suitable carrier for siRNA penetration inside the cells is required. We used chitosan nanoparticles (CS-NPs) to efficiently deliver ATP-binding casette E1 (ABCE1) and eukaryotic release factor 3 (eRF3)-targeting siRNAs, individually and together, to reduce the proliferation and induce the apoptosis of breast cancer cells. The CS-NPs were generated by ionic gelation method using tripolyphosphate (TPP) as a crosslinker. Nanoparticles (NPs) were obtained with diameters ranging between 110 and 230 nm and the zeta potential of approximately 27 mV optimizing the solution pH to 4.5 and CS/TPP mass ratio to 3:1. Loading efficiencies of 98.69 % ± 0.051 and 98.83 % ± 0.047 were achieved when ABCE1 siRNA and eRF3 siRNA were entrapped into the NPs, respectively. Cell proliferation assay demonstrated that siRNA-loaded CS-NPs were more effective on cancer cells when compared to siRNAs without CS-NPs. Parallel results were also obtained by apoptosis/necrosis, double-staining analysis. Within our study, the potency of ABCE1 and eRF3 siRNAs were shown for the first time with this kind of polymeric delivery system. The results also indicated that ABCE1 and eRF3, important molecules in protein synthesis, could serve as effective targets to inhibit the cancer cells.
Directory of Open Access Journals (Sweden)
Rafael Pernil
2015-04-01
Full Text Available Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that can use inorganic compounds such as nitrate or ammonium as nitrogen sources. In the absence of combined nitrogen, it can fix N2 in differentiated cells called heterocysts. Anabaena also shows substantial activities of amino acid uptake, and three ABC-type transporters for amino acids have been previously characterized. Seven new loci encoding predicted amino acid transporters were identified in the Anabaena genomic sequence and inactivated. Two of them were involved in amino acid uptake. Locus alr2535-alr2541 encodes the elements of a hydrophobic amino acid ABC-type transporter that is mainly involved in the uptake of glycine. ORF all0342 encodes a putative transporter from the dicarboxylate/amino acid:cation symporter (DAACS family whose inactivation resulted in an increased uptake of a broad range of amino acids. An assay to study amino acid release from Anabaena filaments to the external medium was set up. Net release of the alanine analogue α-aminoisobutyric acid (AIB was observed when transport system N-I (a hydrophobic amino acid ABC-type transporter was engaged in the uptake of a specific substrate. The rate of AIB release was directly proportional to the intracellular AIB concentration, suggesting leakage from the cells by diffusion.
International Nuclear Information System (INIS)
Cowell, B.S.; Fontana, M.H.; Krakowski, R.A.; Beard, C.A.; Buksa, J.J.; Davidson, J.W.; Sailor, W.C.; Williamson, M.A.
1995-01-01
In preparation for and in support of a detailed R and D Plan for the Accelerator-Based Conversion (ABC) of weapons plutonium, an ABC Plant Layout Study was conducted at the level of a pre-conceptual engineering design. The plant layout is based on an adaptation of the Molten-Salt Breeder Reactor (MSBR) detailed conceptual design that was completed in the early 1070s. Although the ABC Plant Layout Study included the Accelerator Equipment as an essential element, the engineering assessment focused primarily on the Target; Primary System (blanket and all systems containing plutonium-bearing fuel salt); the Heat-Removal System (secondary-coolant-salt and supercritical-steam systems); Chemical Processing; Operation and Maintenance; Containment and Safety; and Instrumentation and Control systems. Although constrained primarily to a reflection of an accelerator-driven (subcritical) variant of MSBR system, unique features and added flexibilities of the ABC suggest improved or alternative approaches to each of the above-listed subsystems; these, along with the key technical issues in need of resolution through a detailed R ampersand D plan for ABC are described on the bases of the ''strawman'' or ''point-of-departure'' plant layout that resulted from this study
Remy, Estelle; Duque, Paula
2014-01-01
Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617
Cnubben, N.H.; Wortelboer, H.M.; Zanden, J.J. van; Rietjens, I.M.; Bladeren, P.J. van
2005-01-01
Membrane transport proteins belonging to the ATP-binding cassette (ABC) family of transport proteins play a central role in the defence of organisms against toxic compounds, including anticancer drugs. However, for compounds that are designed to display a toxic effect, this defence system diminishes
The dependence of electronic transport on compressive deformation of C{sub 60} molecule
Energy Technology Data Exchange (ETDEWEB)
Li, H. [Key Lab of Liquid Structure and Heredity of Materials, Ministry of Education, School of Materials Science and Engineering, Shandong University (China)], E-mail: lihuilmy@hotmail.com; Zhang, X.Q. [Physics Department, Ocean University of China, Qingdao (China)
2008-06-02
The dependence of electronic transport on compressive deformation of C{sub 60} molecule is studied theoretically in this work. Brenner's 'second generation' empirical potential is used to describe the many-body short-range interatomic interactions for C{sub 60} in the molecular dynamics simulations. Our results demonstrate that C{sub 60} can be compressed up to a strain {epsilon}=0.31 before collapsing. Electronic transport under an applied bias is calculated by using a self-consistent field approach coupled with non-equilibrium Green's function (NEGF) formalism. The transmission probability, conductance gap, and conductance spectrum are found to be sensitive to the compression. The peak value of conductance decreases with the increase of strain until the C{sub 60} is compressed up to a strain {epsilon}=0.31.
Kim, S.; Yoon, S.; Venkata Ramana, M.; Ramanathan, V.; Nguyen, H.; Park, S.; Kim, M.
2009-12-01
Cheju Atmospheric Brown Cloud (ABC) Plume-Monsoon Experiment (CAPMEX), comprehsensive ground-based measurements and a series of data-gathering flights by specially equipped autonomous unmanned aerial vehicles (AUAVs) for aerosol and cloud, had conducted at Jeju (formerly, Cheju), South Korea during August-September 2008, to improve our understanding of how the reduction of anthropogenic emissions in China (so-called “great shutdown” ) during and after the Summer Beijing Olympic Games 2008 effcts on the air quliaty and radiation budgets and how atmospheric brown clouds (ABCs) influences solar radiation budget off Asian continent. Large numbers of in-situ and remote sensing instruments at the Gosan ABC observatory and miniaturized instruments on the aircraft measure a range of properties such as the quantity of soot, size-segregated aerosol particle numbers, total particle numbers, size-segregated cloud droplet numbers (only AUAV), aerosol scattering properties (only ground), aerosol vertical distribution, column-integrated aerosol properties, and meteorological variables. By integrating ground-level and high-elevation AUAV measurements with NASA-satellite observations (e.g., MODIS, CALIPSO), we investigate the long range transport of aerosols, the impact of ABCs on clouds, and the role of biogenic and anthropogenic aerosols on cloud condensation nuclei (CCN). In this talk, we will present the results from CAPMEX focusing on: (1) the characteristics of aerosol optical, physical and chemical properties at Gosan observatory, (2) aerosol solar heating calculated from the ground-based micro-pulse lidar and AERONET sun/sky radiometer synergy, and comparison with direct measurements from UAV, and (3) aerosol-cloud interactions in conjunction with measurements by satellites and Gosan observatory.
Delgado, María J; Tresierra-Ayala, Alvaro; Talbi, Chouhra; Bedmar, Eulogio J
2006-01-01
A modABC gene cluster that encodes an ABC-type, high-affinity molybdate transporter from Bradyrhizobium japonicum has been isolated and characterized. B. japonicum modA and modB mutant strains were unable to grow aerobically or anaerobically with nitrate as nitrogen source or as respiratory substrate, respectively, and lacked nitrate reductase activity. The nitrogen-fixing ability of the mod mutants in symbiotic association with soybean plants grown in a Mo-deficient mineral solution was severely impaired. Addition of molybdate to the bacterial growth medium or to the plant mineral solution fully restored the wild-type phenotype. Because the amount of molybdate required for suppression of the mutant phenotype either under free-living or under symbiotic conditions was dependent on sulphate concentration, it is likely that a sulphate transporter is also involved in Mo uptake in B. japonicum. The promoter region of the modABC genes has been characterized by primer extension. Reverse transcription and expression of a transcriptional fusion, P(modA)-lacZ, was detected only in a B. japonicum modA mutant grown in a medium without molybdate supplementation. These findings indicate that transcription of the B. japonicum modABC genes is repressed by molybdate.
Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.
Shahbabaei, Majid; Kim, Daejoong
2017-08-09
In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because
Schepens, Stacey; Goldberg, Allon; Wallace, Melissa
2010-01-01
A shortened version of the ABC 16-item scale (ABC-16), the ABC-6, has been proposed as an alternative balance confidence measure. We investigated whether the ABC-6 is a valid and reliable measure of balance confidence and examined its relationship to balance impairment and falls in older adults. Thirty-five community-dwelling older adults completed the ABC-16, including the 6 questions of the ABC-6. They also completed the following clinical balance tests: unipedal stance time (UST), functional reach (FR), Timed Up and Go (TUG), and maximum step length (MSL). Participants reported 12-month falls history. Balance confidence on the ABC-6 was significantly lower than on the ABC-16, however scores were highly correlated. Fallers reported lower balance confidence than non-fallers as measured by the ABC-6 scale, but confidence did not differ between the groups with the ABC-16. The ABC-6 significantly correlated with all balance tests assessed and number of falls. The ABC-16 significantly correlated with all balance tests assessed, but not with number of falls. Test-retest reliability for the ABC-16 and ABC-6 was good to excellent. The ABC-6 is a valid and reliable measure of balance confidence in community-dwelling older adults, and shows stronger relationships to falls than does the ABC-16. The ABC-6 may be a more useful balance confidence assessment tool than the ABC-16. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Evolutionary Pattern of N-Glycosylation Sequon Numbers in Eukaryotic ABC Protein Superfamilies
Directory of Open Access Journals (Sweden)
R. Shyama Prasad Rao
2010-02-01
Full Text Available Many proteins contain a large number of NXS/T sequences (where X is any amino acid except proline which are the potential sites of asparagine (N linked glycosylation. However, the patterns of occurrence of these N-glycosylation sequons in related proteins or groups of proteins and their underlying causes have largely been unexplored. We computed the actual and probabilistic occurrence of NXS/T sequons in ABC protein superfamilies from eight diverse eukaryotic organisms. The ABC proteins contained significantly higher NXS/T sequon numbers compared to respective genome-wide average, but the sequon density was significantly lower owing to the increase in protein size and decrease in sequon specific amino acids. However, mammalian ABC proteins have significantly higher sequon density, and both serine and threonine containing sequons (NXS and NXT have been positively selected—against the recent findings of only threonine specific Darwinian selection of sequons in proteins. The occurrence of sequons was positively correlated with the frequency of sequon specific amino acids and negatively correlated with proline and the NPS/T sequences. Further, the NPS/T sequences were significantly higher than expected in plant ABC proteins which have the lowest number of NXS/T sequons. Accord- ingly, compared to overall proteins, N-glycosylation sequons in ABC protein superfamilies have a distinct pattern of occurrence, and the results are discussed in an evolutionary perspective.
Thermoelectric Transport Signatures of Dirac Composite Fermions in the Half-Filled Landau Level
Potter, Andrew C.; Serbyn, Maksym; Vishwanath, Ashvin
2016-07-01
The half-filled Landau level is expected to be approximately particle-hole symmetric, which requires an extension of the Halperin-Lee-Read (HLR) theory of the compressible state observed at this filling. Recent work indicates that, when particle-hole symmetry is preserved, the composite fermions experience a quantized π -Berry phase upon winding around the composite Fermi surface, analogous to Dirac fermions at the surface of a 3D topological insulator. In contrast, the effective low-energy theory of the composite fermion liquid originally proposed by HLR lacks particle-hole symmetry and has vanishing Berry phase. In this paper, we explain how thermoelectric transport measurements can be used to test the Dirac nature of the composite fermions by quantitatively extracting this Berry phase. First, we point out that longitudinal thermopower (Seebeck effect) is nonvanishing because of the unusual nature of particle-hole symmetry in this context and is not sensitive to the Berry phase. In contrast, we find that off-diagonal thermopower (Nernst effect) is directly related to the topological structure of the composite Fermi surface, vanishing for zero Berry phase and taking its maximal value for π Berry phase. In contrast, in purely electrical transport signatures, the Berry phase contributions appear as small corrections to a large background signal, making the Nernst effect a promising diagnostic of the Dirac nature of composite fermions.
Single-Molecule Transport at a Rectifying GaAs Contact.
