WorldWideScience

Sample records for hairpin rna constructs

  1. An approach to the construction of tailor-made amphiphilic peptides that strongly and selectively bind to hairpin RNA targets.

    Science.gov (United States)

    Lee, Su Jin; Hyun, Soonsil; Kieft, Jeffrey S; Yu, Jaehoon

    2009-02-18

    The hairpin RNA motif is one of the most frequently observed secondary structures and is often targeted by therapeutic agents. An amphiphilic peptide with seven lysine and eight leucine residues and its derivatives were designed for use as ligands against RNA hairpin motifs. We hypothesized that variations in both the hydrophobic leucine-rich and hydrophilic lysine-rich spheres of these amphiphilic peptides would create extra attractive interactions with hairpin RNA targets. A series of alanine-scanned peptides were probed to identify the most influential lysine residues in the hydrophilic sphere. The binding affinities of these modified peptides with several hairpins, such as RRE, TAR from HIV, a short hairpin from IRES of HCV, and a hairpin from the 16S A-site stem from rRNA, were determined. Since the hairpin from IRES of HCV was the most susceptible to the initial series of alanine-scanned peptides, studies investigating how further variations in the peptides effect binding employed the IRES hairpin. Next, the important Lys residues were substituted by shorter chain amines, such as ornithine, to place the peptide deeper into the hairpin groove. In a few cases, a 70-fold improved binding was observed for peptides that contained the specifically located shorter amine side chains. To further explore changes in binding affinities brought about by alterations in the hydrophobic sphere, tryptophan residues were introduced in place of leucine. A few peptides with tryptophan in specific positions also displayed 70-fold improved binding affinities. Finally, double mutant peptides incorporating both specifically located shorter amine side chains in the hydrophilic region and tryptophan residues in the hydrophobic region were synthesized. The binding affinities of peptides containing the simple double modification were observed to be 80 times lower, and their binding specificities were increased 40-fold. The results of this effort provide important information about

  2. Hairpin-Hairpin Molecular Beacon Interactions for Detection of Survivin mRNA in Malignant SW480 Cells.

    Science.gov (United States)

    Ratajczak, Katarzyna; Krazinski, Bartlomiej E; Kowalczyk, Anna E; Dworakowska, Beata; Jakiela, Slawomir; Stobiecka, Magdalena

    2018-05-07

    Cancer biomarkers offer unique prospects for the development of cancer diagnostics and therapy. One of such biomarkers, protein survivin (Sur), exhibits strong antiapoptotic and proliferation-enhancing properties and is heavily expressed in multiple cancers. Thus, it can be utilized to provide new modalities for modulating the cell-growth rate, essential for effective cancer treatment. Herein, we have focused on the development of a new survivin-based cancer detection platform for colorectal cancer cells SW480 using a turn-on fluorescence oligonucleotide molecular beacon (MB) probe, encoded to recognize Sur messenger RNA (mRNA). Contrary to the expectations, we have found that both the complementary target oligonucleotide strands as well as the single- and double-mismatch targets, instead of exhibiting the anticipated simple random conformations, preferentially formed secondary structure motifs by folding into small-loop hairpin structures. Such a conformation may interfere with, or even undermine, the biorecognition process. To gain better understanding of the interactions involved, we have replaced the classical Tyagi-Kramer model of interactions between a straight target oligonucleotide strand and a hairpin MB with a new model to account for the hairpin-hairpin interactions as the biorecognition principle. A detailed mechanism of these interactions has been proposed. Furthermore, in experimental work, we have demonstrated an efficient transfection of malignant SW480 cells with SurMB probes containing a fluorophore Joe (SurMB-Joe) using liposomal nanocarriers. The green emission from SurMB-Joe in transfected cancer cells, due to the hybridization of the SurMB-Joe loop with Sur mRNA hairpin target, corroborates Sur overexpression. On the other hand, healthy human-colon epithelial cells CCD 841 CoN show only negligible expression of survivin mRNA. These experiments provide the proof-of-concept for distinguishing between the cancer and normal cells by the proposed

  3. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  4. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong [State Key Laboratory of Medicinal Chemical Biology, Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [State Key Laboratory of Medicinal Chemical Biology, Department of Cancer Research, College of Life Sciences, Nankai University, Tianjin 300071 (China)

    2015-04-03

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.

  5. A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

    International Nuclear Information System (INIS)

    Gao, Yuen; Wang, Yuan; Feng, Jinyan; Feng, Guoxing; Zheng, Minying; Yang, Zhe; Xiao, Zelin; Lu, Zhanping; Ye, Lihong; Zhang, Xiaodong

    2015-01-01

    The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within its 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro

  6. Novel guanidinylated bioresponsive poly(amidoamines designed for short hairpin RNA delivery

    Directory of Open Access Journals (Sweden)

    Yu J

    2016-12-01

    Full Text Available Jiankun Yu,1 Jinmin Zhang,1 Haonan Xing,1 Yanping Sun,1 Zhen Yang,1 Tianzhi Yang,2 Cuifang Cai,1 Xiaoyun Zhao,3 Li Yang,1 Pingtian Ding1 1School of Pharmacy, Shenyang Pharmaceutical University, Shenyang, China; 2Department of Basic Pharmaceutical Sciences, School of Pharmacy, Husson University, Bangor, ME, USA; 3Department of Microbiology and Cell Biology, School of Life Science and Biopharmaceutics, Shenyang Pharmaceutical University, Shenyang, China Abstract: Two different disulfide (SS-containing poly(amidoamine (PAA polymers were constructed using guanidino (Gua-containing monomers (ie, arginine [Arg] and agmatine [Agm] and N,N'-cystamine bisacrylamide (CBA by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the

  7. Short hairpin RNA interference therapy for ischemic heart disease

    Science.gov (United States)

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

  8. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  9. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  10. Opening of the TAR hairpin in the HIV-1 genome causes aberrant RNA dimerization and packaging

    Directory of Open Access Journals (Sweden)

    Das Atze T

    2012-07-01

    Full Text Available Abstract Background The TAR hairpin is present at both the 5′ and 3′ end of the HIV-1 RNA genome. The 5′ element binds the viral Tat protein and is essential for Tat-mediated activation of transcription. We recently observed that complete TAR deletion is allowed in the context of an HIV-1 variant that does not depend on this Tat-TAR axis for transcription. Mutations that open the 5′ stem-loop structure did however affect the leader RNA conformation and resulted in a severe replication defect. In this study, we set out to analyze which step of the HIV-1 replication cycle is affected by this conformational change of the leader RNA. Results We demonstrate that opening the 5′ TAR structure through a deletion in either side of the stem region caused aberrant dimerization and reduced packaging of the unspliced viral RNA genome. In contrast, truncation of the TAR hairpin through deletions in both sides of the stem did not affect RNA dimer formation and packaging. Conclusions These results demonstrate that, although the TAR hairpin is not essential for RNA dimerization and packaging, mutations in TAR can significantly affect these processes through misfolding of the relevant RNA signals.

  11. Thermodynamic matchers for the construction of the cuckoo RNA family.

    Science.gov (United States)

    Reinkensmeier, Jan; Giegerich, Robert

    2015-01-01

    RNA family models describe classes of functionally related, non-coding RNAs based on sequence and structure conservation. The most important method for modeling RNA families is the use of covariance models, which are stochastic models that serve in the discovery of yet unknown, homologous RNAs. However, the performance of covariance models in finding remote homologs is poor for RNA families with high sequence conservation, while for families with high structure but low sequence conservation, these models are difficult to built in the first place. A complementary approach to RNA family modeling involves the use of thermodynamic matchers. Thermodynamic matchers are RNA folding programs, based on the established thermodynamic model, but tailored to a specific structural motif. As thermodynamic matchers focus on structure and folding energy, they unfold their potential in discovering homologs, when high structure conservation is paired with low sequence conservation. In contrast to covariance models, construction of thermodynamic matchers does not require an input alignment, but requires human design decisions and experimentation, and hence, model construction is more laborious. Here we report a case study on an RNA family that was constructed by means of thermodynamic matchers. It starts from a set of known but structurally different members of the same RNA family. The consensus secondary structure of this family consists of 2 to 4 adjacent hairpins. Each hairpin loop carries the same motif, CCUCCUCCC, while the stems show high variability in their nucleotide content. The present study describes (1) a novel approach for the integration of the structurally varying family into a single RNA family model by means of the thermodynamic matcher methodology, and (2) provides the results of homology searches that were conducted with this model in a wide spectrum of bacterial species.

  12. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  13. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  14. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Singh Upinder

    2009-02-01

    Full Text Available Abstract Background Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. Results An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Conclusion Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  15. Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica.

    Science.gov (United States)

    Linford, Alicia S; Moreno, Heriberto; Good, Katelyn R; Zhang, Hanbang; Singh, Upinder; Petri, William A

    2009-02-17

    Entamoeba histolytica is an intestinal protozoan parasite of humans. The genome has been sequenced, but the study of individual gene products has been hampered by the lack of the ability to generate gene knockouts. We chose to test the use of RNA interference to knock down gene expression in Entamoeba histolytica. An episomal vector-based system, using the E. histolytica U6 promoter to drive expression of 29-basepair short hairpin RNAs, was developed to target protein-encoding genes in E. histolytica. The short hairpin RNAs successfully knocked down protein levels of all three unrelated genes tested with this system: Igl, the intermediate subunit of the galactose- and N-acetyl-D-galactosamine-inhibitable lectin; the transcription factor URE3-BP; and the membrane binding protein EhC2A. Igl levels were reduced by 72%, URE3-BP by 89%, and EhC2A by 97%. Use of the U6 promoter to drive expression of 29-basepair short hairpin RNAs is effective at knocking down protein expression for unrelated genes in Entamoeba histolytica, providing a useful tool for the study of this parasite.

  16. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

    Directory of Open Access Journals (Sweden)

    Fangquan Wang

    2016-05-01

    Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  17. Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

    Science.gov (United States)

    Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

    2016-05-11

    Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

  18. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  19. The Drosophila Helicase MLE Targets Hairpin Structures in Genomic Transcripts.

    Directory of Open Access Journals (Sweden)

    Simona Cugusi

    2016-01-01

    Full Text Available RNA hairpins are a common type of secondary structures that play a role in every aspect of RNA biochemistry including RNA editing, mRNA stability, localization and translation of transcripts, and in the activation of the RNA interference (RNAi and microRNA (miRNA pathways. Participation in these functions often requires restructuring the RNA molecules by the association of single-strand (ss RNA-binding proteins or by the action of helicases. The Drosophila MLE helicase has long been identified as a member of the MSL complex responsible for dosage compensation. The complex includes one of two long non-coding RNAs and MLE was shown to remodel the roX RNA hairpin structures in order to initiate assembly of the complex. Here we report that this function of MLE may apply to the hairpins present in the primary RNA transcripts that generate the small molecules responsible for RNA interference. Using stocks from the Transgenic RNAi Project and the Vienna Drosophila Research Center, we show that MLE specifically targets hairpin RNAs at their site of transcription. The association of MLE at these sites is independent of sequence and chromosome location. We use two functional assays to test the biological relevance of this association and determine that MLE participates in the RNAi pathway.

  20. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    Directory of Open Access Journals (Sweden)

    Robert J Scarborough

    2014-01-01

    Full Text Available Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies.

  1. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  2. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  3. Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

    Science.gov (United States)

    Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia

    2012-01-01

    Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603

  4. Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

    Directory of Open Access Journals (Sweden)

    Gregory Upert

    2012-01-01

    Full Text Available Human immunodeficiency virus-1 (HIV-1 replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR, to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP cation-based vectors that efficiently deliver nucleotide analogs (PNAs into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins.

  5. Thermodynamics and kinetics of RNA tertiary structure formation in the junctionless hairpin ribozyme.

    Science.gov (United States)

    White, Neil A; Hoogstraten, Charles G

    2017-09-01

    The hairpin ribozyme consists of two RNA internal loops that interact to form the catalytically active structure. This docking transition is a rare example of intermolecular formation of RNA tertiary structure without coupling to helix annealing. We have used temperature-dependent surface plasmon resonance (SPR) to characterize the thermodynamics and kinetics of RNA tertiary structure formation for the junctionless form of the ribozyme, in which loops A and B reside on separate molecules. We find docking to be strongly enthalpy-driven and to be accompanied by substantial activation barriers for association and dissociation, consistent with the structural reorganization of both internal loops upon complex formation. Comparisons with the parallel analysis of a ribozyme variant carrying a 2'-O-methyl modification at the self-cleavage site and with published data in other systems reveal a surprising diversity of thermodynamic signatures, emphasizing the delicate balance of contributions to the free energy of formation of RNA tertiary structure. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Water isotope effect on the thermostability of a polio viral RNA hairpin: A metadynamics study

    Science.gov (United States)

    Pathak, Arup K.; Bandyopadhyay, Tusar

    2017-04-01

    Oral polio vaccine is considered to be the most thermolabile of all the common childhood vaccines. Despite heavy water (D2O) having been known for a long time to stabilise attenuated viral RNA against thermodegradation, the molecular underpinnings of its mechanism of action are still lacking. Whereas, understanding the basis of D2O action is an important step that might reform the way other thermolabile drugs are stored and could possibly minimize the cold chain problem. Here using a combination of parallel tempering and well-tempered metadynamics simulation in light water (H2O) and in D2O, we have fully described the free energy surface associated with the folding/unfolding of a RNA hairpin containing a non-canonical basepair motif, which is conserved within the 3'-untranslated region of poliovirus-like enteroviruses. Simulations reveal that in heavy water (D2O) there is a considerable increase of the stability of the folded basin as monitored through an intramolecular hydrogen bond (HB), size, shape, and flexibility of RNA structures. This translates into a higher melting temperature in D2O by 41 K when compared with light water (H2O). We have explored the hydration dynamics of the RNA, hydration shell around the RNA surface, and spatial dependence of RNA-solvent collective HB dynamics in the two water systems. Simulation in heavy water clearly showed that D2O strengthens the HB network in the solvent, lengthens inter-residue water-bridge lifetime, and weakens dynamical coupling of the hairpin to its solvation environment, which enhances the rigidity of solvent exposed sites of the native configurations. The results might suggest that like other added osmoprotectants, D2O can act as a thermostabilizer when used as a solvent.

  7. Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

    Directory of Open Access Journals (Sweden)

    Tae Kwann Park

    2017-09-01

    Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

  8. Dicer-independent processing of short hairpin RNAs

    NARCIS (Netherlands)

    Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

    2013-01-01

    Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

  9. Function and anatomy of plant siRNA pools derived from hairpin transgenes

    Directory of Open Access Journals (Sweden)

    Lee Kevin AW

    2007-11-01

    Full Text Available Abstract Background RNA interference results in specific gene silencing by small-interfering RNAs (siRNAs. Synthetic siRNAs provide a powerful tool for manipulating gene expression but high cost suggests that novel siRNA production methods are desirable. Strong evolutionary conservation of siRNA structure suggested that siRNAs will retain cross-species function and that transgenic plants expressing heterologous siRNAs might serve as useful siRNA bioreactors. Here we report a detailed evaluation of the above proposition and present evidence regarding structural features of siRNAs extracted from plants. Results Testing the gene silencing capacity of plant-derived siRNAs in mammalian cells proved to be very challenging and required partial siRNA purification and design of a highly sensitive assay. Using the above assay we found that plant-derived siRNAs are ineffective for gene silencing in mammalian cells. Plant-derived siRNAs are almost exclusively double-stranded and most likely comprise a mixture of bona fide siRNAs and aberrant partially complementary duplexes. We also provide indirect evidence that plant-derived siRNAs may contain a hitherto undetected physiological modification, distinct from 3' terminal 2-O-methylation. Conclusion siRNAs produced from plant hairpin transgenes and extracted from plants are ineffective for gene silencing in mammalian cells. Thus our findings establish that a previous claim that transgenic plants offer a cost-effective, scalable and sustainable source of siRNAs is unwarranted. Our results also indicate that the presence of aberrant siRNA duplexes and possibly a plant-specific siRNA modification, compromises the gene silencing capacity of plant-derived siRNAs in mammalian cells.

  10. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  11. Differential RNAi responses of Nicotiana benthamiana individuals transformed with a hairpin-inducing construct during Plum pox virus challenge.

    Science.gov (United States)

    Montes, Christian; Castro, Álvaro; Barba, Paola; Rubio, Julia; Sánchez, Evelyn; Carvajal, Denisse; Aguirre, Carlos; Tapia, Eduardo; DelÍ Orto, Paola; Decroocq, Veronique; Prieto, Humberto

    2014-10-01

    Gene silencing and large-scale small RNA analysis can be used to develop RNA interference (RNAi)-based resistance strategies for Plum pox virus (PPV), a high impact disease of Prunus spp. In this study, a pPPViRNA hairpin-inducing vector harboring two silencing motif-rich regions of the PPV coat protein (CP) gene was evaluated in transgenic Nicotiana benthamiana (NB) plants. Wild-type NB plants infected with a chimeric PPV virus (PPV::GFP) exhibited affected leaves with mosaic chlorosis congruent to GFP fluorescence at 21 day post-inoculation; transgenic lines depicted a range of phenotypes from fully resistant to susceptible. ELISA values and GFP fluorescence intensities were used to select transgenic-resistant (TG-R) and transgenic-susceptible (TG-S) lines for further characterization of small interfering RNAs (siRNAs) by large-scale small RNA sequencing. In infected TG-S and untransformed (WT) plants, the observed siRNAs were nearly exclusively 21- and 22-nt siRNAs that targeted the whole PPV::GFP genome; 24-nt siRNAs were absent in these individuals. Challenged TG-R plants accumulated a full set of 21- to 24-nt siRNAs that were primarily associated with the selected motif-rich regions, indicating that a trans-acting siRNAs process prevented viral multiplication. BLAST analysis identified 13 common siRNA clusters targeting the CP gene. 21-nt siRNA sequences were associated with the 22-nt siRNAs and the scarce 23- and 24-nt molecules in TG-S plants and with most of the observed 22-, 23-, and 24-nt siRNAs in TG-R individuals. These results validate the use of a multi-hot spot silencing vector against PPV and elucidate the molecules by which hairpin-inducing vectors initiate RNAi in vivo.

  12. Enzyme-free electrochemical detection of microRNA-21 using immobilized hairpin probes and a target-triggered hybridization chain reaction amplification strategy

    International Nuclear Information System (INIS)

    Liu, Hongying; Bei, Xiaoqiong; Xia, Qiuting; Fu, Yan; Zhang, Shi; Liu, Maochuan; Fan, Kai; Zhang, Mingzhen; Yang, Yong

    2016-01-01

    We describe a sensitive enzyme-free bioassay for the determination of microRNA-21. It is based on a combination of target-triggered hybridization chain reaction, tagging with CdTe quantum dots (QDs), and anodic stripping voltammetry. Firstly, a thiolated capture hairpin probe SH-HP1 was immobilized on the surface of a gold electrode. HP1 unfolds in the presence of microRNA-21. If hairpin probe 2 (HP2) is present, a HP1-HP2 complex will be formed which possesses an exposed stem of HP2, and microRNA is released in parallel. The released microRNA-21 triggers a hybridization chain reaction and this leads to form an exposed DNA segment of HP2 and cycle use microRNA-21. With the aid of assistant DNA A1 and A2, the exposed DNA segment of HP2 progressed to a long double strand. The strand is rich in CdTe QDs with the help of QDs-A1. Then, the attached QDs were dissolved with HNO 3 to give dissolved Cd(II) ions. Finally, the corresponding electrochemical current response of Cd(II) is monitored by anodic stripping voltammetry and used to quantify the concentration of microRNA-21. More microRNA-21 participated in this reaction increases the number of CdTe QDs, which results in increased electrochemical current. Thus, an ultrasensitive detection of microRNA-21 is accomplished by anodic stripping voltammetry. This gene assay displays a detection limit as low as 33 aM. It can discriminate between complementary DNA sequence and single-base mismatched DNA, indicating its high specificity. (author)

  13. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection.

    Science.gov (United States)

    Pandolfini, Tiziana; Molesini, Barbara; Avesani, Linda; Spena, Angelo; Polverari, Annalisa

    2003-06-25

    Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS), is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV) is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana). Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. In the ihprolC-PP197 gene (intron hair pin rolC PPV 197), a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330) was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80%) transgenic plants are virus free and symptomless. Some plants (20%) contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23-25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation. Transitivity of siRNAs was observed in

  14. Mapping the universe of RNA tetraloop folds

    DEFF Research Database (Denmark)

    Bottaro, Sandro; Lindorff-Larsen, Kresten

    2017-01-01

    We report a map of RNA tetraloop conformations constructed by calculating pairwise distances among all experimentally determined four-nucleotide hairpin loops. Tetraloops with similar structures are clustered together and, as expected, the two largest clusters are the canonical GNRA and UNCG fold...

  15. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Expression of self-complementary hairpin RNA under the control of the rolC promoter confers systemic disease resistance to plum pox virus without preventing local infection

    Directory of Open Access Journals (Sweden)

    Spena Angelo

    2003-06-01

    Full Text Available Abstract Background Homology-dependent selective degradation of RNA, or post-transcriptional gene silencing (PTGS, is involved in several biological phenomena, including adaptative defense mechanisms against plant viruses. Small interfering RNAs mediate the selective degradation of target RNA by guiding a multicomponent RNAse. Expression of self-complementary hairpin RNAs within two complementary regions separated by an intron elicits PTGS with high efficiency. Plum pox virus (PPV is the etiological agent of sharka disease in Drupaceae, although it can also be transmitted to herbaceous species (e.g. Nicotiana benthamiana. Once inside the plant, PPV is transmitted via plasmodesmata from cell to cell, and at longer distances, via phloem. The rolC promoter drives expression in phloem cells. RolC expression is absent in both epidermal and mesophyll cells. The aim of the present study was to confer systemic disease resistance without preventing local viral infection. Results In the ihprolC-PP197 gene (intron hair pin rolC PPV 197, a 197 bp sequence homologous to the PPV RNA genome (from base 134 to 330 was placed as two inverted repeats separated by the DNA sequence of the rolA intron. This hairpin construct is under the control of the rolC promoter.N. benthamiana plants transgenic for the ihprolC-PP197 gene contain siRNAs homologous to the 197 bp sequence. The transgenic progeny of ihprolC-PP197 plants are resistant to PPV systemic infection. Local infection is unaffected. Most (80% transgenic plants are virus free and symptomless. Some plants (20% contain virus in uninoculated apical leaves; however they show only mild symptoms of leaf mottling. PPV systemic resistance cosegregates with the ihprolC-PP197 transgene and was observed in progeny plants of all independent transgenic lines analyzed. SiRNAs of 23–25 nt homologous to the PPV sequence used in the ihprolC-PP197 construct were detected in transgenic plants before and after inoculation

  17. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  18. A four-way junction accelerates hairpin ribozyme folding via a discrete intermediate

    Science.gov (United States)

    Tan, Elliot; Wilson, Timothy J.; Nahas, Michelle K.; Clegg, Robert M.; Lilley, David M. J.; Ha, Taekjip

    2003-01-01

    The natural form of the hairpin ribozyme comprises two major structural elements: a four-way RNA junction and two internal loops carried by adjacent arms of the junction. The ribozyme folds into its active conformation by an intimate association between the loops, and the efficiency of this process is greatly enhanced by the presence of the junction. We have used single-molecule spectroscopy to show that the natural form fluctuates among three distinct states: the folded state and two additional, rapidly interconverting states (proximal and distal) that are inherited from the junction. The proximal state juxtaposes the two loop elements, thereby increasing the probability of their interaction and thus accelerating folding by nearly three orders of magnitude and allowing the ribozyme to fold rapidly in physiological conditions. Therefore, the hairpin ribozyme exploits the dynamics of the junction to facilitate the formation of the active site from its other elements. Dynamic interplay between structural elements, as we demonstrate for the hairpin ribozyme, may be a general theme for other functional RNA molecules. PMID:12883002

  19. Role of the DIS hairpin in replication of human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Berkhout, B.; van Wamel, J. L.

    1996-01-01

    The virion-associated genome of human immunodeficiency virus type 1 consists of a noncovalently linked dimer of two identical, unspliced RNA molecules. A hairpin structure within the untranslated leader transcript is postulated to play a role in RNA dimerization through base pairing of the

  20. Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods

    Science.gov (United States)

    Bizarro, C. V.; Alemany, A.; Ritort, F.

    2012-01-01

    RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710

  1. Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

    Science.gov (United States)

    Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.

    2013-01-01

    The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545

  2. Modeling the mechanism of CLN025 beta-hairpin formation

    Science.gov (United States)

    McKiernan, Keri A.; Husic, Brooke E.; Pande, Vijay S.

    2017-09-01

    Beta-hairpins are substructures found in proteins that can lend insight into more complex systems. Furthermore, the folding of beta-hairpins is a valuable test case for benchmarking experimental and theoretical methods. Here, we simulate the folding of CLN025, a miniprotein with a beta-hairpin structure, at its experimental melting temperature using a range of state-of-the-art protein force fields. We construct Markov state models in order to examine the thermodynamics, kinetics, mechanism, and rate-determining step of folding. Mechanistically, we find the folding process is rate-limited by the formation of the turn region hydrogen bonds, which occurs following the downhill hydrophobic collapse of the extended denatured protein. These results are presented in the context of established and contradictory theories of the beta-hairpin folding process. Furthermore, our analysis suggests that the AMBER-FB15 force field, at this temperature, best describes the characteristics of the full experimental CLN025 conformational ensemble, while the AMBER ff99SB-ILDN and CHARMM22* force fields display a tendency to overstabilize the native state.

  3. Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection.

    Science.gov (United States)

    Zhang, Jingpu; Li, Chao; Zhi, Xiao; Ramón, Gabriel Alfranca; Liu, Yanlei; Zhang, Chunlei; Pan, Fei; Cui, Daxiang

    2016-01-19

    MicroRNA (miRNA) biomarkers display great potential for cancer diagnosis and prognosis. The development of rapid and specific methods for miRNA detection has become a hotspot. Herein, hairpin DNA-templated silver nanoclusters (AgNCs/HpDNA) were prepared and integrated into strand-displacement amplification (SDA) as a novel beacon for miRNA detection. The light-up platform was established based on guanine (G)-rich fluorescence enhancement that essentially converted the excitation/emission pair of AgNCs/HpDNAs from a shorter wavelength to a longer wavelength, and then achieved fluorescent enhancement at longer wavelength. On the basis of the validation of the method, the single and duplex detection were conducted in two plasma biomarkers (miR-16-5p and miR-19b-3p) for the diagnosis of gastric cancer. The probe (AgNCs/RED 16(7s)C) utilized for miR-16-5p detection adopted a better conformation with high specificity to recognize single-base mismatches by producing dramatically opposite signals (increase or decrease at 580 nm ex/640 nm em) while the probe (AgNCs/GRE 19b(5s)C) for miR-19b-3p generated dual signals (increase at 490 nm ex/570 nm em and decrease at 430 nm ex/530 nm em) with bright fluorescence in one reaction during the amplification, but unexpectedly was partially digested. This is for the first time to allow the generation of enhanced fluorescent AgNCs and the target recognition integrated into a single process, which offers great opportunity for specific miRNA detection in an easy and rapid way.

  4. Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Yao Hailan

    2012-08-01

    Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

  5. Determination of low-energy structures of a small RNA hairpin using ...

    Indian Academy of Sciences (India)

    In this method, the history of the simulation is used to increase the probability of states less visited in the simulation. It has been found that using both energy and end-to-end distance as the biasing parameters in the simulation, the partially folded structure of the hairpin starting from random structures could be obtained.

  6. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  7. Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5' but not the 3' splice site inhibit intron processing in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Liu, H X; Goodall, G J; Kole, R; Filipowicz, W

    1995-01-16

    We have performed a systematic study of the effect of artificial hairpins on pre-mRNA splicing in protoplasts of a dicot plant, Nicotiana plumbaginifolia. Hairpins with a potential to form 18 or 24 bp stems strongly inhibit splicing when they sequester the 5' splice site or are placed in the middle of short introns. However, similar 24 bp hairpins sequestering the 3' splice site do not prevent this site from being used as an acceptor. Utilization of the stem-located 3' site requires that the base of the stem is separated from the upstream 5' splice site by a minimum of approximately 45 nucleotides and that another 'helper' 3' splice site is present downstream of the stem. The results indicate that the spliceosome or factors associated with it may have a potential to unfold secondary structure present in the downstream portion of the intron, prior to or at the step of the 3' splice site selection. The finding that the helper 3' site is required for utilization of the stem-located acceptor confirms and extends previous observations, obtained with HeLa cell in vitro splicing systems, indicating that the 3' splice site may be recognized at least twice during spliceosome assembly.

  8. Metschnikowia Species Share a Pool of Diverse rRNA Genes Differing in Regions That Determine Hairpin-Loop Structures and Evolve by Reticulation.

    Directory of Open Access Journals (Sweden)

    Matthias Sipiczki

    Full Text Available Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution.

  9. Statistical properties of thermodynamically predicted RNA secondary structures in viral genomes

    Science.gov (United States)

    Spanò, M.; Lillo, F.; Miccichè, S.; Mantegna, R. N.

    2008-10-01

    By performing a comprehensive study on 1832 segments of 1212 complete genomes of viruses, we show that in viral genomes the hairpin structures of thermodynamically predicted RNA secondary structures are more abundant than expected under a simple random null hypothesis. The detected hairpin structures of RNA secondary structures are present both in coding and in noncoding regions for the four groups of viruses categorized as dsDNA, dsRNA, ssDNA and ssRNA. For all groups, hairpin structures of RNA secondary structures are detected more frequently than expected for a random null hypothesis in noncoding rather than in coding regions. However, potential RNA secondary structures are also present in coding regions of dsDNA group. In fact, we detect evolutionary conserved RNA secondary structures in conserved coding and noncoding regions of a large set of complete genomes of dsDNA herpesviruses.

  10. Structural and dynamic characterization of the upper part of the HIV-1 cTAR DNA hairpin

    OpenAIRE

    Zargarian, Loussin?; Kanevsky, Igor; Bazzi, Ali; Boynard, Jonathan; Chaminade, Fran?oise; Foss?, Philippe; Mauffret, Olivier

    2009-01-01

    First strand transfer is essential for HIV-1 reverse transcription. During this step, the TAR RNA hairpin anneals to the cTAR DNA hairpin; this annealing reaction is promoted by the nucleocapsid protein and involves an initial loop?loop interaction between the apical loops of TAR and cTAR. Using NMR and probing methods, we investigated the structural and dynamic properties of the top half of the cTAR DNA (mini-cTAR). We show that the upper stem located between the apical and the internal loop...

  11. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  12. Hairpin vortices in turbulent boundary layers

    International Nuclear Information System (INIS)

    Eitel-Amor, G; Schlatter, P; Flores, O

    2014-01-01

    The present work addresses the question whether hairpin vortices are a dominant feature of near-wall turbulence and which role they play during transition. First, the parent-offspring mechanism is investigated in temporal simulations of a single hairpin vortex introduced in a mean shear flow corresponding to turbulent channels and boundary layers up to Re τ = 590. Using an eddy viscosity computed from resolved simulations, the effect of a turbulent background is also considered. Tracking the vortical structure downstream, it is found that secondary hairpins are created shortly after initialization. Thereafter, all rotational structures decay, whereas this effect is enforced in the presence of an eddy viscosity. In a second approach, a laminar boundary layer is tripped to transition by insertion of a regular pattern of hairpins by means of defined volumetric forces representing an ejection event. The idea is to create a synthetic turbulent boundary layer dominated by hairpin-like vortices. The flow for Re τ < 250 is analysed with respect to the lifetime of individual hairpin-like vortices. Both the temporal and spatial simulations demonstrate that the regeneration process is rather short-lived and may not sustain once a turbulent background has formed. From the transitional flow simulations, it is conjectured that the forest of hairpins reported in former DNS studies is an outer layer phenomenon not being connected to the onset of near-wall turbulence.

  13. Short hairpin-loop-structured oligodeoxynucleotides reduce HSV-1 replication

    Directory of Open Access Journals (Sweden)

    Heinrich Jochen

    2009-04-01

    Full Text Available Abstract The Herpes simplex virus (HSV is known as an infectious agent and widespread in the human population. The symptoms of HSV infections can range from mild to life threatening, especially in immune-compromised individuals. HSV infections are commonly treated with the guanosine analogue Aciclovir, but reports of resistance are increasing. Efforts are made to establish single-stranded antisense oligodeoxynucleotides (as and small interfering ribonucleic acids (siRNAs for antiviral treatment. Recently, another class of short interfering nucleic acids, partially double-stranded hairpin loop-structured 54 mer oligodeoxynucleotides (ODNs, was shown to allow hydrolysis of HIV RNA by binding to the viral RNA. This leads to a substrate for the viral RNase H. To assess the potential of such ODNs for inhibition of HSV-1 replication, five partially double-stranded ODNs were designed based on the sequences of known siRNAs against HSV-1 with antiviral activity. Three of them are directed against early and two against leaky late genes. Primary human lung fibroblasts, MRC-5, and African green monkey kidney cells, Vero, were transfected with ODNs and subsequently infected. The effect on HSV-1 replication was determined by analyzing the virus titer in cell culture supernatants by quantitative PCR and plaque assays. An inhibitory effect was observed with all five selected ODNs, with two cases showing statistical significance in both cell types. The observed effect was sequence-specific and dose dependent. In one case the ODN was more efficient than a previously described siRNA directed against the same target site in the mRNA of UL5, a component of the helicase/primase complex. HSV-1 virions and ODNs can be applied simultaneously without transfection reagent, but at a 50-fold higher concentration to Vero cells with similar efficiencies. The results underline the potential of partially double-stranded hairpin loop-structured ODNs as antiviral agents.

  14. Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

    Science.gov (United States)

    Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

    2012-01-01

    We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

  15. Adenovirus delivered short hairpin RNA targeting a conserved site in the 5' non-translated region inhibits all four serotypes of dengue viruses.

    Directory of Open Access Journals (Sweden)

    Anil Babu Korrapati

    Full Text Available BACKGROUND: Dengue is a mosquito-borne viral disease caused by four closely related serotypes of Dengue viruses (DENVs. This disease whose symptoms range from mild fever to potentially fatal haemorrhagic fever and hypovolemic shock, threatens nearly half the global population. There is neither a preventive vaccine nor an effective antiviral therapy against dengue disease. The difference between severe and mild disease appears to be dependent on the viral load. Early diagnosis may enable timely therapeutic intervention to blunt disease severity by reducing the viral load. Harnessing the therapeutic potential of RNA interference (RNAi to attenuate DENV replication may offer one approach to dengue therapy. METHODOLOGY/PRINCIPAL FINDINGS: We screened the non-translated regions (NTRs of the RNA genomes of representative members of the four DENV serotypes for putative siRNA targets mapping to known transcription/translation regulatory elements. We identified a target site in the 5' NTR that maps to the 5' upstream AUG region, a highly conserved cis-acting element essential for viral replication. We used a replication-defective human adenovirus type 5 (AdV5 vector to deliver a short-hairpin RNA (shRNA targeting this site into cells. We show that this shRNA matures to the cognate siRNA and is able to inhibit effectively antigen secretion, viral RNA replication and infectious virus production by all four DENV serotypes. CONCLUSION/SIGNIFICANCE: The data demonstrate the feasibility of using AdV5-mediated delivery of shRNAs targeting conserved sites in the viral genome to achieve inhibition of all four DENV serotypes. This paves the way towards exploration of RNAi as a possible therapeutic strategy to curtail DENV infection.

  16. RNA-dependent RNA polymerase 1 in potato (Solanum tuberosum) and its relationship to other plant RNA-dependent RNA polymerases.

    Science.gov (United States)

    Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P

    2016-03-16

    Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.

  17. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  18. ConStruct: Improved construction of RNA consensus structures

    Directory of Open Access Journals (Sweden)

    Steger Gerhard

    2008-04-01

    Full Text Available Abstract Background Aligning homologous non-coding RNAs (ncRNAs correctly in terms of sequence and structure is an unresolved problem, due to both mathematical complexity and imperfect scoring functions. High quality alignments, however, are a prerequisite for most consensus structure prediction approaches, homology searches, and tools for phylogeny inference. Automatically created ncRNA alignments often need manual corrections, yet this manual refinement is tedious and error-prone. Results We present an extended version of CONSTRUCT, a semi-automatic, graphical tool suitable for creating RNA alignments correct in terms of both consensus sequence and consensus structure. To this purpose CONSTRUCT combines sequence alignment, thermodynamic data and various measures of covariation. One important feature is that the user is guided during the alignment correction step by a consensus dotplot, which displays all thermodynamically optimal base pairs and the corresponding covariation. Once the initial alignment is corrected, optimal and suboptimal secondary structures as well as tertiary interaction can be predicted. We demonstrate CONSTRUCT's ability to guide the user in correcting an initial alignment, and show an example for optimal secondary consensus structure prediction on very hard to align SECIS elements. Moreover we use CONSTRUCT to predict tertiary interactions from sequences of the internal ribosome entry site of CrP-like viruses. In addition we show that alignments specifically designed for benchmarking can be easily be optimized using CONSTRUCT, although they share very little sequence identity. Conclusion CONSTRUCT's graphical interface allows for an easy alignment correction based on and guided by predicted and known structural constraints. It combines several algorithms for prediction of secondary consensus structure and even tertiary interactions. The CONSTRUCT package can be downloaded from the URL listed in the Availability and

  19. The molecular variability analysis of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus sheds light on the minimal requirements for the synthesis of its subgenomic RNA.

    Science.gov (United States)

    Aparicio, Frederic; Pallás, Vicente

    2002-01-01

    The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.

  20. A construct with fluorescent indicators for conditional expression of miRNA

    Directory of Open Access Journals (Sweden)

    Xia Xugang

    2008-10-01

    Full Text Available Abstract Background Transgenic RNAi holds promise as a simple, low-cost, and fast method for reverse genetics in mammals. It may be particularly useful for producing animal models for hypomorphic gene function. Inducible RNAi that permits spatially and temporally controllable gene silencing in vivo will enhance the power of transgenic RNAi approach. Furthermore, because microRNA (miRNA targeting specific genes can be expressed simultaneously with protein coding genes, incorporation of fluorescent marker proteins can simplify the screening and analysis of transgenic RNAi animals. Results We sought to optimally express a miRNA simultaneously with a fluorescent marker. We compared two construct designs. One expressed a red fluorescent protein (RFP and a miRNA placed in its 3' untranslated region (UTR. The other expressed the same RFP and miRNA, but the precursor miRNA (pre-miRNA coding sequence was placed in an intron that was inserted into the 3'-UTR. We found that the two constructs expressed comparable levels of miRNA. However, the intron-containing construct expressed a significantly higher level of RFP than the intron-less construct. Further experiments indicate that the 3'-UTR intron enhances RFP expression by its intrinsic gene-expression-enhancing activity and by eliminating the inhibitory effect of the pre-miRNA on the expression of RFP. Based on these findings, we incorporated the intron-embedded pre-miRNA design into a conditional expression construct that employed the Cre-loxP system. This construct initially expressed EGFP gene, which was flanked by loxP sites. After exposure to Cre recombinase, the transgene stopped EGFP expression and began expression of RFP and a miRNA, which silenced the expression of specific cellular genes. Conclusion We have designed and tested a conditional miRNA-expression construct and showed that this construct expresses both the marker genes strongly and can silence the target gene efficiently upon Cre

  1. Species-independent MicroRNA Gene Discovery

    KAUST Repository

    Kamanu, Timothy K.

    2012-01-01

    and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. mi

  2. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  3. Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

    Science.gov (United States)

    Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

    2012-01-01

    Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

  4. The Role of XPG in Processing (CAGn/(CTGn DNA Hairpins

    Directory of Open Access Journals (Sweden)

    Hou Caixia

    2011-03-01

    Full Text Available Abstract Background During DNA replication or repair, disease-associated (CAGn/(CTGn expansion can result from formation of hairpin structures in the repeat tract of the newly synthesized or nicked DNA strand. Recent studies identified a nick-directed (CAGn/(CTGn hairpin repair (HPR system that removes (CAGn/(CTGn hairpins from human cells via endonucleolytic incisions. Because the process is highly similar to the mechanism by which XPG and XPF endonucleases remove bulky DNA lesions during nucleotide excision repair, we assessed the potential role of XPG in conducting (CAGn/(CTGn HPR. Results To determine if the XPG endonuclease is involved in (CAGn/(CTGn hairpin removal, two XPG-deficient cell lines (GM16024 and AG08802 were examined for their ability to process (CAGn/(CTGn hairpins in vitro. We demonstrated that the GM16024 cell line processes all hairpin substrates as efficiently as HeLa cells, and that the AG08802 cell line is partially defective in HPR. Analysis of repair intermediates revealed that nuclear extracts from both XPG-deficient lines remove CAG/CTG hairpins via incisions, but the incision products are distinct from those generated in HeLa extracts. We also show that purified recombinant XPG protein greatly stimulates HPR in XPG-deficient extracts by promoting an incision 5' to the hairpin. Conclusions Our results strongly suggest that 1 human cells possess multiple pathways to remove (CAGn/(CTGn hairpins located in newly synthesized (or nicked DNA strand; and 2 XPG, although not essential for (CAGn/(CTGn hairpin removal, stimulates HPR by facilitating a 5' incision to the hairpin. This study reveals a novel role for XPG in genome-maintenance and implicates XPG in diseases caused by trinucleotide repeat expansion.

  5. Bleomycin Can Cleave an Oncogenic Noncoding RNA.

    Science.gov (United States)

    Angelbello, Alicia J; Disney, Matthew D

    2018-01-04

    Noncoding RNAs are pervasive in cells and contribute to diseases such as cancer. A question in biomedical research is whether noncoding RNAs are targets of medicines. Bleomycin is a natural product that cleaves DNA; however, it is known to cleave RNA in vitro. Herein, an in-depth analysis of the RNA cleavage preferences of bleomycin A5 is presented. Bleomycin A5 prefers to cleave RNAs with stretches of AU base pairs. Based on these preferences and bioinformatic analysis, the microRNA-10b hairpin precursor was identified as a potential substrate for bleomycin A5. Both in vitro and cellular experiments demonstrated cleavage. Importantly, chemical cleavage by bleomycin A5 in the microRNA-10b hairpin precursors occurred near the Drosha and Dicer enzymatic processing sites and led to destruction of the microRNA. Evidently, oncogenic noncoding RNAs can be considered targets of cancer medicines and might elicit their pharmacological effects by targeting noncoding RNA. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Structure and conformational dynamics of the domain 5 RNA hairpin of a bacterial group II intron revealed by solution nuclear magnetic resonance and molecular dynamics simulations.

    Science.gov (United States)

    Pechlaner, Maria; Sigel, Roland K O; van Gunsteren, Wilfred F; Dolenc, Jožica

    2013-10-08

    Nuclear magnetic resonance (NMR) nuclear Overhauser enhancement (NOE) data obtained for a 35-nucleotide RNA segment of a bacterial group II intron indicate a helical hairpin structure in which three parts, a terminal pentaloop, a bulge, and a G-A mismatch, display no Watson-Crick base pairing. The 668 NOE upper distance bounds for atom pairs are insufficient to uniquely determine the conformation of these segments. Therefore, molecular dynamics simulations including time-averaged distance restraints have been used to obtain a conformational ensemble compatible with the observed NMR data. The ensemble shows alternating hydrogen bonding patterns for the mentioned segments. In particular, in the pentaloop and in the bulge, the hydrogen bonding networks correspond to distinct conformational clusters that could not be captured by using conventional single-structure refinement techniques. This implies that, to obtain a realistic picture of the conformational ensemble of such flexible biomolecules, it is necessary to properly account for the conformational variability in the structure refinement of RNA fragments.

  7. α-helix to β-hairpin transition of human amylin monomer

    Science.gov (United States)

    Singh, Sadanand; Chiu, Chi-cheng; Reddy, Allam S.; de Pablo, Juan J.

    2013-04-01

    The human islet amylin polypeptide is produced along with insulin by pancreatic islets. Under some circumstances, amylin can aggregate to form amyloid fibrils, whose presence in pancreatic cells is a common pathological feature of Type II diabetes. A growing body of evidence indicates that small, early stage aggregates of amylin are cytotoxic. A better understanding of the early stages of the amylin aggregation process and, in particular, of the nucleation events leading to fibril growth could help identify therapeutic strategies. Recent studies have shown that, in dilute solution, human amylin can adopt an α-helical conformation, a β-hairpin conformation, or an unstructured coil conformation. While such states have comparable free energies, the β-hairpin state exhibits a large propensity towards aggregation. In this work, we present a detailed computational analysis of the folding pathways that arise between the various conformational states of human amylin in water. A free energy surface for amylin in explicit water is first constructed by resorting to advanced sampling techniques. Extensive transition path sampling simulations are then employed to identify the preferred folding mechanisms between distinct minima on that surface. Our results reveal that the α-helical conformer of amylin undergoes a transformation into the β-hairpin monomer through one of two mechanisms. In the first, misfolding begins through formation of specific contacts near the turn region, and proceeds via a zipping mechanism. In the second, misfolding occurs through an unstructured coil intermediate. The transition states for these processes are identified. Taken together, the findings presented in this work suggest that the inter-conversion of amylin between an α-helix and a β-hairpin is an activated process and could constitute the nucleation event for fibril growth.

  8. Characterization of a parallel-stranded DNA hairpin

    International Nuclear Information System (INIS)

    Germann, M.W.; Vogel, H.J.; Pon, R.T.; van de Sande, J.H.

    1989-01-01

    Recently, the authors have shown that synthetic DNA containing homooligomeric A-T base pairs can form a parallel-stranded intramolecular hairpin structure. In the present study, they have employed NMR and optical spectroscopy to investigate the structure of the parallel-stranded (PS) DNA hairpin 3'-d(T) 8 C 4 (A) 8 -3' and the related antiparallel (APS) hair 5'-d(T) 8 C 4 (A) 8 -3'. The parallel orientation of the strands in the PS oligonucleotide is achieved by introducing a 5'-5' phosphodiester linkage in the hairpin loop. Ultraviolet spectroscopic and fluorescence data of drug binding are consistent with the formation of PS and APS structures, respectively, in these two hairpins. Vacuum circular dichroism measurements in combination with theoretical CD calculations indicate that the PS structure forms a right-handed helix. 31 P NMR measurements indicate that the conformation of the phosphodiester backbone of the PS structure is not drastically different from that of the APS control. The presence of slowly exchanging imino protons at 14 ppm and the observation of nuclear Overhauser enhancement between imino protons and the AH-2 protons demonstrate that similar base pairing and base stacking between T and A residues occur in both hairpins. On the basis of NOESY measurements, they find that the orientation of the bases is in the anti region and that the sugar puckering is in the 2'-endo range. The results indicate a B-like conformation for each of the strands in the stem part of the PS hairpin and reverse Watson-Crick base pairing between the T and A residues. These data are consistent with a previously calculated structure for parallel-stranded DNA

  9. The influence of junction conformation on RNA cleavage by the hairpin ribozyme in its natural junction form.

    Science.gov (United States)

    Thomson, J B; Lilley, D M

    1999-01-01

    In the natural form of the hairpin ribozyme the two loop-carrying duplexes that comprise the majority of essential bases for activity form two adjacent helical arms of a four-way RNA junction. In the present work we have manipulated the sequence around the junction in a way known to perturb the global folding properties. We find that replacement of the junction by a different sequence that has the same conformational properties as the natural sequence gives closely similar reaction rate and Arrhenius activation energy for the substrate cleavage reaction. By comparison, rotation of the natural sequence in order to alter the three-dimensional folding of the ribozyme leads to a tenfold reduction in the kinetics of cleavage. Replacement with the U1 four-way junction that is resistant to rotation into the antiparallel structure required to allow interaction between the loops also gives a tenfold reduction in cleavage rate. The results indicate that the conformation of the junction has a major influence on the catalytic activity of the ribozyme. The results are all consistent with a role for the junction in the provision of a framework by which the loops are presented for interaction in order to create the active form of the ribozyme. PMID:10024170

  10. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  11. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  12. Microprocessor Activity Controls Differential miRNA Biogenesis In Vivo

    Directory of Open Access Journals (Sweden)

    Thomas Conrad

    2014-10-01

    Full Text Available In miRNA biogenesis, pri-miRNA transcripts are converted into pre-miRNA hairpins. The in vivo properties of this process remain enigmatic. Here, we determine in vivo transcriptome-wide pri-miRNA processing using next-generation sequencing of chromatin-associated pri-miRNAs. We identify a distinctive Microprocessor signature in the transcriptome profile from which efficiency of the endogenous processing event can be accurately quantified. This analysis reveals differential susceptibility to Microprocessor cleavage as a key regulatory step in miRNA biogenesis. Processing is highly variable among pri-miRNAs and a better predictor of miRNA abundance than primary transcription itself. Processing is also largely stable across three cell lines, suggesting a major contribution of sequence determinants. On the basis of differential processing efficiencies, we define functionality for short sequence features adjacent to the pre-miRNA hairpin. In conclusion, we identify Microprocessor as the main hub for diversified miRNA output and suggest a role for uncoupling miRNA biogenesis from host gene expression.

  13. [Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

    Science.gov (United States)

    Yu, Yanping; Zhang, Song; Kong, Weijia

    2010-09-01

    To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

  14. Shapes of interacting RNA complexes

    DEFF Research Database (Denmark)

    Fu, Benjamin Mingming; Reidys, Christian

    2014-01-01

    Shapes of interacting RNA complexes are studied using a filtration via their topological genus. A shape of an RNA complex is obtained by (iteratively) collapsing stacks and eliminating hairpin loops.This shape-projection preserves the topological core of the RNA complex and for fixed topological...... genus there are only finitely many such shapes. Our main result is a new bijection that relates the shapes of RNA complexes with shapes of RNA structures. This allows to compute the shape polynomial of RNA complexes via the shape polynomial of RNA structures. We furthermore present a linear time uniform...... sampling algorithm for shapes of RNA complexes of fixed topological genus....

  15. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  16. A dynamical mechanism for the hairpin diagram

    International Nuclear Information System (INIS)

    Chang Chaohsi; Guo Xinheng; Li Xueqian.

