WorldWideScience

Sample records for hafnium 168

  1. Commercial production of metal hafnium and hafnium-based products

    International Nuclear Information System (INIS)

    Negodin, D.A.; Shtutsa, M.G.; Akhtonov, S.G.; Il'enko, E.V.; Kobyzev, A.M.

    2012-01-01

    Hafnium possesses a unique complex of physical and chemical properties which allow the application of products on its basis in various industries. Joint Stock Company 'Chepetsky Mechanical Plant' is the single enterprise which produces hafnium on the territory of Russia. The manufacture of metal hafnium with the total content of zirconium and hafnium, at least, 99,8 % of weights is developed at the present time at Joint Stock Company CHMZ. The weight of melted hafnium ingots is up to 1 ton. Manufacture of wide range of products from hafnium is implemented. The plates from a hafnium with thickness of 0.60 mm which are used for emergency control cartridges of VVER-440 reactors are the most critical product. It is shown that ingots and products obtained from metal hafnium correspond to the Russian and international standards for reactor materials in chemical composition, mechanical and corrosion properties.

  2. Metallurgy of zirconium and hafnium

    International Nuclear Information System (INIS)

    Baryshnikov, N.V.; Geger, V.Eh.; Denisova, N.D.; Kazajn, A.A.; Kozhemyakin, V.A.; Nekhamkin, L.G.; Rodyakin, V.V.; Tsylov, Yu.A.

    1979-01-01

    Considered are those properties of zirconium and of hafnium, which are of practical interest for the manufacture of these elements. Systematized are the theoretical and the practical data on the procedures for thermal decomposition of zirconia and for obtaining zirconium dioxide and hafnium dioxide by a thermal decomposition of compounds and on the hydrometallurgical methods for extracting zirconium and hafnium. Zirconium and hafnium fluorides and chlorides production procedures are described. Considered are the iodide and the electrolytic methods of refining zirconium and hafnium

  3. Gravimetric determination of hafnium through its arsenate in carbide and boride of hafnium

    International Nuclear Information System (INIS)

    Rasulbekova, R.A.; Mamedov, I.A.

    1976-01-01

    A gravimetric method of determining hafnium through hydroarsenate has been recommended. The method differs from the known ones by its simplicity and by the recalculation coefficient which is more than by 50% smaller than that used in preparing a weight form of HfO 2 . Upon development of gravimetric determination of hafnium through hydro-and pyroarsenate, an investigation has been conducted with the aim to find some physico-chemical constants of hafnium hydroarsenate. The weighed amount of hafnium hydroarsenate is dissolved in sulphuric acid (2:5). The precipitate of hafnium hydroarsenate has been studied for recording infrared absorption spectra. Thermographic analysis of the precipitate has been performed. Thermogram reveals endothermal effect at 105 deg C and exothermal at 840 deg C. Water solubility of hafnium has been determined equal to 1.75x10 6 g mol/l. The corresponding solubility product of the precipitate has been calculated which is 2.1x10 -17 . It is shown that the method possesses certain selectivity, sufficient accuracy, and is rather fast. It has been established that determination can be performed in the presence of excess amounts of ions

  4. Hafnium isotope stratigraphy of ferromanganese crusts

    Science.gov (United States)

    Lee; Halliday; Hein; Burton; Christensen; Gunther

    1999-08-13

    A Cenozoic record of hafnium isotopic compositions of central Pacific deep water has been obtained from two ferromanganese crusts. The crusts are separated by more than 3000 kilometers but display similar secular variations. Significant fluctuations in hafnium isotopic composition occurred in the Eocene and Oligocene, possibly related to direct advection from the Indian and Atlantic oceans. Hafnium isotopic compositions have remained approximately uniform for the past 20 million years, probably reflecting increased isolation of the central Pacific. The mechanisms responsible for the increase in (87)Sr/(86)Sr in seawater through the Cenozoic apparently had no effect on central Pacific deep-water hafnium.

  5. Thermal behaviour of hafnium diethylenetriaminepentaacetate studied using the perturbed angular correlation technique

    Energy Technology Data Exchange (ETDEWEB)

    Chain, Cecilia Y. [Universidad Nacional de La Plata (Argentina). Dept. de Fisica; Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Buenos Aires (Argentina); Rivas, Patricia [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Consejo Nacional de Investigaciones Cientificas y Tecnicas, Buenos Aires (Argentina); Universidad Nacional de La Plata (Argentina). Facultad de Ciencias Agrarias y Forestales; Pasquevich, Alberto F. [Universidad Nacional de La Plata (Argentina). Dept. de Fisica; Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), La Plata (Argentina). IFLP-CCT; Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CIC-PBA) (Argentina)

    2014-07-01

    Polyaminecarboxilic ligands like diethylenetriaminepentaacetic acid form stable complexes with many heavy metal ions, excelling as cation chelants especially in the field of radiopharmacy. The aim of this work is to characterize, by using the Time Differential Perturbed Angular Correlations (TDPAC) technique, the hyperfine interactions at hafnium sites in hafnium diethylenetriaminepentaacetate and to investigate their evolution as temperature increases. TDPAC results for KHfDTPA.3H{sub 2}O obtained by chemical synthesis yield a well defined and highly asymmetric interaction of quadrupole frequency ω{sub Q} = 141 Mrad/s, which is consistent with the existence of a unique site for the metal in the crystal lattice. The thermal behaviour of the chelate is investigated by means of differential scanning calorimetry and thermogravimetrical analyses revealing that an endothermic dehydration of KHfDTPA.3H{sub 2}O takes place in one step between 80 C and 180 C. The anhydrous KHfDTPA thus arising is characterized by a fully asymmetric and well defined interaction of quadrupole frequency ω{sub Q} = 168 Mrad/s. (orig.)

  6. Thermal behaviour of hafnium diethylenetriaminepentaacetate studied using the perturbed angular correlation technique

    International Nuclear Information System (INIS)

    Chain, Cecilia Y.; Rivas, Patricia

    2014-01-01

    Polyaminecarboxilic ligands like diethylenetriaminepentaacetic acid form stable complexes with many heavy metal ions, excelling as cation chelants especially in the field of radiopharmacy. The aim of this work is to characterize, by using the Time Differential Perturbed Angular Correlations (TDPAC) technique, the hyperfine interactions at hafnium sites in hafnium diethylenetriaminepentaacetate and to investigate their evolution as temperature increases. TDPAC results for KHfDTPA.3H 2 O obtained by chemical synthesis yield a well defined and highly asymmetric interaction of quadrupole frequency ω Q = 141 Mrad/s, which is consistent with the existence of a unique site for the metal in the crystal lattice. The thermal behaviour of the chelate is investigated by means of differential scanning calorimetry and thermogravimetrical analyses revealing that an endothermic dehydration of KHfDTPA.3H 2 O takes place in one step between 80 C and 180 C. The anhydrous KHfDTPA thus arising is characterized by a fully asymmetric and well defined interaction of quadrupole frequency ω Q = 168 Mrad/s. (orig.)

  7. SEPARATION OF HAFNIUM FROM ZIRCONIUM

    Science.gov (United States)

    Overholser, L.B.; Barton, C.J. Sr.; Ramsey, J.W.

    1960-05-31

    The separation of hafnium impurities from zirconium can be accomplished by means of organic solvent extraction. The hafnium-containing zirconium feed material is dissolved in an aqueous chloride solution and the resulting solution is contacted with an organic hexone phase, with at least one of the phases containing thiocyanate. The hafnium is extracted into the organic phase while zirconium remains in the aqueous phase. Further recovery of zirconium is effected by stripping the onganic phase with a hydrochloric acid solution and commingling the resulting strip solution with the aqueous feed solution. Hexone is recovered and recycled by means of scrubbing the onganic phase with a sulfuric acid solution to remove the hafnium, and thiocyanate is recovered and recycled by means of neutralizing the effluent streams to obtain ammonium thiocyanate.

  8. Zirconium and hafnium

    Science.gov (United States)

    Jones, James V.; Piatak, Nadine M.; Bedinger, George M.; Schulz, Klaus J.; DeYoung,, John H.; Seal, Robert R.; Bradley, Dwight C.

    2017-12-19

    Zirconium and hafnium are corrosion-resistant metals that are widely used in the chemical and nuclear industries. Most zirconium is consumed in the form of the main ore mineral zircon (ZrSiO4, or as zirconium oxide or other zirconium chemicals. Zirconium and hafnium are both refractory lithophile elements that have nearly identical charge, ionic radii, and ionic potentials. As a result, their geochemical behavior is generally similar. Both elements are classified as incompatible because they have physical and crystallochemical properties that exclude them from the crystal lattices of most rock-forming minerals. Zircon and another, less common, ore mineral, baddeleyite (ZrO2), form primarily as accessory minerals in igneous rocks. The presence and abundance of these ore minerals in igneous rocks are largely controlled by the element concentrations in the magma source and by the processes of melt generation and evolution. The world’s largest primary deposits of zirconium and hafnium are associated with alkaline igneous rocks, and, in one locality on the Kola Peninsula of Murmanskaya Oblast, Russia, baddeleyite is recovered as a byproduct of apatite and magnetite mining. Otherwise, there are few primary igneous deposits of zirconium- and hafnium-bearing minerals with economic value at present. The main ore deposits worldwide are heavy-mineral sands produced by the weathering and erosion of preexisting rocks and the concentration of zircon and other economically important heavy minerals, such as ilmenite and rutile (for titanium), chromite (for chromium), and monazite (for rare-earth elements) in sedimentary systems, particularly in coastal environments. In coastal deposits, heavy-mineral enrichment occurs where sediment is repeatedly reworked by wind, waves, currents, and tidal processes. The resulting heavy-mineral-sand deposits, called placers or paleoplacers, preferentially form at relatively low latitudes on passive continental margins and supply 100 percent of

  9. Molten salt scrubbing of zirconium or hafnium tetrachloride

    International Nuclear Information System (INIS)

    Lee, E.D.; McLaughlin, D.F.

    1990-01-01

    This patent describes a continuous process for removing impurities of iron or aluminum chloride or both from vaporous zirconium or hafnium chloride or both. It comprises: introducing impure zirconium or hafnium chloride vapor or both into a middle portion of an absorbing column containing a molten salt phase, the molten salt phase absorbing the impurities of iron or aluminum chloride or both to produce chloride vapor stripped of zirconium or hafnium chloride; introducing sodium or potassium chloride or both into a top portion of the column; controlling the top portion of the column to between 300--375 degrees C.; heating a bottom portion of the column to 450--550 degrees C. To vaporize zirconium chloride or hafnium chloride or hafnium and zirconium chloride from the molten salt; withdrawing molten salt substantially free of zirconium and hafnium chloride from the bottom portion of the column; and withdrawing zirconium chloride or hafnium chloride or hafnium and zirconium chloride vapor substantially free of impurities of iron and aluminum chloride from the top of the column

  10. Recovery of hafnium values from loaded extraction solvent

    International Nuclear Information System (INIS)

    Abodishish, H.A.

    1989-01-01

    This patent describes an improvement in a process for recovering high purity hafnium hydroxide from a methyl isobutyl ketone organic solvent that is substantially free of sulfate ions and contains hafnium thiocyanate and thiocyanic acid. The improvement comprising reacting the organic solvent with ammonia to produce a reaction product in the form of a methyl isobutyl ketone organic solvent that is substantially free of sulfate ions and contains ammonium thiocyanite solution and hafnium hydroxide; separating the constituents of the reaction product in accordance with their respective specific gravities to produce a hafnium hydroxide sludge as one of the separation products; and removing the liquid component of the sludge to yield a high purity hafnium hydroxide ready for calcination to hafnium oxide

  11. Hafnium carbide formation in oxygen deficient hafnium oxide thin films

    Energy Technology Data Exchange (ETDEWEB)

    Rodenbücher, C. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); Hildebrandt, E.; Sharath, S. U.; Kurian, J.; Komissinskiy, P.; Alff, L. [Technische Universität Darmstadt, Institute of Materials Science, 64287 Darmstadt (Germany); Szot, K. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); University of Silesia, A. Chełkowski Institute of Physics, 40-007 Katowice (Poland); Breuer, U. [Forschungszentrum Jülich GmbH, Central Institute for Engineering, Electronics and Analytics (ZEA-3), 52425 Jülich (Germany); Waser, R. [Forschungszentrum Jülich GmbH, Peter Grünberg Institute (PGI-7), JARA-FIT, 52425 Jülich (Germany); RWTH Aachen, Institute of Electronic Materials (IWE 2), 52056 Aachen (Germany)

    2016-06-20

    On highly oxygen deficient thin films of hafnium oxide (hafnia, HfO{sub 2−x}) contaminated with adsorbates of carbon oxides, the formation of hafnium carbide (HfC{sub x}) at the surface during vacuum annealing at temperatures as low as 600 °C is reported. Using X-ray photoelectron spectroscopy the evolution of the HfC{sub x} surface layer related to a transformation from insulating into metallic state is monitored in situ. In contrast, for fully stoichiometric HfO{sub 2} thin films prepared and measured under identical conditions, the formation of HfC{sub x} was not detectable suggesting that the enhanced adsorption of carbon oxides on oxygen deficient films provides a carbon source for the carbide formation. This shows that a high concentration of oxygen vacancies in carbon contaminated hafnia lowers considerably the formation energy of hafnium carbide. Thus, the presence of a sufficient amount of residual carbon in resistive random access memory devices might lead to a similar carbide formation within the conducting filaments due to Joule heating.

  12. SEPARATING HAFNIUM FROM ZIRCONIUM

    Science.gov (United States)

    Lister, B.A.J.; Duncan, J.F.

    1956-08-21

    A dilute aqueous solution of zirconyl chloride which is 1N to 2N in HCl is passed through a column of a cation exchange resin in acid form thereby absorbing both zirconium and associated hafnium impurity in the mesin. The cation exchange material with the absorbate is then eluted with aqueous sulfuric acid of a O.8N to 1.2N strength. The first portion of the eluate contains the zirconium substantially free of hafnium.

  13. Determination of hafnium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Yoshida, Isao; Kobayashi, Hiroshi; Ueno, Keihei.

    1977-01-01

    Optimum conditions for atomic absorption spectrophotometric determination of hafnium were investigated by use of a Jarrel-Ash AA-1 instrument which was equipped with a premixed gas burner slotted 50 mm in length and 0.4 mm in width. Absorption of hafnium, which was atomized in an nitrous oxide-acetylene flame, was measured on a resonance line at 307.29 nm. The absorption due to hafnium was enhanced in the presence of ammonium fluoride and iron(III) ion, as shown in Figs. 2 and 3, depending on their concentration. The highest absorption was attained by the addition of (0.15 -- 0.3)M ammonium fluoride, 0.07 M of iron(III) ion and 0.05 M of hydrochloric acid. An excess of the additives decreased the absorption. The presence of zirconium, which caused a significant interference in the ordinary analytical methods, did not affect the absorption due to hafnium, if the zirconium concentration is less than 0.2 M. A standard procedure was proposed; A sample containing a few mg of hafnium was dissolved in a 25-ml volumetric flask, and ammonium fluoride, ferric nitrate and hydrochloric acid were added so that the final concentrations were 0.3, 0.07 and 0.05 M, respectively. Atomic absorption was measured on the aqueous solution in a nitrous oxide-acetylene flame and the hafnium content was calculated from the absorbance. Sensitivity was as high as 12.5 μg of Hf/ml/l% absorption. The present method is especially recommendable to the direct determination of hafnium in samples containing zirconium. (auth.)

  14. New solvent extraction process for zirconium and hafnium

    International Nuclear Information System (INIS)

    Takahashi, M.; Katoh, Y.; Miyazaki, H.

    1984-01-01

    The authors' company developed a new solvent extraction process for zirconium and hafnium separation, and started production of zirconium sponge by this new process in September 1979. The process utilizes selective extraction of zirconium oxysulfate using high-molecular alkyl amine, and has the following advantages: 1. This extraction system has a separation factor as high as 10 to 20 for zirconium and hafnium in the range of suitable acid concentration. 2. In the scrubbing section, removal of all the hafnium that coexists with zirconium in the organic solvent can be effectively accomplished by using scrubbing solution containing hafnium-free zirconium sulfate. Consequently, hafnium in the zirconium sponge obtained is reduced to less than 50 ppm. 3. The extractant undergoes no chemical changes but is very stable for a long period. In particular, its solubility in water is small, about 20 ppm maximum, posing no environmental pollution problems such as are often caused by other process raffinates. At the present time, the zirconium and hafnium separation operation is very stable, and zirconium sponge made by this process can be applied satisfactorily to nuclear reactors

  15. Preparation of hafnium carbide by chemical vapor deposition

    International Nuclear Information System (INIS)

    Hertz, Dominique.

    1974-01-01

    Hard, adhesive coatings of single-phase hafnium carbide were obtained by chemical vapor reaction in an atmosphere containing hafnium tetrachloride, methane and a large excess of hydrogen. By varying the gas phase composition and temperature the zones of formation of the different solid phases were studied and the growth of elementary hafnium and carbon deposits evaluated separately. The results show that the mechanism of hafnium carbide deposition does not hardly involve phenomene of homogeneous-phase methane decomposition or tetrachloride reduction by hydrogen unless the atmosphere is very rich or very poor in methane with respect to tetrachloride. However, hydrogen acting inversely on these two reactions, affects the stoichiometry of the substance deposited. The methane decomposition reaction is fairly slow, the reaction leading to hafnium carbide deposition is faster and that of tetrachloride reduction by hydrogen is quite fast [fr

  16. Assessing hafnium on hafnia as an oxygen getter

    International Nuclear Information System (INIS)

    O'Hara, Andrew; Demkov, Alexander A.; Bersuker, Gennadi

    2014-01-01

    Hafnium dioxide or hafnia is a wide band gap dielectric used in a range of electronic applications from field effect transistors to resistive memory. In many of these applications, it is important to maintain control over oxygen stoichiometry, which can be realized in practice by using a metal layer, specifically hafnium, to getter oxygen from the adjacent dielectric. In this paper, we employ density functional theory to study the thermodynamic stability of an interface between (100)-oriented monoclinic hafnia and hafnium metal. The nudged elastic band method is used to calculate the energy barrier for migration of oxygen from the oxide to the metal. Our investigation shows that the presence of hafnium lowers the formation energy of oxygen vacancies in hafnia, but more importantly the oxidation of hafnium through the migration of oxygen from hafnia is favored energetically

  17. Flotation separation of hafnium(IV) from aqueous solutions

    International Nuclear Information System (INIS)

    Downey, D.M.; Narick, C.N.; Cohen, T.A.

    1985-01-01

    A simple, rapid method for the separation of hafnium from aqueous solutions was investigated using sup(175+181)Hf tracer. Cationic hafnium complex ions were floated from dilute acid solutions with sodium lauryl sulfate (SLS) and anionic hafnium complexes were floated from basic and oxalic acid solutions with hexadecyltrimethyl ammonium bromide (HTMAB). The conditions necessary for quantitative recovery of the metal and mechanisms of flotation are described. (author)

  18. Method of separating hafnium from zirconium

    International Nuclear Information System (INIS)

    Megy, J.A.

    1980-01-01

    English. A new anhydrous method was developed for separating zirconium and hafnium, which gives higher separation factors and is more economical than previous methods. A molten phase, comprising a solution of unseparated zirconium and hafnium and a solvent metal, is first prepared. The molten metal phase is contacted with a fused salt phase which includes a zirconium salt. Zirconium and hafnium separation is effected by mutual displacement with hafnium being transported from the molten metal phase to the fused salt phase, while zirconium is transported from the fused salt phase to the molten metal phase. The solvent metal is less electropositive than zirconium. Zinc was chosen as the solvent metal, from a group which also included cadmium, lead, bismuth, copper, and tin. The fused salt phase cations are more electropositive than zirconium and were selected from a group comprising the alkali elements, the alkaline earth elements, the rare earth elements, and aluminum. A portion of the zirconium in the molten metal phase was oxidized by injecting an oxidizing agent, chlorine, to form zirconium tetrachlorid

  19. Flotation separation of hafnium(IV) from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Downey, D.M.; Narick, C.N.; Cohen, T.A.

    1985-09-01

    A simple, rapid method for the separation of hafnium from aqueous solutions was investigated using sup(175 + 181)Hf tracer. Cationic hafnium complex ions were floated from dilute acid solutions with sodium lauryl sulfate (SLS) and anionic hafnium complexes were floated from basic and oxalic acid solutions with hexadecyltrimethyl ammonium bromide (HTMAB). The conditions necessary for quantitative recovery of the metal and mechanisms of flotation are described. (author). 21 refs.; 5 figs.

  20. Kinetic studies on the hafnium nad deuterium

    International Nuclear Information System (INIS)

    Bing Wenzeng; Long Xinggui; Zhu Zuliang

    2009-04-01

    Through the method of reaction rate analysis in a constant volume reactor, the time dependence of the pressure drop of the hafnium deuteride formation are studied over a temperature range 573-873 K on a metal hydride thermodynamic and kinetic parameters measuring apparatus. The rate constants of the hafnium deuteride formation, which are 0.0530 s -1 , 0.0452 s -1 , 0.0319 s -1 , 0.0261 s -1 , are calculated at a serial temperatures of 573 K, 673 K, 773 K, 873 K and the initial pressure of 13 kPa. The activation energy of the reaction is (-10.1±1.5) kJ·mol -1 . Comparing the above results with those of titanium deuteride formation on the same measuring apparatus, the kinetic mechanism of the deuteride formation of hafnium and titanium is considered different. It is concluded that the reaction rate of hafnium absorbing deuterium may be controlled by phase transformation and surface oxidation. (authors)

  1. Electronic properties of hafnium oxide: A contribution from defects and traps

    Energy Technology Data Exchange (ETDEWEB)

    Gritsenko, Vladimir A., E-mail: grits@isp.nsc.ru; Perevalov, Timofey V.; Islamov, Damir R., E-mail: damir@isp.nsc.ru

    2016-02-15

    In the present article, we give a review of modern data and latest achievements pertaining to the study of electronic properties of oxygen vacancies in hafnium oxide. Hafnium oxide is a key dielectric for use in many advanced silicon devices. Oxygen vacancies in hafnium oxide largely determine the electronic properties of the material. We show that the electronic transitions between the states due to oxygen vacancies largely determine the optical absorption and luminescent properties of hafnium oxide. We discuss the role of oxygen vacancies as traps that facilitate charge transport in hafnium oxide films. Also, we demonstrate the fact that the electrical conductivity in hafnium oxide is controlled by the phonon-assisted tunnelling of charge carriers between traps that were identified as oxygen vacancies.

  2. Preparation of complexes of zirconium and hafnium tetrachlorides with phosphorus oxychloride

    International Nuclear Information System (INIS)

    McLaughlin, D.F.

    1989-01-01

    This patent describes an improvement in a method for separating hafnium tetrachloride from zirconium tetrachloride where a complex of zirconium-hafnium tetrachlorides and phosphorus oxychloride is prepared from zirconium-hafnium tetrachlorides and the complex of zirconium-hafnium tetrachlorides and phosphorus oxychloride is introduced into a distillation column, which distillation column has a reboiler connected at the bottom and a reflux condenser connected at the top and where a hafnium tetrachloride enriched stream is taken from the top of the column and a zirconium enriched tetrachloride stream is taken from the bottom of the column. The improvement comprising: prepurifying the zirconium-hafnium tetrachlorides, prior to preparation of the complex and introduction of the complex into a distillation column, to substantially eliminate iron chloride from the zirconium hafnium tetrachlorides, whereby buildup or iron chloride in the distillation column and in the reboiler is substantially eliminated and the column can be operated in a continuous, stable and efficient manner

  3. Study of fine structure of deformed hafnium

    International Nuclear Information System (INIS)

    Voskresenskaya, L.A.; Petukhova, A.S.; Kovalev, K.S.

    1978-01-01

    Variations in the hafnium fine structure following the cold plastic deformation have been studied. The fine structure condition has been studied through the harmonic analysis of the profile of the X-ray diffraction line, obtained at the DRON-I installation. Received has been the dependence of the crystal lattice microdistortions value on the deformation extent for hafnium. This dependence is compared with the corresponding one for zirconium. It is found out that at all the deformations the microdistortion distribution is uniform. The microdistortion value grows with the increase in the compression. During the mechanical impact higher microdistortions of the crystal lattice occur in the hafnium rather than in zirconium

  4. Properties of filmogen solutions and films of hafnium compounds

    International Nuclear Information System (INIS)

    Sviridova, A.I.

    1986-01-01

    Study on hafnium hydrolizing compound solutions, used for hafnium oxide homogeneous layer formation, is conducted. In particular, electric conductivity, acidity and refractive index were investigated depending on the sal on ether concentration and the storage time. Oxyhafnium nitrate, hafnium chloride in ethanol, dichlorodiethoxyhafnium, hafnium oxychloride were used as initial compounds. Hydrolysis of hafnium compounds in solution occurs partially; further process occurs in the thin layer on the optical element surface; final decomposition is performed under heat treatment. It is ascertained, that alcoholic-aqueous solutions of inorganic salts can be filmogen only at definite acidity, density and viscosity (1.33-2.5 cp.). It is also ascertained that refractive index values and transmission spectral boundary of coatings, produced from alkoxy compound solutions and from chloride salt solutions, are practically the same. Transmittance boundary in ultraviolet region of spectrum of oxide films produced from nitrate and chloride solutions, varies with the heating temperature increase differently

  5. Investigation of ferromagnetism in oxygen deficient hafnium oxide thin films

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, Erwin; Kurian, Jose; Krockenberger, Yoshiharu; Alff, Lambert [Institut fuer Materialwissenschaft, TU Darmstadt (Germany); Suter, Andreas [PSI, Villingen (Switzerland); Wilhelm, Fabrice; Rogalev, Andrei [ESRF, Grenoble (France)

    2008-07-01

    Oxygen deficient thin films of hafnium oxide were grown on single crystal r-cut and c-cut sapphire by reactive molecular beam epitaxy. RF-activated oxygen was used for the in situ oxidation of hafnium oxide thin films. Oxidation conditions were varied substantially in order to create oxygen deficiency in hafnium oxide films intentionally. The films were characterized by X-ray and magnetic measurements. X-ray diffraction studies show an increase in lattice parameter with increasing oxygen deficiency. Oxygen deficient hafnium oxide thin films also showed a decreasing bandgap with increase in oxygen deficiency. The magnetisation studies carried out with SQUID did not show any sign of ferromagnetism in the whole oxygen deficiency range. X-ray magnetic circular dichroism measurements also confirmed the absence of ferromagnetism in oxygen deficient hafnium oxide thin films.

  6. Titanium zirconium and hafnium coordination compounds with vanillin thiosemicarbazone

    International Nuclear Information System (INIS)

    Konunova, Ts.B.; Kudritskaya, S.A.

    1987-01-01

    Coordination compounds of titanium zirconium and hafnium tetrachlorides with vanillin thiosemicarbazone of MCl 4 x nLig composition, where n=1.5, 4 for titanium and 1, 2, 4 for zirconium and hafnium, are synthesized. Molar conductivity of ethanol solutions is measured; IR spectroscopic and thermochemical investigation are carried out. The supposition about ligand coordination via sulfur and azomethine nitrogen atoms is made. In all cases hafnium forms stable compounds than zirconium

  7. Hafnium - material for chemical apparatus engineering

    International Nuclear Information System (INIS)

    Jennert, D.

    1981-01-01

    This work describes - on the background of available literature - the properties of hafnium in technical quality (DIN-material No. 2.6400) as material for chemical apparatus engineering. The occurence, refining, physical and chemical properties will be described as well as the material behavior. In conclusion, it has been found that there is, at present, sufficient information for the engineering of hafnium which has to be completed by additional investigations for special applications. (orig.) [de

  8. Internal Dosimetry for Inhalation of Hafnium Tritide Aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Inkret, W.C.T.; Schillaci, M.E.; Boyce, M.K.; Cheng, Y.S.; Efurd, D.W.; Little, T.T.; Miller, G.; Musgrave, J.A.; Wermer, J.R

    2001-07-01

    Metal tritides with low dissolution rates may have residence times in the lungs which are considerably longer than the biological half-time normally associated with tritium in body water, resulting in long-term irradiation of the lungs by low energy {beta} particles and bremsstrahlung X rays. Samples of hafnium tritide were placed in a lung simulant fluid to determine approximate lung dissolution rates. Hafnium hydride samples were analysed for particle size distribution with a scanning electron microscope. Lung simulant data indicated a biological dissolution half-time for hafnium tritide on the order of 10{sup 5}d. Hafnium hydride particle sizes ranged between 2 and 10 {mu}m, corresponding to activity median aerodynamic diameters of 5 to 25 {mu}m. Review of in vitro dissolution data, development of a biokinetic model, and determination of secondary limits for 1 {mu}m AMAD particles are presented and discussed. (author)

  9. Titanium(IV), zirconium, hafnium and thorium

    International Nuclear Information System (INIS)

    Brown, Paul L.; Ekberg, Christian

    2016-01-01

    Titanium can exist in solution in a number of oxidation states. The titanium(IV) exists in acidic solutions as the oxo-cation, TiO 2+ , rather than Ti 4+ . Zirconium is used in the ceramics industry and in nuclear industry as a cladding material in reactors where its reactivity towards hydrolysis reactions and precipitation of oxides may result in degradation of the cladding. In nature, hafnium is found together with zirconium and as a consequence of the contraction in ionic radii that occurs due to the 4f -electron shell, the ionic radius of hafnium is almost identical to that of zirconium. All isotopes of thorium are radioactive and, as a consequence of it being fertile, thorium is important in the nuclear fuel cycle. The polymeric hydrolysis species that have been reported for thorium are somewhat different to those identified for zirconium and hafnium, although thorium does form the Th 4 (OH) 8 8+ species.

  10. Ferroelectricity in undoped hafnium oxide

    International Nuclear Information System (INIS)

    Polakowski, Patrick; Müller, Johannes

    2015-01-01

    We report the observation of ferroelectric characteristics in undoped hafnium oxide thin films in a thickness range of 4–20 nm. The undoped films were fabricated using atomic layer deposition (ALD) and embedded into titanium nitride based metal-insulator-metal (MIM) capacitors for electrical evaluation. Structural as well as electrical evidence for the appearance of a ferroelectric phase in pure hafnium oxide was collected with respect to film thickness and thermal budget applied during titanium nitride electrode formation. Using grazing incidence X-Ray diffraction (GIXRD) analysis, we observed an enhanced suppression of the monoclinic phase fraction in favor of an orthorhombic, potentially, ferroelectric phase with decreasing thickness/grain size and for a titanium nitride electrode formation below crystallization temperature. The electrical presence of ferroelectricity was confirmed using polarization measurements. A remanent polarization P r of up to 10 μC cm −2 as well as a read/write endurance of 1.6 × 10 5 cycles was measured for the pure oxide. The experimental results reported here strongly support the intrinsic nature of the ferroelectric phase in hafnium oxide and expand its applicability beyond the doped systems

  11. Hafnium-Based Contrast Agents for X-ray Computed Tomography.

    Science.gov (United States)

    Berger, Markus; Bauser, Marcus; Frenzel, Thomas; Hilger, Christoph Stephan; Jost, Gregor; Lauria, Silvia; Morgenstern, Bernd; Neis, Christian; Pietsch, Hubertus; Sülzle, Detlev; Hegetschweiler, Kaspar

    2017-05-15

    Heavy-metal-based contrast agents (CAs) offer enhanced X-ray absorption for X-ray computed tomography (CT) compared to the currently used iodinated CAs. We report the discovery of new lanthanide and hafnium azainositol complexes and their optimization with respect to high water solubility and stability. Our efforts culminated in the synthesis of BAY-576, an uncharged hafnium complex with 3:2 stoichiometry and broken complex symmetry. The superior properties of this asymmetrically substituted hafnium CA were demonstrated by a CT angiography study in rabbits that revealed excellent signal contrast enhancement.

  12. 40 CFR 471.90 - Applicability; description of the zirconium-hafnium forming subcategory.

    Science.gov (United States)

    2010-07-01

    ... zirconium-hafnium forming subcategory. 471.90 Section 471.90 Protection of Environment ENVIRONMENTAL... POINT SOURCE CATEGORY Zirconium-Hafnium Forming Subcategory § 471.90 Applicability; description of the zirconium-hafnium forming subcategory. This subpart applies to discharges of pollutants to waters of the...

  13. Calorimetric measurements on hafnium titanate

    International Nuclear Information System (INIS)

    Kandan, R.; Prabhakara Reddy, B.; Panneerselvam, G.; Nagarajan, K.

    2012-01-01

    Owing to its desirable nuclear and mechanical properties such as good absorption cross-section for thermal neutrons (105 barns), hafnium titanate (HfTiO 4 ) finds application as control rods for nuclear reactors. An accurate knowledge of the thermo physical properties of this material is necessary for design of control rod and for modeling its performance. Heat capacity is an important thermodynamic property that determines the temperature dependent variation of all other thermodynamic properties. Hence enthalpy increments of hafnium titanate (HfTiO 4 ) were measured in the temperature range 803-1663 K by employing the method of inverse drop calorimetry using high temperature differential calorimeter

  14. Preparation of complexes of zirconium and hafnium tetrachlorides with phosphorus oxychloride

    International Nuclear Information System (INIS)

    Snyder, T.S.; Stoltz, R.A.

    1989-01-01

    This patent describes an improvement in a method for separating hafnium chloride from zirconium chloride using a distillation column, with a hafnium chloride enriched vapor stream taken from the top of the column and a zirconium enriched chloride stream taken from the bottom of the column. The improvement comprising: purifying the zirconium-hafnium chloride in a molten salt purification vessel prior to or after introduction into the distillation column to substantially eliminate iron chloride from the zirconium-hafnium chloride by at least periodically removing iron chloride from the molten salt purification vessel by electrochemically plating iron onto an electrode in the molten salt purification vessel. The molten salt in the molten salt purification vessel consisting essentially of a mixture of chlorides selected from the group consisting of alkali metals, alkaline earth metals, zirconium, hafnium, aluminum, manganese, and zinc

  15. Method of purifying zirconium tetrachloride and hafnium tetrachloride in a vapor stream

    International Nuclear Information System (INIS)

    Snyder, T.S.; Stolz, R.A.

    1992-01-01

    This patent describes a method of purifying zirconium tetrachloride and hafnium tetrachloride in a vapor stream from a sand chlorinator in which the silicon and metals present in sand fed to the chlorinator are converted to chlorides at temperatures over about 800 degrees C. It comprises cooling a vapor stream from a sand chlorinator, the vapor stream containing principally silicon tetrachloride, zirconium tetrachloride, and hafnium tetrachloride contaminated with ferric chloride, to a temperature of from about 335 degrees C to about 600 degrees C; flowing the vapor stream through a gaseous diffusion separative barrier to produce a silicon tetrachloride-containing vapor stream concentrated in zirconium tetrachloride and hafnium tetrachloride and a silicon tetrachloride-containing vapor stream depleted in zirconium tetrachloride and hafnium tetrachloride; adsorbing the ferric chloride in the separative barrier; and recovering the silicon tetrachloride stream concentrated in zirconium tetrachloride and hafnium tetrachloride separately from the silicon tetrachloride stream depleted in zirconium tetrachloride and hafnium tetrachloride

  16. Spectrofluorimetric determination of hafnium and zirconium with 3,7-dihydroxyflavone

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Takushi; Suzuki, Osamu; Seuzuki, Tetsuo; Murata, Akira

    1986-04-01

    The absorptive and fluorescent characteristics of the hafnium and zirconium complexes of 3-hydroxyflavone and its 12 hydroxy and methoxy derivatives have been studied. The fluorescence of the 1:1 hafnium - 3,7-dihydroxyflavone complex (lambdasub(ex.)397 nm,lambdasub(em.) 465 nm) in 3 M hydrochloric acid has been used to determine 2-40 ng ml/sup -1/ of hafnium. The fluorescence of the 1:1 zirconium - 3,7-dihydroxyflavone complex (lambdasub(ex.) 395 nm, lambda sub(em.) 465 nm) at pH 2.0 in 0.02 M sulphate solution has been used to determine 2-40 ng ml/sup -1/ of zirconium. These methods are very sensitive and can be used for the simultaneous determination of hafnium and zirconium with an error of about 5%.