Vezzoli, Andrea; Brooke, Richard J; Ferri, Nicolò; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-02-08
In most single- or few-molecule devices, the contact electrodes are simple ohmic resistors. Here we describe a new type of single-molecule device in which metal and semiconductor contact electrodes impart a function, namely, current rectification, which is then modified by a molecule bridging the gap. We study junctions with the structure Au STM tip/X/n-GaAs substrate, where "X" is either a simple alkanedithiol or a conjugated unit bearing thiol/methylthiol contacts, and we detect current jumps corresponding to the attachment and detachment of single molecules. From the magnitudes of the current jumps we can deduce values for the conductance decay constant with molecule length that agree well with values determined from Au/molecule/Au junctions. The ability to impart functionality to a single-molecule device through the properties of the contacts as well as through the properties of the molecule represents a significant extension of the single-molecule electronics "tool-box".
Su, Jiaye; Guo, Hongxia
2011-01-25
The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.
Dual repression of the multidrug efflux pump CmeABC by CosR and CmeR in Campylobacter jejuni
Directory of Open Access Journals (Sweden)
Tara Grinnage-Pulley
2016-07-01
Full Text Available During transmission and intestinal colonization, Campylobacter jejuni, a major foodborne human pathogen, experiences oxidative stress. CosR, a response regulator in C. jejuni, modulates the oxidative stress response and represses expression of the CmeABC multidrug efflux pump. CmeABC, a key component in resistance to toxic compounds including antimicrobials and bile salts, is also under negative regulation by CmeR, a TetR family transcriptional regulator. How CosR and CmeR interact in binding to the cmeABC promoter and how CosR senses oxidative stress are still unknown. To answer these questions, we conducted various experiments utilizing electrophoretic mobility shift assays and transcriptional fusion assays. CosR and CmeR bound independently to two separate sites of the cmeABC promoter, simultaneously repressing cmeABC expression. This dual binding of CosR and CmeR is optimal with a 17 base pair space between the two binding sites as mutations that shortened the distance between the binding sites decreased binding by CmeR and enhanced cmeABC expression. Additionally, the single cysteine residue (C218 of CosR was sensitive to oxidation, which altered the DNA-binding activity of CosR and dissociated CosR from the cmeABC promoter as determined by electrophoretic mobility shift assay. Replacement of C218 with serine rendered CosR insensitive to oxidation, suggesting a potential role of C218 in sensing oxidative stress and providing a possible mechanism for CosR-mediated response to oxidative stress. These findings reveal a dual regulatory role of CosR and CmeR in modulating cmeABC expression and suggest a potential mechanism that may explain overexpression of cmeABC in response to oxidative stress. Differential expression of cmeABC mediated by CmeR and CosR in response to different signals may facilitate adaptation of Campylobacter to various environmental conditions.
Rice, Austin J; Harrison, Alistair; Alvarez, Frances J D; Davidson, Amy L; Pinkett, Heather W
2014-05-23
Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Flavonoids as modulators of metabolic enzymes and drug transporters.
Miron, Anca; Aprotosoaie, Ana Clara; Trifan, Adriana; Xiao, Jianbo
2017-06-01
Flavonoids, natural compounds found in plants and in plant-derived foods and beverages, have been extensively studied with regard to their capacity to modulate metabolic enzymes and drug transporters. In vitro, flavonoids predominantly inhibit the major phase I drug-metabolizing enzyme CYP450 3A4 and the enzymes responsible for the bioactivation of procarcinogens (CYP1 enzymes) and upregulate the enzymes involved in carcinogen detoxification (UDP-glucuronosyltransferases, glutathione S-transferases (GSTs)). Flavonoids have been reported to inhibit ATP-binding cassette (ABC) transporters (multidrug resistance (MDR)-associated proteins, breast cancer-resistance protein) that contribute to the development of MDR. P-glycoprotein, an ABC transporter that limits drug bioavailability and also induces MDR, was differently modulated by flavonoids. Flavonoids and their phase II metabolites (sulfates, glucuronides) inhibit organic anion transporters involved in the tubular uptake of nephrotoxic compounds. In vivo studies have partially confirmed in vitro findings, suggesting that the mechanisms underlying the modulatory effects of flavonoids are complex and difficult to predict in vivo. Data summarized in this review strongly support the view that flavonoids are promising candidates for the enhancement of oral drug bioavailability, chemoprevention, and reversal of MDR. © 2017 New York Academy of Sciences.
A Quantitative Analysis of the Behavioral Checklist of the Movement ABC Motor Test
Ruiz, Luis Miguel; Gomez, Marta; Graupera, Jose Luis; Gutierrez, Melchor; Linaza, Jose Luis
2007-01-01
The fifth section of the Henderson and Sugden's Movement ABC Checklist is part of the general Checklist that accompanies The Movement ABC Battery. The authors maintain that the analysis of this section must be mainly qualitative instead of quantitative. The main objective of this study was to employ a quantitative analysis of this behavioural…
Staggering in the cleavage pattern of E. coli ABC-excinuclease
International Nuclear Information System (INIS)
Myles, G.M.; Van Houten, B.; Sancar, A.
1986-01-01
E. coli ABC excinuclease is a complex of three proteins encoded by the uvrA, uvrB, and uvrC genes. The enzyme repairs DNA mono and diadducts by the single strand cleavage of DNA eight phosphodiester bond 5' and four or five phosphodiester bonds 3' to a DNA lesion and facilitates the removal of the resulting twelve or thirteen nucleotide fragment. In this study, the authors have investigated the excision pattern for ultraviolet (UV) induced diadducts, i.e. cyclobutane pyrimidine dimers and pyrimidine-pyrimidone (6-4) photoproducts. Terminally (5' or 3') labeled DNA was irradiated with 254nm UV and treated with ABC excinuclease before and after photoreactivation of cyclobutane dimers by E. coli DNA photolyase. In this way, the authors were able to differentiate between the cleavage pattern of pyrimidine dimers and of (6-4) photoproducts. Their results show that certain TT cyclobutane dimers and rare TT (6-4) photoproducts are excised by cleavage seven and, less frequently, six phosphodiester bonds to the 5' side of the DNA lesion in addition to the primary cutting site at the eight 5' phosphodiester bond. The 3' cleavage sites are maintained at the fourth and fifth phosphodiester bonds for the these UV induced lesions. These data indicate that the cleavage pattern of the ABC excinuclease may be dependent upon both the type of DNA lesion as well as it surrounding nucleotide sequence. In addition, the authors analysis shows that (6-4) photoproducts are much better substrates for ABC excinuclease than are pyrimidine dimers
Choroid plexus transport: gene deletion studies
Directory of Open Access Journals (Sweden)
Keep Richard F
2011-11-01
Full Text Available Abstract This review examines the use of transporter knockout (KO animals to evaluate transporter function at the choroid plexus (the blood-CSF barrier; BCSFB. Compared to the blood-brain barrier, there have been few such studies on choroid plexus (CP function. These have primarily focused on Pept2 (an oligopeptide transporter, ATP-binding cassette (ABC transporters, Oat3 (an organic anion transporter, Svct2 (an ascorbic acid transporter, transthyretin, ion transporters, and ion and water channels. This review focuses on the knowledge gained from such studies, both with respect to specific transporters and in general to the role of the CP and its impact on brain parenchyma. It also discusses the pros and cons of using KO animals in such studies and the technical approaches that can be used.
Abdullahi, Wazir; Davis, Thomas P; Ronaldson, Patrick T
2017-07-01
Drug delivery to the central nervous system (CNS) is greatly limited by the blood-brain barrier (BBB). Physical and biochemical properties of the BBB have rendered treatment of CNS diseases, including those with a hypoxia/reoxygenation (H/R) component, extremely difficult. Targeting endogenous BBB transporters from the ATP-binding cassette (ABC) superfamily (i.e., P-glycoprotein (P-gp)) or from the solute carrier (SLC) family (i.e., organic anion transporting polypeptides (OATPs in humans; Oatps in rodents)) has been suggested as a strategy that can improve delivery of drugs to the brain. With respect to P-gp, direct pharmacological inhibition using small molecules or selective regulation by targeting intracellular signaling pathways has been explored. These approaches have been largely unsuccessful due to toxicity issues and unpredictable pharmacokinetics. Therefore, our laboratory has proposed that optimization of CNS drug delivery, particularly for treatment of diseases with an H/R component, can be achieved by targeting Oatp isoforms at the BBB. As the major drug transporting Oatp isoform, Oatp1a4 has demonstrated blood-to-brain transport of substrate drugs with neuroprotective properties. Furthermore, our laboratory has shown that targeting Oatp1a4 regulation (i.e., TGF-β signaling mediated via the ALK-1 and ALK-5 transmembrane receptors) represents an opportunity to control Oatp1a4 functional expression for the purpose of delivering therapeutics to the CNS. In this review, we will discuss limitations of targeting P-gp-mediated transport activity and the advantages of targeting Oatp-mediated transport. Through this discussion, we will also provide critical information on novel approaches to improve CNS drug delivery by targeting endogenous uptake transporters expressed at the BBB.
Chen, Chen-Peng; Chen, Chan-Cheng; Huang, Chia-Wen; Chang, Yen-Ching
2018-04-15
The skin permeability ( Kp ) defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR) based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical's skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.
Schott, Nadja
2014-01-01
The Activities specific Balance Confidence (ABC) is a questionnaire which was developed to assess falls-associated self-efficacy. The aim of this study was to evaluate reliability and validity of the German abbreviated 6-item version of the ABC scores in community-dwelling older people. The study sample included 384 subjects (age 71.1 ± 9.7). In order to determine the psychometric properties, reliability and validity were assessed through administration of the German adaptation of the ABC-D16 to participants twice, 10 days apart, and comparison of the ABC-D16 and the ABC-D6 with functional measures of balance and mobility (one-leg stance; 10 m walk; TUG; Fullerton Advanced Balance Scale (FAB)), physical activity (Physical Activity Scale for the Elderly (PASE)), physical fitness (30s arm curl, 30s chair stand, 6 min walk), cognition (Trail-Making-Test (TMT)), falls status, and quality of life (SF36). Factor analyses suggested a 1-factor solution for the ABC-D6 scale (explained variance 79.8%). Internal consistency (.95) and test-retest reliability (.98) for the ABC-D6 scores were excellent. Scores on the ABC-D6 were significantly lower than on the ABC-D16, but ABC-D16 and ABC-D6 scores were highly correlated (.94). There was an increasing difference in the ABC-scores between men and women with increasing age. Fallers reported lower balance confidence than non-fallers. The ABC-D6 score significantly correlated with functional measures of balance and mobility, physical activity, physical fitness, cognition, and quality of life (-.698valid instrument to asses falls-associated self-efficacy and may be used in future research projects and clinical trials. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Kwon, Deukwoo; Reis, Isildinha M
2015-08-12
When conducting a meta-analysis of a continuous outcome, estimated means and standard deviations from the selected studies are required in order to obtain an overall estimate of the mean effect and its confidence interval. If these quantities are not directly reported in the publications, they must be estimated from other reported summary statistics, such as the median, the minimum, the maximum, and quartiles. We propose a simulation-based estimation approach using the Approximate Bayesian Computation (ABC) technique for estimating mean and standard deviation based on various sets of summary statistics found in published studies. We conduct a simulation study to compare the proposed ABC method with the existing methods of Hozo et al. (2005), Bland (2015), and Wan et al. (2014). In the estimation of the standard deviation, our ABC method performs better than the other methods when data are generated from skewed or heavy-tailed distributions. The corresponding average relative error (ARE) approaches zero as sample size increases. In data generated from the normal distribution, our ABC performs well. However, the Wan et al. method is best for estimating standard deviation under normal distribution. In the estimation of the mean, our ABC method is best regardless of assumed distribution. ABC is a flexible method for estimating the study-specific mean and standard deviation for meta-analysis, especially with underlying skewed or heavy-tailed distributions. The ABC method can be applied using other reported summary statistics such as the posterior mean and 95 % credible interval when Bayesian analysis has been employed.
DEFF Research Database (Denmark)
Kohut, Peter; Wüstner, Daniel; Hronska, L
2011-01-01
of sterol molecules into plasma membrane is not spontaneous but requires assistance of two ABC (ATP-binding cassette) pumps--Aus1p or Pdr11p. DHE taken up by uptake-competent hem1ΔAUS1PDR11 cells could be directly visualized by UV-sensitive wide field fluorescence microscopy. HPLC analysis of sterols......Uptake of external sterols in the yeast Saccharomyces cerevisiae is a multistep process limited to anaerobiosis or heme deficiency. It includes crossing the cell wall, insertion of sterol molecules into plasma membrane and their internalization and integration into intracellular membranes. We...... applied the fluorescent ergosterol analog dehydroergosterol (DHE) to monitor the initial steps of sterol uptake by three independent approaches: fluorescence spectroscopy, fluorescence microscopy and sterol quantification by HPLC. Using specific fluorescence characteristics of DHE we showed that the entry...