    1989-09-01

    Based on the non-valence quark-antiquark and gluon constituent structure of mesons we give a reasonable dynamical mechanism which can induce the hairpin diagram without violating the well-observed OZI rule. We calculate the hairpin amplitudes of D deg. → K-bar deg.η and K-bar deg.η' normalized by D deg. → K-bar deg.π deg. and have found that the hairpin diagram can give rise to substantial contribution to the decays where a meson with a SU(3) flavor singlet component is involved in the final state. In this scenario, we also obtain the branching ratio of D deg. → K-bar deg. φ as 0.55% in comparison with the experimental data of 0.83%. (autor). 33 refs, 3 figs

  17. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  18. Crystallization and preliminary X-ray analysis of the mRNA-binding domain of elongation factor SelB from Escherichia coli in complex with RNA

    International Nuclear Information System (INIS)

    Soler, Nicolas; Fourmy, Dominique; Yoshizawa, Satoko

    2007-01-01

    The mRNA-binding domain of E. coli selenocysteine-specific elongation factor SelB (residues 478–614; SelB-WH3/4) was overproduced in E. coli and its cognate mRNA ligand, 23 nucleotides of the SECIS RNA hairpin, was prepared by in vitro transcription. The purified SelB-WH3/4–SECIS RNA complex crystallized in space group C2 and diffracted to 2.3 Å. In bacteria, selenocysteine (the 21st amino acid) is incorporated into proteins via machinery that includes SelB, a specific translational elongation factor. SelB binds to an mRNA hairpin called the selenocysteine-insertion sequence (SECIS) and delivers selenocysteyl-tRNA Sec to the ribosomal A site. The minimum C-terminal fragment (residues 478–614) of Escherichia coli SelB (SelB-WH3/4) required for SECIS binding has been overexpressed and purified. This protein was crystallized in complex with 23 nucleotides of the SECIS hairpin at 294 K using the hanging-drop vapour-diffusion method. A data set was collected to 2.3 Å resolution from a single crystal at 100 K using ESRF beamline BM-30. The crystal belongs to space group C2, with unit-cell parameters a = 103.50, b = 56.51, c = 48.41 Å. The asymmetric unit contains one WH3/4-domain–RNA complex. The Matthews coefficient was calculated to be 3.37 Å 3 Da −1 and the solvent content was estimated to be 67.4%

  19. Forced evolution of a regulatory RNA helix in the HIV-1 genome

    NARCIS (Netherlands)

    Berkhout, B.; Klaver, B.; Das, A. T.

    1997-01-01

    The 5'and 3'end of the HIV-1 RNA genome forms a repeat (R) element that encodes a double stem-loop structure (the TAR and polyA hairpins). Phylogenetic analysis of the polyA hairpin in different human and simian immunodeficiency viruses suggests that the thermodynamic stability of the helix is

  20. MicroRNA prediction using a fixed-order Markov model based on the secondary structure pattern.

    Directory of Open Access Journals (Sweden)

    Wei Shen

    Full Text Available Predicting miRNAs is an arduous task, due to the diversity of the precursors and complexity of enzyme processes. Although several prediction approaches have reached impressive performances, few of them could achieve a full-function recognition of mature miRNA directly from the candidate hairpins across species. Therefore, researchers continue to seek a more powerful model close to biological recognition to miRNA structure. In this report, we describe a novel miRNA prediction algorithm, known as FOMmiR, using a fixed-order Markov model based on the secondary structural pattern. For a training dataset containing 809 human pre-miRNAs and 6441 human pseudo-miRNA hairpins, the model's parameters were defined and evaluated. The results showed that FOMmiR reached 91% accuracy on the human dataset through 5-fold cross-validation. Moreover, for the independent test datasets, the FOMmiR presented an outstanding prediction in human and other species including vertebrates, Drosophila, worms and viruses, even plants, in contrast to the well-known algorithms and models. Especially, the FOMmiR was not only able to distinguish the miRNA precursors from the hairpins, but also locate the position and strand of the mature miRNA. Therefore, this study provides a new generation of miRNA prediction algorithm, which successfully realizes a full-function recognition of the mature miRNAs directly from the hairpin sequences. And it presents a new understanding of the biological recognition based on the strongest signal's location detected by FOMmiR, which might be closely associated with the enzyme cleavage mechanism during the miRNA maturation.

  1. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  2. Identify Beta-Hairpin Motifs with Quadratic Discriminant Algorithm Based on the Chemical Shifts.

    Directory of Open Access Journals (Sweden)

    Feng YongE

    Full Text Available Successful prediction of the beta-hairpin motif will be helpful for understanding the of the fold recognition. Some algorithms have been proposed for the prediction of beta-hairpin motifs. However, the parameters used by these methods were primarily based on the amino acid sequences. Here, we proposed a novel model for predicting beta-hairpin structure based on the chemical shift. Firstly, we analyzed the statistical distribution of chemical shifts of six nuclei in not beta-hairpin and beta-hairpin motifs. Secondly, we used these chemical shifts as features combined with three algorithms to predict beta-hairpin structure. Finally, we achieved the best prediction, namely sensitivity of 92%, the specificity of 94% with 0.85 of Mathew's correlation coefficient using quadratic discriminant analysis algorithm, which is clearly superior to the same method for the prediction of beta-hairpin structure from 20 amino acid compositions in the three-fold cross-validation. Our finding showed that the chemical shift is an effective parameter for beta-hairpin prediction, suggesting the quadratic discriminant analysis is a powerful algorithm for the prediction of beta-hairpin.

  3. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice.

    Directory of Open Access Journals (Sweden)

    Gene-Errol E Ringpis

    Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either

  4. Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration

    Science.gov (United States)

    Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.

    2001-01-01

    We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of  hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg2+. All three molecules undergo two-state transitions with melting temperatures (TM) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar TM values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ∼110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the TM-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na+ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg2+ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density. PMID:11522834

  5. {sup 13}C relaxation in an RNA hairpin

    Energy Technology Data Exchange (ETDEWEB)

    King, G.C. [Univ. of South Wales, Kensington (Australia)]|[Rice Univ., Houston, TX (United States); Akratos, C. [Univ. of South Wales, Kensington (Australia); Xi, Z.; Michnica, M.J. [Rice Univ., Houston, TX (United States)

    1994-12-01

    This initial survey of {sup 13}C relaxation in the {triangle}TAR RNA element has generated a number of interesting results that should prove generally useful for future studies. The most readily comparable study in the literature monitored {sup 13}C relaxation of the methyl groups from unusual bases in tRNA{sup Phe}. The study, which used T{sub 1} and NOE data only, reported order parameters for the methyl group axis that ranged between 0.51 and 0.97-a range similar to that observed here. However, they reported a breakdown of the standard order parameter analysis at higher (118-MHz {sup 13}C) frequencies, which should serve to emphasize the need for a thorough exploration of suitable motional models.

  6. RNA interference-based resistance against a legume mastrevirus

    Directory of Open Access Journals (Sweden)

    Mansoor Shahid

    2011-11-01

    Full Text Available Abstract Background RNA interference (RNAi is a homology-dependant gene silencing mechanism and has been widely used to engineer resistance in plants against RNA viruses. However, its usefulness in delivering resistance against plant DNA viruses belonging to family Geminiviridae is still being debated. Although the RNAi approach has been shown, using a transient assay, to be useful in countering monocotyledonous plant-infecting geminiviruses of the genus Mastrevirus, it has yet to be investigated as a means of delivering resistance to dicot-infecting mastreviruses. Chickpea chlorotic dwarf Pakistan virus (CpCDPKV is a legume-infecting mastrevirus that affects chickpea and other leguminous crops in Pakistan. Results Here a hairpin (hpRNAi construct containing sequences encompassing part of replication-associated protein gene, intergenic region and part of the movement protein gene of CpCDPKV under the control of the Cauliflower mosaic virus 35S promoter has been produced and stably transformed into Nicotiana benthamiana. Plants harboring the hairpin construct were challenged with CpCDPKV. All non-transgenic N. benthamiana plants developed symptoms of CpCDPKV infection within two weeks post-inoculation. In contrast, none of the inoculated transgenic plants showed symptoms of infection and no viral DNA could be detected by Southern hybridization. A real-time quantitative PCR analysis identified very low-level accumulation of viral DNA in the inoculated transgenic plants. Conclusions The results presented show that the RNAi-based resistance strategy is useful in protecting plants from a dicot-infecting mastrevirus. The very low levels of virus detected in plant tissue of transgenic plants distal to the inoculation site suggest that virus movement and/or viral replication was impaired leading to plants that showed no discernible signs of virus infection.

  7. On hairpin vortices in a transitional boundary layer

    Directory of Open Access Journals (Sweden)

    Uruba Václav

    2012-04-01

    Full Text Available In the presented paper the results of experiments on transitional boundary layer are presented. The boundary layer was generated on smooth flat wall with zero pressure gradient forming one side of the channel of rectangular cross section. The hairpin vortices, packets of hairpin vortices, turbulent spots and calmed regions were experimentally investigated using time-resolved PIV technique.

  8. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5'-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes.

    Science.gov (United States)

    Gao, Zhuangqiang; Qiu, Zhenli; Lu, Minghua; Shu, Jian; Tang, Dianping

    2017-03-15

    This work designs a new label-free aptasensor for the colorimetric determination of small molecules (adenosine 5'-triphosphate, ATP) by using visible gold nanoparticles as the signal-generation tags, based on target-triggered hybridization chain reaction (HCR) between two hairpin DNA probes. The assay is carried out referring to the change in the color/absorbance by salt-induced aggregation of gold nanoparticles after the interaction with hairpins, gold nanoparticles and ATP. To construct such an assay system, two hairpin DNA probes with a short single-stranded DNA at the sticky end are utilized for interaction with gold nanoparticles. In the absence of target ATP, the hairpin DNA probes can prevent gold nanoparticles from the salt-induced aggregation through the interaction of the single-stranded DNA at the sticky end with gold nanoparticles. Upon target ATP introduction, the aptamer-based hairpin probe is opened to expose a new sticky end for the strand-displacement reaction with another complementary hairpin, thus resulting in the decreasing single-stranded DNA because of the consumption of hairpins. In this case, gold nanoparticles are uncovered owing to the formation of double-stranded DNA, which causes their aggregation upon addition of the salt, thereby leading to the change in the red-to-blue color. Under the optimal conditions, the HCR-based colorimetric assay presents good visible color or absorbance responses for the determination of target ATP at a concentration as low as 1.0nM. Importantly, the methodology can be further extended to quantitatively or qualitatively monitor other small molecules or biotoxins by changing the sequence of the corresponding aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  10. Deep Sequence Analysis of AgoshRNA Processing Reveals 3' A Addition and Trimming.

    Science.gov (United States)

    Harwig, Alex; Herrera-Carrillo, Elena; Jongejan, Aldo; van Kampen, Antonius Hubertus; Berkhout, Ben

    2015-07-14

    The RNA interference (RNAi) pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA), was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2) slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA) molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp). This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3' strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3' tail of 1-3 A-nucleotides (nt) and we present evidence that this product is subsequently trimmed by the poly(A)-specific ribonuclease (PARN).

  11. Sequence-dependent unfolding kinetics of DNA hairpins studied by nanopore force spectroscopy

    International Nuclear Information System (INIS)

    Renner, Stephan; Bessonov, Andrey; Simmel, Friedrich C; Gerland, Ulrich

    2010-01-01

    Nanopore force spectroscopy is used to study the unzipping kinetics of two DNA hairpin molecules with a 12 base pair long stem containing two contiguous stretches of six GC and six AT base pairs in interchanged order. Even though the thermodynamic stabilities of the two structures are nearly the same, they differ greatly in their unzipping kinetics. When the GC segment has to be broken before the AT segment, the unfolding rate is orders of magnitude smaller than in the opposite case. We also investigated hairpins with stem regions consisting only of AT or GC base pairs. The pure AT hairpins translocate much faster than the other hairpins, whereas the pure GC hairpins translocate on similar timescales to the hairpins with only an initial GC segment. For each hairpin, nanopore force spectroscopy is performed for different loading rates and the resulting unzipping distributions are mathematically transformed to a master curve that yields the unfolding rate as a function of applied voltage. This is compared with a stochastic model of the unfolding process for the two sequences for different voltages. The results can be rationalized in terms of the different natures of the free energy landscapes for the unfolding process.

  12. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  13. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  14. An enzyme-catalyzed multistep DNA refolding mechanism in hairpin telomere formation.

    Directory of Open Access Journals (Sweden)

    Ke Shi

    Full Text Available Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting-rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions.

  15. Deep Sequence Analysis of AgoshRNA Processing Reveals 3’ A Addition and Trimming

    Directory of Open Access Journals (Sweden)

    Alex Harwig

    2015-01-01

    Full Text Available The RNA interference (RNAi pathway, in which microprocessor and Dicer collaborate to process microRNAs (miRNA, was recently expanded by the description of alternative processing routes. In one of these noncanonical pathways, Dicer action is replaced by the Argonaute2 (Ago2 slicer function. It was recently shown that the stem-length of precursor-miRNA or short hairpin RNA (shRNA molecules is a major determinant for Dicer versus Ago2 processing. Here we present the results of a deep sequence study on the processing of shRNAs with different stem length and a top G·U wobble base pair (bp. This analysis revealed some unexpected properties of these so-called AgoshRNA molecules that are processed by Ago2 instead of Dicer. First, we confirmed the gradual shift from Dicer to Ago2 processing upon shortening of the hairpin length. Second, hairpins with a stem larger than 19 base pair are inefficiently cleaved by Ago2 and we noticed a shift in the cleavage site. Third, the introduction of a top G·U bp in a regular shRNA can promote Ago2-cleavage, which coincides with a loss of Ago2-loading of the Dicer-cleaved 3’ strand. Fourth, the Ago2-processed AgoshRNAs acquire a short 3’ tail of 1–3 A-nucleotides (nt and we present evidence that this product is subsequently trimmed by the poly(A-specific ribonuclease (PARN.

  16. RNA targeting by small molecules: Binding of protoberberine ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... Studies on RNA targeting by small molecules to specifically control certain cellular functions is an .... form secondary structures such as stem-loop, hairpin, etc. ..... paired third strand of the triplex without affecting the stability.

  17. Structural and sequence features of two residue turns in beta-hairpins.

    Science.gov (United States)

    Madan, Bharat; Seo, Sung Yong; Lee, Sun-Gu

    2014-09-01

    Beta-turns in beta-hairpins have been implicated as important sites in protein folding. In particular, two residue β-turns, the most abundant connecting elements in beta-hairpins, have been a major target for engineering protein stability and folding. In this study, we attempted to investigate and update the structural and sequence properties of two residue turns in beta-hairpins with a large data set. For this, 3977 beta-turns were extracted from 2394 nonhomologous protein chains and analyzed. First, the distribution, dihedral angles and twists of two residue turn types were determined, and compared with previous data. The trend of turn type occurrence and most structural features of the turn types were similar to previous results, but for the first time Type II turns in beta-hairpins were identified. Second, sequence motifs for the turn types were devised based on amino acid positional potentials of two-residue turns, and their distributions were examined. From this study, we could identify code-like sequence motifs for the two residue beta-turn types. Finally, structural and sequence properties of beta-strands in the beta-hairpins were analyzed, which revealed that the beta-strands showed no specific sequence and structural patterns for turn types. The analytical results in this study are expected to be a reference in the engineering or design of beta-hairpin turn structures and sequences. © 2014 Wiley Periodicals, Inc.

  18. Correlation of RNA secondary structure statistics with thermodynamic stability and applications to folding.

    Science.gov (United States)

    Wu, Johnny C; Gardner, David P; Ozer, Stuart; Gutell, Robin R; Ren, Pengyu

    2009-08-28

    The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.

  19. Use of tiling array data and RNA secondary structure predictions to identify noncoding RNA genes

    DEFF Research Database (Denmark)

    Weile, Christian; Gardner, Paul P; Hedegaard, Mads M

    2007-01-01

    neuroblastoma cell line SK-N-AS. Using this strategy, we identify thousands of human candidate RNA genes. To further verify the expression of these genes, we focused on candidate genes that had a stable hairpin structures or a high level of covariance. Using northern blotting, we verify the expression of 2 out...

  20. Construction and analysis of lncRNA-lncRNA synergistic networks to reveal clinically relevant lncRNAs in cancer.

    Science.gov (United States)

    Li, Yongsheng; Chen, Juan; Zhang, Jinwen; Wang, Zishan; Shao, Tingting; Jiang, Chunjie; Xu, Juan; Li, Xia

    2015-09-22

    Long non-coding RNAs (lncRNAs) play key roles in diverse biological processes. Moreover, the development and progression of cancer often involves the combined actions of several lncRNAs. Here we propose a multi-step method for constructing lncRNA-lncRNA functional synergistic networks (LFSNs) through co-regulation of functional modules having three features: common coexpressed genes of lncRNA pairs, enrichment in the same functional category and close proximity within protein interaction networks. Applied to three cancers, we constructed cancer-specific LFSNs and found that they exhibit a scale free and modular architecture. In addition, cancer-associated lncRNAs tend to be hubs and are enriched within modules. Although there is little synergistic pairing of lncRNAs across cancers, lncRNA pairs involved in the same cancer hallmarks by regulating same or different biological processes. Finally, we identify prognostic biomarkers within cancer lncRNA expression datasets using modules derived from LFSNs. In summary, this proof-of-principle study indicates synergistic lncRNA pairs can be identified through integrative analysis of genome-wide expression data sets and functional information.

  1. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  2. Metamorphosis of a Hairpin Vortex into a Young Turbulent Spot

    Science.gov (United States)

    Singer, Bart A.; Joslin, Ronald D.

    1995-01-01

    Direct numerical simulation was used to study the formation and growth of a hairpin vortex in a flat-plate boundary layer and its later development into a young turbulent spot. Fluid injection through a slit in the wall triggered the initial vortex. The legs of the vortex were stretched into a hairpin shape as it traveled downstream. Multiple hairpin vortex heads developed between the stretched legs. New vortices formed beneath the streamwise-elongated vortex legs. The continued development of additional vortices resulted in the formation of a traveling region of highly disturbed ow with an arrowhead shape similar to that of a turbulent spot.

  3. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines.

    Science.gov (United States)

    Kristensen, Tatjana P; Maria Cherian, Reeja; Gray, Fiona C; MacNeill, Stuart A

    2014-01-01

    The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies.

  4. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines

    Directory of Open Access Journals (Sweden)

    Tatjana P Kristensen

    2014-03-01

    Full Text Available The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural

  5. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  6. Construction of permanently inducible miRNA-based expression vectors using site-specific recombinases

    Directory of Open Access Journals (Sweden)

    Garwick-Coppens Sara E

    2011-11-01

    Full Text Available Abstract Background RNA interference (RNAi is a conserved gene silencing mechanism mediated by small inhibitory microRNAs (miRNAs. Promoter-driven miRNA expression vectors have emerged as important tools for delivering natural or artificially designed miRNAs to eukaryotic cells and organisms. Such systems can be used to query the normal or pathogenic functions of natural miRNAs or messenger RNAs, or to therapeutically silence disease genes. Results As with any molecular cloning procedure, building miRNA-based expression constructs requires a time investment and some molecular biology skills. To improve efficiency and accelerate the construction process, we developed a method to rapidly generate miRNA expression vectors using recombinases instead of more traditional cut-and-paste molecular cloning techniques. In addition to streamlining the construction process, our cloning strategy provides vectors with added versatility. In our system, miRNAs can be constitutively expressed from the U6 promoter, or inducibly expressed by Cre recombinase. We also engineered a built-in mechanism to destroy the vector with Flp recombinase, if desired. Finally, to further simplify the construction process, we developed a software package that automates the prediction and design of optimal miRNA sequences using our system. Conclusions We designed and tested a modular system to rapidly clone miRNA expression cassettes. Our strategy reduces the hands-on time required to successfully generate effective constructs, and can be implemented in labs with minimal molecular cloning expertise. This versatile system provides options that permit constitutive or inducible miRNA expression, depending upon the needs of the end user. As such, it has utility for basic or translational applications.

  7. Hybridization-based biosensor containing hairpin probes and use thereof

    Science.gov (United States)

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2010-10-12

    A sensor chip that includes: a fluorescence quenching surface; a nucleic acid probe that contains first and second ends with the first end bound to the fluorescence quenching surface, and is characterized by being able to self-anneal into a hairpin conformation; and a first fluorophore bound to the second end of the first nucleic acid molecule. When the first nucleic acid molecule is in the hairpin conformation, the fluorescence quenching surface substantially quenches fluorescent emissions by the first fluorophore; and when the first nucleic acid molecule is in a non-hairpin conformation, fluorescent emissions by the fluorophore are substantially free of quenching by the fluorescence quenching surface. Various nucleic acid probes, methods of making the sensor chip, biological sensor devices that contain the sensor chip, and their methods of use are also disclosed.

  8. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  9. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  10. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  11. Structural studies on an internal loop from a hairpin ribozyme

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Z.; SantaLucia, J. Jr.; Tinoco, I. Jr. [Univ. of California, Berkeley, CA (United States)

    1994-12-01

    Ribozymes, RNA enzymes, catalyze site-specific RNA cleavage and ligation reactions. We are studying the three-dimensional structure of a hairpin ribozyme derived from the minus strand of tobacco ring spot virus satellite RNA ((-)sTRSV), which has been engineering to specifically cleave the HIV-1 RNA. The minimum structure for the catalytic reaction involves a 50-nucleotide ribozyme and a 14-nucleotide substrate. The proposed secondary structure of the ribozyme-substrate complex consists of four short helices separated by two internal loops. The relatively large size (64-nucleotide) of the ribozyme-substrate complex presents formidable problems in solving the structure using NMR. Therefore we are studying smaller structural subunits of the complex. We are determining the high resolution structure of the symmetric internal loop involving the cleavage site and the flanking helices. One strand of the internal loop was selectively {sup 13}C-labeled at C8 of each purine and C6 of each pyrimidine. By using {sup 13}C-edited two-dimensional NMR, the proton NOESY spectrum was greatly simplified. This allowed unambiguous sequential proton resonance assignments along each strand. Three-dimensional {sup 1}-{sup 13}C HMQC-NOESY was used to further facilitate resonance assignments. We are also enzymatically synthesizing the entire 50-nucleotide ribozyme and will combine it with the {sup 13}C-labeled substrate. Through comparison of the NOE connectivities of the labeled nucleotides from the internal loop alone with those from the entire complex, the differences between the two structures can be elucidated.

  12. Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon.

    Science.gov (United States)

    Xue, Jianpeng; Shan, Lingling; Chen, Haiyan; Li, Yang; Zhu, Hongyan; Deng, Dawei; Qian, Zhiyu; Achilefu, Samuel; Gu, Yueqing

    2013-03-15

    Signal transducer and activator of transcription 5B (STAT5B) is an important protein in JAK-STAT signaling pathway that is responsible for the metastasis and proliferation of tumor cells. Determination of the STAT5B messenger Ribonucleic Acid (mRNA) relating to the STAT5B expression provides insight into the mechanism of tumor progression. In this study, we designed and used a special hairpin deoxyribonucleic acid (DNA) for human STAT5B mRNA to functionalize gold nanoparticles, which served as a beacon for detecting human STAT5B expression. Up to 90% quenching efficiency was achieved. Upon hybridizing with the target mRNA, the hairpin DNA modified gold nanoparticle beacons (hDAuNP beacons) release the fluorophores attached at 5' end of the oligonucleotide sequence. The fluorescence properties of the beacon before and after the hybridization with the complementary DNA were confirmed in vitro. The stability of hDAuNP beacons against degradation by DNase I and GSH indicated that the prepared beacon is stable inside cells. The detected fluorescence in MCF-7 cancer cells correlates with the specific STAT5B mRNA expression, which is consistent with the result from PCR measurement. Fluorescence microscopy showed that the hDAuNP beacons internalized in cells without using transfection agents, with intracellular distribution in the cytoplasm rather than the nucleus. The results demonstrated that this beacon could directly provide quantitative measurement of the intracellular STAT5B mRNA in living cells. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection and an increased resistance to nuclease degradation. The strategy reported in this study is a promising approach for the intracellular measurement of RNA or protein expression in living cells, and has great potential in the study of drug screening and discovery. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Design, Construction, and Validation of Artificial MicroRNA Vectors Using Agrobacterium-Mediated Transient Expression System.

    Science.gov (United States)

    Bhagwat, Basdeo; Chi, Ming; Han, Dianwei; Tang, Haifeng; Tang, Guiliang; Xiang, Yu

    2016-01-01

    Artificial microRNA (amiRNA) technology utilizes microRNA (miRNA) biogenesis pathway to produce artificially selected small RNAs using miRNA gene backbone. It provides a feasible strategy for inducing loss of gene function, and has been applied in functional genomics study, improvement of crop quality and plant virus disease resistance. A big challenge in amiRNA applications is the unpredictability of silencing efficacy of the designed amiRNAs and not all constructed amiRNA candidates would be expressed effectively in plant cells. We and others found that high efficiency and specificity in RNA silencing can be achieved by designing amiRNAs with perfect or almost perfect sequence complementarity to their targets. In addition, we recently demonstrated that Agrobacterium-mediated transient expression system can be used to validate amiRNA constructs, which provides a simple, rapid and effective method to select highly expressible amiRNA candidates for stable genetic transformation. Here, we describe the methods for design of amiRNA candidates with perfect or almost perfect base-pairing to the target gene or gene groups, incorporation of amiRNA candidates in miR168a gene backbone by one step inverse PCR amplification, construction of plant amiRNA expression vectors, and assay of transient expression of amiRNAs in Nicotiana benthamiana through agro-infiltration, small RNA extraction, and amiRNA Northern blot.

  14. Crystal structure of the bacteriophage Qβ coat protein in complex with the RNA operator of the replicase gene.

    Science.gov (United States)

    Rumnieks, Janis; Tars, Kaspars

    2014-03-06

    The coat proteins of single-stranded RNA bacteriophages specifically recognize and bind to a hairpin structure in their genome at the beginning of the replicase gene. The interaction serves to repress the synthesis of the replicase enzyme late in infection and contributes to the specific encapsidation of phage RNA. While this mechanism is conserved throughout the Leviviridae family, the coat protein and operator sequences from different phages show remarkable variation, serving as prime examples for the co-evolution of protein and RNA structure. To better understand the protein-RNA interactions in this virus family, we have determined the three-dimensional structure of the coat protein from bacteriophage Qβ bound to its cognate translational operator. The RNA binding mode of Qβ coat protein shares several features with that of the widely studied phage MS2, but only one nucleotide base in the hairpin loop makes sequence-specific contacts with the protein. Unlike in other RNA phages, the Qβ coat protein does not utilize an adenine-recognition pocket for binding a bulged adenine base in the hairpin stem but instead uses a stacking interaction with a tyrosine side chain to accommodate the base. The extended loop between β strands E and F of Qβ coat protein makes contacts with the lower part of the RNA stem, explaining the greater length dependence of the RNA helix for optimal binding to the protein. Consequently, the complex structure allows the proposal of a mechanism by which the Qβ coat protein recognizes and discriminates in favor of its cognate RNA. © 2013.

  15. Miniature short hairpin RNA screens to characterize antiproliferative drugs.

    Science.gov (United States)

    Kittanakom, Saranya; Arnoldo, Anthony; Brown, Kevin R; Wallace, Iain; Kunavisarut, Tada; Torti, Dax; Heisler, Lawrence E; Surendra, Anuradha; Moffat, Jason; Giaever, Guri; Nislow, Corey

    2013-08-07

    The application of new proteomics and genomics technologies support a view in which few drugs act solely by inhibiting a single cellular target. Indeed, drug activity is modulated by complex, often incompletely understood cellular mechanisms. Therefore, efforts to decipher mode of action through genetic perturbation such as RNAi typically yields "hits" that fall into several categories. Of particular interest to the present study, we aimed to characterize secondary activities of drugs on cells. Inhibiting a known target can result in clinically relevant synthetic phenotypes. In one scenario, drug perturbation could, for example, improperly activate a protein that normally inhibits a particular kinase. In other cases, additional, lower affinity targets can be inhibited as in the example of inhibition of c-Kit observed in Bcr-Abl-positive cells treated with Gleevec. Drug transport and metabolism also play an important role in the way any chemicals act within the cells. Finally, RNAi per se can also affect cell fitness by more general off-target effects, e.g., via the modulation of apoptosis or DNA damage repair. Regardless of the root cause of these unwanted effects, understanding the scope of a drug's activity and polypharmacology is essential for better understanding its mechanism(s) of action, and such information can guide development of improved therapies. We describe a rapid, cost-effective approach to characterize primary and secondary effects of small-molecules by using small-scale libraries of virally integrated short hairpin RNAs. We demonstrate this principle using a "minipool" composed of shRNAs that target the genes encoding the reported protein targets of approved drugs. Among the 28 known reported drug-target pairs, we successfully identify 40% of the targets described in the literature and uncover several unanticipated drug-target interactions based on drug-induced synthetic lethality. We provide a detailed protocol for performing such screens and for

  16. Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

    Science.gov (United States)

    Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

    2017-07-11

    RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

  17. Organization and transient expression of the gene for human U11 snRNA

    Science.gov (United States)

    Clemens, Suter-Crazzolara; Walter, Keller

    1991-01-01

    The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

  18. Construction and analysis of circular RNA molecular regulatory networks in liver cancer.

    Science.gov (United States)

    Ren, Shuangchun; Xin, Zhuoyuan; Xu, Yinyan; Xu, Jianting; Wang, Guoqing

    2017-01-01

    Liver cancer is the sixth most prevalent cancer, and the third most frequent cause of cancer-related deaths. Circular RNAs (circRNAs), a kind of special endogenous ncRNAs, have been coming back to the forefront of cancer genomics research. In this study, we used a systems biology approach to construct and analyze the circRNA molecular regulatory networks in the context of liver cancer. We detected a total of 127 differentially expressed circRNAs and 3,235 differentially expressed mRNAs. We selected the top-5 upregulated circRNAs to construct a circRNA-miRNA-mRNA network. We enriched the pathways and gene ontology items and determined their participation in cancer-related pathways such as p53 signaling pathway and pathways involved in angiogenesis and cell cycle. Quantitative real-time PCR was performed to verify the top-five circRNAs. ROC analysis showed circZFR, circFUT8, circIPO11 could significantly distinguish the cancer samples, with an AUC of 0.7069, 0.7575, and 0.7103, respectively. Our results suggest the circRNA-miRNA-mRNA network may help us further understand the molecular mechanisms of tumor progression in liver cancer, and reveal novel biomarkers and therapeutic targets.

  19. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  20. Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

    Science.gov (United States)

    Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

    2015-01-01

    Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

  1. Hairpin structures in DNA containing arabinofuranosylcytosine. A combination of nuclear magnetic resonance and molecular dynamics

    International Nuclear Information System (INIS)

    Pieters, J.M.L.; de Vroom, E.; van der Marel, G.A.; van Boom, J.H.; Altona, C.; Koning, T.H.G.; Kaptein, R.

    1990-01-01

    Nuclear magnetic resonance (NMR) and model-building studies were carried out on the hairpin form of the octamer d(CG a CTAGCG) ( a C = arabinofuranosylcytosine), referred to as the TA compound. The nonexchangeable protons of the TA compound were assigned by means of nuclear Overhauser effect spectroscopy (NOESY) and correlated spectroscopy (COSY). Form a detailed analysis of the coupling data and of the NOESY spectra the following conclusions are reached: (i) the hairpin consists of a stem of three Watson-Crick type base pairs, and the two remaining residues, T(4) and dA(5), participate in a loop. (ii) All sugar rings show conformational flexibility although a strong preference for the S-type (C2'-endo) conformer is observed. (iii) The thymine does not stack upon the 3' side of the stem as expected, but swings into the minor groove. (iv) At the 5'-3' loop-stem junction a stacking discontinuity occurs as a consequence of a sharp turn in that part of the backbone, caused by the unusual β + and γ t torsion angles in residue dG(6). (v) The A base slides over the 5' side of the stem to stack upon the a C(3) residue at the 3' side of the stem in an antiparallel fashion. On the basis of J couplings and a set approximate proton-proton distances from NOE cross peaks, a model for the hairpin was constructed

  2. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

    Directory of Open Access Journals (Sweden)

    Eric R. Gamache

    2017-04-01

    Full Text Available The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT. To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1, a 1-nucleotide interhelical loop and an 8-bp stem (S2 that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging.

  3. Effects of a mutation on the folding mechanism of a β-hairpin

    NARCIS (Netherlands)

    Juraszek, J.; Bolhuis, P.G.

    2009-01-01

    The folding mechanism of a protein is determined by its primary sequence. Yet, how the mechanism is changed by a mutation is still poorly understood, even for basic secondary structures such as β-hairpins. We perform an extensive simulation study of the effects of mutating the GB1 β-hairpin into

  4. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  5. Pressure modulates the self-cleavage step of the hairpin ribozyme

    Science.gov (United States)

    Schuabb, Caroline; Kumar, Narendra; Pataraia, Salome; Marx, Dominik; Winter, Roland

    2017-03-01

    The ability of certain RNAs, denoted as ribozymes, to not only store genetic information but also catalyse chemical reactions gave support to the RNA world hypothesis as a putative step in the development of early life on Earth. This, however, might have evolved under extreme environmental conditions, including the deep sea with pressures in the kbar regime. Here we study pressure-induced effects on the self-cleavage of hairpin ribozyme by following structural changes in real-time. Our results suggest that compression of the ribozyme leads to an accelerated transesterification reaction, being the self-cleavage step, although the overall process is retarded in the high-pressure regime. The results reveal that favourable interactions between the reaction site and neighbouring nucleobases are strengthened under pressure, resulting therefore in an accelerated self-cleavage step upon compression. These results suggest that properly engineered ribozymes may also act as piezophilic biocatalysts in addition to their hitherto known properties.

  6. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    Science.gov (United States)

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  7. shRNA-seq data analysis with edgeR [v1; ref status: indexed, http://f1000r.es/38s

    Directory of Open Access Journals (Sweden)

    Zhiyin Dai

    2014-04-01

    Full Text Available Pooled short hairpin RNA sequencing (shRNA-seq screens are becoming increasingly popular in functional genomics research, and there is a need to establish optimal analysis tools to handle such data. Our open-source shRNA processing pipeline in edgeR provides a complete analysis solution for shRNA-seq screen data, that begins with the raw sequence reads and ends with a ranked lists of candidate shRNAs for downstream biological validation. We first summarize the raw data contained in a fastq file into a matrix of counts (samples in the columns, hairpins in the rows with options for allowing mismatches and small shifts in hairpin position. Diagnostic plots, normalization and differential representation analysis can then be performed using established methods to prioritize results in a statistically rigorous way, with the choice of either the classic exact testing methodology or a generalized linear modelling that can handle complex experimental designs. A detailed users’ guide that demonstrates how to analyze screen data in edgeR along with a point-and-click implementation of this workflow in Galaxy are also provided. The edgeR package is freely available from http://www.bioconductor.org.

  8. Construction of RNA-Quantum Dot Chimera for Nanoscale Resistive Biomemory Application.

    Science.gov (United States)

    Lee, Taek; Yagati, Ajay Kumar; Pi, Fengmei; Sharma, Ashwani; Choi, Jeong-Woo; Guo, Peixuan

    2015-07-28

    RNA nanotechnology offers advantages to construct thermally and chemically stable nanoparticles with well-defined shape and structure. Here we report the development of an RNA-QD (quantum dot) chimera for resistive biomolecular memory application. Each QD holds two copies of the pRNA three-way junction (pRNA-3WJ) of the bacteriophage phi29 DNA packaging motor. The fixed quantity of two RNAs per QD was achieved by immobilizing the pRNA-3WJ with a Sephadex aptamer for resin binding. Two thiolated pRNA-3WJ serve as two feet of the chimera that stand on the gold plate. The RNA nanostructure served as both an insulator and a mediator to provide defined distance between the QD and gold. Immobilization of the chimera nanoparticle was confirmed with scanning tunneling microscopy. As revealed by scanning tunneling spectroscopy, the conjugated pRNA-3WJ-QD chimera exhibited an excellent electrical bistability signal for biomolecular memory function, demonstrating great potential for the development of resistive biomolecular memory and a nano-bio-inspired electronic device for information processing and computing.

  9. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  10. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  11. Hairpin formation within the enhancer region of the human enkephalin gene

    International Nuclear Information System (INIS)

    McMurray, C.T.; Douglass, J.O.; Wilson, W.D.

    1991-01-01

    The 3',5'-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures

  12. Hairpin formation within the enhancer region of the human enkephalin gene

    Energy Technology Data Exchange (ETDEWEB)

    McMurray, C.T.; Douglass, J.O. (Oregon Health Sciences Univ., Portland (United States)); Wilson, W.D. (Georgia State Univ., Atlanta (United States))

    1991-01-15

    The 3{prime},5{prime}-cyclic adenosine monophosphate (cAMP)-inducible enhancer of the human enkephaline gene is located within an imperfect palindrom of 23 base pairs. The authors have found that a 23-base-pair oligonucleotide duplex containing the enhancer undergoes a reversible conformational transition from the duplex to two individual hairpin structures each formed from one strand of the duplex. Each individual hairpin forms with mismatched base pairs, one containing two GT pairs and the other containing two AC pairs. The conformational transition is stabilized by proton transfer to the hairpin containing AC mismatched pairs. The unique physical and thermodynamic properties of the enkephalin enhancer DNA suggest a model in which DNA secondary structure within the enhancer region plays and active role incAMP-inducible activation of the human enkephalin gene via formation of cruciform structures.

  13. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo

    2014-01-01

    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  14. (CAG)(n)-hairpin DNA binds to Msh2-Msh3 and changes properties of mismatch recognition.

    Science.gov (United States)

    Owen, Barbara A L; Yang, Zungyoon; Lai, Maoyi; Gajec, Maciej; Gajek, Maciez; Badger, John D; Hayes, Jeffrey J; Edelmann, Winfried; Kucherlapati, Raju; Wilson, Teresa M; McMurray, Cynthia T

    2005-08-01

    Cells have evolved sophisticated DNA repair systems to correct damaged DNA. However, the human DNA mismatch repair protein Msh2-Msh3 is involved in the process of trinucleotide (CNG) DNA expansion rather than repair. Using purified protein and synthetic DNA substrates, we show that Msh2-Msh3 binds to CAG-hairpin DNA, a prime candidate for an expansion intermediate. CAG-hairpin binding inhibits the ATPase activity of Msh2-Msh3 and alters both nucleotide (ADP and ATP) affinity and binding interfaces between protein and DNA. These changes in Msh2-Msh3 function depend on the presence of A.A mispaired bases in the stem of the hairpin and on the hairpin DNA structure per se. These studies identify critical functional defects in the Msh2-Msh3-CAG hairpin complex that could misdirect the DNA repair process.

  15. Effective relief of neuropathic pain by adeno-associated virus-mediated expression of a small hairpin RNA against GTP cyclohydrolase 1

    Directory of Open Access Journals (Sweden)

    Chang Jin

    2009-11-01

    Full Text Available Abstract Background Recent studies show that transcriptional activation of GTP cyclohydrolase I (GCH1 in dorsal root ganglia (DRG is significantly involved in the development and persistency of pain symptoms. We thus hypothesize that neuropathic pain may be attenuated by down-regulation of GCH1 expression, and propose a gene silencing system for this purpose. Results To interrupt GCH1 synthesis, we designed a bidirectional recombinant adeno-associated virus encoding both a small hairpin RNA against GCH1 and a GFP reporter gene (rAAV-shGCH1. After rAAV-shGCH1 was introduced into the sciatic nerve prior to or following pain-inducing surgery, therapeutic efficacy and the underlying mechanisms were subsequently validated in animal models. The GFP expression data indicates that rAAV effectively delivered transgenes to DRG. Subsequently reduced GCH1 expression was evident from immunohistochemistry and western-blotting analysis. Along with the down-regulation of GCH1, the von Frey test correspondingly indicated a sharp decline in pain symptoms upon both pre- and post-treatment with rAAV-shGCH1. Interestingly, GCH1 down-regulation additionally led to decreased microglial activation in the dorsal horn, implying an association between pain attenuation and reduced inflammation. Conclusion Therefore, the data suggests that GCH1 levels can be reduced by introducing rAAV-shGCH1, leading to pain relief. Based on the results, we propose that GCH1 modulation may be developed as a clinically applicable gene therapy strategy to treat neuropathic pain.

  16. Life extension of MAPS-2 by replacement of boiler hairpin type heat exchangers

    International Nuclear Information System (INIS)

    Tripathi, J.C.; Rastogi, S.K.; Rastogi, A.K.

    2006-01-01

    The steam generating equipment in MAPS-1 and 2 are Hairpin type comprises of eight boiler assemblies arranged in two banks of four boilers each. Each hairpin type heat exchangers consist of 195 Monel-400 tubes of 12.7 mm OD x 1.24 mm WT. One boiler assembly consists of eleven inverted U type heat exchangers (called hairpin type heat exchangers) mounted in parallel on inlet and outlet heavy water manifolds and connected to steam drum through individual short riser. Heavy water flows through these tubes where as feed water enters the shell at the bottom of one leg called pre-heat leg. After commissioning of MAPS-2 in 1985, five hairpins of MAPS-2 developed leak during the course of operation by the year 1999. Absence of physical access for health assessment of steam generator tube and lack of provision for tube sheet cleaning to remove the deposits on feed water side had caused pile and resulted in tube failures by under deposit pitting corrosion. All the 88 hairpins of MAPS-2 were replaced to extend the plant life when MAPS-2 was taken out of grid for En-masse Coolant Channel Replacement job (EMCCR) in the year 2001 - 03. The long shutdown of MAPS units for EMCCR was considered to be cost effective since unscheduled plant shut downs on account of tube leaks could be avoided. (author)

  17. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  18. ARMOUR - A Rice miRNA: mRNA Interaction Resource.

    Science.gov (United States)

    Sanan-Mishra, Neeti; Tripathi, Anita; Goswami, Kavita; Shukla, Rohit N; Vasudevan, Madavan; Goswami, Hitesh

    2018-01-01

    ARMOUR was developed as A Rice miRNA:mRNA interaction resource. This informative and interactive database includes the experimentally validated expression profiles of miRNAs under different developmental and abiotic stress conditions across seven Indian rice cultivars. This comprehensive database covers 689 known and 1664 predicted novel miRNAs and their expression profiles in more than 38 different tissues or conditions along with their predicted/known target transcripts. The understanding of miRNA:mRNA interactome in regulation of functional cellular machinery is supported by the sequence information of the mature and hairpin structures. ARMOUR provides flexibility to users in querying the database using multiple ways like known gene identifiers, gene ontology identifiers, KEGG identifiers and also allows on the fly fold change analysis and sequence search query with inbuilt BLAST algorithm. ARMOUR database provides a cohesive platform for novel and mature miRNAs and their expression in different experimental conditions and allows searching for their interacting mRNA targets, GO annotation and their involvement in various biological pathways. The ARMOUR database includes a provision for adding more experimental data from users, with an aim to develop it as a platform for sharing and comparing experimental data contributed by research groups working on rice.

  19. Rich RNA Structure Landscapes Revealed by Mutate-and-Map Analysis.

    Directory of Open Access Journals (Sweden)

    Pablo Cordero

    2015-11-01

    Full Text Available Landscapes exhibiting multiple secondary structures arise in natural RNA molecules that modulate gene expression, protein synthesis, and viral infection [corrected]. We report herein that high-throughput chemical experiments can isolate an RNA's multiple alternative secondary structures as they are stabilized by systematic mutagenesis (mutate-and-map, M2 and that a computational algorithm, REEFFIT, enables unbiased reconstruction of these states' structures and populations. In an in silico benchmark on non-coding RNAs with complex landscapes, M2-REEFFIT recovers 95% of RNA helices present with at least 25% population while maintaining a low false discovery rate (10% and conservative error estimates. In experimental benchmarks, M2-REEFFIT recovers the structure landscapes of a 35-nt MedLoop hairpin, a 110-nt 16S rRNA four-way junction with an excited state, a 25-nt bistable hairpin, and a 112-nt three-state adenine riboswitch with its expression platform, molecules whose characterization previously required expert mutational analysis and specialized NMR or chemical mapping experiments. With this validation, M2-REEFFIT enabled tests of whether artificial RNA sequences might exhibit complex landscapes in the absence of explicit design. An artificial flavin mononucleotide riboswitch and a randomly generated RNA sequence are found to interconvert between three or more states, including structures for which there was no design, but that could be stabilized through mutations. These results highlight the likely pervasiveness of rich landscapes with multiple secondary structures in both natural and artificial RNAs and demonstrate an automated chemical/computational route for their empirical characterization.

  20. Facile conversion of ATP-binding RNA aptamer to quencher-free molecular aptamer beacon.

    Science.gov (United States)

    Park, Yoojin; Nim-Anussornkul, Duangrat; Vilaivan, Tirayut; Morii, Takashi; Kim, Byeang Hyean

    2018-01-15

    We have developed RNA-based quencher-free molecular aptamer beacons (RNA-based QF-MABs) for the detection of ATP, taking advantage of the conformational changes associated with ATP binding to the ATP-binding RNA aptamer. The RNA aptamer, with its well-defined structure, was readily converted to the fluorescence sensors by incorporating a fluorophore into the loop region of the hairpin structure. These RNA-based QF-MABs exhibited fluorescence signals in the presence of ATP relative to their low background signals in the absence of ATP. The fluorescence emission intensity increased upon formation of a RNA-based QF-MAB·ATP complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A novel bidirectional expression system for simultaneous expression of both the protein-coding genes and short hairpin RNAs in mammalian cells

    International Nuclear Information System (INIS)

    Hung, C.-F.; Cheng, T.-L.; Wu, R.-H.; Teng, C.-F.; Chang, W.-T.

    2006-01-01

    RNA interference (RNAi) is an extremely powerful and widely used gene silencing approach for reverse functional genomics and molecular therapeutics. In mammals, the conserved poly(ADP-ribose) polymerase 2 (PARP-2)/RNase P bidirectional control promoter simultaneously expresses both the PARP-2 protein and RNase P RNA by RNA polymerase II- and III-dependent mechanisms, respectively. To explore this unique bidirectional control system in RNAi-mediated gene silencing strategy, we have constructed two novel bidirectional expression vectors, pbiHsH1 and pbiMmH1, which contained the PARP-2/RNase P bidirectional control promoters from human and mouse, for simultaneous expression of both the protein-coding genes and short hairpin RNAs. Analyses of the dual transcriptional activities indicated that these two bidirectional expression vectors could not only express enhanced green fluorescent protein as a functional reporter but also simultaneously transcribe shLuc for inhibiting the firefly luciferase expression. In addition, to extend its utility for the establishment of inherited stable clones, we have also reconstructed this bidirectional expression system with the blasticidin S deaminase gene, an effective dominant drug resistance selectable marker, and examined both the selection and inhibition efficiencies in drug resistance and gene expression. Moreover, we have further demonstrated that this bidirectional expression system could efficiently co-regulate the functionally important genes, such as overexpression of tumor suppressor protein p53 and inhibition of anti-apoptotic protein Bcl-2 at the same time. In summary, the bidirectional expression vectors, pbiHsH1 and pbiMmH1, should provide a simple, convenient, and efficient novel tool for manipulating the gene function in mammalian cells

  2. Affinity maturation of a portable Fab–RNA module for chaperone-assisted RNA crystallography

    Science.gov (United States)

    Koirala, Deepak; Shelke, Sandip A; Dupont, Marcel; Ruiz, Stormy; DasGupta, Saurja; Bailey, Lucas J; Benner, Steven A; Piccirilli, Joseph A

    2018-01-01

    Abstract Antibody fragments such as Fabs possess properties that can enhance protein and RNA crystallization and therefore can facilitate macromolecular structure determination. In particular, Fab BL3–6 binds to an AAACA RNA pentaloop closed by a GC pair with ∼100 nM affinity. The Fab and hairpin have served as a portable module for RNA crystallization. The potential for general application make it desirable to adjust the properties of this crystallization module in a manner that facilitates its use for RNA structure determination, such as ease of purification, surface entropy or binding affinity. In this work, we used both in vitro RNA selection and phage display selection to alter the epitope and paratope sides of the binding interface, respectively, for improved binding affinity. We identified a 5′-GNGACCC-3′ consensus motif in the RNA and S97N mutation in complimentarity determining region L3 of the Fab that independently impart about an order of magnitude improvement in affinity, resulting from new hydrogen bonding interactions. Using a model RNA, these modifications facilitated crystallization under a wider range of conditions and improved diffraction. The improved features of the Fab–RNA module may facilitate its use as an affinity tag for RNA purification and imaging and as a chaperone for RNA crystallography. PMID:29309709

  3. ARMOUR – A Rice miRNA: mRNA Interaction Resource

    Directory of Open Access Journals (Sweden)

    Neeti Sanan-Mishra

    2018-05-01

    Full Text Available ARMOUR was developed as ARice miRNA:mRNA interaction resource. This informative and interactive database includes the experimentally validated expression profiles of miRNAs under different developmental and abiotic stress conditions across seven Indian rice cultivars. This comprehensive database covers 689 known and 1664 predicted novel miRNAs and their expression profiles in more than 38 different tissues or conditions along with their predicted/known target transcripts. The understanding of miRNA:mRNA interactome in regulation of functional cellular machinery is supported by the sequence information of the mature and hairpin structures. ARMOUR provides flexibility to users in querying the database using multiple ways like known gene identifiers, gene ontology identifiers, KEGG identifiers and also allows on the fly fold change analysis and sequence search query with inbuilt BLAST algorithm. ARMOUR database provides a cohesive platform for novel and mature miRNAs and their expression in different experimental conditions and allows searching for their interacting mRNA targets, GO annotation and their involvement in various biological pathways. The ARMOUR database includes a provision for adding more experimental data from users, with an aim to develop it as a platform for sharing and comparing experimental data contributed by research groups working on rice.

  4. Determination of low-energy structures of a small RNA hairpin using ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... such as water clusters, Argon clusters and different biomo- lecules. ... Keywords. Energy landscape; Monte Carlo; optimization; RNA; tertiary structure .... tui large ribosomal subunit (Residues 310–321, PDB ID: 1JJ2).

  5. Strange temperature dependence of the folding rate of a 16-residue β-hairpin

    International Nuclear Information System (INIS)

    Xu Yao; Wang Ting; Gai Feng

    2006-01-01

    The folding/unfolding kinetics of a 16-residue β-hairpin that undergoes cold denaturation at ambient temperatures were investigated by time-resolved infrared spectroscopy coupled with the laser-induced temperature jump (T-jump) initiation method. We found that the relaxation kinetics of this β-hairpin following a T-jump, obtained by probing the amide I' band of the peptide backbone, show strange temperature dependence. At temperatures below approximately 35 deg. C where this β-hairpin mainly exhibits cold denaturation, the T-jump induced relaxation rate is ∼5 μs -1 , whereas at temperatures where heat denaturation takes place, the relaxation rate increases to ∼1 μs -1 . These results cannot be readily explained by a two-state folding model that has been used to describe the folding thermodynamics of this β-hairpin. In addition, these results suggest that the folding free energy barrier separating the cold-denatured state from the folded state is different from that separating the heat-denatured state from the folded state, coinciding with the idea that the mechanism leading to cold denaturation is different from that leading to heat denaturation

  6. Whirlwinds and hairpins in the atmospheric surface layer

    NARCIS (Netherlands)

    Oncley, Steven P.; Hartogensis, O.K.; Tong, Chenning

    2016-01-01

    Vortices in the atmospheric surface layer are characterized using observations at unprecedented resolution from a fixed array of 31 turbulence sensors. During the day, these vortices likely are dust devils, though no visual observations are available for confirmation. At night, hairpin vortices

  7. Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT.