  17. Molten salt extractive distillation process for zirconium-hafnium separation

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Stoltz, R.A.

    1989-01-01

    This patent describes an improvement in a process for zirconium-hafnium separation. It utilizes an extractive distillation column with a mixture of zirconium and hafnium tetrachlorides introduced into a distillation column having a top and bottom with hafnium enriched overheads taken from the top of the column and a molten salt solvent circulated through the column to provide a liquid phase, and with molten salt solvent containing zirconium chloride being taken from the bottom of the distillation column. The improvements comprising: utilizing a molten salt solvent consisting principally of lithium chloride and at least one of sodium, potassium, magnesium and calcium chlorides; stripping of the zirconium chloride taken from the bottom of the distillation column by electrochemically reducing zirconium from the molten salt solvent; and utilizing a pressurized reflux condenser on the top of the column to add the hafnium chloride enriched overheads to the molten salt solvent previously stripped of zirconium chloride

  18. 40 CFR 421.330 - Applicability: Description of the primary zirconium and hafnium subcategory.

    Science.gov (United States)

    2010-07-01

    ... primary zirconium and hafnium subcategory. 421.330 Section 421.330 Protection of Environment ENVIRONMENTAL... CATEGORY Primary Zirconium and Hafnium Subcategory § 421.330 Applicability: Description of the primary zirconium and hafnium subcategory. The provisions of this subpart are applicable to discharges resulting...

  19. Design and fabrication of hafnium tube to control the power of the irradiation test fuel in HANARO

    Energy Technology Data Exchange (ETDEWEB)

    Kim, D. H.; Lee, C. B.; Kim, Y. M.; Yang, Y. S.; Jung, Y. H

    2003-05-01

    For the irradiation test at HANARO, non-instrumentation capsule was manufactured and hafnium tube was used to control LHGR of HANARO. Hafnium tube can control the irradiation condition of HANARO similar to that of commercial reactor. Hafnium tube thickness was determined by the LHGR calculated at OR-4 irradiation hole to be installed the non-instrumented capsule. To fabricate the hafnium tube with hafnium plate, the fabrication method was determined by using the hafnium mechanical properties. And the tensile strength of hafnium was confirmed by tensile test. This report is confirmed the LHGR control at the OR-4 and the Hafnium fabrication for in used which the AFPCAP non-instrumented irradiation capsule.

  20. Use of X-ray fluorescence analysis for the determination of hafnium in zircalloys

    International Nuclear Information System (INIS)

    Sato, I.M.; Salvador, V.L.R.; Lordello, A.R.

    1985-01-01

    The determination of hafnium at trace levels (ppm) in the presence of zirconium by X-ray fluorescence technique is presented. The samples were prepared in the form of double-layer pellets, with boric acid as the binding material. The most sensitive first order line of hafnium HfLα (0.157 nm), which is used analyticaly, has approximately 67% overlapping with second order line of zirconium ZrKα 1 , (0.079 nm). As the excitation potencial of zirconium is larger than hafnium, the best condition was selected, so that the interference of zirconium intensity would not be significant in hafnium analytical line. The method allowed the determination of hafnium above 5.0 ppm (LLd = 1.5 ppm) with an accuracy of less than 10%. (Author) [pt

  1. Use of hafnium in control bars of nuclear reactors

    International Nuclear Information System (INIS)

    Ramirez S, J.R.; Alonso V, G.

    2003-01-01

    Recently the use of hafnium as neutron absorber material in nuclear reactors has been reason of investigation by virtue of that this material has nuclear properties as to the neutrons absorption and structural that can prolong the useful life of the control mechanisms of the nuclear reactors. In this work some of those more significant hafnium properties are presented like nuclear material. Also there are presented calculations carried out with the HELIOS code for fuel cells of uranium oxide and of uranium and plutonium mixed oxides under controlled conditions with conventional bars of boron carbide and also with similar bars to which are substituted the absorbent material by metallic hafnium, the results are presented in this work. (Author)

  2. The corrosion behavior of hafnium in high-temperature-water environments

    Energy Technology Data Exchange (ETDEWEB)

    Rishel, D.M.; Smee, J.D.; Kammenzind, B.F.

    1999-10-01

    The high-temperature-water corrosion performance of hafnium is evaluated. Corrosion kinetic data are used to develop correlations that are a function of time and temperature. The evaluation is based on corrosion tests conducted in out-of-pile autoclaves and in out-of-flux locations of the Advanced Test Reactor (ATR) at temperatures ranging from 288 to 360 C. Similar to the corrosion behavior of unalloyed zirconium, the high-temperature-water corrosion response of hafnium exhibits three corrosion regimes: pretransition, posttransition, and spalling. In the pretransition regime, cubic corrosion kinetics are exhibited, whereas in the posttransition regime, linear corrosion kinetics are exhibited. Because of the scatter in the spalling regime data, it is not reasonable to use a best fit of the data to describe spalling regime corrosion. Data also show that neutron irradiation does not alter the corrosion performance of hafnium. Finally, the data illustrate that the corrosion rate of hafnium is significantly less than that of Zircaloy-2 and Zircaloy-4.

  3. Corrosion potentials of hafnium in molten alkaline-earth metal chlorides

    International Nuclear Information System (INIS)

    Kovalik, O.Yu.; Tkhaj, V.D.

    2000-01-01

    Corrosion potentials of hafnium in molten calcium, strontium and barium chlorides are measured and their temperature dependences are determined. It is stated that the corrosion potential of hafnium becomes more electropositive with an increase of the environment temperature. If the temperature is the same the potential shifts to the interval of more electronegative values in the row of CaCl 2 , SrCl 2 , BaCl 2 which corresponds to a lesser corrosion rate in environments positioned from left to right. the comparison of hafnium corrosion potentials with previously measured values for titanium and zirconium shows that a metal activity decrease results in a more electronegative corrosion potential [ru

  4. Electronic structure of pentacene on hafnium studied by ultraviolet photoelectron spectroscopy

    International Nuclear Information System (INIS)

    Kang, Seong Jun; Yi, Yeon Jin; Kim, Chung Yi; Whang, Chung Nam

    2005-01-01

    The electronic structure of pentacene on hafnium, which is a low work function metal, was analyzed by using ultraviolet photoelectron spectroscopy. The energy level alignment was studied by using the onset of the highest occupied molecular orbital level and the shift of the vacuum level of the pentacene layer, which was deposited on a clean hafnium surface in a stepwise manner. The measured onset of the highest occupied molecular orbital energy level was 1.52 eV from the Fermi level of hafnium. The vacuum level was shifted 0.28 eV toward higher binding energy with additional pentacene layers, which means an interfacial dipole exists at the interface between pentacene and hafnium. We confirm that a small electron injection barrier can be achieved by inserting a low work function metal in a pentacene thin-film transistor.

  5. Synthesis of Hafnium-Based Ceramic Materials for Ultra-High Temperature Aerospace Applications

    Science.gov (United States)

    Johnson, Sylvia; Feldman, Jay

    2004-01-01

    This project involved the synthesis of hafnium (Hf)-based ceramic powders and Hf-based precursor solutions that were suitable for preparation of Hf-based ceramics. The Hf-based ceramic materials of interest in this project were hafnium carbide (with nominal composition HE) and hafnium dioxide (HfO2). The materials were prepared at Georgia Institute of Technology and then supplied to research collaborators Dr. Sylvia Johnson and Dr. Jay Feldman) at NASA Ames Research Center.

  6. Application of hafnium hydride control rod to large sodium cooled fast breeder reactor

    Energy Technology Data Exchange (ETDEWEB)

    Ikeda, Kazumi, E-mail: kazumi_ikeda@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Moriwaki, Hiroyuki, E-mail: hiroyuki_moriwaki@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Ohkubo, Yoshiyuki, E-mail: yoshiyuki_okubo@mfbr.mhi.co.jp [Mitsubishi FBR Systems, Inc., 34-17, Jingumae 2-Chome, Shibuya-ku, Tokyo 150-0001 (Japan); Iwasaki, Tomohiko, E-mail: tomohiko.iwasaki@qse.tohoku.ac.jp [Department of Quantum Science and Energy Engineering, Tohoku University, Aoba, Aramaki, Aoba-ku, Sendai-shi, Miyagi-ken 980-8579 (Japan); Konashi, Kenji, E-mail: konashi@imr.tohoku.ac.jp [Institute for Materials Research, Tohoku University, Narita-cho, Oarai-machi, Higashi-Ibaraki-gun, Ibaraki-ken 311-1313 (Japan)

    2014-10-15

    Highlights: • Application of hafnium hydride control rod to large sodium cooled fast breeder reactor. • This paper treats application of an innovative hafnium hydride control rod to a large sodium cooled fast breeder reactor. • Hydrogen absorption triples the reactivity worth by neutron spectrum shift at H/Hf ratio of 1.3. • Lifetime of the control rod quadruples because produced daughters of hafnium isotopes are absorbers. • Nuclear and thermal hydraulic characteristics of the reactor are as good as or better than B-10 enriched boron carbide. - Abstract: This study treats the feasibility of long-lived hafnium hydride control rod in a large sodium-cooled fast breeder reactor by nuclear and thermal analyses. According to the nuclear calculations, it is found that hydrogen absorption of hafnium triples the reactivity by the neutron spectrum shift at the H/Hf ratio of 1.3, and a hafnium transmutation mechanism that produced daughters are absorbers quadruples the lifetime due to a low incineration rate of absorbing nuclides under irradiation. That is to say, the control rod can function well for a long time because an irradiation of 2400 EFPD reduces the reactivity by only 4%. The calculation also reveals that the hafnium hydride control rod can apply to the reactor in that nuclear and thermal characteristics become as good as or better than 80% B-10 enriched boron carbide. For example, the maximum linear heat rate becomes 3% lower. Owing to the better power distribution, the required flow rate decreases approximately by 1%. Consequently, it is concluded on desk analyses that the long lived hafnium hydride control rod is feasible in the large sodium-cooled fast breeder reactor.

  7. X-Ray Photoemission Study of the Oxidation of Hafnium

    International Nuclear Information System (INIS)

    Chourasia, R.; Hickman, J.L.; Miller, R.L.; Nixon, G.A.; Seabolt, M.A.

    2011-01-01

    About 20 angstrom of hafnium were deposited on silicon substrates using the electron beam evaporation technique. Two types of samples were investigated. In one type, the substrate was kept at the ambient temperature. After the deposition, the substrate temperature was increased to 100, 200, and 300 degree C. In the other type, the substrate temperature was held fixed at some value during the deposition. For this type, the substrate temperatures used were 100, 200, 300, 400, 500, 550, and 600 degree C. The samples were characterized in situ by the technique of X-ray photoelectron spectroscopy. No trace of elemental hafnium is observed in the deposited overlayer. Also, there is no evidence of any chemical reactivity between the overlayer and the silicon substrate over the temperature range used. The hafnium overlayer shows a mixture of the dioxide and the suboxide. The ratio of the suboxide to dioxide is observed to be more in the first type of samples. The spectral data indicate that hafnium has a strong affinity for oxygen. The overlayer gets completely oxidized to form HfO 2 at substrate temperature around 300 degree C for the first type of samples and at substrate temperature greater than 550 degree C for the second type

  8. X-Ray Photoemission Study of the Oxidation of Hafnium

    Directory of Open Access Journals (Sweden)

    A. R. Chourasia

    2009-01-01

    Full Text Available About 20 Å of hafnium were deposited on silicon substrates using the electron beam evaporation technique. Two types of samples were investigated. In one type, the substrate was kept at the ambient temperature. After the deposition, the substrate temperature was increased to 100, 200, and 300∘C. In the other type, the substrate temperature was held fixed at some value during the deposition. For this type, the substrate temperatures used were 100, 200, 300, 400, 500, 550, and 600∘C. The samples were characterized in situ by the technique of X-ray photoelectron spectroscopy. No trace of elemental hafnium is observed in the deposited overlayer. Also, there is no evidence of any chemical reactivity between the overlayer and the silicon substrate over the temperature range used. The hafnium overlayer shows a mixture of the dioxide and the suboxide. The ratio of the suboxide to dioxide is observed to be more in the first type of samples. The spectral data indicate that hafnium has a strong affinity for oxygen. The overlayer gets completely oxidized to form HfO2 at substrate temperature around 300∘C for the first type of samples and at substrate temperature greater than 550∘C for the second type.

  9. High temperature diffusion of hafnium in tungsten and a tungsten-hafnium carbide alloy

    International Nuclear Information System (INIS)

    Ozaki, Y.; Zee, R.H.

    1994-01-01

    Refractory metals and ceramics are used extensively in energy systems due to their high temperature properties. This is particularly important in direct conversion systems where thermal to electric conversion efficiency is a direct function of temperature. Tungsten, which has the highest melting temperature among elemental metals, does not possess sufficient creep resistance at temperature above 1,600 K. Different dispersion strengthened tungsten alloys have been developed to extend the usefulness of tungsten to higher temperatures. One of these alloys, tungsten with 0.4 mole percent of finely dispersed HfC particles (W-HfC), has the optimum properties for high temperature applications. Hafnium carbide is used as the strengthening agent due to its high chemical stability and its compatibility with tungsten. The presence of HfC particles retards the rate of grain growth as well as restricting dislocation motion. Both of which are beneficial for creep resistance. The long term behavior of this alloy depends largely on the evolution of its microstructure which is governed by the diffusion of its constituents. Data on the diffusion of carbon in tungsten and tungsten self-diffusion are available, but no direct measurements have been made on the diffusion of hafnium in tungsten. The only diffusion data available are estimated from a coarsening study and these data are highly unreliable. In this study, the diffusion behavior of hafnium in pure tungsten and in a W-HfC alloy was directly measured by means of Secondary Ion Mass Spectroscopy (SIMS). The selection of the W-HfC alloy is due to its importance in high temperature engineering applications, and its higher recrystallization temperature. The presence of HfC particles in tungsten restricts grain growth resulting in better high temperature creep resistance. The higher recrystallization temperature allows measurements to be made over a wider range of temperatures at a relatively constant grain size

  10. Elaboration and characterisation of yttrium oxide and hafnium oxide powders by the sol-gel process

    International Nuclear Information System (INIS)

    Hours, T.

    1988-01-01

    The two classical sol-gel processes, colloidal and polymeric are studied for the preparation of yttrium oxide and hafnium oxide high performance powders. In the colloidal process, controlled and reproducible conditions for the preparation of yttrium oxide and hafnium oxide sols from salts or alkoxides are developed and the hydrothermal synthesis monodisperse hafnium oxide colloids is studied. The polymeric process is studied with hafnium ethyl-hexylate, hydrolysis kinetics for controlled preparation of sols and gels is investigated. Each step of preparation is detailed and powders obtained are characterized [fr

  11. Modelling of Zirconium and Hafnium separation using continuous annular chromatography

    International Nuclear Information System (INIS)

    Moch-Setyadji; Endang Susiantini

    2014-01-01

    Nuclear degrees of zirconium in the form of a metal alloy is the main material for fuel cladding of NPP. Zirconium is also used as sheathing UO 2 kernel in the form of ZrC as a substitute of SiC in the fuel elements of High Temperature Reactor (HTR). Difficulty separating hafnium from zirconium because it has a lot of similarities in the chemical properties of Zr and Hf. Annular chromatography is a device that can be used for separating of zirconium and hafnium to obtain zirconium nuclear grade. Therefore, it is necessary to construct the mathematical modelling that can describe the separation of zirconium and hafnium in the annular chromatography containing anion resin dowex-1X8. The aim of research is to perform separation simulation by using the equilibrium model and mass transfer coefficient resulted from research. Zr and Hf feed used in this research were 26 and 1 g/l, respectively. Height of resin (L), angular velocity (ω) and the superficial flow rate (uz) was varied to determine the effect of each parameter on the separation of Zr and Hf. By using Kd and Dv values resulted previous research. Simulation results showed that zirconium and hafnium can be separated using a continuous annular chromatography with high resin (long bed) 50 cm, superficial flow rate of 0.001 cm/s, the rotation speed of 0.006 rad/min and 20 cm diameter annular. In these conditions the results obtained zirconium concentration of 10,303.226 g/m 3 and hafnium concentration of 12.324 g/m 3 (ppm). (author)

  12. Joint titrimetric determination of zirconium and hafnium

    International Nuclear Information System (INIS)

    Vazquez, Cristina; Botbol, Moises; Bianco de Salas, G.N.; Cornell de Casas, M.I.

    1980-01-01

    A method for the joint titrimetric determination of zirconium and hafnium, which are elements of similar chemical behaviour, is described. The disodic salt of the ethylendiaminetetracetic acid (EDTA) is used for titration, while xilenol orange serves as final point indicator. Prior to titration it is important to evaporate with sulfuric acid, the solution resulting from the zirconium depolymerization process, to adjust the acidity and to eliminate any interferences. The method, that allows the quick and precise determination of zirconium and hafnium in quantities comprised between 0.01 and mg, was applied to the analysis of raw materials and of intermediate and final products in the fabrication of zirconium sponge and zircaloy. (M.E.L.) [es

  13. Compositional characterization of hafnium alloy used as control rod material in nuclear reactor

    International Nuclear Information System (INIS)

    Sharma, P.K.; Bassan, M.K.T.; Avhad, D.K.; Singhal, R.K.

    2014-01-01

    Hafnium (Hf) is a heavy, steel-gray metal in the reactive metals group that is very closely related to zirconium (Zr) and forms a continuous solid-solution at all concentrations of zirconium and hafnium. Hafnium occurs naturally with zirconium at a ratio of approximately 1:50 and is produced exclusively as a co-product of nuclear-grade zirconium. It is used in a variety of applications where few substitutes are available. Thus with its relatively high thermal neutron absorption cross-section, hafnium's biggest application is as control rod material in nuclear reactors. During this work, major (Zirconium (Zr), Cobalt (Co) and Molybdenum (Mo)) and trace ((Iron (Fe), Nickel (Ni) and Titanium (Ti)) elements were measured in the bulk matrices of Hf. These materials are also associated with other impurities such as O, N, H etc.

  14. Bond formation in hafnium atom implantation into SiC induced by high-energy electron irradiation

    International Nuclear Information System (INIS)

    Yasuda, H.; Mori, H.; Sakata, T.; Naka, M.; Fujita, H.

    1992-01-01

    Bilayer films of Hf (target atoms)/α-SiC (substrate) were irradiated with 2 MeV electrons in an ultra-high voltage electron microscope (UHVEM), with the electron beam incident on the hafnium layer. As a result of the irradiation, hafnium atoms were implanted into the SiC substrate. Changes in the microstructure and valence electronic states associated with the implantation were studied by a combination of UHVEM and Auger valence electron spectroscopy. The implantation process is summarized as follows. (1) Irradiation with 2 MeV electrons first induces a crystalline-to-amorphous transition in α-SiC. (2) Hafnium atoms which have been knocked-off from the hafnium layer by collision with the 2 MeV electrons are implanted into the resultant amorphous SiC. (3) The implanted hafnium atoms make preferential bonding to carbon atoms. (4) With continued irradiation, the hafnium atoms repeat the displacement along the beam direction and the subsequent bonding with the dangling hybrids of carbon and silicon. The repetition of the displacement and subsequent bonding lead to the deep implantation of hafnium atoms into the SiC substrate. It is concluded that implantation successfully occurs when the bond strength between a constituent atom of a substrate and an injected atom is stronger than that between constituent atoms of a substrate. (Author)

  15. Hafnium Resonance Parameter Analysis Using Neutron Capture and Transmission Experiments

    International Nuclear Information System (INIS)

    MJ Trbovich; DP Barry; RE Slovacck; Y Danon; RC Block; JA Burke; NJ Drindak; G Leinweber; RV Ballad

    2004-01-01

    The focus of this work is to determine resonance parameters for stable hafnium isotopes in the 0.005-200 eV region, with special emphasis on the overlapping 176 Hf and 178 Hf resonances near 8 eV. The large neutron cross section of hafnium, combined with its corrosion resistance and excellent mechanical properties, make it a useful material for controlling nuclear reactions. Experiments measuring neutron capture and transmission were performed at the Rensselaer Polytechnic Institute (RPI) electron linear accelerator (LINAC) using the time of flight method. 6 Li glass scintillation detectors were used for transmission experiments at flight path lengths of 15 and 25 m. Capture experiments were done using a sixteen section NaI(Tl) multiplicity detector at a flight path length of 25 m. These experiments utilized various thicknesses of metallic and isotopically-enriched liquid samples. The liquid samples were designed to provide information on the 176 Hf and 178 Hf contributions to the 8 eV doublet without saturation. Data analysis was done using the R-matrix Bayesian code SAMMY version M6 beta. SAMMY is able to account for experimental resolution effects for each of the experimental setups at the RPI LINAC, and also can correct for multiple scattering effects in neutron capture yield data. The combined capture and transmission data analysis yielded resonance parameters for all hafnium isotopes from 0.005-200 eV. Resonance integrals were calculated along with errors for each hafnium isotope using the NJOY [1] and INTER [2] codes. The isotopic resonance integrals calculated were significantly different than previously published values; however the calculated elemental hafnium resonance integral changed very little

  16. Zirconium and hafnium in the southeastern Atlantic States

    Science.gov (United States)

    Mertie, J.B.

    1958-01-01

    The principal source of zirconium and hafnium is zircon, though a minor source is baddeleyite, mined only in Brazil. Zircon is an accessory mineral in igneous, metamorphic, and sedimentary rocks, but rarely occurs in hardrock in minable quantities. The principal sources of zircon are therefore alluvial deposits, which are mined in many countries of five continents. The principal commercial deposits in the United States are in Florida, though others exist elsewhere in the southeastern Coastal Plain. The evidence indicates that conditions for the accumulation of workable deposits of heavy minerals were more favorable during the interglacial stages of the Pleistocene epoch than during Recent time. Therefore detrital ores of large volume and high tenor are more likely to be found in the terrace deposits than along the present beaches. Other concentrations of heavy minerals, however, are possible at favored sites close to the Fall Line where the Tuscaloosa formation rests upon the crystalline rocks of the Piedmont province. A score of heavy and semiheavy minerals occur in the detrital deposits of Florida, but the principal salable minerals are ilmenite, leucoxene, rutile, and zircon, though monazite and staurolite are saved at some mining plants. Commercial deposits of heavy minerals are generally required to have a tenor of 4 percent, though ores with a lower tenor can be mined at a profit if the content of monazite is notably high. The percentages of zircon in the concentrates ranges from 10 to 16 percent, and in eastern Florida from 13 to 15 percent. Thus the tenor in zircon of the ore-bearing sands ranges from 0.4 to 0.6 percent. The content of hafnium in zircon is immaterial for many uses, but for some purposes very high or very low tenors in hafnium are required. Alluvial zircon cannot be separated into such varieties, which, if needed, must be obtained from sources in bedrock. It thus becomes necessary to determine the Hf : Zr ratios in zircon from many kinds of

  17. Niobium and hafnium grown on porous membranes

    International Nuclear Information System (INIS)

    Morant, C.; Marquez, F.; Campo, T.; Sanz, J.M.; Elizalde, E.

    2010-01-01

    In this work we report on a method for fabricating highly ordered nanostructures of niobium and hafnium metals by physical vapour deposition using two different templates: anodized aluminum oxide membranes (AAO) and zirconium onto AAO membranes (Zr/AAO). The growth mechanism of these metal nanostructures is clearly different depending on the material used as a template. A different morphology was obtained by using AAO or Zr/AAO templates: when the metal is deposited onto AAO membranes, nanospheres with ordered hexagonal regularity are obtained; however, when the metal is deposited onto a Zr/AAO template, highly ordered nanocones are formed. The experimental approach described in this work is simple and suitable for synthesizing nanospheres or nanoholes of niobium and hafnium metals in a highly ordered structure.

  18. Analytical study of zirconium and hafnium α-hydroxy carboxylates

    International Nuclear Information System (INIS)

    Terra, V.R.

    1991-01-01

    The analytical study of zirconium and hafnium α-hydroxy carboxylates was described. For this purpose dl-mandelic, dl-p-bromo mandelic, dl-2-naphthyl glycolic, and benzilic acids were prepared. These were used in conjunction with glycolic, dl-lactic, dl-2-hydroxy isovaleric, dl-2-hydroxy hexanoic, and dl-2-hydroxy dodecanoic acids in order to synthesize the zirconium(IV) and hafnium(IV) tetrakis(α-hydroxy carboxylates). The compounds were characterized by melting point determination, infrared spectroscopy, thermogravimetric analysis, calcination to oxides and X-ray diffractometry by the powder method. (C.G.C)

  19. High temperature evaporation of titanium, zirconium and hafnium carbides

    International Nuclear Information System (INIS)

    Gusev, A.I.; Rempel', A.A.

    1991-01-01

    Evaporation of cubic nonstoichiometric carbides of titanium, zirconium and hafnium in a comparatively low-temperature interval (1800-2700) with detailed crystallochemical sample certification is studied. Titanium carbide is characterized by the maximum evaporation rate: at T>2300 K it loses 3% of sample mass during an hour and at T>2400 K titanium carbide evaporation becomes extremely rapid. Zirconium and hafnium carbide evaporation rates are several times lower than titanium carbide evaporation rates at similar temperatures. Partial pressures of metals and carbon over the carbides studied are calculated on the base of evaporation rates

  20. Determination of hafnium, molybdenum, and vanadium in niobium and niobium-based alloys by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    Ide, Kunikazu; Kobayashi, Takeshi; Sudo, Emiko.

    1985-01-01

    The analytical procedure is as follows: Weigh 1 g of a sample and put it into a 100 cm 3 PTFE beaker. Add 5 ml of distilled water and 5 ml of hydrofluoric acid, and then heat the solution on a hot plate, adding 3 ml of nitric acid dropwise. Dilute the solution to 100 cm 3 with distilled water. When hafnium is determined, add 2 g of diammonium titanium hexafluoride ((NH 4 ) 2 TiF 6 )) before dilution. Working standard solutions are prepared by adding the stock standard solutions of hafnium, molybdenum, and vanadium into niobium solutions. When hafnium is determined, add 2 g of (NH 4 ) 2 TiF 6 and the alloying elements in amounts corresponding to those in sample solutions into the working standard solutions. The tolerable amounts of hydrofluoric acid were 2.9 M, 2.1 M, and 3.1 M and those of nitric acid were 1.0 M, 1.6 M, and 1.6 M for hafnium, molybdenum, and vanadium, respectively. It was found that (NH 4 ) 2 TiF 6 greatly increased the sensitivity for hafnium determination. Niobium showed minus effect for hafnium and plus effect for molybdenum and vanadium. The atomic absorption of molybdenum and vanadium were not influenced by the presence of 20 % of each alloying element, while the atomic absorption of hafnium was given plus effect by 20 % of zirconium, iron, cobalt, nickel, manganese, chromium or vanadium and minus effect by 20 % tungsten. The analytical values of hafnium, molybdenum, and vanadium in niobium-based alloys by this method showed a good agreement with those by X-ray fluorescence analysis. The lower limits of determination (S/N=2) were 0.05, 0.001, and 0.002 % and the relative standard deviation were 3, 1, and 1.5 % for hafnium, molybdenum, and vanadium, respectively. (author)

  1. Separation of zirconium from hafnium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Felipe, Elaine C.B.; Palhares, Hugo G.; Ladeira, Ana Claudia Q., E-mail: elainecfelipe@yahoo.com.br, E-mail: hugopalhares@gmail.com, E-mail: ana.ladeira@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Zirconium and hafnium are two of the most important metals for the nuclear industry. Hafnium occurs in all zirconium ores usually in the range 2 - 3%. However, for the most nuclear industry applications, it is necessary to use a zirconium of extremely pure level. The current work consists in the separation of zirconium and hafnium by the ion exchange method in order to obtain a zirconium concentrate of high purity. The zirconium and hafnium liquors were produced from the leaching of the Zr(OH){sub 4} and Hf(OH){sub 4} with nitric acid for 24 hours. From these two liquors it was prepared one solution containing 7.5 x 10{sup -2} mol L{sup -1} of Zr and 5.8 x 10{sup -3} mol L{sup -1} of Hf with acidity of 1 M. Ion exchange experiments were carried out in batch with the resins Dowex 50WX4, Dowex 50WX8 100, Dowex 50WX8 50, Amberlite IR-120 and Marathon C at constant temperature 28 deg C. Other variables such as, acidity and agitation were kept constant. The data were adjusted to Langmuir equation in order to calculate the maximum loading capacity (q{sub max}) of the resins, the distribution coefficient (K{sub d}) for Zr and Hf and the separation factor (α{sub Hf}{sup Zr} ). The results of maximum loading capacity (q{sub max}) for Zr and Hf, in mmol g{sup -}1, showed that the most suitable resins for columns experiments are: Dowex 50WX4 50 (q{sub max} Z{sub r} = 2.21, Hf = 0.18), Dowex 50WX8 50 (q{sub max} Zr = 1.89, Hf = 0.13) and Amberlite (q{sub max} Zr = 1.64, Hf = 0.12). However, separations factors, α{sub Hf}{sup Zr}, showed that the resins are not selective. (author)

  2. On the stabilization of niobium(V) solutions by zirconium(IV) and hafnium(IV)

    DEFF Research Database (Denmark)

    Sørensen, E.; Bjerre, A.B.

    1992-01-01

    Niobium cannot be separated from zirconium or hafnium when these elements occur together in solution with common anions such as chloride and sulphate. This is ascribed to the co-polymerization of niobium(V) and the hydrolysed ionic species of zirconium(IV) and hafnium(IV) to form colloidal...

  3. Analysis of hafnium in zirconium alloys

    International Nuclear Information System (INIS)

    Kondo, Isao; Sakai, Fumiaki; Ohuchi, Yoshifusa; Nakamura, Hisashi

    1977-01-01

    It is required to analyse alloying components and impurity elements in the acceptance analysis of zirconium alloys as the material for fuel cladding tubes and pressure tubes for advanced thermal reactors. Because of extreme similarity in chemical properties between zirconium and hafnium, about 100 ppm of hafnium is usually contained in zirconium alloys. Zircaloy-2 alloy and 2.5% Nb-zirconium with the addition of hafnium had been prepared as in-house standard samples for rapid analysis. Study was made on fluorescent X-ray analysis and emission spectral analysis to establish the analytical method. By using these in-house standard samples, acceptance analysis was successfully carried out for the fuel cladding tubes for advanced thermal reactors. Sulfuric acid solution was prepared from JAERI-Z 1, 2 and 3, the standard sample for zircaloy-2 prepared by the Analytical Committee on Nuclear Fuel and Reactor Materials, JAERI, and zirconium oxide (Hf 1 ppm/Zr). Standard Hf solution was added to the sulfuric acid solution step by step, to make up a series of the standard oxide samples by the precipitation process. By the use of these standard samples, the development of the analytical method and joint analysis were made by the three-member analytical technique research group including PNC. The analytical precision for the fluorescent X-ray analysis was improved by attaching a metallic yttrium filter to the window of an X-ray tube so as to suppress the effect due to zirconium matrix. The variation factor of the joint analysis was about 10% to show good agreement, and the indication value was determined. (Kobatake, H.)

  4. Knight shift in scandium and its alloys with hafnium and titanium

    International Nuclear Information System (INIS)

    Chachkhiani, Z.B.; Chechernikov, V.I.; Martynova, L.F.; Nidel'ko, V.I.; Chachkhiani, L.G.; Georgadze, G.S.

    1981-01-01

    Results of the investigation of NMR on 45 Sc nuclei and magnetic susceptibility of scandium and its solid solutions with titanium and hafnium are presented. It is shown that the existing hybridization of S and d zones in pure scandium and its alloys with titanium and hafnium affects the Knight shift reducing the value of the contact contribution. The temperature behaviour of the Knight shift from the temperature dependence and spin susceptibility of collectivized d electrons [ru

  5. Composition and microstructure of zirconium and hafnium germanates obtained by different chemical routes

    International Nuclear Information System (INIS)

    Utkin, A.V.; Prokip, V.E.; Baklanova, N.I.

    2014-01-01

    The phase composition and morphology of zirconium and hafnium germanates synthesized by ceramic and co-precipitation routes were studied. The products were characterized using high-temperature X-ray diffraction analysis (XRD), Raman spectroscopy, scanning electron microscopy (SEM) and thermal (TG/DTA) analysis. To investigate the phase composition and stoichiometry of compounds the unit cell parameters were refined by full-profile Rietveld XRD analysis. The morphology of products and its evolution during high-temperature treatment was examined by SEM analysis. It was stated that there is the strong dependence of the phase composition and morphology of products on the preparation route. The ceramic route requires a multi-stage high-temperature treatment to obtain zirconium and hafnium germanates of 95% purity or more. Also, there are strong diffusion limitations to obtain hafnium germanate Hf 3 GeO 8 by ceramic route. On the contrary, the co-precipitation route leads to the formation of nanocrystalline single phase germanates of stoichiometric composition at a relatively low temperatures (less than 1000 °C). The results of quantitative XRD analysis showed the hafnium germanates are stoichiometric compounds in contrast to zirconium germanates that form a set of solid solutions. This distinction may be related to the difference in the ion radii of Zr and Hf. - Graphical abstract: The phase composition and morphology of zirconium and hafnium germanates synthesized by ceramic and co-precipitation routes were studied. It was stated that there is the strong dependence of the phase composition and morphology of products on the preparation route. Display Omitted - Highlights: • Zr and Hf germanates were synthesized by ceramic and co-precipitation routes. • The morphology of products depends on the synthesis parameters. • Zirconium germanates forms a set of solid solutions. • Hafnium germanates are stoichiometric compounds

  6. Recovery of hafnium radioisotopes from a proton irradiated tantalum target

    International Nuclear Information System (INIS)

    Taylor, W.A.; Garcia, J.G.; Hamilton, V.T.; Heaton, R.C.; Jamriska, D.J.; Ott, M.A.; Philips, D.R.; Radzinski, S.D.