Directory of Open Access Journals (Sweden)
Noorazliza Sulaiman
2015-01-01
Full Text Available The standard artificial bee colony (ABC algorithm involves exploration and exploitation processes which need to be balanced for enhanced performance. This paper proposes a new modified ABC algorithm named JA-ABC5 to enhance convergence speed and improve the ability to reach the global optimum by balancing exploration and exploitation processes. New stages have been proposed at the earlier stages of the algorithm to increase the exploitation process. Besides that, modified mutation equations have also been introduced in the employed and onlooker-bees phases to balance the two processes. The performance of JA-ABC5 has been analyzed on 27 commonly used benchmark functions and tested to optimize the reactive power optimization problem. The performance results have clearly shown that the newly proposed algorithm has outperformed other compared algorithms in terms of convergence speed and global optimum achievement.
Sulaiman, Noorazliza; Mohamad-Saleh, Junita; Abro, Abdul Ghani
2015-01-01
The standard artificial bee colony (ABC) algorithm involves exploration and exploitation processes which need to be balanced for enhanced performance. This paper proposes a new modified ABC algorithm named JA-ABC5 to enhance convergence speed and improve the ability to reach the global optimum by balancing exploration and exploitation processes. New stages have been proposed at the earlier stages of the algorithm to increase the exploitation process. Besides that, modified mutation equations have also been introduced in the employed and onlooker-bees phases to balance the two processes. The performance of JA-ABC5 has been analyzed on 27 commonly used benchmark functions and tested to optimize the reactive power optimization problem. The performance results have clearly shown that the newly proposed algorithm has outperformed other compared algorithms in terms of convergence speed and global optimum achievement.
Hepatic ABC transporters and triglyceride metabolism.
Parks, John S; Chung, Soonkyu; Shelness, Gregory S
2012-06-01
Elevated plasma triglyceride and reduced HDL concentrations are prominent features of metabolic syndrome and type 2 diabetes. Individuals with Tangier disease also have elevated plasma triglyceride concentrations and very low HDL, resulting from mutations in ATP-binding cassette transporter A1 (ABCA1), an integral membrane protein that facilitates nascent HDL particle assembly. Past studies attributed the inverse relationship between plasma HDL and triglyceride to intravascular lipid exchange and catabolic events. However, recent studies also suggest that hepatic signaling and lipid mobilization and secretion may explain how HDL affects plasma triglyceride concentrations. Hepatocyte-specific ABCA1 knockout mice have markedly reduced plasma HDL and a two-fold increase in triglyceride due to failure to assemble nascent HDL particles by hepatocytes, causing increased catabolism of HDL apolipoprotein A-I and increased hepatic production of triglyceride-enriched VLDL. In-vitro studies suggest that nascent HDL particles may induce signaling to decrease triglyceride secretion. Inhibition of microRNA 33 expression in nonhuman primates augments hepatic ABCA1, genes involved in fatty acid oxidation, and decreases expression of lipogenic genes, causing increased plasma HDL and decreased triglyceride levels. New evidence suggests potential mechanisms by which hepatic ABCA1-mediated nascent HDL formation regulates VLDL-triglyceride production and contributes to the inverse relationship between plasma HDL and triglyceride.
Bevers, Loes E; Hagedoorn, Peter-Leon; Krijger, Gerard C; Hagen, Wilfred R
2006-09-01
A novel tungstate and molybdate binding protein has been discovered from the hyperthermophilic archaeon Pyrococcus furiosus. This tungstate transport protein A (WtpA) is part of a new ABC transporter system selective for tungstate and molybdate. WtpA has very low sequence similarity with the earlier-characterized transport proteins ModA for molybdate and TupA for tungstate. Its structural gene is present in the genome of numerous archaea and some bacteria. The identification of this new tungstate and molybdate binding protein clarifies the mechanism of tungstate and molybdate transport in organisms that lack the known uptake systems associated with the ModA and TupA proteins, like many archaea. The periplasmic protein of this ABC transporter, WtpA (PF0080), was cloned and expressed in Escherichia coli. Using isothermal titration calorimetry, WtpA was observed to bind tungstate (dissociation constant [K(D)] of 17 +/- 7 pM) and molybdate (K(D) of 11 +/- 5 nM) with a stoichiometry of 1.0 mol oxoanion per mole of protein. These low K(D) values indicate that WtpA has a higher affinity for tungstate than do ModA and TupA and an affinity for molybdate similar to that of ModA. A displacement titration of molybdate-saturated WtpA with tungstate showed that the tungstate effectively replaced the molybdate in the binding site of the protein.
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Spivey, Vicky L.; Molle, Virginie; Whalan, Rachael H.; Rodgers, Angela; Leiba, Jade; Stach, Lasse; Walker, K. Barry; Smerdon, Stephen J.; Buxton, Roger S.
2011-01-01
One major signaling method employed by Mycobacterium tuberculosis, the causative agent of tuberculosis, is through reversible phosphorylation of proteins mediated by protein kinases and phosphatases. This study concerns one of these enzymes, the serine/threonine protein kinase PknF, that is encoded in an operon with Rv1747, an ABC transporter that is necessary for growth of M. tuberculosis in vivo and contains two forkhead-associated (FHA) domains. FHA domains are phosphopeptide recognition motifs that specifically recognize phosphothreonine-containing epitopes. Experiments to determine how PknF regulates the function of Rv1747 demonstrated that phosphorylation occurs on two specific threonine residues, Thr-150 and Thr-208. To determine the in vivo consequences of phosphorylation, infection experiments were performed in bone marrow-derived macrophages and in mice using threonine-to-alanine mutants of Rv1747 that prevent specific phosphorylation and revealed that phosphorylation positively modulates Rv1747 function in vivo. The role of the FHA domains in this regulation was further demonstrated by isothermal titration calorimetry, using peptides containing both phosphothreonine residues. FHA-1 domain mutation resulted in attenuation in macrophages highlighting the critical role of this domain in Rv1747 function. A mutant deleted for pknF did not, however, have a growth phenotype in an infection, suggesting that other kinases can fulfill its role when it is absent. This study provides the first information on the molecular mechanism(s) regulating Rv1747 through PknF-dependent phosphorylation but also indicates that phosphorylation activates Rv1747, which may have important consequences in regulating growth of M. tuberculosis. PMID:21622570
The Role of Activity Based Costing (ABC) in Educational Support Services: A White Paper.
Edds, Daniel B.
Many front-line managers who are assuming more financial responsibility for their organizations find traditional cost accounting inadequate for their needs and are turning to Activity Based Costing (ABC). ABC is not a financial reporting system to serve the needs of regulatory agencies, but a tool that tracks costs from the general ledger…
Abcg5/Abcg8-independent pathways contribute to hepatobiliary cholesterol secretion in mice
Plosch, Torsten; van der Veen, Jelske N.; Havinga, Rick; Huijkman, Nicolette C. A.; Bloks, Vincent W.; Kuipers, Folkert
The ATP-binding cassette (ABC) half-transporters ABCG5 and ABCG8 heterodimerize into a functional complex that mediates the secretion of plant sterols and cholesterol by hepatocytes into bile and their apical efflux from enterocytes. We addressed the putative rate-controlling role of Abcg5/Abcg8 in
Directory of Open Access Journals (Sweden)
Kivisaar Maia
2010-04-01
Full Text Available Abstract Background We have recently found that Pseudomonas putida deficient in ColRS two-component system is sensitive to phenol and displays a serious defect on solid glucose medium where subpopulation of bacteria lyses. The latter phenotype is significantly enhanced by the presence of phenol in growth medium. Here, we focused on identification of factors affecting phenol tolerance of the colR-deficient P. putida. Results By using transposon mutagenesis approach we identified a set of phenol-tolerant derivatives of colR-deficient strain. Surprisingly, half of independent phenol tolerant clones possessed miniTn5 insertion in the ttgABC operon. However, though inactivation of TtgABC efflux pump significantly enhanced phenol tolerance, it did not affect phenol-enhanced autolysis of the colR mutant on glucose medium indicating that phenol- and glucose-caused stresses experienced by the colR-deficient P. putida are not coupled. Inactivation of TtgABC pump significantly increased the phenol tolerance of the wild-type P. putida as well. Comparison of phenol tolerance of growing versus starving bacteria revealed that both ColRS and TtgABC systems affect phenol tolerance only under growth conditions and not under starvation. Flow cytometry analysis showed that phenol strongly inhibited cell division and to some extent also caused cell membrane permeabilization to propidium iodide. Single cell analysis of populations of the ttgC- and colRttgC-deficient strains revealed that their membrane permeabilization by phenol resembles that of the wild-type and the colR mutant, respectively. However, cell division of P. putida with inactivated TtgABC pump seemed to be less sensitive to phenol than that of the parental strain. At the same time, cell division appeared to be more inhibited in the colR-mutant strain than in the wild-type P. putida. Conclusions ColRS signal system and TtgABC efflux pump are involved in the phenol tolerance of P. putida. However, as
Hu, Ting-Ting; Yan, Ling; Yan, Peng-Fei; Wang, Xuan; Yue, Ge-Fen
2016-01-01
Epidural hematoma volume (EDHV) is an independent predictor of prognosis in patients with epidural hematoma (EDH) and plays a central role in treatment decision making. This study's objective was to determine the accuracy and reliability of the widely used volume measurement method ABC/2 in estimating EDHV by comparing it to the computer-assisted planimetric method. A data set of computerized tomography (CT) scans of 35 patients with EDH was evaluated to determine the accuracy of ABC/2 method, using computer-assisted planimetric technique to establish the reference criterion of EDHV for each patient. Another data set was constructed by randomly selecting 5 patients then replicating each case twice to yield 15 patients. Intra- and interobserver reliability were evaluated by asking four observers to independently estimate EDHV for the latter data set using the ABC/2 method. Estimation of EDHV using the ABC/2 method showed high intra- and interobserver reliability (intra-class correlation coefficient = .99). These estimates were closely correlated with planimetric measures (r = .99). But the ABC/2 method generally overestimated EDHV, especially in the nonellipsoid-like group. The difference between the ABC/2 measures and planimetric measures was statistically significant (p ABC/2 method could be used for EDHV measurement, which would contribute to treatment decision making as well as clinical outcome prediction. However, clinicians should be aware that the ABC/2 method results in a general volume overestimation. Future studies focusing on justification of the technique to improve its accuracy would be of practical value. © The Author(s) 2015.
Alves, Ingrid R; Lima-Noronha, Marco A; Silva, Larissa G; Fernández-Silva, Frank S; Freitas, Aline Luiza D; Marques, Marilis V; Galhardo, Rodrigo S
2017-11-01
imuABC (imuAB dnaE2) genes are responsible for SOS-mutagenesis in Caulobacter crescentus and other bacterial species devoid of umuDC. In this work, we have constructed operator-constitutive mutants of the imuABC operon. We used this genetic tool to investigate the effect of SOS-induced levels of these genes upon both spontaneous and damage-induced mutagenesis. We showed that constitutive expression of imuABC does not increase spontaneous or damage-induced mutagenesis, nor increases cellular resistance to DNA-damaging agents. Nevertheless, the presence of the operator-constitutive mutation rescues mutagenesis in a recA background, indicating that imuABC are the only genes required at SOS-induced levels for translesion synthesis (TLS) in C. crescentus. Furthermore, these data also show that TLS mediated by ImuABC does not require RecA, unlike umuDC-dependent mutagenesis in E. coli. Copyright © 2017 Elsevier B.V. All rights reserved.
Modeling of flux, binding and substitution of urea molecules in the urea transporter dvUT.