    Science.gov (United States)

    Haga, Kei; Ohno, Shin-ichi; Yugawa, Takashi; Narisawa-Saito, Mako; Fujita, Masatoshi; Sakamoto, Michiie; Galloway, Denise A; Kiyono, Tohru

    2007-02-01

    Activation of telomerase is sufficient for immortalization of some types of human cells but additional factors may also be essential. It has been proposed that stress imposed by inadequate culture conditions induces senescence due to accumulation of p16(INK4a). Here, we present evidence that many human cell types undergo senescence by activation of the p16(INK4a)/Rb pathway, and that introduction of Bmi-1 can inhibit p16(INK4a) expression and extend the life span of human epithelial cells derived from skin, mammary gland and lung. Introduction of p16(INK4a)-specific short hairpin RNA, as well as Bmi-1, suppressed p16(INK4a) expression in human mammary epithelial cells without promoter methylation, and extended their life span. Subsequent introduction of hTERT, the telomerase catalytic subunit, into cells with low p16(INK4a) levels resulted in efficient immortalization of three cell types without crisis or growth arrest. The majority of the human mammary epithelial cells thus immortalized showed almost normal ploidy as judged by G-banding and spectral karyotyping analysis. Our data suggest that inhibition of p16(INK4a) and introduction of hTERT can immortalize many human cell types with little chromosomal instability.

  8. Hairpin-like fluorescent probe for imaging of NF-κB transcription factor activity.

    Science.gov (United States)

    Metelev, Valeri; Zhang, Surong; Tabatadze, David; Bogdanov, Alexei

    2011-04-20

    Three oligodeoxyribonucleotides (ODN) covalently labeled with near-infrared (NIR) fluorochromes were synthesized and characterized with a goal of comparing in vitro a hairpin-based and a duplex-based FRET probe designed for the detection of human recombinant NF-κB p50/p65 heterodimer binding to DNA. Using deoxyguanosine phosphoramidite with a phosphorus-linked aminoethylene (diethylene glycol) hydrophilic linker, we synthesized ODNs with internucleoside reactive sites. The hairpin loop amino linker was modified with IRDye 800CW (FRET acceptor), and the 3'-end was modified with Cy5.5 (FRET donor) using a dithio-linker. To obtain a duplex probe, we conjugated Cy5.5 and 800CW to complementary strands at the distance of ten base pairs in the resultant duplex. No quenching of dyes was observed in either probe. The FRET efficiency was higher in the duplex (71%) than in the hairpin (56%) due to a more favorable distance between the donor and the acceptor. However, the hairpin design allowed more precise ratiometric measurement of fluorescence intensity changes as a result of NF-κB p50/p65 binding to the probe. We determined that as a result of binding there was a statistically significant increase of fluorescence intensity of Cy5.5 (donor) due to a decrease of FRET if normalized by 800CW intensity measured independently of FRET. We conclude that the hairpin based probe design allows for the synthesis of a dual fluorescence imaging probe that renders signal changes that are simple to interpret and stoichiometrically correct for detecting transcription factor-DNA interactions.

  9. Application of ion mobility-mass spectrometry to microRNA analysis.

    Science.gov (United States)

    Takebayashi, Kosuke; Hirose, Kenji; Izumi, Yoshihiro; Bamba, Takeshi; Fukusaki, Eiichiro

    2013-03-01

    Liquid chromatography/mass spectrometry is widely used for studying sequence determination and modification analysis of small RNAs. However, the efficiency of liquid chromatography-based separation of intact small RNA species is insufficient, since the physiochemical properties among small RNAs are very similar. In this study, we focused on ion mobility-mass spectrometry (IM-MS), which is a gas-phase separation technique coupled with mass spectrometry; we have evaluated the utility of IM-MS for microRNA (miRNA) analysis. A multiply charged deprotonated ion derived from an 18-24-nt-long miRNA was formed by electrospray ionization, and then the time, called the "drift time", taken by each ion to migrate through a buffer gas was measured. Each multivalent ion was temporally separated on the basis of the charge state and structural formation; 3 types of unique mass-mobility correlation patterns (i.e., chainlike-form, hairpin-form, and dimer-form) were present on the two-dimensional mobility-mass spectrum. Moreover, we found that the ion size (sequence length) and the secondary structures of the small RNAs strongly contributed to the IM-MS-based separation, although solvent conditions such as pH had no effect. Therefore, sequence isomers could also be discerned by the selection of each specific charged ion, i.e., the 6(-) charged ion reflected a majority among chainlike-, hairpin-, and other structures. We concluded that the IM-MS provides additional capability for separation; thus, this analytical method will be a powerful tool for comprehensive small RNA analysis. Copyright © 2012. Published by Elsevier B.V.

  10. Transient β-hairpin formation in α-synuclein monomer revealed by coarse-grained molecular dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hang; Ma, Wen [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Han, Wei [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Schulten, Klaus, E-mail: kschulte@ks.uiuc.edu [Beckman Institute for Advanced Science and Technology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States); Department of Physics, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 (United States)

    2015-12-28

    Parkinson’s disease, originating from the intrinsically disordered peptide α-synuclein, is a common neurodegenerative disorder that affects more than 5% of the population above age 85. It remains unclear how α-synuclein monomers undergo conformational changes leading to aggregation and formation of fibrils characteristic for the disease. In the present study, we perform molecular dynamics simulations (over 180 μs in aggregated time) using a hybrid-resolution model, Proteins with Atomic details in Coarse-grained Environment (PACE), to characterize in atomic detail structural ensembles of wild type and mutant monomeric α-synuclein in aqueous solution. The simulations reproduce structural properties of α-synuclein characterized in experiments, such as secondary structure content, long-range contacts, chemical shifts, and {sup 3}J(H{sub N}H{sub C{sub α}})-coupling constants. Most notably, the simulations reveal that a short fragment encompassing region 38-53, adjacent to the non-amyloid-β component region, exhibits a high probability of forming a β-hairpin; this fragment, when isolated from the remainder of α-synuclein, fluctuates frequently into its β-hairpin conformation. Two disease-prone mutations, namely, A30P and A53T, significantly accelerate the formation of a β-hairpin in the stated fragment. We conclude that the formation of a β-hairpin in region 38-53 is a key event during α-synuclein aggregation. We predict further that the G47V mutation impedes the formation of a turn in the β-hairpin and slows down β-hairpin formation, thereby retarding α-synuclein aggregation.

  11. Linear Chromosome-generating System of Agrobacterium tumefaciens C58: Protelomerase Generates and Protects Hairpin Ends

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Wai Mun; DaGloria, Jeanne; Fox, Heather; Ruan, Qiurong; Tillou, John; Shi, Ke; Aihara, Hideki; Aron, John; Casjens, Sherwood (Utah); (UMM)

    2012-09-05

    Agrobacterium tumefaciens C58, the pathogenic bacteria that causes crown gall disease in plants, harbors one circular and one linear chromosome and two circular plasmids. The telomeres of its unusual linear chromosome are covalently closed hairpins. The circular and linear chromosomes co-segregate and are stably maintained in the organism. We have determined the sequence of the two ends of the linear chromosome thus completing the previously published genome sequence of A. tumefaciens C58. We found that the telomeres carry nearly identical 25-bp sequences at the hairpin ends that are related by dyad symmetry. We further showed that its Atu2523 gene encodes a protelomerase (resolvase) and that the purified enzyme can generate the linear chromosomal closed hairpin ends in a sequence-specific manner. Agrobacterium protelomerase, whose presence is apparently limited to biovar 1 strains, acts via a cleavage-and-religation mechanism by making a pair of transient staggered nicks invariably at 6-bp spacing as the reaction intermediate. The enzyme can be significantly shortened at both the N and C termini and still maintain its enzymatic activity. Although the full-length enzyme can uniquely bind to its product telomeres, the N-terminal truncations cannot. The target site can also be shortened from the native 50-bp inverted repeat to 26 bp; thus, the Agrobacterium hairpin-generating system represents the most compact activity of all hairpin linear chromosome- and plasmid-generating systems to date. The biochemical analyses of the protelomerase reactions further revealed that the tip of the hairpin telomere may be unusually polymorphically capable of accommodating any nucleotide.

  12. A Therapeutic Potential of Animal β-hairpin Antimicrobial Peptides.

    Science.gov (United States)

    Panteleev, Pavel V; Balandin, Sergey V; Ivanov, Vadim T; Ovchinnikova, Tatiana V

    2017-01-01

    Endogenous antimicrobial peptides (AMPs) are evolutionary ancient molecular factors of innate immunity that play the key role in host defense. Because of the low resistance rate, AMPs have caught extensive attention as possible alternatives to conventional antibiotics. Over the last years, it has become evident that biological functions of AMPs are beyond direct killing of microbial cells. This review focuses on a relatively small family of animal host defense peptides with the β-hairpin structure stabilized by disulfide bridges. Their small size, rigid structure, stability to proteases, and plethora of biological functions, including antibacterial, antifungal, antiviral, anticancer, endotoxin-binding, metabolism- and immune- modulating activities, make natural β-hairpin AMPs an attractive molecular basis for drug design. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Processing of nuclear viroids in vivo: an interplay between RNA conformations.

    Directory of Open Access Journals (Sweden)

    María-Eugenia Gas

    2007-11-01

    Full Text Available Replication of viroids, small non-protein-coding plant pathogenic RNAs, entails reiterative transcription of their incoming single-stranded circular genomes, to which the (+ polarity is arbitrarily assigned, cleavage of the oligomeric strands of one or both polarities to unit-length, and ligation to circular RNAs. While cleavage in chloroplastic viroids (family Avsunviroidae is mediated by hammerhead ribozymes, where and how cleavage of oligomeric (+ RNAs of nuclear viroids (family Pospiviroidae occurs in vivo remains controversial. Previous in vitro data indicated that a hairpin capped by a GAAA tetraloop is the RNA motif directing cleavage and a loop E motif ligation. Here we have re-examined this question in vivo, taking advantage of earlier findings showing that dimeric viroid (+ RNAs of the family Pospiviroidae transgenically expressed in Arabidopsis thaliana are processed correctly. Using this methodology, we have mapped the processing site of three members of this family at equivalent positions of the hairpin I/double-stranded structure that the upper strand and flanking nucleotides of the central conserved region (CCR can form. More specifically, from the effects of 16 mutations on Citrus exocortis viroid expressed transgenically in A. thaliana, we conclude that the substrate for in vivo cleavage is the conserved double-stranded structure, with hairpin I potentially facilitating the adoption of this structure, whereas ligation is determined by loop E and flanking nucleotides of the two CCR strands. These results have deep implications on the underlying mechanism of both processing reactions, which are most likely catalyzed by enzymes different from those generally assumed: cleavage by a member of the RNase III family, and ligation by an RNA ligase distinct from the only one characterized so far in plants, thus predicting the existence of at least a second plant RNA ligase.

  14. The PS1 hairpin of Mcm3 is essential for viability and for DNA unwinding in vitro.

    Directory of Open Access Journals (Sweden)

    Simon K W Lam

    Full Text Available The pre-sensor 1 (PS1 hairpin is found in ring-shaped helicases of the AAA+ family (ATPases associated with a variety of cellular activities of proteins and is implicated in DNA translocation during DNA unwinding of archaeal mini-chromosome maintenance (MCM and superfamily 3 viral replicative helicases. To determine whether the PS1 hairpin is required for the function of the eukaryotic replicative helicase, Mcm2-7 (also comprised of AAA+ proteins, we mutated the conserved lysine residue in the putative PS1 hairpin motif in each of the Saccharomyces cerevisiae Mcm2-7 subunits to alanine. Interestingly, only the PS1 hairpin of Mcm3 was essential for viability. While mutation of the PS1 hairpin in the remaining MCM subunits resulted in minimal phenotypes, with the exception of Mcm7 which showed slow growth under all conditions examined, the viable alleles were synthetic lethal with each other. Reconstituted Mcm2-7 containing Mcm3 with the PS1 mutation (Mcm3(K499A had severely decreased helicase activity. The lack of helicase activity provides a probable explanation for the inviability of the mcm3(K499A strain. The ATPase activity of Mcm2-7(3K499A was similar to the wild type complex, but its interaction with single-stranded DNA in an electrophoretic mobility shift assay and its associations in cells were subtly altered. Together, these findings indicate that the PS1 hairpins in the Mcm2-7 subunits have important and distinct functions, most evident by the essential nature of the Mcm3 PS1 hairpin in DNA unwinding.

  15. Recognition elements in rRNA for the tylosin resistance methyltransferase RlmA(II)

    DEFF Research Database (Denmark)

    Lebars, Isabelle; Husson, Clotilde; Yoshizawa, Satoko

    2007-01-01

    The methyltransferase RlmA(II) (formerly TlrB) is found in many Gram-positive bacteria, and methylates the N-1 position of nucleotide G748 within the loop of hairpin 35 in 23S rRNA. Methylation of the rRNA by RlmA(II) confers resistance to tylosin and other mycinosylated 16-membered ring macrolide......RNA substrate indicated that multiple contacts occur between RlmA(II) and nucleotides in stem-loops 33, 34 and 35. RlmA(II) appears to recognize its rRNA target through specific surface shape complementarity at the junction formed by these three helices. This means of recognition is highly similar...

  16. Repression of multiple CYP2D genes in mouse primary hepatocytes with a single siRNA construct.

    Science.gov (United States)

    Elraghy, Omaima; Baldwin, William S

    2015-01-01

    The Cyp2d subfamily is the second most abun-dant subfamily of hepatic drug-metabolizing CYPs. In mice, there are nine Cyp2d members that are believed to have redundant catalytic activity. We are testing and optimizing the ability of one short interfering RNA (siRNA) construct to knockdown the expression of multiple mouse Cyp2ds in primary hepatocytes. Expression of Cyp2d10, Cyp2d11, Cyp2d22, and Cyp2d26 was observed in the primary male mouse hepatocytes. Cyp2d9, which is male-specific and growth hormone-dependent, was not expressed in male primary hepatocytes, potentially because of its dependence on pulsatile growth hormone release from the anterior pituitary. Several different siRNAs at different concentrations and with different reagents were used to knockdown Cyp2d expression. siRNA constructs designed to repress only one construct often mildly repressed several Cyp2d isoforms. A construct designed to knockdown every Cyp2d isoform provided the best results, especially when incubated with transfection reagents designed specifically for primary cell culture. Interestingly, a construct designed to knockdown all Cyp2d isoforms, except Cyp2d10, caused a 2.5× increase in Cyp2d10 expression, presumably because of a compensatory response. However, while RNA expression is repressed 24 h after siRNA treatment, associated changes in Cyp2d-mediated metabolism are tenuous. Overall, this study provides data on the expression of murine Cyp2ds in primary cell lines, valuable information on designing siRNAs for silencing multiple murine CYPs, and potential pros and cons of using siRNA as a tool for repressing Cyp2d and estimating Cyp2d's role in murine xenobiotic metabolism.

  17. RNA secondary structure prediction using soft computing.

    Science.gov (United States)

    Ray, Shubhra Sankar; Pal, Sankar K

    2013-01-01

    Prediction of RNA structure is invaluable in creating new drugs and understanding genetic diseases. Several deterministic algorithms and soft computing-based techniques have been developed for more than a decade to determine the structure from a known RNA sequence. Soft computing gained importance with the need to get approximate solutions for RNA sequences by considering the issues related with kinetic effects, cotranscriptional folding, and estimation of certain energy parameters. A brief description of some of the soft computing-based techniques, developed for RNA secondary structure prediction, is presented along with their relevance. The basic concepts of RNA and its different structural elements like helix, bulge, hairpin loop, internal loop, and multiloop are described. These are followed by different methodologies, employing genetic algorithms, artificial neural networks, and fuzzy logic. The role of various metaheuristics, like simulated annealing, particle swarm optimization, ant colony optimization, and tabu search is also discussed. A relative comparison among different techniques, in predicting 12 known RNA secondary structures, is presented, as an example. Future challenging issues are then mentioned.

  18. Model for an RNA tertiary interaction from the structure of an intermolecular complex between a GAAA tetraloop and an RNA helix.

    Science.gov (United States)

    Pley, H W; Flaherty, K M; McKay, D B

    1994-11-03

    In large structured RNAs, RNA hairpins in which the strands of the duplex stem are connected by a tetraloop of the consensus sequence 5'-GNRA (where N is any nucleotide, and R is either G or A) are unusually frequent. In group I introns there is a covariation in sequence between nucleotides in the third and fourth positions of the loop with specific distant base pairs in putative RNA duplex stems: GNAA loops correlate with successive 5'-C-C.G-C base pairs in stems, whereas GNGA loops correlate with 5'-C-U.G-A. This has led to the suggestion that GNRA tetraloops may be involved in specific long-range tertiary interactions, with each A in position 3 or 4 of the loop interacting with a C-G base pair in the duplex, and G in position 3 interacting with a U-A base pair. This idea is supported experimentally for the GAAA loop of the P5b extension of the group I intron of Tetrahymena thermophila and the L9 GUGA terminal loop of the td intron of bacteriophage T4 (ref. 4). NMR has revealed the overall structure of the tetraloop for 12-nucleotide hairpins with GCAA and GAAA loops and models have been proposed for the interaction of GNRA tetraloops with base pairs in the minor groove of A-form RNA. Here we describe the crystal structure of an intermolecular complex between a GAAA tetraloop and an RNA helix. The interactions we observe correlate with the specificity of GNRA tetraloops inferred from phylogenetic studies, suggesting that this complex is a legitimate model for intramolecular tertiary interactions mediated by GNRA tetraloops in large structured RNAs.

  19. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  20. Generation of miRNA sponge constructs

    NARCIS (Netherlands)

    Kluiver, Joost; Slezak-Prochazka, Izabella; Smigielska-Czepiel, Katarzyna; Halsema, Nancy; Kroesen, Bart-Jan; van den Berg, Anke

    2012-01-01

    MicroRNA (miRNA) sponges are RNA molecules with repeated miRNA antisense sequences that can sequester miRNAs from their endogenous targets and thus serve as a decoy. Stably expressed miRNA sponges are especially valuable for long-term loss-of-function studies and can be used in vitro and in vivo. We

  1. Structural characterization of an intermolecular RNA–RNA interaction involved in the transcription regulation element of a bipartite plant virus

    OpenAIRE

    Guenther, Richard H.; Sit, Tim L.; Gracz, Hanna S.; Dolan, Michael A.; Townsend, Hannah L.; Liu, Guihua; Newman, Winnell H.; Agris, Paul F.; Lommel, Steven A.

    2004-01-01

    The 34-nucleotide trans-activator (TA) located within the RNA-2 of Red clover necrotic mosaic virus folds into a simple hairpin. The eight-nucleotide TA loop base pairs with eight complementary nucleotides in the TA binding sequence (TABS) of the capsid protein subgenomic promoter on RNA-1 and trans-activates subgenomic RNA synthesis. Short synthetic oligoribonucleotide mimics of the RNA-1 TABS and the RNA-2 TA form a weak 1:1 bimolecular complex in vitro with a Ka of 5.3 × 104 M–1. Ka determ...

  2. Short, multiple-stranded β-hairpin peptides have antimicrobial potency with high selectivity and salt resistance.

    Science.gov (United States)

    Chou, Shuli; Shao, Changxuan; Wang, Jiajun; Shan, Anshan; Xu, Lin; Dong, Na; Li, Zhongyu

    2016-01-01

    The β-hairpin structure has been proposed to exhibit potent antimicrobial properties with low cytotoxicity, thus, multiple β-hairpin structures have been proved to be highly stable in structures containing tightly packed hydrophobic cores. The aim of this study was to develop peptide-based synthetic strategies for generating short, but effective AMPs as inexpensive antimicrobial agents. Multiple-stranded β-hairpin peptides with the same β-hairpin unit, (WRXxRW)n where n=1, 2, 3, or 4 and Xx represent the turn sequence, were synthesized, and their potential as antimicrobial agents was evaluated. Owning to the tightly packed hydrophobic core and paired Trp of this multiple-stranded β-hairpin structure, all the 12-residues peptides exhibited high cell selectivity towards bacterial cells over human red blood cells (hRBCs), and the peptide W2 exhibited stronger antimicrobial activities with the MIC values of 2-8μM against various tested bacteria. Not only that, but W2 also showed obvious synergy with streptomycin and chloramphenicol against Escherichia coli, and displayed synergy with ciprofloxacin against Staphylococcus aureus with the FICI values ⩽0.5. Fluorescence spectroscopy and electron microscopy analyses indicated that W2 kills microbial cells by permeabilizing the cell membrane and damaging membrane integrity. Collectively, based on the multiple β-hairpin peptides, the ability to develop libraries of short and effective peptides will be a powerful approach to the discovery of novel antimicrobial agents. We successfully screened a peptide W2 ((WRPGRW)2) from a series of multiple-stranded β-hairpin antimicrobial peptides based on the "S-shaped" motif that induced the formation of a globular structure, and Trp zipper was used to replace the disulfide bonds to reduce the cost of production. This novel structure applied to AMPs improved cell selectivity and salt stability. The findings of this study will promote the development of peptide

  3. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  4. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    Science.gov (United States)

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  5. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2005-01-01

    Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.

  6. Computational prediction of miRNA genes from small RNA sequencing data

    Directory of Open Access Journals (Sweden)

    Wenjing eKang

    2015-01-01

    Full Text Available Next-generation sequencing now for the first time allows researchers to gauge the depth and variation of entire transcriptomes. However, now as rare transcripts can be detected that are present in cells at single copies, more advanced computational tools are needed to accurately annotate and profile them. miRNAs are 22 nucleotide small RNAs (sRNAs that post-transcriptionally reduce the output of protein coding genes. They have established roles in numerous biological processes, including cancers and other diseases. During miRNA biogenesis, the sRNAs are sequentially cleaved from precursor molecules that have a characteristic hairpin RNA structure. The vast majority of new miRNA genes that are discovered are mined from small RNA sequencing (sRNA-seq, which can detect more than a billion RNAs in a single run. However, given that many of the detected RNAs are degradation products from all types of transcripts, the accurate identification of miRNAs remain a non-trivial computational problem. Here we review the tools available to predict animal miRNAs from sRNA sequencing data. We present tools for generalist and specialist use cases, including prediction from massively pooled data or in species without reference genome. We also present wet-lab methods used to validate predicted miRNAs, and approaches to computationally benchmark prediction accuracy. For each tool, we reference validation experiments and benchmarking efforts. Last, we discuss the future of the field.

  7. Fluorescence-based characterization of genetically encoded peptides that fold in live cells: progress toward a generic hairpin scaffold

    Science.gov (United States)

    Cheng, Zihao; Campbell, Robert E.

    2007-02-01

    Binding proteins suitable for expression and high affinity molecular recognition in the cytoplasm or nucleus of live cells have numerous applications in the biological sciences. In an effort to add a new minimal motif to the growing repertoire of validated non-immunoglobulin binding proteins, we have undertaken the development of a generic protein scaffold based on a single β-hairpin that can fold efficiently in the cytoplasm. We have developed a method, based on the measurement of fluorescence resonance energy transfer (FRET) between a genetically fused cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), that allows the structural stability of recombinant β-hairpin peptides to be rapidly assessed both in vitro and in vivo. We have previously reported the validation of this method when applied to a 16mer tryptophan zipper β-hairpin. We now describe the use of this method to evaluate the potential of a designed 20mer β-hairpin peptide with a 3rd Trp/Trp cross-strand pair to function as a generic protein scaffold. Quantitative analysis of the FRET efficiency, resistance to proteolysis (assayed by loss of FRET), and circular dichroism spectra revealed that the 20mer peptide is significantly more tolerant of destabilizing mutations than the 16mer peptide. Furthermore, we experimentally demonstrate that the in vitro determined β-hairpin stabilities are well correlated with in vivo β-hairpin stabilities as determined by FRET measurements of colonies of live bacteria expressing the recombinant peptides flanked by CFP and YFP. Finally, we report on our progress to develop highly folded 24mer and 28mer β-hairpin peptides through the use of fluorescence-based library screening.

  8. Targeting of human interleukin-12B by small hairpin RNAs in xenografted psoriatic skin

    Directory of Open Access Journals (Sweden)

    Jakobsen Maria

    2011-02-01

    Full Text Available Abstract Background Psoriasis is a chronic inflammatory skin disorder that shows as erythematous and scaly lesions. The pathogenesis of psoriasis is driven by a dysregulation of the immune system which leads to an altered cytokine production. Proinflammatory cytokines that are up-regulated in psoriasis include tumor necrosis factor alpha (TNFα, interleukin-12 (IL-12, and IL-23 for which monoclonal antibodies have already been approved for clinical use. We have previously documented the therapeutic applicability of targeting TNFα mRNA for RNA interference-mediated down-regulation by anti-TNFα small hairpin RNAs (shRNAs delivered by lentiviral vectors to xenografted psoriatic skin. The present report aims at targeting mRNA encoding the shared p40 subunit (IL-12B of IL-12 and IL-23 by cellular transduction with lentiviral vectors encoding anti-IL12B shRNAs. Methods Effective anti-IL12B shRNAs are identified among a panel of shRNAs by potency measurements in cultured cells. The efficiency and persistency of lentiviral gene delivery to xenografted human skin are investigated by bioluminescence analysis of skin treated with lentiviral vectors encoding the luciferase gene. shRNA-expressing lentiviral vectors are intradermally injected in xenografted psoriatic skin and the effects of the treatment evaluated by clinical psoriasis scoring, by measurements of epidermal thickness, and IL-12B mRNA levels. Results Potent and persistent transgene expression following a single intradermal injection of lentiviral vectors in xenografted human skin is reported. Stable IL-12B mRNA knockdown and reduced epidermal thickness are achieved three weeks after treatment of xenografted psoriatic skin with lentivirus-encoded anti-IL12B shRNAs. These findings mimick the results obtained with anti-TNFα shRNAs but, in contrast to anti-TNFα treatment, anti-IL12B shRNAs do not ameliorate the psoriatic phenotype as evaluated by semi-quantitative clinical scoring and by

  9. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  10. Live-Cell MicroRNA Imaging through MnO2 Nanosheet-Mediated DD-A Hybridization Chain Reaction.

    Science.gov (United States)

    Ou, Min; Huang, Jin; Yang, Xiaohai; He, Xiaoxiao; Quan, Ke; Yang, Yanjing; Xie, Nuli; Li, Jing; Wang, Kemin

    2018-01-18

    Innovative techniques to visualize native microRNAs (miRNAs) in live cells can dramatically impact current research on the roles of miRNA in biology and medicine. Here, we report a novel approach for live-cell miRNA imaging using a biodegradable MnO 2 nanosheet-mediated DD-A FRET hybridization chain reaction (HCR). The MnO 2 nanosheets can adsorb DNA hairpin probes and deliver them into live cells. After entering cells, the MnO 2 nanosheets are degraded by cellular GSH. Then, the target miR-21 triggers cascaded assembly of the liberated hairpin probes into long dsDNA polymers, which brings each two FAMs (donor) and one TAMRA (acceptor) into close proximity to generate significantly enhanced DD-A FRET signals, which was discovered and proven by our previous report. We think the developed approach can serve as an excellent intracellular miRNAs detection tool, which promises the potential for biological and disease studies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. A proteomic study of TAR-RNA binding protein (TRBP-associated factors

    Directory of Open Access Journals (Sweden)

    Chi Ya-Hui

    2011-02-01

    Full Text Available Abstract Background The human TAR RNA-binding protein, TRBP, was first identified and cloned based on its high affinity binding to the small hairpin trans-activation responsive (TAR RNA of HIV-1. TRBP has more recently been found to be a constituent of the RNA-induced silencing complex (RISC serving as a Dicer co-factor in the processing of the ~70 nucleotide pre-microRNAs(miRNAs to 21-25 nucleotide mature miRNAs. Findings Using co-immunoprecipitation and protein-identification by mass spectrometry, we characterized intracellular proteins that complex with TRBP. These interacting proteins include those that have been described to act in protein synthesis, RNA modifications and processing, DNA transcription, and cell proliferation. Conclusions Our findings provide a proteome of factors that may cooperate with TRBP in activities such as miRNA processing and in RNA interference by the RISC complex.

  12. "Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E

    2011-03-01

    A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.

  13. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  14. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  15. Balancing gene expression without library construction via a reusable sRNA pool.

    Science.gov (United States)

    Ghodasara, Amar; Voigt, Christopher A

    2017-07-27

    Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  17. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Christiane Noronha Fernandes-Brum

    Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  18. Ultrasensitive and Facile Detection of MicroRNA via a Portable Pressure Meter.

    Science.gov (United States)

    Shi, Lu; Lei, Jing; Zhang, Bei; Li, Baoxin; Yang, Chaoyong James; Jin, Yan

    2018-04-18

    The upregulation of microRNA (miRNA) is highly related with some kinds of tumor, such as breast, prostate, lung, and pancreatic cancers. Therefore, for an important tumor biomarker, the point-of-care testing (POCT) of miRNA is of significant importance and is in great demand for disease diagnosis and clinical prognoses. Herein, a POCT assay for miRNA detection was developed via a portable pressure meter. Two hairpin DNA probes, H1 and H2, were ingeniously designed and functionalized with magnetic beads (MBs) and platinum nanoparticles (PtNPs), respectively, to form MBs-H1 and PtNPs-H2 complexes. In the presence of target microRNA 21 (miR-21), the cyclic strand displacement reaction (SDR) between MBs-H1 and PtNPs-H2 was triggered to continuously form the MBs-H1/PtNPs-H2 duplex. Owing to the amplification of cyclic SDR, numerous PtNPs were enriched onto the surface of MBs to catalytically decompose H 2 O 2 for the generation of much O 2 . The gas pressure value has a linear relationship with the logarithmic value of miR-21 concentration in the range of 10 fM to 10 pM. The limit of detection is 7.6 fM, which is more sensitive than that in a number of previous reports. Hairpin DNA probes and magnetic separation highly ensured the specificity and reliability. Single-base mutation was easily discriminated, and the detection of miR-21 in the serum sample achieved satisfactory result. Therefore, it offers a reliable POCT strategy for the detection of miRNA, which is of great theoretical and practical importance for POCT clinical diagnostics.

  19. Highly selective and sensitive detection of miRNA based on toehold-mediated strand displacement reaction and DNA tetrahedron substrate.

    Science.gov (United States)

    Li, Wei; Jiang, Wei; Ding, Yongshun; Wang, Lei

    2015-09-15

    MicroRNAs (miRNAs) play important roles in a variety of biological processes and have been regarded as tumor biomarkers in cancer diagnosis and prognosis. In this work, a single-molecule counting method for miRNA analysis was proposed based on toehold-mediated strand displacement reaction (SDR) and DNA tetrahedron substrate. Firstly, a specially designed DNA tetrahedron was assembled with a hairpin at one of the vertex, which has an overhanging toehold domain. Then, the DNA tetrahedron was immobilized on the epoxy-functional glass slide by epoxy-amine reaction, forming a DNA tetrahedron substrate. Next, the target miRNA perhybridized with the toehold domain and initiated a strand displacement reaction along with the unfolding of the hairpin, realizing the selective recognization of miRNA. Finally, a biotin labeled detection DNA was hybridized with the new emerging single strand and the streptavidin coated QDs were used as fluorescent probes. Fluorescent images were acquired via epi-fluorescence microscopy, the numbers of fluorescence dots were counted one by one for quantification. The detection limit is 5 fM, which displayed an excellent sensitivity. Moreover, the proposed method which can accurately be identified the target miRNA among its family members, demonstrated an admirable selectivity. Furthermore, miRNA analysis in total RNA samples from human lung tissues was performed, suggesting the feasibility of this method for quantitative detection of miRNA in biomedical research and early clinical diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. A regenerative electrochemical biosensor for mercury(II) by using the insertion approach and dual-hairpin-based amplification

    International Nuclear Information System (INIS)

    Jia, Jing; Ling, Yu; Gao, Zhong Feng; Lei, Jing Lei; Luo, Hong Qun; Li, Nian Bing

    2015-01-01

    Highlights: • The dual-hairpin structure as a signal amplifier is label-free and handy. • The strategy uses the insertion approach to improve the hybridization efficiency. • This biosensor has a low detection limit (28 pM) for detection of Hg 2+ . • This biosensor can be easily regenerated by using L-cysteine. - Abstract: A simple and effective biosensor for Hg 2+ determination was investigated. The novel biosensor was prepared by the insertion approach that the moiety-labeled DNA inserted into a loosely packed cyclic-dithiothreitol (DTT) monolayer, improving the hybridization efficiency. Electrochemical impedance spectroscopy studies of two biosensors (single-hairpin and dual-hairpin structure DNA modified electrodes) used for Hg 2+ detection indicated that the dual-hairpin modified electrode had a larger electron transfer resistance change (ΔR ct ). Consequently, the dual-hairpin structure was used as a signal amplifier for the preparation of a selective Hg 2+ biosensor. This biosensor exhibited an excellent selectivity toward Hg 2+ over Cd 2+ , Pd 2+ , Co 2+ etc. Also, a linear relation was observed between the ΔR ct and Hg 2+ concentrations in a range from 0.1 nM to 5 μM with a detection limit of 28 pM under optimum conditions. Moreover, the biosensor can be reused by using L-cysteine and successfully applied for detecting Hg 2+ in real samples

  1. MatureBayes: a probabilistic algorithm for identifying the mature miRNA within novel precursors.

    Directory of Open Access Journals (Sweden)

    Katerina Gkirtzou

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are small, single stranded RNAs with a key role in post-transcriptional regulation of thousands of genes across numerous species. While several computational methods are currently available for identifying miRNA genes, accurate prediction of the mature miRNA remains a challenge. Existing approaches fall short in predicting the location of mature miRNAs but also in finding the functional strand(s of miRNA precursors. METHODOLOGY/PRINCIPAL FINDINGS: Here, we present a computational tool that incorporates a Naive Bayes classifier to identify mature miRNA candidates based on sequence and secondary structure information of their miRNA precursors. We take into account both positive (true mature miRNAs and negative (same-size non-mature miRNA sequences examples to optimize sensitivity as well as specificity. Our method can accurately predict the start position of experimentally verified mature miRNAs for both human and mouse, achieving a significantly larger (often double performance accuracy compared with two existing methods. Moreover, the method exhibits a very high generalization performance on miRNAs from two other organisms. More importantly, our method provides direct evidence about the features of miRNA precursors which may determine the location of the mature miRNA. We find that the triplet of positions 7, 8 and 9 from the mature miRNA end towards the closest hairpin have the largest discriminatory power, are relatively conserved in terms of sequence composition (mostly contain a Uracil and are located within or in very close proximity to the hairpin loop, suggesting the existence of a possible recognition site for Dicer and associated proteins. CONCLUSIONS: This work describes a novel algorithm for identifying the start position of mature miRNA(s produced by miRNA precursors. Our tool has significantly better (often double performance than two existing approaches and provides new insights about the potential use

  2. Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen.

    Science.gov (United States)

    Deng, Dawei; Li, Yang; Xue, Jianpeng; Wang, Jie; Ai, Guanhua; Li, Xin; Gu, Yueqing

    2015-01-01

    Messenger RNA (mRNA), a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP) beacon containing a bare gold nanoparticle (AuNP) as fluorescence quencher and thiol-terminated fluorescently labeled stem-loop-stem oligonucleotide sequences attached by Au-S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b) mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.

  3. Mutations in domain II of 23 S rRNA facilitate translation of a 23 S rRNA-encoded pentapeptide conferring erythromycin resistance

    DEFF Research Database (Denmark)

    Dam, M; Douthwaite, S; Tenson, T

    1996-01-01

    Mutations in domain II of Escherichia coli 23 S rRNA that cause resistance to erythromycin do so in a manner fundamentally different from mutations at the drug binding site in domain V of the 23 S rRNA. The domain II mutations are located in a hairpin structure between nucleotides 1198 and 1247...... this hypothesis, a range of point mutations was generated in domain II of 23 S rRNA in the vicinity of the E-peptide open reading frame. We find a correlation between erythromycin resistance of the mutant clones and increased accessibility of the ribosome binding site of the E-peptide gene. Furthermore......, the erythromycin resistance determinant in the mutants was shown to be confined to a small 23 S rRNA segment containing the coding region and the ribosome binding site of the E-peptide open reading frame. It thus appears that the domain II mutations mediate erythromycin resistance by increasing expression...

  4. An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

    Directory of Open Access Journals (Sweden)

    Kaur Jatinder

    2010-05-01

    Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

  5. Chimira: analysis of small RNA sequencing data and microRNA modifications.

    Science.gov (United States)

    Vitsios, Dimitrios M; Enright, Anton J

    2015-10-15

    Chimira is a web-based system for microRNA (miRNA) analysis from small RNA-Seq data. Sequences are automatically cleaned, trimmed, size selected and mapped directly to miRNA hairpin sequences. This generates count-based miRNA expression data for subsequent statistical analysis. Moreover, it is capable of identifying epi-transcriptomic modifications in the input sequences. Supported modification types include multiple types of 3'-modifications (e.g. uridylation, adenylation), 5'-modifications and also internal modifications or variation (ADAR editing or single nucleotide polymorphisms). Besides cleaning and mapping of input sequences to miRNAs, Chimira provides a simple and intuitive set of tools for the analysis and interpretation of the results (see also Supplementary Material). These allow the visual study of the differential expression between two specific samples or sets of samples, the identification of the most highly expressed miRNAs within sample pairs (or sets of samples) and also the projection of the modification profile for specific miRNAs across all samples. Other tools have already been published in the past for various types of small RNA-Seq analysis, such as UEA workbench, seqBuster, MAGI, OASIS and CAP-miRSeq, CPSS for modifications identification. A comprehensive comparison of Chimira with each of these tools is provided in the Supplementary Material. Chimira outperforms all of these tools in total execution speed and aims to facilitate simple, fast and reliable analysis of small RNA-Seq data allowing also, for the first time, identification of global microRNA modification profiles in a simple intuitive interface. Chimira has been developed as a web application and it is accessible here: http://www.ebi.ac.uk/research/enright/software/chimira. aje@ebi.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  6. A regenerative electrochemical biosensor for mercury(II) by using the insertion approach and dual-hairpin-based amplification

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Jing; Ling, Yu; Gao, Zhong Feng [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Lei, Jing Lei [College of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044 (China); Luo, Hong Qun, E-mail: luohq@swu.edu.cn [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China); Li, Nian Bing, E-mail: linb@swu.edu.cn [Key Laboratory of Eco-Environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715 (China)

    2015-09-15

    Highlights: • The dual-hairpin structure as a signal amplifier is label-free and handy. • The strategy uses the insertion approach to improve the hybridization efficiency. • This biosensor has a low detection limit (28 pM) for detection of Hg{sup 2+}. • This biosensor can be easily regenerated by using L-cysteine. - Abstract: A simple and effective biosensor for Hg{sup 2+} determination was investigated. The novel biosensor was prepared by the insertion approach that the moiety-labeled DNA inserted into a loosely packed cyclic-dithiothreitol (DTT) monolayer, improving the hybridization efficiency. Electrochemical impedance spectroscopy studies of two biosensors (single-hairpin and dual-hairpin structure DNA modified electrodes) used for Hg{sup 2+} detection indicated that the dual-hairpin modified electrode had a larger electron transfer resistance change (ΔR{sub ct}). Consequently, the dual-hairpin structure was used as a signal amplifier for the preparation of a selective Hg{sup 2+} biosensor. This biosensor exhibited an excellent selectivity toward Hg{sup 2+} over Cd{sup 2+}, Pd{sup 2+}, Co{sup 2+} etc. Also, a linear relation was observed between the ΔR{sub ct} and Hg{sup 2+} concentrations in a range from 0.1 nM to 5 μM with a detection limit of 28 pM under optimum conditions. Moreover, the biosensor can be reused by using L-cysteine and successfully applied for detecting Hg{sup 2+} in real samples.

  7. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  8. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  9. Origins and Early Evolution of the tRNA Molecule

    Directory of Open Access Journals (Sweden)

    Koji Tamura

    2015-12-01

    Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  10. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  11. Stabilization of a β-hairpin in monomeric Alzheimer's amyloid-β peptide inhibits amyloid formation

    Science.gov (United States)

    Hoyer, Wolfgang; Grönwall, Caroline; Jonsson, Andreas; Ståhl, Stefan; Härd, Torleif

    2008-01-01

    According to the amyloid hypothesis, the pathogenesis of Alzheimer's disease is triggered by the oligomerization and aggregation of the amyloid-β (Aβ) peptide into protein plaques. Formation of the potentially toxic oligomeric and fibrillar Aβ assemblies is accompanied by a conformational change toward a high content of β-structure. Here, we report the solution structure of Aβ(1–40) in complex with the phage-display selected affibody protein ZAβ3, a binding protein of nanomolar affinity. Bound Aβ(1–40) features a β-hairpin comprising residues 17–36, providing the first high-resolution structure of Aβ in β conformation. The positions of the secondary structure elements strongly resemble those observed for fibrillar Aβ. ZAβ3 stabilizes the β-sheet by extending it intermolecularly and by burying both of the mostly nonpolar faces of the Aβ hairpin within a large hydrophobic tunnel-like cavity. Consequently, ZAβ3 acts as a stoichiometric inhibitor of Aβ fibrillation. The selected Aβ conformation allows us to suggest a structural mechanism for amyloid formation based on soluble oligomeric hairpin intermediates. PMID:18375754

  12. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  13. 2-Aminopurine hairpin probes for the detection of ultraviolet-induced DNA damage

    International Nuclear Information System (INIS)

    El-Yazbi, Amira F.; Loppnow, Glen R.

    2012-01-01

    Highlights: ► Molecular beacon with 2AP bases detects DNA damage in a simple mix-and-read assay. ► Molecular beacons with 2AP bases detect damage at a 17.2 nM limit of detection. ► The 2AP molecular beacon is linear over a 0–3.5 μM concentration range for damage. - Abstract: Nucleic acid exposure to radiation and chemical insults leads to damage and disease. Thus, detection and understanding DNA damage is important for elucidating molecular mechanisms of disease. However, current methods of DNA damage detection are either time-consuming, destroy the sample, or are too specific to be used for generic detection of damage. In this paper, we develop a fluorescence sensor of 2-aminopurine (2AP), a fluorescent analogue of adenine, incorporated in the loop of a hairpin probe for the quantification of ultraviolet (UV) C-induced nucleic acid damage. Our results show that the selectivity of the 2AP hairpin probe to UV-induced nucleic acid damage is comparable to molecular beacon (MB) probes of DNA damage. The calibration curve for the 2AP hairpin probe shows good linearity (R 2 = 0.98) with a limit of detection of 17.2 nM. This probe is a simple, fast and economic fluorescence sensor for the quantification of UV-induced damage in DNA.

  14. New families of human regulatory RNA structures identified by comparative analysis of vertebrate genomes.

    Science.gov (United States)

    Parker, Brian J; Moltke, Ida; Roth, Adam; Washietl, Stefan; Wen, Jiayu; Kellis, Manolis; Breaker, Ronald; Pedersen, Jakob Skou

    2011-11-01

    Regulatory RNA structures are often members of families with multiple paralogous instances across the genome. Family members share functional and structural properties, which allow them to be studied as a whole, facilitating both bioinformatic and experimental characterization. We have developed a comparative method, EvoFam, for genome-wide identification of families of regulatory RNA structures, based on primary sequence and secondary structure similarity. We apply EvoFam to a 41-way genomic vertebrate alignment. Genome-wide, we identify 220 human, high-confidence families outside protein-coding regions comprising 725 individual structures, including 48 families with known structural RNA elements. Known families identified include both noncoding RNAs, e.g., miRNAs and the recently identified MALAT1/MEN β lincRNA family; and cis-regulatory structures, e.g., iron-responsive elements. We also identify tens of new families supported by strong evolutionary evidence and other statistical evidence, such as GO term enrichments. For some of these, detailed analysis has led to the formulation of specific functional hypotheses. Examples include two hypothesized auto-regulatory feedback mechanisms: one involving six long hairpins in the 3'-UTR of MAT2A, a key metabolic gene that produces the primary human methyl donor S-adenosylmethionine; the other involving a tRNA-like structure in the intron of the tRNA maturation gene POP1. We experimentally validate the predicted MAT2A structures. Finally, we identify potential new regulatory networks, including large families of short hairpins enriched in immunity-related genes, e.g., TNF, FOS, and CTLA4, which include known transcript destabilizing elements. Our findings exemplify the diversity of post-transcriptional regulation and provide a resource for further characterization of new regulatory mechanisms and families of noncoding RNAs.

  15. A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition.

    Directory of Open Access Journals (Sweden)

    Huiling Qiu

    Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.

  16. Guidance for RNA-seq co-expression network construction and analysis: safety in numbers.

    Science.gov (United States)

    Ballouz, S; Verleyen, W; Gillis, J

    2015-07-01

    RNA-seq co-expression analysis is in its infancy and reasonable practices remain poorly defined. We assessed a variety of RNA-seq expression data to determine factors affecting functional connectivity and topology in co-expression networks. We examine RNA-seq co-expression data generated from 1970 RNA-seq samples using a Guilt-By-Association framework, in which genes are assessed for the tendency of co-expression to reflect shared function. Minimal experimental criteria to obtain performance on par with microarrays were >20 samples with read depth >10 M per sample. While the aggregate network constructed shows good performance (area under the receiver operator characteristic curve ∼0.71), the dependency on number of experiments used is nearly identical to that present in microarrays, suggesting thousands of samples are required to obtain 'gold-standard' co-expression. We find a major topological difference between RNA-seq and microarray co-expression in the form of low overlaps between hub-like genes from each network due to changes in the correlation of expression noise within each technology. jgillis@cshl.edu or sballouz@cshl.edu Networks are available at: http://gillislab.labsites.cshl.edu/supplements/rna-seq-networks/ and supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. MicroRNA-triggered, cascaded and catalytic self-assembly of functional ``DNAzyme ferris wheel'' nanostructures for highly sensitive colorimetric detection of cancer cells

    Science.gov (United States)

    Zhou, Wenjiao; Liang, Wenbin; Li, Xin; Chai, Yaqin; Yuan, Ruo; Xiang, Yun

    2015-05-01

    The construction of DNA nanostructures with various sizes and shapes has significantly advanced during the past three decades, yet the application of these DNA nanostructures for solving real problems is still in the early stage. On the basis of microRNA-triggered, catalytic self-assembly formation of the functional ``DNAzyme ferris wheel'' nanostructures, we show here a new signal amplification platform for highly sensitive, label-free and non-enzyme colorimetric detection of a small number of human prostate cancer cells. The microRNA (miR-141), which is catalytically recycled and reused, triggers isothermal self-assembly of a pre-designed, G-quadruplex sequence containing hairpin DNAs into ``DNAzyme ferris wheel''-like nanostructures (in association with hemin) with horseradish peroxidase mimicking activity. These DNAzyme nanostructures catalyze an intensified color transition of the probe solution for highly sensitive detection of miR-141 down to 0.5 pM with the naked eye, and the monitoring of as low as 283 human prostate cancer cells can also, theoretically, be achieved in a colorimetric approach. The work demonstrated here thus offers new opportunities for the construction of functional DNA nanostructures and for the application of these DNA nanostructures as an effective signal amplification means in the sensitive detection of nucleic acid biomarkers.

  18. HIV-1 nef suppression by virally encoded microRNA

    Directory of Open Access Journals (Sweden)

    Brisibe Ebiamadon

    2004-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are 21~25-nucleotides (nt long and interact with mRNAs to trigger either translational repression or RNA cleavage through RNA interference (RNAi, depending on the degree of complementarity with the target mRNAs. Our recent study has shown that HIV-1 nef dsRNA from AIDS patients who are long-term non-progressors (LTNPs inhibited the transcription of HIV-1. Results Here, we show the possibility that nef-derived miRNAs are produced in HIV-1 persistently infected cells. Furthermore, nef short hairpin RNA (shRNA that corresponded to a predicted nef miRNA (~25 nt, miR-N367 can block HIV-1 Nef expression in vitro and the suppression by shRNA/miR-N367 would be related with low viremia in an LTNP (15-2-2. In the 15-2-2 model mice, the weight loss, which may be rendered by nef was also inhibited by shRNA/miR-N367 corresponding to suppression of nef expression in vivo. Conclusions These data suggest that nef/U3 miRNAs produced in HIV-1-infected cells may suppress both Nef function and HIV-1 virulence through the RNAi pathway.

  19. The subgenomic promoter of brome mosaic virus folds into a stem-loop structure capped by a pseudo-triloop that is structurally similar to the triloop of the genomic promoter

    DEFF Research Database (Denmark)

    Skov, J.; Gaudin, M.; Podbevsek, P.

    2012-01-01

    In brome mosaic virus, both the replication of the genomic (+)-RNA strands and the transcription of the subgenomic RNA are carried out by the viral replicase. The production of (-)-RNA strands is dependent on the formation of an AUA triloop in the stem-loop C (SLC) hairpin in the 3'-untranslated...... region of the (+)-RNA strands. Two alternate hypotheses have been put forward for the mechanism of subgenomic RNA transcription. One posits that transcription commences by recognition of at least four key nucleotides in the subgenomic promoter by the replicase. The other posits that subgenomic...... transcription starts by binding of the replicase to a hairpin formed by the subgenomic promoter that resembles the minus strand promoter hairpin SLC. In this study, we have determined the three-dimensional structure of the subgenomic promoter hairpin using NMR spectroscopy. The data show that the hairpin...

  20. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    Science.gov (United States)

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  1. Turn stability in beta-hairpin peptides: Investigation of peptides containing 3:5 type I G1 bulge turns.

    Science.gov (United States)

    Blandl, Tamas; Cochran, Andrea G; Skelton, Nicholas J

    2003-02-01

    The turn-forming ability of a series of three-residue sequences was investigated by substituting them into a well-characterized beta-hairpin peptide. The starting scaffold, bhpW, is a disulfide-cyclized 10-residue peptide that folds into a stable beta-hairpin with two antiparallel strands connected by a two-residue reverse turn. Substitution of the central two residues with the three-residue test sequences leads to less stable hairpins, as judged by thiol-disulfide equilibrium measurements. However, analysis of NMR parameters indicated that each molecule retains a significant folded population, and that the type of turn adopted by the three-residue sequence is the same in all cases. The solution structure of a selected peptide with a PDG turn contained an antiparallel beta-hairpin with a 3:5 type I + G1 bulge turn. Analysis of the energetic contributions of individual turn residues in the series of peptides indicates that substitution effects have significant context dependence, limiting the predictive power of individual amino acid propensities for turn formation. The most stable and least stable sequences were also substituted into a more stable disulfide-cyclized scaffold and a linear beta-hairpin scaffold. The relative stabilities remained the same, suggesting that experimental measurements in the bhpW context are a useful way to evaluate turn stability for use in protein design projects. Moreover, these scaffolds are capable of displaying a diverse set of turns, which can be exploited for the mimicry of protein loops or for generating libraries of reverse turns.

  2. miRge - A Multiplexed Method of Processing Small RNA-Seq Data to Determine MicroRNA Entropy.