    1998-01-01

    The 178m2 Hf nucleus, with its long half-life (31 y) and high-spin isomeric state (16 + ) is desired for new and exotic nuclear physics studies. The Los Alamos Radioisotope Program irradiated a kilogram of natural tantalum at the Los Alamos Meson Physics Facility in early 1981. After fifteen years of decay, this target was ideal for the recovery of 178m2 Hf. There was more than a millicurie of 178m2 Hf produced during this irradiation and there has been a sufficient period of time for most of the other hafnium radioisotopes to decayed away. Traditionally, separation techniques for recovering hafnium isotopes from tantalum targets employ solvent extractions with reagents that are considered hazardous. These techniques are no longer condoned because they generate a mixed-waste (radioactive and hazardous components) that can not be treated for disposal. In this paper we describe a new and unique procedure for the recovery of hafnium radioisotopes from a highly radioactive, proton irradiated, tantalum target using reagents that do not contribute a hazardous waste component. (author)

  7. Investigation of colourless complexes of thorium, hafnium and zirconium

    International Nuclear Information System (INIS)

    Kiciak, S.; Stefanowicz, T.; Gontarz, H.; Swit, Z.

    1980-01-01

    The investigations conducted in the Institute of General Chemistry of Poznan Technical University in partial cooperation with Kharkhof Technical University related with thorium, hafnium and zirconium complexes are reviewed. (author)

  8. Separation process of zirconium and hafnium; Procede de separation du zirconium et du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Hure, J; Saint-James, R [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1955-07-01

    About the separation different processes of zirconium-hafnium, the extraction by solvent in cross-current is the most easily the process usable on an industrial scale. It uses tributyl phosphate as solvent, diluted with white spirit to facilitate the decanting. Some exploratory tests showed that nitric environment seemed the most favorable for extraction; but a lot of other factors intervene in the separation process. We studied the influence of the acidity successively, the NO{sub 3}{sup -} ions concentration, the role of the cation coming with NO{sub 3}{sup -}, as well as the influence of the concentration of zirconium in the solution on the separation coefficient {beta} = {alpha}{sub Zr} / {alpha}{sub Hf}. (M.B.) [French] Des differents procedes de separation zirconium-hafnium, l'extraction par solvant en contre-courant est le procede le plus facilement utilisable a l'echelle industrielle. On utilise comme solvant le phosphate de tributyle, dilue avec du white spirit pour faciliter les decantations. Des essais preliminaires ont montre que le milieu nitrique semblait le plus favorable a l'extraction; mais beaucoup d'autres facteurs interviennent dans le processus de separation. Nous avons etudie successivement l'influence de l'acidite, celle de la concentration en ions NO{sub 3}{sup -}, le role du cation accompagnant NO{sub 3}{sup -}, ainsi que l'influence de la concentration en zirconium de la solution sur le coefficient de separation {beta} = {alpha}{sub Zr} / {alpha}{sub Hf}. (MB)

  9. Strong influence of polymer architecture on the microstructural evolution of hafnium-alkoxide-modified silazanes upon ceramization.

    Science.gov (United States)

    Papendorf, Benjamin; Nonnenmacher, Katharina; Ionescu, Emanuel; Kleebe, Hans-Joachim; Riedel, Ralf

    2011-04-04

    The present study focuses on the synthesis and ceramization of novel hafnium-alkoxide-modified silazanes as well as on their microstructure evolution at high temperatures. The synthesis of hafnia-modified polymer-derived SiCN ceramic nanocomposites is performed via chemical modification of a polysilazane and of a cyclotrisilazane, followed by cross-linking and pyrolysis in argon atmosphere. Spectroscopic investigation (i.e., NMR, FTIR, and Raman) shows that the hafnium alkoxide reacts with the N-H groups of the cyclotrisilazane; in the case of polysilazane, reactions of N-H as well as Si-H groups with the alkoxide are observed. Consequently, scanning and transmission electron microscopy studies reveal that the ceramic nanocomposites obtained from cyclotrisilazane and polysilazane exhibited markedly different microstructures, which is a result of the different reaction pathways of the hafnium alkoxide with cyclotrisilazane and with polysilazane. Furthermore, the two prepared ceramic nanocomposites are unexpectedly found to exhibit extremely different high-temperature behavior with respect to decomposition and crystallization; this essential difference is found to be related to the different distribution of hafnium throughout the ceramic network in the two samples. Thus, the homogeneous distribution of hafnium observed in the polysilazane-derived ceramic leads to an enhanced thermal stability with respect to decomposition, whereas the local enrichment of hafnium within the matrix of the cyclotrisilazane-based sample induces a pronounced decomposition upon annealing at high temperatures. The results indicate that the chemistry and architecture of the precursor has a crucial effect on the microstructure of the resulting ceramic material and consequently on its high-temperature behavior. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Separation of hafnium from zirconium in sulfuric acid solutions using pressurized ion exchange

    International Nuclear Information System (INIS)

    Hurst, F.J.

    1981-01-01

    High-resolution pressurized ion exchange has been used successfully to study and separate hafnium and zirconium sulfate complexes by chromatographic elution from Dowex 50W-X8 (15 to 25 μm) resin with sulfuric acid solutions. Techniques were developed to continuously monitor the column effluents for zirconium and hafnium by reaction with fluorometric and colorimetric reagents. Since neither reagent was specific for either metal ion, peak patterns were initially identified by using the stable isotopes 90 Zr and 180 Hf as fingerprints of their elution position. Distribution ratios for both zirconium and hafnium decrease as the inverse fourth power of the sulfuric acid concentration below 2N and as the inverse second power at higher acid concentration. The hafnium-to-zirconium separation factor is approximately constant (approx. 8) over the 0.5 to 3N range. Under certain conditions, an unseparated fraction was observed that was not retained by the resin. The amount of this fraction which is thought to be a polymeric hydrolysis product appears to be a function of metal and sulfuric acid concentrations. Conditions are being sought to give the highest zirconium concentration and the lowest acid concentration that can be used as a feed material for commercial scale-up in the continuous annular chromatographic (CAC) unit without formation of the polymer

  11. Separation of zirconium and hafnium from acompanying elements by paper chromatography in the systems of alcohol-acid

    International Nuclear Information System (INIS)

    Lebedeva, G.G.; Viktorova, M.E.

    1980-01-01

    Solvents have been chosen and investigated which provide expressed separation of zirconium and hafnium at the analysis of mineral raw materials by paper chromatography. The systems with HNO 3 and HCl containing methyl, ethyl, propyl and butyl alcohols have been studied as mobile phases for separation of zirconium and hafnium. It has been shown that alcohol contents and solvent acidity affect the Rsub(f) value of these elements. The C 2 H 5 OH-5MHCl and C 2 H 5 OH-5MHNO 3 systems are most optimal for pre-concentration of zirconium and hafnium

  12. Low-voltage bendable pentacene thin-film transistor with stainless steel substrate and polystyrene-coated hafnium silicate dielectric.

    Science.gov (United States)

    Yun, Dong-Jin; Lee, Seunghyup; Yong, Kijung; Rhee, Shi-Woo

    2012-04-01

    The hafnium silicate and aluminum oxide high-k dielectrics were deposited on stainless steel substrate using atomic layer deposition process and octadecyltrichlorosilane (OTS) and polystyrene (PS) were treated improve crystallinity of pentacene grown on them. Besides, the effects of the pentacene deposition condition on the morphologies, crystallinities and electrical properties of pentacene were characterized. Therefore, the surface treatment condition on dielectric and pentacene deposition conditions were optimized. The pentacene grown on polystyrene coated high-k dielectric at low deposition rate and temperature (0.2-0.3 Å/s and R.T.) showed the largest grain size (0.8-1.0 μm) and highest crystallinity among pentacenes deposited various deposition conditions, and the pentacene TFT with polystyrene coated high-k dielectric showed excellent device-performance. To decrease threshold voltage of pentacene TFT, the polystyrene-thickness on high-k dielectric was controlled using different concentration of polystyrene solution. As the polystyrene-thickness on hafnium silicate decreases, the dielectric constant of polystyrene/hafnium silicate increases, while the crystallinity of pentacene grown on polystyrene/hafnium silicate did not change. Using low-thickness polystyrene coated hafnium silicate dielectric, the high-performance and low voltage operating (pentacene thin film transistor (μ: ~2 cm(2)/(V s), on/off ratio, >1 × 10(4)) and complementary inverter (DC gains, ~20) could be fabricated.

  13. Primary hafnium metal sponge and other forms, approved standard 1973

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    A specification is presented covering virgin hafnium metal commonly designated as sponge because of its porous, sponge-like texture; it may also be in other forms such as chunklets. The specification does not cover crystal bar

  14. Evolution of the hafnium isotopic composition in the RBMK reactor

    International Nuclear Information System (INIS)

    Jurkevicius, A.; Remeikis, V.

    2002-01-01

    The isotopic composition of hafnium in the radial neutron flux sensor of the RBMK-1500 reactor, the rates of the neutron absorption on Hf isotopes and the neutron spectrum in the sensor were numerically modeled. The sequence SAS2 (Shielding Analysis Sequence) program from the package SCALE 4.4A and the HELIOS code system were used for calculations. It has been obtained that the overall neutron absorption rates in hafnium for the sensors located in the 2.4 % and 2.6 % enrichment uranium-erbium nuclear fuel assemblies are by 16 % and 19 % lower than in the 2.0 % enrichment uranium nuclear fuel assemblies. The overall neutron absorption rate in hafnium decreases 2.70-2.75 times due to the sensor burnup to 5800 MW d. The sensitivity of the Hf sensors to the thermal neutron flux increases twice due to the nuclear fuel assembly burnup to 3000 MW d. The corrective factors ξ d (I) at the different integral current I of the sensors and ξ td (E) at the different burnup E of the nuclear fuel assemblies were calculated. The obtained dependence ξ d (I) calculated numerically was compared to the experimental one determined by comparing signals of the fresh sensor and the sensor with the integral current I and by processing repeated calibration results of Hf sensors in RBMK-1500 reactors. The relative relationship coefficients K T (T FA ) were found for all RBMK-1500 nuclear fuel types. (author)

  15. Preparation of hafnium metal by calciothermic reduction of HfO2

    International Nuclear Information System (INIS)

    Sharma, I.G.; Vijay, P.L.; Sehra, J.C.; Sundaram, C.V.

    1975-01-01

    Hafnium metal powder has been produced by the calciothermic reduction of hafnium oxide. The influence of various experimental parameters - such as amount of calcium in excess of stoichiometric requirement, temperature, and time of reduction - on the yield and purity of the metal has been studied. The metal powder obtained by reduction at 960 0 C (two hours) with a calcium excess of 70% analysed 600 ppm of oxygen and 147 ppm of nitrogen. A reduction efficiency of 96% has been achieved under these conditions. The refining of the powder by electron beam melting, fused salt electrolysis, and iodide process has been studied. The oxygen content in the metal could be brought down from 6900 to 148 ppm by electron beam melt-refining. (author)

  16. ENTIRELY AQUEOUS SOLUTION-GEL ROUTE FOR THE PREPARATION OF ZIRCONIUM CARBIDE, HAFNIUM CARBIDE AND THEIR TERNARY CARBIDE POWDERS

    Directory of Open Access Journals (Sweden)

    Zhang Changrui

    2016-07-01

    Full Text Available An entirely aqueous solution-gel route has been developed for the synthesis of zirconium carbide, hafnium carbide and their ternary carbide powders. Zirconium oxychloride (ZrOCl₂.8H₂O, malic acid (MA and ethylene glycol (EG were dissolved in water to form the aqueous zirconium carbide precursor. Afterwards, this aqueous precursor was gelled and transformed into zirconium carbide at a relatively low temperature (1200 °C for achieving an intimate mixing of the intermediate products. Hafnium and the ternary carbide powders were also synthesized via the same aqueous route. All the zirconium, hafnium and ternary carbide powders exhibited a particle size of ∼100 nm.

  17. On the phase formation of sputtered hafnium oxide and oxynitride films

    International Nuclear Information System (INIS)

    Sarakinos, K.; Music, D.; Mraz, S.; Baben, M. to; Jiang, K.; Nahif, F.; Braun, A.; Zilkens, C.; Schneider, J. M.; Konstantinidis, S.; Renaux, F.; Cossement, D.; Munnik, F.

    2010-01-01

    Hafnium oxynitride films are deposited from a Hf target employing direct current magnetron sputtering in an Ar-O 2 -N 2 atmosphere. It is shown that the presence of N 2 allows for the stabilization of the transition zone between the metallic and the compound sputtering mode enabling deposition of films at well defined conditions of target coverage by varying the O 2 partial pressure. Plasma analysis reveals that this experimental strategy facilitates control over the flux of the O - ions which are generated on the oxidized target surface and accelerated by the negative target potential toward the growing film. An arrangement that enables film growth without O - ion bombardment is also implemented. Moreover, stabilization of the transition sputtering zone and control of the O - ion flux without N 2 addition is achieved employing high power pulsed magnetron sputtering. Structural characterization of the deposited films unambiguously proves that the phase formation of hafnium oxide and hafnium oxynitride films with the crystal structure of HfO 2 is independent from the O - bombardment conditions. Experimental and theoretical data indicate that the presence of vacancies and/or the substitution of O by N atoms in the nonmetal sublattice favor the formation of the cubic and/or the tetragonal HfO 2 crystal structure at the expense of the monoclinic HfO 2 one.

  18. Solvent extraction of titanium(IV), zirconium(IV) and hafnium(IV) salicylates using liquid ion exchangers

    Energy Technology Data Exchange (ETDEWEB)

    Sundaramurthi, N M; Shinde, V M

    1989-02-01

    A solvent extraction method is proposed for the extraction of quadrivalent titanium, zirconium an hafnium from salicylate media using liquid ion exchangers such as Aliquat 336 and trioctylamine dissolved in xylene. The optimum conditions were evaluated from a critical study of the following: pH, salicylate concentration, amine concentration, diluent and period of equilibration. The method allows the separation of titanium, zirconium and hafnium from binary mixtures containing commonly associated metal ions and is applicable to the analysis of real samples such as BCS-CRM 387 nimonic 901, BCS-CRM 243/4 ferro-titanium, BCS-CRM 307 magnesium alloy and BCS-CRM 388 zircon. Titanium is determined either with hydrogen peroxide or by atomic absorption spectrometry whereas zirconium and hafnium are determined spectrophotometrically with Alizarin Red S and Zylenol Orange, respectively. The results of both separation and analysis are reported. The method is precise, accurate and fast.

  19. Solvent extraction of zirconium and hafnium using MIBK-HSCN-HCL process

    International Nuclear Information System (INIS)

    Borges, J.A.L.; Cunha, O.G.C. da

    1985-01-01

    The separation process of zirconium and hafnium, using MIBK as extractant in a set of mixer-settler is described. The chemical analysis was done by X-ray fluorescence and emission spectrography. (Author) [pt

  20. Radiation effects on the electrical properties of hafnium oxide based MOS capacitors.

    Energy Technology Data Exchange (ETDEWEB)

    Petrosky, J. C. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH); McClory, J. W. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH); Bielejec, Edward Salvador; Foster, J. C. (Air Force Institute of Technology, Wright-Patterson Air Force Base, OH)

    2010-10-01

    Hafnium oxide-based MOS capacitors were investigated to determine electrical property response to radiation environments. In situ capacitance versus voltage measurements were analyzed to identify voltage shifting as a result of changes to trapped charge with increasing dose of gamma, neutron, and ion radiation. In situ measurements required investigation and optimization of capacitor fabrication to include dicing, cleaning, metalization, packaging, and wire bonding. A top metal contact of 200 angstroms of titanium followed by 2800 angstroms of gold allowed for repeatable wire bonding and proper electrical response. Gamma and ion irradiations of atomic layer deposited hafnium oxide on silicon devices both resulted in a midgap voltage shift of no more than 0.2 V toward less positive voltages. This shift indicates recombination of radiation induced positive charge with negative trapped charge in the bulk oxide. Silicon ion irradiation caused interface effects in addition to oxide trap effects that resulted in a flatband voltage shift of approximately 0.6 V also toward less positive voltages. Additionally, no bias dependent voltage shifts with gamma irradiation and strong oxide capacitance room temperature annealing after ion irradiation was observed. These characteristics, in addition to the small voltage shifts observed, demonstrate the radiation hardness of hafnium oxide and its applicability for use in space systems.

  1. Investigation of chlorination of zirconium and hafnium and their compounds in discharge from hollow cathode

    International Nuclear Information System (INIS)

    Ioffe, R.B.; Korovin, Yu.I.

    1978-01-01

    The possibility is investigated of chlorinating various zirconium and hafnium compounds (metal, oxide, carbide) in a hot discharge from a hollow cathode with various chlorinating reagents: copper monochloride, nickel chloride, magnesium chloride, for the purpose of accelerating their entrance into the excitation zone. It has been shown thermodynamically and experimentally that chlorination of metal zirconium and hafnium and their carbides with copper monochloride in hot hollow cathode conditions provides a sharp increase in the intensity of the lines of these elements

  2. Development and characterization of ultrathin hafnium titanates as high permittivity gate insulators

    Science.gov (United States)

    Li, Min

    High permittivity or high-kappa materials are being developed for use as gate insulators for future ultrascaled metal oxide semiconductor field effect transistors (MOSFETs). Hafnium containing compounds are the leading candidates. Due to its moderate permittivity, however, it is difficult to achieve HfO2 gate structures with an EOT well below 1.0 nm. One approach to increase HfO2 permittivity is combining it with a very high-kappa material, such as TiO2. In this thesis, we systematically studied the electrical and physical characteristics of high-kappa hafnium titanates films as gate insulators. A series of HfxTi1-xO2 films with well-controlled composition were deposited using an MOCVD system. The physical properties of the films were analyzed using a variety of characterization techniques. X-ray micro diffraction indicates that the Ti-rich thin film is more immune to crystallization. TEM analysis showed that the thick stoichiometric HfTiO 4 film has an orthorhombic structure and large anisotropic grains. The C-V curves from the devices with the hafnium titanates films displayed relatively low hysteresis. In a certain composition range, the interfacial layer (IL) EOT and permittivity of HfxTi1-x O2 increases linearly with increasing Ti. The charge is negative for HfxTi1-xO2/IL and positive for Si/IL interface, and the magnitude increases as Hf increases. For ultra-thin films (less than 2 nm EOT), the leakage current increases with increasing HE Moreover, the Hf-rich sample has weaker temperature dependence of the current. In the MOSFET devices with the hafnium titanates films, normal transistor characteristics were observed, also electron mobility degradation. Next, we investigated the effects that different pre-deposition surface treatments, including HF dipping, NH3 surface nitridation, and HfO2 deposition, have on the electrical properties of hafnium titanates. Surface nitridation shows stronger effect than the thin HfO2 layer. The nitrided samples displayed a

  3. Separation of zirconium and hafnium using paper distribution chromatography

    International Nuclear Information System (INIS)

    Lebedeva, G.G.; Viktorova, M.E.

    1981-01-01

    A method is suggested of chromatographic separation of zirconium and hafnium in a CCl 4 -tributyl phosphate system (1:9) containing KCl as a salting-out agent in 5 M HNO 3 at 28-30 deg C. Zr and Hf are deterfmined in articiial mixtures under optimal chromatography conditions using visual colorimetry [ru

  4. 21 CFR 168.122 - Lactose.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Lactose. 168.122 Section 168.122 Food and Drugs... § 168.122 Lactose. (a) Lactose is the carbohydrate normally obtained from whey. It may be anhydrous or... the following specifications: (1) The lactose content is not less than 98.0 percent, mass over mass (m...

  5. Hafnium as a prospective absorber for VVER-1000 reactors of Ukraine

    International Nuclear Information System (INIS)

    Afanas'ev, A.A.; Konotop, Yu.F.; Odejchuk, N.L.

    2000-01-01

    Nuclear-physical parameters of hafnium having in mind its use as an absorber, are considered. Technical aspects of Hf production are exposed. Use of B 4 C/Hf absorber is twice cheaper than a standard one

  6. Evaluation of thermodynamic data on zirconium and hafnium halides and oxyhalides by means of transport experiments

    International Nuclear Information System (INIS)

    Dittmer, G.; Niemann, U.

    1987-01-01

    A consistent set of thermodynamic data for zirconium and hafnium halides, oxides and oxyhalides was achieved. It was found that formation enthalpies of gaseous compounds could be derived from solubility measurements together with theoretical estimations and a revision of literature data. Free energy functions were calculated employing statistical mechanics. Data for liquid and solid compounds were obtained via sublimation and vaporization data. Chemical equilibria of zirconium and hafnium with halogens are discussed. 51 refs.; 16 figs.; 14 tabs

  7. Electrodeposition in molten salts of metals used in nuclear industry: hafnium and uranium

    International Nuclear Information System (INIS)

    Serrano, K.

    1998-01-01

    The aim of this work is to study the electrodeposition in molten salts of metals used in nuclear industry: hafnium and uranium. The experiment is carried out in a molten alkaline halogenide medium in a temperature range between 670 and 750 degrees Celsius. The first part of this work concerns more particularly the electrochemical behaviour of the hafnium and uranium ions in the electrolytic solution. The reduction mechanisms of these ions have been studied by the use of three methods: cyclic voltametry, chrono-potentiometry and square wave voltametry. Results have shown that the process of metal deposition is difficult to explain because secondary reactions (as for instance: adsorption phenomena or cathodic deposit dissolution) occur. The uranium germination has then been studied by modelling of chrono-amperograms. The experiments have shown that the deposition is the result of the initial uranium crystal growth and depends on the electrolyte diffusion. The second part of this work deals with the implementation of hafnium and uranium deposition taking into account the preceding mechanistic studies. Depositions have all been observed by physical methods as for instance scanning electron microscopy. Particular experimental solutions (soluble anode, addition of fluoride ions to the electrolyte) have been used. The obtained deposition of hafnium is smooth and adheres very well to the substrate. The uranium depositions have been implemented with the use of a soluble anode. Uranium is deposited in a dendritic shape to the cathode. It has also been shown that the electro-kinetic parameters (temperature, uranium ions concentration, current density) have not an important influence on the dendritic morphology of the deposition. This morphology could be the consequence of particular convection movements to the surface of the cathode. (O.M.)

  8. Synthesis and characterization of Ho3+ doped hafnium oxide TLD for radiation dosimeter

    International Nuclear Information System (INIS)

    Sekar, Nandakumar; Ganesan, Bharanidharan; Sahib, Hajee Reyaz Ali; Aruna, Prakasarao; Ganesan, Singaravelu; Thamilkumar, P.; Rai, R.R.

    2017-01-01

    Cancer is a dreaded disease which is treated by Radiotherapy, Chemotherapy and Surgery. Radiotherapy plays a vital role in treatment of cancer and recently measurements of invivo radiation dosimetric in patient is of great interest due to high dose gradients in advanced technology like IMRT, IGRT etc. Hence, for the last few decades, a great degree of interest has been shown for the hafnium oxide for radiation dosimetric applications, due to its high dielectric constant, wide band gap and better interface properties such as chemical stability, conduction band offset and thermodynamic stability. In the present study, Synthesis and characterization of Ho 3+ doped Hafnium oxide were carried out and its applications towards radiation dosimeter were investigated

  9. Use of hafnium in control bars of nuclear reactors; Uso de hafnio en barras de control de reactores nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez S, J.R.; Alonso V, G. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: jrrs@nuclear.inin-mx

    2003-07-01

    Recently the use of hafnium as neutron absorber material in nuclear reactors has been reason of investigation by virtue of that this material has nuclear properties as to the neutrons absorption and structural that can prolong the useful life of the control mechanisms of the nuclear reactors. In this work some of those more significant hafnium properties are presented like nuclear material. Also there are presented calculations carried out with the HELIOS code for fuel cells of uranium oxide and of uranium and plutonium mixed oxides under controlled conditions with conventional bars of boron carbide and also with similar bars to which are substituted the absorbent material by metallic hafnium, the results are presented in this work. (Author)

  10. Plasma spraying of zirconium carbide – hafnium carbide – tungsten cermets

    Czech Academy of Sciences Publication Activity Database

    Brožek, Vlastimil; Ctibor, Pavel; Cheong, D.-I.; Yang, S.-H.

    2009-01-01

    Roč. 9, č. 1 (2009), s. 49-64 ISSN 1335-8987 Institutional research plan: CEZ:AV0Z20430508 Keywords : Plasma spraying * cermet coatings * microhardness * zirconium carbide * hafnium carbide * tungsten * water stabilized plasma Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass

  11. 46 CFR 168.15-10 - Construction.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 168.15-10 Section 168.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-10 Construction. (a) The accommodations provided must be securely constructed, properly...

  12. 32 CFR 168a.3 - Definition.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Definition. 168a.3 Section 168a.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DEFENSE CONTRACTING NATIONAL DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.3 Definition. Sponsoring Agency. A DoD Component or an...

  13. 25 CFR 168.14 - Livestock trespass.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Livestock trespass. 168.14 Section 168.14 Indians BUREAU... PARTITIONED LANDS AREA § 168.14 Livestock trespass. The owner of any livestock grazing in trespass on the Hopi... Hopi Partitioned Lands of any livestock without an approved grazing or crossing permit; (b) Allowing...

  14. 28 CFR 16.8 - Business information.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Business information. 16.8 Section 16.8... Procedures for Disclosure of Records Under the Freedom of Information Act § 16.8 Business information. (a) In general. Business information obtained by the Department from a submitter will be disclosed under the FOIA...

  15. 21 CFR 168.111 - Dextrose monohydrate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose monohydrate. 168.111 Section 168.111 Food... Table Sirups § 168.111 Dextrose monohydrate. (a) Dextrose monohydrate is purified and crystallized D.../mass (m/m), and the reducing sugar content (dextrose equivalent), expressed as D-glucose, is not less...

  16. Extraction of zirconium and hafnium thiocyanates by CH3COCH2CH.(CH3)2-HSCN solvent from chloride medium

    International Nuclear Information System (INIS)

    Okada, A.T.

    1982-01-01

    A zirconium-hafnium separation process for application in nuclear industry is presented. The extraction of zirconium and hafnium thiocyanates in chloride medium by hexone-HSCN solvent was studied. The extraction process was developed, varying the parameters, such as, concentrations of the metals, the thiocyanate ion, the sulphate ion and free acidity in aqueous phase. (Author) [pt

  17. 21 CFR 168.140 - Maple sirup.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Maple sirup. 168.140 Section 168.140 Food and... § 168.140 Maple sirup. (a) Maple sirup is the liquid food derived by concentration and heat treatment of the sap of the maple tree (Acer) or by solution in water of maple sugar (mapel concrete) made from...

  18. 21 CFR 168.110 - Dextrose anhydrous.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose anhydrous. 168.110 Section 168.110 Food... Table Sirups § 168.110 Dextrose anhydrous. (a) Dextrose anhydrous is purified and crystallized D-glucose... solids content is not less than 98.0 percent m/m. (b) The name of the food is “Dextrose anhydrous” or...

  19. Separation process of zirconium and hafnium

    International Nuclear Information System (INIS)

    Hure, J.; Saint-James, R.

    1955-01-01

    About the separation different processes of zirconium-hafnium, the extraction by solvent in cross-current is the most easily the process usable on an industrial scale. It uses tributyl phosphate as solvent, diluted with white spirit to facilitate the decanting. Some exploratory tests showed that nitric environment seemed the most favorable for extraction; but a lot of other factors intervene in the separation process. We studied the influence of the acidity successively, the NO 3 - ions concentration, the role of the cation coming with NO 3 - , as well as the influence of the concentration of zirconium in the solution on the separation coefficient β = α Zr / α Hf . (M.B.) [fr

  20. Synthesis and characterization of hafnium oxide films for thermo and photoluminescence applications

    International Nuclear Information System (INIS)

    Guzman Mendoza, J.; Aguilar Frutis, M.A.; Flores, G. Alarcon; Garcia Hipolito, M.; Maciel Cerda, A.; Azorin Nieto, J.; Rivera Montalvo, T.; Falcony, C.

    2010-01-01

    Hafnium oxide (HfO 2 ) films were deposited by the ultrasonic spray pyrolysis process. The films were synthesized from hafnium chloride as raw material in deionized water as solvent and were deposited on corning glass substrates at temperatures from 300 to 600 deg. C. For substrate temperatures lower than 400 deg. C the deposited films were amorphous, while for substrate temperatures higher than 450 deg. C, the monoclinic phase of HfO 2 appeared. Scanning electron microscopy showed that the film's surface resulted rough with semi-spherical promontories. The films showed a chemical composition close to HfO 2 , with an Hf/O ratio of about 0.5. UV radiation was used in order to achieve the thermoluminescent characterization of the films; the 240 nm wavelength induced the best response. In addition, preliminary photoluminescence spectra, as a function of the deposition temperatures, are shown.

  1. A study of a production process for hafnium-free zirconium from zircon

    International Nuclear Information System (INIS)

    Ratanalert, N.

    1985-01-01

    The purpose of this experiment was to extract and purify the zirconium from zircon. The effects of time of extraction and stripping of zirconium, concentration of feed solution, concentration of hydrochloric acid in stripping process, equilibrium curve of extraction of zirconium and hafnium and equilibrium curve of stripping zirconium or scrubbing hafnium were studied from standard zirconium and hafnium. The results, subsequently were applied to the extraction procedures for zirconium from zircon. Minus 100 mesh zircon was fused with sodium hydroxide in the ratio of 1 : 6 at 700 degree C for l hour. After fusion the zirconate was leached with water and dissolved in hot concentrated hydrochloric acid. Zirconyl chloride octahydrate crystallized out when the solution was cooled. An agueons solution of zirconyl chloride was used as the feed to the hexone - thiocyanate solvent extraction process. This was prepared by dissolving zirconyl chloride octahydrate crystal in waster. This zirconium feed solution in 1 M HCl and 1 M N H 4 CNS was extracted with 2.7 m N H 4 CNS in hexone and then stripped with 3.6 M HCl the aqueous phase was got rid of thiocyanate ion by extracting with pure hexone, then the zirconium in aqueous phase was precipitated with sulfuric acid and ammonium hydroxide at pH 1.8 - 2.0 and zirconium oxide was obtained by ignition at 700 degree C. The process could be modified to improve the purity of zirconium by using cation exchange resin to get rid of thiocyanate ion after solvent extraction process

  2. 7 CFR 3015.168 - Disposal of equipment.

    Science.gov (United States)

    2010-01-01

    ..., DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Property § 3015.168 Disposal of equipment. When original or replacement equipment is no longer to be used in projects or programs currently or... 7 Agriculture 15 2010-01-01 2010-01-01 false Disposal of equipment. 3015.168 Section 3015.168...

  3. Vapor pressure, heat capacities, and phase transitions of tetrakis(tert-butoxy)hafnium

    Czech Academy of Sciences Publication Activity Database

    Fulem, Michal; Růžička, K.

    2011-01-01

    Roč. 311, Dec. (2011), s. 25-29 ISSN 0378-3812 Institutional research plan: CEZ:AV0Z10100521 Keywords : tetrakis(tert-butoxy)hafnium * MO precursor * vapor pressure * heat capacity * vaporization enthalpy * enthalpy of fusion Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.139, year: 2011

  4. 32 CFR 644.168 - Exercise of options.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Exercise of options. 644.168 Section 644.168... ESTATE HANDBOOK Acquisition Procurement of Options Prior to Real Estate Directives (military) § 644.168 Exercise of options. Upon issuance of a real estate directive for acquisition of the optioned real property...

  5. Prognostic impact of CD168 expression in gastric cancer

    International Nuclear Information System (INIS)

    Ishigami, Sumiya; Yoshiaki, Kita; Kijima, Yuko; Kitazono, Masaki; Natsugoe, Shoji; Ueno, Shinichi; Nishizono, Yuka; Matsumoto, Masataka; Kurahara, Hiroshi; Arigami, Takaaki; Uchikado, Yasuto; Setoyama, Tetsuro; Arima, Hideo

    2011-01-01

    Interactions of stromal hyaluronic acid (HA) with its binding protein RHAMM (receptor for HA-mediated motility) (CD168) have been reported to affect tumor extension and the migration of crucial molecules to promote tumor progression and metastases. Cancerous CD168 expression is correlated with aggressive biological features in several cancers. However, the clinical implications of CD168 positivity in gastric cancer have remained unclear. We examined the CD168 expression of 196 consecutive gastric cancer patients by immunohistochemistry. According to CD168 positivity, the 196 gastric cancer patients were divided into two groups (57 CD168-positive and 139 CD168-negative patients). The correlation between CD168 expression and clinicopathological factors (age, sex, histology, tumor depth, lymph node status, and vessel invasion) was evaluated according to the Japanese Classification of Gastric Carcinoma. Cancerous CD168 expression was detectable in 57 of the 196 tumors (29%). CD168 positivity was significantly correlated with the depth of invasion, nodal involvement, and vessel invasion (p < 0.01). Survival analysis of the 196 gastric cancer patients showed that the CD168-positive group had a significantly higher mortality than the CD168-negative group (p < 0.01). In terms of a correlation with CD168 positivity at separate clinical stages, a significance difference was only found in stages II and III. Multivariate analysis revealed that CD168 expression was a significant independent prognostic marker (p = 0.013) after depth of invasion (p < 0.005) and nodal involvement (p < 0.01). Our results suggest that cancerous CD168 positivity is strongly related to the invasion and metastasis of gastric cancer tumors. These results suggest that cancerous CD168 expression can be used as a prognostic marker of gastric cancer owing to its interactions with stromal hyaluronic acid

  6. Pentamethylcyclopentadienyl Zirconium and Hafnium Polyhydride Complexes : Synthesis, Structure, and Reactivity

    NARCIS (Netherlands)

    Visser, Cindy; Hende, Johannes R. van den; Meetsma, Auke; Hessen, Bart; Teuben, Jan H.

    2001-01-01

    The half-sandwich zirconium and hafnium N,N-dimethylaminopropyl complexes Cp*M[(CH2)3NMe2]Cl2 (Cp* = η5-C5Me5, M = Zr, 1; Hf, 2) and Cp*M[(CH2)3NMe2]2Cl (M = Zr, 3; Hf, 4) were synthesized by mono- or dialkylation of Cp*MCl3 with the corresponding alkyllithium and Grignard reagents. Hydrogenolysis

  7. 10 CFR 26.168 - Blind performance testing.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Blind performance testing. 26.168 Section 26.168 Energy... and Human Services § 26.168 Blind performance testing. (a) Each licensee and other entity shall submit blind performance test samples to the HHS-certified laboratory. (1) During the initial 90-day period of...

  8. Properties of neutron-rich hafnium high-spin isomers

    CERN Multimedia

    Tungate, G; Walker, P M; Neyens, G; Billowes, J; Flanagan, K; Koester, U H; Litvinov, Y

    It is proposed to study highly-excited multi-quasiparticle isomers in neutron-rich hafnium (Z=72) isotopes. Long half-lives have already been measured for such isomers in the storage ring at GSI, ensuring their accessibility with ISOL production. The present proposal focuses on:\\\\ (i) an on-line experiment to measure isomer properties in $^{183}$Hf and $^{184}$Hf, and\\\\ (ii) an off-line molecular breakup test using REXTRAP, to provide Hf$^{+}$ beams for future laser spectroscopy and greater sensitivity for the future study of more neutron-rich isotopes.

  9. 25 CFR 168.7 - Kind of livestock.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Kind of livestock. 168.7 Section 168.7 Indians BUREAU OF... LANDS AREA § 168.7 Kind of livestock. Unless determined otherwise by the Area Director for conservation purposes, the Hopi Tribe may determine, subject to the authorized carrying capacity, the kind of livestock...

  10. 46 CFR 168.15-35 - Hospital space.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Hospital space. 168.15-35 Section 168.15-35 Shipping... VESSELS Accommodations § 168.15-35 Hospital space. (a) Each vessel must be provided with a hospital space. This space must be situated with due regard for the comfort of the sick so that they may receive proper...