Zhang, Hai-Tian; Wang, Zhe; Yu, Tao; Sang, Jian-Ping; Zou, Xian-Wu; Zou, Xiaoqin
2017-09-01
Urea transporters (UTs) are transmembrane proteins that transport urea molecules across cell membranes and play a crucial role in urea excretion and water balance. Modeling the functional characteristics of UTs helps us understand how their structures accomplish the functions at the atomic level, and facilitates future therapeutic design targeting the UTs. This study was based on the crystal structure of Desulfovibrio vulgaris urea transporter (dvUT). To model the binding behavior of urea molecules in dvUT, we constructed a cooperative binding model. To model the substitution of urea by the urea analogue N,N'-dimethylurea (DMU) in dvUT, we calculated the occupation probability of DMU along the urea pore and the ratio of the occupation probabilities of DMU at the external (S ext ) and internal (S int ) binding sites, and we established the mutual substitution rule for binding and substitution of urea and DMU. Based on these calculations and modelings, together with the use of the Monte Carlo (MC) method, we further modeled the urea flux in dvUT, equilibrium urea binding to dvUT, and the substitution of urea by DMU in the dvUT. Our modeling results are in good agreement with the existing experimental functional data. Furthermore, the modelings have discovered the microscopic process and mechanisms of those functional characteristics. The methods and the results would help our future understanding of the underlying mechanisms of the diseases associated with impaired UT functions and rational drug design for the treatment of these diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Ensemble inequivalence: Landau theory and the ABC model
International Nuclear Information System (INIS)
Cohen, O; Mukamel, D
2012-01-01
It is well known that systems with long-range interactions may exhibit different phase diagrams when studied within two different ensembles. In many of the previously studied examples of ensemble inequivalence, the phase diagrams differ only when the transition in one of the ensembles is first order. By contrast, in a recent study of a generalized ABC model, the canonical and grand-canonical ensembles of the model were shown to differ even when they both exhibit a continuous transition. Here we show that the order of the transition where ensemble inequivalence may occur is related to the symmetry properties of the order parameter associated with the transition. This is done by analyzing the Landau expansion of a generic model with long-range interactions. The conclusions drawn from the generic analysis are demonstrated for the ABC model by explicit calculation of its Landau expansion. (paper)
Una mirada al 23 F. Los editoriales de El País y ABC
Directory of Open Access Journals (Sweden)
Aitor Pérez Blázquez
2013-10-01
Full Text Available En el presente artículo pretendemos realizar un acercamiento a uno de los hechos más graves de la democracía española. Nos referimos al fallido intento de golpe de estado del 23 de Febrero. Nos hemos fijado en las líneas editoriales de dos periodicos, ABC y EL Pais, para observar como percibieron y se posicionaron durante los días claves tras el golpe militar.Palabras clave: 23F; Editoriales; El País; ABC 23F, editorials, El País, ABC_________________A look to 23 F. The editorials of El País and ABCAbstract:In the present paper we try to realize an approximation to one of the most serious facts of the Spanish democracy. We refer to 23 F. We have concentrated on the publishing lines of two newspapers, ABC and El País, to observe since they perceived and were positioned during the key days after the militar strike.Keywords:
Atomic-Scale Control of Electron Transport through Single Molecules
DEFF Research Database (Denmark)
Wang, Y. F.; Kroger, J.; Berndt, R.
2010-01-01
Tin-phthalocyanine molecules adsorbed on Ag(111) were contacted with the tip of a cryogenic scanning tunneling microscope. Orders-of-magnitude variations of the single-molecule junction conductance were achieved by controllably dehydrogenating the molecule and by modifying the atomic structure...
Directory of Open Access Journals (Sweden)
Chen-Peng Chen
2018-04-01
Full Text Available The skin permeability (Kp defines the rate of a chemical penetrating across the stratum corneum. This value is widely used to quantitatively describe the transport of molecules in the outermost layer of epidermal skin and indicate the significance of skin absorption. This study defined a Kp quantitative structure-activity relationship (QSAR based on 106 chemical substances of Kp measured using human skin and interpreted the molecular interactions underlying transport behavior of small molecules in the stratum corneum. The Kp QSAR developed in this study identified four molecular descriptors that described the molecular cyclicity in the molecule reflecting local geometrical environments, topological distances between pairs of oxygen and chlorine atoms, lipophilicity, and similarity to antineoplastics in molecular properties. This Kp QSAR considered the octanol-water partition coefficient to be a direct influence on transdermal movement of molecules. Moreover, the Kp QSAR identified a sub-domain of molecular properties initially defined to describe the antineoplastic resemblance of a compound as a significant factor in affecting transdermal permeation of solutes. This finding suggests that the influence of molecular size on the chemical’s skin-permeating capability should be interpreted with other relevant physicochemical properties rather than being represented by molecular weight alone.
Knock-down of ABCE1 gene induces G1/S arrest in human oral cancer cells
Wang, Lei; Zhang, Mei; Liu, Dong-Xu
2014-01-01
Purpose: This study aims to explore the clinical characteristics of ATP binding cassette E1 (ABCE1) in oral squamous cell carcinomas (OSCC) and its roles in the proliferation, invasiveness, migration and apoptosis of the human oral squamous cell carcinoma cells CAL-27. Methods: The expression of ABCE1 and its target protein-RNase L, were first studied in tumor tissues of OSCC and adjacent non-tumor tissues. Moreover, CAL-27cells were transfected by ABCE1-specific shRNA, then MTT assay, the tr...
Czech Academy of Sciences Publication Activity Database
Elsnerová, K.; Mohelniková; Duchonová, B.; Čeřovská, E.; Ehrlichová, M.; Gut, I.; Rob, L.; Skapa, P.; Hruda, M.; Bartáková, A.; Bouda, J.; Vodička, Pavel; Souček, P.; Václavíková, R.
2016-01-01
Roč. 35, č. 4 (2016), s. 2159-2170 ISSN 1021-335X R&D Projects: GA MZd(CZ) NT14056; GA MŠk(CZ) LD14050 Institutional support: RVO:68378041 Keywords : epithelial ovarian cancer * ABC transporters * SLC transporters * gene expression * prognosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.662, year: 2016
Classification of E-Nose Aroma Data of Four Fruit Types by ABC-Based Neural Network
Directory of Open Access Journals (Sweden)
M. Fatih Adak
2016-02-01
Full Text Available Electronic nose technology is used in many areas, and frequently in the beverage industry for classification and quality-control purposes. In this study, four different aroma data (strawberry, lemon, cherry, and melon were obtained using a MOSES II electronic nose for the purpose of fruit classification. To improve the performance of the classification, the training phase of the neural network with two hidden layers was optimized using artificial bee colony algorithm (ABC, which is known to be successful in exploration. Test data were given to two different neural networks, each of which were trained separately with backpropagation (BP and ABC, and average test performances were measured as 60% for the artificial neural network trained with BP and 76.39% for the artificial neural network trained with ABC. Training and test phases were repeated 30 times to obtain these average performance measurements. This level of performance shows that the artificial neural network trained with ABC is successful in classifying aroma data.
Classification of E-Nose Aroma Data of Four Fruit Types by ABC-Based Neural Network.
Adak, M Fatih; Yumusak, Nejat
2016-02-27
Electronic nose technology is used in many areas, and frequently in the beverage industry for classification and quality-control purposes. In this study, four different aroma data (strawberry, lemon, cherry, and melon) were obtained using a MOSES II electronic nose for the purpose of fruit classification. To improve the performance of the classification, the training phase of the neural network with two hidden layers was optimized using artificial bee colony algorithm (ABC), which is known to be successful in exploration. Test data were given to two different neural networks, each of which were trained separately with backpropagation (BP) and ABC, and average test performances were measured as 60% for the artificial neural network trained with BP and 76.39% for the artificial neural network trained with ABC. Training and test phases were repeated 30 times to obtain these average performance measurements. This level of performance shows that the artificial neural network trained with ABC is successful in classifying aroma data.
Accuracy of shock index versus ABC score to predict need for massive transfusion in trauma patients.
Schroll, Rebecca; Swift, David; Tatum, Danielle; Couch, Stuart; Heaney, Jiselle B; Llado-Farrulla, Monica; Zucker, Shana; Gill, Frances; Brown, Griffin; Buffin, Nicholas; Duchesne, Juan
2018-01-01
Various scoring systems have been developed to predict need for massive transfusion in traumatically injured patients. Assessments of Blood Consumption (ABC) score and Shock Index (SI) have been shown to be reliable predictors for Massive Transfusion Protocol (MTP) activation. However, no study has directly compared these two scoring systems to determine which is a better predictor for MTP activation. The primary objective was to determine whether ABC or SI better predicted the need for MTP in adult trauma patients with severe hemorrhage. This was a retrospective cohort study which included all injured patients who were trauma activations between January 1, 2009 and December 31, 2013 at an urban Level I trauma center. Patients ABC and SI were calculated for each patient. MTP was defined as need for >10 units PRBC transfusion within 24h of emergency department arrival. Sensitivity, specificity, and area under the receiver operating characteristic curve (AUROC) were used to evaluate scoring systems' ability to predict effective MTP utilization. A total of 645 patients had complete data for analysis. Shock Index ≥1 had sensitivity of 67.7% (95% CI 49.5%-82.6%) and specificity of 81.3% (95% CI 78.0%-84.3%) for predicting MTP, and ABC score ≥2 had sensitivity of 47.0% (95% CI 29.8%-64.9%) and specificity of 89.8% (95% CI 87.2%-92.1%). AUROC analyses showed SI to be the strongest predictor followed by ABC score with AUROC values of 0.83 and 0.74, respectively. SI had a significantly greater sensitivity (P=0.035), but a significantly weaker specificity (PABC score. ABC score and Shock Index can both be used to predict need for massive transfusion in trauma patients, however SI is more sensitive and requires less technical skill than ABC score. Copyright © 2017 Elsevier Ltd. All rights reserved.
ANALISIS BEBAN KERJA DENGAN MENGGUNAKAN METODE CVL DAN NASATLX DI PT. ABC
Directory of Open Access Journals (Sweden)
Renty Anugerah Mahaji Puteri
2017-10-01
Full Text Available PT. ABC merupakan perusahaan Jepang yang bergerak di bidang usaha jasa konstruksi mekanikal, elektrikal, dan system komunikasi. Sebagai perusahaan jasa konstruksi, PT. ABC dituntut untuk mencapai tujuan / target perusahaan tiap tahunnya yaitu mendapatkan tender proyek, maka tak jarang karyawannya dituntut untuk lembur. Seringnya karyawan lembur, maka menimbulkan masalah kelelahan terhadap para karyawannya sehingga target tidak tercapai. Penelitian ini bertujuan untuk mengevaluasi beban kerja yang dialami oleh engineer leader pada Departemen DesaindanOperasional di PT. ABC. Beban kerja yang diukur adalah beban kerja fisik dan mental. Beban kerja fisik diukur berdasarkan cardiovascular load (CVL. Beban kerja mental diukur dengan menggunakan metode NASA-Task Load Index (NASA-TLX. Berdasarkan hasil analisis CVL, beban kerja fisik yang diterima engineer proyek memiliki presentase CVL sebesar 31,16%, denganhasilperbaikanmenjadi 23,38%. Sedangkan dari hasil analisis NASA-TLX, beban kerja mental yang diterima engineer proyek yaitu dengan skor NASA-TLX 74,2% denganhasilperbaikanmenjadi 51,6%, sedangkan skor NASA-TLX engineer head office 61,5% denganhasilperbaikanmenjadi 47,66%.
Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel
2005-01-01
We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208
Directory of Open Access Journals (Sweden)
Rhiannon N. Hardwick
2016-12-01
Full Text Available Tyrosine and aurora kinases are important effectors in signal transduction pathways that are often involved in aberrant cancer cell growth. Tyrosine (TKI and aurora (AKI kinase inhibitors are anti-cancer agents specifically designed to target such signaling pathways through TKI/AKI binding to the ATP-binding pocket of kinases thereby leading to diminished kinase activity. Some TKIs have been identified as inhibitors of ATP-binding cassette (ABC transporters such as P-glycoprotein and breast cancer resistance protein (BCRP, which are commonly upregulated in malignant cells. TKI/AKIs have been investigated as ABC transporter inhibitors in order to facilitate the accumulation of concomitantly administered chemo-therapeutics within cancer cells. However, ABC transporters are prominently expressed in the liver and other eliminating organs, and their inhibition has been linked to intracellular accumulation of drugs, altered disposition, and toxicity. The potential for TKIs/AKIs to inhibit other important hepatic efflux transporters, particularly multidrug resistance-associated proteins (MRPs, remains unknown. The aim of the current study was to compare the inhibitory potency of 20 selected TKI/AKIs against MRP4 and BCRP through the use of inverted membrane vesicle assays. Relative IC50 values were estimated by determining TKI/AKI inhibition of MRP4-mediated [3H]-dehydroepiandrosterone sulfate uptake and BCRP-mediated [3H]-estrone sulfate uptake. To provide insight to the clinical relevance of TKI/AKI inhibition of ABC efflux transporters, the ratio of the steady-state maximum total plasma concentration (Css to the IC50 for each compound was calculated with Css/IC50 ratio >0.1 deemed potentially clinically relevant. Such analysis identified several potentially clinically relevant inhibitors of MRP4: alisertib, danusertib, erlotinib, lapatinib, neratinib, nilotinib, pazopanib, sorafenib, and tozasertib. The potentially clinically relevant inhibition of
Membrane Transporters for Bilirubin and Its Conjugates: A Systematic Review
Directory of Open Access Journals (Sweden)
Jovana Čvorović
2017-12-01
Full Text Available Background: Bilirubin is a highly-hydrophobic tetrapyrrole which binds to plasma albumin. It is conjugated in the liver to glucuronic acid, and the water-soluble glucuronides are excreted in urine and bile. The membrane transporters of bilirubin diglucuronide are well-known. Still undefined are however the transporters performing the uptake of bilirubin from the blood into the liver, a process known to be fast and not rate-limited. The biological importance of this process may be appraised by considering that in normal adults 200–300 mg of bilirubin are produced daily, as a result of the physiologic turnover of hemoglobin and cellular cytochromes. Nevertheless, research in this field has yielded controversial and contradicting results. We have undertaken a systematic review of the literature, believing in its utility to improve the existing knowledge and promote further advancements.Methods: We have sourced the PubMed database until 30 June 2017 by applying 5 sequential searches. Screening and eligibility criteria were applied to retain research articles reporting results obtained by using bilirubin molecules in membrane transport assays in vitro or by assessing serum bilirubin levels in in vivo experiments.Results: We have identified 311 articles, retaining 44, reporting data on experimental models having 6 incremental increases of complexity (isolated proteins, membrane vesicles, cells, organ fragments, in vivo rodents, and human studies, demonstrating the function of 19 membrane transporters, encoded by either SLCO or ABC genes. Three other bilirubin transporters have no gene, though one, i.e., bilitranslocase, is annotated in the Transporter Classification Database.Conclusions: This is the first review that has systematically examined the membrane transporters for bilirubin and its conjugates. Paradoxically, the remarkable advancements in the field of membrane transport of bilirubin have pointed to the elusive mechanism(s enabling
Directory of Open Access Journals (Sweden)
Goffeau André
2009-10-01
Full Text Available Abstract Background Pleiotropic Drug Resistant transporters (PDR are members of the ATP-Binding Cassette (ABC subfamily which export antifungals and other xenobiotics in fungi and plants. This subfamily of transmembrane transporters has nine known members in Saccharomyces cerevisiae. We have analyzed the complex evolution of the pleiotropic drug resistance proteins (Pdrp subfamily where gene duplications and deletions occur independently in individual genomes. This study was carried out on 62 Pdrp from nine hemiascomycetous species, seven of which span 6 of the 14 clades of the Saccharomyces complex while the two others species, Debaryomyces hansenii and Yarrowia lipolytica, are further apart from an evolutive point of view. Results Combined phylogenetic and neighborhood analyses enabled us to identify five Pdrp clusters in the Saccharomyces complex. Three of them comprise orthologs of the Pdrp sensu stricto, Pdr5p, Pdr10p, Pdr12p, Pdr15p, Snq2p and YNR070wp. The evolutive pathway of the orthologs of Snq2 and YNR070w is particularly complex due to a tandem gene array in Eremothecium gossypii, Kluyveromyces lactis and Saccharomyces (Lachancea kluyveri. This pathway and different cases of duplications and deletions were clarified by using a neighborhood analysis based on synteny. For the two distant species, Yarrowia lipolytica and Debaryomyces hansenii, no neighborhood evidence is available for these clusters and many homologs of Pdr5 and Pdr15 are phylogenetically assigned to species-based clusters. Two other clusters comprise the orthologs of the sensu lato Pdrp, Aus1p/Pdr11p and YOL075cp respectively. The evolutionary pathway of these clusters is simpler. Nevertheless, orthologs of these genes are missing in some species. Conclusion Numerous duplications were traced among the Hemiascomycetous Pdrp studied. The role of the Whole Genome Duplication (WGD is sorted out and our analyses confirm the common ancestrality of Pdr5p and Pdr15p. A tandem
Seret, Marie-Line; Diffels, Julie F; Goffeau, André; Baret, Philippe V
2009-10-01
Pleiotropic Drug Resistant transporters (PDR) are members of the ATP-Binding Cassette (ABC) subfamily which export antifungals and other xenobiotics in fungi and plants. This subfamily of transmembrane transporters has nine known members in Saccharomyces cerevisiae. We have analyzed the complex evolution of the pleiotropic drug resistance proteins (Pdrp) subfamily where gene duplications and deletions occur independently in individual genomes. This study was carried out on 62 Pdrp from nine hemiascomycetous species, seven of which span 6 of the 14 clades of the Saccharomyces complex while the two others species, Debaryomyces hansenii and Yarrowia lipolytica, are further apart from an evolutive point of view. Combined phylogenetic and neighborhood analyses enabled us to identify five Pdrp clusters in the Saccharomyces complex. Three of them comprise orthologs of the Pdrp sensu stricto, Pdr5p, Pdr10p, Pdr12p, Pdr15p, Snq2p and YNR070wp. The evolutive pathway of the orthologs of Snq2 and YNR070w is particularly complex due to a tandem gene array in Eremothecium gossypii, Kluyveromyces lactis and Saccharomyces (Lachancea) kluyveri. This pathway and different cases of duplications and deletions were clarified by using a neighborhood analysis based on synteny. For the two distant species, Yarrowia lipolytica and Debaryomyces hansenii, no neighborhood evidence is available for these clusters and many homologs of Pdr5 and Pdr15 are phylogenetically assigned to species-based clusters. Two other clusters comprise the orthologs of the sensu lato Pdrp, Aus1p/Pdr11p and YOL075cp respectively. The evolutionary pathway of these clusters is simpler. Nevertheless, orthologs of these genes are missing in some species. Numerous duplications were traced among the Hemiascomycetous Pdrp studied. The role of the Whole Genome Duplication (WGD) is sorted out and our analyses confirm the common ancestrality of Pdr5p and Pdr15p. A tandem gene array is observed in Eremothecium gossypii. One
Schepens, Stacey; Goldberg, Allon; Wallace, Melissa
2009-01-01
A shortened version of the ABC 16-item scale (ABC-16), the ABC-6, has been proposed as an alternative balance confidence measure. We investigated whether the ABC-6 is a valid and reliable measure of balance confidence and examined its relationship to balance impairment and falls in older adults. Thirty-five community-dwelling older adults completed the ABC-16, including the six questions of the ABC-6. They also completed the following clinical balance tests: unipedal stance time (UST), functi...
DEFF Research Database (Denmark)
Thøgersen, John; Ølander, Carl Folke
specifically the source separation of compostable kitchen waste. The investigation was carried out before and after the introduction of a system, facilitating such separation, in a Danish community. Hypotheses derived from the A-B-C model, predicting that changes over time in the correlation between attitude...... and behaviour would be influenced by (a) the introduction of the system, and (b) the pre-intervention structural conditions for different groups of households, were supported....
Directory of Open Access Journals (Sweden)
Gilberto José Miranda
2007-08-01
Full Text Available O Custeio Baseado em Atividades tem se mostrado como uma alternativa promissora para fazer frente à complexidade que caracteriza os custos hospitalares. Nos últimos dez anos, somente na Plataforma Lattes, foram encontrados mais de uma centena de estudos dessa natureza. Este trabalho tem como objetivo, conhecer, empiricamente, a utilização do Custeio ABC nos hospitais universitários e de ensino brasileiros e comparar os resultados, conforme as possibilidades, com as pesquisas realizadas nas maiores empresas brasileiras pelos autores: Khoury (1999, Beuren e Roedel (2002 e Azevedo, Santos e Pamplona (2004. Dos 115 questionários enviados aos hospitais universitários, 34 foram respondidos. O estudo levou a conclusões importantes, como: Os sistemas de custos atuais dos hospitais têm poucas condições de fornecer informações úteis à gestão; o Custeio ABC é bastante conhecido no ambiente, mas o número de usuários ainda é relativamente pequeno: apenas 15% da amostra; mas existe expectativa por parte de 44% dos hospitais com relação ao uso futuro da abordagem. As principais causas apresentadas para a não-utilização do Sistema ABC foram: (a o sistema utilizado atende às necessidades da organização e (b o Custeio Baseado em Atividades é muito complexo.The Cost Based Activity has been a promising alternative to deal with the complexity that characterizes hospital costs. In the last ten years, only in the Plataforma Lattes, more than a hundred studies of this nature had been found. This work aims to find out, empirically, the use of ABC Costing in Brazilian university hospitals and to compare the results, according to the possibilities, with the researches that have been made in the biggest Brazilian companies by the authors: Khoury (1999, Beuren and Roedel (2002 and Azevedo, Santos and Pamplona (2004. A hundred and fifteen questionnaires were sent to the university hospitals, 34 had been answered. The study relates important
Wang, Xinning; Liang, Zhenzhen; Hou, Jin; Shen, Yu; Bao, Xiaoming
2017-01-01
Enhancing the tolerance of Saccharomyces cerevisiae to inhibitors derived from lignocellulose is conducive to producing biofuel and chemicals using abundant lignocellulosic materials. Vanillin is a major type of phenolic inhibitor in lignocellulose hydrolysates for S. cerevisiae . In the present work, the factors beneficial to vanillin resistance in yeast were identified from the vanillin-resistant strain EMV-8, which was derived from strain NAN-27 by adaptive evolution. We found 450 SNPs and 44 genes with InDels in the vanillin-tolerant strain EMV-8 by comparing the genome sequences of EMV-8 and NAN-27. To investigate the effects of InDels, InDels were deleted in BY4741, respectively. We demonstrated that the deletion of YRR1 improved vanillin tolerance of strain. In the presence of 6 mM vanillin, deleting YRR1 increase the maximum specific growth rate and the vanillin consumption rate by 142 and 51%, respectively. The subsequent transcriptome analysis revealed that deleting YRR1 resulted in changed expression of over 200 genes in the presence of 5 mM vanillin. The most marked changes were the significant up-regulation of the dehydrogenase ADH7 , several ATP-binding cassette (ABC) transporters, and dozens of genes involved in ribosome biogenesis and rRNA processing. Coincidently, the crude enzyme solution of BY4741( yrr1 Δ) exhibited higher NADPH-dependent vanillin reduction activity than control. In addition, overexpressing the ABC transporter genes PDR5, YOR1 , and SNQ2 , as well as the RNA helicase gene DBP2 , increased the vanillin tolerance of strain. Interestingly, unlike the marked changes we mentioned above, under vanillin-free conditions, there are only limited transcriptional differences between wildtype and yrr1 Δ. This indicated that vanillin might act as an effector in Yrr1p-related regulatory processes. The new findings of the relationship between YRR1 and vanillin tolerance, as well as the contribution of rRNA processing and ribosome biogenesis to
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
DEFF Research Database (Denmark)
Hansen, Morten Ejby; Fredslund, Folmer; Andersen, Joakim Mark
2016-01-01
that the dominant HGM commensal Bacteroides ovatus was out-competed by B. animalis subsp. lactis Bl-04 in mixed cultures growing on raffinose, the preferred ligand for the BlG16BP. By comparison, B. ovatus mono-cultures grew very efficiently on this trisaccharide. These findings suggest that the ABC-mediated uptake...... of raffinose provides an important competitive advantage, particularly against dominant Bacteroides that lack glycan-specific ABC-transporters. This novel insight highlights the role of glycan transport in defining the metabolic specialization of gut bacteria....
International Nuclear Information System (INIS)
Liu, Y.; Li, T.; Yang, C.
2015-01-01
The activity of bc1 complex kinase (ABC1K) protein family, which widely exists in prokaryotes and eukaryotes, consists of 15 members in rice, and the role of this family in plants has not yet been studied in details. In this study, a novel function of OsABC1K8 (LOC-Os06g48770), a member of rice ABC1K family, was characterized. The transcript level of OsABC1K8 changes in response to salt, dehydration, cold, PEG, oxidative (H/sub 2/O/sub 2/) stresses, or abscisic acid (ABA) treatment. Overexpression of OsABC1K8 significantly increased sensitivity to dehydration and reduced sensitivity to ABA. In the contrast, RNAi transgenic lines displayed significantly reduced sensitivity to dehydration stress and increased sensitivity to ABA. Furthermore, the transcriptional levels of several ABA/stress-regulated responsive genes were suppressed in OsABC1K8 over-expressing plants under dehydration stress. In conclusion, our results suggested that OsABC1K8 is a negative regulator in response to dehydration stress through an ABA-dependent pathway. (author)
Directory of Open Access Journals (Sweden)
Ildikó Réka CARDOS
2011-06-01
Full Text Available Adherents of ABC/ABM systems claimed traditional management accounting systems generated misleading costs in a contemporary, tumultuous, often changing business environment and implementing ABC/ABM would remedy this. That is why activity-based costing (ABC and activity-based management (ABM represents the symbol of improved competitiveness and efficiency in every organization.The purpose of this article – after analyzing the existing literature in the field – is to emphasize that new cost systems such as ABC and ABM could be a strong couple that assures competitiveness and efficiency for each company. Another objective is to present that, besides its disadvantages, firms implement the ABC/ABM system because it permits better tracing of costs to objects, superior allocation of overheads to cost objects, financial and non-financial analysis and measures useful to managers and management accountants in the decision-making process.