    Directory of Open Access Journals (Sweden)

    Alexander S Baras

    Full Text Available Small RNA RNA-seq for microRNAs (miRNAs is a rapidly developing field where opportunities still exist to create better bioinformatics tools to process these large datasets and generate new, useful analyses. We built miRge to be a fast, smart small RNA-seq solution to process samples in a highly multiplexed fashion. miRge employs a Bayesian alignment approach, whereby reads are sequentially aligned against customized mature miRNA, hairpin miRNA, noncoding RNA and mRNA sequence libraries. miRNAs are summarized at the level of raw reads in addition to reads per million (RPM. Reads for all other RNA species (tRNA, rRNA, snoRNA, mRNA are provided, which is useful for identifying potential contaminants and optimizing small RNA purification strategies. miRge was designed to optimally identify miRNA isomiRs and employs an entropy based statistical measurement to identify differential production of isomiRs. This allowed us to identify decreasing entropy in isomiRs as stem cells mature into retinal pigment epithelial cells. Conversely, we show that pancreatic tumor miRNAs have similar entropy to matched normal pancreatic tissues. In a head-to-head comparison with other miRNA analysis tools (miRExpress 2.0, sRNAbench, omiRAs, miRDeep2, Chimira, UEA small RNA Workbench, miRge was faster (4 to 32-fold and was among the top-two methods in maximally aligning miRNAs reads per sample. Moreover, miRge has no inherent limits to its multiplexing. miRge was capable of simultaneously analyzing 100 small RNA-Seq samples in 52 minutes, providing an integrated analysis of miRNA expression across all samples. As miRge was designed for analysis of single as well as multiple samples, miRge is an ideal tool for high and low-throughput users. miRge is freely available at http://atlas.pathology.jhu.edu/baras/miRge.html.

  3. Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism.

    Science.gov (United States)

    Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul

    2017-07-15

    The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

  4. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  5. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  6. Construction of RNA nanocages by re-engineering the packaging RNA of Phi29 bacteriophage

    Science.gov (United States)

    Hao, Chenhui; Li, Xiang; Tian, Cheng; Jiang, Wen; Wang, Guansong; Mao, Chengde

    2014-05-01

    RNA nanotechnology promises rational design of RNA nanostructures with wide array of structural diversities and functionalities. Such nanostructures could be used in applications such as small interfering RNA delivery and organization of in vivo chemical reactions. Though having impressive development in recent years, RNA nanotechnology is still quite limited and its programmability and complexity could not rival the degree of its closely related cousin: DNA nanotechnology. Novel strategies are needed for programmed RNA self-assembly. Here, we have assembled RNA nanocages by re-engineering a natural, biological RNA motif: the packaging RNA of phi29 bacteriophage. The resulting RNA nanostructures have been thoroughly characterized by gel electrophoresis, cryogenic electron microscopy imaging and dynamic light scattering.

  7. Genomic analysis suggests that mRNA destabilization by the microprocessor is specialized for the auto-regulation of Dgcr8.

    Directory of Open Access Journals (Sweden)

    Archana Shenoy

    2009-09-01

    Full Text Available The Microprocessor, containing the RNA binding protein Dgcr8 and RNase III enzyme Drosha, is responsible for processing primary microRNAs to precursor microRNAs. The Microprocessor regulates its own levels by cleaving hairpins in the 5'UTR and coding region of the Dgcr8 mRNA, thereby destabilizing the mature transcript.To determine whether the Microprocessor has a broader role in directly regulating other coding mRNA levels, we integrated results from expression profiling and ultra high-throughput deep sequencing of small RNAs. Expression analysis of mRNAs in wild-type, Dgcr8 knockout, and Dicer knockout mouse embryonic stem (ES cells uncovered mRNAs that were specifically upregulated in the Dgcr8 null background. A number of these transcripts had evolutionarily conserved predicted hairpin targets for the Microprocessor. However, analysis of deep sequencing data of 18 to 200nt small RNAs in mouse ES, HeLa, and HepG2 indicates that exonic sequence reads that map in a pattern consistent with Microprocessor activity are unique to Dgcr8.We conclude that the Microprocessor's role in directly destabilizing coding mRNAs is likely specifically targeted to Dgcr8 itself, suggesting a specialized cellular mechanism for gene auto-regulation.

  8. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

    Science.gov (United States)

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

    2010-02-01

    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.

  9. A Poisson Log-Normal Model for Constructing Gene Covariation Network Using RNA-seq Data.

    Science.gov (United States)

    Choi, Yoonha; Coram, Marc; Peng, Jie; Tang, Hua

    2017-07-01

    Constructing expression networks using transcriptomic data is an effective approach for studying gene regulation. A popular approach for constructing such a network is based on the Gaussian graphical model (GGM), in which an edge between a pair of genes indicates that the expression levels of these two genes are conditionally dependent, given the expression levels of all other genes. However, GGMs are not appropriate for non-Gaussian data, such as those generated in RNA-seq experiments. We propose a novel statistical framework that maximizes a penalized likelihood, in which the observed count data follow a Poisson log-normal distribution. To overcome the computational challenges, we use Laplace's method to approximate the likelihood and its gradients, and apply the alternating directions method of multipliers to find the penalized maximum likelihood estimates. The proposed method is evaluated and compared with GGMs using both simulated and real RNA-seq data. The proposed method shows improved performance in detecting edges that represent covarying pairs of genes, particularly for edges connecting low-abundant genes and edges around regulatory hubs.

  10. Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen

    Directory of Open Access Journals (Sweden)

    Deng D

    2015-04-01

    Full Text Available Dawei Deng,* Yang Li,* Jianpeng Xue, Jie Wang, Guanhua Ai, Xin Li, Yueqing GuDepartment of Biomedical Engineering, China Pharmaceutical University, Nanjing, People’s Republic of China*These authors contributed equally to this workAbstract: Messenger RNA (mRNA, a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP beacon containing a bare gold nanoparticle (AuNP as fluorescence quencher and thiol-terminated fluorescently labeled stem–loop–stem oligonucleotide sequences attached by Au–S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.Keywords: molecular beacon, bioinformatics, gold nanoparticle, STAT5b mRNA, visual detection

  11. How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

    Science.gov (United States)

    Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

    2016-01-01

    Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

  12. Ubiquitous expression of CUG or CAG trinucleotide repeat RNA causes common morphological defects in a Drosophila model of RNA-mediated pathology.

    Directory of Open Access Journals (Sweden)

    Kynan T Lawlor

    Full Text Available Expanded DNA repeat sequences are known to cause over 20 diseases, including Huntington's disease, several types of spinocerebellar ataxia and myotonic dystrophy type 1 and 2. A shared genetic basis, and overlapping clinical features for some of these diseases, indicate that common pathways may contribute to pathology. Multiple mechanisms, mediated by both expanded homopolymeric proteins and expanded repeat RNA, have been identified by the use of model systems, that may account for shared pathology. The use of such animal models enables identification of distinct pathways and their 'molecular hallmarks' that can be used to determine the contribution of each pathway in human pathology. Here we characterise a tergite disruption phenotype in adult flies, caused by ubiquitous expression of either untranslated CUG or CAG expanded repeat RNA. Using the tergite phenotype as a quantitative trait we define a new genetic system in which to examine 'hairpin' repeat RNA-mediated cellular perturbation. Further experiments use this system to examine whether pathways involving Muscleblind sequestration or Dicer processing, which have been shown to mediate repeat RNA-mediated pathology in other model systems, contribute to cellular perturbation in this model.

  13. Structure of noncoding RNA is a determinant of function of RNA binding proteins in transcriptional regulation

    Directory of Open Access Journals (Sweden)

    Oyoshi Takanori

    2012-01-01

    Full Text Available Abstract The majority of the noncoding regions of mammalian genomes have been found to be transcribed to generate noncoding RNAs (ncRNAs, resulting in intense interest in their biological roles. During the past decade, numerous ncRNAs and aptamers have been identified as regulators of transcription. 6S RNA, first described as a ncRNA in E. coli, mimics an open promoter structure, which has a large bulge with two hairpin/stalk structures that regulate transcription through interactions with RNA polymerase. B2 RNA, which has stem-loops and unstructured single-stranded regions, represses transcription of mRNA in response to various stresses, including heat shock in mouse cells. The interaction of TLS (translocated in liposarcoma with CBP/p300 was induced by ncRNAs that bind to TLS, and this in turn results in inhibition of CBP/p300 histone acetyltransferase (HAT activity in human cells. Transcription regulator EWS (Ewing's sarcoma, which is highly related to TLS, and TLS specifically bind to G-quadruplex structures in vitro. The carboxy terminus containing the Arg-Gly-Gly (RGG repeat domains in these proteins are necessary for cis-repression of transcription activation and HAT activity by the N-terminal glutamine-rich domain. Especially, the RGG domain in the carboxy terminus of EWS is important for the G-quadruplex specific binding. Together, these data suggest that functions of EWS and TLS are modulated by specific structures of ncRNAs.

  14. β-Hairpin of Islet Amyloid Polypeptide Bound to an Aggregation Inhibitor

    Science.gov (United States)

    Mirecka, Ewa A.; Feuerstein, Sophie; Gremer, Lothar; Schröder, Gunnar F.; Stoldt, Matthias; Willbold, Dieter; Hoyer, Wolfgang

    2016-01-01

    In type 2 diabetes, the formation of islet amyloid consisting of islet amyloid polypeptide (IAPP) is associated with reduction in β-cell mass and contributes to the failure of islet cell transplantation. Rational design of inhibitors of IAPP amyloid formation has therapeutic potential, but is hampered by the lack of structural information on inhibitor complexes of the conformationally flexible, aggregation-prone IAPP. Here we characterize a β-hairpin conformation of IAPP in complex with the engineered binding protein β-wrapin HI18. The β-strands correspond to two amyloidogenic motifs, 12-LANFLVH-18 and 22-NFGAILS-28, which are connected by a turn established around Ser-20. Besides backbone hydrogen bonding, the IAPP:HI18 interaction surface is dominated by non-polar contacts involving hydrophobic side chains of the IAPP β-strands. Apart from monomers, HI18 binds oligomers and fibrils and inhibits IAPP aggregation and toxicity at low substoichiometric concentrations. The IAPP β-hairpin can serve as a molecular recognition motif enabling control of IAPP aggregation. PMID:27641459

  15. Dissection of functional lncRNAs in Alzheimer's disease by construction and analysis of lncRNA-mRNA networks based on competitive endogenous RNAs.

    Science.gov (United States)

    Wang, Lian-Kun; Chen, Xiao-Feng; He, Dan-Dan; Li, You; Fu, Jin

    2017-04-08

    Alzheimer's disease (AD) is a neurodegenerative disorder that is the most common cause of dementia in the elderly, and intracellular neurofibrillary tangles (NFTs) are one of the pathological features of AD. Recent studies have suggested long noncoding RNAs (lncRNAs) play important roles in AD. Competing endogenous RNAs (ceRNAs) is a mechanism that has recently been proposed, in which lncRNAs compete for common miRNA-binding sites with mRNAs. However, the roles of lncRNAs and ceRNA in AD NFTs is limited. In this study, we constructed a global triple network based on ceRNA theory, then an AD NFT lncRNA-mRNA network (NFTLMN) was generated. By analyzing the NFTLMN, three lncRNAs (AP000265.1, KB-1460A1.5 and RP11-145M9.4), which are highly related with AD NFTs were identified. To further explore the cross-talk between mRNAs and lncRNAs, a clustering module analysis was performed on the NFTLMN and two AD NFT related modules were identified. Our study provides a better understanding of the molecular basis of AD NFTs and may offer novel treatment strategies for AD. Copyright © 2016. Published by Elsevier Inc.

  16. Acyclic peptides incorporating the d-Phe-2-Abz turn motif: Investigations on antimicrobial activity and propensity to adopt β-hairpin conformations.

    Science.gov (United States)

    Cameron, Alan J; Varnava, Kyriakos G; Edwards, Patrick J B; Harjes, Elena; Sarojini, Vijayalekshmi

    2018-06-14

    Three linear peptides incorporating d-Phe-2-Abz as the turn motif are reported. Peptide 1, a hydrophobic β-hairpin, served as a proof of principle for the design strategy with both NMR and CD spectra strongly suggesting a β-hairpin conformation. Peptides 2 and 3, designed as amphipathic antimicrobials, exhibited broad spectrum antimicrobial activity, with potency in the nanomolar range against Staphylococcus aureus. Both compounds possess a high degree of selectivity, proving non-haemolytic at concentrations 500 to 800 times higher than their respective minimal inhibitory concentrations (MICs) against S. aureus. Peptide 2 induced cell membrane and cell wall disintegration in both S. aureus and Pseudomonas aeruginosa as observed by transmission electron microscopy. Peptide 2 also demonstrated moderate antifungal activity against Candida albicans with an MIC of 50 μM. Synergism was observed with sub-MIC levels of amphotericin B (AmB), leading to nanomolar MICs against C. albicans for peptide 2. Based on circular dichroism spectra, both peptides 2 and 3 appear to exist as a mixture of conformers with the β-hairpin as a minor conformer in aqueous solution, and a slight increase in hairpin population in 50% trifluoroethanol, which was more pronounced for peptide 3. NMR spectra of peptide 2 in a 1:1 CD 3 CN/H 2 O mixture and 30 mM deuterated sodium dodecyl sulfate showed evidence of an extended backbone conformation of the β-strand residues. However, inter-strand rotating frame Overhauser effects (ROE) could not be detected and a loosely defined divergent hairpin structure resulted from ROE structure calculation in CD 3 CN/H 2 O. The loosely defined hairpin conformation is most likely a result of the electrostatic repulsions between cationic strand residues which also probably contribute towards maintaining low haemolytic activity. Copyright © 2018 European Peptide Society and John Wiley & Sons, Ltd.

  17. An "off-on" electrochemiluminescent biosensor based on DNAzyme-assisted target recycling and rolling circle amplifications for ultrasensitive detection of microRNA.

    Science.gov (United States)

    Zhang, Pu; Wu, Xiaoyan; Yuan, Ruo; Chai, Yaqin

    2015-03-17

    In this study, an off-on switching of a dual amplified electrochemiluminescence (ECL) biosensor based on Pb(2+)-induced DNAzyme-assisted target recycling and rolling circle amplification (RCA) was constructed for microRNA (miRNA) detection. First, the primer probe with assistant probe and miRNA formed Y junction which was cleaved with the addition of Pb(2+) to release miRNA. Subsequently, the released miRNA could initiate the next recycling process, leading to the generation of numerous intermediate DNA sequences (S2). Afterward, bare glassy carbon electrode (GCE) was immersed into HAuCl4 solution to electrodeposit a Au nanoparticle layer (depAu), followed by the assembly of a hairpin probe (HP). Then, dopamine (DA)-modified DNA sequence (S1) was employed to hybridize with HP, which switching off the sensing system. This is the first work that employs DA to quench luminol ECL signal, possessing the biosensor ultralow background signal. Afterward, S2 produced by the target recycling process was loaded onto the prepared electrode to displace S1 and served as an initiator for RCA. With rational design, numerous repeated DNA sequences coupling with hemin to form hemin/G-quadruplex were generated, which could exhibit strongly catalytic toward H2O2, thus amplified the ECL signal and switched the ON state of the sensing system. The liner range for miRNA detection was from 1.0 fM to 100 pM with a low detection limit down to 0.3 fM. Moreover, with the high sensitivity and specificity induced by the dual signal amplification, the proposed miRNA biosensor holds great potential for analysis of other interesting tumor markers.

  18. Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

    Science.gov (United States)

    Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

    2013-01-01

    This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing

  19. On RNA-RNA interaction structures of fixed topological genus.

    Science.gov (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M

    2015-04-01

    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Curcumin stably interacts with DNA hairpin through minor groove binding and demonstrates enhanced cytotoxicity in combination with FdU nucleotides.

    Science.gov (United States)

    Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H

    2018-03-01

    We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Expression of a novel non-coding mitochondrial RNA in human proliferating cells.

    Science.gov (United States)

    Villegas, Jaime; Burzio, Veronica; Villota, Claudio; Landerer, Eduardo; Martinez, Ronny; Santander, Marcela; Martinez, Rodrigo; Pinto, Rodrigo; Vera, María I; Boccardo, Enrique; Villa, Luisa L; Burzio, Luis O

    2007-01-01

    Previously, we reported the presence in mouse cells of a mitochondrial RNA which contains an inverted repeat (IR) of 121 nucleotides (nt) covalently linked to the 5' end of the mitochondrial 16S RNA (16S mtrRNA). Here, we report the structure of an equivalent transcript of 2374 nt which is over-expressed in human proliferating cells but not in resting cells. The transcript contains a hairpin structure comprising an IR of 815 nt linked to the 5' end of the 16S mtrRNA and forming a long double-stranded structure or stem and a loop of 40 nt. The stem is resistant to RNase A and can be detected and isolated after digestion with the enzyme. This novel transcript is a non-coding RNA (ncRNA) and several evidences suggest that the transcript is synthesized in mitochondria. The expression of this transcript can be induced in resting lymphocytes stimulated with phytohaemagglutinin (PHA). Moreover, aphidicolin treatment of DU145 cells reversibly blocks proliferation and expression of the transcript. If the drug is removed, the cells re-assume proliferation and over-express the ncmtRNA. These results suggest that the expression of the ncmtRNA correlates with the replicative state of the cell and it may play a role in cell proliferation.

  2. Species-independent MicroRNA Gene Discovery

    KAUST Repository

    Kamanu, Timothy K.

    2012-12-01

    MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA

  3. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

    Science.gov (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

    2013-12-01

    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  4. BP Neural Network Could Help Improve Pre-miRNA Identification in Various Species

    Directory of Open Access Journals (Sweden)

    Limin Jiang

    2016-01-01

    Full Text Available MicroRNAs (miRNAs are a set of short (21–24 nt noncoding RNAs that play significant regulatory roles in cells. In the past few years, research on miRNA-related problems has become a hot field of bioinformatics because of miRNAs’ essential biological function. miRNA-related bioinformatics analysis is beneficial in several aspects, including the functions of miRNAs and other genes, the regulatory network between miRNAs and their target mRNAs, and even biological evolution. Distinguishing miRNA precursors from other hairpin-like sequences is important and is an essential procedure in detecting novel microRNAs. In this study, we employed backpropagation (BP neural network together with 98-dimensional novel features for microRNA precursor identification. Results show that the precision and recall of our method are 95.53% and 96.67%, respectively. Results further demonstrate that the total prediction accuracy of our method is nearly 13.17% greater than the state-of-the-art microRNA precursor prediction software tools.

  5. Defining RNA-Small Molecule Affinity Landscapes Enables Design of a Small Molecule Inhibitor of an Oncogenic Noncoding RNA.

    Science.gov (United States)

    Velagapudi, Sai Pradeep; Luo, Yiling; Tran, Tuan; Haniff, Hafeez S; Nakai, Yoshio; Fallahi, Mohammad; Martinez, Gustavo J; Childs-Disney, Jessica L; Disney, Matthew D

    2017-03-22

    RNA drug targets are pervasive in cells, but methods to design small molecules that target them are sparse. Herein, we report a general approach to score the affinity and selectivity of RNA motif-small molecule interactions identified via selection. Named High Throughput Structure-Activity Relationships Through Sequencing (HiT-StARTS), HiT-StARTS is statistical in nature and compares input nucleic acid sequences to selected library members that bind a ligand via high throughput sequencing. The approach allowed facile definition of the fitness landscape of hundreds of thousands of RNA motif-small molecule binding partners. These results were mined against folded RNAs in the human transcriptome and identified an avid interaction between a small molecule and the Dicer nuclease-processing site in the oncogenic microRNA (miR)-18a hairpin precursor, which is a member of the miR-17-92 cluster. Application of the small molecule, Targapremir-18a, to prostate cancer cells inhibited production of miR-18a from the cluster, de-repressed serine/threonine protein kinase 4 protein (STK4), and triggered apoptosis. Profiling the cellular targets of Targapremir-18a via Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP), a covalent small molecule-RNA cellular profiling approach, and other studies showed specific binding of the compound to the miR-18a precursor, revealing broadly applicable factors that govern small molecule drugging of noncoding RNAs.

  6. Observation of hairpin defects in a nematic main-chain polyester

    Science.gov (United States)

    Li, M. H.; Brûlet, A.; Davidson, P.; Keller, P.; Cotton, J. P.

    1993-04-01

    The conformation of a main-chain liquid crystalline polyester in its oriented nematic phase has been determined by small-angle neutron scattering. The data are fitted by a model of rigid cylinder with orientational fluctuations. For a low degree of polymerization (~9) the chain is almost completely elongated in the direction of the nematic field. For a polymer 3 times longer, the existence of two hairpins is shown at high temperature; this number decreases with decreasing temperature.

  7. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures

    Science.gov (United States)

    Sloma, Michael F.; Mathews, David H.

    2016-01-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. PMID:27852924

  8. miRNAFold: a web server for fast miRNA precursor prediction in genomes.

    Science.gov (United States)

    Tav, Christophe; Tempel, Sébastien; Poligny, Laurent; Tahi, Fariza

    2016-07-08

    Computational methods are required for prediction of non-coding RNAs (ncRNAs), which are involved in many biological processes, especially at post-transcriptional level. Among these ncRNAs, miRNAs have been largely studied and biologists need efficient and fast tools for their identification. In particular, ab initio methods are usually required when predicting novel miRNAs. Here we present a web server dedicated for miRNA precursors identification at a large scale in genomes. It is based on an algorithm called miRNAFold that allows predicting miRNA hairpin structures quickly with high sensitivity. miRNAFold is implemented as a web server with an intuitive and user-friendly interface, as well as a standalone version. The web server is freely available at: http://EvryRNA.ibisc.univ-evry.fr/miRNAFold. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Design of a new hairpin DNAzyme: The activity controlled by TMPyP4

    African Journals Online (AJOL)

    Jane

    2011-08-01

    Aug 1, 2011 ... activity and increase cell toxicity (Abdelgany et al., 2007). The hairpin DNAzyme is a ... fixed concentration of 5×10-4M in 50 mM Tris-HCl buffer (pH= 7.5,. 25°C) with 10 mM ..... Functional nucleic acid sensors. Chem. Rev.

  10. DNA hairpin structures in solution: 500-MHz two-dimensional 1H NMR studies on d(CGCCGCAGC) and d(CGCCGTAGC)

    International Nuclear Information System (INIS)

    Gupta, G.; Sarma, M.H.; Sarma, R.H.

    1987-01-01

    A hairpin structure contains two conformationally distinct domains: a double-helical stem with Watson-Crick base pairs and a single-stranded loop that connects the two arms of the stem. By extensive 1D and 2D 500-MHz 1 H NMR studies in H 2 O and D 2 O, it has been demonstrated that the DNA oligomers d(CGCCGCAGC) and d(CGCCGTAGC) form hairpin structures under conditions of low concentration, 0.5 mM in DNA strand, and low salt (20 mM NaCl, pH 7). From examination of the nuclear Overhauser effect (NOE) between base protons H8/H6 and sugar protons H1' and H2'/H2'', it was concluded that in D(CGCCGCAGC) and d(CGCCCTAGC) all the nine nucleotides display average (C2'-endo,anti) geometry. The NMR data in conjunction with molecular model building and solvent accessibility studies were used to derive a working model for the hairpins

  11. Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

    Directory of Open Access Journals (Sweden)

    Yuan-xing Gu

    2014-01-01

    Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

  12. An amplified graphene oxide-based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling for bioassays.

    Science.gov (United States)

    Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai

    2013-04-15

    An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Interaction of the tylosin-resistance methyltransferase RlmA II at its rRNA target differs from the orthologue RlmA I

    DEFF Research Database (Denmark)

    Douthwaite, Stephen; Jakobsen, Lene; Yoshizawa, Satoko

    2008-01-01

    of Gram-positive bacteria, including the tylosin-producer Streptomyces fradiae and the pathogen Streptococcus pneumoniae. Recombinant S. pneumoniae RlmA(II) was purified and shown to retain its activity and specificity in vitro when tested on unmethylated 23 S rRNA substrates. RlmA(II) makes multiple......RlmA(II) methylates the N1-position of nucleotide G748 in hairpin 35 of 23 S rRNA. The resultant methyl group extends into the peptide channel of the 50 S ribosomal subunit and confers resistance to tylosin and other mycinosylated macrolide antibiotics. Methylation at G748 occurs in several groups...

  14. Identification of a novel miRNA from the ovine ovary by a combinatorial approach of bioinformatics and experiments

    Science.gov (United States)

    CHANG, Weihua; WANG, Juanhong; TAO, Dayong; ZHANG, Yong; HE, Jianzhong; SHI, Changqing

    2015-01-01

    MicroRNAs (miRNAs) are a class of short endogenous, single-stranded, non-coding small RNA molecules, about 19–25 nucleotides in length that regulate gene expression at the translation level and influence many physiological process, such apoptosis, metabolism, signal transduction, and occurrence and development of diseases. In this study, we constructed a library from the ovine luteal phase ovary by using next-generation sequencing technology (Solexa high-throughput sequencing technique) and identified 267 novel miRNAs by bioinformatics. One of the novel miRNAs (ovis_aries_ovary-m0033_3p), which expressed in the sheep ovary and testis, was confirmed by real time PCR and northern blot. Ovis_aries_ovary-m0033_3p was 21 nucleotides in length and located on chromosome 12, and it had 100% similarity to hsa-miR-214-3p, mmu-miR-214-3p, dre-miR-214and ssc-miR-214. Meanwhile, the pre-miRNA was 82 nucleotides in length and had a standard hairpin stem-loop structure. From the consistency of the sequence and structure, we speculated that ovis_aries_ovary-m0033_3p had a function similar to hsa-miR-214-3p, which is involved in the fine regulation of cell survival, embryonic development, breeding activities and resistance to ovarian cancer, so we defined it as oar-miR-214-3p. These experimental results will enrich the miRNA database for ovis aries and provide the basis for researching the regulation mechanism of miRNA in relation to breeding activities of seasonal breeding animals. PMID:26268666

  15. Melting of a beta-Hairpin Peptide Using Isotope-Edited 2D IR Spectroscopy and Simulations

    NARCIS (Netherlands)

    Smith, Adam W.; Lessing, Joshua; Ganim, Ziad; Peng, Chunte Sam; Tokmakoff, Andrei; Roy, Santanu; Jansen, Thomas L. C.; Knoester, Jasper

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used! to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (17.2) across its thermal unfolding transition Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  16. Melting of a beta-hairpin peptide using isotope-edited 2D IR spectroscopy and simulations.

    NARCIS (Netherlands)

    Smith, A.W.; Lessing, J.; Ganim, Z.; Peng, C.S.; Tokmakoff, A.; Roy, S.; Jansen, T.L.Th.A.; Knoester, J.

    2010-01-01

    Isotope-edited two-dimensional infrared spectroscopy has been used to characterize the conformational heterogeneity of the beta-hairpin peptide TrpZip2 (TZ2) across its thermal unfolding transition. Four isotopologues were synthesized to probe hydrogen bonding and solvent exposure of the beta-turn

  17. High-affinity interaction of hnRNP A1 with conserved RNA structural elements is required for translation and replication of enterovirus 71.

    Science.gov (United States)

    Levengood, Jeffrey D; Tolbert, Michele; Li, Mei-Ling; Tolbert, Blanton S

    2013-07-01

    Human Enterovirus 71 (EV71) is an emerging pathogen of infectious disease and a serious threat to public health. Currently, there are no antivirals or vaccines to slow down or prevent EV71 infections, thus underscoring the urgency to better understand mechanisms of host-enterovirus interactions. EV71 uses a type I internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit via a pathway that requires the cytoplasmic localization of hnRNP A1, which acts as an IRES trans-activating factor. The mechanism of how hnRNP A1 trans activates EV71 RNA translation is unknown, however. Here, we report that the UP1 domain of hnRNP A1 interacts specifically with stem loop II (SLII) of the IRES, via a thermodynamically well-defined biphasic transition that involves conserved bulge 5'-AYAGY-3' and hairpin 5'-RY(U/A)CCA-3' loops. Calorimetric titrations of wild-type and mutant SLII constructs reveal these structural elements are essential to form a high-affinity UP1-SLII complex. Mutations that alter the bulge and hairpin primary or secondary structures abrogate the biphasic transition and destabilize the complex. Notably, mutations within the bulge that destabilize the complex correlate with a large reduction in IRES-dependent translational activity and impair EV71 replication. Taken together, this study shows that a conserved SLII structure is necessary to form a functional hnRNP A1-IRES complex, suggesting that small molecules that target this stem loop may have novel antiviral properties.

  18. Overview of methods in RNA nanotechnology: synthesis, purification, and characterization of RNA nanoparticles.

    Science.gov (United States)

    Haque, Farzin; Guo, Peixuan

    2015-01-01

    RNA nanotechnology encompasses the use of RNA as a construction material to build homogeneous nanostructures by bottom-up self-assembly with defined size, structure, and stoichiometry; this pioneering concept demonstrated in 1998 (Guo et al., Molecular Cell 2:149-155, 1998; featured in Cell) has emerged as a new field that also involves materials engineering and synthetic structural biology (Guo, Nature Nanotechnology 5:833-842, 2010). The field of RNA nanotechnology has skyrocketed over the last few years, as evidenced by the burst of publications in prominent journals on RNA nanostructures and their applications in nanomedicine and nanotechnology. Rapid advances in RNA chemistry, RNA biophysics, and RNA biology have created new opportunities for translating basic science into clinical practice. RNA nanotechnology holds considerable promise in this regard. Increased evidence also suggests that substantial part of the 98.5 % of human genome (Lander et al. Nature 409:860-921, 2001) that used to be called "junk DNA" actually codes for noncoding RNA. As we understand more on how RNA structures are related to function, we can fabricate synthetic RNA nanoparticles for the diagnosis and treatment of diseases. This chapter provides a brief overview of the field regarding the design, construction, purification, and characterization of RNA nanoparticles for diverse applications in nanotechnology and nanomedicince.

  19. Mutational analysis of an archaeal minichromosome maintenance protein exterior hairpin reveals critical residues for helicase activity and DNA binding

    Directory of Open Access Journals (Sweden)

    Brewster Aaron S

    2010-08-01

    Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.

  20. Structural insights into Rhino-Deadlock complex for germline piRNA cluster specification.

    Science.gov (United States)

    Yu, Bowen; Lin, Yu An; Parhad, Swapnil S; Jin, Zhaohui; Ma, Jinbiao; Theurkauf, William E; Zhang, Zz Zhao; Huang, Ying

    2018-06-01

    PIWI-interacting RNAs (piRNAs) silence transposons in germ cells to maintain genome stability and animal fertility. Rhino, a rapidly evolving heterochromatin protein 1 (HP1) family protein, binds Deadlock in a species-specific manner and so defines the piRNA-producing loci in the Drosophila genome. Here, we determine the crystal structures of Rhino-Deadlock complex in Drosophila melanogaster and simulans In both species, one Rhino binds the N-terminal helix-hairpin-helix motif of one Deadlock protein through a novel interface formed by the beta-sheet in the Rhino chromoshadow domain. Disrupting the interface leads to infertility and transposon hyperactivation in flies. Our structural and functional experiments indicate that electrostatic repulsion at the interaction interface causes cross-species incompatibility between the sibling species. By determining the molecular architecture of this piRNA-producing machinery, we discover a novel HP1-partner interacting mode that is crucial to piRNA biogenesis and transposon silencing. We thus explain the cross-species incompatibility of two sibling species at the molecular level. © 2018 The Authors.

  1. The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1.

    Science.gov (United States)

    Toczyski, D P; Steitz, J A

    1993-01-01

    EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

  2. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  3. RNA versatility, flexibility, and thermostability for practice in RNA nanotechnology and biomedical applications.

    Science.gov (United States)

    Haque, Farzin; Pi, Fengmei; Zhao, Zhengyi; Gu, Shanqing; Hu, Haibo; Yu, Hang; Guo, Peixuan

    2018-01-01

    In recent years, RNA has attracted widespread attention as a unique biomaterial with distinct biophysical properties for designing sophisticated architectures in the nanometer scale. RNA is much more versatile in structure and function with higher thermodynamic stability compared to its nucleic acid counterpart DNA. Larger RNA molecules can be viewed as a modular structure built from a combination of many 'Lego' building blocks connected via different linker sequences. By exploiting the diversity of RNA motifs and flexibility of structure, varieties of RNA architectures can be fabricated with precise control of shape, size, and stoichiometry. Many structural motifs have been discovered and characterized over the years and the crystal structures of many of these motifs are available for nanoparticle construction. For example, using the flexibility and versatility of RNA structure, RNA triangles, squares, pentagons, and hexagons can be constructed from phi29 pRNA three-way-junction (3WJ) building block. This review will focus on 2D RNA triangles, squares, and hexamers; 3D and 4D structures built from basic RNA building blocks; and their prospective applications in vivo as imaging or therapeutic agents via specific delivery and targeting. Methods for intracellular cloning and expression of RNA molecules and the in vivo assembly of RNA nanoparticles will also be reviewed. WIREs RNA 2018, 9:e1452. doi: 10.1002/wrna.1452 This article is categorized under: RNA Methods > RNA Nanotechnology RNA Structure and Dynamics > RNA Structure, Dynamics and Chemistry RNA in Disease and Development > RNA in Disease Regulatory RNAs/RNAi/Riboswitches > Regulatory RNAs. © 2017 Wiley Periodicals, Inc.

  4. Design of a Bioactive Small Molecule that Targets the Myotonic Dystrophy Type 1 RNA Via an RNA Motif-Ligand Database & Chemical Similarity Searching

    Science.gov (United States)

    Parkesh, Raman; Childs-Disney, Jessica L.; Nakamori, Masayuki; Kumar, Amit; Wang, Eric; Wang, Thomas; Hoskins, Jason; Tran, Tuan; Housman, David; Thornton, Charles A.; Disney, Matthew D.

    2012-01-01

    Myotonic dystrophy type 1 (DM1) is a triplet repeating disorder caused by expanded CTG repeats in the 3′ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene. The transcribed repeats fold into an RNA hairpin with multiple copies of a 5′CUG/3′GUC motif that binds the RNA splicing regulator muscleblind-like 1 protein (MBNL1). Sequestration of MBNL1 by expanded r(CUG) repeats causes splicing defects in a subset of pre-mRNAs including the insulin receptor, the muscle-specific chloride ion channel, Sarco(endo)plasmic reticulum Ca2+ ATPase 1 (Serca1/Atp2a1), and cardiac troponin T (cTNT). Based on these observations, the development of small molecule ligands that target specifically expanded DM1 repeats could serve as therapeutics. In the present study, computational screening was employed to improve the efficacy of pentamidine and Hoechst 33258 ligands that have been shown previously to target the DM1 triplet repeat. A series of inhibitors of the RNA-protein complex with low micromolar IC50’s, which are >20-fold more potent than the query compounds, were identified. Importantly, a bis-benzimidazole identified from the Hoechst query improves DM1-associated pre-mRNA splicing defects in cell and mouse models of DM1 (when dosed with 1 mM and 100 mg/kg, respectively). Since Hoechst 33258 was identified as a DM1 binder through analysis of an RNA motif-ligand database, these studies suggest that lead ligands targeting RNA with improved biological activity can be identified by using a synergistic approach that combines analysis of known RNA-ligand interactions with virtual screening. PMID:22300544

  5. Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression.

    Directory of Open Access Journals (Sweden)

    Carlos F Solis

    Full Text Available BACKGROUND: Modern RNA interference (RNAi methodologies using small interfering RNA (siRNA oligonucleotide duplexes or episomally synthesized hairpin RNA are valuable tools for the analysis of gene function in the protozoan parasite Entamoeba histolytica. However, these approaches still require time-consuming procedures including transfection and drug selection, or costly synthetic molecules. PRINCIPAL FINDINGS: Here we report an efficient and handy alternative for E. histolytica gene down-regulation mediated by bacterial double-stranded RNA (dsRNA targeting parasite genes. The Escherichia coli strain HT115 which is unable to degrade dsRNA, was genetically engineered to produce high quantities of long dsRNA segments targeting the genes that encode E. histolytica beta-tubulin and virulence factor KERP1. Trophozoites cultured in vitro were directly fed with dsRNA-expressing bacteria or soaked with purified dsRNA. Both dsRNA delivery methods resulted in significant reduction of protein expression. In vitro host cell-parasite assays showed that efficient downregulation of kerp1 gene expression mediated by bacterial dsRNA resulted in significant reduction of parasite adhesion and lytic capabilities, thus supporting a major role for KERP1 in the pathogenic process. Furthermore, treatment of trophozoites cultured in microtiter plates, with a repertoire of eighty-five distinct bacterial dsRNA segments targeting E. histolytica genes with unknown function, led to the identification of three genes potentially involved in the growth of the parasite. CONCLUSIONS: Our results showed that the use of bacterial dsRNA is a powerful method for the study of gene function in E. histolytica. This dsRNA delivery method is also technically suitable for the study of a large number of genes, thus opening interesting perspectives for the identification of novel drug and vaccine targets.

  6. In Vivo RNA Interference Screening Identifies a Leukemia-Specific Dependence on Integrin Beta 3 Signaling

    Science.gov (United States)

    Miller, Peter G.; Al-Shahrour, Fatima; Hartwell, Kimberly A.; Chu, Lisa P.; Järås, Marcus; Puram, Rishi V.; Puissant, Alexandre; Callahan, Kevin P.; Ashton, John; McConkey, Marie E.; Poveromo, Luke P.; Cowley, Glenn S.; Kharas, Michael G.; Labelle, Myriam; Shterental, Sebastian; Fujisaki, Joji; Silberstein, Lev; Alexe, Gabriela; Al-Hajj, Muhammad A.; Shelton, Christopher A.; Armstrong, Scott A.; Root, David E.; Scadden, David T.; Hynes, Richard O.; Mukherjee, Siddhartha; Stegmaier, Kimberly; Jordan, Craig T.; Ebert, Benjamin L.

    2013-01-01

    SUMMARY We used an in vivo short hairpin RNA (shRNA) screening approach to identify genes that are essential for MLL-AF9 acute myeloid leukemia (AML). We found that Integrin Beta 3 (Itgb3) is essential for murine leukemia cells in vivo, and for human leukemia cells in xenotransplantation studies. In leukemia cells, Itgb3 knockdown impaired homing, downregulated LSC transcriptional programs, and induced differentiation via the intracellular kinase, Syk. In contrast, loss of Itgb3 in normal HSPCs did not affect engraftment, reconstitution, or differentiation. Finally, we confirmed that Itgb3 is dispensable for normal hematopoiesis and required for leukemogenesis using an Itgb3 knockout mouse model. Our results establish the significance of the Itgb3 signaling pathway as a potential therapeutic target in AML. PMID:23770013

  7. Inhibition of osteoclastogenesis by RNA interference targeting RANK

    Directory of Open Access Journals (Sweden)

    Ma Ruofan

    2012-08-01

    Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.

  8. Sustained miRNA-mediated knockdown of mutant AAT with simultaneous augmentation of wild-type AAT has minimal effect on global liver miRNA profiles.

    Science.gov (United States)

    Mueller, Christian; Tang, Qiushi; Gruntman, Alisha; Blomenkamp, Keith; Teckman, Jeffery; Song, Lina; Zamore, Phillip D; Flotte, Terence R

    2012-03-01

    α-1 antitrypsin (AAT) deficiency can exhibit two pathologic states: a lung disease that is primarily due to the loss of AAT's antiprotease function, and a liver disease resulting from a toxic gain-of-function of the PiZ-AAT (Z-AAT) mutant protein. We have developed several recombinant adeno-associated virus (rAAV) vectors that incorporate microRNA (miRNA) sequences targeting the AAT gene while also driving the expression of miRNA-resistant wild-type AAT-PiM (M-AAT) gene, thus achieving concomitant Z-AAT knockdown in the liver and increased expression of M-AAT. Transgenic mice expressing the human PiZ allele treated with dual-function rAAV9 vectors showed that serum PiZ was stably and persistently reduced by an average of 80%. Treated animals showed knockdown of Z-AAT in liver and serum with concomitant increased serum M-AAT as determined by allele-specific enzyme-linked immunosorbent assays (ELISAs). In addition, decreased globular accumulation of misfolded Z-AAT in hepatocytes and a reduction in inflammatory infiltrates in the liver was observed. Results from microarray studies demonstrate that endogenous miRNAs were minimally affected by this treatment. These data suggests that miRNA mediated knockdown does not saturate the miRNA pathway as has been seen with viral vector expression of short hairpin RNAs (shRNAs). This safe dual-therapy approach can be applied to other disorders such as amyotrophic lateral sclerosis, Huntington disease, cerebral ataxia, and optic atrophies.

  9. Computational prediction and experimental validation of Ciona intestinalis microRNA genes

    Directory of Open Access Journals (Sweden)

    Pasquinelli Amy E

    2007-11-01

    Full Text Available Abstract Background This study reports the first collection of validated microRNA genes in the sea squirt, Ciona intestinalis. MicroRNAs are processed from hairpin precursors to ~22 nucleotide RNAs that base pair to target mRNAs and inhibit expression. As a member of the subphylum Urochordata (Tunicata whose larval form has a notochord, the sea squirt is situated at the emergence of vertebrates, and therefore may provide information about the evolution of molecular regulators of early development. Results In this study, computational methods were used to predict 14 microRNA gene families in Ciona intestinalis. The microRNA prediction algorithm utilizes configurable microRNA sequence conservation and stem-loop specificity parameters, grouping by miRNA family, and phylogenetic conservation to the related species, Ciona savignyi. The expression for 8, out of 9 attempted, of the putative microRNAs in the adult tissue of Ciona intestinalis was validated by Northern blot analyses. Additionally, a target prediction algorithm was implemented, which identified a high confidence list of 240 potential target genes. Over half of the predicted targets can be grouped into the gene ontology categories of metabolism, transport, regulation of transcription, and cell signaling. Conclusion The computational techniques implemented in this study can be applied to other organisms and serve to increase the understanding of the origins of non-coding RNAs, embryological and cellular developmental pathways, and the mechanisms for microRNA-controlled gene regulatory networks.

  10. A distant cis acting intronic element induces site-selective RNA editing

    DEFF Research Database (Denmark)

    Daniel, Chammiran; Venø, Morten Trillingsgaard; Ekdahl, Ylva

    2012-01-01

    Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated...... shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce...... the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been...

  11. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo

    2015-01-01

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  12. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: lxuhelen@163.com [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: liuzhiguo@fmmu.edu.cn [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  13. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  14. Probing the Gaseous Structure of a β-Hairpin Peptide with H/D Exchange and Electron Capture Dissociation.

    Science.gov (United States)

    Straus, Rita N; Jockusch, Rebecca A

    2017-02-01

    An improved understanding of the extent to which native protein structure is retained upon transfer to the gas phase promises to enhance biological mass spectrometry, potentially streamlining workflows and providing fundamental insights into hydration effects. Here, we investigate the gaseous conformation of a model β-hairpin peptide using gas-phase hydrogen-deuterium (H/D) exchange with subsequent electron capture dissociation (ECD). Global gas-phase H/D exchange levels, and residue-specific exchange levels derived from ECD data, are compared among the wild type 16-residue peptide GB1p and several variants. High protection from H/D exchange observed for GB1p, but not for a truncated version, is consistent with the retention of secondary structure of GB1p in the gas phase or its refolding into some other compact structure. Four alanine mutants that destabilize the hairpin in solution show levels of protection similar to that of GB1p, suggesting collapse or (re)folding of these peptides upon transfer to the gas phase. These results offer a starting point from which to understand how a key secondary structural element, the β-hairpin, is affected by transfer to the gas phase. This work also demonstrates the utility of a much-needed addition to the tool set that is currently available for the investigation of the gaseous conformation of biomolecules, which can be employed in the future to better characterize gaseous proteins and protein complexes. Graphical Abstract ᅟ.

  15. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  16. Designing synthetic RNA for delivery by nanoparticles

    International Nuclear Information System (INIS)

    Jedrzejczyk, Dominika; Pawlowska, Roza; Chworos, Arkadiusz; Gendaszewska-Darmach, Edyta

    2017-01-01

    The rapid development of synthetic biology and nanobiotechnology has led to the construction of various synthetic RNA nanoparticles of different functionalities and potential applications. As they occur naturally, nucleic acids are an attractive construction material for biocompatible nanoscaffold and nanomachine design. In this review, we provide an overview of the types of RNA and nucleic acid’s nanoparticle design, with the focus on relevant nanostructures utilized for gene-expression regulation in cellular models. Structural analysis and modeling is addressed along with the tools available for RNA structural prediction. The functionalization of RNA-based nanoparticles leading to prospective applications of such constructs in potential therapies is shown. The route from the nanoparticle design and modeling through synthesis and functionalization to cellular application is also described. For a better understanding of the fate of targeted RNA after delivery, an overview of RNA processing inside the cell is also provided. (topical review)

  17. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    Science.gov (United States)

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  18. Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

    Directory of Open Access Journals (Sweden)

    Neeraj K. Dubey

    2017-09-01

    Full Text Available RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp. are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma: transient expression using Tobacco rattle virus (TRV:pma as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill. plants harboring a hairpin construct (pBINPLUS35:pma. siRNA-mediated transgene-silencing (20–24 nt was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes.

  19. Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

    2012-06-15

    Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

  20. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    Science.gov (United States)

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  1. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  2. FUNDAMENTAL STUDY OF DETECTION OF MUSCLE HYPERTROPHY-ORIENTED GENE DOPING BY MYOSTATIN KNOCK DOWN USING RNA INTERFERENCE

    Directory of Open Access Journals (Sweden)

    Tohru Takemasa

    2012-06-01

    Full Text Available To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control

  3. Binding of HIV-1 gp41-directed neutralizing and non-neutralizing fragment antibody binding domain (Fab and single chain variable fragment (ScFv antibodies to the ectodomain of gp41 in the pre-hairpin and six-helix bundle conformations.

    Directory of Open Access Journals (Sweden)

    John M Louis

    Full Text Available We previously reported a series of antibodies, in fragment antigen binding domain (Fab formats, selected from a human non-immune phage library, directed against the internal trimeric coiled-coil of the N-heptad repeat (N-HR of HIV-1 gp41. Broadly neutralizing antibodies from that series bind to both the fully exposed N-HR trimer, representing the pre-hairpin intermediate state of gp41, and to partially-exposed N-HR helices within the context of the gp41 six-helix bundle. While the affinities of the Fabs for pre-hairpin intermediate mimetics vary by only 2 to 20-fold between neutralizing and non-neutralizing antibodies, differences in inhibition of viral entry exceed three orders of magnitude. Here we compare the binding of neutralizing (8066 and non-neutralizing (8062 antibodies, differing in only four positions within the CDR-H2 binding loop, in Fab and single chain variable fragment (ScFv formats, to several pre-hairpin intermediate and six-helix bundle constructs of gp41. Residues 56 and 58 of the mini-antibodies are shown to be crucial for neutralization activity. There is a large differential (≥ 150-fold in binding affinity between neutralizing and non-neutralizing antibodies to the six-helix bundle of gp41 and binding to the six-helix bundle does not involve displacement of the outer C-terminal helices of the bundle. The binding stoichiometry is one six-helix bundle to one Fab or three ScFvs. We postulate that neutralization by the 8066 antibody is achieved by binding to a continuum of states along the fusion pathway from the pre-hairpin intermediate all the way to the formation of the six-helix bundle, but prior to irreversible fusion between viral and cellular membranes.

  4. Domestication of transposable elements into MicroRNA genes in plants.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

  5. Identification of Subtype Specific miRNA-mRNA Functional Regulatory Modules in Matched miRNA-mRNA Expression Data: Multiple Myeloma as a Case

    Directory of Open Access Journals (Sweden)

    Yunpeng Zhang

    2015-01-01

    Full Text Available Identification of miRNA-mRNA modules is an important step to elucidate their combinatorial effect on the pathogenesis and mechanisms underlying complex diseases. Current identification methods primarily are based upon miRNA-target information and matched miRNA and mRNA expression profiles. However, for heterogeneous diseases, the miRNA-mRNA regulatory mechanisms may differ between subtypes, leading to differences in clinical behavior. In order to explore the pathogenesis of each subtype, it is important to identify subtype specific miRNA-mRNA modules. In this study, we integrated the Ping-Pong algorithm and multiobjective genetic algorithm to identify subtype specific miRNA-mRNA functional regulatory modules (MFRMs through integrative analysis of three biological data sets: GO biological processes, miRNA target information, and matched miRNA and mRNA expression data. We applied our method on a heterogeneous disease, multiple myeloma (MM, to identify MM subtype specific MFRMs. The constructed miRNA-mRNA regulatory networks provide modular outlook at subtype specific miRNA-mRNA interactions. Furthermore, clustering analysis demonstrated that heterogeneous MFRMs were able to separate corresponding MM subtypes. These subtype specific MFRMs may aid in the further elucidation of the pathogenesis of each subtype and may serve to guide MM subtype diagnosis and treatment.

  6. The mitochondrial genomes of sponges provide evidence for multiple invasions by Repetitive Hairpin-forming Elements (RHE

    Directory of Open Access Journals (Sweden)

    Lavrov Dennis V

    2009-12-01

    Full Text Available Abstract Background The mitochondrial (mt genomes of sponges possess a variety of features, which appear to be intermediate between those of Eumetazoa and non-metazoan opisthokonts. Among these features is the presence of long intergenic regions, which are common in other eukaryotes, but generally absent in Eumetazoa. Here we analyse poriferan mitochondrial intergenic regions, paying particular attention to repetitive sequences within them. In this context we introduce the mitochondrial genome of Ircinia strobilina (Lamarck, 1816; Demospongiae: Dictyoceratida and compare it with mtDNA of other sponges. Results Mt genomes of dictyoceratid sponges are identical in gene order and content but display major differences in size and organization of intergenic regions. An even higher degree of diversity in the structure of intergenic regions was found among different orders of demosponges. One interesting observation made from such comparisons was of what appears to be recurrent invasions of sponge mitochondrial genomes by repetitive hairpin-forming elements, which cause large genome size differences even among closely related taxa. These repetitive hairpin-forming elements are structurally and compositionally divergent and display a scattered distribution throughout various groups of demosponges. Conclusion Large intergenic regions of poriferan mt genomes are targets for insertions of repetitive hairpin- forming elements, similar to the ones found in non-metazoan opisthokonts. Such elements were likely present in some lineages early in animal mitochondrial genome evolution but were subsequently lost during the reduction of intergenic regions, which occurred in the Eumetazoa lineage after the split of Porifera. Porifera acquired their elements in several independent events. Patterns of their intra-genomic dispersal can be seen in the mt genome of Vaceletia sp.