  11. On-line experience with the 168/E

    International Nuclear Information System (INIS)

    Carroll, J.T.; Brau, J.E.; Maruyama, T.; Parker, D.B.; Chima, J.S.; Price, D.R.; Rankin, P.; Hatley, R.W.

    1981-04-01

    Current 20 GeV/c photoproduction experiments at the SLAC Hybrid Facility require a decision to take a picture within 150 to 300 μs after the beam pulse. A charged track trigger is provided by a 168/E processor which finds tracks in a downstream PWC system. To meet trigger time requirements the 168/E SNOOP module CAMAC interface is augmented by a CAMAD Auxiliary Controller and dedicated I/0 cards in the 168/E chassis. Between beam pulses a floating point Fortran program executing on a 168/E monitors data acquisition. Experiences with software development and application are reviewed

  12. 42 CFR 423.168 - Accreditation organizations.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 423.168 Section 423.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM VOLUNTARY MEDICARE PRESCRIPTION DRUG BENEFIT Cost Control and Quality...

  13. Ion-bombardment-induced reduction in vacancies and its enhanced effect on conductivity and reflectivity in hafnium nitride films

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Zhiqing; Wang, Jiafu; Hu, Chaoquan; Zhang, Xiaobo; Dang, Jianchen; Gao, Jing; Zheng, Weitao [Jilin University, School of Materials Science and Engineering, Key Laboratory of Mobile Materials, MOE, and State Key Laboratory of Superhard Materials, Changchun (China); Zhang, Sam [Nanyang Technological University, School of Mechanical and Aerospace Engineering, Singapore (Singapore); Wang, Xiaoyi [Chinese Academy of Sciences, Key Laboratory of Optical System Advanced Manufacturing Technology, Changchun Institute of Optics, Fine Mechanics and Physics, Changchun (China); Chen, Hong [Jilin University, Department of Control Science and Engineering, Changchun (China)

    2016-08-15

    Although the role of ion bombardment on electrical conductivity and optical reflectivity of transition metal nitrides films was reported previously, the results were controversial and the mechanism was not yet well explored. Here, we show that proper ion bombardment, induced by applying the negative bias voltage (V{sub b}), significantly improves the electrical conductivity and optical reflectivity in rocksalt hafnium nitride films regardless of level of stoichiometry (i.e., in both near-stoichiometric HfN{sub 1.04} and over-stoichiometric HfN{sub 1.17} films). The observed improvement arises from the increase in the concentration of free electrons and the relaxation time as a result of reduction in nitrogen and hafnium vacancies in the films. Furthermore, HfN{sub 1.17} films have always much lower electrical conductivity and infrared reflectance than HfN{sub 1.04} films for a given V{sub b}, owing to more hafnium vacancies because of larger composition deviation from HfN exact stoichiometry (N:Hf = 1:1). These new insights are supported by good agreement between experimental results and theoretical calculations. (orig.)

  14. Results for heterogeneous poisoning of the critical HTR-test facility KAHTER using absorber elements containing hafnium and boron

    International Nuclear Information System (INIS)

    Drueke, V.; Filges, D.; Nabi, R.; Neef, R.D.; Paul, N.; Schaal, H.

    1979-10-01

    Experiments and checking computations for investigating the initial-core poisoning of the pebble bed high temperature reactor are described. Following the example of the THTR-300, THTR absorber elements poisoned with hafnium/boron were added to the THTR fuel- and graphite elements of the KAHTER core. Three different hafnium-boron poisoned core loadings, corresponding to 2.7, 5.3 and 8% reactivity compensation, were used in the experiments. For purposes of comparison, two cores exclusively boron poisoned were also studied. The poisoning of these cores correspond to 2.7 and 8% reactivity compensation. The experiments and checking computations should serve to test the accuracy of the theoretical models and data sets in modeling the reactivity effects of absorber poisoned elements in the THTR. In particular, the applicability of the nuclear data of hafnium and the treatment of resonance calculations should be verified. In addition, to determining critical masses and ksub(eff), special emphasis was placed in the experiments on the exact determination of all reactivity effects. In some cases, repeated loading of a configuration also provided a measure of the reproducibility of ksub(eff). The experiments were checked computationally using the GAMTEREX code package and the program system RSYST. These two computation packages contain different data bases, - although the hafnium data are identical -, and the computing models differ in certain phases of the calculations. Both code systems compute ksub(eff) values to within the present accuracy requirements, whereas the program system RSYST gives better agreement with experimental measurements. (orig.) 891 RW/orig. 892 RDG [de

  15. 40 CFR 68.168 - Five-year accident history.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Five-year accident history. 68.168 Section 68.168 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.168 Five-year accident history...

  16. 7 CFR 987.168 - Handler records.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler records. 987.168 Section 987.168 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... weight and destination or name and address of the person to whom each shipment was sent; (c) If different...

  17. 46 CFR 168.15-45 - Heating and cooling.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Heating and cooling. 168.15-45 Section 168.15-45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-45 Heating and cooling. All quarters must be adequately heated and cooled...

  18. 46 CFR 168.10-5 - Civilian nautical school.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Civilian nautical school. 168.10-5 Section 168.10-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Definitions of Terms Used in This Part § 168.10-5 Civilian nautical school. The term civilian...

  19. 12 CFR 16.8 - Small issues.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Small issues. 16.8 Section 16.8 Banks and....8 Small issues. (a) The OCC will deem offers and sales of bank issued securities that satisfy the requirements of Commission Regulation A (17 CFR part 230, Regulation A—Conditional Small Issues Exemption) to...

  20. Using the MMPI 168 with Medical Inpatients

    Science.gov (United States)

    Erickson, Richard C.; Freeman, Charles

    1976-01-01

    Explores the potential utility of the MMPI 168 with two inpatient medical populations. Correlations and clinically relevant comparisons suggest that the MMPI 168 predicted the standard MMPI with a high degree accuracy. (Editor/RK)

  1. Studies on Optical and Electrical Properties of Hafnium Oxide Nanoparticles

    Science.gov (United States)

    Jayaraman, Venkatachalam; Sagadevan, Suresh; Sudhakar, Rajesh

    2017-07-01

    In this paper, the synthesis and physico-chemical properties of hafnium oxide nanoparticles (HfO2 NPs) are analyzed and reported. The synthesis was carried out by the precipitation route by using hafnium tetrachloride (HfCl4) as precursor material with potassium hydroxide (KOH) dissolved in Millipore water. In the precipitation technique, the chemical reaction is comparatively simple, low-cost and non-toxic compared to other synthetic methods. The synthesized HfO2 NPs were characterized by using powder x-ray diffraction (PXRD), ultraviolet-visible (UV-Vis) spectroscopy, Raman analysis, and high-resolution transmission electron microscopy (HRTEM). The monoclinic structure of the HfO2 NPs was resolved utilizing x-ray diffraction (XRD). The optical properties were studied from the UV-Vis absorption spectrum. The optical band gap of the HfO2NPs was observed to be 5.1 eV. The Raman spectrum shows the presence of HfO2 NPs. The HRTEM image showed that the HfO2 NPs were of spherical shape with an average particle size of around 28 nm. The energy-dispersive x-ray spectroscopy (EDS) spectrum obviously demonstrated the presence of HfO2 NPs. Analysis and studies on the dielectric properties of the HfO2 NPs such as the dielectric constant, the dielectric loss, and alternating current (AC) conductivity were carried out at varying frequencies and temperatures.

  2. Rare-earth hafnium oxide materials for magnetohydrodynamic (MHD) generator application

    Energy Technology Data Exchange (ETDEWEB)

    Marchant, D. D; Bates, J. L.

    1979-01-01

    Several ceramic materials based on rare-earth hafnium oxides have been identified as potential high-temperature electrodes and low-temperature current leadouts for open cycle coal-fired MHD generator channels. The electrode-current leadouts combination must operate at temperatures between 400 and 2000K with an electrical conductivity greater than 10/sup -2/ ohm/sup -1/ cm/sup -1/. The electrodes will be exposed to flowing (linear flow rates up to 100 m/s) potassium seeded coal combustion gases (plasma core temperatures between 2400 to 3200/sup 0/K) and coal slag. During operation the electrodes must conduct direct electric current at densities near 1.5 amp/cm/sup 2/. Consequently, the electrodes must be resistant to electrochemical decompositions and interactions with both the coal slag and potassium salts (e.g., K/sub 2/SO/sub 4/, K/sub 2/CO/sub 3/). The current leadout materials are placed between the hot electrodes and the water-cooled copper structural members and must have electrical conductivities greater than 10/sup -2/ ohm/sup -1/ cm/sup -1/ between 1400 and 400/sup 0/K. The current leadouts must be thermally and electrochemically compatible with the electrode, copper, and potassium salts. Ideally, the electrodes and current leadouts should exhibit minimal ionic conductivity. The fabrication, electrical conductivity, and electrochemical corrosion of rare-earth hafnium oxide materials are discussed. (WHK)

  3. Hafnium isotope evidence for a transition in the dynamics of continental growth 3.2 Gyr ago.

    Science.gov (United States)

    Næraa, T; Scherstén, A; Rosing, M T; Kemp, A I S; Hoffmann, J E; Kokfelt, T F; Whitehouse, M J

    2012-05-30

    Earth's lithosphere probably experienced an evolution towards the modern plate tectonic regime, owing to secular changes in mantle temperature. Radiogenic isotope variations are interpreted as evidence for the declining rates of continental crustal growth over time, with some estimates suggesting that over 70% of the present continental crustal reservoir was extracted by the end of the Archaean eon. Patterns of crustal growth and reworking in rocks younger than three billion years (Gyr) are thought to reflect the assembly and break-up of supercontinents by Wilson cycle processes and mark an important change in lithosphere dynamics. In southern West Greenland numerous studies have, however, argued for subduction settings and crust growth by arc accretion back to 3.8 Gyr ago, suggesting that modern-day tectonic regimes operated during the formation of the earliest crustal rock record. Here we report in situ uranium-lead, hafnium and oxygen isotope data from zircons of basement rocks in southern West Greenland across the critical time period during which modern-like tectonic regimes could have initiated. Our data show pronounced differences in the hafnium isotope-time patterns across this interval, requiring changes in the characteristics of the magmatic protolith. The observations suggest that 3.9-3.5-Gyr-old rocks differentiated from a >3.9-Gyr-old source reservoir with a chondritic to slightly depleted hafnium isotope composition. In contrast, rocks formed after 3.2 Gyr ago register the first additions of juvenile depleted material (that is, new mantle-derived crust) since 3.9 Gyr ago, and are characterized by striking shifts in hafnium isotope ratios similar to those shown by Phanerozoic subduction-related orogens. These data suggest a transitional period 3.5-3.2 Gyr ago from an ancient (3.9-3.5 Gyr old) crustal evolutionary regime unlike that of modern plate tectonics to a geodynamic setting after 3.2 Gyr ago that involved juvenile crust generation by plate

  4. The interaction of fast neutrons with hafnium

    International Nuclear Information System (INIS)

    Smith, A.B.

    2002-01-01

    Elemental hafnium neutron total cross sections are measured from ∼0.75 to 4.5 MeV in steps of ∼40 keV. Differential neutron elastic-scattering cross sections are measured from ∼4.5 to 10.0 MeV in ∼0.5 MeV steps and at 40 scattering angles distributed between ∼17 and 160 deg. These data are combined with those found in the literature to construct a comprehensive experimental data base which is interpreted in terms of coupled-channels models. Physical characteristics of the resulting potentials are discussed. Comparisons are made with ENDF/B-6 (MAT 7200). A detailed report of this work is given by Smith (Smith, A., 2001. Argonne National Laboratory Report ANL/NDM-153)

  5. Reinforcement against crack propagation of PWR absorbers by development of boron-carbon-hafnium composites

    International Nuclear Information System (INIS)

    Provot, B.; Herter, P.

    2000-01-01

    In order to improve the mechanical behaviour of materials used as neutron absorbers in nuclear reactors, we have developed CERCER or CERMET composites with boron and hafnium. Thus a new composite B 4 C/HfB 2 has been especially studied. We have identified three kinds of degradation under irradiation (thermal gradient, swelling due to fission products and accidental corrosion) that induce imposed deformations cracking phenomena. Mechanical behaviour and crack propagation resistance have been studied by ball-on-three-balls and double torsion tests. A special device was developed to enable crack propagation and associated stress intensity factor measurements. Effects of structure and of a second phase are underline. First results show that these materials present crack initiation and propagation resistance much higher than pure boron carbide or hafnium diboride. We observe R-Curves effects, crack bridging or branching, crack arrests, and toughness increases that we can relate respectively to the composite structures. (author)

  6. Titrimetric determination of thiocyanate in solutions of the hafnium-zirconium separation process

    International Nuclear Information System (INIS)

    Vazquez, Cristina; Botbol, Moises; Hernandez, M.H.

    1980-01-01

    The control of the thiocyanate concentration is necessary during the process of separating hafnium from zirconium by the hexone-thiocyanate method. Said control is carried out by titrimetric determination of thiocyanate in aqueous and organic solutions containing hydrochloric acid and ammonium thiocyanate in presence or absence of zirconium and/or hafnium. The method consists in a redox volumetric analysis using a cerium (IV) salt as titrating agent, and ferroine as the final point indicator. Owing to the instability of thiocyanate in an acid medium it is necessary to know previously if the decomposition of solutions with different concentration of ammonium thiocyanate and hydrochloric acid may have an influence upon the analytic results or may even invalidate them. In order to obtain reliable results, it must be taken into account that the stability of the solutions depends on the thiocyanate concentration, the acidity and the time elapsed from the moment the sample is taken until the test is performed. The decomposition process can be slowed down by cooling the solutions. This method allows to control the plant and does not require any special equipment. (M.E.L) [es

  7. Synthesis and characterization of hafnium oxide for luminescent applications

    International Nuclear Information System (INIS)

    Guzman Mendoza, J.; Aguilar Frutis, M.A.; Flores, G. Alarcon; Garcia Hipolito, M.; Azorin Nieto, J.; Rivera Montalvo, T.; Falcony, C.

    2008-01-01

    Full text: Hafnium oxide (HfO 2 ) is a material with a wide range of possible technological applications because it's chemical and physical properties such as high melting point, high chemical stability, high refraction index, high dielectric constant and hardness near to diamond in the tetragonal phase. The large energy gap and low phonon frequencies of the HfO 2 makes it appropriate as a host matrix for been doped with rare earth activators. Efficient luminescent materials find wide application in electroluminescent flat panel displays; color plasma displays panels, scintillators, cathode ray tubes, fluorescent lamps, lasers, etc. In recent years the study of luminescent materials based on HfO 2 has been intensified. Some groups have studied the optical properties of doped and undoped HfO 2 . In this contribution, Hafnium Oxide (HfO 2 ) films were prepared using the spray pyrolysis deposition technique. The material was synthesized using chlorides as raw materials in deionised water as solvent and deposited on Corning glass substrates at temperatures from 300 deg C to 600 deg C. For substrate temperatures lower than 400 deg C, the deposited films are amorphous, while for substrate temperatures higher than 450 deg C, the monoclinic phase of HfO 2 appears. Scanning electron microscopy with microprobe analysis was use to observe the microstructure and obtain the chemical composition of the films; rough surfaces with spherical particles were appreciated. UV and low energy X Ray radiations were used in order to achieve the thermoluminescent characterization of the films as a function of the deposition temperature

  8. Titanium, zirconium- and hafnium containing initiators in the polymerization of acrylic monomers to ''living'' polymers

    International Nuclear Information System (INIS)

    Farnham, W.B.; Hertler, W.R.

    1988-01-01

    This patent describes a process for preparing ''living'' polymer. The process comprises contacting one or more acrylic monomers under polymerizing conditions with a polymerization-initiating amount of a tetra-coordinate organotitanium, organozirconium or organo-hafnium polymerization initiator, and ''living'' polymers produced thereby

  9. Does the MMPI-168 exaggerate psychotic pathology?

    NARCIS (Netherlands)

    Dingemans, P. M.; Wekking, E. M.

    1996-01-01

    Three scoring versions of the MMPI, scored on the same protocol, were compared in a multivariate design with 198 psychiatric patients. The MMPI-168 schizophrenia scale had a statistically higher elevation than the Dutch and American scoring versions. This makes MMPI-168 profiles more often

  10. Zirconium and hafnium tetrachloride separation by extractive distillation with molten zinc chloride lead chloride solvent

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Stoltz, R.A.

    1988-01-01

    In an extractive distillation method for separating hafniuim tetrachloride from zirconium tetrachloride of the type wherein a mixture of zirconium and hafnium tetrachlorides is introduced into an extractive distillation column, which extractive distillation column has a reboiler connected at the bottom and a reflux condenser connected at the top and wherein a molten salt solvent is circulated into the reflux condenser and through the column to provide a liquid phase, and wherein molten salt solvent containing zirconium tetrachloride is taken from the reboiler and run through a stripper to remove zirconium tetrachloride product from the molten salt solvent and the stripped molten salt solvent is returned to the reflux condenser and hafnium tetrachloride enriched vapor is taken as product from the reflux condenser, the improvement is described comprising: the molten salt having a composition of at least 30 mole percent zinc chloride and at least 10 mole percent of lead chloride

  11. Atomic layer deposition of calcium oxide and calcium hafnium oxide films using calcium cyclopentadienyl precursor

    International Nuclear Information System (INIS)

    Kukli, Kaupo; Ritala, Mikko; Sajavaara, Timo; Haenninen, Timo; Leskelae, Markku

    2006-01-01

    Calcium oxide and calcium hafnium oxide thin films were grown by atomic layer deposition on borosilicate glass and silicon substrates in the temperature range of 205-300 o C. The calcium oxide films were grown from novel calcium cyclopentadienyl precursor and water. Calcium oxide films possessed refractive index 1.75-1.80. Calcium oxide films grown without Al 2 O 3 capping layer occurred hygroscopic and converted to Ca(OH) 2 after exposure to air. As-deposited CaO films were (200)-oriented. CaO covered with Al 2 O 3 capping layers contained relatively low amounts of hydrogen and re-oriented into (111) direction upon annealing at 900 o C. In order to examine the application of CaO in high-permittivity dielectric layers, mixtures of Ca and Hf oxides were grown by alternate CaO and HfO 2 growth cycles at 230 and 300 o C. HfCl 4 was used as a hafnium precursor. When grown at 230 o C, the films were amorphous with equal amounts of Ca and Hf constituents (15 at.%). These films crystallized upon annealing at 750 o C, showing X-ray diffraction peaks characteristic of hafnium-rich phases such as Ca 2 Hf 7 O 16 or Ca 6 Hf 19 O 44 . At 300 o C, the relative Ca content remained below 8 at.%. The crystallized phase well matched with rhombohedral Ca 2 Hf 7 O 16 . The dielectric films grown on Si(100) substrates possessed effective permittivity values in the range of 12.8-14.2

  12. Separation of zirconium--hafnium by nitride precipitation

    International Nuclear Information System (INIS)

    Anderson, R.N.; Parlee, N.A.

    1977-01-01

    A method is described for the separation of a light reactive metal (e.g., zirconium) from a heavy reactive metal (e.g., hafnium) by forming insoluble nitrides of the metals in a molten metal solvent (e.g., copper) inert to nitrogen and having a suitable density for the light metal nitride to form a separate phase in the upper portion of the solvent and for the heavy metal nitride to form a separate phase in the lower portion of the solvent. Nitriding is performed by maintaining a nitrogen-containing atmosphere over the bath. The light and heavy metals may be an oxide mixture and carbothermically reduced to metal form in the same bath used for nitriding. The nitrides are then separately removed and decomposed to form the desired separate metals. 16 claims, 1 figure

  13. Modified method for zirconium or hafnium gravimetric determination with glycolic acid derivatives

    International Nuclear Information System (INIS)

    Barbieri, R.S.; Rocha, J.C.; Terra, V.R.; Marques Neto, A.

    1989-01-01

    The conditions for gravimetric determination of zirconium or hafnium by glicolic acid derivatives were studied by thermogravimetric analysis. The method utilized shown that after precipitation, washing and drying of precipitates at 150 0 C, the resulting solid was weighed in the form of [M{RCH(OH)COO} 4 ] (M = Zr,Hf;R = C 6 H 5 , β-C 10 H 7 ,p-BrC 6 H 4 ). (author) [pt

  14. Correlations between nuclear data and integral slab experiments: the case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J M

    1999-07-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  15. Correlations between nuclear data and integral slab experiments: the case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J.M

    1999-07-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  16. On-line separation of refractory hafnium and tantalum isotopes at the ISOCELE separator

    CERN Document Server

    Liang, C F; Obert, J; Paris, P; Putaux, J C

    1981-01-01

    By chemical evaporation technique, neutron deficient hafnium nuclei have been on-line separated at the ISOCELE facility, from the isobar rare-earth elements, in the metal-fluoride HfF/sub 3//sup +/ ion form. Half-lives of /sup 162-165/Hf have been measured. Similarly, tantalum has been selectively separated on the TaF/sub 4//sup +/ form. (4 refs) .

  17. Self-cleaning and surface chemical reactions during hafnium dioxide atomic layer deposition on indium arsenide.

    Science.gov (United States)

    Timm, Rainer; Head, Ashley R; Yngman, Sofie; Knutsson, Johan V; Hjort, Martin; McKibbin, Sarah R; Troian, Andrea; Persson, Olof; Urpelainen, Samuli; Knudsen, Jan; Schnadt, Joachim; Mikkelsen, Anders

    2018-04-12

    Atomic layer deposition (ALD) enables the ultrathin high-quality oxide layers that are central to all modern metal-oxide-semiconductor circuits. Crucial to achieving superior device performance are the chemical reactions during the first deposition cycle, which could ultimately result in atomic-scale perfection of the semiconductor-oxide interface. Here, we directly observe the chemical reactions at the surface during the first cycle of hafnium dioxide deposition on indium arsenide under realistic synthesis conditions using photoelectron spectroscopy. We find that the widely used ligand exchange model of the ALD process for the removal of native oxide on the semiconductor and the simultaneous formation of the first hafnium dioxide layer must be significantly revised. Our study provides substantial evidence that the efficiency of the self-cleaning process and the quality of the resulting semiconductor-oxide interface can be controlled by the molecular adsorption process of the ALD precursors, rather than the subsequent oxide formation.

  18. The Use of the MMPI-168 with Delinquent Adolescents.

    Science.gov (United States)

    Lueger, Robert J.

    1983-01-01

    Compared the standard MMPI and MMPI-168 scores of 90 male delinquent adolescents. Raw score and T-score correlations were high and within acceptable limits, which indicates that MMPI-168 scores are useful with delinquent adolescents. However, two-point codetypes derived from standard MMPIs and MMPI-168s were in agreement less than half the time.…

  19. Ground-state structures of Hafnium clusters

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Wei Chun; Yoon, Tiem Leong [School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Lim, Thong Leng [Faculty of Engineering and Technoloty, Multimedia University, Melaca Campus, 75450 Melaka (Malaysia)

    2015-04-24

    Hafnium (Hf) is a very large tetra-valence d-block element which is able to form relatively long covalent bond. Researchers are interested to search for substitution to silicon in the semi-conductor industry. We attempt to obtain the ground-state structures of small Hf clusters at both empirical and density-functional theory (DFT) levels. For calculations at the empirical level, charge-optimized many-body functional potential (COMB) is used. The lowest-energy structures are obtained via a novel global-minimum search algorithm known as parallel tempering Monte-Carlo Basin-Hopping and Genetic Algorithm (PTMBHGA). The virtue of using COMB potential for Hf cluster calculation lies in the fact that by including the charge optimization at the valence shells, we can encourage the formation of proper bond hybridization, and thus getting the correct bond order. The obtained structures are further optimized using DFT to ensure a close proximity to the ground-state.

  20. Molecular structure, vibrational, HOMO-LUMO, MEP and NBO analysis of hafnium selenite

    Science.gov (United States)

    Yankova, Rumyana; Genieva, Svetlana; Dimitrova, Ginka

    2017-08-01

    In hydrothermal condition hafnium selenite with estimated chemical composition Hf(SeO3)2·n(H2O) was obtained and characterized by powder X-Ray diffraction, IR spectroscopy and thermogravimetrical analysis. The composition of the obtained crystalline phase was established as dihydrate of tetraaqua complex of the hafnium selenite [Hf(SeO3)2(H2O)4]·2H2O. The results of the thermogravimetrical analysis are shown that the two hydrated water molecules are released in the temperature interval 80-110°C, while the four coordinated water molecules - at 210-300°C. By DFT method, with Becke's three parameter exchange-functional combined with gradient-corrected correlation functional of Lee, Yang and Parr and 6-31G(d), 6-311 + G(d,p) basis sets and LANL2DZ for Hf atom were calculated the molecular structure, vibrational frequencies and thermodynamic properties of the structure. The UV-Vis spectra and electronic properties are presented. The energy and oscillator strength calculated by time-dependent density functional theory corresponds well with the experimental ones. Molecular electrostatic potential (MEP) was performed. Mulliken population analysis on atomic charges was also calculated. The stability and intramolecular interactions are interpreted by NBO analysis.

  1. 168 Hours Salt Fog Test

    International Nuclear Information System (INIS)

    Nur Ubaidah Saidin; Muhamad Daud; Siti Radiah Mohd Kamarudin

    2011-01-01

    This report explained the test conducted in salt fog chamber to evaluate the effectiveness of mild steel, coated with rust converter, for 168 hours in artificial seawater exposure. The samples were compared with mild steel coated with commercial primer. The tests were conducted followed ASTM B117. Individual pictures were taken of each sample before the tests began, at 24, 48, 72, 96, 120, 144 and 168 hours to see the progression of the corrosion. Results showed that the samples coated with rust converter provide a good significant protection against corrosion phenomenon than the samples coated with commercial primer that available in the market. (author)

  2. Near net shape processing of zirconium or hafnium metals and alloys

    International Nuclear Information System (INIS)

    Evans, S.C.

    1992-01-01

    This patent describes a process for producing a metal shape. It comprises: plasma arc melting a metal selected from zirconium, hafnium and alloys thereof comprising at least about 90 w/o of these metals to form a liquid pool; pouring the metal form the pool into a mold to form a near net shape; and reducing the metal from its near net shape to a final size while maintaining the metal temperature below the alpha-beta transition temperature throughout the size reducing step

  3. In-Pile Experiment of a New Hafnium Aluminide Composite Material to Enable Fast Neutron Testing in the Advanced Test Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Donna Post Guillen; Douglas L. Porter; James R. Parry; Heng Ban

    2010-06-01

    A new hafnium aluminide composite material is being developed as a key component in a Boosted Fast Flux Loop (BFFL) system designed to provide fast neutron flux test capability in the Advanced Test Reactor. An absorber block comprised of hafnium aluminide (Al3Hf) particles (~23% by volume) dispersed in an aluminum matrix can absorb thermal neutrons and transfer heat from the experiment to pressurized water cooling channels. However, the thermophysical properties, such as thermal conductivity, of this material and the effect of irradiation are not known. This paper describes the design of an in-pile experiment to obtain such data to enable design and optimization of the BFFL neutron filter.

  4. Complexing of zirconium and hafnium with ortho-aminobenzoic acid and paraaminobenzoic acid

    International Nuclear Information System (INIS)

    Alekseeva, I.I.; Nemzer, I.I.; Yuranova, L.I.; Borisova, V.V.; Prozorovskaya, Z.N.

    1977-01-01

    Formation of complexes between zirconium and hafnium and ortho- and para-aminobenzoic acids has been studied by the kinetic method. It has been found that at pH=1.3-2.0 and concentrations of metals 10 -5 -10 -6 mole complex compounds are formed with composition Me:L=1:2 and 1:1 (Me=Zr, Hf; L=ortho- or para-aminobenzoic acids). Stepwise constants and overall effective constants of complex formation have been calculated

  5. Correlations between nuclear data and results of integral slab experiments. Case of hafnium; Correlations entre donnees nucleaires et experiences integrales a plaques: le cas du hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Palau, J M

    1997-10-22

    The aim of this thesis was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular `mock-up` reactor. In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods (APOLLO2 code) together with Monte Carlo- type simulations (TRIPOLI4 code) enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope {sup 177}Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent`s efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author) 128 refs.

  6. High temperature thermodynamics of solutions of oxygen in zirconium and hafnium

    International Nuclear Information System (INIS)

    Boureau, G.; Gerdanian, P.

    1984-01-01

    The Tian-Calvet microcalorimetric method has been applied to the determination at 1323 Kelvin of ΔH(O 2 ), the partial molar enthalpy of mixing of oxygen in zirconium and in hafnium. No measurable departure from Henry's law has been found for dilute solutions (ratio oxygen over metal smaller than 0.1). For concentrated solutions repulsive interactions are found in agreement with the existence of ordered structures at lower temperatures. The domain of homogeneity of zirconium has been found larger than previously assumed. (author)

  7. Extraction of hafnium by 1-phenyl-3-methyl-4-benzoyl-5-pyralozone from aqueous-alcoholic solutions

    International Nuclear Information System (INIS)

    Hala, J.; Prihoda, J.

    1975-01-01

    Extraction of hafnium by 1-phenyl-3-methyl-4-benzoyl-5-pyrazolone (HL) in benzene, toluene, chloroform and tetrachloromethane from aqueous-alcoholic solutions of the formal acidity of 2M-HClO 4 was studied. Methyl, ethyl, n- and isopropyl, tert-butyl and allyl alcohol as well as ethylene glycol monomethyl ether and propylene glycol were used as organic components of the mixed aqueous-organic phase. Their presence in some cases resulted in a synergic increase in the distribution ratio of hafnium. The increase is interpreted using the results of a slope analysis and measurements of the alcohol distribution and the relative permittivity of the organic phase. It is suggested that HfL 4 molecules were solvated by alcohol molecules in the organic phase. At high alcohol concentration synergism changed into antagonism. This was caused by changes in the distribution of HL and its interaction with the alcohol in the organic phase. (author)

  8. Trap state passivation improved hot-carrier instability by zirconium-doping in hafnium oxide in a nanoscale n-metal-oxide semiconductor-field effect transistors with high-k/metal gate

    International Nuclear Information System (INIS)

    Liu, Hsi-Wen; Tsai, Jyun-Yu; Liu, Kuan-Ju; Lu, Ying-Hsin; Chang, Ting-Chang; Chen, Ching-En; Tseng, Tseung-Yuen; Lin, Chien-Yu; Cheng, Osbert; Huang, Cheng-Tung; Ye, Yi-Han

    2016-01-01

    This work investigates the effect on hot carrier degradation (HCD) of doping zirconium into the hafnium oxide high-k layer in the nanoscale high-k/metal gate n-channel metal-oxide-semiconductor field-effect-transistors. Previous n-metal-oxide semiconductor-field effect transistor studies demonstrated that zirconium-doped hafnium oxide reduces charge trapping and improves positive bias temperature instability. In this work, a clear reduction in HCD is observed with zirconium-doped hafnium oxide because channel hot electron (CHE) trapping in pre-existing high-k bulk defects is the main degradation mechanism. However, this reduced HCD became ineffective at ultra-low temperature, since CHE traps in the deeper bulk defects at ultra-low temperature, while zirconium-doping only passivates shallow bulk defects.

  9. Determination of hafnium with the inductively coupled plasma (ICP)

    International Nuclear Information System (INIS)

    Wuensch, G.; Pose, K.

    1985-01-01

    The relative intensities of 198 hafnium lines in the Ar-ICP are listed. Spectral interference tables are given for the 9 analytically best lines, covering the range of +-60 pm around the Hf-lines. They include measured (not calculated) data of the interferent equivalent concentrations (IEC) and the critical concentration ratios (CCR) for 115 lines of all 34 possibly interfering elements. In many cases, these IEC- or CCR-data differ by 1 or 2 orders of magnitude from those calculated from intensities observed in the NBS-copper arc. Since no intense Hf-line is free from spectral interferences, examples are given for the calculation of the most suitable line for a known matrix. (orig.) [de

  10. Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.

    Science.gov (United States)

    Pramanik, Subrata; Kutzner, Arne; Heese, Klaus

    2017-05-23

    In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.

  11. Data acquisition using the 168/E

    International Nuclear Information System (INIS)

    Carroll, J.T.; Cittolin, S.; Demoulin, M.; Fucci, A.; Martin, B.; Norton, A.; Porte, J.P.; Rossi, P.; Storr, K.M.

    1983-03-01

    Event sizes and data rates at the CERN anti p p collider compose a formidable environment for a high level trigger. A system using three 168/E processors for experiment UA1 real-time event selection is described. With 168/E data memory expanded to 512K bytes, each processor holds a complete event allowing a FORTRAN trigger algorithm access to data from the entire detector. A smart CAMAC interface reads five Remus branches in parallel transferring one word to the target processor every 0.5 μs. The NORD host computer can simultaneously read an accepted event from another processor

  12. Atom-vacancy ordering and magnetic susceptibility of nonstoichiometric hafnium carbide

    International Nuclear Information System (INIS)

    Gusev, A.I.; Zyryanova, A.N.

    1999-01-01

    Experimental results on magnetic susceptibility of nonstoichiometric hafnium carbide HfC y (0.6 0.71 , HfC 0.78 and HfC 0.83 in the range of 870-930 K the anomalies are revealed which are associated with superstructure short-range ordering in a non-metallics sublattice. It is shown that a short-range order in HfC 0.71 and HfC 0.78 carbides corresponds to Hf 3 C 2 ordered phase, and in HfC 0.83 carbide - to Hf 6 C 5 ordered phase. HfC 0.78 carbide is found to possesses zero magnetic susceptibility in temperature range 910-980 K [ru

  13. Hafnium carbide nanocrystal chains for field emitters

    International Nuclear Information System (INIS)

    Tian, Song; Li, Hejun; Zhang, Yulei; Ren, Jincui; Qiang, Xinfa; Zhang, Shouyang

    2014-01-01

    A hafnium carbide (HfC) nanostructure, i.e., HfC nanocrystal chain, was synthesized by a chemical vapor deposition (CVD) method. X-ray diffractometer, field-emission scanning electron microscope, transmission electron microscope, and energy-dispersive X-ray spectrometer were employed to characterize the product. The synthesized one-dimensional (1D) nanostructures with many faceted octahedral nanocrystals possess diameters of tens of nanometers to 500 nm and lengths of a few microns. The chain-like structures possess a single crystalline structure and preferential growth direction along the [1 0 0] crystal orientation. The growth of the chains occurred through the vapor–liquid–solid process along with a negative-feedback mechanism. The field emission (FE) properties of the HfC nanocrystal chains as the cold cathode emitters were examined. The HfC nanocrystal chains display good FE properties with a low turn-on field of about 3.9 V μm −1 and a high field enhancement factor of 2157, implying potential applications in vacuum microelectronics.

  14. A 168E emulator for off-line production

    CERN Multimedia

    CERN PhotoLab

    1982-01-01

    By the end of 1982 seven such processors each with 184 kbyte memory were made available to a few experiments for about 3500 hours of equivalent IBM 370/168 equivalent time, at a cost of about 300 hours of equivalent IBM 370/168 time on the Computer Centre IBM. See Annual Report 1982 p. 81. In front of the computer, Christiane Ball

  15. Simplified method for gravimetric determination of zirconium or hafnium with α-hydroxy carboxylic acids

    International Nuclear Information System (INIS)

    Barbieri, R.S.; Rocha, J.C.; Terra, V.R.; Marques Netto, A.