Directory of Open Access Journals (Sweden)
Liping He
2012-11-01
Membrane proteins make up ∼30% of the proteome. During the early stages of maturation, this class of proteins can experience localized misfolding in distinct cellular compartments, such as the cytoplasm, endoplasmic reticulum (ER lumen and ER membrane. ER quality control (ERQC mechanisms monitor folding and determine whether a membrane protein is appropriately folded or is misfolded and warrants degradation. ERQC plays crucial roles in human diseases, such as cystic fibrosis, in which deletion of a single amino acid (F508 results in the misfolding and degradation of the cystic fibrosis transmembrane conductance regulator (CFTR Cl– channel. We introduced the ΔF508 mutation into Caenorhabditis elegans PGP-3, a 12-transmembrane ABC transporter with 15% identity to CFTR. When expressed in intestinal epithelial cells, PGP-3wt was stable and efficiently trafficked to the apical plasma membrane through a COPII-dependent mechanism. However, PGP-3ΔF508 was post-transcriptionally destabilized, resulting in reduced total and apical membrane protein levels. Genetic or physiological activation of the osmotic stress response pathway, which causes accumulation of the chemical chaperone glycerol, stabilized PGP-3ΔF508. Efficient degradation of PGP-3ΔF508 required the function of several C. elegans ER-associated degradation (ERAD homologs, suggesting that destabilization occurs through an ERAD-type mechanism. Our studies show that the ΔF508 mutation causes post-transcriptional destabilization and degradation of PGP-3 in C. elegans epithelial cells. This model, combined with the power of C. elegans genetics, provides a new opportunity to genetically dissect metazoan ERQC.
ATP Binding cassette transporter gene expression in rat liver progenitor cells
Ros, J.E.; Roskams, T.A.D.; Geuken, M.; Havinga, R.; Splinter, P.L.; Petersen, B.E.; LaRusso, N.F.; Kolk, van der D.M.; Kuipers, F.; Faber, K.N.; Müller, M.R.; Jansen, P.L.M.
2003-01-01
Background and aim: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are
ATP binding cassette transporter gene expression in rat liver progenitor cells
Ros, J. E.; Roskams, T. A. D.; Geuken, M.; Havinga, R.; Splinter, P. L.; Petersen, B. E.; LaRusso, N. F.; van der Kolk, D. M.; Kuipers, F.; Faber, K. N.; Müller, M.; Jansen, P. L. M.
2003-01-01
BACKGROUND AND AIM: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are
ATP binding cassette transporter gene expression in rat liver progenitor cells
Ros, J.E.; Roskams, TAD; Geuken, M; Havinga, R; Splinter, PL; Petersen, BE; LaRusso, NF; van der Kolk, D.M.; Kuipers, F; Faber, KN; Muller, M; Jansen, PLM
Background and aim: Liver regeneration after severe liver damage depends in part on proliferation and differentiation of hepatic progenitor cells (HPCs). Under these conditions they must be able to withstand the toxic milieu of the damaged liver. ATP binding cassette (ABC) transporters are
High performance p-type half-Heusler thermoelectric materials
Yu, Junjie; Xia, Kaiyang; Zhao, Xinbing; Zhu, Tiejun
2018-03-01
Half-Heusler compounds, which possess robust mechanical strength, good high temperature thermal stability and multifaceted physical properties, have been verified as a class of promising thermoelectric materials. During the last two decades, great progress has been made in half-Heusler thermoelectrics. In this review, we summarize some representative work of p-type half-Heusler materials, the thermoelectric performance of which has been remarkably enhanced in recent years. We introduce the features of the crystal and electronic structures of half-Heusler compounds, and successful strategies for optimizing electrical and thermal transport in the p-type RFeSb (R = V, Nb, Ta) and MCoSb (M = Ti, Zr, Hf) based systems, including band engineering, the formation of solid solutions and hierarchical phonon scattering. The outlook for future research directions of half-Heusler thermoelectrics is also presented.
Transportation fuel prices around the world, first half 1993
International Nuclear Information System (INIS)
Anon.
1993-01-01
This survey of 41 countries reveals that while most countries experienced higher prices in national currencies, a stronger dollar resulted in lower U.S. dollar adjusted fuel prices during the first half of the year. Currency exchange rate depreciation against the dollar was the predominant fact around the world
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Energy Technology Data Exchange (ETDEWEB)
Niu, Mingshan [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Shen, Yangling; Xu, Xiaoyu [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Yao, Yao; Fu, Chunling [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Yan, Zhiling [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Wu, Qingyun [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Cao, Jiang; Sang, Wei [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Zeng, Lingyu [Blood Diseases Institute, Xuzhou Medical College, Xuzhou, Jiangsu (China); Jiangsu Key Laboratory of Bone Marrow Stem Cell, Xuzhou Medical College, Xuzhou, Jiangsu (China); Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Li, Zhenyu [Department of Hematology, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu (China); Liu, Xuejiao, E-mail: liuxuejiao0923@126.com [Insititute of Nervous System Diseases, Xuzhou Medical College, Xuzhou, Jiangsu (China); and others
2015-07-10
Constitutive NF-κB activation is required for survival of activated B cell-like subtype of diffuse large B cell lymphoma (ABC-DLBCL). However, current NF-κB targeting strategies lack cancer cell specificity. Here, we identified a novel inhibitor, piperlongumine, features direct binding to NF-κB p65 subunit and suppression of p65 nuclear import. This was accompanied by NF-κB reporter activity suppression and NF-κB target gene downregulation. Moreover, mutation of Cys{sup 38} to Ser in p65 abolished this effect of piperlongumine on inhibition of p65 nuclear import. Furthermore, we show that piperlongumine selectively inhibited proliferation and induced apoptosis of ABC-DLBCL cells. Most notably, it has been reported that piperlongumine did not affect normal cells even at high doses and was nontoxic to animals. Hence, our current study provides new insight into piperlongumine's mechanism of action and novel approach to ABC-DLBCL target therapy. - Highlights: • Current NF-κB targeting strategies lack cancer cell specificity. • Piperlongumine inhibits NF-κB p65 subunit nuclear import via directly binding to p65. • Piperlongumine selectively inhibits proliferation of ABC-DLBCL cells. • This study provides a novel approach to ABC-DLBCL target therapy.
International Nuclear Information System (INIS)
Niu, Mingshan; Shen, Yangling; Xu, Xiaoyu; Yao, Yao; Fu, Chunling; Yan, Zhiling; Wu, Qingyun; Cao, Jiang; Sang, Wei; Zeng, Lingyu; Li, Zhenyu; Liu, Xuejiao
2015-01-01
Constitutive NF-κB activation is required for survival of activated B cell-like subtype of diffuse large B cell lymphoma (ABC-DLBCL). However, current NF-κB targeting strategies lack cancer cell specificity. Here, we identified a novel inhibitor, piperlongumine, features direct binding to NF-κB p65 subunit and suppression of p65 nuclear import. This was accompanied by NF-κB reporter activity suppression and NF-κB target gene downregulation. Moreover, mutation of Cys 38 to Ser in p65 abolished this effect of piperlongumine on inhibition of p65 nuclear import. Furthermore, we show that piperlongumine selectively inhibited proliferation and induced apoptosis of ABC-DLBCL cells. Most notably, it has been reported that piperlongumine did not affect normal cells even at high doses and was nontoxic to animals. Hence, our current study provides new insight into piperlongumine's mechanism of action and novel approach to ABC-DLBCL target therapy. - Highlights: • Current NF-κB targeting strategies lack cancer cell specificity. • Piperlongumine inhibits NF-κB p65 subunit nuclear import via directly binding to p65. • Piperlongumine selectively inhibits proliferation of ABC-DLBCL cells. • This study provides a novel approach to ABC-DLBCL target therapy
Kakebeeke, Tanja H; Egloff, Kristin; Caflisch, Jon; Chaouch, Aziz; Rousson, Valentin; Largo, Remo H; Jenni, Oskar G
2014-11-01
An established tool for the assessment of motor performance in children with developmental coordination disorder (DCD) is the Movement-ABC-2 (M-ABC-2). The Zurich Neuromotor Assessment (ZNA) is also widely used for the evaluation of children's motor performance, but has not been compared with the M-ABC-2. Fifty-one children (39 males) between 5 and 7 years of age with suspected DCD were assessed using the M-ABC-2 and the ZNA. Rank correlations between scores of different test components were calculated. The structure of the tests was explored using canonical-correlation analysis. The correlation between total scores of the two motor tests was reasonable (0.66; pABC-2, due to poor performance in the fine motor adaptive component and increased contralateral associated movements (CAM). The canonical-correlation analysis revealed that ZNA measures components like pure motor skills and CAM that are not represented in the M-ABC-2. Furthermore, there was also no equivalent for the aiming and catching items of the M-ABC-2 in ZNA. The two tests measure different motor characteristics in children with suspected DCD and, thus, can be used complementary for the diagnosis of the disorder. Copyright © 2014. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Phillip C. James
2013-07-01
Full Text Available Financial institutions are increasingly operating in a highly competitively environment and therefore cost management has become an imperative. This paper investigates the factors influencing the adoption of activity-based costing (ABC methodology within the financial sector in Jamaica. Quantitative analysis was done using the generalized linear logistic regression model. The results show that there are three main factors that are statistically significant in the decision to implement an ABC system, these are: companies perception of the ability of ABC to assist in cost control, the proportion of overhead to total cost and finally, the action of competitors, that is, whether a competitor adopts the ABC methodology
Dhote, Valentin; Skaalure, Stacey; Akalp, Umut; Roberts, Justine; Bryant, Stephanie J; Vernerey, Franck J
2013-03-01
Damage to cartilage caused by injury or disease can lead to pain and loss of mobility, diminishing one's quality of life. Because cartilage has a limited capacity for self-repair, tissue engineering strategies, such as cells encapsulated in synthetic hydrogels, are being investigated as a means to restore the damaged cartilage. However, strategies to date are suboptimal in part because designing degradable hydrogels is complicated by structural and temporal complexities of the gel and evolving tissue along multiple length scales. To address this problem, this study proposes a multi-scale mechanical model using a triphasic formulation (solid, fluid, unbound matrix molecules) based on a single chondrocyte releasing extracellular matrix molecules within a degrading hydrogel. This model describes the key players (cells, proteoglycans, collagen) of the biological system within the hydrogel encompassing different length scales. Two mechanisms are included: temporal changes of bulk properties due to hydrogel degradation, and matrix transport. Numerical results demonstrate that the temporal change of bulk properties is a decisive factor in the diffusion of unbound matrix molecules through the hydrogel. Transport of matrix molecules in the hydrogel contributes both to the development of the pericellular matrix and the extracellular matrix and is dependent on the relative size of matrix molecules and the hydrogel mesh. The numerical results also demonstrate that osmotic pressure, which leads to changes in mesh size, is a key parameter for achieving a larger diffusivity for matrix molecules in the hydrogel. The numerical model is confirmed with experimental results of matrix synthesis by chondrocytes in biodegradable poly(ethylene glycol)-based hydrogels. This model may ultimately be used to predict key hydrogel design parameters towards achieving optimal cartilage growth. Copyright © 2012 Elsevier Ltd. All rights reserved.
Genome-wide Identification and Expression Analysis of Half-size ABCG Genes in Malus × domestica
Directory of Open Access Journals (Sweden)
Juanjuan MA
2018-03-01
Full Text Available Half-size adenosine triphosphate-binding cassette transporter subgroup G (ABCG genes play crucial roles in regulating the movements of a variety of substrates and have been well studied in several plants. However, half-size ABCGs have not been characterized in detail in apple (Malus × domestica Borkh.. Here, we performed a genome-wide identification and expression analysis of the half-size ABCG gene family in apple. A total of 46 apple half-size ABCGs were identified and divided into six clusters according to the phylogenetic analysis. A gene structural analysis showed that most half-size ABCGs in the same cluster shared a similar exon–intron organization. A gene duplication analysis showed that segmental, tandem and whole-genome duplications could account for the expansion of half-size ABCG transporters in M. domestica. Moreover, a promoter scan, digital expression analysis and RNA-seq revealed that MdABCG21 may be involved in root's cytokinin transport and that ABCG17 may be involved in the lateral bud development of M. spectabilis ‘Bly114’ by mediating cytokinin transport. The data presented here lay the foundation for further investigations into the biological and physiological processes and functions of half-size ABCG genes in apple. Keywords: apple, ABCG gene, duplication, gene expression
Controlled transport through a single molecule
Kumar, Avijit; Heimbuch, Rene; Poelsema, Bene; Zandvliet, Henricus J.W.
2012-01-01
We demonstrate how an electrode–molecule–electrode junction can be controllably opened and closed by careful tuning of the contacts' interspace and voltage. The molecule, an octanethiol, flips to bridge a ~1 nm interspace between substrate and scanning tunnelling microscope tip when an electric
DEFF Research Database (Denmark)
Kosawang, Chatchai; Karlsson, Magnus; Jensen, Dan Funck
2014-01-01
a number of ATP-Binding Cassette (ABC) transporter transcripts were highly frequent in the ZEA-induced library. Subsequent bioinformatics analysis predicted that all transcripts with similarity to ABC transporters could be ascribed to only 2 ABC transporters genes, and phylogenetic analysis...... of the predicted ABC transporters suggested that they belong to group G (pleiotropic drug transporters) of the fungal ABC transporter gene family. This is the first report suggesting involvement of ABC transporters in ZEA tolerance. Expression patterns of a selected set of DON- and ZEA-induced genes were validated...... and ZEA in the mycoparasitic fungus C. rosea. Whilst metabolic readjustment is potentially the key to withstanding DON, the fungus produces ZHD101 to detoxify ZEA and ABC transporters to transport ZEA or its degradation products out from the fungal cell....