  7. 1H and 31P resonance assignments and secondary structure of hairpin conformer of IA mismatched oligonucleotide d-GGTACIAGTACC

    International Nuclear Information System (INIS)

    Chary, K.V.R.; Rastogi, V.K.; Govil, Girjesh

    1994-01-01

    Almost complete 1 H and 31 P resonance assignments of two coexisting conformers, duplex and an hairpin, of d-GGTACIAGTACC at 1.25mM concentration and 305 K have been achieved. The results demonstrate that the hairpin conformer has a structure with two purines I6 and A7 forming a two-base loop on a B-DNA stem. Stacking is continued on the 5'-side of the loop, with the I6 stacked upon C5. The base A7, on the 3'-side of the loop stacks partially with I6. The glycosidic angle for G8 is in the anti domain and it maintains normal Watson-Crick base-pairing with the opposite C5. (author). 28 refs., 7 figs., 2 tabs

  8. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    Science.gov (United States)

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  9. Permuted tRNA genes of Cyanidioschyzon merolae, the origin of the tRNA molecule and the root of the Eukarya domain.

    Science.gov (United States)

    Di Giulio, Massimo

    2008-08-07

    An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super

  10. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  11. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K, E-mail: Jamboor.vishwanatha@unthsc.edu [Department of Molecular Biology and Immunology and Institute for Cancer Research, Graduate School of Biomedical Sciences, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-11-04

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high ({approx}97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  12. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Science.gov (United States)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.

    2011-11-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  13. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    International Nuclear Information System (INIS)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K

    2011-01-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (∼97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  14. Identification of microRNA-Like RNAs in the filamentous fungus Trichoderma reesei by solexa sequencing.

    Directory of Open Access Journals (Sweden)

    Kang Kang

    Full Text Available microRNAs (miRNAs are non-coding small RNAs (sRNAs capable of negatively regulating gene expression. Recently, microRNA-like small RNAs (milRNAs were discovered in several filamentous fungi but not yet in Trichoderma reesei, an industrial filamentous fungus that can secrete abundant hydrolases. To explore the presence of milRNA in T. reesei and evaluate their expression under induction of cellulose, two T. reesei sRNA libraries of cellulose induction (IN and non-induction (CON were generated and sequenced using Solexa sequencing technology. A total of 726 and 631 sRNAs were obtained from the IN and CON samples, respectively. Global expression analysis showed an extensively differential expression of sRNAs in T. reesei under the two conditions. Thirteen predicted milRNAs were identified in T. reesei based on the short hairpin structure analysis. The milRNA profiles obtained in deep sequencing were further validated by RT-qPCR assay. Computational analysis predicted a number of potential targets relating to many processes including regulation of enzyme expression. The presence and differential expression of T. reesei milRNAs imply that milRNA might play a role in T. reesei growth and cellulase induction. This work lays foundation for further functional study of fungal milRNAs and their industrial application.

  15. Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato.

    Science.gov (United States)

    Mamta; Reddy, K R K; Rajam, M V

    2016-02-01

    Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a devastating agricultural insect pest with broad spectrum of host range, causing million dollars crop loss annually. Limitations in the present conventional and transgenic approaches have made it crucial to develop sustainable and environmental friendly methods for crop improvement. In the present study, host-induced RNA interference (HI-RNAi) approach was used to develop H. armigera resistant tobacco and tomato plants. Chitinase (HaCHI) gene, critically required for insect molting and metamorphosis was selected as a potential target. Hair-pin RNAi construct was prepared from the conserved off-target free partial HaCHI gene sequence and was used to generate several HaCHI-RNAi tobacco and tomato plants. Northern hybridization confirmed the production of HaCHI gene-specific siRNAs in HaCHI-RNAi tobacco and tomato lines. Continuous feeding on leaves of RNAi lines drastically reduced the target gene transcripts and consequently, affected the overall growth and survival of H. armigera. Various developmental deformities were also manifested in H. armigera larvae after feeding on the leaves of RNAi lines. These results demonstrated the role of chitinase in insect development and potential of HI-RNAi for effective management of H. armigera.

  16. Vibrational spectral simulation for peptides of mixed secondary structure: Method comparisons with the Trpzip model hairpin

    Czech Academy of Sciences Publication Activity Database

    Bouř, Petr; Keiderling, T. A.

    2005-01-01

    Roč. 109, - (2005), 23687-23697 ISSN 1089-5647 R&D Projects: GA AV ČR(CZ) IAA4055104 Grant - others:NSF(US) CHE03-16014 Institutional research plan: CEZ:AV0Z40550506 Keywords : VCD * trpzin model hairpin * peptides Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.679, year: 2003

  17. ELFN1-AS1: A Novel Primate Gene with Possible MicroRNA Function Expressed Predominantly in Human Tumors

    Directory of Open Access Journals (Sweden)

    Dmitrii E. Polev

    2014-01-01

    Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.

  18. Construction of an Aptamer-SiRNA Chimera-Modified Tissue-Engineered Blood Vessel for Cell-Type-Specific Capture and Delivery.

    Science.gov (United States)

    Chen, Wen; Zeng, Wen; Sun, Jiansen; Yang, Mingcan; Li, Li; Zhou, Jingting; Wu, Yangxiao; Sun, Jun; Liu, Ge; Tang, Rui; Tan, Ju; Zhu, Chuhong

    2015-06-23

    The application of tissue-engineered blood vessels (TEBVs) is the main developmental direction of vascular replacement therapy. Due to few and/or dysfunctional endothelial progenitor cells (EPCs), it is difficult to successfully construct EPC capture TEBVs in diabetes. RNA has a potential application in cell protection and diabetes treatment, but poor specificity and low efficiency of RNA transfection in vivo limit the application of RNA. On the basis of an acellular vascular matrix, we propose an aptamer-siRNA chimera-modified TEBV that can maintain a satisfactory patency in diabetes. This TEBV consists of two parts, CD133-adenosine kinase (ADK) chimeras and a TEBV scaffold. Our results showed that CD133-ADK chimeras could selectively capture the CD133-positive cells in vivo, and then captured cells can internalize the bound chimeras to achieve RNA self-transfection. Subsequently, CD133-ADK chimeras were cut into ADK siRNA by a dicer, resulting in depletion of ADK. An ADK-deficient cell may act as a bioreactor that sustainably releases adenosine. To reduce nonspecific RNA transfection, we increased the proportion of HAuCl4 during the material preparation, through which the transfection capacity of polyethylenimine (PEI)/polyethylene glycol (PEG)-capped gold nanoparticles (PEI/PEG-AuNPs) was significantly decreased and the ability of TEBV to resist tensile and liquid shear stress was greatly enhanced. PEG and 2'-O-methyl modification was used to enhance the in vivo stability of RNA chimeras. At day 30 postgrafting, the patency rate of CD133-ADK chimera-modified TEBVs reached 90% in diabetic rats and good endothelialization was observed.

  19. Identification of a key structural element for protein folding within beta-hairpin turns.

    Science.gov (United States)

    Kim, Jaewon; Brych, Stephen R; Lee, Jihun; Logan, Timothy M; Blaber, Michael

    2003-05-09

    Specific residues in a polypeptide may be key contributors to the stability and foldability of the unique native structure. Identification and prediction of such residues is, therefore, an important area of investigation in solving the protein folding problem. Atypical main-chain conformations can help identify strains within a folded protein, and by inference, positions where unique amino acids may have a naturally high frequency of occurrence due to favorable contributions to stability and folding. Non-Gly residues located near the left-handed alpha-helical region (L-alpha) of the Ramachandran plot are a potential indicator of structural strain. Although many investigators have studied mutations at such positions, no consistent energetic or kinetic contributions to stability or folding have been elucidated. Here we report a study of the effects of Gly, Ala and Asn substitutions found within the L-alpha region at a characteristic position in defined beta-hairpin turns within human acidic fibroblast growth factor, and demonstrate consistent effects upon stability and folding kinetics. The thermodynamic and kinetic data are compared to available data for similar mutations in other proteins, with excellent agreement. The results have identified that Gly at the i+3 position within a subset of beta-hairpin turns is a key contributor towards increasing the rate of folding to the native state of the polypeptide while leaving the rate of unfolding largely unchanged.

  20. Step-by-Step Construction of Gene Co-expression Networks from High-Throughput Arabidopsis RNA Sequencing Data.

    Science.gov (United States)

    Contreras-López, Orlando; Moyano, Tomás C; Soto, Daniela C; Gutiérrez, Rodrigo A

    2018-01-01

    The rapid increase in the availability of transcriptomics data generated by RNA sequencing represents both a challenge and an opportunity for biologists without bioinformatics training. The challenge is handling, integrating, and interpreting these data sets. The opportunity is to use this information to generate testable hypothesis to understand molecular mechanisms controlling gene expression and biological processes (Fig. 1). A successful strategy to generate tractable hypotheses from transcriptomics data has been to build undirected network graphs based on patterns of gene co-expression. Many examples of new hypothesis derived from network analyses can be found in the literature, spanning different organisms including plants and specific fields such as root developmental biology.In order to make the process of constructing a gene co-expression network more accessible to biologists, here we provide step-by-step instructions using published RNA-seq experimental data obtained from a public database. Similar strategies have been used in previous studies to advance root developmental biology. This guide includes basic instructions for the operation of widely used open source platforms such as Bio-Linux, R, and Cytoscape. Even though the data we used in this example was obtained from Arabidopsis thaliana, the workflow developed in this guide can be easily adapted to work with RNA-seq data from any organism.

  1. Reversal of pathology in CHMP2B-mediated frontotemporal dementia patient cells using RNA interference

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Mizielinska, Sarah; Hasholt, Lis

    2012-01-01

    role in the pathogenesis of the disease. METHODS: In the present study, we used lentiviral vectors to efficiently knockdown CHMP2B by delivering microRNA embedded small hairpin RNAs. RESULTS: We show that CHMP2B can be efficiently knocked down in patient fibroblasts using an RNA interference approach......BACKGROUND: Frontotemporal dementia is the second most common form of young-onset dementia after Alzheimer's disease, and several genetic forms of frontotemporal dementia are known. A rare genetic variant is caused by a point mutation in the CHMP2B gene. CHMP2B is a component of the ESCRT......-III complex, which is involved in endosomal trafficking of proteins targeted for degradation in lysosomes. Mutations in CHMP2B result in abnormal endosomal structures in patient fibroblasts and patient brains, probably through a gain-of-function mechanism, suggesting that the endosomal pathway plays a central...

  2. Substantial Loss of Conserved and Gain of Novel MicroRNA Families in Flatworms

    Science.gov (United States)

    Fromm, Bastian; Worren, Merete Molton; Hahn, Christoph; Hovig, Eivind; Bachmann, Lutz

    2013-01-01

    Recent studies on microRNA (miRNA) evolution focused mainly on the comparison of miRNA complements between animal clades. However, evolution of miRNAs within such groups is poorly explored despite the availability of comparable data that in some cases lack only a few key taxa. For flatworms (Platyhelminthes), miRNA complements are available for some free-living flatworms and all major parasitic lineages, except for the Monogenea. We present the miRNA complement of the monogenean flatworm Gyrodactylus salaris that facilitates a comprehensive analysis of miRNA evolution in Platyhelminthes. Using the newly designed bioinformatics pipeline miRCandRef, the miRNA complement was disentangled from next-generation sequencing of small RNAs and genomic DNA without a priori genome assembly. It consists of 39 miRNA hairpin loci of conserved miRNA families, and 22 novel miRNAs. A comparison with the miRNA complements of Schmidtea mediterranea (Turbellaria), Schistosoma japonicum (Trematoda), and Echinococcus granulosus (Cestoda) reveals a substantial loss of conserved bilaterian, protostomian, and lophotrochozoan miRNAs. Eight of the 46 expected conserved miRNAs were lost in all flatworms, 16 in Neodermata and 24 conserved miRNAs could not be detected in the cestode and the trematode. Such a gradual loss of miRNAs has not been reported before for other animal phyla. Currently, little is known about miRNAs in Platyhelminthes, and for the majority of the lost miRNAs there is no prediction of function. As suggested earlier they might be related to morphological simplifications. The presence and absence of 153 conserved miRNAs was compared for platyhelminths and 32 other metazoan taxa. Phylogenetic analyses support the monophyly of Platyhelminthes (Turbellaria + Neodermata [Monogenea {Trematoda + Cestoda}]). PMID:24025793

  3. Advances in targeted delivery of small interfering RNA using simple bioconjugates

    DEFF Research Database (Denmark)

    Nielsen, Christoffer; Kjems, Jørgen; Sorensen, Kristine Rothaus

    2014-01-01

    with a targeting moiety, in a simple bioconjugate construct. We discuss the use of different types of targeting moieties, as well as the different conjugation strategies employed for preparing these bioconjugate constructs that deliver the siRNA to target cells. We focus especially on the in-built or passive......Introduction: Development of drugs based on RNA interference by small interfering RNA (siRNA) has been progressing slowly due to a number of challenges associated with the in vivo behavior of siRNA. A central problem is controlling siRNA delivery to specific cell types. Here, we review existing...... literature on one type of strategy for solving the issue of cell-specific delivery of siRNA, namely delivering the siRNA as part of simple bioconjugate constructs. Areas covered: This review presents current experience from strategies aimed at targeting siRNA to specific cell types, by associating the siRNA...

  4. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  5. Viral Delivery of dsRNA for Control of Insect Agricultural Pests and Vectors of Human Disease: Prospects and Challenges

    Directory of Open Access Journals (Sweden)

    Anna Kolliopoulou

    2017-06-01

    Full Text Available RNAi is applied as a new and safe method for pest control in agriculture but efficiency and specificity of delivery of dsRNA trigger remains a critical issue. Various agents have been proposed to augment dsRNA delivery, such as engineered micro-organisms and synthetic nanoparticles, but the use of viruses has received relatively little attention. Here we present a critical view of the potential of the use of recombinant viruses for efficient and specific delivery of dsRNA. First of all, it requires the availability of plasmid-based reverse genetics systems for virus production, of which an overview is presented. For RNA viruses, their application seems to be straightforward since dsRNA is produced as an intermediate molecule during viral replication, but DNA viruses also have potential through the production of RNA hairpins after transcription. However, application of recombinant virus for dsRNA delivery may not be straightforward in many cases, since viruses can encode RNAi suppressors, and virus-induced silencing effects can be determined by the properties of the encoded RNAi suppressor. An alternative is virus-like particles that retain the efficiency and specificity determinants of natural virions but have encapsidated non-replicating RNA. Finally, the use of viruses raises important safety issues which need to be addressed before application can proceed.

  6. A Probabilistic Framework for Constructing Temporal Relations in Replica Exchange Molecular Trajectories.

    Science.gov (United States)

    Chattopadhyay, Aditya; Zheng, Min; Waller, Mark Paul; Priyakumar, U Deva

    2018-05-23

    Knowledge of the structure and dynamics of biomolecules is essential for elucidating the underlying mechanisms of biological processes. Given the stochastic nature of many biological processes, like protein unfolding, it's almost impossible that two independent simulations will generate the exact same sequence of events, which makes direct analysis of simulations difficult. Statistical models like Markov Chains, transition networks etc. help in shedding some light on the mechanistic nature of such processes by predicting long-time dynamics of these systems from short simulations. However, such methods fall short in analyzing trajectories with partial or no temporal information, for example, replica exchange molecular dynamics or Monte Carlo simulations. In this work we propose a probabilistic algorithm, borrowing concepts from graph theory and machine learning, to extract reactive pathways from molecular trajectories in the absence of temporal data. A suitable vector representation was chosen to represent each frame in the macromolecular trajectory (as a series of interaction and conformational energies) and dimensionality reduction was performed using principal component analysis (PCA). The trajectory was then clustered using a density-based clustering algorithm, where each cluster represents a metastable state on the potential energy surface (PES) of the biomolecule under study. A graph was created with these clusters as nodes with the edges learnt using an iterative expectation maximization algorithm. The most reactive path is conceived as the widest path along this graph. We have tested our method on RNA hairpin unfolding trajectory in aqueous urea solution. Our method makes the understanding of the mechanism of unfolding in RNA hairpin molecule more tractable. As this method doesn't rely on temporal data it can be used to analyze trajectories from Monte Carlo sampling techniques and replica exchange molecular dynamics (REMD).

  7. Hairpin stabilized fluorescent silver nanoclusters for quantitative detection of NAD+ and monitoring NAD+/NADH based enzymatic reactions.

    Science.gov (United States)

    Jain, Priyamvada; Chakma, Babina; Patra, Sanjukta; Goswami, Pranab

    2017-03-01

    A set of 90 mer long ssDNA candidates, with different degrees of cytosine (C-levels) (% and clusters) was analyzed for their function as suitable Ag-nanocluster (AgNC) nucleation scaffolds. The sequence (P4) with highest C-level (42.2%) emerged as the only candidate supporting the nucleation process as evident from its intense fluorescence peak at λ 660 nm . Shorter DNA subsets derived from P4 with only stable hairpin structures could support the AgNC formation. The secondary hairpin structures were confirmed by PAGE, and CD studies. The number of base pairs in the stem region also contributes to the stability of the hairpins. A shorter 29 mer sequence (Sub 3) (ΔG = -1.3 kcal/mol) with 3-bp in the stem of a 7-mer loop conferred highly stable AgNC. NAD + strongly quenched the fluorescence of Sub 3-AgNC in a concentration dependent manner. Time resolved photoluminescence studies revealed the quenching involves a combined static and dynamic interaction where the binding constant and number of binding sites for NAD + were 0.201 L mol -1 and 3.6, respectively. A dynamic NAD + detection range of 50-500 μM with a limit of detection of 22.3 μM was discerned. The NAD + mediated quenching of AgNC was not interfered by NADH, NADP + , monovalent and divalent ions, or serum samples. The method was also used to follow alcohol dehydrogenase and lactate dehydrogenase catalyzed physiological reactions in a turn-on and turn-off assay, respectively. The proposed method with ssDNA-AgNC could therefore be extended to monitor other NAD + /NADH based enzyme catalyzed reactions in a turn-on/turn-off approach. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    Science.gov (United States)

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. RNA synthetic biology inspired from bacteria: construction of transcription attenuators under antisense regulation.

    Science.gov (United States)

    Dawid, Alexandre; Cayrol, Bastien; Isambert, Hervé

    2009-07-01

    Among all biopolymers, ribonucleic acids or RNA have unique functional versatility, which led to the early suggestion that RNA alone (or a closely related biopolymer) might have once sustained a primitive form of life based on a single type of biopolymer. This has been supported by the demonstration of processive RNA-based replication and the discovery of 'riboswitches' or RNA switches, which directly sense their metabolic environment. In this paper, we further explore the plausibility of this 'RNA world' scenario and show, through synthetic molecular design guided by advanced RNA simulations, that RNA can also perform elementary regulation tasks on its own. We demonstrate that RNA synthetic regulatory modules directly inspired from bacterial transcription attenuators can efficiently activate or repress the expression of other RNA by merely controlling their folding paths 'on the fly' during transcription through simple RNA-RNA antisense interaction. Factors, such as NTP concentration and RNA synthesis rate, affecting the efficiency of this kinetic regulation mechanism are also studied and discussed in the light of evolutionary constraints. Overall, this suggests that direct coupling among synthesis, folding and regulation of RNAs may have enabled the early emergence of autonomous RNA-based regulation networks in absence of both DNA and protein partners.

  10. Target-induced structure switching of hairpin aptamers for label-free and sensitive fluorescent detection of ATP via exonuclease-catalyzed target recycling amplification.

    Science.gov (United States)

    Xu, Yunying; Xu, Jin; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2014-01-15

    In this work, we described the development of a new label-free, simple and sensitive fluorescent ATP sensing platform based on exonuclease III (Exo III)-catalyzed target recycling (ECTR) amplification and SYBR Green I indicator. The hairpin aptamer probes underwent conformational structure switching and re-configuration in the presence of ATP, which led to catalytic cleavage of the re-configured aptamers by Exo III to release ATP and to initiate the ECTR process. Such ECTR process resulted in the digestion of a significant number of the hairpin aptamer probes, leading to much less intercalation of SYBR Green I to the hairpin stems and drastic suppression of the fluorescence emission for sensitive ATP detection down to the low nanomolar level. Due to the highly specific affinity bindings between aptamers and ATP, the developed method exhibited excellent selectivity toward ATP against other analogous molecules. Besides, our ATP sensing approach used un-modified aptamer probes and could be performed in a "mix-and-detect" fashion in homogenous solutions. All these distinct advantages of the developed method thus made it hold great potential for the development of simple and robust sensing strategies for the detection of other small molecules. © 2013 Elsevier B.V. All rights reserved.

  11. Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi; Ding, Fran; Wang, Hongwei; DeLisa, Matthew P.; Ke, Ailong (Yale); (Cornell); (Tsinghua)

    2012-10-10

    Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing, Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.

  12. One-step isothermal detection of multiple KRAS mutations by forming SNP specific hairpins on a gold nanoshell.

    Science.gov (United States)

    Chung, Chan Ho; Kim, Joong Hyun

    2018-04-24

    We developed a one-step isothermal method for typing multiple KRAS mutations using a designed set of primers to form a hairpin on a gold nanoshell upon being ligated by a SNP specific DNA ligase after binding of targets. As a result, we could detect as low as 20 attomoles of KRAS mutations within 1 h.

  13. RNA synthetic biology inspired from bacteria: construction of transcription attenuators under antisense regulation

    International Nuclear Information System (INIS)

    Dawid, Alexandre; Cayrol, Bastien; Isambert, Hervé

    2009-01-01

    Among all biopolymers, ribonucleic acids or RNA have unique functional versatility, which led to the early suggestion that RNA alone (or a closely related biopolymer) might have once sustained a primitive form of life based on a single type of biopolymer. This has been supported by the demonstration of processive RNA-based replication and the discovery of 'riboswitches' or RNA switches, which directly sense their metabolic environment. In this paper, we further explore the plausibility of this 'RNA world' scenario and show, through synthetic molecular design guided by advanced RNA simulations, that RNA can also perform elementary regulation tasks on its own. We demonstrate that RNA synthetic regulatory modules directly inspired from bacterial transcription attenuators can efficiently activate or repress the expression of other RNA by merely controlling their folding paths 'on the fly' during transcription through simple RNA–RNA antisense interaction. Factors, such as NTP concentration and RNA synthesis rate, affecting the efficiency of this kinetic regulation mechanism are also studied and discussed in the light of evolutionary constraints. Overall, this suggests that direct coupling among synthesis, folding and regulation of RNAs may have enabled the early emergence of autonomous RNA-based regulation networks in absence of both DNA and protein partners

  14. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

    2013-01-01

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  15. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif

    2013-01-14

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  16. Computer-Aided Design of RNA Origami Structures.

    Science.gov (United States)

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  17. Upregulation of Long Noncoding RNA Small Nucleolar RNA Host Gene 18 Promotes Radioresistance of Glioma by Repressing Semaphorin 5A

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Rong [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Fujian Medical University Union Hospital, Fuzhou, Fujian (China); Yao, Qiwei [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Teaching Hospital of Fujian Medical University, Fujian Provincial Cancer Hospital, Fuzhou, Fujian (China); Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yang, Kaijun [Department of Neurosurgery, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yuan, Yawei, E-mail: yuanyawei2015@outlook.com [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Cancer Hospital Center of Guangzhou Medical University, Guangzhou, Guangdong (China)

    2016-11-15

    Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.

  18. Upregulation of Long Noncoding RNA Small Nucleolar RNA Host Gene 18 Promotes Radioresistance of Glioma by Repressing Semaphorin 5A

    International Nuclear Information System (INIS)

    Zheng, Rong; Yao, Qiwei; Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha; Yang, Kaijun; Yuan, Yawei

    2016-01-01

    Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.

  19. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Science.gov (United States)

    Nieves Torres, Evelyn C; Yang, Binxia; Roy, Bhaskar; Janardhanan, Rajiv; Brahmbhatt, Akshaar; Leof, Ed; Mukhopadhyay, Debabrata; Misra, Sanjay

    2014-01-01

    Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH) causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1) at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF) using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1) at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A) and matrix metalloproteinase-9 (MMP-9) (LV-shRNA-ADAMTS-1 transduced vessels vs. controls). These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  20. Adventitial delivery of lentivirus-shRNA-ADAMTS-1 reduces venous stenosis formation in arteriovenous fistula.

    Directory of Open Access Journals (Sweden)

    Evelyn C Nieves Torres

    Full Text Available Hemodialysis vascular access can develop venous neointimal hyperplasia (VNH causing stenosis. Recent clinical and experimental data has demonstrated that there is increased expression of a disintegrin and metalloproteinase thrombospondin motifs-1 (ADAMTS-1 at site of VNH. The experiments outlined in the present paper were designed to test the hypothesis that targeting of the adventitia of the outflow vein of murine arteriovenous fistula (AVF using a small hairpin RNA that inhibits ADAMTS-1 expression (LV-shRNA-ADAMTS-1 at the time of fistula creation will decrease VNH. At early time points, ADAMTS-1 expression was significantly decreased associated with a reduction in vascular endothelial growth factor-A (VEGF-A and matrix metalloproteinase-9 (MMP-9 (LV-shRNA-ADAMTS-1 transduced vessels vs. controls. These changes in gene and protein expression resulted in favorable vascular remodeling with a significant increase in mean lumen vessel area, decrease in media/adventitia area, with a significant increase in TUNEL staining accompanied with a decrease in cellular proliferation accompanied with a reduction in CD68 staining. Collectively, these results demonstrate that ADAMTS-1 transduced vessels of the outflow vein of AVF have positive vascular remodeling.

  1. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

    Science.gov (United States)

    Bandaranayake, Pradeepa C G; Yoder, John I

    2013-05-01

    Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

  2. Signal-on electrochemiluminescence biosensor for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction.

    Science.gov (United States)

    Wang, Minghui; Zhou, Yunlei; Yin, Huanshun; Jiang, Wenjing; Wang, Haiyan; Ai, Shiyun

    2018-06-01

    MicroRNAs play crucial role in regulating gene expression in organism, thus it is very necessary to exploit an efficient method for the sensitive and specific detection of microRNA. Herein, a signal-on electrochemiluminescence biosensor was fabricated for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction (ISDPR). In the presence of target microRNA, amounts of trigger DNA could be generated by the first ISDPR. Then, the trigger DNA and the primer hybridized simultaneously with the hairpin probe to open the stem of the probe, and then the ECL signal will be emitted. In the presence of phi29 DNA polymerase and dNTPs, the trigger DNA could be displaced to initiate a new cycle which was the second ISDPR. Due to the two-stage amplification, this method presented excellent detection sensitivity with a low detection limit of 0.14 fM. Moreover, the applicability of the developed method was demonstrated by detecting the change of microRNA-319a content in the leaves of rice seedlings after the rice seeds were incubated with chemical mutagen of ethyl methanesulfonate. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Extracellular and circulating redox- and metalloregulated eRNA and eRNP: copper ion-structured RNA cytokines (angiotropin ribokines) and bioaptamer targets imparting RNA chaperone and novel biofunctions to S100-EF-hand and disease-associated proteins.

    Science.gov (United States)

    Wissler, Josef H

    2004-06-01

    Bioassays for cellular differentiation and tissue morphogenesis were used to design methods for isolation of bioactive redox- and metalloregulated nucleic acids and copper ion complexes with proteins from extracellular, circulating, wound, and supernatant fluids of cultured cells. In extracellular biospheres, diversities of nucleic acids were found to be secreted by cells upon activation. They may reflect nucleic acid biolibraries with molecular imprints of cellular history. After removal of protein components, eRNA prototypes exuded by activated cells were sequenced. They are small, endogenous, highly modified and edited, redox- and metalloregulated 5'-end phosphorylated extracellular eRNA (approximately 2-200 bases) with cellular, enzymic, and bioaptamer functions. Fenton-type OH* radical redox reactions may form modified nucleotides in RNA as wobbles eRNA per se, or as copper ion-complex with protein (e.g., S100A12-EF-hand protein, angiotropin-related protein, calgranulin-C, hippocampal neurite differentiation factor) are shown to be bioactive in vivo and in vitro as cytokines (ribokines) and as nonmitogenic angiomorphogens for endothelial cell differentiation in the formation of organoid supracellular capillary structures. As bioaptamers, copper ion-structured eRNA imparts novel biofunctions to proteins that they do not have on their own. The origin of extracellular RNA and intermediate precursors (up to 500 bases) was traced to intracellular parent nucleic acids. Intermediate precursors with and without partial homology were found. This suggests that bioaptamers are not directly retranslatable gene products. Metalloregulated eRNA bioaptamer function was investigated by domains (e.g. 5'...CUG...3' hairpin loop) for folding, bioactivity, and binding of protein with copper, calcium, and alkali metal ion affinity. Vice versa, metalloregulated nucleic acid-binding domains (K3H, R3H) in proteins were identified. Interaction of protein and eRNA docking potentials

  4. Role of RNA interference in plant improvement.

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  5. Role of RNA interference in plant improvement

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  6. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  7. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  8. DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Sizolwenkosi Mlotshwa

    2008-03-01

    Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

  9. HTS dual-band bandpass filters using stub-loaded hair-pin resonators for mobile communication systems

    Energy Technology Data Exchange (ETDEWEB)

    Sekiya, N., E-mail: nsekiya@yamanashi.ac.jp; Sugiyama, S.

    2014-09-15

    Highlights: • We have developed a HTS five-pole dual-band bandpass filter using stub-loaded hair-pin resonators. • The proposed dual-band BPF can independently control of the center frequency. • Flexibly adjustment of the bandwidth can be achieved by the H-shaped waveguide. • The proposed BPF is evaluated by simulation and measurement with good agreement. - Abstract: A HTS dual-band bandpass filter is developed to obtain sharp-cut off characteristics for mobile communication systems. The filter is composed of five stub-loaded hair-pin resonators with H-shaped waveguides between them. The main advantage of the proposed filter is to allow independent control of the center frequency of the first and second bands. The bandwidths can be flexibly adjusted using the H-shaped waveguide. An electromagnetic simulator was used to design and analyze the filter, which have a 3.5-GHz center frequency and a 70-MHz (2%) bandwidth for the first band and a 5.0-GHz center frequency and a 100-MHz (2%) bandwidth for the second band. The filter was fabricated using YBa{sub 2}Cu{sub 3}O{sub y} thin film on an Al{sub 2}O{sub 3} substrate. Ground plane was fabricated using Au thin film. The measured frequency responses of the filter tally well with the simulated ones.

  10. Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections.

    Science.gov (United States)

    Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung

    2018-05-01

    The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium

  11. RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

    Science.gov (United States)

    Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

    2012-08-01

    A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

  12. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  13. Cancer-Related Triplets of mRNA-lncRNA-miRNA Revealed by Integrative Network in Uterine Corpus Endometrial Carcinoma

    Directory of Open Access Journals (Sweden)

    Chenglin Liu

    2017-01-01

    Full Text Available The regulation of transcriptome expression level is a complex process involving multiple-level interactions among molecules such as protein coding RNA (mRNA, long noncoding RNA (lncRNA, and microRNA (miRNA, which are essential for the transcriptome stability and maintenance and regulation of body homeostasis. The availability of multilevel expression data enables a comprehensive view of the regulatory network. In this study, we analyzed the coding and noncoding gene expression profiles of 301 patients with uterine corpus endometrial carcinoma (UCEC. A new method was proposed to construct a genome-wide integrative network based on variance inflation factor (VIF regression method. The cross-regulation relations of mRNA, lncRNA, and miRNA were then selected based on clique-searching algorithm from the network, when any two molecules of the three were shown as interacting according to the integrative network. Such relation, which we call the mRNA-lncRNA-miRNA triplet, demonstrated the complexity in transcriptome regulation process. Finally, six UCEC-related triplets were selected in which the mRNA participates in endometrial carcinoma pathway, such as CDH1 and TP53. The multi-type RNAs are proved to be cross-regulated as to each of the six triplets according to literature. All the triplets demonstrated the association with the initiation and progression of UCEC. Our method provides a comprehensive strategy for the investigation of transcriptome regulation mechanism.

  14. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  15. RNA-SeQC: RNA-seq metrics for quality control and process optimization.

    Science.gov (United States)

    DeLuca, David S; Levin, Joshua Z; Sivachenko, Andrey; Fennell, Timothy; Nazaire, Marc-Danie; Williams, Chris; Reich, Michael; Winckler, Wendy; Getz, Gad

    2012-06-01

    RNA-seq, the application of next-generation sequencing to RNA, provides transcriptome-wide characterization of cellular activity. Assessment of sequencing performance and library quality is critical to the interpretation of RNA-seq data, yet few tools exist to address this issue. We introduce RNA-SeQC, a program which provides key measures of data quality. These metrics include yield, alignment and duplication rates; GC bias, rRNA content, regions of alignment (exon, intron and intragenic), continuity of coverage, 3'/5' bias and count of detectable transcripts, among others. The software provides multi-sample evaluation of library construction protocols, input materials and other experimental parameters. The modularity of the software enables pipeline integration and the routine monitoring of key measures of data quality such as the number of alignable reads, duplication rates and rRNA contamination. RNA-SeQC allows investigators to make informed decisions about sample inclusion in downstream analysis. In summary, RNA-SeQC provides quality control measures critical to experiment design, process optimization and downstream computational analysis. See www.genepattern.org to run online, or www.broadinstitute.org/rna-seqc/ for a command line tool.

  16. Small RNA sequence analysis of adenovirus VA RNA-derived miRNAs reveals an unexpected serotype-specific difference in structure and abundance.

    Directory of Open Access Journals (Sweden)

    Wael Kamel

    Full Text Available Human adenoviruses (HAds encode for one or two highly abundant virus-associated RNAs, designated VA RNAI and VA RNAII, which fold into stable hairpin structures resembling miRNA precursors. Here we show that the terminal stem of the VA RNAs originating from Ad4, Ad5, Ad11 and Ad37, all undergo Dicer dependent processing into virus-specific miRNAs (so-called mivaRNAs. We further show that the mivaRNA duplex is subjected to a highly asymmetric RISC loading with the 3'-strand from all VA RNAs being the favored strand, except for the Ad37 VA RNAII, where the 5'-mivaRNAII strand was preferentially assembled into RISC. Although the mivaRNA seed sequences are not fully conserved between the HAds a bioinformatics prediction approach suggests that a large fraction of the VA RNAII-, but not the VA RNAI-derived mivaRNAs still are able to target the same cellular genes. Using small RNA deep sequencing we demonstrate that the Dicer processing event in the terminal stem of the VA RNAs is not unique and generates 3'-mivaRNAs with a slight variation of the position of the 5' terminal nucleotide in the RISC loaded guide strand. Also, we show that all analyzed VA RNAs, except Ad37 VA RNAI and Ad5 VA RNAII, utilize an alternative upstream A start site in addition to the classical +1 G start site. Further, the 5'-mivaRNAs with an A start appears to be preferentially incorporated into RISC. Although the majority of mivaRNA research has been done using Ad5 as the model system our analysis demonstrates that the mivaRNAs expressed in Ad11- and Ad37-infected cells are the most abundant mivaRNAs associated with Ago2-containing RISC. Collectively, our results show an unexpected variability in Dicer processing of the VA RNAs and a serotype-specific loading of mivaRNAs into Ago2-based RISC.

  17. Structural basis for the function of DEAH helicases

    DEFF Research Database (Denmark)

    He, Yangzi; Andersen, Gregers Rom; Nielsen, Klaus Hvid

    2010-01-01

    DEAH helicases participate in pre‐messenger RNA splicing and ribosome biogenesis. The structure of yeast Prp43p‐ADP reveals the homology of DEAH helicases to DNA helicases and the presence of an oligonucleotide‐binding motif. A β‐hairpin from the second RecA domain is wedged between two carboxy......‐terminal domains and blocks access to the occluded RNA binding site formed by the RecA domains and a C‐terminal domain. ATP binding and hydrolysis are likely to induce conformational changes in the hairpin that are important for RNA unwinding or ribonucleoprotein remodelling. The structure of Prp43p provides...

  18. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  19. Deep sequencing of small RNAs identifies canonical and non-canonical miRNA and endogenous siRNAs in mammalian somatic tissues.

    Science.gov (United States)

    Castellano, Leandro; Stebbing, Justin

    2013-03-01

    MicroRNAs (miRNAs) are small RNA molecules that regulate gene expression. They are characterized by specific maturation processes defined by canonical and non-canonical biogenic pathways. Analysis of ∼0.5 billion sequences from mouse data sets derived from different tissues, developmental stages and cell types, partly characterized by either ablation or mutation of the main proteins belonging to miRNA processor complexes, reveals 66 high-confidence new genomic loci coding for miRNAs that could be processed in a canonical or non-canonical manner. A proportion of the newly discovered miRNAs comprises mirtrons, for which we define a new sub-class. Notably, some of these newly discovered miRNAs are generated from untranslated and open reading frames of coding genes, and we experimentally validate these. We also show that many annotated miRNAs do not present miRNA-like features, as they are neither processed by known processing complexes nor loaded on AGO2; this indicates that the current miRNA miRBase database list should be refined and re-defined. Accordingly, a group of them map on ribosomal RNA molecules, whereas others cannot undergo genuine miRNA biogenesis. Notably, a group of annotated miRNAs are Dgcr8 independent and DICER dependent endogenous small interfering RNAs that derive from a unique hairpin formed from a short interspersed nuclear element.

  20. Polycistronic tRNA and CRISPR guide-RNA enables highly efficient multiplexed genome engineering in human cells.

    Science.gov (United States)

    Dong, Fengping; Xie, Kabin; Chen, Yueying; Yang, Yinong; Mao, Yingwei

    2017-01-22

    CRISPR/Cas9 has been widely used for genomic editing in many organisms. Many human diseases are caused by multiple mutations. The CRISPR/Cas9 system provides a potential tool to introduce multiple mutations in a genome. To mimic complicated genomic variants in human diseases, such as multiple gene deletions or mutations, two or more small guide RNAs (sgRNAs) need to be introduced all together. This can be achieved by separate Pol III promoters in a construct. However, limited enzyme sites and increased insertion size lower the efficiency to make a construct. Here, we report a strategy to quickly assembly multiple sgRNAs in one construct using a polycistronic-tRNA-gRNA (PTG) strategy. Taking advantage of the endogenous tRNA processing system in mammalian cells, we efficiently express multiple sgRNAs driven using only one Pol III promoter. Using an all-in-one construct carrying PTG, we disrupt the deacetylase domain in multiple histone deacetylases (HDACs) in human cells simultaneously. We demonstrate that multiple HDAC deletions significantly affect the activation of the Wnt-signaling pathway. Thus, this method enables to efficiently target multiple genes and provide a useful tool to establish mutated cells mimicking human diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  2. Defects in Histone H3.3 Phosphorylation and ATRX Recruitment to Misaligned Chromosomes during Mitosis Contribute to the Development of Pediatric Glioblastomas

    Science.gov (United States)

    2015-09-01

    aneuploidy. 2. Keywords: aneuploidy, ATRX, cell cycle, chromosome missegregation, CRISPR /Cas9, DAXX, glioblastoma, histone H3.3, microinjection, mitosis...histone H3.3 with mutant constructs. We have switched from shRNA hairpins to CRISPR /Cas9 gene editing to silence both alleles of H3.3 (and an H3.3...plasmids against H3F3B. Both plasmids had the Cas9 gene and a soluble GFP reporter. The CRISPR guide sequence in one of these plasmids was 100% match

  3. Construction of an miRNA-Regulated Pathway Network Reveals Candidate Biomarkers for Postmenopausal Osteoporosis

    Directory of Open Access Journals (Sweden)

    Min Shao

    2017-01-01

    Full Text Available We aimed to identify risk pathways for postmenopausal osteoporosis (PMOP via establishing an microRNAs- (miRNA- regulated pathway network (MRPN. Firstly, we identified differential pathways through calculating gene- and pathway-level statistics based on the accumulated normal samples using the individual pathway aberrance score (iPAS. Significant pathways based on differentially expressed genes (DEGs using DAVID were extracted, followed by identifying the common pathways between iPAS and DAVID methods. Next, miRNAs prediction was implemented via calculating TargetScore values with precomputed input (log fold change (FC, TargetScan context score (TSCS, and probabilities of conserved targeting (PCT. An MRPN construction was constructed using the common genes in the common pathways and the predicted miRNAs. Using false discovery rate (FDR < 0.05, 279 differential pathways were identified. Using the criteria of FDR < 0.05 and log⁡FC≥2, 39 DEGs were retrieved, and these DEGs were enriched in 64 significant pathways identified by DAVID. Overall, 27 pathways were the common ones between two methods. Importantly, MAPK signaling pathway and PI3K-Akt signaling pathway were the first and second significantly enriched ones, respectively. These 27 common pathways separated PMOP from controls with the accuracy of 0.912. MAPK signaling pathway and PI3K/Akt signaling pathway might play crucial roles in PMOP.

  4. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  5. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    The binding of a series of PNA and DNA probes to a group of unusually stable DNA hairpins of the tetraloop motif has been observed using absorbance hypochromicity (ABS), circular dichroism (CD), and a colorimetric assay for PNA/DNA duplex detection. These results indicate that both stable PNA...... structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic...

  6. Parameter optimization for constructing competing endogenous RNA regulatory network in glioblastoma multiforme and other cancers.

    Science.gov (United States)

    Chiu, Yu-Chiao; Hsiao, Tzu-Hung; Chen, Yidong; Chuang, Eric Y

    2015-01-01

    In addition to direct targeting and repressing mRNAs, recent studies reported that microRNAs (miRNAs) can bridge up an alternative layer of post-transcriptional gene regulatory networks. The competing endogenous RNA (ceRNA) regulation depicts the scenario where pairs of genes (ceRNAs) sharing, fully or partially, common binding miRNAs (miRNA program) can establish coexpression through competition for a limited pool of the miRNA program. While the dynamics of ceRNA regulation among cellular conditions have been verified based on in silico and in vitro experiments, comprehensive investigation into the strength of ceRNA regulation in human datasets remains largely unexplored. Furthermore, pan-cancer analysis of ceRNA regulation, to our knowledge, has not been systematically investigated. In the present study we explored optimal conditions for ceRNA regulation, investigated functions governed by ceRNA regulation, and evaluated pan-cancer effects. We started by investigating how essential factors, such as the size of miRNA programs, the number of miRNA program binding sites, and expression levels of miRNA programs and ceRNAs affect the ceRNA regulation capacity in tumors derived from glioblastoma multiforme patients captured by The Cancer Genome Atlas (TCGA). We demonstrated that increased numbers of common targeting miRNAs as well as the abundance of binding sites enhance ceRNA regulation and strengthen coexpression of ceRNA pairs. Also, our investigation revealed that the strength of ceRNA regulation is dependent on expression levels of both miRNA programs and ceRNAs. Through functional annotation analysis, our results indicated that ceRNA regulation is highly associated with essential cellular functions and diseases including cancer. Furthermore, the highly intertwined ceRNA regulatory relationship enables constitutive and effective intra-function regulation of genes in diverse types of cancer. Using gene and microRNA expression datasets from TCGA, we successfully

  7. SERS-based inverse molecular sentinel (iMS) nanoprobes for multiplexed detection of microRNA cancer biomarkers in biological samples

    Science.gov (United States)

    Crawford, Bridget M.; Wang, Hsin-Neng; Fales, Andrew M.; Bowie, Michelle L.; Seewaldt, Victoria L.; Vo-Dinh, Tuan

    2017-02-01

    The development of sensitive and selective biosensing techniques is of great interest for clinical diagnostics. Here, we describe the development and application of a surface enhanced Raman scattering (SERS) sensing technology, referred to as "inverse Molecular Sentinel (iMS)" nanoprobes, for the detection of nucleic acid biomarkers in biological samples. This iMS nanoprobe involves the use of plasmonic-active nanostars as the sensing platform for a homogenous assay for multiplexed detection of nucleic acid biomarkers, including DNA, RNA and microRNA (miRNA). The "OFF-to-ON" signal switch is based on a non-enzymatic strand-displacement process and the conformational change of stem-loop (hairpin) oligonucleotide probes upon target binding. Here, we demonstrate the development of iMS nanoprobes for the detection of DNA sequences as well as a modified design of the nanoprobe for the detection of short (22-nt) microRNA sequences. The application of iMS nanoprobes to detect miRNAs in real biological samples was performed with total small RNA extracted from breast cancer cell lines. The multiplex capability of the iMS technique was demonstrated using a mixture of the two differently labeled nanoprobes to detect miR-21 and miR-34a miRNA biomarkers for breast cancer. The results of this study demonstrate the feasibility of applying the iMS technique for multiplexed detection of nucleic acid biomarkers, including short miRNAs molecules.

  8. A path-based measurement for human miRNA functional similarities using miRNA-disease associations

    Science.gov (United States)

    Ding, Pingjian; Luo, Jiawei; Xiao, Qiu; Chen, Xiangtao

    2016-09-01

    Compared with the sequence and expression similarity, miRNA functional similarity is so important for biology researches and many applications such as miRNA clustering, miRNA function prediction, miRNA synergism identification and disease miRNA prioritization. However, the existing methods always utilized the predicted miRNA target which has high false positive and false negative to calculate the miRNA functional similarity. Meanwhile, it is difficult to achieve high reliability of miRNA functional similarity with miRNA-disease associations. Therefore, it is increasingly needed to improve the measurement of miRNA functional similarity. In this study, we develop a novel path-based calculation method of miRNA functional similarity based on miRNA-disease associations, called MFSP. Compared with other methods, our method obtains higher average functional similarity of intra-family and intra-cluster selected groups. Meanwhile, the lower average functional similarity of inter-family and inter-cluster miRNA pair is obtained. In addition, the smaller p-value is achieved, while applying Wilcoxon rank-sum test and Kruskal-Wallis test to different miRNA groups. The relationship between miRNA functional similarity and other information sources is exhibited. Furthermore, the constructed miRNA functional network based on MFSP is a scale-free and small-world network. Moreover, the higher AUC for miRNA-disease prediction indicates the ability of MFSP uncovering miRNA functional similarity.

  9. [Construction of RNA-containing virus-like nanoparticles expression vector with cysteine residues on surface and fluorescent decoration].

    Science.gov (United States)

    Cheng, Yang-Jian; Liang, Ji-Xuan; Li, Qing-Ge

    2005-08-01

    Site-directed mutagenesis was performed at the codon 15 of the MS2 bacteriophage coat protein gene,which had been cloned to the virus-like particles expression vector containing non-self RNA fragment. The produced expression vector,termed pARSC, was transformed to E. coli DH5alpha. The positive clones were selected and proliferated. The harvested cells were treated with sonication and the supernatant was then subjected to linear sucrose density gradients centrifugation (15% to 60%) at 32000 r/min for 4 h at 4 degrees C. The virus-like particles, VLP-Cy, were collected at 35% sucrose density. The particles were examined by transmission electron microscopy and the spherical viral particles of approximately 27 nm in diameter were found. The thiolated VLP-Cy was then chemically modified with fluorescein -5'-maleimide. The covalent fluorescent labeling was confirmed by absorption analysis, SDS-PAGE and MALDI-TOF mass spectroscopy. This is the first report of preparation of RNA-containing natural fluorescent nanoparticles. The study highlight the versatility of MS2 bacteriophage capsids as building blocks for functional nanomaterials construction for a variety of application purposes.

  10. Molecular effects of autoimmune-risk promoter polymorphisms on expression, exon choice, and translational efficiency of interferon regulatory factor 5.

    Science.gov (United States)

    Clark, Daniel N; Lambert, Jared P; Till, Rodney E; Argueta, Lissenya B; Greenhalgh, Kathryn E; Henrie, Brandon; Bills, Trieste; Hawkley, Tyson F; Roznik, Marinya G; Sloan, Jason M; Mayhew, Vera; Woodland, Loc; Nelson, Eric P; Tsai, Meng-Hsuan; Poole, Brian D

    2014-05-01

    The rs2004640 single nucleotide polymorphism and the CGGGG copy-number variant (rs77571059) are promoter polymorphisms within interferon regulatory factor 5 (IRF5). They have been implicated as susceptibility factors for several autoimmune diseases. IRF5 uses alternative promoter splicing, where any of 4 first exons begin the mRNA. The CGGGG indel is in exon 1A's promoter; the rs2004640 allele creates a splicing recognition site, enabling usage of exon 1B. This study aimed at characterizing alterations in IRF5 mRNA due to these polymorphisms. Cells with risk polymorphisms exhibited ~2-fold higher levels of IRF5 mRNA and protein, but demonstrated no change in mRNA stability. Quantitative PCR demonstrated decreased usage of exons 1C and 1D in cell lines with the risk polymorphisms. RNA folding analysis revealed a hairpin in exon 1B; mutational analysis showed that the hairpin shape decreased translation 5-fold. Although translation of mRNA that uses exon 1B is low due to a hairpin, increased IRF5 mRNA levels in individuals with the rs2004640 risk allele lead to higher overall protein expression. In addition, several new splice variants of IRF5 were sequenced. IRF5's promoter polymorphisms alter first exon usage and increase transcription levels. High levels of IRF5 may bias the immune system toward autoimmunity.

  11. Label-free fluorescence strategy for sensitive microRNA detection based on isothermal exponential amplification and graphene oxide.

    Science.gov (United States)

    Li, Wei; Hou, Ting; Wu, Min; Li, Feng

    2016-01-01

    MicroRNAs (miRNAs) play an important role in many biological processes, and have been regarded as potential targets and biomarkers in cancer diagnosis and therapy. Also, to meet the big challenge imposed by the characteristics of miRNAs, such as small size and vulnerability to enzymatic digestion, it is of great importance to develop accurate, sensitive and simple miRNA assays. Herein, we developed a label-free fluorescence strategy for sensitive miRNA detection by combining isothermal exponential amplification and the unique features of SYBR Green I (SG) and graphene oxide (GO), in which SG gives significantly enhanced fluorescence upon intercalation into double-stranded DNAs (dsDNAs), and GO selectively adsorbs miRNA, single-stranded DNA and SG, to protect miRNA from enzymatic digestion, and to quench the fluorescence of the adsorbed SG. In the presence of the target miRNA, the ingeniously designed hairpin probe (HP) is unfolded and the subsequent polymerization and strand displacement reaction takes place to initiate the target recycling process. The newly formed dsDNAs are then recognized and cleaved by the nicking enzyme, generating new DNA triggers with the same sequence as the target miRNA, which hybridize with intact HPs to initiate new extension reactions. As a result, the circular exponential amplification for target miRNA is achieved and large amount of dsDNAs are formed to generate significantly enhanced fluorescence upon the intercalation of SG. Thus sensitive and selective fluorescence miRNA detection is realized, and the detection limit of 3 fM is obtained. Besides, this method exhibits additional advantages of simplicity and low cost, since expensive and tedious labeling process is avoided. Therefore, the as-proposed label-free fluorescence strategy has great potential in the applications in miRNA-related clinical practices and biochemical researches. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Protein-binding RNA aptamers affect molecular interactions distantly from their binding sites.