    1989-01-01

    The conditions for gravimetric determination of zirconium or hafnium by glicoloc acids derivatives were studied by thermogravimetric analysis. The method utilized shownd that after precipitation, washing and drying of precipitates at 150 o C, the resulting solid was weighed in the form of [M (RCH(OH)COO) 4 ] (M = Zr, Hf; R + C 6 H 5 , β-C 10 H 7 , p-BrC 6 H 4 ). (author)

  16. Complexonometric determination of hafnium (4) in the presence of europium(3) or tantalum(5)

    International Nuclear Information System (INIS)

    Oziashvili, E.D.; Ehsakiya, K.E.; Sirakanyan, N.M.

    1986-01-01

    Complexonometric determination of hafnium in the presence of Ta or Eu in samples which can be decomposed by acids, i.e. in double borides has been investigated. Initial solutions are prepared by fusing with K 2 S 2 O 8 excess, the fusion was leached by hot water, H 2 SO L 4 was added and Hf was titrated by complexone 3 in the presence of xylenol orange

  17. Investigation of interaction of zirconium and hafnium tetrafluorides with strontium fluoride

    International Nuclear Information System (INIS)

    Ratnikova, I.D.; Korenev, Yu.M.; Novoselova, A.V.

    1980-01-01

    Diagrams of the condensated state of systems SrF 2 -EF 4 have been plotted, where E represents Zr, Hf. In these systems, three intermediate compounds of Sr 3 EF 10 , Sr 2 EF 8 and Sr EF 6 compositions are formed. All those compounds melt incongruently at temperatures of 982, 865 and 750 deg C, respectively - zirconium salt; at temperatures of 1000, 900 and 820 deg C - hafnium salts. Fluoro-metallates of composition 2:1, and 1:1, exist in two polymorphic forms. Tetrafluorides were found to dissolve in strontium fluoride: they form solid solutions having fluorite structure

  18. Correlations between nuclear data and integral slab experiments: the case of hafnium

    International Nuclear Information System (INIS)

    Palau, J.M.

    1999-01-01

    The aim of this work was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor.In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods together with Monte Carlo- type simulations enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope 177 Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  19. Laser coating of hafnium on Ti6Al4 for biomedical applications

    CSIR Research Space (South Africa)

    Phume, L

    2012-12-01

    Full Text Available Al4V FOR BIOMEDICAL APPLICATIONS Lerato Phume 1, 2, S.L. Pityana 1, 2, C. Meacock 1, A.P.I Popoola 2 1. National Laser Centre, Council for Scientific and Industrial Research, P.O. Box 395, Pretoria, 0001, South Africa 2. Department of Chemical... and Metallurgical Engineering, Tshwane University of Technology, Private Bag X 680, Pretoria, 0001, South Africa (b) (c) (e) To investigate laser surface coating of Ti6Al4V with preplaced Hafnium powder, to determine the influence of the energy density...

  20. Preparation, structure and properties of hafnium compounds in the system Hf-C-N-O

    International Nuclear Information System (INIS)

    Brundiers, G.D.

    1975-08-01

    Highly dense, homogenous and single phase hafnium carbonitride samples (with low oxygen content) were prepared in the whole concentration range of the ternary cubic carbonitrides. Stoichiometric hafnium oxicarbides were also prepared within the range of solubility. The procedure involved the hot pressing of powders of HfC, HfN, Hf, Hf-Oxide and carbon at temperatures of 3,000 0 C and pressures up to 550 kpf/cm 2 using a novel technique. Small single crystals of slightly substoichiometric HfN were also repared. The densification of the powders was studied as a function of the non-metal concentration. Carbonitrides with N/Hf ratio of 0.37 were prepared in a high temperature autoclave operating at medium pressures by the reaction of HfC with nitrogen. All the samples were characterized by density measurements, chemical, X-ray and metallographic analysis and in some cases with the aid of quantitative metallography and microprobe analysis. Typical properties investigated were lattice parameter, thermal expansion, microhardness and electrical resistivity as function of the non-metal content. For specific concentrations extreme values in the properties are attained. With the aid of the valence electron concentration (VEC) parameter, the properties can be correlated with the density of states of electrons at the Fermi level. (orig./HK) [de

  1. Systematic investigation of electromagnetic properties of all stable hafnium isotopes

    International Nuclear Information System (INIS)

    Napiorkowski, T.J.; Choinski, J.; Czosnyka, T.; Iwanicki, J.; Kownacki, J.; Zemlo, L.; Srebrny, J.; Starosta, K.; Boer, J. de.; Gollwitzer, A.; Loewe, M.; Wuerkner, M.; Guenther, C.; Weber, T.; Hagemann, G.; Sletten, G.

    1996-01-01

    In a systematic investigation of the electromagnetic structure of hafnium stable isotopes enriched targets of 176, 177, 178, 179, 180 Hf were Coulomb exciting using: 67 MeV 19 F beam from NBITAL FN Tandem, 125 MeV 32 S beam from MP Tandem in Accelerator Laboratory LMU and TU Munich, 225 MeV 58 Ni beam from NBITAL FN Tandem plus 2 Liniac Boosters complex. Scattered particle-gamma as well as p-γ-γ coincidence were registered. A further simultaneous analysis of Coulomb excitation cross section as a function of scattering angle of 19 F, 32 S, 58 Ni projectiles should be sufficient to deduce reduced probabilities of E2 transitions in ground state band

  2. Highly substituted zirconium and hafnium cyclopentadienyl bifunctional β-diketiminate complexes – Synthesis, structure, and catalytic activity towards ethylene polymerization

    Czech Academy of Sciences Publication Activity Database

    Havlík, A.; Lamač, Martin; Pinkas, Jiří; Varga, Vojtěch; Růžička, A.; Olejník, R.; Horáček, Michal

    2015-01-01

    Roč. 786, JUN 2015 (2015), s. 71-80 ISSN 0022-328X R&D Projects: GA ČR GAP106/10/0924 Institutional support: RVO:61388955 Keywords : Zirconium * Hafnium * Cyclopentadienyl Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.336, year: 2015

  3. Wake-up effects in Si-doped hafnium oxide ferroelectric thin films

    International Nuclear Information System (INIS)

    Zhou, Dayu; Xu, Jin; Li, Qing; Guan, Yan; Cao, Fei; Dong, Xianlin; Müller, Johannes; Schenk, Tony; Schröder, Uwe

    2013-01-01

    Hafnium oxide based ferroelectric thin films have shown potential as a promising alternative material for non-volatile memory applications. This work reports the switching stability of a Si-doped HfO 2 film under bipolar pulsed-field operation. High field cycling causes a “wake-up” in virgin “pinched” polarization hysteresis loops, demonstrated by an enhancement in remanent polarization and a shift of negative coercive voltage. The rate of wake-up is accelerated by either reducing the frequency or increasing the amplitude of the cycling field. We suggest de-pinning of domains due to reduction of the defect concentration at bottom electrode interface as origin of the wake-up

  4. Correlations between nuclear data and results of integral slab experiments. Case of hafnium

    International Nuclear Information System (INIS)

    Palau, J.M.

    1997-01-01

    The aim of this thesis was to evaluate how much integral slab experiments can both reduce discrepancies between experimental results and calculations, and improve the knowledge of hafnium isotopes neutronic parameters by an adapted sensitivity and uncertainty method. A statistical approach, based on the generalized least squares method and perturbation theory, has been incorporated into our calculation system in order to deduce microscopic cross-section adjustments from observed integral measurements on this particular 'mock-up' reactor. In this study it has been established that the correlations between integral parameters and hafnium capture cross-sections enable specific variations in the region of resolved resonances at the level of multigroup and punctual cross-sections recommended data (JEF-2.2 evaluation) to be highlighted. The use of determinist methods (APOLLO2 code) together with Monte Carlo- type simulations (TRIPOLI4 code) enabled a depth analysis of the modelling approximations to be carried out. Furthermore, the sensitivity coefficient validation technique employed leads to a reliable assessment of the quality of the new basic nuclear data. In this instance, the adjustments proposed for certain isotope 177 Hf resonance parameters reduce, after error propagation, by 3 to 5 per cent the difference between experimental results and calculations related to this absorbent's efficiency. Beyond this particular application, the qualification methodology integrated in our calculation system should enable other basic sizing parameters to be treated (chemical / geometric data or other unexplored nuclear data) to make technological requirements less stringent. (author)

  5. Extraction of hafnium with chelating agents from aqueous-alcoholic solutions

    International Nuclear Information System (INIS)

    Hala, J.; Prihoda, J.

    1975-01-01

    The extraction was studied of hafnium into solutions of N-benzoyl-N-phenylhydroxylamine, 2-thenoyltrifluoroacetone and di-n-butylphosphoric acid in benzene, toluene, chloroform and tetrachloromethane from aqueous alcoholic solutions with a formal acidity of 2M-HClO 4 . Methyl-, ethyl-, n- and isopropyl- and tert-butyl alcohol were used as organic components in the mixed aqueous-organic phase. In the extraction into N-benzoyl-N-phenylhydroxylamine the presence of the alcohols resulted in synergic effects analogous to the previously described extraction by substituted benzoylpyrazolone. With the other two extractants, the effect of the alcohols was antagonistic, due to the interaction of alcohol or water with the reagent in the organic phase, and to the decrease in the reagent distribution constant. (author)

  6. Studies of high-K isomers in hafnium nuclei

    International Nuclear Information System (INIS)

    Sletten, G.; Gjoerup, N.L.

    1991-01-01

    K-isomeric states built on high-Ω Nilsson orbitals from deformation-aligned high-j levels near the Fermi surface are found to cluster in the neutron rich Hf, W and Os nuclei. It has been shown that some of the high seniority states of this type have decay properties that indicate strong mixing of configurations and that in Osmium nuclei γ-softness cause strong deviations from the well established K-selection rule. Also in the Hafnium nuclei is the expected forbiddenness in isomeric decays an order of magnitude smaller than expected from the K-selection rule. A new 9 quasiparticle isomer has been discovered in 175 Hf at I=57/2. This isomer has the anomalous decay as the dominant mode. Other lower seniority states are also identified. At spin 35/2 and 45/2 the deformation aligned states become yrast, but the structure of the yrast line to even higher spins is not yet understood. (author)

  7. Luminescent determination of zirconium and hafnium with myricetin

    International Nuclear Information System (INIS)

    Talipov, Sh.T.; Zel'tser, L.E.; Morozova, L.A.; Tashkhodzhaev, A.T.

    1978-01-01

    Reaction of formation of 3, 5, 7, 3', 4', 5' - hexaoxiflavone - myricetin complexes with zirconium and hafnium ions has been the basis for development of luminescent method of determining these elements. Optimum conditions for complexing have been determined. For Hf they are : 8-9 HCl concentration, maximum fluorescence wave length (lambda fl.)of 520 nm, wave length of exciting light (lambda el) of 436 nm, for Zr lambda fl = 536nm, lambda el = 436 nm. Stable fluorescence establishes after 25 min. for Zr and after 15 min for Hf in the presence of 40% ethanol. Usage of various camouflage agents has permitted to attain high selectivity of the method. Possibility for determination of Zr with myricetin in the presence of a 10-time excess of Hf, Cr, Cu, 50-time excess of Mo and Ti is shown. Sensitivity of Zr determination is 2.0x10 μg -2 /ml, for Hf it is 9.0x10 μg -3 and mineral waters

  8. β-γ and isomeric decay spectroscopy of 168Dy

    Directory of Open Access Journals (Sweden)

    Zhang G.X.

    2018-01-01

    Full Text Available This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.

  9. β-γ and isomeric decay spectroscopy of 168Dy

    Science.gov (United States)

    Zhang, G. X.; Watanabe, H.; Kondev, F. G.; Lane, G. J.; Regan, P. H.; Söderström, P.-A.; Walker, P. M.; Kanaoka, H.; Korkulu, Z.; Lee, P. S.; Liu, J. J.; Nishimura, S.; Wu, J.; Yagi, A.; Ahn, D. S.; Alharbi, T.; Baba, H.; Browne, F.; Bruce, A. M.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Doornenbal, P.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Isobe, T.; Kanaya, S.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, C. S.; Lee, E. J.; Lorusso, G.; Lotay, G.; Moon, C.-B.; Nishizuka, I.; Nita, C. R.; Odahara, A.; Patel, Z.; Phong, V. H.; Podolyák, Zs.; Roberts, O. J.; Sakurai, H.; Schaffner, H.; Shand, C. M.; Shimizu, Y.; Sumikama, T.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Valiente-Dóbon, J. J.; Xu, Z. Y.

    2018-05-01

    This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.

  10. Amorphous Hafnium-Indium-Zinc Oxide Semiconductor Thin Film Transistors

    Directory of Open Access Journals (Sweden)

    Sheng-Po Chang

    2012-01-01

    Full Text Available We reported on the performance and electrical properties of co-sputtering-processed amorphous hafnium-indium-zinc oxide (α-HfIZO thin film transistors (TFTs. Co-sputtering-processed α-HfIZO thin films have shown an amorphous phase in nature. We could modulate the In, Hf, and Zn components by changing the co-sputtering power. Additionally, the chemical composition of α-HfIZO had a significant effect on reliability, hysteresis, field-effect mobility (μFE, carrier concentration, and subthreshold swing (S of the device. Our results indicated that we could successfully and easily fabricate α-HfIZO TFTs with excellent performance by the co-sputtering process. Co-sputtering-processed α-HfIZO TFTs were fabricated with an on/off current ratio of ~106, higher mobility, and a subthreshold slope as steep as 0.55 V/dec.

  11. 26 CFR 5c.168(f)(8)-4 - Minimum investment of lessor.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Minimum investment of lessor. 5c.168(f)(8)-4....168(f)(8)-4 Minimum investment of lessor. (a) Minimum investment. Under section 168(f)(8)(B)(ii), an... has a minimum at risk investment which, at the time the property is placed in service under the lease...

  12. 25 CFR 168.16 - Impoundment and disposal of unauthorized livestock.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Impoundment and disposal of unauthorized livestock. 168... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.16 Impoundment and disposal of unauthorized livestock. Unauthorized livestock within any range unit of the Hopi Partitioned Lands which are not removed therefrom...

  13. 25 CFR 168.15 - Control of livestock diseases and parasites.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Control of livestock diseases and parasites. 168.15... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.15 Control of livestock diseases and parasites. Whenever... parasites or have been exposed thereto, such livestock must be treated and the movement thereof restricted...

  14. SNOOP module CAMAC interface to the 168/E microprocessor

    International Nuclear Information System (INIS)

    Bernstein, D.; Carroll, J.T.; Mitnick, V.H.; Paffrath, L.; Parker, D.B.

    1979-10-01

    A pair of 168/E microprocessors will be used to meet the realtime computing requirements of the SLAC Hybrid Facility. A SNOOP module and 168/E Interface provide the link between the host computer and the microprocessors. By eavesdropping on normal CAMAC read operations, the SNOOP provides a direct data transfer from CAMAC to microprocessor memory. The host computer controls the processors using standard CAMAC programmed I/O to the SNOOP

  15. Differential perturbed angular correlation: use of physico-chemical study of some hafnium complexes derivates of hydroxy acids and EDTA

    International Nuclear Information System (INIS)

    Silveira, J.G. da.

    1981-01-01

    Measures of quadrupolar interaction to nucleus level of the metal, in some hafnium complexes are presented, including the analysis by combustion, microanalysis, infrared spectroscopy and thermogravimetry. The hyperfine interaction parameters, the temperature effects and the thermal neutrons capture effects over the irradiated Hf Y (Y = EDTA) are also studied. (author)

  16. Dicty_cDB: SFG168 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG

  17. 26 CFR 1.168(h)-1 - Like-kind exchanges involving tax-exempt use property.

    Science.gov (United States)

    2010-04-01

    ... property. 1.168(h)-1 Section 1.168(h)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.168(h)-1 Like-kind exchanges involving tax-exempt use property. (a) Scope. (1... property (as defined in section 168(h)) at the time of the transfer; and (ii) Property that does not become...

  18. Rhodium and Hafnium Influence on the Microstructure, Phase Composition, and Oxidation Resistance of Aluminide Coatings

    OpenAIRE

    Maryana Zagula-Yavorska; Małgorzata Wierzbińska; Jan Sieniawski

    2017-01-01

    A 0.5 μm thick layer of rhodium was deposited on the CMSX 4 superalloy by the electroplating method. The rhodium-coated superalloy was hafnized and aluminized or only aluminized using the Chemical vapour deposition method. A comparison was made of the microstructure, phase composition, and oxidation resistance of three aluminide coatings: nonmodified (a), rhodium-modified (b), and rhodium- and hafnium-modified (c). All three coatings consisted of two layers: the additive layer and the interdi...

  19. Study of bulk Hafnium oxide (HfO2) under compression

    Science.gov (United States)

    Pathak, Santanu; Mandal, Guruprasad; Das, Parnika

    2018-04-01

    Hafnium oxide (HfO2) is a technologically important material. This material has K-value of 25 and band gap 5.8 eV. A k value of 25-30 is preferred for a gate dielectric [1]. As it shows good insulating and capacitive properties, HfO2 is being considered as a replacement to SiO2 in microelectronic devices as gate dielectrics. On the other hand because of toughening mechanism due to phase transformation induced by stress field observed in these oxides, HFO2 has been a material of investigations in various configurations for a very long time. However the controversies about phase transition of HfO2 under pressure still exists. High quality synchrotron radiation has been used to study the structural phase transition of HfO2 under pressure.

  20. Hafnium at subduction zones: isotopic budget of input and output fluxes; L'hafnium dans les zones de subduction: bilan isotopique des flux entrant et sortant

    Energy Technology Data Exchange (ETDEWEB)

    Marini, J.Ch

    2004-05-15

    Subduction zones are the primary regions of mass exchanges between continental crust and mantle of Earth through sediment subduction toward the earth's mantle and by supply of mantellic magmas to volcanic arcs. We analyze these mass exchanges using Hafnium and Neodymium isotopes. At the Izu-Mariana subduction zone, subducting sediments have Hf and Nd isotopes equivalent to Pacific seawater. Altered oceanic crust has Hf and Nd isotopic compositions equivalent to the isotopic budget of unaltered Pacific oceanic crust. At Luzon and Java subduction zones, arc lavas present Hf isotopic ratios highly radiogenic in comparison to their Nd isotopic ratios. Such compositions of the Luzon and Java arc lavas are controlled by a contamination of their sources by the subducted oceanic sediments. (author)

  1. 29 CFR 4.168 - Wage payments-deductions from wages paid.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Wage payments-deductions from wages paid. 4.168 Section 4... Standards Compliance with Compensation Standards § 4.168 Wage payments—deductions from wages paid. (a) The wage requirements of the Act will not be met where unauthorized deductions, rebates, or refunds reduce...

  2. Hafnium at subduction zones: isotopic budget of input and output fluxes

    International Nuclear Information System (INIS)

    Marini, J.Ch.

    2004-05-01

    Subduction zones are the primary regions of mass exchanges between continental crust and mantle of Earth through sediment subduction toward the earth's mantle and by supply of mantellic magmas to volcanic arcs. We analyze these mass exchanges using Hafnium and Neodymium isotopes. At the Izu-Mariana subduction zone, subducting sediments have Hf and Nd isotopes equivalent to Pacific seawater. Altered oceanic crust has Hf and Nd isotopic compositions equivalent to the isotopic budget of unaltered Pacific oceanic crust. At Luzon and Java subduction zones, arc lavas present Hf isotopic ratios highly radiogenic in comparison to their Nd isotopic ratios. Such compositions of the Luzon and Java arc lavas are controlled by a contamination of their sources by the subducted oceanic sediments. (author)

  3. Centrifugal stretching along the ground state band of 168Hf

    International Nuclear Information System (INIS)

    Costin, A.; Pietralla, N.; Reese, M.; Moeller, O.; Ai, H.; Casten, R. F.; Heinz, A.; McCutchan, E. A.; Meyer, D. A.; Qian, J.; Werner, V.; Dusling, K.; Fitzpatrick, C. R.; Guerdal, G.; Petkov, P.; Rainovski, G.

    2009-01-01

    The lifetimes of the J π =4 + , 6 + , 8 + , and 10 + levels along the ground state band in 168 Hf were measured by means of the recoil distance Doppler shift (RDDS) method using the New Yale Plunger Device (NYPD) and the SPEEDY detection array at Wright Nuclear Structure Laboratory of Yale University. Excited states in 168 Hf were populated using the 124 Sn( 48 Ti,4n) fusion evaporation reaction. The new lifetime values are sufficiently precise to clearly prove the increase of quadrupole deformation as a function of angular momentum in the deformed nucleus 168 Hf. The data agree with the predictions from the geometrical confined β-soft (CBS) rotor model that involves centrifugal stretching in a soft potential

  4. 40 CFR 35.168 - Award limitations.

    Science.gov (United States)

    2010-07-01

    ... STATE AND LOCAL ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.168...) The State monitors and compiles, analyzes, and reports water quality data as described in section 106... October 18, 1972, a summary report of the current status of the State pollution control program, including...

  5. Thermal expansion studies on Hafnium titanate (HfTiO4)

    International Nuclear Information System (INIS)

    Panneerselvam, G.; Subramanian, G.G.S.; Antony, M.P.

    2006-01-01

    The lattice thermal expansion characteristics of hafnium titanate (HfTiO 4 ) have been studied by measuring the lattice parameter as a function of temperature by high temperature X-ray diffraction technique (HT-XRD) in the temperature range 298-1973K. Percentage linear thermal expansion and mean linear thermal expansion coefficients were computed from the lattice parameter data. The thermal expansion of HfTiO 4 is highly anisotropic. The expansivity along 'a' axis is large; as compared to the expansivity along 'b' axis which is negative below 1073 K. The percentage linear thermal expansion in the temperature range 298-1973 K along a, b and c axis are 2.74, 0.901 and 1.49 respectively. Thermal expansion values obtained in the present study are in reasonable agreement with the existing thermal expansion data. (author)

  6. The structure of the 168Er nucleus and the 166Er(t,p) 168 Er reaction in terms of the sdg interacting boson model

    Science.gov (United States)

    Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.

    1986-05-01

    Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of 168Er in the 166Er(t,P) 168Er reaction rather well. In particular, the excitation of I,Kπi = 4,3 +1; 2,2 +2; 0,0 +3 and 0,0 +4 states is much improved over the sd-IBM approach.

  7. 42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...

  8. Surface State Capture Cross-Section at the Interface between Silicon and Hafnium Oxide

    Directory of Open Access Journals (Sweden)

    Fu-Chien Chiu

    2013-01-01

    Full Text Available The interfacial properties between silicon and hafnium oxide (HfO2 are explored by the gated-diode method and the subthreshold measurement. The density of interface-trapped charges, the current induced by surface defect centers, the surface recombination velocity, and the surface state capture cross-section are obtained in this work. Among the interfacial properties, the surface state capture cross-section is approximately constant even if the postdeposition annealing condition is changed. This effective capture cross-section of surface states is about 2.4 × 10−15 cm2, which may be an inherent nature in the HfO2/Si interface.

  9. A thermally robust and thickness independent ferroelectric phase in laminated hafnium zirconium oxide

    Directory of Open Access Journals (Sweden)

    S. Riedel

    2016-09-01

    Full Text Available Ferroelectric properties in hafnium oxide based thin films have recovered the scaling potential for ferroelectric memories due to their ultra-thin-film- and CMOS-compatibility. However, the variety of physical phenomena connected to ferroelectricity allows a wider range of applications for these materials than ferroelectric memory. Especially mixed HfxZr1-xO2 thin films exhibit a broad compositional range of ferroelectric phase stability and provide the possibility to tailor material properties for multiple applications. Here it is shown that the limited thermal stability and thick-film capability of HfxZr1-xO2 can be overcome by a laminated approach using alumina interlayers.

  10. Influence of plastic deformation on nitriding of a molybdenum-hafnium alloy

    International Nuclear Information System (INIS)

    Lakhtin, Yu.M.; Kogan, Ya.D.; Shashkov, D.P.; Likhacheva, T.E.

    1982-01-01

    The influence of a preliminary plastic strain on the structure and properties of molybdenum alloy with 0.2 wt.% Hf upon nitriding in the ammonia medium at 900-1200 deg C during 1-6 h is investigated. The study of microhardness distribution across the nitrided layer thickness has shown that with increase of the degree of preliminary plastic strain up to 50 % the nitrided layer hardness decreases and with further reduction growth up to 90 % - increases. Nitriding sharply (hundred times) increases wear resistance of molybdenum alloy with hafnium addition. At the reduction degree 25 % the wear resistance is less than at other values of percentage reduction in area owing to the minimum thickness of the nitride zone. The alloy strained before nitriding by 25 % has shown the best results during heat resistance testing

  11. Clinical and Biological Manifestation of RNF168 Deficiency in Two Polish Siblings

    Directory of Open Access Journals (Sweden)

    Barbara Pietrucha

    2017-12-01

    Full Text Available Germline mutations in the RING finger protein gene RNF168 have been identified in a combined immunodeficiency disorder called RIDDLE syndrome. Since only two patients have been described with somewhat different phenotypes, there is need to identify further patients. Here, we report on two Polish siblings with RNF168 deficiency due to homozygosity for a novel frameshift mutation, c.295delG, that was identified through exome sequencing. Both patients presented with immunoglobulin deficiency, telangiectasia, cellular radiosensitivity, and increased alpha-fetoprotein (AFP levels. The younger sibling had a more pronounced neurological and morphological phenotype, and she also carried an ATM gene mutation in the heterozygous state. Immunoblot analyses showed absence of RNF168 protein, whereas ATM levels and function were proficient in lymphoblastoid cells from both patients. Consistent with the absence of RNF168 protein, 53BP1 recruitment to DNA double-strand breaks (DSBs after irradiation was undetectable in lymphoblasts or primary fibroblasts from either of the two patients. γH2AX foci accumulated normally but they disappeared with significant delay, indicating a severe defect in DSB repair. A comparison with the two previously identified patients indicates immunoglobulin deficiency, cellular radiosensitivity, and increased AFP levels as hallmarks of RNF168 deficiency. The variability in its clinical expression despite similar cellular phenotypes suggests that some manifestations of RNF168 deficiency may be modified by additional genetic or epidemiological factors.

  12. Dielectric response and ac conductivity analysis of hafnium oxide nanopowder

    International Nuclear Information System (INIS)

    Karahaliou, P K; Xanthopoulos, N; Krontiras, C A; Georga, S N

    2012-01-01

    The dielectric response of hafnium oxide nanopowder was studied in the frequency range of 10 -2 -10 6 MHz and in the temperature range of 20-180 °C. Broadband dielectric spectroscopy was applied and the experimental results were analyzed and discussed using the electric modulus (M*) and alternating current (ac) conductivity formalisms. The analyses of the dc conductivity and electric modulus data revealed the presence of mechanisms which are thermally activated, both with almost the same activation energy of 1.01 eV. A fitting procedure involving the superposition of the thermally activated dc conductivity, the universal dielectric responce and the near constant loss terms has been used to describe the frequency evolution of the real part of the specific electrical conductivity. The conductivity master curve was obtained, suggesting that the time-temperature superposition principle applies for the studied system, thus implying that the conductivity mechanisms are temperature independent.

  13. Interface and oxide traps in high-κ hafnium oxide films

    International Nuclear Information System (INIS)

    Wong, H.; Zhan, N.; Ng, K.L.; Poon, M.C.; Kok, C.W.

    2004-01-01

    The origins of the interface trap generation and the effects of thermal annealing on the interface and bulk trap distributions are studied in detail. We found that oxidation of the HfO 2 /Si interface, removal of deep trap centers, and crystallization of the as-deposited film will take place during the post-deposition annealing (PDA). These processes will result in the removal of interface traps and deep oxide traps and introduce a large amount of shallow oxide traps at the grain boundaries of the polycrystalline film. Thus, trade-off has to be made in considering the interface trap density and oxide trap density when conducting PDA. In addition, the high interface trap and oxide trap densities of the HfO 2 films suggest that we may have to use the SiO 2 /HfO 2 stack or hafnium silicate structure for better device performance

  14. 9 CFR 381.168 - Maximum percent of skin in certain poultry products.

    Science.gov (United States)

    2010-01-01

    ... poultry products. 381.168 Section 381.168 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

  15. Effects of oxygen partial pressure and annealing temperature on the residual stress of hafnium oxide thin-films on silicon using synchrotron-based grazing incidence X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Biswas, Debaleen [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Sinha, Anil Kumar [ISU, Raja Ramanna Centre for Advanced Technology, Indore 452 013 (India); Homi Bhabha National Institute, BARC, Mumbai 400 094 (India); Chakraborty, Supratic, E-mail: supratic.chakraborty@saha.ac.in [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)

    2016-10-30

    Highlights: • Residual stress estimation thin hafnium oxide film with thickness of <10 nm. • A mathematical expression is proposed for stress estimation of thin-film using GIXRD. • Residual stress varies with argon content in Ar/O{sub 2} plasma and annealing temperature. • Variation of stress is explained by IL swelling and enhanced structural relaxation. - Abstract: Synchrotron radiation-based grazing incidence X-ray diffraction (GI-XRD) technique is employed here to estimate the residual stress of < 10 nm thin hafnium oxide film deposited on Si (100) substrate at different argon/oxygen ratios using reactive rf sputtering. A decrease in residual stress, tensile in nature, is observed at higher annealing temperature for the samples deposited with increasing argon ratio in the Ar/O{sub 2} plasma. The residual stress of the films deposited at higher p{sub Ar} (Ar:O{sub 2} = 4:1) is also found to be decreased with increasing annealing temperature. But the stress is more or less constant with annealing temperature for the films deposited at lower Ar/O{sub 2} (1:4) ratio. All the above phenomena can be explained on the basis of swelling of the interfacial layer and enhanced structural relaxation in the presence of excess Hf in hafnium oxide film during deposition.

  16. Pyroelectricity of silicon-doped hafnium oxide thin films

    Science.gov (United States)

    Jachalke, Sven; Schenk, Tony; Park, Min Hyuk; Schroeder, Uwe; Mikolajick, Thomas; Stöcker, Hartmut; Mehner, Erik; Meyer, Dirk C.

    2018-04-01

    Ferroelectricity in hafnium oxide thin films is known to be induced by various doping elements and in solid-solution with zirconia. While a wealth of studies is focused on their basic ferroelectric properties and memory applications, thorough studies of the related pyroelectric properties and their application potential are only rarely found. This work investigates the impact of Si doping on the phase composition and ferro- as well as pyroelectric properties of thin film capacitors. Dynamic hysteresis measurements and the field-free Sharp-Garn method were used to correlate the reported orthorhombic phase fractions with the remanent polarization and pyroelectric coefficient. Maximum values of 8.21 µC cm-2 and -46.2 µC K-1 m-2 for remanent polarization and pyroelectric coefficient were found for a Si content of 2.0 at%, respectively. Moreover, temperature-dependent measurements reveal nearly constant values for the pyroelectric coefficient and remanent polarization over the temperature range of 0 ° C to 170 ° C , which make the material a promising candidate for IR sensor and energy conversion applications beyond the commonly discussed use in memory applications.

  17. Implantation of titanium, chromium, yttrium, molybdenum, silver, hafnium, tantalum, tungsten and platinum ions generated by a metal vapor vacuum ion source into 440C stainless steel

    International Nuclear Information System (INIS)

    Sasaki, Jun; Hayashi, Kazunori; Sugiyama, Kenji; Ichiko, Osami; Hashiguchi, Yoshihiro

    1992-01-01

    Titanium, yttrium, molybdenum, silver, chromium, hafnium, tantalum, tungsten and platinum ions generated by a metal vapor vacuum arc (MEVVA) ion source were implanted into 440C stainless steel in the dose region 10 17 ions cm -2 with extraction voltages of up to 70 kV. Glow discharge spectroscopy (GDS), friction coefficient, and Vickers microhardness of the specimens were studied. Grooves made by friction tests were investigated by electron probe microanalysis (EPMA). GDS showed incorporation of carbon in the yttrium, hafnium, tantalum, tungsten and platinum implanted specimens, as well as titanium implanted samples. A large amount of oxygen was observed in the yttrium implanted specimen. The friction coefficient was measured by reciprocating sliding of an unimplanted 440C ball without lubricant at a load of 0.245 N. The friction decreased and achieved a stable state after implantation of titanium, hafnium and tantalum. The friction coefficient of the platinum implanted specimen showed a gradual decrease after several cycles of sliding at high friction coefficient. The yttrium implanted sample exhibited a decreased but slightly unstable friction coefficient. Results from EPMA showed that the implanted elements, which gave decreased friction, remained even after sliding of 200 cycles. Implantation of chromium, molybdenum, silver and tungsten did not provide a decrease in friction and the implants were gone from the wear grooves after the sliding tests. (orig.)

  18. Critical evaluation of the determination of zirconium and hafnium by instrumental and radiochemical neutron activation analysis

    International Nuclear Information System (INIS)

    Burger, Mario; Kraehenbuehl, Urs

    1991-01-01

    Neutron activation analysis (instrument or radiochemical) is suitable for the determination of zirconium and hafnium in samples of geochemical origin only when sufficient attention is paid to inter-fering nuclides. The size of the necessary correction for INAA depends on the composition of the sample; this problem is discussed. The radio-chemical technique which is recommended involves separation of the samples, precipitations and anion-exchange separation. Results are given for various standard reference materials and for meteorites. (author). 12 refs.; 1 fig.; 9 tabs

  19. A fast response hafnium selective polymeric membrane electrode based on N,N'-bis(α-methyl-salicylidene)-dipropylenetriamine as a neutral carrier

    International Nuclear Information System (INIS)

    Rezaei, B.; Meghdadi, S.; Zarandi, R. Fazel

    2008-01-01

    In this study a new hafnium selective sensor was fabricated from polyvinylchloride (PVC) matrix membrane containing neutral carrier N,N'-bis(α-methyl-salicylidene)-dipropylenetriamine (Mesaldpt) as a new ionophore, sodium tetraphenyl borate (NaTPB) as anionic discriminator and dioctyl phthalate (DOP) as plasticizing solvent mediator in tetrahydrofuran solvent. The electrode exhibits Nernstian response for Hf 4+ (Hafnium(IV)) over a wide concentration range (2.0 x 10 -7 to 1.0 x 10 -1 M) with the determination coefficient of 0.9966 and slope of 15.1 ± 0.1 mV decades -1 . The limit of detection is 1.9 x 10 -7 M. The electrode has a fast response time of 18 s and a working pH range of 4-8. The proposed membrane shows excellent discriminating ability towards Hf 4+ ion with regard to several alkali, alkaline earth transition and heavy metal ions. It can be used over a period of 1.5 months with good reproducibility. It is successfully applied for direct determination of Hf 4+ in solutions by standard addition method for real sample analysis

  20. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-Gonzá lez, R.; Garcí a-Cerda, L. A.; Alshareef, Husam N.; Gnade, Bruce E.; Quevedo-Ló pez, Manuel Angel Quevedo

    2010-01-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  1. Study of hafnium (IV) oxide nanoparticles synthesized by polymerized complex and polymer precursor derived sol-gel methods

    KAUST Repository

    Ramos-González, R.