Surface roughness optimization in machining of AZ31 magnesium alloy using ABC algorithm
Directory of Open Access Journals (Sweden)
Abhijith
2018-01-01
Full Text Available Magnesium alloys serve as excellent substitutes for materials traditionally used for engine block heads in automobiles and gear housings in aircraft industries. AZ31 is a magnesium alloy finds its applications in orthopedic implants and cardiovascular stents. Surface roughness is an important parameter in the present manufacturing sector. In this work optimization techniques namely firefly algorithm (FA, particle swarm optimization (PSO and artificial bee colony algorithm (ABC which are based on swarm intelligence techniques, have been implemented to optimize the machining parameters namely cutting speed, feed rate and depth of cut in order to achieve minimum surface roughness. The parameter Ra has been considered for evaluating the surface roughness. Comparing the performance of ABC algorithm with FA and PSO algorithm, which is a widely used optimization algorithm in machining studies, the results conclude that ABC produces better optimization when compared to FA and PSO for optimizing surface roughness of AZ 31.
Chondroitinase ABC plus bone marrow mesenchymal stem cells for repair of spinal cord injury☆
Zhang, Chun; He, Xijing; Li, Haopeng; Wang, Guoyu
2013-01-01
As chondroitinase ABC can improve the hostile microenvironment and cell transplantation is proven to be effective after spinal cord injury, we hypothesized that their combination would be a more effective treatment option. At 5 days after T8 spinal cord crush injury, rats were injected with bone marrow mesenchymal stem cell suspension or chondroitinase ABC 1 mm from the edge of spinal cord damage zone. Chondroitinase ABC was first injected, and bone marrow mesenchymal stem cell suspension was injected on the next day in the combination group. At 14 days, the mean Basso, Beattie and Bresnahan score of the rats in the combination group was higher than other groups. Hematoxylin-eosin staining showed that the necrotic area was significantly reduced in the combination group compared with other groups. Glial fibrillary acidic protein-chondroitin sulfate proteoglycan double staining showed that the damage zone of astrocytic scars was significantly reduced without the cavity in the combination group. Glial fibrillary acidic protein/growth associated protein-43 double immunostaining revealed that positive fibers traversed the damage zone in the combination group. These results suggest that the combination of chondroitinase ABC and bone marrow mesenchymal stem cell transplantation contributes to the repair of spinal cord injury. PMID:25206389
On minimal coupling of the ABC-superparticle to supergravity background
Galajinsky, A. V.; Gitman, D. M.
1998-01-01
By rigorous application of the Hamiltonian methods we show that the ABC-formulation of the Siegel superparticle admits consistent minimal coupling to external supergravity. The consistency check proves to involve all the supergravity constraints.
Finanční analýza účetní jednotky ABC/Financial Analysis of Company ABC
Kaprálová, Aneta
2009-01-01
This thesis is focused on financial analysis of company ABC that works in rubber industry. First part is aimed at theoretical interpretation of financial analysis, its goals, history, users and sources. Attention is paid to sources of information especially financial statements. Further basic methods are defined, which financial analysis uses. Ratios are described in this thesis above all. At the close there is practical display of financial analysis based on data from financial statements of...
Brand, J.; Gozdzik, S.; Néel, N.; Lado, J. L.; Fernández-Rossier, J.; Kröger, J.
2018-05-01
A scanning tunneling microscope is used to explore the evolution of electron and Cooper-pair transport across single Mn-phthalocyanine molecules adsorbed on Pb(111) from tunneling to contact ranges. Normal-metal as well as superconducting tips give rise to a gradual transition of the Bardeen-Cooper-Schrieffer energy gap in the tunneling range into a zero-energy resonance close to and at contact. Supporting transport calculations show that in the normal-metal-superconductor junctions this resonance reflects the merging of in-gap Yu-Shiba-Rusinov states as well as the onset of Andreev reflection. For the superconductor-superconductor contacts, the zero-energy resonance is rationalized in terms of a finite Josephson current that is carried by phase-dependent Andreev and Yu-Shiba-Rusinov levels.
Energy Technology Data Exchange (ETDEWEB)
Jensen, R.J. [Los Alamos National Laboratory, NM (United States)
1995-10-01
ABC stand for accelerator based conversion of Pu. It is a unique approach to Pu destruction that allows for a well controlled and complete burn of Pu as may be required by treaty or policy. The central idea of the approach is to provide a spallation source of neutrons that allows the operation of a fissioning system without a critical mass and at a K effective less than one. Material to be fissioned is suspended in a molten salt medium for high temperature control and on-line removal of neutron absorbing fission products. This paper discusses the issues associated with the selection and operation of a molten salt chemical system: redox control, product removal, material feed, solubilities, deposition control, and a host of operational procedures.
Directory of Open Access Journals (Sweden)
Baiq Nensi Veni Indipenrian
2015-12-01
Full Text Available This study aims to examine the effect of individual behavioral change on the adoption of activity- based costing (ABC system and its usage, using Unified Theory of Accep-tance and Use of Technology (UTAUT and Information System Success Model. The sample involves 78 respondents who have positions as financial manager, controller manager, accounting manager, and production manager in mid-sized manufacturing companies in East java. The data were collected by survey method. This study used a Partial Least Square (PLS as the data analysis method. It was found that not all of the main UTAUT models were supported, because performance expectancy and effort expectancy have no effect on behavioral intention and use behavior to adopt ABC system. Whereas, social factors, information quality and facilitating conditions had a positive effect on behavioral intention and use behavior to adopt ABC system. The different results of this study with several previous studies are probably caused by the differences in the context of system, culture and characteristics of the sample. The implication of this study is not only to propose a theoretical framework for researches in future, but also useful for companies to optimize the use of ABC system that should be supported by top level and mid-level management and the readiness of the individu-als to accept the adoption of the ABC system.
DEFF Research Database (Denmark)
Nikolic, Branislav K.; Saha, Kamal K.; Markussen, Troels
2012-01-01
to two metallic zigzag graphene nanoribbons (ZGNRs) via highly transparent contacts. Such contacts make possible injection of evanescent wavefunctions from the ZGNR electrodes, so that their overlap within the molecular region generates a peak in the electronic transmission around the Fermi energy......We overview the nonequilibrium Green function combined with density functional theory (NEGF-DFT) approach to modeling of independent electronic and phononic quantum transport in nanoscale thermoelectrics with examples focused on a new class of devices where a single organic molecule is attached...
Okumura, Yuki; Kobayashi, Ryohei; Onishi, Takako; Shoyama, Yoshinari; Barret, Olivier; Alagille, David; Jennings, Danna; Marek, Kenneth; Seibyl, John; Tamagnan, Gilles; Tanaka, Akihiro; Shirakami, Yoshifumi
2016-01-01
Abstract Non-invasive imaging of amyloid-β in the brain, a hallmark of Alzheimer’s disease, may support earlier and more accurate diagnosis of the disease. In this study, we assessed the novel single photon emission computed tomography tracer 123 I-ABC577 as a potential imaging biomarker for amyloid-β in the brain. The radio-iodinated imidazopyridine derivative 123 I-ABC577 was designed as a candidate for a novel amyloid-β imaging agent. The binding affinity of 123 I-ABC577 for amyloid-β was evaluated by saturation binding assay and in vitro autoradiography using post-mortem Alzheimer’s disease brain tissue. Biodistribution experiments using normal rats were performed to evaluate the biokinetics of 123 I-ABC577. Furthermore, to validate 123 I-ABC577 as a biomarker for Alzheimer’s disease, we performed a clinical study to compare the brain uptake of 123 I-ABC577 in three patients with Alzheimer’s disease and three healthy control subjects. 123 I-ABC577 binding was quantified by use of the standardized uptake value ratio, which was calculated for the cortex using the cerebellum as a reference region. Standardized uptake value ratio images were visually scored as positive or negative. As a result, 123 I-ABC577 showed high binding affinity for amyloid-β and desirable pharmacokinetics in the preclinical studies. In the clinical study, 123 I-ABC577 was an effective marker for discriminating patients with Alzheimer’s disease from healthy control subjects based on visual images or the ratio of cortical-to-cerebellar binding. In patients with Alzheimer’s disease, 123 I-ABC577 demonstrated clear retention in cortical regions known to accumulate amyloid, such as the frontal cortex, temporal cortex, and posterior cingulate. In contrast, less, more diffuse, and non-specific uptake without localization to these key regions was observed in healthy controls. At 150 min after injection, the cortical standardized uptake value ratio increased by ∼60% in patients
Molecular electronics with single molecules in solid-state devices.
Moth-Poulsen, Kasper; Bjørnholm, Thomas
2009-09-01
The ultimate aim of molecular electronics is to understand and master single-molecule devices. Based on the latest results on electron transport in single molecules in solid-state devices, we focus here on new insights into the influence of metal electrodes on the energy spectrum of the molecule, and on how the electron transport properties of the molecule depend on the strength of the electronic coupling between it and the electrodes. A variety of phenomena are observed depending on whether this coupling is weak, intermediate or strong.
Transporter-mediated natural product–drug interactions for the treatment of cardiovascular diseases
Directory of Open Access Journals (Sweden)
Weibin Zha
2018-04-01
Full Text Available The growing use of natural products in cardiovascular (CV patients has been greatly raising the concerns about potential natural product–CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product–CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product–drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins have been identified to be substrates and inhibitors of the solute carrier (SLC transporters and the ATP-binding cassette (ABC transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product–CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product–CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product–CV drug interactions and help public and physicians understand these type of interactions. Keywords: Cardiovascular drugs, Natural products, Drug transporters, Natural product–drug interaction, Pharmacokinetics
International Nuclear Information System (INIS)
Svoboda, M.
2010-01-01
Eleven members of the organic anion transporting polypeptides (OATP) family have been identified in humans. They are responsible for the Na+ independent cellular uptake of a broad range of substances. The aim of this thesis was to investigate the possible role of OATPs present in various cancer entities including breast, bone, liver and ovary. In the first study, carrier-mediated uptake of paclitaxel was studied in X. laevis oocytes expressing all known human OATPs and in ovarian cancer cell lines. OATP1B1 could be identified as an uptake transporter for paclitaxel showing a Km value of 0.6 μM indicating high affinity to this taxane. Subsequently, the expression status of OATPs and several ABC transporters was assessed in malignant specimens from 191 ovarian cancer patients. OATP3A1 was significantly correlated with the FIGO stage of tumors. Moreover, OATP6A1, ABCB2 and ABCC3 were identified as highly significant predictor for the disease free survival of ovarian cancer patients. In additional studies we showed distinct OATP expression patterns in cancer tissues compared to normal tissue or benign tumors. In general, higher OATP levels were detected in normal tissues compared to malignant ones in breast cancer as well as bone cancer. In liver cancer, we observed upregulation of OATP2A1 and 5A1 in primary and secondary hepatic tumors but OATP4A1 was only upregulated in secondary hepatic tumors. The distinct expression pattern for individual OATPs in tumor cells suggest their specific functions which may involve transport of molecules important for cellular signaling as well as of drugs used in therapy. (author) [de
Why activity based costing (ABC) is still tagging behind the traditional costing in Malaysia?
Rasiah, Devinaga
2011-01-01
This study compares activity-based costing (ABC) model and traditional costing method in Malaysia. Activity based costing (ABC) which was developed into the manufacturing/service sectors in Malaysia. It calculates the cost and performance of activities, resources and cost objects. It can be considered as an alternative model to Traditional Cost-based accounting systems. In this study the results indicated that most operations managers believed that their present cost systems were adequate for...
Kuriakose, Jerrin
2014-01-01
Multidrug resistance (MDR) is the condition where cancer cells or microorganisms cease to respond to multiple drugs. MDR conferred by efflux transporters, that deprive the bioavailability of drugs at their site of action, are a threat to cancer and malarial chemotherapy. Specifically, the mammalian ABC transporter Pglycoprotein (P-gp) has undermined many drugs in treatment of cancer and other disease states. Mutations in the parasitic transporter Plasmodium falciparum chloroquine resistance t...