    Directory of Open Access Journals (Sweden)

    Daniel M Dupont

    Full Text Available Nucleic acid aptamer selection is a powerful strategy for the development of regulatory agents for molecular intervention. Accordingly, aptamers have proven their diligence in the intervention with serine protease activities, which play important roles in physiology and pathophysiology. Nonetheless, there are only a few studies on the molecular basis underlying aptamer-protease interactions and the associated mechanisms of inhibition. In the present study, we use site-directed mutagenesis to delineate the binding sites of two 2´-fluoropyrimidine RNA aptamers (upanap-12 and upanap-126 with therapeutic potential, both binding to the serine protease urokinase-type plasminogen activator (uPA. We determine the subsequent impact of aptamer binding on the well-established molecular interactions (plasmin, PAI-1, uPAR, and LRP-1A controlling uPA activities. One of the aptamers (upanap-126 binds to the area around the C-terminal α-helix in pro-uPA, while the other aptamer (upanap-12 binds to both the β-hairpin of the growth factor domain and the kringle domain of uPA. Based on the mapping studies, combined with data from small-angle X-ray scattering analysis, we construct a model for the upanap-12:pro-uPA complex. The results suggest and highlight that the size and shape of an aptamer as well as the domain organization of a multi-domain protein such as uPA, may provide the basis for extensive sterical interference with protein ligand interactions considered distant from the aptamer binding site.

  13. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification.

    Science.gov (United States)

    Yu, Cong; Li, Lifu; Xie, Fei; Guo, Shichao; Liu, Fayuan; Dong, Nianguo; Wang, Yongjun

    2018-01-01

    Emerging evidence indicates that long non-coding RNAs (lncRNAs) play a vital role in cardiovascular physiology and pathology. Although the lncRNA TUG1 is implicated in atherosclerosis, its function in calcific aortic valve disease (CAVD) remains unknown. In this study, we found that TUG1 was highly expressed in human aortic valves and primary valve interstitial cells (VICs). Moreover, TUG1 knockdown induced inhibition of osteoblast differentiation in CAVD both in vitro and in vivo. Mechanistically, silencing of TUG1 increased the expression of miR-204-5p and subsequently inhibited Runx2 expression at the post-transcriptional level. Importantly, TUG1 directly interacted with miR-204-5p and downregulation of miR-204-5p efficiently reversed the suppression of Runx2 induced by TUG1 short hairpin RNA (shRNA). Thus, TUG1 positively regulated the expression of Runx2, through sponging miR-204-5p, and promoted osteogenic differentiation in CAVD. All together, the evidence generated by our study elucidates the role of lncRNA TUG1 as a miRNA sponge in CAVD, and sheds new light on lncRNA-directed diagnostics and therapeutics in CAVD. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2017. For permissions please email: journals.permissions@oup.com.

  14. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  15. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  16. Stabilization of the H,K-ATPase M5M6 membrane hairpin by K+ ions. Mechanistic significance for p2-type atpases.

    Science.gov (United States)

    Gatto, C; Lutsenko, S; Shin, J M; Sachs, G; Kaplan, J H

    1999-05-14

    The integral membrane protein, the gastric H,K-ATPase, is an alpha-beta heterodimer, with 10 putative transmembrane segments in the alpha-subunit and one such segment in the beta-subunit. All transmembrane segments remain within the membrane domain following trypsinization of the intact gastric H,K-ATPase in the presence of K+ ions, identified as M1M2, M3M4, M5M6, and M7, M8, M9, and M10. Removal of K+ ions from this digested preparation results in the selective loss of the M5M6 hairpin from the membrane. The release of the M5M6 fragment is directed to the extracellular phase as evidenced by the accumulation of the released M5M6 hairpin inside the sealed inside out vesicles. The stabilization of the M5M6 hairpin in the membrane phase by the transported cation as well as loss to the aqueous phase in the absence of the transported cation has been previously observed for another P2-type ATPase, the Na, K-ATPase (Lutsenko, S., Anderko, R., and Kaplan, J. H. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7936-7940). Thus, the effects of the counter-transported cation on retention of the M5M6 segment in the membrane as compared with the other membrane pairs may be a general feature of P2-ATPase ion pumps, reflecting a flexibility of this region that relates to the mechanism of transport.

  17. Molecular structure and thermodynamic predictions to create highly sensitive microRNA biosensors

    International Nuclear Information System (INIS)

    Larkey, Nicholas E.; Brucks, Corinne N.; Lansing, Shan S.; Le, Sophia D.; Smith, Natasha M.; Tran, Victoria; Zhang, Lulu; Burrows, Sean M.

    2016-01-01

    Many studies have established microRNAs (miRNAs) as post-transcriptional regulators in a variety of intracellular molecular processes. Abnormal changes in miRNA have been associated with several diseases. However, these changes are sometimes subtle and occur at nanomolar levels or lower. Several biosensing hurdles for in situ cellular/tissue analysis of miRNA limit detection of small amounts of miRNA. Of these limitations the most challenging are selectivity and sensor degradation creating high background signals and false signals. Recently we developed a reporter+probe biosensor for let-7a that showed potential to mitigate false signal from sensor degradation. Here we designed reporter+probe biosensors for miR-26a-2-3p and miR-27a-5p to better understand the effect of thermodynamics and molecular structures of the biosensor constituents on the analytical performance. Signal changes from interactions between Cy3 and Cy5 on the reporters were used to understand structural aspects of the reporter designs. Theoretical thermodynamic values, single stranded conformations, hetero- and homodimerization structures, and equilibrium concentrations of the reporters and probes were used to interpret the experimental observations. Studies of the sensitivity and selectivity revealed 5–9 nM detection limits in the presence and absence of interfering off-analyte miRNAs. These studies will aid in determining how to rationally design reporter+probe biosensors to overcome hurdles associated with highly sensitive miRNA biosensing. - Highlights: • Challenges facing highly sensitive miRNA biosensor designs are addressed. • Thermodynamic and molecular structure design metrics for reporter+probe biosensors are proposed. • The influence of ideal and non-ideal reporter hairpin structures on reporter+probe formation and signal change are discussed. • 5–9 nM limits of detection were observed with no interference from off-analytes.

  18. Molecular structure and thermodynamic predictions to create highly sensitive microRNA biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Larkey, Nicholas E.; Brucks, Corinne N.; Lansing, Shan S.; Le, Sophia D.; Smith, Natasha M.; Tran, Victoria; Zhang, Lulu; Burrows, Sean M., E-mail: sean.burrows@oregonstate.edu

    2016-02-25

    Many studies have established microRNAs (miRNAs) as post-transcriptional regulators in a variety of intracellular molecular processes. Abnormal changes in miRNA have been associated with several diseases. However, these changes are sometimes subtle and occur at nanomolar levels or lower. Several biosensing hurdles for in situ cellular/tissue analysis of miRNA limit detection of small amounts of miRNA. Of these limitations the most challenging are selectivity and sensor degradation creating high background signals and false signals. Recently we developed a reporter+probe biosensor for let-7a that showed potential to mitigate false signal from sensor degradation. Here we designed reporter+probe biosensors for miR-26a-2-3p and miR-27a-5p to better understand the effect of thermodynamics and molecular structures of the biosensor constituents on the analytical performance. Signal changes from interactions between Cy3 and Cy5 on the reporters were used to understand structural aspects of the reporter designs. Theoretical thermodynamic values, single stranded conformations, hetero- and homodimerization structures, and equilibrium concentrations of the reporters and probes were used to interpret the experimental observations. Studies of the sensitivity and selectivity revealed 5–9 nM detection limits in the presence and absence of interfering off-analyte miRNAs. These studies will aid in determining how to rationally design reporter+probe biosensors to overcome hurdles associated with highly sensitive miRNA biosensing. - Highlights: • Challenges facing highly sensitive miRNA biosensor designs are addressed. • Thermodynamic and molecular structure design metrics for reporter+probe biosensors are proposed. • The influence of ideal and non-ideal reporter hairpin structures on reporter+probe formation and signal change are discussed. • 5–9 nM limits of detection were observed with no interference from off-analytes.

  19. Binding, folding and insertion of a β-hairpin peptide at a lipid bilayer surface: Influence of electrostatics and lipid tail packing.

    Science.gov (United States)

    Reid, Keon A; Davis, Caitlin M; Dyer, R Brian; Kindt, James T

    2018-03-01

    Antimicrobial peptides (AMPs) act as host defenses against microbial pathogens. Here we investigate the interactions of SVS-1 (KVKVKVKV d P l PTKVKVKVK), an engineered AMP and anti-cancer β-hairpin peptide, with lipid bilayers using spectroscopic studies and atomistic molecular dynamics simulations. In agreement with literature reports, simulation and experiment show preferential binding of SVS-1 peptides to anionic over neutral bilayers. Fluorescence and circular dichroism studies of a Trp-substituted SVS-1 analogue indicate, however, that it will bind to a zwitterionic DPPC bilayer under high-curvature conditions and folds into a hairpin. In bilayers formed from a 1:1 mixture of DPPC and anionic DPPG lipids, curvature and lipid fluidity are also observed to promote deeper insertion of the fluorescent peptide. Simulations using the CHARMM C36m force field offer complementary insight into timescales and mechanisms of folding and insertion. SVS-1 simulated at an anionic mixed POPC/POPG bilayer folded into a hairpin over a microsecond, the final stage in folding coinciding with the establishment of contact between the peptide's valine sidechains and the lipid tails through a "flip and dip" mechanism. Partial, transient folding and superficial bilayer contact are seen in simulation of the peptide at a zwitterionic POPC bilayer. Only when external surface tension is applied does the peptide establish lasting contact with the POPC bilayer. Our findings reveal the influence of disruption to lipid headgroup packing (via curvature or surface tension) on the pathway of binding and insertion, highlighting the collaborative effort of electrostatic and hydrophobic interactions on interaction of SVS-1 with lipid bilayers. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The art of editing RNA structural alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth

    2014-01-01

    Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious, it is re......Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious...

  1. Characterization of the TRBP domain required for Dicer interaction and function in RNA interference

    Directory of Open Access Journals (Sweden)

    El Far Mohamed

    2009-05-01

    Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.

  2. Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

    Science.gov (United States)

    Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

    2012-10-31

    Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

  3. RNA and RNP as Building Blocks for Nanotechnology and Synthetic Biology.

    Science.gov (United States)

    Ohno, Hirohisa; Saito, Hirohide

    2016-01-01

    Recent technologies that aimed to elucidate cellular function have revealed essential roles for RNA molecules in living systems. Our knowledge concerning functional and structural information of naturally occurring RNA and RNA-protein (RNP) complexes is increasing rapidly. RNA and RNP interaction motifs are structural units that function as building blocks to constitute variety of complex structures. RNA-central synthetic biology and nanotechnology are constructive approaches that employ the accumulated information and build synthetic RNA (RNP)-based circuits and nanostructures. Here, we describe how to design and construct synthetic RNA (RNP)-based devices and structures at the nanometer-scale for biological and future therapeutic applications. RNA/RNP nanostructures can also be utilized as the molecular scaffold to control the localization or interactions of target molecule(s). Moreover, RNA motifs recognized by RNA-binding proteins can be applied to make protein-responsive translational "switches" that can turn gene expression "on" or "off" depending on the intracellular environment. This "synthetic RNA and RNP world" will expand tools for nanotechnology and synthetic biology. In addition, these reconstructive approaches would lead to a greater understanding of building principle in naturally occurring RNA/RNP molecules and systems. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Expanding the peptide beta-turn in alphagamma hybrid sequences: 12 atom hydrogen bonded helical and hairpin turns.

    Science.gov (United States)

    Chatterjee, Sunanda; Vasudev, Prema G; Raghothama, Srinivasarao; Ramakrishnan, Chandrasekharan; Shamala, Narayanaswamy; Balaram, Padmanabhan

    2009-04-29

    Hybrid peptide segments containing contiguous alpha and gamma amino acid residues can form C(12) hydrogen bonded turns which may be considered as backbone expanded analogues of C(10) (beta-turns) found in alphaalpha segments. Exploration of the regular hydrogen bonded conformations accessible for hybrid alphagamma sequences is facilitated by the use of a stereochemically constrained gamma amino acid residue gabapentin (1-aminomethylcyclohexaneacetic acid, Gpn), in which the two torsion angles about C(gamma)-C(beta) (theta(1)) and C(beta)-C(alpha) (theta(2)) are predominantly restricted to gauche conformations. The crystal structures of the octapeptides Boc-Gpn-Aib-Gpn-Aib-Gpn-Aib-Gpn-Aib-OMe (1) and Boc-Leu-Phe-Val-Aib-Gpn-Leu-Phe-Val-OMe (2) reveal two distinct conformations for the Aib-Gpn segment. Peptide 1 forms a continuous helix over the Aib(2)-Aib(6) segment, while the peptide 2 forms a beta-hairpin structure stabilized by four cross-strand hydrogen bonds with the Aib-Gpn segment forming a nonhelical C(12) turn. The robustness of the helix in peptide 1 in solution is demonstrated by NMR methods. Peptide 2 is conformationally fragile in solution with evidence of beta-hairpin conformations being obtained in methanol. Theoretical calculations permit delineation of the various C(12) hydrogen bonded structures which are energetically feasible in alphagamma and gammaalpha sequences.

  5. Primordial soup or vinaigrette: did the RNA world evolve at acidic pH?

    Directory of Open Access Journals (Sweden)

    Bernhardt Harold S

    2012-01-01

    Full Text Available Abstract Background The RNA world concept has wide, though certainly not unanimous, support within the origin-of-life scientific community. One view is that life may have emerged as early as the Hadean Eon 4.3-3.8 billion years ago with an atmosphere of high CO2 producing an acidic ocean of the order of pH 3.5-6. Compatible with this scenario is the intriguing proposal that life arose within alkaline (pH 9-11 deep-sea hydrothermal vents like those of the 'Lost City', with the interface with the acidic ocean creating a proton gradient sufficient to drive the first metabolism. However, RNA is most stable at pH 4-5 and is unstable at alkaline pH, raising the possibility that RNA may have first arisen in the acidic ocean itself (possibly near an acidic hydrothermal vent, acidic volcanic lake or comet pond. As the Hadean Eon progressed, the ocean pH is inferred to have gradually risen to near neutral as atmospheric CO2 levels decreased. Presentation of the hypothesis We propose that RNA is well suited for a world evolving at acidic pH. This is supported by the enhanced stability at acidic pH of not only the RNA phosphodiester bond but also of the aminoacyl-(tRNA and peptide bonds. Examples of in vitro-selected ribozymes with activities at acid pH have recently been documented. The subsequent transition to a DNA genome could have been partly driven by the gradual rise in ocean pH, since DNA has greater stability than RNA at alkaline pH, but not at acidic pH. Testing the hypothesis We have proposed mechanisms for two key RNA world activities that are compatible with an acidic milieu: (i non-enzymatic RNA replication of a hemi-protonated cytosine-rich oligonucleotide, and (ii specific aminoacylation of tRNA/hairpins through triple helix interactions between the helical aminoacyl stem and a single-stranded aminoacylating ribozyme. Implications of the hypothesis Our hypothesis casts doubt on the hypothesis that RNA evolved in the vicinity of alkaline

  6. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  7. Phe783, Thr797, and Asp804 in transmembrane hairpin M5-M6 of Na+,K+-ATPase play a key role in ouabain binding.

    Science.gov (United States)

    Qiu, Li Yan; Koenderink, Jan B; Swarts, Herman G P; Willems, Peter H G M; De Pont, Jan Joep H H M

    2003-11-21

    Ouabain is a glycoside that binds to and inhibits the action of Na+,K+-ATPase. Little is known, however, about the specific requirements of the protein surface for glycoside binding. Using chimeras of gastric H+,K+-ATPase and Na+,K+-ATPase, we demonstrated previously that the combined presence of transmembrane hairpins M3-M4 and M5-M6 of Na+,K+-ATPase in a backbone of H+,K+-ATPase (HN34/56) is both required and sufficient for high affinity ouabain binding. Since replacement of transmembrane hairpin M3-M4 by the N terminus up to transmembrane segment 3 (HNN3/56) resulted in a low affinity ouabain binding, hairpin M5-M6 seems to be essential for ouabain binding. To assess which residues of M5-M6 are required for ouabain action, we divided this transmembrane hairpin in seven parts and individually replaced these parts by the corresponding sequences of H+,K+-ATPase in chimera HN34/56. Three of these chimeras failed to bind ouabain following expression in Xenopus laevis oocytes. Altogether, these three chimeras contained 7 amino acids that were specific for Na+,K+-ATPase. Individual replacement of these 7 amino acids by the corresponding amino acids in H+,K+-ATPase revealed a dramatic loss of ouabain binding for F783Y, T797C, and D804E. As a proof of principle, the Na+,K+-ATPase equivalents of these 3 amino acids were introduced in different combinations in chimera HN34. The presence of all 3 amino acids appeared to be required for ouabain action. Docking of ouabain onto a three-dimensional-model of Na+,K+-ATPase suggests that Asp804, in contrast to Phe783 and Thr797, does not actually form part of the ouabain-binding pocket. Most likely, the presence of this amino acid is required for adopting of the proper conformation for ouabain binding.

  8. An O(n(5)) algorithm for MFE prediction of kissing hairpins and 4-chains in nucleic acids.

    Science.gov (United States)

    Chen, Ho-Lin; Condon, Anne; Jabbari, Hosna

    2009-06-01

    Efficient methods for prediction of minimum free energy (MFE) nucleic secondary structures are widely used, both to better understand structure and function of biological RNAs and to design novel nano-structures. Here, we present a new algorithm for MFE secondary structure prediction, which significantly expands the class of structures that can be handled in O(n(5)) time. Our algorithm can handle H-type pseudoknotted structures, kissing hairpins, and chains of four overlapping stems, as well as nested substructures of these types.

  9. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  10. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  11. The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression

    Directory of Open Access Journals (Sweden)

    Linna Lu

    2017-01-01

    Full Text Available Increasing evidence suggests that aberrant long non-coding RNAs (lncRNAs are significantly correlated with the pathogenesis, development and metastasis of cancers. RHPN1 antisense RNA 1 (RHPN1-AS1 is a 2030-bp transcript originating from human chromosome 8q24. However, the role of RHPN1-AS1 in uveal melanoma (UM remains to be clarified. In this study, we aimed to elucidate the molecular function of RHPN1-AS1 in UM. The RNA levels of RHPN1-AS1 in UM cell lines were examined using the quantitative real-time polymerase chain reaction (qRT-PCR. Short interfering RNAs (siRNAs were designed to quench RHPN1-AS1 expression, and UM cells stably expressing short hairpin (sh RHPN1-AS1 were established. Next, the cell proliferation and migration abilities were determined using a colony formation assay and a transwell migration/invasion assay. A tumor xenograft model in nude mice was established to confirm the function of RHPN1-AS1 in vivo. RHPN1-AS1 was significantly upregulated in a number of UM cell lines compared with the normal human retinal pigment epithelium (RPE cell line. RHPN1-AS1 knockdown significantly inhibited UM cell proliferation and migration in vitro and in vivo. Our data suggest that RHPN1-AS1 could be an oncoRNA in UM, which may serve as a candidate prognostic biomarker and target for new therapies in malignant UM.

  12. MicroRNA 107 partly inhibits endothelial progenitor cells differentiation via HIF-1β.

    Directory of Open Access Journals (Sweden)

    Shu Meng

    Full Text Available Endothelial progenitor cells (EPCs play an important role in tissue repair after ischemic heart disease. In particular, the recovery of endothelial function is reliant on the ability and rate of EPCs differentiate into mature endothelial cells. The present study evaluated the effect of microRNA 107 (miR-107 on the mechanism of EPCs differentiation. EPCs were isolated from rats' bone marrow and miR-107 expression of EPCs in hypoxic and normoxic conditions were measured by real-time qualitative PCR. CD31 was analyzed by flow cytometry and eNOS was examined by real-time qualitative PCR and western blotting and these were used as markers of EPC differentiation. In order to reveal the mechanism, we used miR107 inhibitor and lentiviral vector expressing a short hairpin RNA (shRNA that targets miR-107 and hypoxia-inducible factor-1 β (HIF-1β to alter miR107 and HIF-1β expression. MiR-107 expression were increased in EPCs under hypoxic conditions. Up-regulation of miR-107 partly suppressed the EPCs differentiation induced in hypoxia, while down-regulation of miR-107 promoted EPC differentiation. HIF-1β was the target. This study indicated that miR-107 was up-regulated in hypoxia to prevent EPCs differentiation via its target HIF-1β. The physiological mechanisms of miR-107 must be evaluated if it is to be used as a potential anti-ischemia therapeutic regime.

  13. Agrobacterium-mediated transformation of grapefruit with the wild-type and mutant RNA-dependent RNA polymerase genes of Citrus tristeza virus

    Science.gov (United States)

    Citrus paradisi Macf. cv. Duncan was transformed with constructs coding for the wild-type and mutant RNA-dependent RNA polymerase (RdRp) of Citrus tristeza virus (CTV) for exploring replicase-mediated pathogen-derived resistance (RM-PDR). The RdRp gene was amplified from CTV genome and used to gener...

  14. Phosphorylation of eIF2α is required for mRNA translation inhibition and survival during moderate hypoxia

    International Nuclear Information System (INIS)

    Koritzinsky, Marianne; Rouschop, Kasper M.A.; Beucken, Twan van den; Magagnin, Michael G.; Savelkouls, Kim; Lambin, Philippe; Wouters, Bradly G.

    2007-01-01

    Abstracts: Background and purpose: Human tumors are characterized by temporal fluctuations in oxygen tension. The biological pathways that respond to the dynamic tumor microenvironment represent potential molecular targets for cancer therapy. Anoxic conditions result in eIF2α dependent inhibition of overall mRNA translation, differential gene expression, hypoxia tolerance and tumor growth. The signaling pathway which governs eIF2α phosphorylation has therefore emerged as a potential molecular target. In this study, we investigated the role of eIF2α in regulating mRNA translation and hypoxia tolerance during moderate hypoxia. Since other molecular pathways that regulate protein synthesis are frequently mutated in cancer, we also assessed mRNA translation in a panel of cell lines from different origins. Materials and methods: Immortalized human fibroblast, transformed mouse embryo fibroblasts (MEFs) and cells from six cancer cell lines were exposed to 0.2% or 0.0% oxygen. We assayed global mRNA translation efficiency by polysome analysis, as well as proliferation and clonogenic survival. The role of eIF2α was assessed in MEFs harboring a homozygous inactivating mutation (S51A) as well as in U373-MG cells overexpressing GADD34 (C-term) under a tetracycline-dependent promoter. The involvement of eIF4E regulation was investigated in HeLa cells stably expressing a short hairpin RNA (shRNA) targeting 4E-BP1. Results: All cells investigated inhibited mRNA translation severely in response to anoxia and modestly in response to hypoxia. Two independent genetic cell models demonstrated that inhibition of mRNA translation in response to moderate hypoxia was dependent on eIF2α phosphorylation. Disruption of eIF2α phosphorylation caused sensitivity to hypoxia and anoxia. Conclusions: Disruption of eIF2α phosphorylation is a potential target for hypoxia-directed molecular cancer therapy

  15. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    Science.gov (United States)

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  16. Rapid NMR screening of RNA secondary structure and binding

    International Nuclear Information System (INIS)

    Helmling, Christina; Keyhani, Sara; Sochor, Florian; Fürtig, Boris; Hengesbach, Martin; Schwalbe, Harald

    2015-01-01

    Determination of RNA secondary structures by NMR spectroscopy is a useful tool e.g. to elucidate RNA folding space or functional aspects of regulatory RNA elements. However, current approaches of RNA synthesis and preparation are usually time-consuming and do not provide analysis with single nucleotide precision when applied for a large number of different RNA sequences. Here, we significantly improve the yield and 3′ end homogeneity of RNA preparation by in vitro transcription. Further, by establishing a native purification procedure with increased throughput, we provide a shortcut to study several RNA constructs simultaneously. We show that this approach yields μmol quantities of RNA with purities comparable to PAGE purification, while avoiding denaturation of the RNA

  17. Rapid NMR screening of RNA secondary structure and binding

    Energy Technology Data Exchange (ETDEWEB)

    Helmling, Christina; Keyhani, Sara; Sochor, Florian; Fürtig, Boris; Hengesbach, Martin; Schwalbe, Harald, E-mail: schwalbe@nmr.uni-frankfurt.de [Johann Wolfgang Goethe-Universität, Institut für Organische Chemie und Chemische Biologie, Center for Biomolecular Magnetic Resonance (BMRZ) (Germany)

    2015-09-15

    Determination of RNA secondary structures by NMR spectroscopy is a useful tool e.g. to elucidate RNA folding space or functional aspects of regulatory RNA elements. However, current approaches of RNA synthesis and preparation are usually time-consuming and do not provide analysis with single nucleotide precision when applied for a large number of different RNA sequences. Here, we significantly improve the yield and 3′ end homogeneity of RNA preparation by in vitro transcription. Further, by establishing a native purification procedure with increased throughput, we provide a shortcut to study several RNA constructs simultaneously. We show that this approach yields μmol quantities of RNA with purities comparable to PAGE purification, while avoiding denaturation of the RNA.

  18. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    Science.gov (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  19. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  20. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    International Nuclear Information System (INIS)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh; Finley, Natosha L.

    2014-01-01

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R h ) and reduced thermal stability in the mutant complex. Taken together

  1. Mutation in the β-hairpin of the Bordetella pertussis adenylate cyclase toxin modulates N-lobe conformation in calmodulin

    Energy Technology Data Exchange (ETDEWEB)

    Springer, Tzvia I.; Goebel, Erich; Hariraju, Dinesh [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Finley, Natosha L., E-mail: finleynl@miamioh.edu [Department of Microbiology, Miami University, Oxford, OH 45056 (United States); Cell, Molecular, and Structural Biology Program, Miami University, Oxford, OH 45056 (United States)

    2014-10-10

    Highlights: • Bordetella pertussis adenylate cyclase toxin modulates bi-lobal structure of CaM. • The structure and stability of the complex rely on intermolecular associations. • A novel mode of CaM-dependent activation of the adenylate cyclase toxin is proposed. - Abstract: Bordetella pertussis, causative agent of whooping cough, produces an adenylate cyclase toxin (CyaA) that is an important virulence factor. In the host cell, the adenylate cyclase domain of CyaA (CyaA-ACD) is activated upon association with calmodulin (CaM), an EF-hand protein comprised of N- and C-lobes (N-CaM and C-CaM, respectively) connected by a flexible tether. Maximal CyaA-ACD activation is achieved through its binding to both lobes of intact CaM, but the structural mechanisms remain unclear. No high-resolution structure of the intact CaM/CyaA-ACD complex is available, but crystal structures of isolated C-CaM bound to CyaA-ACD shed light on the molecular mechanism by which this lobe activates the toxin. Previous studies using molecular modeling, biochemical, and biophysical experiments demonstrate that CyaA-ACD’s β-hairpin participates in site-specific interactions with N-CaM. In this study, we utilize nuclear magnetic resonance (NMR) spectroscopy to probe the molecular association between intact CaM and CyaA-ACD. Our results indicate binding of CyaA-ACD to CaM induces large conformational perturbations mapping to C-CaM, while substantially smaller structural changes are localized primarily to helices I, II, and IV, and the metal-binding sites in N-CaM. Site-specific mutations in CyaA-ACD’s β-hairpin structurally modulate N-CaM, resulting in conformational perturbations in metal binding sites I and II, while no significant structural modifications are observed in C-CaM. Moreover, dynamic light scattering (DLS) analysis reveals that mutation of the β-hairpin results in a decreased hydrodynamic radius (R{sub h}) and reduced thermal stability in the mutant complex. Taken

  2. MicroRNAs in Amoebozoa: deep sequencing of the small RNA population in the social amoeba Dictyostelium discoideum reveals developmentally regulated microRNAs.

    Science.gov (United States)

    Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik

    2012-10-01

    The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.

  3. Nuclear targeting by fragmentation of the Potato spindle tuber viroid genome

    International Nuclear Information System (INIS)

    Abraitiene, Asta; Zhao Yan; Hammond, Rosemarie

    2008-01-01

    Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequent GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus

  4. A single-stranded architecture for cotranscriptional folding of RNA nanostructures

    DEFF Research Database (Denmark)

    Geary, Cody; Rothemund, Paul; Andersen, Ebbe Sloth

    2014-01-01

    Artificial DNA and RNA structures have been used as scaffolds for a variety of nanoscale devices. In comparison to DNA structures, RNA structures have been limited in size, but they also have advantages: RNA can fold during transcription and thus can be genetically encoded and expressed in cells....... We introduce an architecture for designing artificial RNA structures that fold from a single strand, in which arrays of antiparallel RNA helices are precisely organized by RNA tertiary motifs and a new type of crossover pattern. We constructed RNA tiles that assemble into hexagonal lattices...

  5. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

    Science.gov (United States)

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

    2016-07-08

    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  6. Stabilization of the beta-hairpin in Mason-Pfizer monkey virus capsid protein- a critical step for infectivity

    Czech Academy of Sciences Publication Activity Database

    Obr, M.; Hadravová, Romana; Doležal, Michal; Křížová, Ivana; Papoušková, V.; Žídek, L.; Hrabal, R.; Ruml, T.; Rumlová, Michaela

    2014-01-01

    Roč. 11, Oct 30 (2014), 94/1-94/14 ISSN 1742-4690 R&D Projects: GA ČR(CZ) GA14-15326S; GA MŠk LO1302 Grant - others:GA MŠk(CZ) ED1.1.00/02.0068; Seventh Framework Programme of the European Union(XE) FP7-261863 Program:ED Institutional support: RVO:61388963 Keywords : retrovirus * assembly * M-PMV * capsid protein * maturation * beta-hairpin Subject RIV: EE - Microbiology, Virology Impact factor: 4.185, year: 2014 http://www.retrovirology.com/content/11/1/94

  7. Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

  8. Combinatorial pattern discovery approach for the folding trajectory analysis of a beta-hairpin.

    Directory of Open Access Journals (Sweden)

    Laxmi Parida

    2005-06-01

    Full Text Available The study of protein folding mechanisms continues to be one of the most challenging problems in computational biology. Currently, the protein folding mechanism is often characterized by calculating the free energy landscape versus various reaction coordinates, such as the fraction of native contacts, the radius of gyration, RMSD from the native structure, and so on. In this paper, we present a combinatorial pattern discovery approach toward understanding the global state changes during the folding process. This is a first step toward an unsupervised (and perhaps eventually automated approach toward identification of global states. The approach is based on computing biclusters (or patterned clusters-each cluster is a combination of various reaction coordinates, and its signature pattern facilitates the computation of the Z-score for the cluster. For this discovery process, we present an algorithm of time complexity c in RO((N + nm log n, where N is the size of the output patterns and (n x m is the size of the input with n time frames and m reaction coordinates. To date, this is the best time complexity for this problem. We next apply this to a beta-hairpin folding trajectory and demonstrate that this approach extracts crucial information about protein folding intermediate states and mechanism. We make three observations about the approach: (1 The method recovers states previously obtained by visually analyzing free energy surfaces. (2 It also succeeds in extracting meaningful patterns and structures that had been overlooked in previous works, which provides a better understanding of the folding mechanism of the beta-hairpin. These new patterns also interconnect various states in existing free energy surfaces versus different reaction coordinates. (3 The approach does not require calculating the free energy values, yet it offers an analysis comparable to, and sometimes better than, the methods that use free energy landscapes, thus validating the

  9. Combinatorial Pattern Discovery Approach for the Folding Trajectory Analysis of a beta-Hairpin.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available The study of protein folding mechanisms continues to be one of the most challenging problems in computational biology. Currently, the protein folding mechanism is often characterized by calculating the free energy landscape versus various reaction coordinates, such as the fraction of native contacts, the radius of gyration, RMSD from the native structure, and so on. In this paper, we present a combinatorial pattern discovery approach toward understanding the global state changes during the folding process. This is a first step toward an unsupervised (and perhaps eventually automated approach toward identification of global states. The approach is based on computing biclusters (or patterned clusters-each cluster is a combination of various reaction coordinates, and its signature pattern facilitates the computation of the Z-score for the cluster. For this discovery process, we present an algorithm of time complexity cinRO((N + nm log n, where N is the size of the output patterns and (n x m is the size of the input with n time frames and m reaction coordinates. To date, this is the best time complexity for this problem. We next apply this to a beta-hairpin folding trajectory and demonstrate that this approach extracts crucial information about protein folding intermediate states and mechanism. We make three observations about the approach: (1 The method recovers states previously obtained by visually analyzing free energy surfaces. (2 It also succeeds in extracting meaningful patterns and structures that had been overlooked in previous works, which provides a better understanding of the folding mechanism of the beta-hairpin. These new patterns also interconnect various states in existing free energy surfaces versus different reaction coordinates. (3 The approach does not require calculating the free energy values, yet it offers an analysis comparable to, and sometimes better than, the methods that use free energy landscapes, thus validating the

  10. Multiple Regression Analysis of mRNA-miRNA Associations in Colorectal Cancer Pathway

    Science.gov (United States)

    Wang, Fengfeng; Wong, S. C. Cesar; Chan, Lawrence W. C.; Cho, William C. S.; Yip, S. P.; Yung, Benjamin Y. M.

    2014-01-01

    Background. MicroRNA (miRNA) is a short and endogenous RNA molecule that regulates posttranscriptional gene expression. It is an important factor for tumorigenesis of colorectal cancer (CRC), and a potential biomarker for diagnosis, prognosis, and therapy of CRC. Our objective is to identify the related miRNAs and their associations with genes frequently involved in CRC microsatellite instability (MSI) and chromosomal instability (CIN) signaling pathways. Results. A regression model was adopted to identify the significantly associated miRNAs targeting a set of candidate genes frequently involved in colorectal cancer MSI and CIN pathways. Multiple linear regression analysis was used to construct the model and find the significant mRNA-miRNA associations. We identified three significantly associated mRNA-miRNA pairs: BCL2 was positively associated with miR-16 and SMAD4 was positively associated with miR-567 in the CRC tissue, while MSH6 was positively associated with miR-142-5p in the normal tissue. As for the whole model, BCL2 and SMAD4 models were not significant, and MSH6 model was significant. The significant associations were different in the normal and the CRC tissues. Conclusion. Our results have laid down a solid foundation in exploration of novel CRC mechanisms, and identification of miRNA roles as oncomirs or tumor suppressor mirs in CRC. PMID:24895601

  11. On topological RNA interaction structures.

    Science.gov (United States)

    Qin, Jing; Reidys, Christian M

    2013-07-01

    Recently a folding algorithm of topological RNA pseudoknot structures was presented in Reidys et al. (2011). This algorithm folds single-stranded γ-structures, that is, RNA structures composed by distinct motifs of bounded topological genus. In this article, we set the theoretical foundations for the folding of the two backbone analogues of γ structures: the RNA γ-interaction structures. These are RNA-RNA interaction structures that are constructed by a finite number of building blocks over two backbones having genus at most γ. Combinatorial properties of γ-interaction structures are of practical interest since they have direct implications for the folding of topological interaction structures. We compute the generating function of γ-interaction structures and show that it is algebraic, which implies that the numbers of interaction structures can be computed recursively. We obtain simple asymptotic formulas for 0- and 1-interaction structures. The simplest class of interaction structures are the 0-interaction structures, which represent the two backbone analogues of secondary structures.

  12. Unique small RNA signatures uncovered in the tammar wallaby genome

    Directory of Open Access Journals (Sweden)

    Lindsay James

    2012-10-01

    Full Text Available Abstract Background Small RNAs have proven to be essential regulatory molecules encoded within eukaryotic genomes. These short RNAs participate in a diverse array of cellular processes including gene regulation, chromatin dynamics and genome defense. The tammar wallaby, a marsupial mammal, is a powerful comparative model for studying the evolution of regulatory networks. As part of the genome sequencing initiative for the tammar, we have explored the evolution of each of the major classes of mammalian small RNAs in an Australian marsupial for the first time, including the first genome-scale analysis of the newest class of small RNAs, centromere repeat associated short interacting RNAs (crasiRNAs. Results Using next generation sequencing, we have characterized the major classes of small RNAs, micro (mi RNAs, piwi interacting (pi RNAs, and the centromere repeat associated short interacting (crasi RNAs in the tammar. We examined each of these small RNA classes with respect to the newly assembled tammar wallaby genome for gene and repeat features, salient features that define their canonical sequences, and the constitution of both highly conserved and species-specific members. Using a combination of miRNA hairpin predictions and co-mapping with miRBase entries, we identified a highly conserved cluster of miRNA genes on the X chromosome in the tammar and a total of 94 other predicted miRNA producing genes. Mapping all miRNAs to the tammar genome and comparing target genes among tammar, mouse and human, we identified 163 conserved target genes. An additional nine genes were identified in tammar that do not have an orthologous miRNA target in human and likely represent novel miRNA-regulated genes in the tammar. A survey of the tammar gonadal piRNAs shows that these small RNAs are enriched in retroelements and carry members from both marsupial and tammar-specific repeat classes. Lastly, this study includes the first in-depth analyses of the newly

  13. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    Science.gov (United States)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  14. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  15. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    Science.gov (United States)

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  16. Stability of monomeric Cro variants: Isoenergetic transformation of a type I' to a type II' beta-hairpin by single amino acid replacements.

    Science.gov (United States)

    Mollah, A K M M; Stennis, Rhonda L; Mossing, Michael C

    2003-05-01

    The thermodynamic stabilities of three monomeric variants of the bacteriophage lambda Cro repressor that differ only in the sequence of two amino acids at the apex of an engineered beta-hairpin have been determined. The sequences of the turns are EVK-XX-EVK, where the two central residues are DG, GG, and GT, respectively. Standard-state unfolding free energies, determined from circular dichroism measurements as a function of urea concentration, range from 2.4 to 2.7 kcal/mole, while those determined from guanidine hydrochloride range from 2.8 to 3.3 kcal/mole for the three proteins. Thermal denaturation yields van't Hoff unfolding enthalpies of 36 to 40 kcal /mole at midpoint temperatures in the range of 53 to 58 degrees C. Extrapolation of the thermal denaturation free energies with heat capacities of 400 to 600 cal/mole deg gives good agreement with the parameters determined in denaturant titrations. As predicted from statistical surveys of amino acid replacements in beta-hairpins, energetic barriers to transformation from a type I' turn (DG) to a type II' turn (GT) can be quite small.

  17. Deletions in cox2 mRNA result in loss of splicing and RNA editing and gain of novel RNA editing sites.

    Directory of Open Access Journals (Sweden)

    Stefanie Grüttner

    Full Text Available As previously demonstrated, the maize cox2 RNA is fully edited in cauliflower mitochondria. Use of constructs with a deleted cox2 intron, however, led to a loss of RNA editing at almost all editing sites, with only a few sites still partially edited. Likewise, one deletion in exon 1 and three in exon 2 abolish RNA editing at all cox2 sites analyzed. Furthermore, intron splicing is abolished using these deletions. Mutation of a cytosine residue, which is normally edited and localized directly adjacent to the intron, to thymidine did not result in restoration of splicing, indicating that the loss of splicing was not due to loss of RNA editing. One deletion in exon 2 did not lead to loss of splicing. Instead, most editing sites were found to be edited, only three were not edited. Unexpectedly, we observed additional RNA editing events at new sites. Thus it appears that deletions in the cox2 RNA sequence can have a strong effect on RNA processing, leading to loss of splicing, loss of editing at all sites, or even to a gain of new editing sites. As these effects are not limited to the vicinity of the respective deletions, but appear to be widespread or even affect all editing sites, they may not be explained by the loss of PPR binding sites. Instead, it appears that several parts of the cox2 transcript are required for proper RNA processing. This indicates the roles of the RNA sequence and structural elements in the recognition of the editing sites.

  18. Engineering a Functional Small RNA Negative Autoregulation Network with Model-Guided Design.

    Science.gov (United States)

    Hu, Chelsea Y; Takahashi, Melissa K; Zhang, Yan; Lucks, Julius B

    2018-05-22

    RNA regulators are powerful components of the synthetic biology toolbox. Here, we expand the repertoire of synthetic gene networks built from these regulators by constructing a transcriptional negative autoregulation (NAR) network out of small RNAs (sRNAs). NAR network motifs are core motifs of natural genetic networks, and are known for reducing network response time and steady state signal. Here we use cell-free transcription-translation (TX-TL) reactions and a computational model to design and prototype sRNA NAR constructs. Using parameter sensitivity analysis, we design a simple set of experiments that allow us to accurately predict NAR function in TX-TL. We transfer successful network designs into Escherichia coli and show that our sRNA transcriptional network reduces both network response time and steady-state gene expression. This work broadens our ability to construct increasingly sophisticated RNA genetic networks with predictable function.

  19. Non-Target Effects of Green Fluorescent Protein (GFP-Derived Double-Stranded RNA (dsRNA-GFP Used in Honey Bee RNA Interference (RNAi Assays

    Directory of Open Access Journals (Sweden)

    Francis M. F. Nunes

    2013-01-01

    Full Text Available RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP-derived double-stranded RNA (dsRNA-GFP is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  20. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

    Science.gov (United States)

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

    2013-01-04

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  1. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  2. A multiplexed miRNA and transgene expression platform for simultaneous repression and expression of protein coding sequences.

    Science.gov (United States)

    Seyhan, Attila A

    2016-01-01

    Knockdown of single or multiple gene targets by RNA interference (RNAi) is necessary to overcome escape mutants or isoform redundancy. It is also necessary to use multiple RNAi reagents to knockdown multiple targets. It is also desirable to express a transgene or positive regulatory elements and inhibit a target gene in a coordinated fashion. This study reports a flexible multiplexed RNAi and transgene platform using endogenous intronic primary microRNAs (pri-miRNAs) as a scaffold located in the green fluorescent protein (GFP) as a model for any functional transgene. The multiplexed intronic miRNA - GFP transgene platform was designed to co-express multiple small RNAs within the polycistronic cluster from a Pol II promoter at more moderate levels to reduce potential vector toxicity. The native intronic miRNAs are co-transcribed with a precursor GFP mRNA as a single transcript and presumably cleaved out of the precursor-(pre) mRNA by the RNA splicing machinery, spliceosome. The spliced intron with miRNA hairpins will be further processed into mature miRNAs or small interfering RNAs (siRNAs) capable of triggering RNAi effects, while the ligated exons become a mature messenger RNA for the translation of the functional GFP protein. Data show that this approach led to robust RNAi-mediated silencing of multiple Renilla Luciferase (R-Luc)-tagged target genes and coordinated expression of functional GFP from a single transcript in transiently transfected HeLa cells. The results demonstrated that this design facilitates the coordinated expression of all mature miRNAs either as individual miRNAs or as multiple miRNAs and the associated protein. The data suggest that, it is possible to simultaneously deliver multiple negative (miRNA or shRNA) and positive (transgene) regulatory elements. Because many cellular processes require simultaneous repression and activation of downstream pathways, this approach offers a platform technology to achieve that dual manipulation efficiently

  3. RNA Binding of T-cell Intracellular Antigen-1 (TIA-1) C-terminal RNA Recognition Motif Is Modified by pH Conditions*

    Science.gov (United States)

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Persson, Cecilia; Karlsson, B. Göran; Díaz-Moreno, Irene

    2013-01-01

    T-cell intracellular antigen-1 (TIA-1) is a DNA/RNA-binding protein that regulates critical events in cell physiology by the regulation of pre-mRNA splicing and mRNA translation. TIA-1 is composed of three RNA recognition motifs (RRMs) and a glutamine-rich domain and binds to uridine-rich RNA sequences through its C-terminal RRM2 and RRM3 domains. Here, we show that RNA binding mediated by either isolated RRM3 or the RRM23 construct is controlled by slight environmental pH changes due to the protonation/deprotonation of TIA-1 RRM3 histidine residues. The auxiliary role of the C-terminal RRM3 domain in TIA-1 RNA recognition is poorly understood, and this work provides insight into its binding mechanisms. PMID:23902765

  4. Efficient Translation of Pelargonium line pattern virus RNAs Relies on a TED-Like 3´-Translational Enhancer that Communicates with the Corresponding 5´-Region through a Long-Distance RNA-RNA Interaction.

    Science.gov (United States)

    Blanco-Pérez, Marta; Pérez-Cañamás, Miryam; Ruiz, Leticia; Hernández, Carmen

    2016-01-01

    Cap-independent translational enhancers (CITEs) have been identified at the 3´-terminal regions of distinct plant positive-strand RNA viruses belonging to families Tombusviridae and Luteoviridae. On the bases of their structural and/or functional requirements, at least six classes of CITEs have been defined whose distribution does not correlate with taxonomy. The so-called TED class has been relatively under-studied and its functionality only confirmed in the case of Satellite tobacco necrosis virus, a parasitic subviral agent. The 3´-untranslated region of the monopartite genome of Pelargonium line pattern virus (PLPV), the recommended type member of a tentative new genus (Pelarspovirus) in the family Tombusviridae, was predicted to contain a TED-like CITE. Similar CITEs can be anticipated in some other related viruses though none has been experimentally verified. Here, in the first place, we have performed a reassessment of the structure of the putative PLPV-TED through in silico predictions and in vitro SHAPE analysis with the full-length PLPV genome, which has indicated that the presumed TED element is larger than previously proposed. The extended conformation of the TED is strongly supported by the pattern of natural sequence variation, thus providing comparative structural evidence in support of the structural data obtained by in silico and in vitro approaches. Next, we have obtained experimental evidence demonstrating the in vivo activity of the PLPV-TED in the genomic (g) RNA, and also in the subgenomic (sg) RNA that the virus produces to express 3´-proximal genes. Besides other structural features, the results have highlighted the key role of long-distance kissing-loop interactions between the 3´-CITE and 5´-proximal hairpins for gRNA and sgRNA translation. Bioassays of CITE mutants have confirmed the importance of the identified 5´-3´ RNA communication for viral infectivity and, moreover, have underlined the strong evolutionary constraints that may

  5. Efficient Translation of Pelargonium line pattern virus RNAs Relies on a TED-Like 3´-Translational Enhancer that Communicates with the Corresponding 5´-Region through a Long-Distance RNA-RNA Interaction.

    Directory of Open Access Journals (Sweden)

    Marta Blanco-Pérez

    Full Text Available Cap-independent translational enhancers (CITEs have been identified at the 3´-terminal regions of distinct plant positive-strand RNA viruses belonging to families Tombusviridae and Luteoviridae. On the bases of their structural and/or functional requirements, at least six classes of CITEs have been defined whose distribution does not correlate with taxonomy. The so-called TED class has been relatively under-studied and its functionality only confirmed in the case of Satellite tobacco necrosis virus, a parasitic subviral agent. The 3´-untranslated region of the monopartite genome of Pelargonium line pattern virus (PLPV, the recommended type member of a tentative new genus (Pelarspovirus in the family Tombusviridae, was predicted to contain a TED-like CITE. Similar CITEs can be anticipated in some other related viruses though none has been experimentally verified. Here, in the first place, we have performed a reassessment of the structure of the putative PLPV-TED through in silico predictions and in vitro SHAPE analysis with the full-length PLPV genome, which has indicated that the presumed TED element is larger than previously proposed. The extended conformation of the TED is strongly supported by the pattern of natural sequence variation, thus providing comparative structural evidence in support of the structural data obtained by in silico and in vitro approaches. Next, we have obtained experimental evidence demonstrating the in vivo activity of the PLPV-TED in the genomic (g RNA, and also in the subgenomic (sg RNA that the virus produces to express 3´-proximal genes. Besides other structural features, the results have highlighted the key role of long-distance kissing-loop interactions between the 3´-CITE and 5´-proximal hairpins for gRNA and sgRNA translation. Bioassays of CITE mutants have confirmed the importance of the identified 5´-3´ RNA communication for viral infectivity and, moreover, have underlined the strong evolutionary

  6. Effect of halophilic conditions in stabilisation of RNA structure and function at high temperature under radiations.

    Science.gov (United States)

    Maurel, M.-C.

    We have already shown the structural integrity of tRNA at high temperature - 82C for 30h - in high salt concentrations (Tehei et al, 2002). Stability were also performed by measuring the residual specific tRNA charge capacity after heat treatment for 30 h at 82C. RNA molecules are selected (in vitro selection) at high temperature at high salt concentration. We are undergoing studies of such molecules submitted to several stressful conditions, in particular high radiations. These studies provide support for the importance of salt to protect macromolecules against severe cosmic conditions. These could be useful for searching traces of life in planetary objects and space exploration. References : ElAmri, C., Baron, M-H., Maurel, M.-C. ``Adenine adsorption onto and release from meteorite specimens assessed by Surface Enhanced Raman Spectroscopy ''. Journal of Raman Spectroscopy (2004) in press. Meli, M., Vergne, J. and Maurel, M-C. "In vitro selection of adenine-dependent hairpin ribozymes" J. Biol. Chem., (2003), 278, 11, 9835-9842. ElAmri, C., Baron, M-H., Maurel, M.-C. ``Adenine in mineral samples : development of a methodology based on Surface Enhanced Raman Spectroscopy (SERS) for picomole detections ''. Spectrochimica Acta, A, 59, 2645-2654. Tehei, M., Franzetti, B., Maurel, M-C., Vergne, J., Hountondji, C. , Zaccai, G. ``Salt and the Search for Traces of Life '', Extremophiles, (2002), 6 : 427-430. Meli, M., Vergne, J., Décout, J.L., and Maurel, M-C. ``Adenine-Aptamer Complexes. A bipartite RNA site which binds the adenine nucleic base '', J. Biol. Chem., (2002), 277, 3, 2104-2111.

  7. Visible-light induced photoelectrochemical biosensor for the detection of microRNA based on Bi2S3 nanorods and streptavidin on an ITO electrode

    International Nuclear Information System (INIS)

    Wang, Mo; Yang, Zhiqing; Guo, Yunlong; Wang, Xinxu; Yin, Huanshun; Ai, Shiyun

    2015-01-01

    We demonstrate a photo-electrochemical biosensor for the sensitive and specific detection of microRNA using Bi 2 S 3 nanorods as a photoactive material and streptavidin as the unit that inhibits photocurrent. Bi 2 S 3 nanorods were synthesized hydrothermally in organic phase and displayed excellent light-to-current conversion efficiency. The Bi 2 S 3 was deposited on an indium tin oxide (ITO) slice and then modified with gold nanoparticles onto which biotinylated hairpin probe DNA was deposited as a monolayer. Following hybridization between the biotinylated probe DNA and the target microRNA, the stem-loop structure of the probe DNA was unfolded and the biotin directed outwards into the solution. Streptavidin was then added to bind to biotin via the strong streptavidin-biotin interactions. This causes the photocurrent of the modified ITO to decrease due to steric hindrance that blocks the transfer of electrons from added ascorbic acid to the surface of the electrode. The method has a detection limit as low as 3.5 fM of microRNA and can excellently discriminate even singly mismatched microRNA. The method was successfully applied to investigate the effect of abscisic acid on the expression level of microRNA-159a in seeds of Arabidopsis thaliana. We conclude that the assay presented here has a large potential as a method for quantification of microRNA and for studying the epigenetic regulation of flowering plants. (author)

  8. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    Science.gov (United States)

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Eroding dipoles and vorticity growth for Euler flows in {{{R}}}^{3}: the hairpin geometry as a model for finite-time blowup

    Science.gov (United States)

    Childress, Stephen; Gilbert, Andrew D.