    2010-03-01

    This work reports the preparation and characterization of hafnium (IV) oxide (HfO2) nanoparticles grown by derived sol-gel routes that involves the formation of an organic polymeric network. A comparison between polymerized complex (PC) and polymer precursor (PP) methods is presented. For the PC method, citric acid (CA) and ethylene glycol (EG) are used as the chelating and polymerizable reagents, respectively. In the case of PP method, poly(acrylic acid) (PAA) is used as the chelating reagent. In both cases, different precursor gels were prepared and the hafnium (IV) chloride (HfCl4) molar ratio was varied from 0.1 to 1.0 for the PC method and from 0.05 to 0.5 for the PP method. In order to obtain the nanoparticles, the precursors were heat treated at 500 and 800 °C. The thermal characterization of the precursor gels was carried out by thermogravimetric analysis (TGA) and the structural and morphological characterization by X-ray diffraction (XRD) and transmission electron microscopy (TEM). The XRD patterns of the samples obtained by both methods shows the formation of HfO2 at 500 °C with monoclinic crystalline phase. The PC method exhibited also the cubic phase. Finally, the HfO2 nanoparticles size (4 to 11 nm) was determined by TEM and XRD patterns. © (2010) Trans Tech Publications.

  2. Image collection: 168 [Togo Picture Gallery[Archive

    Lifescience Database Archive (English)

    Full Text Available 168 Choloepus_didactylus_NL.png フタユビナマケモノ Toed sloth Choloepus didactylus 27675 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱

  3. Rapid formation of nanocrystalline HfO2 powders from amorphous hafnium hydroxide under ultrasonically assisted hydrothermal treatment

    International Nuclear Information System (INIS)

    Meskin, Pavel E.; Sharikov, Felix Yu.; Ivanov, Vladimir K.; Churagulov, Bulat R.; Tretyakov, Yury D.

    2007-01-01

    Peculiarities of hafnium hydroxide hydrothermal decomposition were studied by in situ heat flux calorimetry for the first time. It was shown that this process occurs in one exothermal stage (ΔH = -17.95 kJ mol -1 ) at 180-250 deg. C resulting in complete crystallization of amorphous phase with formation of pure monoclinic HfO 2 . It was found that the rate of m-HfO 2 formation can be significantly increased by combining hydrothermal treatment with simultaneous ultrasonic activation

  4. Improvement of aging kinetics and precipitate size refinement in Mg–Sn alloys by hafnium additions

    Energy Technology Data Exchange (ETDEWEB)

    Behdad, S. [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States); Zhou, L. [Department of Materials Science and Engineering and Advanced Materials Processing and Analysis Center, University of Central Florida, Orlando, FL 32816 (United States); Henderson, H.B.; Manuel, M.V. [Department of Materials Science and Engineering, University of Florida, Gainesville, FL 32611 (United States); Sohn, Y. [Department of Materials Science and Engineering and Advanced Materials Processing and Analysis Center, University of Central Florida, Orlando, FL 32816 (United States); Agarwal, A. [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States); Boesl, B., E-mail: bboesl@fiu.edu [Department of Mechanical and Materials Engineering, Florida International University, Miami, FL 33174 (United States)

    2016-01-10

    Two Mg–Sn alloys were microalloyed by addition of Hafnium and their age-hardening response was studied at 200 °C. Time to reach peak hardness was significantly reduced and improved by Hf addition. TEM study showed Hf clusters in the close vicinity and at the surface of Mg{sub 2}Sn precipitates, which confirms that Hf clusters act as additional nucleation centers for Mg{sub 2}Sn precipitate formation. Our results support the validity of thermokinetic criterion proposed by Mendis for selection of microalloying elements in order to refine precipitate size, accelerate aging kinetics and enhance peak hardness.

  5. 27 CFR 24.168 - Identification of tanks.

    Science.gov (United States)

    2010-04-01

    ..., DEPARTMENT OF THE TREASURY LIQUORS WINE Construction and Equipment § 24.168 Identification of tanks. (a) General. Each tank, barrel, puncheon, or similar bulk container, used to ferment wine or used to process or store wine, spirits, or wine making materials will have the contents marked and will be marked as...

  6. Structure of the /sup 168/Er nucleus and the /sup 166/Er(t,p)/sup 168/Er reaction in terms of the sdg interacting boson model

    Energy Technology Data Exchange (ETDEWEB)

    Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.

    1986-05-29

    Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of /sup 168/Er in the /sup 166/Er(t,P)/sup 168/Er reaction rather well. In particular, the excitation of I,Ksub(i)sup(..pi..) = 4,3/sub 1//sup +/; 2,2/sub 2//sup +/; 0,0/sub 3//sup +/ and 0,0/sub 4//sup +/ states is much improved over the sd-IBM appraoch.

  7. 168/E online for UA1

    CERN Multimedia

    1983-01-01

    Five 168/E processors and associated specialized interface hardware made an importartant contribution to the UA1 experiment. The processors provided an online event display facility, and also flagged candidate events. See Annual Report 1983 p. 75, and photo 8305815X, 8395813X. This photo shows the team including DD personnel and UA1 members. On the foreground left, is Michel Demoulin. On the background, 3rd from left, is Adolfo Fucci, last Sergio Cittolin.

  8. Solvent extraction of hafnium(IV) by dinonylnaphthalene sulfonic acid from mixed aqueous-organic media

    International Nuclear Information System (INIS)

    Hala, J.; Piperkovova, H.

    1979-01-01

    The extraction of hafnium(IV) by heptane and toluene solutions of dinonylnaphthalene sulfonic acid (HD) from mixed aqueous-organic solutions has been studied. Alcohols, ketones, carboxylic acids, cyclic ethers, dimethylsulfoxide and dimethylformamide were used as the organic component of the mixed phase. Methanol, ethanol, formic acid and dioxane increased the extractability of Hf(IV) whereas other solvents showed only an antagonistic effect. The results were discussed from the point of view of the changes in micellar structure of HD, and compared with the uptake of Hf(IV) by resinous cation exchangers. The solubilization by HD of alcohols, carboxylic acids and dimethylsulfoxide was demonstrated by using the corresponding 14 C and 35 S labelled compounds. (author)

  9. The interfacial orientation relationship of oxide nanoparticles in a hafnium-containing oxide dispersion-strengthened austenitic stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Miao, Yinbin, E-mail: miao2@illinois.edu [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Mo, Kun [Nuclear Engineering Division, Argonne National Laboratory, Lemont, IL 60493 (United States); Cui, Bai [Department of Mechanical and Materials Engineering, University of Nebraska-Lincoln, Lincoln, NE 68588 (United States); Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Chen, Wei-Ying [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Miller, Michael K.; Powers, Kathy A. [Center for Nanophase Materials Sciences, Oak Ridge National Laboratory, Oak Ridge, TN 37830 (United States); McCreary, Virginia; Gross, David [Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Almer, Jonathan [X-ray Science Division, Argonne National Laboratory, Lemont, IL 60493 (United States); Robertson, Ian M. [Department of Material Science and Engineering, University of Wisconsin-Madison, Madison, WA 53706 (United States); Department of Material Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States); Stubbins, James F. [Department of Nuclear, Plasma and Radiological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801 (United States)

    2015-03-15

    This work reports comprehensive investigations on the orientation relationship of the oxide nanoparticles in a hafnium-containing austenitic oxide dispersion-strengthened 316 stainless steel. The phases of the oxide nanoparticles were determined by a combination of scanning transmission electron microscopy–electron dispersive X-ray spectroscopy, atom probe tomography and synchrotron X-ray diffraction to be complex Y–Ti–Hf–O compounds with similar crystal structures, including bixbyite Y{sub 2}O{sub 3}, fluorite Y{sub 2}O{sub 3}–HfO{sub 2} solid solution and pyrochlore (or fluorite) Y{sub 2}(Ti,Hf){sub 2−x}O{sub 7−x}. High resolution transmission electron microscopy was used to characterize the particle–matrix interfaces. Two different coherency relationships along with one axis-parallel relation between the oxide nanoparticles and the steel matrix were found. The size of the nanoparticles significantly influences the orientation relationship. The results provide insight into the relationship of these nanoparticles with the matrix, which has implications for interpreting material properties as well as responses to radiation. - Highlights: • The oxide nanoparticles in a hafnium-containing austenitic ODS were characterized. • The nanoparticles are Y–Hf–Ti–O enriched phases according to APT and STEM–EDS. • Two coherency and an axis-parallel orientation relationships were found by HR-TEM. • Particle size has a prominent effect on the orientation relationship (OR). • Formation mechanism of the oxide nanoparticles was discussed based on the ORs.

  10. Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.

    Directory of Open Access Journals (Sweden)

    Kequan Fu

    Full Text Available Transmembrane protein 168 (TMEM168 comprises 697 amino acid residues, including some putative transmembrane domains. It is reported that TMEM168 controls methamphetamine (METH dependence in the nucleus accumbens (NAc of mice. Moreover, a strong link between METH dependence-induced adaptive changes in the brain and mood disorders has been evaluated. In the present study, we investigated the effects of accumbal TMEM168 in a battery of behavioral paradigms. The adeno-associated virus (AAV Tmem168 vector was injected into the NAc of C57BL/6J mice (NAc-TMEM mice. Subsequently, the accumbal TMEM168 mRNA was increased approximately by seven-fold when compared with the NAc-Mock mice (controls. The NAc-TMEM mice reported no change in the locomotor activity, cognitive ability, social interaction, and depression-like behaviors; however, TMEM168 overexpression enhanced anxiety in the elevated-plus maze and light/dark box test. The increased anxiety was reversed by pretreatment with the antianxiety drug diazepam (0.3 mg/kg i.p.. Moreover, the NAc-TMEM mice exhibited decreased prepulse inhibition (PPI in the startle response test, and the induced schizophrenia-like behavior was reversed by pretreatment with the antipsychotic drug risperidone (0.01 mg/kg i.p.. Furthermore, accumbal TMEM168 overexpression decreased the basal levels of extracellular GABA in the NAc and the high K+ (100 mM-stimulated GABA elevation; however, the total contents of GABA in the NAc remained unaffected. These results suggest that the TMEM168-regulated GABAergic neuronal system in the NAc might become a novel target while studying the etiology of anxiety and sensorimotor gating deficits.

  11. Comparative genomic analyses of Mycoplasma hyopneumoniae pathogenic 168 strain and its high-passaged attenuated strain

    Science.gov (United States)

    2013-01-01

    Background Mycoplasma hyopneumoniae is the causative agent of porcine enzootic pneumonia (EP), a mild, chronic pneumonia of swine. Despite presenting with low direct mortality, EP is responsible for major economic losses in the pig industry. To identify the virulence-associated determinants of M. hyopneumoniae, we determined the whole genome sequence of M. hyopneumoniae strain 168 and its attenuated high-passage strain 168-L and carried out comparative genomic analyses. Results We performed the first comprehensive analysis of M. hyopneumoniae strain 168 and its attenuated strain and made a preliminary survey of coding sequences (CDSs) that may be related to virulence. The 168-L genome has a highly similar gene content and order to that of 168, but is 4,483 bp smaller because there are 60 insertions and 43 deletions in 168-L. Besides these indels, 227 single nucleotide variations (SNVs) were identified. We further investigated the variants that affected CDSs, and compared them to reported virulence determinants. Notably, almost all of the reported virulence determinants are included in these variants affected CDSs. In addition to variations previously described in mycoplasma adhesins (P97, P102, P146, P159, P216, and LppT), cell envelope proteins (P95), cell surface antigens (P36), secreted proteins and chaperone protein (DnaK), mutations in genes related to metabolism and growth may also contribute to the attenuated virulence in 168-L. Furthermore, many mutations were located in the previously described repeat motif, which may be of primary importance for virulence. Conclusions We studied the virulence attenuation mechanism of M. hyopneumoniae by comparative genomic analysis of virulent strain 168 and its attenuated high-passage strain 168-L. Our findings provide a preliminary survey of CDSs that may be related to virulence. While these include reported virulence-related genes, other novel virulence determinants were also detected. This new information will form

  12. 33 CFR 110.168 - Hampton Roads, Virginia and adjacent waters (Datum: NAD 83).

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hampton Roads, Virginia and adjacent waters (Datum: NAD 83). 110.168 Section 110.168 Navigation and Navigable Waters COAST GUARD..., Virginia and adjacent waters (Datum: NAD 83). (a) Anchorage Grounds—(1) Anchorage A [Naval Anchorage]. The...

  13. 32 CFR 168a.4 - Policy and procedures.

    Science.gov (United States)

    2010-07-01

    ... to pursue graduate degrees in science, engineering, or other fields of study that are designated, in... DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.4 Policy and procedures. (a) Sponsoring... nationwide competition in which all appropriate actions have been taken to encourage applications from...

  14. Hafnium oxide nanoparticles: toward an in vitro predictive biological effect?

    International Nuclear Information System (INIS)

    Marill, Julie; Anesary, Naeemunnisa Mohamed; Zhang, Ping; Vivet, Sonia; Borghi, Elsa; Levy, Laurent; Pottier, Agnes

    2014-01-01

    Hafnium oxide, NBTXR3 nanoparticles were designed for high dose energy deposition within cancer cells when exposed to ionizing radiation. The purpose of this study was to assess the possibility of predicting in vitro the biological effect of NBTXR3 nanoparticles when exposed to ionizing radiation. Cellular uptake of NBTXR3 nanoparticles was assessed in a panel of human cancer cell lines (radioresistant and radiosensitive) by transmission electron microscopy. The radioenhancement of NBTXR3 nanoparticles was measured by the clonogenic survival assay. NBTXR3 nanoparticles were taken up by cells in a concentration dependent manner, forming clusters in the cytoplasm. Differential nanoparticle uptake was observed between epithelial and mesenchymal or glioblastoma cell lines. The dose enhancement factor increased with increase NBTXR3 nanoparticle concentration and radiation dose. Beyond a minimum number of clusters per cell, the radioenhancement of NBTXR3 nanoparticles could be estimated from the radiation dose delivered and the radiosensitivity of the cancer cell lines. Our preliminary results suggest a predictable in vitro biological effect of NBTXR3 nanoparticles exposed to ionizing radiation

  15. 33 CFR 165.168 - Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays.

    Science.gov (United States)

    2010-07-01

    ... of the Port New York Fireworks Displays. 165.168 Section 165.168 Navigation and Navigable Waters... Guard District § 165.168 Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays. (a... Upper New York Bay within a 360-yard radius of the fireworks barge in approximate position 40°41′16.5″ N...

  16. Transcriptional regulation of Arabidopsis MIR168a and argonaute1 homeostasis in abscisic acid and abiotic stress responses.

    Science.gov (United States)

    Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi

    2012-03-01

    The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.

  17. Nano-scale Radiotherapy-NBTXR3 Hafnium Oxide Nanoparticles as Promising Cancer Therapy

    International Nuclear Information System (INIS)

    Maggiorella, L.; Barouch, G.; Devaux, C.; Pottier, A.; Levy, L.; Deutsch, E.; Bourhis, J.; Borghi, E.

    2011-01-01

    Complete text of publication follows: Background: There is considerable interest in approaches that could improve the therapeutic window of radiotherapy, which represents a crucial modality of treatment in oncology. We present the rationale for designing NBTXR3 nanoparticles activated by radiotherapy and validate the concept. We performed the Monte Carlo calculations for the first time based on the 'local model' simulation that showed a dose enhancement of radiation to tumour cells of approximately nine-fold. NBTXR3 was shown to deposit high energy when the ionizing radiation source is 'on' and to have chemically inert behavior in cellular and subcellular systems demonstrated by very good systemic tolerance, thus decreasing potential health hazards. Material and Methods: We used conventional methods, implemented in different ways, to explore interactions of high Z matter and ionizing radiation with biological systems. In addition, microtomography was performed to explore the nanoparticle volume occupancy inside the tumour and its persistence overtime in mouse tumour models. The antitumour activity of NBTXR3 and tolerance were evaluated in Ewing tumour (A673) and fibrosarcoma (HT1080) using high energy source. Results and Conclusion: We created and developed NBTXR3 nanoparticles with a crystalline hafnium oxide core which provide high electron density structure and inert behavior in biological media. NBTXR3 nanoparticles' characteristics, size, charge and shape, allow for efficient interaction with biological entities, cell membrane binding and cellular uptake. The nanoparticles were shown to form clusters at the subcellular level in tumour models. Of most importance, we show NBTXR3 intra-tumour bioavailability with dispersion of nanoparticles in the three dimensions and persistence within the tumour structure, supporting the use of NBTXR3 as effective antitumour therapeutic agent. Antitumour activity of NBTXR3 showed marked advantage in terms of survival, tumour

  18. A fast response hafnium selective polymeric membrane electrode based on N,N'-bis({alpha}-methyl-salicylidene)-dipropylenetriamine as a neutral carrier

    Energy Technology Data Exchange (ETDEWEB)

    Rezaei, B. [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)], E-mail: rezaei@cc.iut.ac.ir; Meghdadi, S.; Zarandi, R. Fazel [Department of Chemistry, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2008-08-30

    In this study a new hafnium selective sensor was fabricated from polyvinylchloride (PVC) matrix membrane containing neutral carrier N,N'-bis({alpha}-methyl-salicylidene)-dipropylenetriamine (Mesaldpt) as a new ionophore, sodium tetraphenyl borate (NaTPB) as anionic discriminator and dioctyl phthalate (DOP) as plasticizing solvent mediator in tetrahydrofuran solvent. The electrode exhibits Nernstian response for Hf{sup 4+} (Hafnium(IV)) over a wide concentration range (2.0 x 10{sup -7} to 1.0 x 10{sup -1} M) with the determination coefficient of 0.9966 and slope of 15.1 {+-} 0.1 mV decades{sup -1}. The limit of detection is 1.9 x 10{sup -7} M. The electrode has a fast response time of 18 s and a working pH range of 4-8. The proposed membrane shows excellent discriminating ability towards Hf{sup 4+} ion with regard to several alkali, alkaline earth transition and heavy metal ions. It can be used over a period of 1.5 months with good reproducibility. It is successfully applied for direct determination of Hf{sup 4+} in solutions by standard addition method for real sample analysis.

  19. Coulomb-nuclear interference measurements of hexadecapole deformations in 168Yb and 178,180Hf

    International Nuclear Information System (INIS)

    Nettles, W.G.; Mississippi Coll., Clinton; Ramayya, A.V.; Hamilton, J.H.

    1988-01-01

    Coulomb-nuclear interference studies of 168 Yb and 178,180 Hf have been carried out with alpha particles from the Pittsburgh tandem. From coupled channel fits to the data at 18 MeV for 168 Yb and 19.5 MeV for 178,180 Hf, β 4 c values of -0.030(20), -0.166(18), and -0.180(6) were obtained, respectively. These data agree with the positive M 04 value from sub-Coulomb studies of 168 Yb but with the large negative M 04 values from sub-Coulomb studies of 178,180 Hf. (author)

  20. Hafnium-doped hydroxyapatite nanoparticles with ionizing radiation for lung cancer treatment.

    Science.gov (United States)

    Chen, Min-Hua; Hanagata, Nobutaka; Ikoma, Toshiyuki; Huang, Jian-Yuan; Li, Keng-Yuan; Lin, Chun-Pin; Lin, Feng-Huei

    2016-06-01

    Recently, photodynamic therapy (PDT) is one of the new clinical options by generating cytotoxic reactive oxygen species (ROS) to kill cancer cells. However, the optical approach of PDT is limited by tissue penetration depth of visible light. In this study, we propose that a ROS-enhanced nanoparticle, hafnium-doped hydroxyapatite (Hf:HAp), which is a material to yield large quantities of ROS inside the cells when the nanoparticles are bombarded with high penetrating power of ionizing radiation. Hf:HAp nanoparticles are generated by wet chemical precipitation with total doping concentration of 15mol% Hf(4+) relative to Ca(2+) in HAp host material. The results show that the HAp particles could be successfully doped with Hf ions, resulted in the formation of nano-sized rod-like shape and with pH-dependent solubility. The impact of ionizing radiation on Hf:HAp nanoparticles is assessed by using in-vitro and in-vivo model using A549 cell line. The 2',7'-dichlorofluorescein diacetate (DCFH-DA) results reveal that after being exposed to gamma rays, Hf:HAp could significantly lead to the formation of ROS in cells. Both cell viability (WST-1) and cytotoxicity (LDH) assay show the consistent results that A549 lung cancer cell lines are damaged with changes in the cells' ROS level. The in-vivo studies further demonstrate that the tumor growth is inhibited owing to the cells apoptosis when Hf:HAp nanoparticles are bombarded with ionizing radiation. This finding offer a new therapeutic method of interacting with ionizing radiation and demonstrate the potential of Hf:HAp nanoparticles in tumor treatment, such as being used in a palliative treatment after lung surgical procedure. Photodynamic therapy (PDT) is one of the new clinical options by generating cytotoxic reactive oxygen species (ROS) to kill cancer cells. Unfortunately, the approach of PDT is usually limited to the treatment of systemic disease and deeper tumor, due to the limited tissue penetration depth of visible

  1. Lifetimes Measurements in 160Yb,162Yb,164Yb,166Yb,168Yb

    International Nuclear Information System (INIS)

    Araddad, S. Y.; El-barouni, A. M.; Rateb, G. M.; Mosbah, D. S.; Elahrash, M. S.; Sergiwa, S. M.

    2004-01-01

    From our measurements of the lifetimes of high spin states in 168 Yb along with the published lifetime data for the nearby even even ytterbium isotopes, 160-168 Yb using the Recoil Distance Method (RDM) and the Doppler Shift Attenuation Method (DSAM) present a great opportunity to probe systematically the relationship between the nuclear shape changes and the reduction in collectivity. (authors)

  2. Sub-10 nm low current resistive switching behavior in hafnium oxide stack

    Energy Technology Data Exchange (ETDEWEB)

    Hou, Y., E-mail: houyi@pku.edu.cn, E-mail: lfliu@pku.edu.cn [Institute of Microelectronics, Peking University, 100871 Beijing (China); IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Department of Physics and Astronomy, KU Leuven, Celestijnenlaan 200D, B-3001 Heverlee (Belgium); Celano, U.; Xu, Z.; Vandervorst, W. [IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Department of Physics and Astronomy, KU Leuven, Celestijnenlaan 200D, B-3001 Heverlee (Belgium); Goux, L.; Fantini, A.; Degraeve, R.; Youssef, A.; Jurczak, M. [IMEC, Kapeldreef 75, B-3001 Heverlee (Belgium); Liu, L., E-mail: houyi@pku.edu.cn, E-mail: lfliu@pku.edu.cn; Cheng, Y.; Kang, J. [Institute of Microelectronics, Peking University, 100871 Beijing (China)

    2016-03-21

    In this letter, a tip-induced cell relying on the conductive atomic force microscope is proposed. It is verified as a referable replica of an integrated resistive random access memory (RRAM) device. On the basis of this cell, the functionality of sub-10 nm resistive switching is confirmed in hafnium oxide stack. Moreover, the low current switching behavior in the sub-10 nm dimension is found to be more pronounced than that of a 50 × 50 nm{sup 2} device. It shows better ON/OFF ratio and low leakage current. The enhanced memory performance is ascribed to a change in the shape of the conductive filament as the device dimensions are reduced to sub-10 nm. Therefore, device downscaling provides a promising approach for the resistance optimization that benefits the RRAM array design.

  3. 28 CFR 0.168 - Redelegation by Assistant Attorneys General.

    Science.gov (United States)

    2010-07-01

    ..., Penalties, and Forfeitures § 0.168 Redelegation by Assistant Attorneys General. (a) Assistant Attorneys... the Assistant Attorney General level must be presented to the Assistant Attorney General for... the Deputy Attorney General or the Associate Attorney General, as appropriate, before taking effect...

  4. Separation of hafnium from zirconium in their tetrachloride solution in molten alkali metal chlorides

    Energy Technology Data Exchange (ETDEWEB)

    Salyulev, A B; Kudyakov, V Ya; Smirnov, M V; Moskalenko, N I [AN SSSR, Sverdlovsk. Inst. Ehlektrokhimii

    1984-08-01

    The coefficient of HfCl/sub 4/ and ZrCl/sub 4/ separation in the process of vapour sublimation from their solutions in molten NaCl, KCl, CsCl, NaCl-KCl and NaCl-CsCl equimolar mixtures is found to vary in the series from approximately 1.10 to approximately 1.22 and practically not to depend on the temperature (in the 600-910 deg) range and concentration (2-25 mol.% ZrCl/sub 4/+HfCl/sub 4/). HfCl/sub 4/ and ZrCl/sub 4/ are shown to form almost perfect solutions with each other, which in their turn form imperfect solutions with molten alkali metal chlorides, with the strength of hafnium complex chloride anions increasing higher than that of zirconium in the series from NaCl to CsCl.

  5. Separation of hafnium from zirconium in their tetrachloride solution in molten alkali metal chlorides

    International Nuclear Information System (INIS)

    Salyulev, A.B.; Kudyakov, V.Ya.; Smirnov, M.V.; Moskalenko, N.I.

    1984-01-01

    The coefficient of HfCl 4 and ZrCl 4 separation in the process of vapour sublimation from their solutions in molten NaCl, KCl, CsCl, NaCl-KCl and NaCl-CsCl equimolar mixtures is found to vary in the series from approximately 1.10 to approximately 1.22 and practically not to depend on the temperature (in the 600-910 deg) range and concentration (2-25 mol.% ZrCl 4 +HfCl 4 ). HfCl 4 and ZrCl 4 are shown to form almost perfect solutions with each other, which in their turn form imperfect solutions with molten alkali metal chlorides, with the strength of hafnium complex chloride anions increasing higher than that of zirconium in the series from NaCl to CsCl

  6. The 168/E at CERN and the MARK 2. An improved processor design

    International Nuclear Information System (INIS)

    Kunz, P.; Botterill, D.R.; Lord, D.; Edwards, A.; Fucci, A.; Lee, G.; Martin, B.; Mornacchi, G.; Scharff-Hansen, P.; Storr, M.

    1981-01-01

    In the first part of this paper the history of the 168/E work at CERN is reviewed, this is followed by a short description of the hardware and software in use and finally some examples of future applications are given. In the second part of the paper the limitations of the present 168/E design are discussed and the ways that a new design, Mark 2, could overcome them are presented. (orig.)

  7. Transcriptional Regulation of Arabidopsis MIR168a and ARGONAUTE1 Homeostasis in Abscisic Acid and Abiotic Stress Responses1[W

    Science.gov (United States)

    Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi

    2012-01-01

    The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272

  8. Density and surface tension of melts of zirconium and hafnium fluorides with lithium fluoride

    International Nuclear Information System (INIS)

    Katyshev, S.F.; Artemov, V.V.; Desyatnik, V.N.

    1988-01-01

    A study was conducted to determine the temperature dependence of the density and surface tension of melts of LiF-ZrF 4 and LiF-HfF 4 . Density and surface tension were determined by the method of maximum pressure in an argon bubble. On the basis of experimental data over the entire concentration range the molar volumes and their relative deviations from the additive molar volumes were calculated for 1100 0 K. The positive deviations of the molar volumes from additivity in the LiF-HfF 4 system (22.45%) were greater than in the LiF-ZrF 4 system (15.75%). This indicated that the reaction with lithium fluoride is intensified with the switch to the hafnium fluoride. Results also demonstrated that the fluorides are surface-active components in the molten mixtures

  9. Tribo-electrochemical characterization of hafnium multilayer systems deposited on nitride/vanadium nitride AISI 4140 steel

    Science.gov (United States)

    Mora, M.; Vera, E.; Aperador, W.

    2016-02-01

    In this work is presented the synergistic behaviour among corrosion/wear (tribocorrosion) of the multilayer coatings hafnium nitride/vanadium nitride [HfN/VN]n. The multilayers were deposited on AISI 4140 steel using the technique of physical vapor deposition PVD magnetron sputtering, the tests were performed using a pin-on-disk tribometer, which has an adapted potentiostat galvanostat with three-electrode electrochemical cell. Tribocorrosive parameters such as: Friction coefficient between the coating and the counter body (100 Cr6 steel ball); Polarization resistance by means of electrochemical impedance spectroscopy technique and corrosion rate by polarization curves were determined. It was observed an increase in the polarization resistance, a decrease in the corrosion rate and a low coefficient of friction in comparison with the substrate, due to an increase on the number of bilayers.

  10. Tribo-electrochemical characterization of hafnium multilayer systems deposited on nitride/vanadium nitride AISI 4140 steel

    International Nuclear Information System (INIS)

    Mora, M; Vera, E; Aperador, W

    2016-01-01

    In this work is presented the synergistic behaviour among corrosion/wear (tribocorrosion) of the multilayer coatings hafnium nitride/vanadium nitride [HfN/VN]n. The multilayers were deposited on AISI 4140 steel using the technique of physical vapor deposition PVD magnetron sputtering, the tests were performed using a pin-on-disk tribometer, which has an adapted potentiostat galvanostat with three-electrode electrochemical cell. Tribocorrosive parameters such as: Friction coefficient between the coating and the counter body (100 Cr6 steel ball); Polarization resistance by means of electrochemical impedance spectroscopy technique and corrosion rate by polarization curves were determined. It was observed an increase in the polarization resistance, a decrease in the corrosion rate and a low coefficient of friction in comparison with the substrate, due to an increase on the number of bilayers. (paper)

  11. Rapid screening of nuclear grade zirconium silicate without separation of hafnium from the bulk matrix

    International Nuclear Information System (INIS)

    Venkatesh, Manisha; Sharma, P.K.; Avhad, D.K.; Basu, H.; Singhal, R.K.; Reddy, A.V.R.

    2014-01-01

    Zirconium silicate, also zirconium orthosilicate, (ZrSiO 4 ) is a chemical compound, and occurs in nature as zircon, a silicate mineral. The concentration of Hafnium in nuclear grade Zirconium must be less than 0.2% w/w of Zr. In view of this it must be accurately chemically characterized before issuing a certification for export under non nuclear category. As the chemistry of Zr and Hf is similar, it is difficult to separate Hf by direct wet chemical method. During this work, concentration of Hf in zirconium silicate was measured by Field Portable X-ray Fluorescence (FPXRF) and results obtained were validated by using detailed chemical method. FPXRF spectrometry has become a common analytical technique for on-site screening and fast turnaround analysis of contaminant elements in environmental samples

  12. Low-temperature fabrication of an HfO2 passivation layer for amorphous indium-gallium-zinc oxide thin film transistors using a solution process.

    Science.gov (United States)

    Hong, Seonghwan; Park, Sung Pyo; Kim, Yeong-Gyu; Kang, Byung Ha; Na, Jae Won; Kim, Hyun Jae

    2017-11-24

    We report low-temperature solution processing of hafnium oxide (HfO 2 ) passivation layers for amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). At 150 °C, the hafnium chloride (HfCl 4 ) precursor readily hydrolyzed in deionized (DI) water and transformed into an HfO 2 film. The fabricated HfO 2 passivation layer prevented any interaction between the back surface of an a-IGZO TFT and ambient gas. Moreover, diffused Hf 4+ in the back-channel layer of the a-IGZO TFT reduced the oxygen vacancy, which is the origin of the electrical instability in a-IGZO TFTs. Consequently, the a-IGZO TFT with the HfO 2 passivation layer exhibited improved stability, showing a decrease in the threshold voltage shift from 4.83 to 1.68 V under a positive bias stress test conducted over 10,000 s.

  13. Hafnium Films and Magnetic Shielding for TIME, A mm-Wavelength Spectrometer Array

    Science.gov (United States)

    Hunacek, J.; Bock, J.; Bradford, C. M.; Butler, V.; Chang, T.-C.; Cheng, Y.-T.; Cooray, A.; Crites, A.; Frez, C.; Hailey-Dunsheath, S.; Hoscheit, B.; Kim, D. W.; Li, C.-T.; Marrone, D.; Moncelsi, L.; Shirokoff, E.; Steinbach, B.; Sun, G.; Trumper, I.; Turner, A.; Uzgil, B.; Weber, A.; Zemcov, M.

    2018-04-01

    TIME is a mm-wavelength grating spectrometer array that will map fluctuations of the 157.7-μm emission line of singly ionized carbon ([CII]) during the epoch of reionization (redshift z ˜ 5-9). Sixty transition-edge sensor (TES) bolometers populate the output arc of each of the 32 spectrometers, for a total of 1920 detectors. Each bolometer consists of gold absorber on a ˜ 3 × 3 mm silicon nitride micro-mesh suspended near the corners by 1 × 1 × 500 μm silicon nitride legs targeting a photon-noise-dominated NEP ˜ 1 × 10^{-17} W/√{Hz} . Hafnium films are explored as a lower-T_c alternative to Ti (500 mK) for TIME TESs, allowing thicker support legs for improved yield. Hf T_c is shown to vary between 250 and 450 mK when varying the resident Ar pressure during deposition. Magnetic shielding designs and simulations are presented for the TIME first-stage SQUIDs. Total axial field suppression is predicted to be 5 × 10^7.

  14. Bermuda Triangle: a subsystem of the 168/E interfacing scheme used by Group B at SLAC

    International Nuclear Information System (INIS)

    Oxoby, G.J.; Levinson, L.J.; Trang, Q.H.

    1979-12-01

    The Bermuda Triangle system is a method of interfacing several 168/E microprocessors to a central system for control of the processors and overlaying their memories. The system is a three-way interface with I/O ports to a large buffer memory, a PDP11 Unibus and a bus to the 168/E processors. Data may be transferred bidirectionally between any two ports. Two Bermuda Triangles are used, one for the program memory and one for the data memory. The program buffer memory stores the overlay programs for the 168/E, and the data buffer memory, the incoming raw data, the data portion of the overlays, and the outgoing processed events. This buffering is necessary since the memories of 168/E microprocessors are small compared to the main program and the amount of data being processed. The link to the computer facility is via a Unibus to IBM channel interface. A PDP11/04 controls the data flow. 7 figures, 4 tables

  15. 26 CFR 1.168(i)-4 - Changes in use.

    Science.gov (United States)

    2010-04-01

    ... property because the equipment was used by Z in its steam production plant for 8 months in 2004. If the... classification of the equipment under section 168(e) changes from 7-year property to 5-year property and the... equipment in its combustion turbine production plant for 4 months and then uses the equipment in its steam...

  16. A spanish mineral of zirconium and hafnium. Separation of the two elements by liquid-liquid extraction, using tributyl phosphate as chelating agent

    International Nuclear Information System (INIS)

    Ruiz Sanchez, F.; Cruz Castillo, F. de la; Fernandez Cellini, R.

    1962-01-01

    The zirconium and Hafnium oxides are obtained from a Spanish mineral of zircon with an average contest of 55% in ZrO 2 -HfO 2 . An alkaline fusion to open the mineral, followed by a purification by crystallization as (Zr O-Hf O)Cl 2 H 2 O or as (Zr-Hf) (SO 4 ) 2 . 4H 2 O, is used. A discussion of the best experimental conditions for opening the mineral and of the purification method is made. (Author) 45 refs

  17. Investigation of the 168Hf electron capture decay using fast radiochemical separation

    International Nuclear Information System (INIS)

    Trubert, D.; Hussonnois, M.; Brillard, L.; Barci, V.; Ardisson, G.; Szeglowski, Z.; Constantinescu, O.