Kasyanenko, Valeriy Mitrofanovich
Measuring the three-dimensional structure of molecules, dynamics of structural changes, and energy transport on a molecular scale is important for many areas of natural science. Supplementing the widely used methods of x-ray diffraction, NMR, and optical spectroscopies, a two-dimensional infrared spectroscopy (2DIR) method was introduced about a decade ago. The 2DIR method measures pair-wise interactions between vibrational modes in molecules, thus acquiring molecular structural constraints such as distances between vibrating groups and the angles between their transition dipoles. The 2DIR method has been applied to a variety of molecular systems but in studying larger molecules such as proteins and peptides the method is facing challenges associated with the congestion of their vibrational spectra and delocalized character of their vibrational modes. To help extract structural information from such spectra and make efficient use of vibrational modes separated by large distances, a novel relaxation-assisted 2DIR method (RA 2DIR) has recently been proposed, which exploits the transport of excess vibrational energy from the initially excited mode. With the goal of further development of RA 2DIR, we applied it to a variety of molecular systems, including model compounds, transition-metal complexes, and isomers. The experiments revealed several novel effects which both enhance the power of RA 2DIR and bring a deeper understanding to the fundamental process of energy transport on a molecular level. We demonstrated that RA 2DIR can enhance greatly (27-fold) the cross-peak amplitude among spatially remote modes, which leads to an increase of the range of distances accessible for structural measurements by several fold. We demonstrated that the energy transport time correlates with the intermode distance. This correlation offers a new way for identifying connectivity patterns in molecules. We developed two models of energy transport in molecules. In one, a spatial overlap
Acid mine water reclamation using the ABC process
CSIR Research Space (South Africa)
De Beer, Morris
2010-09-01
Full Text Available of about 2 to 4.5 g/L of sulphate, 250 to 1200 mg/L of Ferrous iron, 60 to 175 mg/L of Mn and 120 mg/L of Mg. The CSIR ABC desalination process, developed for AMD neutralisation and the removal of total dissolved solids from 2 600 to 360 mg/L...
Preconceptual ABC design definition and system configuration layout
International Nuclear Information System (INIS)
Barthold, W.
1995-03-01
This document is the conceptual design document for the follow-on to the Molten Salt Breeder Reactor, known as the ABC type reactor. It addresses blanket design options, containment options, off-gas systems, drainage systems, and components/layouts of the primary, secondary, and tertiary systems, and it contains a number of diagrams for the configuration of the major systems
Carrano, A.; Snkhchyan, H.; Kooij, G.; van der Pol, S.; van Horssen, J.; Veerhuis, R.; Hoozemans, J.J.M.; Rozemuller, A.J.M.; de Vries, H.E.
2014-01-01
Alzheimer's disease (AD) is the most common form of dementia and marked by deposition of amyloid-β (Aβ) within the brain. Alterations of Aβ transporters at the neurovasculature may play a role in the disease process. We investigated the expression of ABC transporters P-glycoprotein (P-gp) and breast
Computed ABC Analysis for Rational Selection of Most Informative Variables in Multivariate Data.
Ultsch, Alfred; Lötsch, Jörn
2015-01-01
Multivariate data sets often differ in several factors or derived statistical parameters, which have to be selected for a valid interpretation. Basing this selection on traditional statistical limits leads occasionally to the perception of losing information from a data set. This paper proposes a novel method for calculating precise limits for the selection of parameter sets. The algorithm is based on an ABC analysis and calculates these limits on the basis of the mathematical properties of the distribution of the analyzed items. The limits implement the aim of any ABC analysis, i.e., comparing the increase in yield to the required additional effort. In particular, the limit for set A, the "important few", is optimized in a way that both, the effort and the yield for the other sets (B and C), are minimized and the additional gain is optimized. As a typical example from biomedical research, the feasibility of the ABC analysis as an objective replacement for classical subjective limits to select highly relevant variance components of pain thresholds is presented. The proposed method improved the biological interpretation of the results and increased the fraction of valid information that was obtained from the experimental data. The method is applicable to many further biomedical problems including the creation of diagnostic complex biomarkers or short screening tests from comprehensive test batteries. Thus, the ABC analysis can be proposed as a mathematically valid replacement for traditional limits to maximize the information obtained from multivariate research data.
Selections from the ABC 2011 Annual Convention, Montreal, Canada
Whalen, D. Joel; Andersen, Ken; Campbell, Gloria; Crenshaw, Cheri; Cross, Geoffrey A.; Grinols, Anne Bradstreet; Hildebrand, John; Newman, Amy; Ortiz, Lorelei A.; Paulson, Edward; Phillabaum, Melinda; Powell, Elizabeth A.; Sloan, Ryan
2012-01-01
The 12 Favorite Assignments featured in this article were presented at the 2011 Annual Convention of the Association for Business Communication (ABC), Montreal, Canada. A variety of learning objectives are featured: delivering bad news, handling difficult people, persuasion, reporting financial analysis, electronic media, face-to-face…
Selections from the ABC 2012 Annual Convention, Honolulu, Hawaii
Whalen, D. Joel
2013-01-01
The 13 Favorite Assignments featured here were presented at the 2012 Association for Business Communication (ABC) Annual Convention, Honolulu, Hawaii. A variety of learning objectives are featured, including the following: enhancing resume's visual impact, interpersonal skills, social media, team building, web design, community service projects,…
Transporter-mediated natural product-drug interactions for the treatment of cardiovascular diseases.
Zha, Weibin
2018-04-01
The growing use of natural products in cardiovascular (CV) patients has been greatly raising the concerns about potential natural product-CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product-CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product-drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins) have been identified to be substrates and inhibitors of the solute carrier (SLC) transporters and the ATP-binding cassette (ABC) transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients) are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product-CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product-CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product-CV drug interactions and help public and physicians understand these type of interactions. Copyright © 2017. Published by Elsevier B.V.
Fischer, Jana; Kleinau, Gunnar; Rutz, Claudia; Zwanziger, Denise; Khajavi, Noushafarin; Müller, Anne; Rehders, Maren; Brix, Klaudia; Worth, Catherine L; Führer, Dagmar; Krude, Heiko; Wiesner, Burkhard; Schülein, Ralf; Biebermann, Heike
2018-06-01
G-protein-coupled receptors (GPCRs) can constitute complexes with non-GPCR integral membrane proteins, while such interaction has not been demonstrated at a single molecule level so far. We here investigated the potential interaction between the thyrotropin receptor (TSHR) and the monocarboxylate transporter 8 (MCT8), a member of the major facilitator superfamily (MFS), using fluorescence cross-correlation spectroscopy (FCCS). Both the proteins are expressed endogenously on the basolateral plasma membrane of the thyrocytes and are involved in stimulation of thyroid hormone production and release. Indeed, we demonstrate strong interaction between both the proteins which causes a suppressed activation of G q/11 by TSH-stimulated TSHR. Thus, we provide not only evidence for a novel interaction between the TSHR and MCT8, but could also prove this interaction on a single molecule level. Moreover, this interaction forces biased signaling at the TSHR. These results are of general interest for both the GPCR and the MFS research fields.
Is the ABC pain scale reliable for premature babies?
Bellieni, Cv; Maffei, M; Ancora, G; Cordelli, D; Mastrocola, M; Faldella, G; Ferretti, E; Buonocore, G
2007-07-01
We recently developed the ABC scale to assess pain in term newborns. The aim of the present study was to assess the reliability of the scale in preterm babies. The scale consists of three cry parameters: (a) pitch of the first cry, (b) rhythmicity of the bout of crying and (c) cry constancy. Changes in these parameters were previously found to distinguish medium and high levels of pain as evaluated by spectral analysis of crying. We enrolled 72 babies to perform the steps usually requested to validate a scale, namely the study of the concurrent validity, specificity and sensibility. Moreover, we assessed the interjudge reliability and the clinical utility and ease of the scale. A good correlation (r = 0.68; r(2)= 0.45; p babies who underwent pain and babies who underwent non-painful stimulus.) Interobserver reliability was good: Cohen's kappa = 0.7. The good correlation between the two scales shows that the ABC scale is also reliable for premature babies.
Possibility designing half-wave and full-wave molecular rectifiers by using single benzene molecule
Abbas, Mohammed A.; Hanoon, Falah H.; Al-Badry, Lafy F.
2018-02-01
This work focused on possibility designing half-wave and full-wave molecular rectifiers by using single and two benzene rings, respectively. The benzene rings were threaded by a magnetic flux that changes over time. The quantum interference effect was considered as the basic idea in the rectification action, the para and meta configurations were investigated. All the calculations are performed by using steady-state theoretical model, which is based on the time-dependent Hamiltonian model. The electrical conductance and the electric current are considered as DC output signals of half-wave and full-wave molecular rectifiers. The finding in this work opens up the exciting potential to use these molecular rectifiers in molecular electronics.
Rapid cloning and bioinformatic analysis of spinach Y chromosome ...
Indian Academy of Sciences (India)
Rapid cloning and bioinformatic analysis of spinach Y chromosome- specific EST sequences. Chuan-Liang Deng, Wei-Li Zhang, Ying Cao, Shao-Jing Wang, ... Arabidopsis thaliana mRNA for mitochondrial half-ABC transporter (STA1 gene). 389 2.31E-13. 98.96. SP3−12. Betula pendula histidine kinase 3 (HK3) mRNA, ...
Karthikeyan, Subburayan; Hoti, Sugeerappa Laxmanappa; Nazeer, Yasin; Hegde, Harsha Vasudev
2016-07-05
Multidrug resistance (MDR) is considered to be the major contributor to failure of chemotherapy in oral squamous cell carcinoma (SCC). This study was aimed to explore the effects and mechanisms of glaucarubinone (GLU), one of the major quassinoids from Simarouba glauca DC, in potentiating cytotoxicity of paclitaxel (PTX), an anticancer drug in KB cells. Our data showed that the administration of GLU pre-treatment significantly enhanced PTX anti-proliferative effect in ABCB1 over-expressing KB cells. The Rh 123 drug efflux studies revealed that there was a significant transport function inhibition by GLU-PTX treatment. Interestingly, it was also found that this enhanced anticancer efficacy of GLU was associated with PTX-induced cell arrest in the G2/M phase of cell cycle. Further, the combined treatment of GLU-PTX had significant decrease in the expression levels of P-gp, MRPs, and BCRP in resistant KB cells at both mRNA and protein levels. Furthermore, the combination treatments showed significant reactive oxygen species (ROS) production, chromatin condensation and reduced mitochondrial membrane potential in resistant KB cells. The results from DNA fragmentation analysis also demonstrated the GLU induced apoptosis in KB cells and its synergy with PTX. Importantly, GLU and/or PTX triggered apoptosis through the activation of pro-apoptotic proteins such as p53, Bax, and caspase-9. Our findings demonstrated for the first time that GLU causes cell death in human oral cancer cells via the ROS-dependent suppression of MDR transporters and p53-mediated activation of the intrinsic mitochondrial pathway of apoptosis. Additionally, the present study also focussed on investigation of the protective effect of GLU and combination drugs in human normal blood lymphocytes. Normal blood lymphocytes assay indicated that GLU is able to induce selective toxicity in cancer cells and in silico molecular docking studies support the choice of GLU as ABC inhibitor to enhance PTX efficacy
Vipsi ABC Grupp teatas kavatsusest börsile minna / Anne Oja
Oja, Anne, 1970-
2010-01-01
Kaubanduskontsern ABC Grupp maksis tagasi 97,2 mln. krooni eest võlakirju, juhatuse esimehe teatel kasutab ettevõtte meeskond saadud kogemusi naasmaks tulevikus avaliku ettevõtte staatusesse juba aktsiaemitendina
Comparing the results of DAADD and ABC of children included in autism spectrum disorders.
Barbosa, Milene Rossi Pereira; Fernandes, Fernanda Dreux Miranda
2014-01-01
To verify if there are characteristic behaviors of the different diagnosis included in the autism spectrum according to the Differential Assessment of Autism and Other Developmental Disorders (DAADD) and to the Autism Behavior Checklist (ABC). Participants were 45 individuals and their respective speech-language therapists. All therapists are graduate students working with the children for at least 1 year. This time was considered sufficient to the therapists to have the information required by the DAADD questionnaire. It is comprised by 3 protocols specifically designed to children with 2 to 4 years, 4 to 6 years and 6 to 8 years, the same criteria used to separate the research groups, G1, G2 and G3, respectively. Data referring to the ABC were retrieved from the subject's files at the Laboratório de Investigação Fonoaudiológica nos Distúrbios do Espectro do Autismo (Research Laboratory on Language Disorders in the Autism Spectrum) of the School of Medicine, Universidade de São Paulo, where it is routinely applied during the annual assessment. Answers to the different areas of DAADD are similar to the different areas of ABC. These data show data the diagnosis by DAADD is easier in older children. Although there is no significant difference, the large occurrence of Rett's syndrome diagnosis according to the DAADD was associated to higher risk for autism according to the ABC in G1. With increasing age this tendency decreases and either in G2 and G3 Autism is the most frequent diagnosis. Although the results of both questionnaires tend to agree more with increasing age, the DAADD is more sensitive in the different ages while the ABC if more specific only to older children.