    2018-02-01

    A theory of an eroding ‘hairpin’ vortex dipole structure in three-dimensions is developed, extending our previous study of an axisymmetric eroding dipole without swirl. The axisymmetric toroidal dipole was found to lead to maximal growth of vorticity, as {t}4/3. The hairpin is here similarly proposed as a model to produce large ‘self-stretching’ of vorticity, with the possibility of finite-time blow-up. We derive a system of partial differential equations of ‘generalized’ form, involving contour averaging of a locally two-dimensional Euler flow. We do not attempt here to solve the system exactly, but point out that non-existence of physically acceptable solutions would most probably be a result of the axial flow. Because of the axial flow the vorticity distribution within the dipole eddies is no longer of the simple Sadovskii type (vorticity constant over a cross-section) obtained in the axisymmetric problem. Thus the solution of the system depends upon the existence of a larger class of propagating two-dimensional dipoles. The hairpin model is obtained by formal asymptotic analysis. As in the axisymmetric problem a local transformation to ‘shrinking’ coordinates is introduced, but now in a self-similar form appropriate to the study of a possible finite-time singularity. We discuss some properties of the model, including a study of the helicity and a first step in iterating toward a solution from the Sadovskii structure. We also present examples of two-dimensional propagating dipoles not previously studied, which have a vorticity profile consistent with our model. Although no rigorous results can be given, and analysis of the system is only partial, the formal calculations are consistent with the possibility of a finite time blowup of vorticity at a point of vanishing circulation of the dipole eddies, but depending upon the existence of the necessary two-dimensional propagating dipole. Our results also suggest that conservation of kinetic energy as

  10. The Role of Repeat Administration of Adventitial Delivery of Lentivirus-shRNA-Vegf-A in Arteriovenous Fistula to Prevent Venous Stenosis Formation.

    Science.gov (United States)

    Janardhanan, Rajiv; Yang, Binxia; Kilari, Sreenivasulu; Leof, Edward B; Mukhopadhyay, Debabrata; Misra, Sanjay

    2016-04-01

    To determine if a second dose of a lentivirus mediated small hairpin RNA that inhibits Vegf-A gene expression (LV-shRNA-Vegf-A) can improve lumen vessel area (LVA) of the outflow vein of an arteriovenous fistula (AVF) and decrease venous neointimal hyperplasia. Chronic kidney disease was created in C57BL/6 mice; 28 days later, an AVF was created by connecting the right carotid artery to the ipsilateral jugular vein. Immediately after AVF creation, 5 × 10(6) plaque-forming units of LV-shRNA-Vegf-A or control shRNA was administered to the adventitia of the outflow vein, and a second dose of the same treatment was administered 14 days later. Animals were sacrificed at 21 days, 28 days, and 42 days after AVF creation for reverse transcription polymerase chain reaction and histomorphometric analyses. By day 21, there was a 125% increase in the average LVA (day 21, P = .11), with a decrease in cell proliferation (day 21, P = .0079; day 28, P = .28; day 42, P = .5), decrease in α-smooth muscle cell actin staining (day 21, P < .0001; day 28, P < .05; day 42, P = .59), and decrease in hypoxic stress (day 21, P < .001; day 28, P = .28; day 42, P = .46) in LV versus control shRNA vessels. A second dose of LV-shRNA-Vegf-A administration results in a moderate improvement in LVA at day 21. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

  11. Liquid crystal polymers: evidence of hairpin defects in nematic main chains, comparison with side chain polymers

    Science.gov (United States)

    Li, M. H.; Brûlet, A.; Keller, P.; Cotton, J. P.

    1996-09-01

    This article describes the conformation of two species of liquid crystalline polymers as revealed by small angle neutron scattering. The results obtained with side chain polymers are recalled. The procedure used to analyze the scattering data of main chains in the nematic phase is reported in this paper. It permits a demonstration of the existence of hairpins. Comparison of both polymer species shows that in the isotropic phase, the two polymers adopt a random coil conformation. In the nematic phase, the conformations are very different; the side chains behave as a melt of penetrable random coils whereas the main chains behave as a nematic phase of non penetrable cylinders.

  12. Mitochondrial tRNA cleavage by tRNA-targeting ribonuclease causes mitochondrial dysfunction observed in mitochondrial disease

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Tetsuhiro, E-mail: atetsu@mail.ecc.u-tokyo.ac.jp; Shimizu, Ayano; Takahashi, Kazutoshi; Hidaka, Makoto; Masaki, Haruhiko, E-mail: amasaki@mail.ecc.u-tokyo.ac.jp

    2014-08-15

    Highlights: • MTS-tagged ribonuclease was translocated successfully to the mitochondrial matrix. • MTS-tagged ribonuclease cleaved mt tRNA and reduced COX activity. • Easy and reproducible method of inducing mt tRNA dysfunction. - Abstract: Mitochondrial DNA (mtDNA) is a genome possessed by mitochondria. Since reactive oxygen species (ROS) are generated during aerobic respiration in mitochondria, mtDNA is commonly exposed to the risk of DNA damage. Mitochondrial disease is caused by mitochondrial dysfunction, and mutations or deletions on mitochondrial tRNA (mt tRNA) genes are often observed in mtDNA of patients with the disease. Hence, the correlation between mt tRNA activity and mitochondrial dysfunction has been assessed. Then, cybrid cells, which are constructed by the fusion of an enucleated cell harboring altered mtDNA with a ρ{sup 0} cell, have long been used for the analysis due to difficulty in mtDNA manipulation. Here, we propose a new method that involves mt tRNA cleavage by a bacterial tRNA-specific ribonuclease. The ribonuclease tagged with a mitochondrial-targeting sequence (MTS) was successfully translocated to the mitochondrial matrix. Additionally, mt tRNA cleavage, which resulted in the decrease of cytochrome c oxidase (COX) activity, was observed.

  13. The 5'-end heterogeneity of adenovirus virus-associated RNAI contributes to the asymmetric guide strand incorporation into the RNA-induced silencing complex.

    Science.gov (United States)

    Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran

    2009-11-01

    Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.

  14. Single step production of Cas9 mRNA for zygote injection.

    Science.gov (United States)

    Redel, Bethany K; Beaton, Benjamin P; Spate, Lee D; Benne, Joshua A; Murphy, Stephanie L; O'Gorman, Chad W; Spate, Anna M; Prather, Randall S; Wells, Kevin D

    2018-03-01

    Production of Cas9 mRNA in vitro typically requires the addition of a 5´ cap and 3´ polyadenylation. A plasmid was constructed that harbored the T7 promoter followed by the EMCV IRES and a Cas9 coding region. We hypothesized that the use of the metastasis associated lung adenocarcinoma transcript 1 (Malat1) triplex structure downstream of an IRES/Cas9 expression cassette would make polyadenylation of in vitro produced mRNA unnecessary. A sequence from the mMalat1 gene was cloned downstream of the IRES/Cas9 cassette described above. An mRNA concentration curve was constructed with either commercially available Cas9 mRNA or the IRES/ Cas9/triplex, by injection into porcine zygotes. Blastocysts were genotyped to determine if differences existed in the percent of embryos modified. The concentration curve identified differences due to concentration and RNA type injected. Single step production of Cas9 mRNA provides an alternative source of Cas9 for use in zygote injections.

  15. A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters

    Directory of Open Access Journals (Sweden)

    Chen Yun-Ru

    2012-09-01

    Full Text Available Abstract Background Deep sequencing is a powerful tool for novel small RNA discovery. Illumina small RNA sequencing library preparation requires a pre-adenylated 3’ end adapter containing a 5’,5’-adenyl pyrophosphoryl moiety. In the absence of ATP, this adapter can be ligated to the 3’ hydroxyl group of small RNA, while RNA self-ligation and concatenation are repressed. Pre-adenylated adapters are one of the most essential and costly components required for library preparation, and few are commercially available. Results We demonstrate that DNA oligo with 5’ phosphate and 3’ amine groups can be enzymatically adenylated by T4 RNA ligase 1 to generate customized pre-adenylated adapters. We have constructed and sequenced a small RNA library for tomato (Solanum lycopersicum using the T4 RNA ligase 1 adenylated adapter. Conclusion We provide an efficient and low-cost method for small RNA sequencing library preparation, which takes two days to complete and costs around $20 per library. This protocol has been tested in several plant species for small RNA sequencing including sweet potato, pepper, watermelon, and cowpea, and could be readily applied to any RNA samples.

  16. Development of a software tool and criteria evaluation for efficient design of small interfering RNA

    International Nuclear Information System (INIS)

    Chaudhary, Aparna; Srivastava, Sonam; Garg, Sanjeev

    2011-01-01

    Research highlights: → The developed tool predicted siRNA constructs with better thermodynamic stability and total score based on positional and other criteria. → Off-target silencing below score 30 were observed for the best siRNA constructs for different genes. → Immunostimulation and cytotoxicity motifs considered and penalized in the developed tool. → Both positional and compositional criteria were observed to be important. -- Abstract: RNA interference can be used as a tool for gene silencing mediated by small interfering RNAs (siRNA). The critical step in effective and specific RNAi processing is the selection of suitable constructs. Major design criteria, i.e., Reynolds's design rules, thermodynamic stability, internal repeats, immunostimulatory motifs were emphasized and implemented in the siRNA design tool. The tool provides thermodynamic stability score, GC content and a total score based on other design criteria in the output. The viability of the tool was established with different datasets. In general, the siRNA constructs produced by the tool had better thermodynamic score and positional properties. Comparable thermodynamic scores and better total scores were observed with the existing tools. Moreover, the results generated had comparable off-target silencing effect. Criteria evaluations with additional criteria were achieved in WEKA.

  17. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome.

    Science.gov (United States)

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F; Yan, Ziying; Qiu, Jianming

    2016-09-01

    Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1

  18. Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

    Science.gov (United States)

    Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

    2004-10-27

    Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

  19. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  20. Crystal Structure of the Full-Length Feline Immunodeficiency Virus Capsid Protein Shows an N-Terminal β-Hairpin in the Absence of N-Terminal Proline

    Directory of Open Access Journals (Sweden)

    Christelle Folio

    2017-11-01

    Full Text Available Feline immunodeficiency virus (FIV is a member of the Retroviridae family. It is the causative agent of an acquired immunodeficiency syndrome (AIDS in cats and wild felines. Its capsid protein (CA drives the assembly of the viral particle, which is a critical step in the viral replication cycle. Here, the first atomic structure of full-length FIV CA to 1.67 Å resolution is determined. The crystallized protein exhibits an original tetrameric assembly, composed of dimers which are stabilized by an intermolecular disulfide bridge induced by the crystallogenesis conditions. The FIV CA displays a standard α-helical CA topology with two domains, separated by a linker shorter than other retroviral CAs. The β-hairpin motif at its amino terminal end, which interacts with nucleotides in HIV-1, is unusually long in FIV CA. Interestingly, this functional β-motif is formed in this construct in the absence of the conserved N-terminal proline. The FIV CA exhibits a cis Arg–Pro bond in the CypA-binding loop, which is absent in known structures of lentiviral CAs. This structure represents the first tri-dimensional structure of a functional, full-length FIV CA.

  1. Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.

    Science.gov (United States)

    Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven

    2015-11-01

    Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

    Directory of Open Access Journals (Sweden)

    Ricardo eFlores

    2012-06-01

    Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

  3. RNA Nanostructures – Methods and Protocols | Center for Cancer Research

    Science.gov (United States)

    RNA nanotechnology is a young field with many potential applications. The goal is to utilize designed RNA strands, such that the obtained constructs have specific properties in terms of shape and functionality. RNA has potential functionalities that are comparable to that of proteins, but possesses (compared to proteins) simpler design principles akin to DNA. The promise is that designed RNA complexes may make possible novel types of molecular assemblies with applications in medicine (as therapeutics or diagnostics), material science, imaging, structural biology, and basic research.

  4. Identification of the miRNA-mRNA regulatory network of small cell osteosarcoma based on RNA-seq.

    Science.gov (United States)

    Xie, Lin; Liao, Yedan; Shen, Lida; Hu, Fengdi; Yu, Sunlin; Zhou, Yonghong; Zhang, Ya; Yang, Yihao; Li, Dongqi; Ren, Minyan; Yuan, Zhongqin; Yang, Zuozhang

    2017-06-27

    Small cell osteosarcoma (SCO) is a rare subtype of osteosarcoma characterized by highly aggressive progression and a poor prognosis. The miRNA and mRNA expression profiles of peripheral blood mononuclear cells (PBMCs) were obtained in 3 patients with SCO and 10 healthy individuals using high-throughput RNA-sequencing. We identified 37 dysregulated miRNAs and 1636 dysregulated mRNAs in patients with SCO compared to the healthy controls. Specifically, the 37 dysregulated miRNAs consisted of 27 up-regulated miRNAs and 10 down-regulated miRNAs; the 1636 dysregulated mRNAs consisted of 555 up-regulated mRNAs and 1081 down-regulated mRNAs. The target-genes of miRNAs were predicted, and 1334 negative correlations between miRNAs and mRNAs were used to construct an miRNA-mRNA regulatory network. Dysregulated genes were significantly enriched in pathways related to cancer, mTOR signaling and cell cycle signaling. Specifically, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p were significantly dysregulated miRNAs and exhibited a high degree of connectivity with target genes. Overall, the expression of dysregulated genes in tumor tissues and peripheral blood samples of patients with SCO measured by quantitative real-time polymerase chain reaction corroborated with our bioinformatics analyses based on the expression profiles of PBMCs from patients with SCO. Thus, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p may be involved in SCO tumorigenesis.

  5. Deciphering the porcine intestinal microRNA transcriptome

    Directory of Open Access Journals (Sweden)

    Keller Andreas

    2010-04-01

    Full Text Available Abstract Background While more than 700 microRNAs (miRNAs are known in human, a comparably low number has been identified in swine. Because of the close phylogenetic distance to humans, pigs serve as a suitable model for studying e.g. intestinal development or disease. Recent studies indicate that miRNAs are key regulators of intestinal development and their aberrant expression leads to intestinal malignancy. Results Here, we present the identification of hundreds of apparently novel miRNAs in the porcine intestine. MiRNAs were first identified by means of deep sequencing followed by miRNA precursor prediction using the miRDeep algorithm as well as searching for conserved miRNAs. Second, the porcine miRNAome along the entire intestine (duodenum, proximal and distal jejunum, ileum, ascending and transverse colon was unraveled using customized miRNA microarrays based on the identified sequences as well as known porcine and human ones. In total, the expression of 332 intestinal miRNAs was discovered, of which 201 represented assumed novel porcine miRNAs. The identified hairpin forming precursors were in part organized in genomic clusters, and most of the precursors were located on chromosomes 3 and 1, respectively. Hierarchical clustering of the expression data revealed subsets of miRNAs that are specific to distinct parts of the intestine pointing to their impact on cellular signaling networks. Conclusions In this study, we have applied a straight forward approach to decipher the porcine intestinal miRNAome for the first time in mammals using a piglet model. The high number of identified novel miRNAs in the porcine intestine points out their crucial role in intestinal function as shown by pathway analysis. On the other hand, the reported miRNAs may share orthologs in other mammals such as human still to be discovered.

  6. Chemical correction of pre-mRNA splicing defects associated with sequestration of muscleblind-like 1 protein by expanded r(CAG) transcripts

    Science.gov (United States)

    Kumar, Amit; Parkesh, Raman; Sznajder, Lukasz J.; Childs-Disney, Jessica; Sobczak, Krzysztof; Disney, Matthew D.

    2012-01-01

    Recently, it was reported that expanded r(CAG) triplet repeats (r(CAG)exp) associated with untreatable neurological diseases cause pre-mRNA mis-splicing likely due to sequestration of muscleblind-like 1 (MBNL1) splicing factor. Bioactive small molecules that bind the 5’CAG/3’GAC motif found in r(CAG)exp hairpin structure were identified by using RNA binding studies and virtual screening/chemical similarity searching. Specifically, a benzylguanidine-containing small molecule was found to improve pre-mRNA alternative splicing of MBNL1-sensitive exons in cells expressing the toxic r(CAG)exp. The compound was identified by first studying the binding of RNA 1×1 nucleotide internal loops to small molecules known to have affinity for nucleic acids. Those studies identified 4',6-diamidino-2-phenylindole (DAPI) as a specific binder to RNAs with the 5’CAG/3’GAC motif. DAPI was then used as a query molecule in a shape- and chemistry alignment-based virtual screen to identify compounds with improved properties, which identified 4-guanidinophenyl 4-guanidinobenzoate as small molecule capable of improving pre-mRNA splicing defects associated with the r(CAG)exp-MBNL1 complex. This compound may facilitate the development of therapeutics to treat diseases caused by r(CAG)exp and could serve as a useful chemical tool to dissect the mechanisms of r(CAG)exp toxicity. The approach used in these studies, defining the small RNA motifs that bind known nucleic acid binders and then using virtual screening to optimize them for bioactivity, may be generally applicable for designing small molecules that target other RNAs in human genomic sequence. PMID:22252896

  7. Inverse folding of RNA pseudoknot structures

    Directory of Open Access Journals (Sweden)

    Li Linda YM

    2010-06-01

    Full Text Available Abstract Background RNA exhibits a variety of structural configurations. Here we consider a structure to be tantamount to the noncrossing Watson-Crick and G-U-base pairings (secondary structure and additional cross-serial base pairs. These interactions are called pseudoknots and are observed across the whole spectrum of RNA functionalities. In the context of studying natural RNA structures, searching for new ribozymes and designing artificial RNA, it is of interest to find RNA sequences folding into a specific structure and to analyze their induced neutral networks. Since the established inverse folding algorithms, RNAinverse, RNA-SSD as well as INFO-RNA are limited to RNA secondary structures, we present in this paper the inverse folding algorithm Inv which can deal with 3-noncrossing, canonical pseudoknot structures. Results In this paper we present the inverse folding algorithm Inv. We give a detailed analysis of Inv, including pseudocodes. We show that Inv allows to design in particular 3-noncrossing nonplanar RNA pseudoknot 3-noncrossing RNA structures-a class which is difficult to construct via dynamic programming routines. Inv is freely available at http://www.combinatorics.cn/cbpc/inv.html. Conclusions The algorithm Inv extends inverse folding capabilities to RNA pseudoknot structures. In comparison with RNAinverse it uses new ideas, for instance by considering sets of competing structures. As a result, Inv is not only able to find novel sequences even for RNA secondary structures, it does so in the context of competing structures that potentially exhibit cross-serial interactions.

  8. mRNA transfection of mouse and human neural stem cell cultures

    OpenAIRE

    McLenachan, Samuel; Zhang, D.; Palomo, A.B.; Edel, Michael John; Chen, F.K.

    2013-01-01

    The use of synthetic mRNA as an alternative gene delivery vector to traditional DNA-based constructs provides an effective method for inducing transient gene expression in cell cultures without genetic modification. Delivery of mRNA has been proposed as a safer alternative to viral vectors in the induction of pluripotent cells for regenerative therapies. Although mRNA transfection of fibroblasts, dendritic and embryonic stem cells has been described, mRNA delivery to neurosphere cultures has ...

  9. Cleavage of influenza RNA by using a human PUF-based artificial RNA-binding protein–staphylococcal nuclease hybrid

    International Nuclear Information System (INIS)

    Mori, Tomoaki; Nakamura, Kento; Masaoka, Keisuke; Fujita, Yusuke; Morisada, Ryosuke; Mori, Koichi; Tobimatsu, Takamasa; Sera, Takashi

    2016-01-01

    Various viruses infect animals and humans and cause a variety of diseases, including cancer. However, effective methodologies to prevent virus infection have not yet been established. Therefore, development of technologies to inactivate viruses is highly desired. We have already demonstrated that cleavage of a DNA virus genome was effective to prevent its replication. Here, we expanded this methodology to RNA viruses. In the present study, we used staphylococcal nuclease (SNase) instead of the PIN domain (PilT N-terminus) of human SMG6 as an RNA-cleavage domain and fused the SNase to a human Pumilio/fem-3 binding factor (PUF)-based artificial RNA-binding protein to construct an artificial RNA restriction enzyme with enhanced RNA-cleavage rates for influenzavirus. The resulting SNase-fusion nuclease cleaved influenza RNA at rates 120-fold greater than the corresponding PIN-fusion nuclease. The cleaving ability of the PIN-fusion nuclease was not improved even though the linker moiety between the PUF and RNA-cleavage domain was changed. Gel shift assays revealed that the RNA-binding properties of the PUF derivative used was not as good as wild type PUF. Improvement of the binding properties or the design method will allow the SNase-fusion nuclease to cleave an RNA target in mammalian animal cells and/or organisms. - Highlights: • A novel RNA restriction enzyme using SNase was developed tor cleave viral RNA. • Our enzyme cleaved influenza RNA with rates >120-fold higher rates a PIN-fusion one. • Our artificial enzyme with the L5 linker showed the highest RNA cleavage rate. • Our artificial enzyme site-selectively cleaved influenza RNA in vitro.

  10. Respiratory-aspirated 35-mm hairpin successfully retrieved with a Teflon® snare system under fluoroscopic guidance via a split endotracheal tube: a useful technique in cases of failed extraction by bronchoscopy and avoiding the need for a thoracotomy.

    Science.gov (United States)

    Gill, S S; Pease, R A; Ashwin, C J; Gill, S S; Tait, N P

    2012-09-01

    Respiratory foreign body aspiration (FBA) is a common global health problem requiring prompt recognition and early treatment to prevent potentially fatal complications. The majority of FBAs are due to organic objects and treatment is usually via either endoscopic or surgical extraction. FBA of a straight hairpin has been described as a unique entity in the literature, occurring most commonly in females, particularly during adolescence. In the process of inserting hairpins, the pins will typically be between the teeth with the head tilted backwards, while tying their hair with both hands. This position increases the risk of aspiration, particularly if there is any sudden coughing or laughing. To our knowledge, this is the first case report of a 35-mm straight metallic hairpin foreign body that has been successfully retrieved by a radiological snare system under fluoroscopic guidance. This was achieved with the use of a split endotracheal tube, and therefore avoided the need for a thoracotomy in an adolescent female patient.

  11. RNA Nanoparticles Derived from Three-Way Junction of Phi29 Motor pRNA Are Resistant to I-125 and Cs-131 Radiation

    Science.gov (United States)

    Li, Hui; Rychahou, Piotr G.; Cui, Zheng; Pi, Fengmei; Evers, B. Mark; Shu, Dan

    2015-01-01

    Radiation reagents that specifically target tumors are in high demand for the treatment of cancer. The emerging field of RNA nanotechnology might provide new opportunities for targeted radiation therapy. This study investigates whether chemically modified RNA nanoparticles derived from the packaging RNA (pRNA) three-way junction (3WJ) of phi29 DNA-packaging motor are resistant to potent I-125 and Cs-131 radiation, which is a prerequisite for utilizing these RNA nanoparticles as carriers for targeted radiation therapy. pRNA 3WJ nanoparticles were constructed and characterized, and the stability of these nanoparticles under I-125 and Cs-131 irradiation with clinically relevant doses was examined. RNA nanoparticles derived from the pRNA 3WJ targeted tumors specifically and they were stable under irradiation of I-125 and Cs-131 with clinically relevant doses ranging from 1 to 90 Gy over a significantly long time up to 20 days, while control plasmid DNA was damaged at 20 Gy or higher. PMID:26017686

  12. Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.

    Science.gov (United States)

    Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John

    2017-02-01

    Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published

  13. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    Science.gov (United States)

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Integrated Analysis of Long Noncoding RNA and mRNA Expression Profile in Advanced Laryngeal Squamous Cell Carcinoma.

    Directory of Open Access Journals (Sweden)

    Ling Feng

    Full Text Available Long non-coding RNA (lncRNA plays an important role in tumorigenesis. However, the expression pattern and function of lncRNAs in laryngeal squamous cell carcinoma (LSCC are still unclear. To investigate the aberrantly expressed lncRNAs and mRNAs in advanced LSCC, we screened lncRNA and mRNA expression profiles in 9 pairs of primary Stage IVA LSCC tissues and adjacent non-neoplastic tissues by lncRNA and mRNA integrated microarrays. Gene Ontology and pathway analysis were performed to find out the significant function and pathway of the differentially expressed mRNAs, gene-gene functional interaction network and ceRNA network were constructed to select core mRNAs, and lncRNA-mRNA expression correlation network was built to identify the interactions between lncRNA and mRNA. qRT-PCR was performed to further validate the expressions of selected lncRNAs and mRNAs in advanced LSCC. We found 1459 differentially expressed lncRNAs and 2381 differentially expressed mRNAs, including 846 up-regulated lncRNAs and 613 down-regulated lncRNAs, 1542 up-regulated mRNAs and 839 down-regulated mRNAs. The mRNAs ITGB1, HIF1A, and DDIT4 were selected as core mRNAs, which are mainly involved in biological processes, such as matrix organization, cell cycle, adhesion, and metabolic pathway. LncRNA-mRNA expression correlation network showed LncRNA NR_027340, MIR31HG were positively correlated with ITGB1, HIF1A respectively. LncRNA SOX2-OT was negatively correlated with DDIT4. qRT-PCR further validated the expression of these lncRNAs and mRNAs. The work provides convincing evidence that the identified lncRNAs and mRNAs are potential biomarkers in advanced LSCC for further future studies.

  15. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  16. Expression of Herpes Simplex Virus Thymidine Kinase/Ganciclovir by RNA Trans-Splicing Induces Selective Killing of HIV-Producing Cells

    Directory of Open Access Journals (Sweden)

    Carin K. Ingemarsdotter

    2017-06-01

    Full Text Available Antiviral strategies targeting hijacked cellular processes are less easily evaded by the virus than viral targets. If selective for viral functions, they can have a high therapeutic index. We used RNA trans-splicing to deliver the herpes simplex virus thymidine kinase-ganciclovir (HSV-tk/GCV cell suicide system into HIV-producing cells. Using an extensive in silico bioinformatics and RNA structural analysis approach, ten HIV RNA trans-splicing constructs were designed targeting eight different HIV splice donor or acceptor sites and were tested in cells expressing HIV. Trans-spliced mRNAs were identified in HIV-expressing cells using qRT-PCR with successful detection of fusion RNA transcripts between HIV RNA and the HSV-tk RNA transcripts from six of ten candidate RNA trans-splicing constructs. Conventional PCR and Sanger sequencing confirmed RNA trans-splicing junctions. Measuring cell viability in the presence or absence of GCV expression of HSV-tk by RNA trans-splicing led to selective killing of HIV-producing cells using either 3′ exon replacement or 5′ exon replacement in the presence of GCV. Five constructs targeting four HIV splice donor and acceptor sites, D4, A5, A7, and A8, involved in regulating the generation of multiple HIV RNA transcripts proved to be effective for trans-splicing mediated selective killing of HIV-infected cells, within which individual constructs targeting D4 and A8 were the most efficient.

  17. Targeted Regression of Hepatocellular Carcinoma by Cancer-Specific RNA Replacement through MicroRNA Regulation.

    Science.gov (United States)

    Kim, Juhyun; Won, Ranhui; Ban, Guyee; Ju, Mi Ha; Cho, Kyung Sook; Young Han, Sang; Jeong, Jin-Sook; Lee, Seong-Wook

    2015-07-20

    Hepatocellular carcinoma (HCC) has a high fatality rate and limited therapeutic options with side effects and low efficacy. Here, we proposed a new anti-HCC approach based on cancer-specific post-transcriptional targeting. To this end, trans-splicing ribozymes from Tetrahymena group I intron were developed, which can specifically induce therapeutic gene activity through HCC-specific replacement of telomerase reverse transcriptase (TERT) RNA. To circumvent side effects due to TERT expression in regenerating liver tissue, liver-specific microRNA-regulated ribozymes were constructed by incorporating complementary binding sites for the hepatocyte-selective microRNA-122a (miR-122a), which is down-regulated in HCC. The ribozyme activity in vivo was assessed in mouse models orthotopically implanted with HCC. Systemic administration of adenovirus encoding the developed ribozymes caused efficient anti-cancer effect and the least hepatotoxicity with regulation of ribozyme expression by miR-122a in both xenografted and syngeneic orthotopic murine model of multifocal HCC. Of note, the ribozyme induced local and systemic antitumor immunity, thereby completely suppressing secondary tumor challenge in the syngeneic mouse. The cancer specific trans-splicing ribozyme system, which mediates tissue-specific microRNA-regulated RNA replacement, provides a clinically relevant, safe, and efficient strategy for HCC treatment.

  18. Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis.

    Science.gov (United States)

    Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang

    2018-01-22

    The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.

  19. Small RNA Deep Sequencing and the Effects of microRNA408 on Root Gravitropic Bending in Arabidopsis

    Science.gov (United States)

    Li, Huasheng; Lu, Jinying; Sun, Qiao; Chen, Yu; He, Dacheng; Liu, Min

    2015-11-01

    MicroRNA (miRNA) is a non-coding small RNA composed of 20 to 24 nucleotides that influences plant root development. This study analyzed the miRNA expression in Arabidopsis root tip cells using Illumina sequencing and real-time PCR before (sample 0) and 15 min after (sample 15) a 3-D clinostat rotational treatment was administered. After stimulation was performed, the expression levels of seven miRNA genes, including Arabidopsis miR160, miR161, miR394, miR402, miR403, miR408, and miR823, were significantly upregulated. Illumina sequencing results also revealed two novel miRNAsthat have not been previously reported, The target genes of these miRNAs included pentatricopeptide repeat-containing protein and diadenosine tetraphosphate hydrolase. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicate that miR408 could play a role in root gravitropic response.

  20. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  1. Determination of an effective scoring function for RNA-RNA interactions with a physics-based double-iterative method.

    Science.gov (United States)

    Yan, Yumeng; Wen, Zeyu; Zhang, Di; Huang, Sheng-You

    2018-05-18

    RNA-RNA interactions play fundamental roles in gene and cell regulation. Therefore, accurate prediction of RNA-RNA interactions is critical to determine their complex structures and understand the molecular mechanism of the interactions. Here, we have developed a physics-based double-iterative strategy to determine the effective potentials for RNA-RNA interactions based on a training set of 97 diverse RNA-RNA complexes. The double-iterative strategy circumvented the reference state problem in knowledge-based scoring functions by updating the potentials through iteration and also overcame the decoy-dependent limitation in previous iterative methods by constructing the decoys iteratively. The derived scoring function, which is referred to as DITScoreRR, was evaluated on an RNA-RNA docking benchmark of 60 test cases and compared with three other scoring functions. It was shown that for bound docking, our scoring function DITScoreRR obtained the excellent success rates of 90% and 98.3% in binding mode predictions when the top 1 and 10 predictions were considered, compared to 63.3% and 71.7% for van der Waals interactions, 45.0% and 65.0% for ITScorePP, and 11.7% and 26.7% for ZDOCK 2.1, respectively. For unbound docking, DITScoreRR achieved the good success rates of 53.3% and 71.7% in binding mode predictions when the top 1 and 10 predictions were considered, compared to 13.3% and 28.3% for van der Waals interactions, 11.7% and 26.7% for our ITScorePP, and 3.3% and 6.7% for ZDOCK 2.1, respectively. DITScoreRR also performed significantly better in ranking decoys and obtained significantly higher score-RMSD correlations than the other three scoring functions. DITScoreRR will be of great value for the prediction and design of RNA structures and RNA-RNA complexes.

  2. Prediction of miRNA-mRNA associations in Alzheimer's disease mice using network topology.

    Science.gov (United States)

    Noh, Haneul; Park, Charny; Park, Soojun; Lee, Young Seek; Cho, Soo Young; Seo, Hyemyung

    2014-08-03

    Little is known about the relationship between miRNA and mRNA expression in Alzheimer's disease (AD) at early- or late-symptomatic stages. Sequence-based target prediction algorithms and anti-correlation profiles have been applied to predict miRNA targets using omics data, but this approach often leads to false positive predictions. Here, we applied the joint profiling analysis of mRNA and miRNA expression levels to Tg6799 AD model mice at 4 and 8 months of age using a network topology-based method. We constructed gene regulatory networks and used the PageRank algorithm to predict significant interactions between miRNA and mRNA. In total, 8 cluster modules were predicted by the transcriptome data for co-expression networks of AD pathology. In total, 54 miRNAs were identified as being differentially expressed in AD. Among these, 50 significant miRNA-mRNA interactions were predicted by integrating sequence target prediction, expression analysis, and the PageRank algorithm. We identified a set of miRNA-mRNA interactions that were changed in the hippocampus of Tg6799 AD model mice. We determined the expression levels of several candidate genes and miRNA. For functional validation in primary cultured neurons from Tg6799 mice (MT) and littermate (LM) controls, the overexpression of ARRDC3 enhanced PPP1R3C expression. ARRDC3 overexpression showed the tendency to decrease the expression of miR139-5p and miR3470a in both LM and MT primary cells. Pathological environment created by Aβ treatment increased the gene expression of PPP1R3C and Sfpq but did not significantly alter the expression of miR139-5p or miR3470a. Aβ treatment increased the promoter activity of ARRDC3 gene in LM primary cells but not in MT primary cells. Our results demonstrate AD-specific changes in the miRNA regulatory system as well as the relationship between the expression levels of miRNAs and their targets in the hippocampus of Tg6799 mice. These data help further our understanding of the function

  3. Hepatitis C virus (HCV) induces formation of stress granules whose proteins regulate HCV RNA replication and virus assembly and egress.

    Science.gov (United States)

    Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V

    2012-10-01

    Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.

  4. Enhanced caveolin-1 expression increases migration, anchorage-independent growth and invasion of endometrial adenocarcinoma cells

    International Nuclear Information System (INIS)

    Diaz-Valdivia, Natalia; Bravo, Denisse; Huerta, Hernán; Henriquez, Soledad; Gabler, Fernando; Vega, Margarita; Romero, Carmen; Calderon, Claudia; Owen, Gareth I.; Leyton, Lisette; Quest, Andrew F. G.

    2015-01-01

    Caveolin-1 (CAV1) has been implicated both in tumor suppression and progression, whereby the specific role appears to be context dependent. Endometrial cancer is one of the most common malignancies of the female genital tract; however, little is known about the role of CAV1 in this disease. Here, we first determined by immunohistochemistry CAV1 protein levels in normal proliferative human endometrium and endometrial tumor samples. Then using two endometrial cancer cell lines (ECC: Ishikawa and Hec-1A) we evaluated mRNA and protein levels of CAV1 by real time qPCR and Western blot analysis, respectively. The role of CAV1 expression in ECC malignancy was further studied by either inducing its expression in endometrial cancer cells with the tumor promotor 12-O-tetradecanoyl-phorbol-13-acetate (4β-TPA) or decreasing expression using short-hairpin RNA constructs, and then evaluating the effects of these changes on ECC proliferation, transmigration, matrigel invasion, and colony formation in soft agar. Immunohistochemical analysis of endometrial epithelia revealed that substantially higher levels of CAV1 were present in endometrial tumors than the normal proliferative epithelium. Also, in Ishikawa and Hec-1A endometrial cancer cells CAV1 expression was readily detectable. Upon treatment with 4β-TPA CAV1 levels increased and coincided with augmented cell transmigration, matrigel invasion, as well as colony formation in soft agar. Reduction of CAV1 expression using short-hairpin RNA constructs ablated these effects in both cell types whether treated or not with 4β-TPA. Alternatively, CAV1 expression appeared not to modulate significantly proliferation of these cells. Our study shows that elevated CAV1, observed in patients with endometrial cancer, is linked to enhanced malignancy of endometrial cancer cells, as evidenced by increased migration, invasion and anchorage-independent growth. The online version of this article (doi:10.1186/s12885-015-1477-5) contains

  5. Tamarix microRNA Profiling Reveals New Insight into Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Jianwen Wang

    2018-04-01

    Full Text Available The halophyte tamarisk (Tamarix is extremely salt tolerant, making it an ideal material for salt tolerance-related studies. Although many salt-responsive genes of Tamarix were identified in previous studies, there are no reports on the role of post-transcriptional regulation in its salt tolerance. We constructed six small RNA libraries of Tamarix chinensis roots with NaCl treatments. High-throughput sequencing of the six libraries was performed and microRNA expression profiles were constructed. We investigated salt-responsive microRNAs to uncover the microRNA-mediated genes regulation. From these analyses, 251 conserved and 18 novel microRNA were identified from all small RNAs. From 191 differentially expressed microRNAs, 74 co-expressed microRNAs were identified as salt-responsive candidate microRNAs. The most enriched GO (gene ontology terms for the 157 genes targeted by differentially expressed microRNAs suggested that transcriptions factors were highly active. Two hub microRNAs (miR414, miR5658, which connected by several target genes into an organic microRNA regulatory network, appeared to be the key regulators of post-transcriptional salt-stress responses. As the first survey on the tamarisk small RNAome, this study improves the understanding of tamarisk salt-tolerance mechanisms and will contribute to the molecular-assisted resistance breeding.

  6. RNA-Seq analysis uncovers non-coding small RNA system of Mycobacterium neoaurum in the metabolism of sterols to accumulate steroid intermediates.

    Science.gov (United States)

    Liu, Min; Zhu, Zhan-Tao; Tao, Xin-Yi; Wang, Feng-Qing; Wei, Dong-Zhi

    2016-04-25

    Understanding the metabolic mechanism of sterols to produce valuable steroid intermediates in mycobacterium by a noncoding small RNA (sRNA) view is still limited. In the work, RNA-seq was implemented to investigate the noncoding transcriptome of Mycobacterium neoaurum (Mn) in the transformation process of sterols to valuable steroid intermediates, including 9α-hydroxy-4-androstene-3,17-dione (9OHAD), 1,4-androstadiene-3,17-dione (ADD), and 22-hydroxy-23, 24-bisnorchola-1,4-dien-3-one (1,4-BNA). A total of 263 sRNA candidates were predicted from the intergenic regions in Mn. Differential expression of sRNA candidates was explored in the wide type Mn with vs without sterol addition, and the steroid intermediate producing Mn strains vs wide type Mn with sterol addition, respectively. Generally, sRNA candidates were differentially expressed in various strains, but there were still some shared candidates with outstandingly upregulated or downregulated expression in these steroid producing strains. Accordingly, four regulatory networks were constructed to reveal the direct and/or indirect interactions between sRNA candidates and their target genes in four groups, including wide type Mn with vs without sterol addition, 9OHAD, ADD, and BNA producing strains vs wide type Mn with sterol addition, respectively. Based on these constructed networks, several highly focused sRNA candidates were discovered to be prevalent in the networks, which showed comprehensive regulatory roles in various cellular processes, including lipid transport and metabolism, amino acid transport and metabolism, signal transduction, cell envelope biosynthesis and ATP synthesis. To explore the functional role of sRNA candidates in Mn cells, we manipulated the overexpression of candidates 131 and 138 in strain Mn-9OHAD, which led to enhanced production of 9OHAD from 1.5- to 2.3-fold during 6 d' fermentation and a slight effect on growth rate. This study revealed the complex and important regulatory

  7. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chunmao; Ding, Chao; Kong, Minjian [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Dong, Aiqiang, E-mail: dr_dongaiqiang@sina.com [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China); Qian, Jianfang; Jiang, Daming; Shen, Zhonghua [Department of Cardiothoracic Surgery, Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310009 (China)

    2011-07-08

    Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the

  8. Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

    International Nuclear Information System (INIS)

    Wang, Chunmao; Ding, Chao; Kong, Minjian; Dong, Aiqiang; Qian, Jianfang; Jiang, Daming; Shen, Zhonghua

    2011-01-01

    Highlights: → We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. → We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. → We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. → Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lung cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 ± 6% and by liposomal magnetofection by 85.1 ± 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R

  9. The LncRNA Connectivity Map: Using LncRNA Signatures to Connect Small Molecules, LncRNAs, and Diseases.

    Science.gov (United States)

    Yang, Haixiu; Shang, Desi; Xu, Yanjun; Zhang, Chunlong; Feng, Li; Sun, Zeguo; Shi, Xinrui; Zhang, Yunpeng; Han, Junwei; Su, Fei; Li, Chunquan; Li, Xia

    2017-07-27

    Well characterized the connections among diseases, long non-coding RNAs (lncRNAs) and drugs are important for elucidating the key roles of lncRNAs in biological mechanisms in various biological states. In this study, we constructed a database called LNCmap (LncRNA Connectivity Map), available at http://www.bio-bigdata.com/LNCmap/ , to establish the correlations among diseases, physiological processes, and the action of small molecule therapeutics by attempting to describe all biological states in terms of lncRNA signatures. By reannotating the microarray data from the Connectivity Map database, the LNCmap obtained 237 lncRNA signatures of 5916 instances corresponding to 1262 small molecular drugs. We provided a user-friendly interface for the convenient browsing, retrieval and download of the database, including detailed information and the associations of drugs and corresponding affected lncRNAs. Additionally, we developed two enrichment analysis methods for users to identify candidate drugs for a particular disease by inputting the corresponding lncRNA expression profiles or an associated lncRNA list and then comparing them to the lncRNA signatures in our database. Overall, LNCmap could significantly improve our understanding of the biological roles of lncRNAs and provide a unique resource to reveal the connections among drugs, lncRNAs and diseases.

  10. Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

    Science.gov (United States)

    Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

    2017-11-01

    RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Assorted Processing of Synthetic Trans-Acting siRNAs and Its Activity in Antiviral Resistance.

    Science.gov (United States)

    Zhao, Mingmin; San León, David; Mesel, Frida; García, Juan Antonio; Simón-Mateo, Carmen

    2015-01-01

    The use of syn-tasiRNAs has been proposed as an RNA interference technique alternative to those previously described: hairpin based, virus induced gene silencing or artificial miRNAs. In this study we engineered the TAS1c locus to impair Plum pox virus (PPV) infection by replacing the five native siRNAs with two 210-bp fragments from the CP and the 3´NCR regions of the PPV genome. Deep sequencing analysis of the small RNA species produced by both constructs in planta has shown that phased processing of the syn-tasiRNAs is construct-specific. While in syn-tasiR-CP construct the processing was as predicted 21-nt phased in register with miR173-guided cleavage, the processing of syn-tasiR-3NCR is far from what was expected. A 22-nt species from the miR173-guided cleavage was a guide of two series of phased small RNAs, one of them in an exact 21-nt register, and the other one in a mixed of 21-/22-nt frame. In addition, both constructs produced abundant PPV-derived small RNAs in the absence of miR173 as a consequence of a strong sense post-transcriptional gene silencing induction. The antiviral effect of both constructs was also evaluated in the presence or absence of miR173 and showed that the impairment of PPV infection was not significantly higher when miR173 was present. The results show that syn-tasiRNAs processing depends on construct-specific factors that should be further studied before the so-called MIGS (miRNA-induced gene silencing) technology can be used reliably.

  12. Assorted Processing of Synthetic Trans-Acting siRNAs and Its Activity in Antiviral Resistance.

    Directory of Open Access Journals (Sweden)

    Mingmin Zhao

    Full Text Available The use of syn-tasiRNAs has been proposed as an RNA interference technique alternative to those previously described: hairpin based, virus induced gene silencing or artificial miRNAs. In this study we engineered the TAS1c locus to impair Plum pox virus (PPV infection by replacing the five native siRNAs with two 210-bp fragments from the CP and the 3´NCR regions of the PPV genome. Deep sequencing analysis of the small RNA species produced by both constructs in planta has shown that phased processing of the syn-tasiRNAs is construct-specific. While in syn-tasiR-CP construct the processing was as predicted 21-nt phased in register with miR173-guided cleavage, the processing of syn-tasiR-3NCR is far from what was expected. A 22-nt species from the miR173-guided cleavage was a guide of two series of phased small RNAs, one of them in an exact 21-nt register, and the other one in a mixed of 21-/22-nt frame. In addition, both constructs produced abundant PPV-derived small RNAs in the absence of miR173 as a consequence of a strong sense post-transcriptional gene silencing induction. The antiviral effect of both constructs was also evaluated in the presence or absence of miR173 and showed that the impairment of PPV infection was not significantly higher when miR173 was present. The results show that syn-tasiRNAs processing depends on construct-specific factors that should be further studied before the so-called MIGS (miRNA-induced gene silencing technology can be used reliably.

  13. Good quality Vitis RNA obtained from an adapted DNA isolation protocol

    Directory of Open Access Journals (Sweden)

    Isabel Baiges

    2003-03-01

    Full Text Available Grapevine is a woody plant, whose high carbohydrate and phenolic compound contents usually interferes with nucleic acid isolation. After we tried several protocols for isolating RNA from the Vitis rootstock Richter- 110 (R-110 with little or no success, we adapted a method reported to be satisfactory for grapevine DNA isolation, to extract RNA. With slight protocol modifications, we succeeded to obtain polysaccharide- and phenolic-free RNA preparations from all vegetative tissues, without excessive sample handling. RNA isolated by the reported method permitted to obtain highly pure mRNA (messenger RNA to construct a cDNA (complementary DNA library and allowed gene transcription analysis by reverse Northern, which guarantees RNA integrity. This method may also be suitable for other plant species with high polysaccharide or phenolic contents.

  14. Suppression of the expression of hypoxia-inducible factor-1α by RNA interference alleviates hypoxia-induced pulmonary hypertension in adult rats.

    Science.gov (United States)

    Li, Ying; Shi, Bo; Huang, Liping; Wang, Xin; Yu, Xiaona; Guo, Baosheng; Ren, Weidong

    2016-12-01

    Hypoxia-inducible factor-1α (HIF-1α) has been implicated in the pathogenesis of hypoxic pulmonary hypertension (PH). However, the potential clinical value of HIF-1α as a therapeutic target in the treatment of PH has not yet been evaluated. In this study, an animal model of hypoxia-induced PH was established by exposing adult rats to 10% O2 for 3 weeks, and the effects of the lentivirus-mediated delivery of HIF-1α short hairpin RNA (shRNA) by intratracheal instillation prior to exposure to hypoxia on the manifestations of hypoxia-induced PH were assessed. The successful delivery of HIF-1α shRNA into the pulmonary arteries effectively suppressed the hypoxia-induced upregulation of HIF-1α, accompanied by the prominent attenuation the symptoms associated with hypoxia-induced PH, including the elevation of pulmonary arterial pressure, hypertrophy and hyperplasia of pulmonary artery smooth muscle cells (PASMCs), as well as the muscularization of pulmonary arterioles. In addition, the knockdown of HIF-1α in cultured rat primary PASMCs significantly inhibited the hypoxia-induced acceleration of the cell cycle and the proliferation of the PASMCs, suggesting that HIF-1α may be a direct mediator of PASMC hyperplasia in hypoxia-induced PH. In conclusion, this study demonstrates the potent suppressive effects of HIF-1α shRNA on hypoxia-induced PH and PASMC hyperplasia, providing evidence for the potential application of HIF-1α shRNA in the treatment of hypoxic PH.

  15. Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

    Science.gov (United States)

    Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

    2012-01-01

    To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

  16. Importance of specific nucleotides in the folding of the natural form of the hairpin ribozyme.

    Science.gov (United States)

    Wilson, T J; Zhao, Z Y; Maxwell, K; Kontogiannis, L; Lilley, D M

    2001-02-20

    The hairpin ribozyme in its natural context consists of two loops in RNA duplexes that are connected as arms of a four-way helical junction. Magnesium ions induce folding into the active conformation in which the two loops are in proximity. In this study, we have investigated nucleotides that are important to this folding process. We have analyzed the folding in terms of the cooperativity and apparent affinity for magnesium ions as a function of changes in base sequence and functional groups, using fluorescence resonance energy transfer. Our results suggest that the interaction between the loops is the sum of a number of component interactions. Some sequence variants such as A10U, G+1A, and C25U exhibit loss of cooperativity and reduced affinity of apparent magnesium ion binding. These variants are also very impaired in ribozyme cleavage activity. Nucleotides A10, G+1, and C25 thus appear to be essential in creating the conformational environment necessary for ion binding. The double variant G+1A/C25U exhibits a marked recovery of both folding and catalytic activity compared to either individual variant, consistent with the proposal of a triple-base interaction among A9, G+1, and C25 [Pinard, R., Lambert, D., Walter, N. G., Heckman, J. E., Major, F., and Burke, J. M. (1999) Biochemistry 38, 16035-16039]. However, substitution of A9 leads to relatively small changes in folding properties and cleavage activity, and the double variant G+1DAP/C25U (DAP is 2,6-diaminopurine), which could form an isosteric triple-base interaction, exhibits folding and cleavage activities that are both very impaired compared to those of the natural sequence. Our results indicate an important role for a Watson--Crick base pair between G+1 and C25; this may be buttressed by an interaction with A9, but the loss of this has less significant consequences for folding. 2'-Deoxyribose substitution leads to folding with reduced magnesium ion affinity in the following order: unmodified RNA > dA9

  17. Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via regulating RSU1.

    Science.gov (United States)

    Phuah, Neoh Hun; Azmi, Mohamad Nurul; Awang, Khalijah; Nagoor, Noor Hasima

    2017-01-01

    Cervical cancer is the fourth most frequent malignancy affecting women worldwide, but drug resistance and toxicities remain a major challenge in chemotherapy. The use of natural compounds is promising because they are less toxic and able to target multiple signaling pathways. The 1'S-1'-acetoxychavicol acetate (ACA), a natural compound isolated from wild ginger Alpinia conchigera , induced cytotoxicity on various cancer cells including cervical cancer. MicroRNAs (miRNAs) are short noncoding RNAs that regulate numerous biological processes, such as apoptosis and chemosensitivity. Past studies reported that miR-629 is upregulated in many cancers, and its expression was altered in ACA-treated cervical cancer cells. However, the role of miR-629 in regulating sensitivity toward ACA or other anticancer agents has not been reported. Hence, this study aims to investigate the role of miR-629 in regulating response toward ACA on cervical cancer cells. The miR-629 expression following transfection with miR-629 hairpin inhibitor and hairpin inhibitor negative control was measured using quantitative real-time polymerase chain reaction (RT-qPCR). The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to investigate sensitivity toward ACA. Apoptosis was detected using Annexin V/propidium iodide and Caspase 3/7 assays. The gene target for miR-629 was identified using miRNA target prediction programs, luciferase reporter assay and Western blots. Gene overexpression studies were performed to evaluate its role in regulating response toward ACA. Transfection with miR-629 hairpin inhibitor downregulated its expression in both cervical cancer cell lines. Suppression of miR-629 increased sensitivity toward ACA by reducing cell proliferation and inducing apoptosis. Luciferase reporter assay confirmed RSU1 as a direct target of miR-629. Overexpression of miR-629 decreased RSU1 protein expression, while inhibition of miR-629 increased RSU1 protein expression

  18. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  19. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    Science.gov (United States)

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  20. A 3'-end structure in RNA2 of a crinivirus is essential for viral RNA synthesis and contributes to replication-associated translation activity.