    1995-01-01

    The (EC + β + ) decay of 168 Hf, produced by the 156 Gd ( 16 O,4n) reaction, has been studied, with high efficiency HPGe coaxial detectors, using on-line measurements carried out with the RACHEL setup, built to investigate the chemical properties of transactinide elements. Off-line measurements were also carried out using catcher collection technique. Energies and intensities of 119 γ-lines are reported among which only two were known in the earlier study of Chu and Reednick. The 168 Lu level scheme built on the basis of single and γ-γ coincidence measurements, allows the interpretation of more than 79 γ-transitions, between 38 excited states reported for the first time. (orig.)

  18. George de Hevesy (1885-1966). Discoverer of hafnium, founder of radioanalytical chemistry and X-ray fluorescence analysis and father of nuclear medicine

    International Nuclear Information System (INIS)

    Niese, Siegfried

    2017-01-01

    George de Hevesy known as discoverer of hafnium, founder of radioanalytical chemistry and X-ray fluorescence analysis and father of nuclear medicine has done important research work in inorganic, physical and radioanalytical and physiological chemistry as well as in geochemistry, radiation biology and medicine. When he must flee for political reasons from a country he must change his colleagues, his equipments, and the topic of his work. It is extremely surprising that he could receive important results under such circumstances even at an advanced age. (author)

  19. Silicon-doped hafnium oxide anti-ferroelectric thin films for energy storage

    Science.gov (United States)

    Ali, Faizan; Liu, Xiaohua; Zhou, Dayu; Yang, Xirui; Xu, Jin; Schenk, Tony; Müller, Johannes; Schroeder, Uwe; Cao, Fei; Dong, Xianlin

    2017-10-01

    Motivated by the development of ultracompact electronic devices as miniaturized energy autonomous systems, great research efforts have been expended in recent years to develop various types of nano-structural energy storage components. The electrostatic capacitors characterized by high power density are competitive; however, their implementation in practical devices is limited by the low intrinsic energy storage density (ESD) of linear dielectrics like Al2O3. In this work, a detailed experimental investigation of energy storage properties is presented for 10 nm thick silicon-doped hafnium oxide anti-ferroelectric thin films. Owing to high field induced polarization and slim double hysteresis, an extremely large ESD value of 61.2 J/cm3 is achieved at 4.5 MV/cm with a high efficiency of ˜65%. In addition, the ESD and the efficiency exhibit robust thermal stability in 210-400 K temperature range and an excellent endurance up to 109 times of charge/discharge cycling at a very high electric field of 4.0 MV/cm. The superior energy storage performance together with mature technology of integration into 3-D arrays suggests great promise for this recently discovered anti-ferroelectric material to replace the currently adopted Al2O3 in fabrication of nano-structural supercapacitors.

  20. Tuning the magnetic properties of pure hafnium by high pressure torsion

    International Nuclear Information System (INIS)

    Cepeda-Jiménez, C.M.; Beltrán, J.I.; Hernando, A.; García, M.A.; Ynduráin, F.; Zhilyaev, A.; Pérez-Prado, M.T.

    2017-01-01

    This work demonstrates that room temperature (RT) ferromagnetism might be triggered in pure hafnium (Hf), a classic paramagnet, by severe plastic deformation (SPD) via high pressure torsion (HPT). The origin of this phenomenon is elucidated by a combined approach including density functional theory (DFT) calculations and transmission electron microscopy (TEM). In particular, it is shown that the elastic lattice distorsions induced in pure Hf as a consequence of grain refinement down to the nanocrystalline regime by HPT lead to the development of a new monoclinic crystalline structure that exhibits a spontaneous magnetization at RT. DFT calculations are utilized to prove that local stretching of the original pure Hf hexagonal close packed (hcp) lattice along specific pyramidal directions, due to the presence of internal stresses in the deformed nanostructure, may give rise to the emergence of the monoclinic phase, which is endowed with a net magnetic moment. An excellent agreement is found between DFT calculations and experimental TEM observations, which provide a first evidence of the presence of the pure Hf monoclinic crystal lattice. This work shows that SPD may constitute a viable, yet widely unexplored, strategy to tune the magnetic properties and, in particular, to induce RT ferromagnetism in bulk non-magnetic metals.

  1. Ocular Toxicity Profile of ST-162 and ST-168 as Novel Bifunctional MEK/PI3K Inhibitors.

    Science.gov (United States)

    Smith, Andrew; Pawar, Mercy; Van Dort, Marcian E; Galbán, Stefanie; Welton, Amanda R; Thurber, Greg M; Ross, Brian D; Besirli, Cagri G

    2018-04-30

    ST-162 and ST-168 are small-molecule bifunctional inhibitors of MEK and PI3K signaling pathways that are being developed as novel antitumor agents. Previous small-molecule and biologic MEK inhibitors demonstrated ocular toxicity events that were dose limiting in clinical studies. We evaluated in vitro and in vivo ocular toxicity profiles of ST-162 and ST-168. Photoreceptor cell line 661W and adult retinal pigment epithelium cell line ARPE-19 were treated with increasing concentrations of bifunctional inhibitors. Western blots, cell viability, and caspase activity assays were performed to evaluate MEK and PI3K inhibition and dose-dependent in vitro toxicity, and compared with monotherapy. In vivo toxicity profile was assessed by intravitreal injection of ST-162 and ST-168 in Dutch-Belted rabbits, followed by ocular examination and histological analysis of enucleated eyes. Retinal cell lines treated with ST-162 or ST-168 exhibited dose-dependent inhibition of MEK and PI3K signaling. Compared with inhibition by monotherapies and their combinations, bifunctional inhibitors demonstrated reduced cell death and caspase activity. In vivo, both bifunctional inhibitors exhibited a more favorable toxicity profile when compared with MEK inhibitor PD0325901. Novel MEK and PI3K bifunctional inhibitors ST-162 and ST-168 demonstrate favorable in vitro and in vivo ocular toxicity profiles, supporting their further development as potential therapeutic agents targeting multiple aggressive tumors.

  2. The sdg interacting-boson model applied to 168Er

    Science.gov (United States)

    Yoshinaga, N.; Akiyama, Y.; Arima, A.

    1986-03-01

    The sdg interacting-boson model is applied to 168Er. Energy levels and E2 transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. The level scheme including the Kπ=3+ band is well reproduced and the calculated B(E2)'s are consistent with the experimental data.

  3. Characterization of hafnium oxide resistive memory layers deposited on copper by atomic layer deposition

    Energy Technology Data Exchange (ETDEWEB)

    Briggs, B.D.; Bishop, S.M. [SUNY College of Nanoscale Science and Engineering, 255 Fuller Road, Albany, NY 12203 (United States); Leedy, K.D. [Air Force Research Laboratory, 2241 Avionics Circle, Wright Patterson Air Force Base, Dayton, OH 45433 (United States); Cady, N.C., E-mail: ncady@albany.edu [SUNY College of Nanoscale Science and Engineering, 255 Fuller Road, Albany, NY 12203 (United States)

    2014-07-01

    Hafnium oxide-based resistive memory devices have been fabricated on copper bottom electrodes. The HfO{sub x} active layers in these devices were deposited by atomic layer deposition (ALD) at 250 °C with tetrakis(dimethylamido)hafnium(IV) as the metal precursor and an O{sub 2} plasma as the reactant. Depth profiles of the HfO{sub x} by X-ray photoelectron spectroscopy and secondary ion mass spectroscopy revealed a copper concentration on the order of five atomic percent throughout the HfO{sub x} film. In addition to the Cu doped HfO{sub x}, a thin layer (20 nm) of Cu{sub x}O is present at the surface. This surface layer is believed to have formed during the ALD process, and greatly complicates the analysis of the switching mechanism. The resistive memory structures fabricated from the ALD HfO{sub x} exhibited non-polar resistive switching, independent of the top metal electrode (Ni, Pt, Al, Au). Resistive switching current voltage (I–V) curves were analyzed using Schottky emission and ionic hopping models to gain insight into the physical mechanisms underpinning the device behavior. During the forming process it was determined that, at voltages in excess of 2.5 V, an ionic hopping model is in good agreement with the I–V data. The extracted ion hopping distance ∼ 4 Å was within the range of interatomic spacing of HfO{sub 2} during the forming process consistent with ionic motion of Cu{sup 2+} ions. Lastly the on state I–V data was dominated at larger voltages by Schottky emission with an estimated barrier height of ∼ 0.5 eV and a refractive index of 2.59. The consequence of the Schottky emission analysis indicates the on state resistance to be a product of a Pt/Cu{sub 2}O/Cu filament(s)/Cu{sub 2}O/Cu structure. - Highlights: • HfO{sub 2} was grown via atomic layer deposition at 250 and 100 °C on Cu substrates. • A Cu{sub 2}O surface layer and Cu doping were observed in post-deposition of HfO{sub 2}. • Resistive memory devices were fabricated and

  4. Thermodynamic and kinetic studies in the systems alkali chloride-zinconium (or hafnium) tetrachloride: Part I. Vapour pressure measurements over hexachloro compounds and use of vapour pressure data in fractional decomposition

    International Nuclear Information System (INIS)

    Ray, H.S.; Bhat, B.G.; Reddy, G.S.; Biswas, A.K.

    1978-01-01

    A molten tin isoteniscope has been used to measure the vapour pressures over ZrCl 4 , HfCl 4 and the hexachlore zirconates (M 2 ZrCl 6 ) and the hexachloro hafnates (M 2 HfCl 6 ) of four alkali metals (M = Na,K,Rb,Cs). The method of preparation of these compounds and the effect of small amounts of residual alkali chlorides on the their vapour pressure are discussed. The pressure-temperature plots are examined in the light of some theoretical postulates. A scheme for separation of hafnium from zirconoium by multistage fractional decomposition of the hexachlore compounds of any alkali metal is described. The scheme, which is analogous to rectification in liquid-vapour systems, employs a countercurrent flow of Zr(Hf)Cl 4 in a gas stream and a moving bed of alkali chlorides. The separation is based on the difference in the dissociation equilibrium for zirconium and hafnium compounds. Stage calculations for such a scheme and the main conclusions of a computational work are presented. (author)

  5. Identification of excited states in 167Os and 168Os: shape coexistence at extreme neutron deficiency

    International Nuclear Information System (INIS)

    Joss, D.T.; King, S.L.; Page, R.D.; Simpson, J.; Keenan, A.; Amzal, N.; Baeck, T.; Bentley, M.A.; Cederwall, B.; Cocks, J.F.C.; Cullen, D.M.; Greenlees, P.T.; Helariutta, K.; Jones, P.M.; Julin, R.; Juutinen, S.; Kankaanpaeae, H.; Kettunen, H.; Kuusiniemi, P.; Leino, M.; Muikku, M.; Savelius, A.; Uusitalo, J.; Williams, S.J.

    2001-01-01

    Excited states in the very neutron-deficient isotopes 167 Os and 168 Os have been observed using the reaction 112 Sn( 58 Ni, 2pxn). The JUROSPHERE γ-ray spectrometer array was used in conjunction with the RITU gas-filled recoil separator to collect prompt γ radiation in coincidence with recoils implanted in a silicon strip detector located at the focal plane of RITU. Using a selective recoil decay tagging technique it has been possible to unambiguously assign γ-ray transitions to 167 Os and 168 Os through the characteristic α radioactivity of these nuclides. The high-spin structure of the bands is discussed in terms of quasiparticle configurations within the framework of the cranked shell model. The role of shape coexistence in 168 Os is examined with phenomenological three-band mixing calculations

  6. Isomer spectroscopy of neutron-rich 168 Tb 103

    Energy Technology Data Exchange (ETDEWEB)

    Gurgi, L. A.; Regan, P. H.; Söderström, P. -A.; Watanabe, H.; Walker, P. M.; Podolyák, Zs.; Nishimura, S.; Berry, T. A.; Doornenbal, P.; Lorusso, G.; Isobe, T.; Baba, H.; Xu, Z. Y.; Sakurai, H.; Sumikama, T.; Catford, W. N.; Bruce, A. M.; Browne, F.; Lane, G. J.; Kondev, F. G.; Odahara, A.; Wu, J.; Liu, H. L.; Xu, F. R.; Korkulu, Z.; Lee, P.; Liu, J. J.; Phong, V. H.; Yag, A.; Zhang, G. X.; Alharbi, T.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Kanaoka, H.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, E. J.; Lee, C. S.; Lotay, G.; Moon, C. -B.; Nishizuka, I.; Nita, C. R.; Patel, Z.; Roberts, O. J.; Schaffner, H.; Shand, C. M.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Yoshida, S.; Valiente-Dòbon, J. J.

    2017-11-01

    In-flight fission of a 345 MeV per nucleon 238U primary beam on a 2 mm thick 9Be target has been used to produce and study the decays of a range of neutron-rich nuclei centred around the doubly mid-shell nucleus 170Dy at the RIBF Facility, RIKEN, Japan. The produced secondary fragments of interest were identified event-by-event using the BigRIPS separator. The fragments were implanted into the WAS3ABI position sensitive silicon active stopper which allowed pixelated correlations between implants and their subsequent β-decay. Discrete γ-ray transitions emitted following decays from either metastable states or excited states populated following beta decay were identified using the 84 coaxial high-purity germanium (HPGe) detectors of the EURICA spectrometer, which was complemented by 18 additional cerium-doped lanthanum bromide (LaBr3) fast-timing scintillation detectors from the FATIMA collaboration. This paper presents the internal decay of a metastable isomeric excited state in the odd-odd nucleus 168Tb, which corresponds to a single proton-neutron hole configuration in the valence maximum nucleus 170Dy. These data represent the first information on excited states in this nucleus, which is the most neutron-rich odd-odd isotope of terbium (Z=65) studied to date. Nilsson configurations associated with an axially symmetric, prolate-deformed nucleus are proposed for the 168Tb ground state the observed isomeric state by comparison with Blocked BCS-Nilsson calculations.

  7. BEPS redesign of 168 commercial buildings: summary report

    Energy Technology Data Exchange (ETDEWEB)

    Stoops, J.L.; Deringer, J.J.; Moreno, S.; Misuriello, H.P.

    1984-05-01

    The objective of this report is to present, in usable form, summary data from the Building Energy Performance Standards (BEPS) Phase II commercial buildings energy research conducted in 1978-1979. Summary data presented were obtained from two major research efforts: the BEPS Phase II Redesign experiment; and the related research on ASHRAE Standard 90-75R. The bulk of this report consists of data tabulations of key energy parameters for the 168 sample buildings, which were tabulated from computer-stored files of the 1978-1979 data. Two kinds of tabulations are included: numerical tabulations that extracted information from the computer-stored data base for the 168 sample buildings; and graphic presentations of the computer-generated data, plus data extracted from other sources. The intent is to provide a single data compendium of key energy-related factors from the 1978 redesign experiment and the associated 1978-1979 ASHRAE Standard 90-75R research. This report also supplements the information for which there was not space in the magazine articles. Thus, for some building types, additional analysis, comments, and data tabulations are included that could not be included in the articles because space was limited. These additional analysis items are not consistent across building types because both the energy conservation opportunities and the design strategies applied by the building designers varied considerably by building type. The chapters have been entered individually into EDB and ERA.

  8. New levels in 168Er: Use of a Compton-suppressed Ge array with the (n,γ) reaction

    International Nuclear Information System (INIS)

    Gill, R.L.; Casten, R.F.; Phillips, W.R.; Varley, B.J.; Lister, C.J.; Durell, J.L.; Shannon, J.A.; Warner, D.D.

    1996-01-01

    For the first time an (n,γ) reaction has been extensively studied using a large array of Compton-suppressed Ge detectors (the TESSA array). The nucleus 168 Er was studied and the data show substantial improvement, in both quantity and quality, over previous coincidence data. Even though 168 Er is perhaps the best studied deformed nucleus, over 250 new coincidence relations and a number of new levels in 168 Er were disclosed, demonstrating the usefulness of this approach. Nuclear physics applications relate to the extension of nearly complete spectroscopy to higher excitation energies and to the study of statistical and chaotic features of the decay of low spin compound nuclear levels. copyright 1996 The American Physical Society

  9. 26 CFR 1.168(k)-1 - Additional first year depreciation deduction.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Additional first year depreciation deduction. 1... Corporations § 1.168(k)-1 Additional first year depreciation deduction. (a) Scope and definitions—(1) Scope. This section provides the rules for determining the 30-percent additional first year depreciation...

  10. Metallorganic chemical vapor deposition and atomic layer deposition approaches for the growth of hafnium-based thin films from dialkylamide precursors for advanced CMOS gate stack applications

    Science.gov (United States)

    Consiglio, Steven P.

    To continue the rapid progress of the semiconductor industry as described by Moore's Law, the feasibility of new material systems for front end of the line (FEOL) process technologies needs to be investigated, since the currently employed polysilicon/SiO2-based transistor system is reaching its fundamental scaling limits. Revolutionary breakthroughs in complementary-metal-oxide-semiconductor (CMOS) technology were recently announced by Intel Corporation and International Business Machines Corporation (IBM), with both organizations revealing significant progress in the implementation of hafnium-based high-k dielectrics along with metal gates. This announcement was heralded by Gordon Moore as "...the biggest change in transistor technology since the introduction of polysilicon gate MOS transistors in the late 1960s." Accordingly, the study described herein focuses on the growth of Hf-based dielectrics and Hf-based metal gates using chemical vapor-based deposition methods, specifically metallorganic chemical vapor deposition (MOCVD) and atomic layer deposition (ALD). A family of Hf source complexes that has received much attention recently due to their desirable properties for implementation in wafer scale manufacturing is the Hf dialkylamide precursors. These precursors are room temperature liquids and possess sufficient volatility and desirable decomposition characteristics for both MOCVD and ALD processing. Another benefit of using these sources is the existence of chemically compatible Si dialkylamide sources as co-precursors for use in Hf silicate growth. The first part of this study investigates properties of MOCVD-deposited HfO2 and HfSixOy using dimethylamido Hf and Si precursor sources using a customized MOCVD reactor. The second part of this study involves a study of wet and dry surface pre-treatments for ALD growth of HfO2 using tetrakis(ethylmethylamido)hafnium in a wafer scale manufacturing environment. The third part of this study is an investigation of

  11. Recoil Induced Room Temperature Stable Frenkel Pairs in a-Hafnium Upon Thermal Neutron Capture

    Science.gov (United States)

    Butz, Tilman; Das, Satyendra K.; Dey, Chandi C.; Ghoshal, Shamik

    2013-11-01

    Ultrapure hafnium metal (110 ppm zirconium) was neutron activated with a thermal neutron flux of 6:6 · 1012 cm-2s-1 in order to obtain 181Hf for subsequent time differential perturbed angular correlation (TDPAC) experiments using the nuclear probe 181Hf(β-) 181Ta. Apart from the expected nuclear quadrupole interaction (NQI) signal for a hexagonal close-packed (hcp) metal, three further discrete NQIs were observed with a few percent fraction each. The TDPAC spectra were recorded for up to 11 half lives with extreme statistical accuracy. The fitted parameters vary slightly within the temperature range between 248 K and 373 K. The signals corresponding to the three additional sites completely disappear after `annealing' at 453 K for one minute. Based on the symmetry of the additional NQIs and their temperature dependencies, they are tentatively attributed to Frenkel pairs produced by recoil due to the emission of a prompt 5:694 MeV -ray following thermal neutron capture and reported by the nuclear probe in three different positions. These Frenkel pairs are stable up to at least 373 K.

  12. 25 CFR 1000.168 - Is it mandatory to go through the information phase before initiating the negotiation phase?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Is it mandatory to go through the information phase before initiating the negotiation phase? 1000.168 Section 1000.168 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN...

  13. 78 FR 50112 - 168th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2013-08-16

    ... DEPARTMENT OF LABOR Employee Benefits Security Administration 168th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Teleconference Meeting Pursuant to the.... 1142, the 168th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans...

  14. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    Science.gov (United States)

    Nguyen, Duc; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Girolami, Gregory S.; Lyding, Joseph; Gruebele, Martin

    2014-11-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB2 glass surface, two-state hopping of 1-2 nm diameter cooperatively rearranging regions or "clusters" occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how "mixed" features can show up in surface dynamics of glasses.

  15. About the structure and stability of complex carbonates of thorium (IV), cerium (IV), zirconium (IV), hafnium (IV)

    International Nuclear Information System (INIS)

    Dervin, Jacqueline

    1972-01-01

    This research thesis addressed the study of complex carbonates of cations of metals belonging to the IV A column, i.e. thorium (IV), zirconium (IV), hafnium (IV), and also cerium (IV) and uranium (VI), and more particularly focused on ionic compounds formed in solution, and also on the influence of concentration and nature of cations on stability and nature of the formed solid. The author first presents methods used in this study, discusses their precision and scope of validity. She reports the study of the formation of different complex ions which have been highlighted in solution, and the determination of their formation constants. She reports the preparation and study of the stability domain of solid complexes. The next part reports the use of thermogravimetric analysis, IR spectrometry, and crystallography for the structural study of these compounds

  16. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  17. Improvement of Fibrinolytic Activity of Bacillus subtilis 168 by Integration of a Fibrinolytic Gene into the Chromosome.

    Science.gov (United States)

    Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan

    2015-11-01

    Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.

  18. High-spin spectroscopy of {sup 168}Yb and the reduction of pairing correlations

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, J R.B. [Sao Paulo Univ., SP (Brazil); Stephens, F S; Deleplanque, M A; Diamond, R M [Lawrence Berkeley Lab., CA (United States); Draper, J E; Rubel, E; Duyar, C [California Univ., Davis, CA (United States); Beacker, J A; Henry, E A; Roy, N [Lawrence Livermore National Lab., CA (United States); Beausang, C W [Liverpool Univ. (United Kingdom); Frauendorf, S [Institut fur Kern und Hadronen Physik, F2-Rossendorf, Dresden (Germany)

    1992-08-01

    The high spin states of {sup 168}Yb were investigated by means of in-beam gamma spectroscopy with the High Energy Resolution Array at the 88 in. cyclotron of the Lawrence Berkeley Laboratory. The {sup 168}Yb nucleus was produced in the reaction {sup 48}Ca({sup 124}Sn,4n) at 210 MeV. Five bands previously reported were confirmed; additionally, four other bands, two extending to spins as high as 36 {Dirac_h} were observed. Cranked shell models suggest that one of the new bands can be interpreted as the continuation of the ground state band (above the AB crossing frequency) crossing into the four-quasiparticle band ABCD at about 0.38 MeV. Both relative alignment and Routhians are in good agreement with the experimental values. However, these calculations were done at constant pairing strength, which is not expected to be good at high rotational frequencies where one or more crossings have occurred in each band. Particle-hole calculations (with no pairing) were done for {sup 168}Yb as well as for other N {approx_equal} 98 nuclei for which good experimental data are available. In most cases, it is possible to associate a particle-hole configuration for each band observed at very high rotational frequencies, and the overall description is good. At frequencies below the first crossing, a full pairing calculation is necessary to describe the bands properly. At intermediate frequencies, the pairing strength is believed to be intermediate. 3 figs.

  19. Impact of UK NICE clinical guidelines 168 on referrals to a specialist academic leg ulcer service.

    Science.gov (United States)

    Davies, Huw Ob; Popplewell, Matthew; Bate, Gareth; Kelly, Lisa; Darvall, Katy; Bradbury, Andrew W

    2018-03-01

    Background Leg ulcers are a common cause of morbidity and disability and result in significant health and social care expenditure. The UK National Institute for Health and Care Excellence (NICE) Clinical Guideline (CG)168, published in July 2013, sought to improve care of patients with leg ulcers, recommending that patients with a break in the skin below the knee that had not healed within two weeks be referred to a specialist vascular service for diagnosis and management. Aim Determine the impact of CG168 on referrals to a leg ulcer service. Methods Patients referred with leg ulceration during an 18-month period prior to CG168 (January 2012-June 2013) and an 18-month period commencing six months after (January 2014-June 2015) publication of CG168 were compared. Results There was a two-fold increase in referrals (181 patients, 220 legs vs. 385 patients, 453 legs) but no change in mean age, gender or median-duration of ulcer at referral (16.6 vs. 16.2 weeks). Mean-time from referral to specialist appointment increased (4.8 vs. 6 weeks, p = 0.0001), as did legs with superficial venous insufficiency (SVI) (36% vs. 44%, p = 0.05). There was a trend towards more SVI endovenous interventions (32% vs. 39%, p = 0.271) with an increase in endothermal (2 vs. 32 legs, p = 0.001) but no change in sclerotherapy (24 vs. 51 legs) treatments. In both groups, 62% legs had compression. There was a reduction in legs treated conservatively with simple dressings (26% vs. 15%, p = 0.0006). Conclusions Since CG168, there has been a considerable increase in leg ulcer referrals. However, patients are still not referred until ulceration has been present for many months. Although many ulcers are multi-factorial and the mainstay of treatment remains compression, there has been an increase in SVI endovenous intervention. Further efforts are required to persuade community practitioners to refer patients earlier, to educate patients and encourage further investment in

  20. 26 CFR 5c.168(f)(8)-7 - Reporting of income, deductions and investment tax credit; at risk rules.

    Science.gov (United States)

    2010-04-01

    ... tax credit; at risk rules. 5c.168(f)(8)-7 Section 5c.168(f)(8)-7 Internal Revenue INTERNAL REVENUE... investment tax credit; at risk rules. (a) In general. The fact that the lessor's payments of interest and... property shall be limited to the extent the at risk rules under the investment tax credit provisions and...

  1. A search for long-lived radionuclides produced by fast-neutron irradiations of copper, silver, europium, terbium, and hafnium

    International Nuclear Information System (INIS)

    Meadows, J.W.; Smith, D.L.; Ikeda, Y.; Konno, C.

    1990-01-01

    Identical sample packets, each containing samples of elemental copper, silver, europium, terbium, and hafnium, as well as titanium, iron and nickel as dosimeters, have been irradiated in three distinct accelerator neutron fields (at Argonne National Laboratory and Los Alamos National Laboratory in the U.S.A., and Japan Atomic Energy Research Institute, Tokai, Japan) as part of an interlaboratory research collaboration to search for the production of long-lived radionuclides for fusion waste disposal applications. This paper is a progress report on this project. To date, we have detected the following activities, and have obtained preliminary experimental cross section values for several of these: Ag-106m,108m,110m; Eu-150m,152g,154; Tb-158,160; and Hf-175,178m2,179m2,181. (author). 11 refs, 1 fig., 4 tabs

  2. Physico-chemical stability of butorphanol-tramadol and butorphanol-fentanyl patient-controlled analgesia infusion solutions over 168 hours.

    Science.gov (United States)

    Chen, Fuchao; Fang, Baoxia; Li, Peng; Zhu, Xuesong; Zhou, Benhong

    2014-08-01

    This study was to investigate the physical and chemical compatibility of butorphanol with tramadol or fentanyl in 0.9% sodium chloride injections for patient controlled analgesia administration. The solutions were prepared in polyvinyl chloride (PVC) infusion bags and stored without protected from light exposure at room temperature (25 degrees C) or refrigerated (4 degrees C). Over a period of 168 hours, stabilities were determined by visual inspection, pH measurement, and high-pressure liquid chromatography (HPLC) assay of drug concentrations. At both temperatures, admixtures of butorphanol-tramadol and butorphanol-fentanyl were clear in appearance, and no color change or precipitation was observed during the study period. The maximum losses obtained were lower than 5% for the three drugs after 168 hours of storage. The results indicate that, at ambient or refrigerated storage conditions, the drug mixtures of butorphanol-tramadol and butorphanol-fentanyl in 0.9% sodium chloride injections were physically and chemically stable for at least 168 hours when stored in PVC syringes.

  3. Ferroelectric transistors with monolayer molybdenum disulfide and ultra-thin aluminum-doped hafnium oxide

    Science.gov (United States)

    Yap, Wui Chung; Jiang, Hao; Liu, Jialun; Xia, Qiangfei; Zhu, Wenjuan

    2017-07-01

    In this letter, we demonstrate ferroelectric memory devices with monolayer molybdenum disulfide (MoS2) as the channel material and aluminum (Al)-doped hafnium oxide (HfO2) as the ferroelectric gate dielectric. Metal-ferroelectric-metal capacitors with 16 nm thick Al-doped HfO2 are fabricated, and a remnant polarization of 3 μC/cm2 under a program/erase voltage of 5 V is observed. The capability of potential 10 years data retention was estimated using extrapolation of the experimental data. Ferroelectric transistors based on embedded ferroelectric HfO2 and MoS2 grown by chemical vapor deposition are fabricated. Clockwise hysteresis is observed at low program/erase voltages due to slow bulk traps located near the 2D/dielectric interface, while counterclockwise hysteresis is observed at high program/erase voltages due to ferroelectric polarization. In addition, the endurances of the devices are tested, and the effects associated with ferroelectric materials, such as the wake-up effect and polarization fatigue, are observed. Reliable writing/reading in MoS2/Al-doped HfO2 ferroelectric transistors over 2 × 104 cycles is achieved. This research can potentially lead to advances of two-dimensional (2D) materials in low-power logic and memory applications.

  4. Yellow fever vaccine: comparison of the neurovirulence of new 17D-204 Stamaril™ seed lots and RK 168-73 strain.

    Science.gov (United States)

    Moulin, Jean-Claude; Silvano, Jérémy; Barban, Véronique; Riou, Patrice; Allain, Caroline

    2013-07-01

    The neurovirulence of two new candidate 17D-204 Stamaril™ working seed lots and that of two reference preparations were compared. The Stamaril™ working seed lots have been used for more than twenty years for the manufacturing of vaccines of acceptable safety and efficacy. The preparation designated RK 168-73 and provided by the Robert Koch Institute was used as a reference. It was confirmed that RK 168-73 strain was not a good virus control in our study because it has a very low neurovirulence regarding both the clinical and histopathological scores in comparison with Stamaril™ strain and is not representative of a vaccine known to be satisfactory in use. The results were reinforced by the phenotypic characterization by plaque assay demonstrating that RK 168-73 was very different from the Stamaril™ vaccine, and by sequencing results showing 4 mutations between Stamaril™ and RK 168-73 viruses leading to amino acid differences in the NS4B and envelop proteins. Copyright © 2013 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  5. On-line use of the 168/E emulator at the CERN ISR SFM detector

    International Nuclear Information System (INIS)

    Bertuzzi, C.; Drijard, D.; Frehse, H.; Gavillet, P.; Gokieli, R.; Innocenti, P.G.; Messerli, R.; Mornacchi, G.; Norton, A.; Porte, J.P.

    1981-01-01

    The Split Field Magnet Detector at the CERN ISR has been used in recent years to study events with a high transverse momentum charged particle. As a first level computer based trigger a linear estimate of the track momentum by fixed point arithmethic was calculated on-line by a minicomputer. In addition appreciable further rejection was obtained by off-line filtering on the IBM-370/168, using pattern recognition and a fit of the triggering particle in the magnetic field. The availability of the 168/E emulator makes it possible to transfer the proven methods used off-line to real time data reduction. Preliminary results on filter efficiency and speed for an experiment triggering on a high Psub(T) hadron at 10 to 20 0 with respect to the outgoing beam (Exp. R 419) are given. Possible improvements and extensions are discussed. (orig.)

  6. Crystallization and preliminary X-ray diffraction analysis of YisP protein from Bacillus subtilis subsp. subtilis strain 168

    International Nuclear Information System (INIS)

    Hu, Yumei; Jia, Shiru; Ren, Feifei; Huang, Chun-Hsiang; Ko, Tzu-Ping; Mitchell, Douglas A.; Guo, Rey-Ting; Zheng, Yingying

    2012-01-01

    A bacteria biofilm formation involved enzyme, BsYisP, from Bacillus subtilis subsp. subtilis strain 168, was crystallized and diffracted to 1.92 Å. YisP is an enzyme involved in the pathway of biofilm formation in bacteria and is predicted to possess squalene synthase activity. A BlastP search using the YisP protein sequence from Bacillus subtilis subsp. subtilis strain 168 shows that it shares 23% identity with the dehydrosqualene synthase from Staphylococcus aureus. The YisP from B. subtilis 168 was expressed in Escherichia coli and the recombinant protein was purified and crystallized. The crystals, which belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 43.966, b = 77.576, c = 91.378 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.92 Å resolution. Structure determination using MAD and MIR methods is in progress

  7. The deubiquitylating enzyme USP44 counteracts the DNA double-strand break response mediated by the RNF8 and RNF168 ubiquitin ligases

    DEFF Research Database (Denmark)

    Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon

    2013-01-01

    Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...... of individually overexpressing the majority of human DUBs on RNF8/RNF168-mediated 53BP1 retention at DSB sites, we found that USP44 and USP29 powerfully inhibited this response at the level of RNF168 accrual. Both USP44 and USP29 promoted efficient deubiquitylation of histone H2A, but unlike USP44, USP29...... displayed non-specific reactivity towards ubiquitylated substrates. Moreover, USP44 but not other H2A DUBs was recruited to RNF168-generated ubiquitylation products at DSB sites. Individual depletion of these DUBs only mildly enhanced accumulation of ubiquitin conjugates and 53BP1 at DSBs, suggesting...

  8. IER-297 CED-2: Final Design for Thermal/Epithermal eXperiments with Jemima Plates with Polyethylene and Hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, A. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Percher, C. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Zywiec, W. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Heinrichs, D. P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-11

    This report presents the final design (CED-2) for IER-297, and focuses on 15 critical configurations using highly enriched uranium (HEU) Jemima plates moderated by polyethylene with and without hafnium diluent. The goal of the U.S. Nuclear Criticality Safety Program’s Thermal/Epithermal eXperiments (TEX) is to design and conduct new critical experiments to address high priority nuclear data needs from the nuclear criticality safety and nuclear data communities, with special emphasis on intermediate energy (0.625 eV – 100 keV) assemblies that can be easily modified to include various high priority diluent materials. The TEX (IER 184) CED-1 Report [1], completed in 2012, demonstrated the feasibility of meeting the TEX goals with two existing NCSP fissile assets, plutonium Zero Power Physics Reactor (ZPPR) plates and highly enriched uranium (HEU) Jemima plates. The first set of TEX experiments will focus on using the plutonium ZPPR plates with polyethylene moderator and tantalum diluents.

  9. Poly(ADP-ribosyl)ation links the chromatin remodeler SMARCA5/SNF2H to RNF168-dependent DNA damage signaling

    DEFF Research Database (Denmark)

    Smeenk, G.; Wiegant, W.W.; Luijsterburg, M.S.

    2013-01-01

    Ionizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains largely...... unexplored. Here, we show that SMARCA5/SNF2H, the catalytic subunit of ISWI chromatin remodeling complexes, is recruited to DSBs in a poly(ADP-ribose) polymerase 1 (PARP1)-dependent manner. Remarkably, PARP activity, although dispensable for the efficient spreading of νH2AX into damaged chromatin......, selectively promotes spreading of SMARCA5, the E3 ubiquitin ligase RNF168, ubiquitin conjugates and the ubiquitin-binding factors RAD18 and the RAP80-BRCA1 complex throughout DSB-flanking chromatin. This suggests that PARP regulates the spatial organization of the RNF168-driven ubiquitin response to DNA...