    Science.gov (United States)

    Mongkolsiriwattana, Chawin; Zhou, Jaclyn S; Ng, James C K

    2016-10-03

    The terminal ends in the genome of RNA viruses contain features that regulate viral replication and/or translation. We have identified a Y-shaped structure (YSS) in the 3' terminal regions of the bipartite genome of Lettuce chlorosis virus (LCV), a member in the genus Crinivirus (family Closteroviridae). The YSS is the first in this family of viruses to be determined using Selective 2'-Hydroxyl Acylation Analyzed by Primer Extension (SHAPE). Using luciferase constructs/replicons, in vivo and in vitro assays showed that the 5' and YSS-containing 3' terminal regions of LCV RNA1 supported translation activity. In contrast, similar regions from LCV RNA2, including those upstream of the YSS, did not. LCV RNA2 mutants with nucleotide deletions or replacements that affected the YSS were replication deficient. In addition, the YSS of LCV RNA1 and RNA2 were interchangeable without affecting viral RNA synthesis. Translation and significant replication were observed for specific LCV RNA2 replicons only in the presence of LCV RNA1, but both processes were impaired when the YSS and/or its upstream region were incomplete or altered. These results are evidence that the YSS is essential to the viral replication machinery, and contributes to replication enhancement and replication-associated translation activity in the RNA2 replicons.

  1. Three RNA recognition motifs participate in RNA recognition and structural organization by the pro-apoptotic factor TIA-1

    Science.gov (United States)

    Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.

    2012-01-01

    T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808

  2. Matrix Metallopeptidase 14 Plays an Important Role in Regulating Tumorigenic Gene Expression and Invasion Ability of HeLa Cells.

    Science.gov (United States)

    Zhang, Ying-Hui; Wang, Juan-Juan; Li, Min; Zheng, Han-Xi; Xu, Lan; Chen, You-Guo

    2016-03-01

    The objectives of this study were to investigate the functional effect of matrix metallopeptidase 14 (MMP14) on cell invasion in cervical cancer cells (HeLa line) and to study the underlying molecular mechanisms. Expression vector of short hairpin RNA targeting MMP14 was treated in HeLa cells, and then, transfection efficiency was verified by a florescence microscope. Transwell assay was used to investigate cell invasion ability in HeLa cells. Quantitative polymerase chain reaction and Western blotting analysis were used to detect the expression of MMP14 and relative factors in messenger RNA and protein levels, respectively. Matrix metallopeptidase 14 short hairpin RNA expression vector transfection obviously decreased MMP14 expression in messenger RNA and protein levels. Down-regulation of MMP14 suppressed invasion ability of HeLa cells and reduced transforming growth factor β1 and vascular endothelial growth factor B expressions. Furthermore, MMP14 knockdown decreased bone sialoprotein and enhanced forkhead box protein L2 expression in both RNA and protein levels. Matrix metallopeptidase 14 plays an important role in regulating invasion of HeLa cells. Matrix metallopeptidase 14 knockdown contributes to attenuating the malignant phenotype of cervical cancer cell.

  3. Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones.

    Science.gov (United States)

    Zarzyńska-Nowak, Aleksandra; Ferriol, Inmaculada; Falk, Bryce W; Borodynko-Filas, Natasza; Hasiów-Jaroszewska, Beata

    2017-02-15

    Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  5. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.

    1987-01-01

    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  6. Monte Carlo simulation of AB-copolymers with saturating bonds

    CERN Document Server

    Chertovich, A V; Khokhlov, A R; Bohr, J

    2003-01-01

    Structural transitions in a single AB-copolymer chain where saturating bonds can be formed between A-and B-units are studied by means of Monte Carlo computer simulations using the bond fluctuation model. Three transitions are found, coil-globule, coil-hairpin and globule-hairpin, depending on the nature of a particular AB-sequence: statistical random sequence, diblock sequence and 'random-complementary' sequence (one-half of such an AB-sequence is random with Bernoulli statistics while the other half is complementary to the first one). The properties of random-complementary sequences are closer to those of diblock sequences than to the properties of random sequences. The model (although quite rough) is expected to represent some basic features of real RNA molecules, i.e. the formation of secondary structure of RNA due to hydrogen bonding of corresponding bases and stacking interactions of the base pairs in helixes. We introduce the notation of RNA-like copolymers and discuss in what sense the sequences studie...

  7. Efficient RNA extraction protocol for the wood mangrove species Laguncularia racemosa suited for next-generation RNA sequencing

    International Nuclear Information System (INIS)

    Wilwerth, M. W.; Rossetto, P.

    2016-01-01

    Mangrove flora and habitat have immeasurable importance in marine and coastal ecology as well as in the economy. Despite their importance, they are constantly threatened by oil spill accidents and environmental contamination; therefore, it is crucial to understand the changes in gene expression to better predict toxicity in these plants. Among the species of Atlantic coast mangrove (Americas and Africa), Laguncularia racemosa, or white mangrove, is a conspicuous species. The wide distribution of L. racemosa in areas where marine oil exploration is rapidly increasing make it a candidate mangrove species model to uncover the impact of oil spills at the molecular level with the use of massive transcriptome sequencing. However, for this purpose, the RNA extraction protocol should ensure low levels of contaminants and structure integrity. In this study, eight RNA extraction methods were tested and analysed using downstream applications. The InviTrap Spin Plant RNA Mini Kit performed best with regard to purity and integrity. Moreover, the obtained RNA was submitted to cDNA synthesis and RT-PCR, successfully generating amplification products of the expected size. These Results show the applicability of the RNA obtained here for downstream methodologies, such as the construction of cDNA libraries for the Illumina Hi-seq platform. (author)

  8. Cellular toxicity following application of adeno-associated viral vector-mediated RNA interference in the nervous system

    Directory of Open Access Journals (Sweden)

    Verhaagen Joost

    2010-02-01

    Full Text Available Abstract Background After a spinal cord lesion, axon regeneration is inhibited by the presence of a diversity of inhibitory molecules in the lesion environment. At and around the lesion site myelin-associated inhibitors, chondroitin sulfate proteoglycans (CSPGs and several axon guidance molecules, including all members of the secreted (class 3 Semaphorins, are expressed. Interfering with multiple inhibitory signals could potentially enhance the previously reported beneficial effects of blocking single molecules. RNA interference (RNAi is a tool that can be used to simultaneously silence expression of multiple genes. In this study we aimed to employ adeno-associated virus (AAV mediated expression of short hairpin RNAs (shRNAs to target all Semaphorin class 3 signaling by knocking down its receptors, Neuropilin 1 (Npn-1 and Neuropilin 2 (Npn-2. Results We have successfully generated shRNAs that knock down Npn-1 and Npn-2 in a neuronal cell line. We detected substantial knockdown of Npn-2 mRNA when AAV5 viral vector particles expressing Npn-2 specific shRNAs were injected in dorsal root ganglia (DRG of the rat. Unexpectedly however, AAV1-mediated expression of Npn-2 shRNAs and a control shRNA in the red nucleus resulted in an adverse tissue response and neuronal degeneration. The observed toxicity was dose dependent and was not seen with control GFP expressing AAV vectors, implicating the shRNAs as the causative toxic agents. Conclusions RNAi is a powerful tool to knock down Semaphorin receptor expression in neuronal cells in vitro and in vivo. However, when shRNAs are expressed at high levels in CNS neurons, they trigger an adverse tissue response leading to neuronal degradation.

  9. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  10. Mirnacle: machine learning with SMOTE and random forest for improving selectivity in pre-miRNA ab initio prediction.

    Science.gov (United States)

    Marques, Yuri Bento; de Paiva Oliveira, Alcione; Ribeiro Vasconcelos, Ana Tereza; Cerqueira, Fabio Ribeiro

    2016-12-15

    MicroRNAs (miRNAs) are key gene expression regulators in plants and animals. Therefore, miRNAs are involved in several biological processes, making the study of these molecules one of the most relevant topics of molecular biology nowadays. However, characterizing miRNAs in vivo is still a complex task. As a consequence, in silico methods have been developed to predict miRNA loci. A common ab initio strategy to find miRNAs in genomic data is to search for sequences that can fold into the typical hairpin structure of miRNA precursors (pre-miRNAs). The current ab initio approaches, however, have selectivity issues, i.e., a high number of false positives is reported, which can lead to laborious and costly attempts to provide biological validation. This study presents an extension of the ab initio method miRNAFold, with the aim of improving selectivity through machine learning techniques, namely, random forest combined with the SMOTE procedure that copes with imbalance datasets. By comparing our method, termed Mirnacle, with other important approaches in the literature, we demonstrate that Mirnacle substantially improves selectivity without compromising sensitivity. For the three datasets used in our experiments, our method achieved at least 97% of sensitivity and could deliver a two-fold, 20-fold, and 6-fold increase in selectivity, respectively, compared with the best results of current computational tools. The extension of miRNAFold by the introduction of machine learning techniques, significantly increases selectivity in pre-miRNA ab initio prediction, which optimally contributes to advanced studies on miRNAs, as the need of biological validations is diminished. Hopefully, new research, such as studies of severe diseases caused by miRNA malfunction, will benefit from the proposed computational tool.

  11. Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

    Science.gov (United States)

    Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

    2009-01-01

    Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

  12. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  13. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  14. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    International Nuclear Information System (INIS)

    Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

    2015-01-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

  15. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

    2015-05-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

  16. A study of the influence of charged residues on β-hairpin formation by nuclear magnetic resonance and molecular dynamics.

    Science.gov (United States)

    Makowska, Joanna; Zmudzińska, Wioletta; Uber, Dorota; Chmurzyński, Lech

    2014-12-01

    Chain reversals are often nucleation sites in protein folding. The β-hairpins of FBP28 WW domain and IgG are stable and have been proved to initiate the folding and are, therefore, suitable for studying the influence of charged residues on β-hairpin conformation. In this paper, we carried out NMR examination of the conformations in solution of two fragments from the FPB28 protein (PDB code: 1E0L) (N-terminal part) namely KTADGKT-NH2 (1E0L 12-18, D7) and YKTADGKTY-NH2 (1E0L 11-19, D9), one from the B3 domain of the protein G (PDB code: 1IGD), namely DDATKT-NH2 (1IGD 51-56) (Dag1), and three variants of Dag1 peptide: DVATKT-NH2 (Dag2), OVATKT-NH2 (Dag3) and KVATKT-NH2 (Dag4), respectively, in which the original charged residue were replaced with non-polar residues or modified charged residues. It was found that both the D7 and D9 peptides form a large fraction bent conformations. However, no hydrophobic contacts between the terminal Tyr residues of D9 occur, which suggests that the presence of a pair of like-charged residues stabilizes chain reversal. Conversely, only the Dag1 and Dag2 peptides exhibit some chain reversal; replacing the second aspartic-acid residue with a valine and the first one with a basic residue results in a nearly extended conformation. These results suggest that basic residues farther away in sequence can result in stabilization of chain reversal owing to screening of the non-polar core. Conversely, smaller distance in sequence prohibits this screening, while the presence oppositely-charged residues can stabilize a turn because of salt-bridge formation.

  17. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  18. 78 FR 59237 - Regulated Navigation Area-Weymouth Fore River, Fore River Bridge Construction, Weymouth and...

    Science.gov (United States)

    2013-09-26

    ... regulatory action because this RNA will only be enforced when construction operations require such. Thus... establishing a temporary regulated navigation area (RNA) on the navigable waters of Weymouth Fore River in the...: Table of Acronyms COTP Captain of the Port DHS Department of Homeland Security FR Federal Register RNA...

  19. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    Science.gov (United States)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  20. ncRNA consensus secondary structure derivation using grammar strings.

    Science.gov (United States)

    Achawanantakun, Rujira; Sun, Yanni; Takyar, Seyedeh Shohreh

    2011-04-01

    Many noncoding RNAs (ncRNAs) function through both their sequences and secondary structures. Thus, secondary structure derivation is an important issue in today's RNA research. The state-of-the-art structure annotation tools are based on comparative analysis, which derives consensus structure of homologous ncRNAs. Despite promising results from existing ncRNA aligning and consensus structure derivation tools, there is a need for more efficient and accurate ncRNA secondary structure modeling and alignment methods. In this work, we introduce a consensus structure derivation approach based on grammar string, a novel ncRNA secondary structure representation that encodes an ncRNA's sequence and secondary structure in the parameter space of a context-free grammar (CFG) and a full RNA grammar including pseudoknots. Being a string defined on a special alphabet constructed from a grammar, grammar string converts ncRNA alignment into sequence alignment. We derive consensus secondary structures from hundreds of ncRNA families from BraliBase 2.1 and 25 families containing pseudoknots using grammar string alignment. Our experiments have shown that grammar string-based structure derivation competes favorably in consensus structure quality with Murlet and RNASampler. Source code and experimental data are available at http://www.cse.msu.edu/~yannisun/grammar-string.

  1. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

    Science.gov (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

    2008-02-22

    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  2. Application of RNA interference methodology to investigate and ...

    Indian Academy of Sciences (India)

    Specific fragments of the sugarcane mosaic virus (SCMV) coat protein gene (cp) were amplified by reverse transcription-polymerase chain reaction and used to construct a marker free small interfering RNA complex expression vector against SCMV. In planta transformation was performed on maize (Zea mays) inbred line ...

  3. Construction of CRISPR Libraries for Functional Screening.

    Science.gov (United States)

    Carstens, Carsten P; Felts, Katherine A; Johns, Sarah E

    2018-01-01

    Identification of gene function has been aided by the ability to generate targeted gene knockouts or transcriptional repression using the CRISPR/CAS9 system. Using pooled libraries of guide RNA expression vectors that direct CAS9 to a specific genomic site allows identification of genes that are either enriched or depleted in response to a selection scheme, thus linking the affected gene to the chosen phenotype. The quality of the data generated by the screening is dependent on the quality of the guide RNA delivery library with regards to error rates and especially evenness of distribution of the guides. Here, we describe a method for constructing complex plasmid libraries based on pooled designed oligomers with high representation and tight distributions. The procedure allows construction of plasmid libraries of >60,000 members with a 95th/5th percentile ratio of less than 3.5.

  4. Atomistic mechanism of microRNA translation upregulation via molecular dynamics simulations.

    Directory of Open Access Journals (Sweden)

    Wei Ye

    Full Text Available MicroRNAs are endogenous 23-25 nt RNAs that play important gene-regulatory roles in animals and plants. Recently, miR369-3 was found to upregulate translation of TNFα mRNA in quiescent (G0 mammalian cell lines. Knock down and immunofluorescence experiments suggest that microRNA-protein complexes (with FXR1 and AGO2 are necessary for the translation upregulation. However the molecular mechanism of microRNA translation activation is poorly understood. In this study we constructed the microRNA-mRNA-AGO2-FXR1 quadruple complex by bioinformatics and molecular modeling, followed with all atom molecular dynamics simulations in explicit solvent to investigate the interaction mechanisms for the complex. A combined analysis of experimental and computational data suggests that AGO2-FXR1 complex relocalize microRNA:mRNA duplex to polysomes in G0. The two strands of dsRNA are then separated upon binding of AGO2 and FXR1. Finally, polysomes may improve the translation efficiency of mRNA. The mutation research confirms the stability of microRNA-mRNA-FXR1 and illustrates importance of key residue of Ile304. This possible mechanism can shed more light on the microRNA-dependent upregulation of translation.

  5. Transcription of potato spindle tuber viroid by RNA polymerase II starts in the left terminal loop

    International Nuclear Information System (INIS)

    Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja; Hu, Kang-Hong; Moors, Michaela; Schmitz, Michael; Steger, Gerhard; Riesner, Detlev

    2006-01-01

    Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified by affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta

  6. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  7. Preparation of Small RNA NGS Libraries from Biofluids.

    Science.gov (United States)

    Etheridge, Alton; Wang, Kai; Baxter, David; Galas, David

    2018-01-01

    Next generation sequencing (NGS) is a powerful method for transcriptome analysis. Unlike other gene expression profiling methods, such as microarrays, NGS provides additional information such as splicing variants, sequence polymorphisms, and novel transcripts. For this reason, NGS is well suited for comprehensive profiling of the wide range of extracellular RNAs (exRNAs) in biofluids. ExRNAs are of great interest because of their possible biological role in cell-to-cell communication and for their potential use as biomarkers or for therapeutic purposes. Here, we describe a modified protocol for preparation of small RNA libraries for NGS analysis. This protocol has been optimized for use with low-input exRNA-containing samples, such as plasma or serum, and has modifications designed to reduce the sequence-specific bias typically encountered with commercial small RNA library construction kits.

  8. Specific interaction of the nonstructural protein NS1 of minute virus of mice (MVM) with [ACCA](2) motifs in the centre of the right-end MVM DNA palindrome induces hairpin-primed viral DNA replication.

    Science.gov (United States)

    Willwand, Kurt; Moroianu, Adela; Hörlein, Rita; Stremmel, Wolfgang; Rommelaere, Jean

    2002-07-01

    The linear single-stranded DNA genome of minute virus of mice (MVM) is replicated via a double-stranded replicative form (RF) intermediate DNA. Amplification of viral RF DNA requires the structural transition of the right-end palindrome from a linear duplex into a double-hairpin structure, which serves for the repriming of unidirectional DNA synthesis. This conformational transition was found previously to be induced by the MVM nonstructural protein NS1. Elimination of the cognate NS1-binding sites, [ACCA](2), from the central region of the right-end palindrome next to the axis of symmetry was shown to markedly reduce the efficiency of hairpin-primed DNA replication, as measured in a reconstituted in vitro replication system. Thus, [ACCA](2) sequence motifs are essential as NS1-binding elements in the context of the structural transition of the right-end MVM palindrome.

  9. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  10. Genes for 7S RNAs can replace the gene for 4.5S RNA in growth of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S

    1991-01-01

    4.5S RNAs of eubacteria and 7S RNAs of archaebacteria and eukaryotes exist in a hairpin conformation. The apex of this hairpin displays structural and sequence similarities among both 4.5S and 7S RNAs. Furthermore, a hyphenated sequence of 16 nucleotides is conserved in all eubacterial 4.5S RNAs...... examined. In this article I report that 7S RNAs that contain this 16-nucleotide sequence are able to replace 4.5S RNAs and permit growth of Escherichia coli....

  11. Import of desired nucleic acid sequences using addressing motif of mitochondrial ribosomal 5S-rRNA for fluorescent in vivo hybridization of mitochondrial DNA and RNA.

    Science.gov (United States)

    Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr

    2014-04-01

    Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.

  12. In silico mining of micro-RNAs from Spodoptera frugiperda (Smith ...

    African Journals Online (AJOL)

    Rebijith K B

    2014-01-01

    Jan 1, 2014 ... 1Division of Biotechnology, Indian Institute of Horticultural Research, Hessaraghatta Lake P.O.,. Karnataka .... kcal/mol; 2) mature miRNA on the stem region of the hairpin ... Start position End position Strand Match extent.

  13. SL1 revisited: functional analysis of the structure and conformation of HIV-1 genome RNA.

    Science.gov (United States)

    Sakuragi, Sayuri; Yokoyama, Masaru; Shioda, Tatsuo; Sato, Hironori; Sakuragi, Jun-Ichi

    2016-11-11

    The dimer initiation site/dimer linkage sequence (DIS/DLS) region of HIV is located on the 5' end of the viral genome and suggested to form complex secondary/tertiary structures. Within this structure, stem-loop 1 (SL1) is believed to be most important and an essential key to dimerization, since the sequence and predicted secondary structure of SL1 are highly stable and conserved among various virus subtypes. In particular, a six-base palindromic sequence is always present at the hairpin loop of SL1 and the formation of kissing-loop structure at this position between the two strands of genomic RNA is suggested to trigger dimerization. Although the higher-order structure model of SL1 is well accepted and perhaps even undoubted lately, there could be stillroom for consideration to depict the functional SL1 structure while in vivo (in virion or cell). In this study, we performed several analyses to identify the nucleotides and/or basepairing within SL1 which are necessary for HIV-1 genome dimerization, encapsidation, recombination and infectivity. We unexpectedly found that some nucleotides that are believed to contribute the formation of the stem do not impact dimerization or infectivity. On the other hand, we found that one G-C basepair involved in stem formation may serve as an alternative dimer interactive site. We also report on our further investigation of the roles of the palindromic sequences on viral replication. Collectively, we aim to assemble a more-comprehensive functional map of SL1 on the HIV-1 viral life cycle. We discovered several possibilities for a novel structure of SL1 in HIV-1 DLS. The newly proposed structure model suggested that the hairpin loop of SL1 appeared larger, and genome dimerization process might consist of more complicated mechanism than previously understood. Further investigations would be still required to fully understand the genome packaging and dimerization of HIV.

  14. Hairpin-induced tRNA-mediated (HITME) recombination in HIV-1

    NARCIS (Netherlands)

    Konstantinova, Pavlina; de Haan, Peter; Das, Atze T.; Berkhout, Ben

    2006-01-01

    Recombination due to template switching during reverse transcription is a major source of genetic variability in retroviruses. In the present study we forced a recombination event in human immunodeficiency virus type 1 (HIV-1) by electroporation of T cells with DNA from a molecular HIV-1 clone that

  15. Systematic Analysis of RNA Regulatory Network in Rat Brain after Ischemic Stroke

    Directory of Open Access Journals (Sweden)

    Juan Liu

    2018-01-01

    Full Text Available Although extensive studies have identified large number of microRNAs (miRNAs and long noncoding RNAs (lncRNAs in ischemic stroke, the RNA regulation network response to focal ischemia remains poorly understood. In this study, we simultaneously interrogate the expression profiles of lncRNAs, miRNAs, and mRNAs changes during focal ischemia induced by transient middle cerebral artery occlusion. A set of 1924 novel lncRNAs were identified and may involve brain injury and DNA repair as revealed by coexpression network analysis. Furthermore, many short interspersed elements (SINE mediated lncRNA:mRNA duplexes were identified, implying that lncRNAs mediate Staufen1-mediated mRNA decay (SMD which may play a role during focal ischemia. Moreover, based on the competitive endogenous RNA (ceRNA hypothesis, a stroke regulatory ceRNA network which reveals functional lncRNA:miRNA:mRNA interactions was revealed in ischemic stroke. In brief, this work reports a large number of novel lncRNAs responding to focal ischemia and constructs a systematic RNA regulation network which highlighted the role of ncRNAs in ischemic stroke.

  16. Construction of recombinant DNA clone for bovine viral diarrhea virus

    International Nuclear Information System (INIS)

    Yeo, S.G.; Cho, H.J.; Masri, S.A.

    1992-01-01

    Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

  17. A surface-mediated siRNA delivery system developed with chitosan/hyaluronic acid-siRNA multilayer films through layer-by-layer self-assembly

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Lijuan [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Wu, Changlin, E-mail: Ph.Dclwu1314@sina.cn [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Liu, Guangwan [Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Liao, Nannan [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Zhao, Fang; Yang, Xuxia; Qu, Hongyuan [Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Peng, Bo [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Chen, Li [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China); Suzhou Novovita Bio-products Co., Ltd., Suzhou 215300 (China); Yang, Guang [Shanghai Key Laboratory of Magnetic Resonance, East China Normal University, Shanghai 200062 (China)

    2016-12-15

    Highlights: • We prepared Chitosan/Hyaluronic acid-siRNA multilayer as carrier to effectively load and protect siRNAs. • The stability and integrity of the siRNA was verified in the siRNA-loaded films. • The siRNA-loaded films showed good cells adhesion and gene silencing effect in eGFP-HEK 293T cells. • This is a new type of surface-mediated non-viral multilayer films. - Abstract: siRNA delivery remains highly challenging because of its hydrophilic and anionic nature and its sensitivity to nuclease degradation. Effective siRNA loading and improved transfection efficiency into cells represents a key problem. In our study, we prepared Chitosan/Hyaluronic acid-siRNA multilayer films through layer-by-layer self-assembly, in which siRNAs can be effectively loaded and protected. The construction process was characterized by FTIR, {sup 13}C NMR (CP/MAS), UV–vis spectroscopy, and atomic force microscopy (AFM). We presented the controlled-release performance of the films during incubation in 1 M NaCl solution for several days through UV–vis spectroscopy and polyacrylamide gel electrophoresis (PAGE). Additionally, we verified the stability and integrity of the siRNA loaded on multilayer films. Finally, the biological efficacy of the siRNA delivery system was evaluated via cells adhesion and gene silencing analyses in eGFP-HEK 293T cells. This new type of surface-mediated non-viral multilayer films may have considerable potential in the localized and controlled-release delivery of siRNA in mucosal tissues, and tissue engineering application.

  18. Mirnovo: genome-free prediction of microRNAs from small RNA sequencing data and single-cells using decision forests.

    Science.gov (United States)

    Vitsios, Dimitrios M; Kentepozidou, Elissavet; Quintais, Leonor; Benito-Gutiérrez, Elia; van Dongen, Stijn; Davis, Matthew P; Enright, Anton J

    2017-12-01

    The discovery of microRNAs (miRNAs) remains an important problem, particularly given the growth of high-throughput sequencing, cell sorting and single cell biology. While a large number of miRNAs have already been annotated, there may well be large numbers of miRNAs that are expressed in very particular cell types and remain elusive. Sequencing allows us to quickly and accurately identify the expression of known miRNAs from small RNA-Seq data. The biogenesis of miRNAs leads to very specific characteristics observed in their sequences. In brief, miRNAs usually have a well-defined 5' end and a more flexible 3' end with the possibility of 3' tailing events, such as uridylation. Previous approaches to the prediction of novel miRNAs usually involve the analysis of structural features of miRNA precursor hairpin sequences obtained from genome sequence. We surmised that it may be possible to identify miRNAs by using these biogenesis features observed directly from sequenced reads, solely or in addition to structural analysis from genome data. To this end, we have developed mirnovo, a machine learning based algorithm, which is able to identify known and novel miRNAs in animals and plants directly from small RNA-Seq data, with or without a reference genome. This method performs comparably to existing tools, however is simpler to use with reduced run time. Its performance and accuracy has been tested on multiple datasets, including species with poorly assembled genomes, RNaseIII (Drosha and/or Dicer) deficient samples and single cells (at both embryonic and adult stage). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  20. Expression profiles of mRNA and long noncoding RNA in the ovaries of letrozole-induced polycystic ovary syndrome rat model through deep sequencing.

    Science.gov (United States)

    Fu, Lu-Lu; Xu, Ying; Li, Dan-Dan; Dai, Xiao-Wei; Xu, Xin; Zhang, Jing-Shun; Ming, Hao; Zhang, Xue-Ying; Zhang, Guo-Qing; Ma, Ya-Lan; Zheng, Lian-Wen

    2018-05-30

    Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in reproductive-aged women. However, the exact pathophysiology of PCOS remains largely unclear. We performed deep sequencing to investigate the mRNA and long noncoding RNA (lncRNA) expression profiles in the ovarian tissues of letrozole-induced PCOS rat model and control rats. A total of 2147 mRNAs and 158 lncRNAs were differentially expressed between the PCOS models and control. Gene ontology analysis indicated that differentially expressed mRNAs were associated with biological adhesion, reproduction, and metabolic process. Pathway analysis results indicated that these aberrantly expressed mRNAs were related to several specific signaling pathways, including insulin resistance, steroid hormone biosynthesis, PPAR signaling pathway, cell adhesion molecules, autoimmune thyroid disease, and AMPK signaling pathway. The relative expression levels of mRNAs and lncRNAs were validated through qRT-PCR. LncRNA-miRNA-mRNA network was constructed to explore ceRNAs involved in the PCOS model and were also verified by qRTPCR experiment. These findings may provide insight into the pathogenesis of PCOS and clues to find key diagnostic and therapeutic roles of lncRNA in PCOS. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Resonance hairpin and Langmuir probe-assisted laser photodetachment measurements of the negative ion density in a pulsed dc magnetron discharge

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, James W.; Dodd, Robert; You, S.-D.; Sirse, Nishant; Karkari, Shantanu Kumar [Department of Electrical Engineering and Electronics, University of Liverpool, Liverpool (United Kingdom); National Centre for Plasma Science and Technology, Dublin City University, Dublin 9, Republic of Ireland (Ireland); National Centre for Plasma Science and Technology, Dublin City University, Dublin 9, Republic of Ireland and Institute for Plasma Research, Bhat Gandhinagar, Gujarat (India)

    2011-05-15

    The time-resolved negative oxygen ion density n{sub -} close to the center line in a reactive pulsed dc magnetron discharge (10 kHz and 50% duty cycle) has been determined for the first time using a combination of laser photodetachment and resonance hairpin probing. The discharge was operated at a power of 50 W in 70% argon and 30% oxygen gas mixtures at 1.3 Pa pressure. The results show that the O{sup -} density remains pretty constant during the driven phase of the discharge at values typically below 5x10{sup 14} m{sup -3}; however, in the off-time, the O{sup -} density grows reaching values several times those in the on-time. This leads to the negative ion fraction (or degree of electronegativity) {alpha}=n{sub -}/n{sub e} being higher in the off phase (maximum value {alpha}{approx}1) than in the on phase ({alpha}=0.05-0.3). The authors also see higher values of {alpha} at positions close to the magnetic null than in the more magnetized region of the plasma. This fractional increase in negative ion density during the off-phase is attributed to the enhanced dissociative electron attachment of highly excited oxygen molecules in the cooling plasma. The results show that close to the magnetic null the photodetached electron density decays quickly after the laser pulse, followed by a slow decay over a few microseconds governed by the negative ion temperature. However, in the magnetized regions of the plasma, this decay is more gradual. This is attributed to the different cross-field transport rates for electrons in these two regions. The resonance hairpin probe measurements of the photoelectron densities are compared directly to photoelectron currents obtained using a conventional Langmuir probe. There is good agreement in the general trends, particularly in the off-time.

  2. Cross disease analysis of co-functional microRNA pairs on a reconstructed network of disease-gene-microRNA tripartite.

    Science.gov (United States)

    Peng, Hui; Lan, Chaowang; Zheng, Yi; Hutvagner, Gyorgy; Tao, Dacheng; Li, Jinyan

    2017-03-24

    MicroRNAs always function cooperatively in their regulation of gene expression. Dysfunctions of these co-functional microRNAs can play significant roles in disease development. We are interested in those multi-disease associated co-functional microRNAs that regulate their common dysfunctional target genes cooperatively in the development of multiple diseases. The research is potentially useful for human disease studies at the transcriptional level and for the study of multi-purpose microRNA therapeutics. We designed a computational method to detect multi-disease associated co-functional microRNA pairs and conducted cross disease analysis on a reconstructed disease-gene-microRNA (DGR) tripartite network. The construction of the DGR tripartite network is by the integration of newly predicted disease-microRNA associations with those relationships of diseases, microRNAs and genes maintained by existing databases. The prediction method uses a set of reliable negative samples of disease-microRNA association and a pre-computed kernel matrix instead of kernel functions. From this reconstructed DGR tripartite network, multi-disease associated co-functional microRNA pairs are detected together with their common dysfunctional target genes and ranked by a novel scoring method. We also conducted proof-of-concept case studies on cancer-related co-functional microRNA pairs as well as on non-cancer disease-related microRNA pairs. With the prioritization of the co-functional microRNAs that relate to a series of diseases, we found that the co-function phenomenon is not unusual. We also confirmed that the regulation of the microRNAs for the development of cancers is more complex and have more unique properties than those of non-cancer diseases.

  3. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Science.gov (United States)

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  4. Lymphotoxin β receptor activation promotes mRNA expression of RelA and pro-inflammatory cytokines TNFα and IL-1β in bladder cancer cells.

    Science.gov (United States)

    Shen, Mo; Zhou, Lianlian; Zhou, Ping; Zhou, Wu; Lin, Xiangyang

    2017-07-01

    The role of inflammation in tumorigenesis and development is currently well established. Lymphotoxin β receptor (LTβR) activation induces canonical and noncanonical nuclear factor (NF)‑κB signaling pathways, which are linked to inflammation‑induced carcinogenesis. In the present study, 5,637 bladder cancer cells were cultured and the activation of LTβR was induced by functional ligand, lymphotoxin (LT) α1β2, and silencing with shRNA. Reverse transcription‑quantitative polymerase chain reaction was utilized to detect the mRNA expression levels of NF‑κB family members RelA and RelB, cytokines including LTα, LTβ, tumor necrosis factor (TNF)α, TNF superfamily member 14, interleukin (IL)‑6 and IL‑1β, and proliferation‑related genes including CyclinD1 and Survivin. The expression of phospho‑p65 was determined by western blotting. Activation of LTβR on bladder cancer 5,637 cells was demonstrated to upregulate the mRNA expression levels of the RELA proto‑oncogene, RelA, by 2.5‑fold compared with unstimulated cells, while no significant change was observed in the RELB proto‑oncogene NF‑κB member mRNA levels. Expression of pro‑inflammatory cytokines tumor necrosis factor (TNF)α and interleukin (IL)‑1β mRNA levels were significantly increased nearly 5‑fold and 1.5‑fold, respectively, following LTβR activation compared with unstimulated cells. The LTβR‑induced upregulation of RelA, TNFα and IL‑1β was decreased by ~33, 27, and 26% respectively when LTβR was silenced via short hairpin RNA. Activation of LTβR had no effect on 5,637 cell growth, despite CyclinD1 and Survivin mRNA levels increasing by ~2.7 and 1.3‑fold, respectively, compared with unstimulated cells. In conclusion, activation of LTβR induced the expression of RelA mRNA levels. LTβR activation might be an important mediator in promoting an inflammatory microenvironment in bladder cancer, via the upregulation of TNFα and IL‑1β mRNA levels. LTβR may

  5. dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.

    Science.gov (United States)

    Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L

    2008-12-26

    Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.

  6. Studies on the role of NonA in mRNA biogenesis

    International Nuclear Information System (INIS)

    Kozlova, Natalia; Braga, Jose; Lundgren, Josefin; Rino, Jose; Young, Patrick; Carmo-Fonseca, Maria; Visa, Neus

    2006-01-01

    The NonA protein of Drosophila melanogaster is an abundant nuclear protein that belongs to the DBHS (Drosophila behavior, human splicing) protein family. The DBHS proteins bind both DNA and RNA in vitro and have been involved in different aspects of gene expression, including pre-mRNA splicing, transcription regulation and nuclear retention of mRNA. We have used double-stranded RNA interference in Drosophila S2 cells to silence the expression of NonA and to investigate its role in mRNA biogenesis. We show that knockdown of NonA does not affect transcription nor splicing. We demonstrate that NonA forms a complex with the essential nuclear export factor NXF1 in an RNA-dependent manner. We have constructed stable S2 cell lines that express full-length and truncated NXF1 fused to GFP in order to perform fluorescence recovery after photobleaching experiments. We show that knockdown of NonA reduces the intranuclear mobility of NXF1-GFP associated with poly(A) + RNA in vivo, while the mobility of the truncated NXF1-GFP that does not bind RNA is not affected. Our data suggest that NonA facilitates the intranuclear mobility of mRNP particles

  7. Involvement of the 5'-leader sequence in coupling the stability of a human H3 histone mRNA with DNA replication

    International Nuclear Information System (INIS)

    Morris, T.; Marashi, F.; Weber, L.; Hickey, E.; Greenspan, D.; Bonner, J.; Stein, J.; Stein, G.

    1986-01-01

    Two lines of evidence derived from fusion gene constructs indicate that sequences residing in the 5'-nontranslated region of a cell cycle-dependent human H3 histone mRNA are involved in the selective destabilization that occurs when DNA synthesis is terminated. The experimental approach was to construct chimeric genes in which fragments of the mRNA coding regions of the H3 histone gene were fused with fragments of genes not expressed in a cell cycle-dependent manner. After transfection in HeLa S3 cells with the recombinant plasmids, levels of fusion mRNAs were determined by S1 nuclease analysis prior to and following DNA synthesis inhibition. When the first 20 nucleotides of an H3 histone mRNA leader were replaced with 89 nucleotides of the leader from a Drosophila heat-shock (hsp70) mRNA, the fusion transcript remained stable during inhibition of DNA synthesis, in contrast to the rapid destabilization of the endogenous histone mRNA in these cells. In a reciprocal experiment, a histone-globin fusion gene was constructed that produced a transcript with the initial 20 nucleotides of the H3 histone mRNA substituted for the human β-globin mRNA leader. In HeLa cells treated with inhibitors of DNA synthesis and/or protein synthesis, cellular levels of this histone-globin fusion mRNA appeared to be regulated in a manner similar to endogenous histone mRNA levels. These results suggest that the first 20 nucleotides of the leader are sufficient to couple histone mRNA stability with DNA replication

  8. Investigation of RNA Structure by High-Throughput SHAPE-Based Probing Methods

    DEFF Research Database (Denmark)

    Poulsen, Line Dahl

    of highthroughput SHAPE-based approaches to investigate RNA structure based on novel SHAPE reagents that permit selection of full-length cDNAs. The SHAPE Selection (SHAPES) method is applied to the foot-and-mouth disease virus (FMDV) plus strand RNA genome, and the data is used to construct a genome-wide structural...... that they are functional. The SHAPES method is further applied to the hepatitis C virus (HCV), where the data is used to refine known and predicted structures. Over the past years, the interest of studying RNA structure in their native environment has been increased, and to allow studying RNA structure inside living cells...... using the SHAPE Selection approach, I introduce a biotinylated probing reagent. This chemical can cross cell membranes and reacts with RNA inside the cells, allowing the structural conformations to be studied in the context of physiological relevant conditions in living cells. The methods and results...

  9. Expanding the informational chemistries of life: peptide/RNA networks

    Science.gov (United States)

    Taran, Olga; Chen, Chenrui; Omosun, Tolulope O.; Hsieh, Ming-Chien; Rha, Allisandra; Goodwin, Jay T.; Mehta, Anil K.; Grover, Martha A.; Lynn, David G.

    2017-11-01

    The RNA world hypothesis simplifies the complex biopolymer networks underlining the informational and metabolic needs of living systems to a single biopolymer scaffold. This simplification requires abiotic reaction cascades for the construction of RNA, and this chemistry remains the subject of active research. Here, we explore a complementary approach involving the design of dynamic peptide networks capable of amplifying encoded chemical information and setting the stage for mutualistic associations with RNA. Peptide conformational networks are known to be capable of evolution in disease states and of co-opting metal ions, aromatic heterocycles and lipids to extend their emergent behaviours. The coexistence and association of dynamic peptide and RNA networks appear to have driven the emergence of higher-order informational systems in biology that are not available to either scaffold independently, and such mutualistic interdependence poses critical questions regarding the search for life across our Solar System and beyond. This article is part of the themed issue 'Reconceptualizing the origins of life'.

  10. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  11. Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

    Science.gov (United States)

    Deaner, Matthew; Holzman, Allison; Alper, Hal S

    2018-04-16

    Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Electronic Detection of DNA Hybridization by Coupling Organic Field-Effect Transistor-Based Sensors and Hairpin-Shaped Probes

    Directory of Open Access Journals (Sweden)

    Corrado Napoli

    2018-03-01

    Full Text Available In this paper, the electronic transduction of DNA hybridization is presented by coupling organic charge-modulated field-effect transistors (OCMFETs and hairpin-shaped probes. These probes have shown interesting properties in terms of sensitivity and selectivity in other kinds of assays, in the form of molecular beacons (MBs. Their integration with organic-transistor based sensors, never explored before, paves the way to a new class of low-cost, easy-to-use, and portable genetic sensors with enhanced performances. Thanks to the peculiar characteristics of the employed sensor, measurements can be performed at relatively high ionic strengths, thus optimizing the probes’ functionality without affecting the detection ability of the device. A complete electrical characterization of the sensor is reported, including calibration with different target concentrations in the measurement environment and selectivity evaluation. In particular, DNA hybridization detection for target concentration as low as 100 pM is demonstrated.

  13. Ternary Electrochemiluminescence System Based on Rubrene Microrods as Luminophore and Pt Nanomaterials as Coreaction Accelerator for Ultrasensitive Detection of MicroRNA from Cancer Cells.

    Science.gov (United States)

    Liu, Jia-Li; Tang, Zhi-Ling; Zhuo, Ying; Chai, Ya-Qin; Yuan, Ruo

    2017-09-05

    As the only endogenous coreactant in the electrochemiluminescence (ECL) system, the dissolved O 2 was the ideal candidate due to the mild reaction and easy operation, but compared to S 2 O 8 2- , the dissolved O 2 with weaker redox activity suffers from the poor enhancement effect of the luminophore, which restricted the further application in bioanalysis. Here, a high-intense ECL signal was gained by the employing of Pt nanomaterials as a coreaction accelerator to generate more of the intermediate of dissolved O 2 to promote the coreaction efficiency. On the basis of a new ternary ECL system of Pt nanomaterials as the coreaction accelerator, dissolved O 2 as the coreactant, and a neotype rubrene microrods as the luminophore, an efficient "on-off-on" solid-state ECL switch platfrom was designed for ultrasensitive microRNA (miRNA) detection with a background reduction strategy of ferrocene-labeled single-stranded DNA (Fc-DNA) as a quencher. In the presence of miRNA 141, the Pt nanoparticles labeled hairpin (HP1/PtNPs) was opened to produce plenty of Pt nanoparticles labeled output DNA (S1/PtNPs) and release the miRNA-141 to participate in the next cycle. Then, the S1/PtNPs were captured on the surface of the electrode by the complementary strand to obtain the super "signal on" state with extremely high ECL signal. This novel solid-state ECL platform exhibited excellent sensitivity from 10 aM to 100 pM with a detection limit of 2.1 aM, which provided a new approach for ultrasensitive ECL bioanalysis.

  14. Elucidating Mechanisms of Molecular Recognition Between Human Argonaute and miRNA Using Computational Approaches

    KAUST Repository

    Jiang, Hanlun

    2016-12-06

    MicroRNA (miRNA) and Argonaute (AGO) protein together form the RNA-induced silencing complex (RISC) that plays an essential role in the regulation of gene expression. Elucidating the underlying mechanism of AGO-miRNA recognition is thus of great importance not only for the in-depth understanding of miRNA function but also for inspiring new drugs targeting miRNAs. In this chapter we introduce a combined computational approach of molecular dynamics (MD) simulations, Markov state models (MSMs), and protein-RNA docking to investigate AGO-miRNA recognition. Constructed from MD simulations, MSMs can elucidate the conformational dynamics of AGO at biologically relevant timescales. Protein-RNA docking can then efficiently identify the AGO conformations that are geometrically accessible to miRNA. Using our recent work on human AGO2 as an example, we explain the rationale and the workflow of our method in details. This combined approach holds great promise to complement experiments in unraveling the mechanisms of molecular recognition between large, flexible, and complex biomolecules.

  15. Elucidating Mechanisms of Molecular Recognition Between Human Argonaute and miRNA Using Computational Approaches.

    Science.gov (United States)

    Jiang, Hanlun; Zhu, Lizhe; Héliou, Amélie; Gao, Xin; Bernauer, Julie; Huang, Xuhui

    2017-01-01

    MicroRNA (miRNA) and Argonaute (AGO) protein together form the RNA-induced silencing complex (RISC) that plays an essential role in the regulation of gene expression. Elucidating the underlying mechanism of AGO-miRNA recognition is thus of great importance not only for the in-depth understanding of miRNA function but also for inspiring new drugs targeting miRNAs. In this chapter we introduce a combined computational approach of molecular dynamics (MD) simulations, Markov state models (MSMs), and protein-RNA docking to investigate AGO-miRNA recognition. Constructed from MD simulations, MSMs can elucidate the conformational dynamics of AGO at biologically relevant timescales. Protein-RNA docking can then efficiently identify the AGO conformations that are geometrically accessible to miRNA. Using our recent work on human AGO2 as an example, we explain the rationale and the workflow of our method in details. This combined approach holds great promise to complement experiments in unraveling the mechanisms of molecular recognition between large, flexible, and complex biomolecules.

  16. Serum long non coding RNA MALAT-1 protected by exosomes is up-regulated and promotes cell proliferation and migration in non-small cell lung cancer.

    Science.gov (United States)

    Zhang, Rui; Xia, Yuhong; Wang, Zhixin; Zheng, Jie; Chen, Yafei; Li, Xiaoli; Wang, Yu; Ming, Huaikun

    2017-08-19

    Circulating lncRNAs have been defined as a novel biomarker for non-small cell lung cancer (NSCLC), MALAT-1 was first identified lncRNA that was related to lung cancer metastasis. However, the relationship between exosomal lncRNAs and the diagnosis and prognosis of NSCLC was poorly understood. The aim of this study is to evaluate the clinical significance of serum exosomal MALAT-1 as a biomarker in the metastasis of NSCLC. In this study, we firstly isolated the exosomes from healthy subjects and NSCLC patients. Then we measured the expression levels of MALAT-1 contained in exosomes, and found that exosomal MALAT-1 was highly expressed in NSCLC patients, more importantly, the levels of exosomal MALAT-1 were positively associated with tumor stage and lymphatic metastasis. In addition, we decreased MALAT-1 expression by short hairpin RNA and conducted a series of assays including MTT, cell cycle, colony formation, wound-healing scratch and Annexin/V PI by flow cytometry in human lung cancer cell lines. These in vitro studies demonstrated that serum exosome-derived long noncoding RNA MALAT-1 promoted the tumor growth and migration, and prevented tumor cells from apoptosis in lung cancer cell lines. Taken together, this study shed a light on utilizing MALAT-1 in exosomes as a non-invasive serum-based tumor biomarker for diagnosis and prognosis of NSCLC. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Expression of a single siRNA against a conserved region of NP gene strongly inhibits in vitro replication of different Influenza A virus strains of avian and swine origin.

    Science.gov (United States)

    Stoppani, Elena; Bassi, Ivan; Dotti, Silvia; Lizier, Michela; Ferrari, Maura; Lucchini, Franco

    2015-08-01

    Influenza A virus is the principal agent responsible of the respiratory tract's infections in humans. Every year, highly pathogenic and infectious strains with new antigenic assets appear, making ineffective vaccines so far developed. The discovery of RNA interference (RNAi) opened the way to the progress of new promising drugs against Influenza A virus and also to the introduction of disease resistance traits in genetically modified animals. In this paper, we show that Madin-Darby Canine Kidney (MDCK) cell line expressing short hairpin RNAs (shRNAs) cassette, designed on a specific conserved region of the nucleoprotein (NP) viral genome, can strongly inhibit the viral replication of four viral strains sharing the target sequence, reducing the viral mRNA respectively to 2.5×10(-4), 7.5×10(-5), 1.7×10(-3), 1.9×10(-4) compared to the control, as assessed by real-time PCR. Moreover, we demonstrate that during the challenge with a viral strain bearing a single mismatch on the target sequence, although a weaker inhibition is observed, viral mRNA is still lowered down to 1.2×10(-3) folds in the shRNA-expressing clone compared to the control, indicating a broad potential use of this approach. In addition, we developed a highly predictive and fast screening test of siRNA sequences based on dual-luciferase assay, useful for the in vitro prediction of the potential effect of viral inhibition. In conclusion, these findings reveal new siRNA sequences able to inhibit Influenza A virus replication and provide a basis for the development of siRNAs as prophylaxis and therapy for influenza infection both in humans and animals. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. iDoRNA: An Interacting Domain-based Tool for Designing RNA-RNA Interaction Systems

    Directory of Open Access Journals (Sweden)

    Jittrawan Thaiprasit

    2016-03-01

    Full Text Available RNA-RNA interactions play a crucial role in gene regulation in living organisms. They have gained increasing interest in the field of synthetic biology because of their potential applications in medicine and biotechnology. However, few novel regulators based on RNA-RNA interactions with desired structures and functions have been developed due to the challenges of developing design tools. Recently, we proposed a novel tool, called iDoDe, for designing RNA-RNA interacting sequences by first decomposing RNA structures into interacting domains and then designing each domain using a stochastic algorithm. However, iDoDe did not provide an optimal solution because it still lacks a mechanism to optimize the design. In this work, we have further developed the tool by incorporating a genetic algorithm (GA to find an RNA solution with maximized structural similarity and minimized hybridized RNA energy, and renamed the tool iDoRNA. A set of suitable parameters for the genetic algorithm were determined and found to be a weighting factor of 0.7, a crossover rate of 0.9, a mutation rate of 0.1, and the number of individuals per population set to 8. We demonstrated the performance of iDoRNA in comparison with iDoDe by using six RNA-RNA interaction models. It was found that iDoRNA could efficiently generate all models of interacting RNAs with far more accuracy and required far less computational time than iDoDe. Moreover, we compared the design performance of our tool against existing design tools using forty-four RNA-RNA interaction models. The results showed that the performance of iDoRNA is better than RiboMaker when considering the ensemble defect, the fitness score and computation time usage. However, it appears that iDoRNA is outperformed by NUPACK and RNAiFold 2.0 when considering the ensemble defect. Nevertheless, iDoRNA can still be an useful alternative tool for designing novel RNA-RNA interactions in synthetic biology research. The source code of iDoRNA

  19. Sipi soup inhibits cancer‑associated fibroblast activation and the inflammatory process by downregulating long non‑coding RNA HIPK1‑AS.

    Science.gov (United States)

    Zhou, Bingxiu; Yu, Yuanyuan; Yu, Lixia; Que, Binfu; Qiu, Rui

    2018-06-06

    Sipi soup (SPS), the aqueous extract derived from the root bark of Sophora japonical L, Salix babylonica L., Morus alba L., as well as Amygdalus davidiana (Carr.) C. de Vos, is a traditional Chinese medicine frequently used to prevent and treat infection and inflammation. However, the role of SPS in cancer‑associated fibroblasts (CAFs) require further investigation. In the present study, the effects of SPS on fibroblast inactivation and the underlying mechanism were investigated. Reverse transcription‑quantitative polymerase chain reaction was used to analyze the mRNA expression levels of fibroblast activation protein (FAP), interleukin (IL)‑6, α‑smooth muscle actin (α‑SMA) and programmed cell death 4 (PDCD4). Flow cytometry was used to evaluate cell apoptosis. Immunofluorescence was used to determine the number of activated fibroblasts. The present study reported that SPS treatment did not affect the proliferative apoptotic potential of fibroblasts. Treatment with HeLa cell culture medium (CM) induced a significant increase in the expression levels of FAP, IL‑6 and α‑SMA, but reduced the expression of PDCD4. SPS reversed the effects of HeLa CM on the expression of these genes. Analysis with a long non‑coding (lnc)RNA array of numerous differentially expressed lncRNAs revealed that the expression levels of the lncRNA homeodomain‑interacting protein kinase 1 antisense RNA (HIPK1‑AS) were increased in cervicitis tissues and cervical squamous cell carcinoma tissues compared with in normal cervical tissues. HIPK1‑AS expression levels were upregulated in response to HeLa CM, but were decreased under SPS treatment. The downregulation of HIPK1‑AS expression via short hairpin RNA abolished the effects of HeLa CM on the expression of inflammation‑associated genes. The findings of the present study suggested that SPS may prevent the progression of cervical cancer by inhibiting the activation of CAF and the inflammatory process by reducing HIPK1

  20. A constructive approach to gene expression dynamics

    International Nuclear Information System (INIS)

    Ochiai, T.; Nacher, J.C.; Akutsu, T.

    2004-01-01

    Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property