  10. Measurement on K-electron capture probabilities in the decay of [sup 183]Re and [sup 168]Tm

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, N.V.S.V.; Rao, M.V.S.C.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L. (Andhra Univ., Visakhapatnam (India). Swami Jnanananda Labs. for Nuclear Research); Murty, G.S.K. (UNDNJ, Newark, NJ (United States). Dept. of Radiology); Chintalapudi, S.N. (Inter University Consortium for DAE Facilities, Calcutta (India))

    1994-03-01

    The K-electron capture probabilities for the 5/2[sup +] to 3/2[sup -]transition in the electron capture decay of [sup 183]Re to the 208.805 keV level in the daughter [sup 183]W and for the 3[sup (+)] to 3[sup -]and 3[sup (+)] to 4[sup -] transitions in the electron capture decay of [sup 168]Tm to the 1541.4 keV and 1093.0 keV levels, respectively, in the daughter [sup 168]Er were measured for the first time using an x-[gamma] summing method. The experimental P[sub K] values are reported in this paper, together with those due to theory, and discussed. (Author).

  11. 40 CFR 168.22 - Advertising of unregistered pesticides, unregistered uses of registered pesticides and FIFRA...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Advertising of unregistered pesticides... ENFORCEMENT POLICIES AND INTERPRETATIONS Advertising § 168.22 Advertising of unregistered pesticides.... EPA interprets these provisions as extending to advertisements in any advertising medium to which...

  12. Improved DC performance of AlGaN/GaN high electron mobility transistors using hafnium oxide for surface passivation

    International Nuclear Information System (INIS)

    Liu, Chang; Chor, Eng Fong; Tan, Leng Seow

    2007-01-01

    Improved DC performance of AlGaN/GaN high electron mobility transistors (HEMTs) have been demonstrated using reactive-sputtered hafnium oxide (HfO 2 ) thin film as the surface passivation layer. Hall data indicate a significant increase in the product of sheet carrier concentration (n s ) and electron mobility (μ n ) in the HfO 2 -passivated HEMTs, compared to the unpassivated HEMTs. This improvement in electron carrier characteristics gives rise to a 22% higher I Dmax and an 18% higher g mmax in HEMTs with HfO 2 passivation relative to the unpassivated devices. On the other hand, I gleak of the HEMTs decreases by nearly one order of magnitude when HfO 2 passivation is applied. In addition, drain current is measured in the subthreshold regime. Compared to the unpassivated HEMTs, HfO 2 -passivated HEMTs exhibit a much smaller off-state I D , indicating better turn-off characteristics

  13. Protective coatings of hafnium dioxide by atomic layer deposition for microelectromechanical systems applications

    Energy Technology Data Exchange (ETDEWEB)

    Berdova, Maria, E-mail: maria.berdova@aalto.fi [Aalto University, Department of Materials Science and Engineering, 02150, Espoo (Finland); Wiemer, Claudia; Lamperti, Alessio; Tallarida, Grazia; Cianci, Elena [Laboratorio MDM, IMM CNR, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Lamagna, Luca; Losa, Stefano; Rossini, Silvia; Somaschini, Roberto; Gioveni, Salvatore [STMicroelectronics, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Fanciulli, Marco [Laboratorio MDM, IMM CNR, Via C. Olivetti 2, 20864, Agrate Brianza, MB (Italy); Università degli studi di Milano Bicocca, Dipartimento di Scienza dei Materiali, 20126, Milano (Italy); Franssila, Sami, E-mail: sami.franssila@aalto.fi [Aalto University, Department of Materials Science and Engineering, 02150, Espoo (Finland)

    2016-04-15

    Graphical abstract: - Highlights: • Atomic layer deposition of HfO{sub 2} from (CpMe){sub 2}Hf(OMe)Me or Hf(NMeEt){sub 4} and ozone for potential applications in microelectromechanical systems. • ALD HfO{sub 2} protects aluminum substrates from degradation in moist environment and at the same time retains good reflectance properties of the underlying material. • The resistance of hafnium dioxide to moist environment is independent of chosen precursors. - Abstract: This work presents the investigation of HfO{sub 2} deposited by atomic layer deposition (ALD) from either HfD-CO4 or TEMAHf and ozone for microelectromechanical systems (MEMS) applications, in particular, for environmental protection of aluminum micromirrors. This work shows that HfO{sub 2} films successfully protect aluminum in moist environment and at the same time retain good reflectance properties of underlying material. In our experimental work, the chemical composition, crystal structure, electronic density and roughness of HfO{sub 2} films remained the same after one week of humidity treatment (relative humidity of 85%, 85 °C). The reflectance properties underwent only minor changes. The observed shift in reflectance was only from 80–90% to 76–85% in 400–800 nm spectral range when coated with ALD HfO{sub 2} films grown with Hf(NMeEt){sub 4} and no shift (remained in the range of 68–83%) for films grown from (CpMe){sub 2}Hf(OMe)Me.

  14. Lifetime measurement in {sup 168}Yb using the recoil distance Doppler shift (RDDS) method

    Energy Technology Data Exchange (ETDEWEB)

    Reese, Michael; Moeller, Oliver; Pietralla, Norbert [TU Darmstadt (Germany); Dewald, Alfred; Pissulla, Thomas [Universitaet Koeln (Germany); Petkov, Pavel [Universitaet Koeln (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria)

    2009-07-01

    In the analysis of coincidence RDDS experiments one uses the Differential Decay Curve (DDC) Method to determine lifetimes of excited states. Experiments with small recoil velocities, thus small Doppler shifts, enforce the use of narrow coincidence gates to determine peak intensities. This results in a loss of statistics. As an alternative to the application of gates, we present the fit of 2-dimensional functions to the {gamma}{gamma} coincidence data. This approach has been studied on data taken in a RDDS measurement for the ground state band of {sup 168}Yb. The {sup 18}O({sup 154}Sm,4n){sup 168}Yb{sup *} fusion evaporation reaction was induced by an 80 MeV ion beam of the tandem accelerator facility in Cologne. The target was mounted in the Cologne coincidence plunger device. Lifetimes from the 4{sub 1}{sup +} to the 10{sub 1}{sup +} states have been extracted. The method is discussed and the results are compared to the CBS rotor model in the context of centrifugal stretching.

  15. Efficient UV-emitting X-ray phosphors: octahedral Zr(PO4)6 luminescence centers in potassium hafnium-zirconium phosphates K2Hf1-xZrx(PO4)2 and KHf2(1-x)Zr2x(PO4)3

    International Nuclear Information System (INIS)

    Torardi, C.C.; Miao, C.R.; Li, J.

    2003-01-01

    Potassium hafnium-zirconium phosphates, K 2 Hf 1-x Zr x (PO 4 ) 2 and KHf 2(1-x) Zr 2x (PO 4 ) 3 , are broad-band UV-emitting phosphors. At room temperature, they have emission peak maxima at approximately 322 and 305 nm, respectively, under 30 kV peak molybdenum X-ray excitation. Both phosphors demonstrate luminescence efficiencies that make them up to ∼60% as bright as commercially available CaWO 4 Hi-Plus. The solid-state and flux synthesis conditions, and X-ray excited UV luminescence of these two phosphors are discussed. Even though the two compounds have different atomic structures, they contain zirconium in the same active luminescence environment as that found in highly efficient UV-emitting BaHf 1-x Zr x (PO 4 ) 2 . All the three materials have hafnium and zirconium in octahedral coordination via oxygen-atom corner sharing with six separate PO 4 tetrahedra. This octahedral Zr(PO 4 ) 6 moiety appears to be an important structural element for efficient X-ray excited luminescence, as are the edge-sharing octahedral TaO 6 chains for tantalate emission

  16. Rotational bands in the nuclear sup(168)Er and some remarks on their interpretation

    International Nuclear Information System (INIS)

    Davidson, W.F.; Dixon, W.R.; Storey, R.S.

    1984-01-01

    Further analysis of previously published data on sup(168)Er, together with results of new measurements of selected portions of the neutron capture γ-ray spectrum, has resulted in the construction of an improved level spectrum for this nucleus. Altogether 127 excited levels have now been established and grouped into 36 rotational bands. Some remarks on their interpretation are advanced

  17. About octupole states in the 158Dy and the 168Er nuclei

    International Nuclear Information System (INIS)

    Kvasil, Ya.; Chariev, M.M.; Choriev, B.

    1984-01-01

    The properties of negative parity low-lying states in 158 Dy and 168 Er in the random phase approximation based on the cranking model are investigated. Octupole-octupole forces have been used as a residual interaction. Calculated energy levels are compared with the experimental ones, and also with the energy values obtained with making allowance for dipole-dipole, octupole-octupole and dipole-octupole type forces. The resuits of calculation by the used model permit to understand the nature of negative parity low-lying states

  18. 26 CFR 1.168(i)-0 - Table of contents for the general asset account rules.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Table of contents for the general asset account... and Corporations § 1.168(i)-0 Table of contents for the general asset account rules. This section...) Irrevocable election. (2) Time for making election. (3) Manner of making election. (l) Effective date. (1) In...

  19. Recovery of metal chlorides from their complexes by molten salt displacement

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Stoltz, R.A.

    1989-01-01

    This patent describes a process for recovering zirconium or hafnium chloride from a complex of zirconium or hafnium tetrachloride and phosphorus oxychloride. The process comprising: introducing liquid complex of zirconium or hafnium tetrachloride and phosphorus oxychloride into an upper portion of a feed column containing zirconium or hafnium tetrachloride vapor and phosphorus oxychloride vapor. The liquid complex absorbing zirconium or hafnium tetrachloride vapor and producing a bottoms liquid and also producing a phosphorus oxychloride vapor stripped of zirconium or hafnium tetrachloride; introducing the bottoms liquid into a molten salt containing displacement reactor, the reactor containing molten salt comprising at least 30 mole percent lithium chloride and at least 30 mole percent of at least one other alkali metal chloride, the reactor being heated to 30-450 0 C to displace phosphorus oxychloride from the complex and product zirconium or hafnium tetrachloride vapor and phosphorus oxychloride vapor and zirconium or hafnium tetrachloride-containing molten salt; introducing the zirconium or hafnium tetrachloride vapor and the phosphorus oxychloride vapor into the feed column below the point of introduction of the liquid stream; introducing the zirconium or hafnium tetrachloride containing-molten salt into a recovery vessel where zirconium or hafnium tetrachloride is removed from the molten salt to produce zirconium or hafnium tetrachloride product and zirconium or hafnium chloride-depleted molten salt; and recycling the zirconium or hafnium tetachloride-depleted molten salt to the displacement reactor

  20. Characterization of Pharmacologic and Pharmacokinetic Properties of CCX168, a Potent and Selective Orally Administered Complement 5a Receptor Inhibitor, Based on Preclinical Evaluation and Randomized Phase 1 Clinical Study.

    Science.gov (United States)

    Bekker, Pirow; Dairaghi, Daniel; Seitz, Lisa; Leleti, Manmohan; Wang, Yu; Ertl, Linda; Baumgart, Trageen; Shugarts, Sarah; Lohr, Lisa; Dang, Ton; Miao, Shichang; Zeng, Yibin; Fan, Pingchen; Zhang, Penglie; Johnson, Daniel; Powers, Jay; Jaen, Juan; Charo, Israel; Schall, Thomas J

    2016-01-01

    The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan), an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg) and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.

  1. Growth of HfO{sub x} thin films by reactive molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, Erwin; Kurian, Jose; Alff, Lambert [Institut fuer Materialwissenschaft, TU Darmstadt (Germany)

    2008-07-01

    Thin films of hafnium oxide were grown on single crystal r-cut and c-cut sapphire by reactive molecular beam epitaxy. The conditions for the growth of single oriented hafnium oxide thin films have been established. Hafnium oxide thin films were characterized by X-ray diffraction and optical absorption measurements. It was found that hafnium oxide thin films grown on r-cut sapphire were (00l) oriented whereas, on c-cut sapphire, hafnium oxide films showed different orientations depending on the growth temperature and oxidation conditions. The hafnium oxide films grown at higher temperature and under strong oxidation conditions yielded (001) oriented films on c-cut sapphire whereas slightly weaker oxidation condition leads to (111) oriented hafnium oxide films. The bandgap deducted from optical absorption measurement carried out on hafnium oxide films grown under optimized conditions agreed well with the values reported in literature. A range of oxygen deficient thin films of hafnium oxide were also grown on single crystal sapphire substrates in order to investigate the effect of oxygen vacancies on dielectric properties of hafnium oxide. The oxygen deficient thin films of hafnium oxide show a decrease in bandgap with increase in oxygen deficiency.

  2. 26 CFR 5c.168(f)(8)-9 - Pass-through leases-transfer of only the investment tax credit to a party other than the ultimate...

    Science.gov (United States)

    2010-04-01

    ... investment tax credit to a party other than the ultimate user of the property. [Reserved] 5c.168(f)(8)-9...) INCOME TAX (CONTINUED) TEMPORARY INCOME TAX REGULATIONS UNDER THE ECONOMIC RECOVERY TAX ACT OF 1981 § 5c.168(f)(8)-9 Pass-through leases—transfer of only the investment tax credit to a party other than the...

  3. Dynamic sporulation gene co-expression networks for Bacillus subtilis 168 and the food-borne isolate Bacillus amyloliquefaciens: a transcriptomic model.

    Science.gov (United States)

    Omony, Jimmy; de Jong, Anne; Krawczyk, Antonina O; Eijlander, Robyn T; Kuipers, Oscar P

    2018-02-09

    Sporulation is a survival strategy, adapted by bacterial cells in response to harsh environmental adversities. The adaptation potential differs between strains and the variations may arise from differences in gene regulation. Gene networks are a valuable way of studying such regulation processes and establishing associations between genes. We reconstructed and compared sporulation gene co-expression networks (GCNs) of the model laboratory strain Bacillus subtilis 168 and the food-borne industrial isolate Bacillus amyloliquefaciens. Transcriptome data obtained from samples of six stages during the sporulation process were used for network inference. Subsequently, a gene set enrichment analysis was performed to compare the reconstructed GCNs of B. subtilis 168 and B. amyloliquefaciens with respect to biological functions, which showed the enriched modules with coherent functional groups associated with sporulation. On basis of the GCNs and time-evolution of differentially expressed genes, we could identify novel candidate genes strongly associated with sporulation in B. subtilis 168 and B. amyloliquefaciens. The GCNs offer a framework for exploring transcription factors, their targets, and co-expressed genes during sporulation. Furthermore, the methodology described here can conveniently be applied to other species or biological processes.

  4. 26 CFR 1.168A-6 - Depreciation of portion of emergency facility not subject to amortization.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Depreciation of portion of emergency facility... for Individuals and Corporations § 1.168A-6 Depreciation of portion of emergency facility not subject... in lieu of any deduction for depreciation which would otherwise be allowable under section 167 is...

  5. Characterization of Pharmacologic and Pharmacokinetic Properties of CCX168, a Potent and Selective Orally Administered Complement 5a Receptor Inhibitor, Based on Preclinical Evaluation and Randomized Phase 1 Clinical Study.

    Directory of Open Access Journals (Sweden)

    Pirow Bekker

    Full Text Available The complement 5a receptor has been an attractive therapeutic target for many autoimmune and inflammatory disorders. However, development of a selective and potent C5aR antagonist has been challenging. Here we describe the characterization of CCX168 (avacopan, an orally administered selective and potent C5aR inhibitor. CCX168 blocked the C5a binding, C5a-mediated migration, calcium mobilization, and CD11b upregulation in U937 cells as well as in freshly isolated human neutrophils. CCX168 retains high potency when present in human blood. A transgenic human C5aR knock-in mouse model allowed comparison of the in vitro and in vivo efficacy of the molecule. CCX168 effectively blocked migration in in vitro and ex vivo chemotaxis assays, and it blocked the C5a-mediated neutrophil vascular endothelial margination. CCX168 was effective in migration and neutrophil margination assays in cynomolgus monkeys. This thorough in vitro and preclinical characterization enabled progression of CCX168 into the clinic and testing of its safety, tolerability, pharmacokinetic, and pharmacodynamic profiles in a Phase 1 clinical trial in 48 healthy volunteers. CCX168 was shown to be well tolerated across a broad dose range (1 to 100 mg and it showed dose-dependent pharmacokinetics. An oral dose of 30 mg CCX168 given twice daily blocked the C5a-induced upregulation of CD11b in circulating neutrophils by 94% or greater throughout the entire day, demonstrating essentially complete target coverage. This dose regimen is being tested in clinical trials in patients with anti-neutrophil cytoplasmic antibody-associated vasculitis. Trial Registration ISRCTN registry with trial ID ISRCTN13564773.

  6. Evaluation and Enhancement of the Oxygen Reduction Reaction Activity on Hafnium Oxide Nanoparticles Assisted by L(+)-lysine

    International Nuclear Information System (INIS)

    Chisaka, Mitsuharu; Itagaki, Noriaki

    2016-01-01

    Evaluation of the oxygen reduction reaction (ORR) on oxide compounds is difficult owing to the insulating nature of oxides. In this study, various amounts of L(+)-lysine were added to the precursor dispersion for the hydrothermal synthesis of hafnium oxide nanoparticles on reduced graphene oxide sheets (HfO_x–rGO) to coat the HfO_x catalysts with layers of carbon, thereby increasing the conductivity and number of active sites. When the mass ratio of L(+)-lysine to GO, R, was above 26, carbon layers were formed and the amount monotonically increased with increasing R, as noted by cyclic voltammogrametry. X-ray photoelectron spectroscopy and rotating disk electrode analyses revealed that pyrolysis produced ORR-active oxygen defects, whose formation was proposed to involve carbothermal reduction. When 53 ≤ R ≤ 210, HfO_x–rGO contained a similar amount of oxygen defects and ORR activity, as represented by an onset potential of 0.9 V versus the reversible hydrogen electrode in 0.1 mol dm"−"3 H_2SO_4. However, the number of active sites depended on R due to the amount of L(+)-lysine-derived carbon layers that increased both the number of active sites and resistivity towards oxygen diffusion.

  7. Mechanistic Studies of Hafnium-Pyridyl Amido-Catalyzed 1-Octene Polymerization and Chain Transfer Using Quench-Labeling Methods.

    Science.gov (United States)

    Cueny, Eric S; Johnson, Heather C; Anding, Bernie J; Landis, Clark R

    2017-08-30

    Chromophore quench-labeling applied to 1-octene polymerization as catalyzed by hafnium-pyridyl amido precursors enables quantification of the amount of active catalyst and observation of the molecular weight distribution (MWD) of Hf-bound polymers via UV-GPC analysis. Comparison of the UV-detected MWD with the MWD of the "bulk" (all polymers, from RI-GPC analysis) provides important mechanistic information. The time evolution of the dual-detection GPC data, concentration of active catalyst, and monomer consumption suggests optimal activation conditions for the Hf pre-catalyst in the presence of the activator [Ph 3 C][B(C 6 F 5 ) 4 ]. The chromophore quench-labeling agents do not react with the chain-transfer agent ZnEt 2 under the reaction conditions. Thus, Hf-bound polymeryls are selectively labeled in the presence of zinc-polymeryls. Quench-labeling studies in the presence of ZnEt 2 reveal that ZnEt 2 does not influence the rate of propagation at the Hf center, and chain transfer of Hf-bound polymers to ZnEt 2 is fast and quasi-irreversible. The quench-label techniques represent a means to study commercial polymerization catalysts that operate with high efficiency at low catalyst concentrations without the need for specialized equipment.

  8. Characteristics of laser produced plasmas of hafnium and tantalum in the 1-7 nm region

    Science.gov (United States)

    Li, Bowen; Otsuka, Takamitsu; Sokell, Emma; Dunne, Padraig; O'Sullivan, Gerry; Hara, Hiroyuki; Arai, Goki; Tamura, Toshiki; Ono, Yuichi; Dinh, Thanh-Hung; Higashiguchi, Takeshi

    2017-11-01

    Soft X-ray (SXR) spectra from hafnium and tantalum laser produced plasmas were recorded in the 1-7 nm region using two Nd:YAG lasers with pulse lengths of 170 ps and 10 ns, respectively, operating at a range of power densities. The maximum focused peak power density was 2. 3 × 1014 W cm-2 for 170 ps pulses and 1. 8 × 1012 W cm-2 for 10 ns pulses, respectively. Two intense quasicontinuous intensity bands resulting from n = 4 - n = 4 and n = 4 - n = 5 unresolved transition arrays (UTAs) dominate both sets of experimental spectra. Comparison with calculations performed with the Cowan suite of atomic structure codes as well as consideration of previous experimental and theoretical results aided identification of the most prominent features in the spectra. For the 10 ns spectrum, the highest ion stage that could be identified from the n = 4 - n = 5 arrays were lower than silver-like Hf25+ and Ta26+ (which has a 4 d 104 f ground configuration) indicating that the plasma temperature attained was too low to produce ions with an outermost 4 d subshell, while for the 170 ps plasmas the presence of significantly higher stages was deduced and lines due to 4 d-5 p transitions were clearly evident. Furthermore, we show an enhancement of emission from tantalum using dual laser irradiation, and the effect of pre-pulse durations and delay times between two pulses are demonstrated.

  9. Corrective Action Plan for Corrective Action Unit 168: Area 25 and 26 Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada, REV 1

    International Nuclear Information System (INIS)

    NSTec Environmental Restoration

    2007-01-01

    Corrective Action Unit (CAU) 168 is identified in the Federal Facility Agreement and Consent Order of 1996 as Area 25 and 26 Contaminated Materials and Waste Dumps. CAU 168 consists of twelve Corrective Action Sites (CASs) in Areas 25 and 26 of the Nevada Test Site, which is approximately 105 kilometers (65 miles) northwest of Las Vegas, Nevada. The CASs contain surface and subsurface debris, impacted soil, and contaminated materials. Site characterization activities were conducted in 2002, and the results are presented in the Corrective Action Decision Document (CADD) for CAU 168 (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office [NNSA/NSO], 2006). Site characterization results indicated that soil at several sites exceeded the clean-up criteria for total petroleum hydrocarbons (TPH), polychlorinated biphenyls (PCBs), and radionuclides. The Nevada Division of Environmental Protection approved the proposed corrective actions specified in the CADD (NNSA/NSO, 2006). The approved corrective actions include no further action, clean closure, and closure in place with administrative controls

  10. X-ray tube target

    International Nuclear Information System (INIS)

    Weber, R.G.

    1980-01-01

    A target with an improved heat emissive surface for use in a rotating anode type x-ray tube is described. The target consists of a body having a first surface portion made of x-ray emissive material and a second surface portion made of a heat emissive material comprising at least one of hafnium boride, hafnium oxide, hafnium nitride, hafnium silicide, and hafnium aluminide. (U.K.)

  11. Materials properties of hafnium and zirconium silicates: Metal interdiffusion and dopant penetration studies

    Science.gov (United States)

    Quevedo Lopez, Manuel Angel

    Hafnium and Zirconium based gate dielectrics are considered potential candidates to replace SiO2 or SiON as the gate dielectric in CMOS processing. Furthermore, the addition of nitrogen into this pseudo-binary alloy has been shown to improve their thermal stability, electrical properties, and reduce dopant penetration. Because CMOS processing requires high temperature anneals (up to 1050°C), it is important to understand the diffusion properties of any metal associated with the gate dielectric in silicon at these temperatures. In addition, dopant penetration from the doped polysilicon gate into the Si channel at these temperatures must also be studied. Impurity outdiffusion (Hf, Zr) from the dielectric, or dopant (B, As, P) penetration through the dielectric into the channel region would likely result in deleterious effects upon the carrier mobility. In this dissertation extensive thermal stability studies of alternate gate dielectric candidates ZrSixOy and HfSixO y are presented. Dopant penetration studies from doped-polysilicon through HfSixOy and HfSixOyNz are also presented. Rutherford Backscattering Spectroscopy (RBS), Heavy Ion RBS (HI-RBS), X-ray Photoelectron Spectroscopy (XPS), High Resolution Transmission Electron Microscopy (HR-TEM), and Time of Flight and Dynamic Secondary Ion Mass Spectroscopy (ToF-SIMS, D-SIMS) methods were used to characterize these materials. The dopant diffusivity is calculated by modeling of the dopant profiles in the Si substrate. In this disseration is reported that Hf silicate films are more stable than Zr silicate films, from the metal interdiffusion point of view. On the other hand, dopant (B, As, and P) penetration is observed for HfSixO y films. However, the addition of nitrogen to the Hf - Si - O systems improves the dopant penetration properties of the resulting HfSi xOyNz films.

  12. Lifetime embrittlement of reactor core materials

    International Nuclear Information System (INIS)

    Kreyns, P.H..; Bourgeois, W.F.; Charpentier, P.L.; Kammenzind, B.F.; Franklin, D.G.; White, C.J.

    1994-08-01

    Over a core lifetime, the reactor materials Zircaloy-2, Zircaloy-4, and hafnium may become embrittled due to the absorption of corrosion- generated hydrogen and to neutron irradiation damage. Results are presented on the effects of fast fluence on the fracture toughness of wrought Zircaloy-2, Zircaloy-4, and hafnium; Zircaloy-4 to hafnium butt welds; and hydrogen precharged beta treated and weld metal Zircaloy-4 for fluences up to a maximum of approximately 150 x 10 24 n/M 2 (> 1 Mev). While Zircaloy-4 did not exhibit a decrement in K IC due to irradiation, hafnium and butt welds between hafnium and Zircaloy-4 are susceptible to embrittlement with irradiation. The embrittlement can be attributed to irradiation strengthening, which promotes cleavage fracture in hafnium and hafnium-Zircaloy welds, and, in part, to the lower chemical potential of hydrogen in Zircaloy-4 compared to hafnium, which causes hydrogen, over time, to drift from the hafnium end toward the Zircaloy-4 end and to precipitate at the interface between the weld and base-metal interface. Neutron radiation apparently affects the fracture toughness of Zircaloy-2, Zircaloy-4, and hafnium in different ways. Possible explanations for these differences are suggested. It was found that Zircaloy-4 is preferred over Zircaloy-2 in hafnium-to- Zircaloy butt-weld applications due to its absence of a radiation- induced reduction in K IC plus its lower hydrogen absorption characteristics compared with Zircaloy-2

  13. The energy landscape of glassy dynamics on the amorphous hafnium diboride surface

    International Nuclear Information System (INIS)

    Nguyen, Duc; Girolami, Gregory S.; Mallek, Justin; Cloud, Andrew N.; Abelson, John R.; Lyding, Joseph; Gruebele, Martin

    2014-01-01

    Direct visualization of the dynamics of structural glasses and amorphous solids on the sub-nanometer scale provides rich information unavailable from bulk or conventional single molecule techniques. We study the surface of hafnium diboride, a conductive ultrahigh temperature ceramic material that can be grown in amorphous films. Our scanning tunneling movies have a second-to-hour dynamic range and single-point current measurements extend that to the millisecond-to-minute time scale. On the a-HfB 2 glass surface, two-state hopping of 1–2 nm diameter cooperatively rearranging regions or “clusters” occurs from sub-milliseconds to hours. We characterize individual clusters in detail through high-resolution (<0.5 nm) imaging, scanning tunneling spectroscopy and voltage modulation, ruling out individual atoms, diffusing adsorbates, or pinned charges as the origin of the observed two-state hopping. Smaller clusters are more likely to hop, larger ones are more likely to be immobile. HfB 2 has a very high bulk glass transition temperature T g , and we observe no three-state hopping or sequential two-state hopping previously seen on lower T g glass surfaces. The electronic density of states of clusters does not change when they hop up or down, allowing us to calibrate an accurate relative z-axis scale. By directly measuring and histogramming single cluster vertical displacements, we can reconstruct the local free energy landscape of individual clusters, complete with activation barrier height, a reaction coordinate in nanometers, and the shape of the free energy landscape basins between which hopping occurs. The experimental images are consistent with the compact shape of α-relaxors predicted by random first order transition theory, whereas the rapid hopping rate, even taking less confined motion at the surface into account, is consistent with β-relaxations. We make a proposal of how “mixed” features can show up in surface dynamics of glasses

  14. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung

    2014-03-01

    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  15. An Auger electron spectroscopy study on the anodization process of high-quality thin-film capacitors made of hafnium

    International Nuclear Information System (INIS)

    Noya, Atsushi; Sasaki, Katsutaka; Umezawa, Toshiji

    1989-01-01

    Formation process of the anodic oxide film of hafnium for use as a thin-film capacitor has been examined by the current-voltage characteristics of the anodization and the in-depth analysis of formed oxide using Auger electron spectroscopy. It is found that the oxide growth obeys three different rate laws such as the linear rate law at first and next the parabolic rate law during the constant current anodization, and then the reciprocal logarithmic rate law during the constant voltage anodization following after the constant current process. From the Auger electron spectroscopy analysis, it is found that the shape of the compositional depth profile of the grown oxide film varies associating with the rate law of oxidation obeyed. The variation of depth profile correlating with the rate law is discussed with respect to each elementary process such as the transport and/or the reaction of chemical species interpreted from the over-all behavior of anodization process. It is revealed that the stoichiometric film having an interface with sharp transition, which is favorable for obtaining excellent electrical properties of the capacitor, can be obtained under the condition that the phase-boundary reaction is the rate-determining step of the anodization. The constant voltage anodization process also satisfies such circumstances and therefore can be favorable method for preparing highquality thin-film capacitors. (author)

  16. Contribution towards ALD and MOCVD of rare earth oxides and hafnium oxide. From precursor evaluation to process development and thin film characterization

    International Nuclear Information System (INIS)

    Xu, Ke

    2013-01-01

    elements for ALD applications. A possible synthesis route is the salt metatheses route. It could be expected that the monodentate guanidine ligand would provide increased reactivity towards water, where the bulky guanidine ligands will shield the RE center providing self-limiting growth behavior. In Chapter 4 and 7, ALD of rare earth oxides and hafnium oxide using corresponding guanidinate precursors are in detail investigated. According to the measurements, these processes are true ALD processes with broad ALD windows, high growth per cycle in the saturated area. Furthermore, the rare earth guanidinate and hafnium guanidinate precursors exhibit matching ALD window in the temperature range of 200 - 225 C. This motivated us to deposite trinary oxide thin films (HfREOx) using corresponding precursor combinations.

  17. Poly(ADP-ribosyl)ation links the chromatin remodeler SMARCA5/SNF2H to RNF168-dependent DNA damage signaling

    NARCIS (Netherlands)

    G. Smeenk (Godelieve); W.W. Wiegant (Wouter); J.A. Marteijn (Jurgen); M.S. Luijsterburg (Martijn); N. Sroczynski (Nicholas); T. Costelloe (Thomas); R. Romeijn (Ron); A. Pastink (Albert); N. Mailand (Niels); W. Vermeulen (Wim); H. van Attikum (Haico)

    2013-01-01

    textabstractIonizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains

  18. Nano-crystals of cerium–hafnium binary oxide: Their size-dependent structure

    Energy Technology Data Exchange (ETDEWEB)

    Raitano, Joan M. [Department of Applied Physics and Applied Mathematics, Materials Science and Engineering Program, Columbia University, New York, NY 10027 (United States); Khalid, Syed [National Synchrotron Light Source, Brookhaven National Laboratory, Upton, NY 11973 (United States); Marinkovic, Nebojsa [Chemical Engineering Department, Columbia University, 500 W 120th St, Mudd 801, New York, NY 10027 (United States); Chan, Siu-Wai, E-mail: sc174@columbia.edu [Department of Applied Physics and Applied Mathematics, Materials Science and Engineering Program, Columbia University, New York, NY 10027 (United States)

    2015-09-25

    Highlights: • (1 − x)CeO{sub 2}–xHfO{sub 2} was precipitated (0 < x < 1) and calcined in air. • For x ⩽ 0.14, crystallites ⩽140 nm in size exhibit only the fluorite structure. • This low hafnia solubility is attributable to no auto-reduction (Ce{sup 3+} = 0). • The low solubility is also due to the high temperature required for homogenization. • Coarsening is lessened as Hf{sup 4+} ions slow cation diffusion in these crystallites. - Abstract: Cerium oxide (CeO{sub 2}, “ceria”) and hafnium oxide (HfO{sub 2}, “hafnia”) were aqueously co-precipitated and subsequently calcined to allow for homogenization. The size of the (1−x)CeO{sub 2}–xHfO{sub 2} crystallites, determined by the Scherrer equation, varied from 140 nm for x = 0 to 15 nm for x = 0.73. For x ⩽ 0.14, only cubic structures are visible in X-ray diffractograms, and the lattice parameters are consistent with the values expected for structurally cubic solid solutions of hafnia in ceria. At x = 0.26, tetragonal and monoclinic phases nucleated with the former not being observed in the bulk phase diagram for ceria–hafnia. Therefore, the solubility limit of the cubic structure is between x = 0.14 and x = 0.26 for 40–61 nm crystallites, the sizes of these respective compositions. More specifically, for the 40 nm crystallites of x = 0.26 (1 − x)CeO{sub 2}–xHfO{sub 2}, 15% of the hafnia remains in a structurally cubic solid solution with ceria based on the observed cubic lattice parameter. The compositional domain for the cubic fluorite structure in this study is narrower than other nanostructured (1 − x)CeO{sub 2}–xHfO{sub 2} studies, especially studies with crystallite sizes less than 10 nm, but wider than observed in the bulk and helps to expand the size regime over which the relationship between crystallite size and phase stability is known. The extent of this cubic-structure domain is mainly attributable to the intermediate crystallite size and the roughly zero Ce{sup 3

  19. RPA method based on the self-consistent cranking model for 168Er and 158Dy

    International Nuclear Information System (INIS)

    Kvasil, J.; Cwiok, S.; Chariev, M.M.; Choriev, B.

    1983-01-01

    The low-lying nuclear states in 168 Er and 158 Dy are analysed within the random phase approximation (RPA) method based on the self-consistent cranking model (SCCM). The moment of inertia, the value of chemical potential, and the strength constant k 1 have been obtained from the symmetry condition. The pairing strength constants Gsub(tau) have been determined from the experimental values of neutron and proton pairing energies for nonrotating nuclei. A quite good agreement with experimental energies of states with positive parity was obtained without introducing the two-phonon vibrational states

  20. Early complications after pneumonectomy: retrospective study of 168 patients.

    Science.gov (United States)

    Alloubi, Ihsan; Jougon, Jacques; Delcambre, Frédéric; Baste, Jean Marc; Velly, Jean François

    2010-08-01

    The purpose of this study was to assess the mortality and risk factors of complications after pneumonectomy for lung cancer. Between 1996 and 2001, we reviewed and analysed the demographic, clinical, functional, and surgical variables of 168 patients to identify risk factors of postoperative complications by univariate and multivariate analyses with Medlog software system. The mean age was 60+/-10 years, overall mortality and morbidity rates were 4.17% and 41.6%, respectively. All frequencies of respiratory complications were 1.2% for acute respiratory failure, 10.1% for pneumonia, 2.4% for acute pulmonary oedema, 4.17% for bronchopleural fistula, 2.4% for thoracic empyema and 18.5% for left recurrent nerve injuries. Postoperative arrhythmias developed in 46% of our patients. The risk factors for cardiopulmonary morbidity and mortality with univariate analysis were advanced age (P<0.01), preoperative poor performance status (P<0.015), and chronic artery disease (P<0.008). Factors adversely affecting morbidity with multivariate analysis included age (P=0.0001), associated cardiovascular disease (P=0.001), and altered forced expiratory volume in 1 s (P=0.0005). Complications after pneumonectomy are associated with high mortality. Careful attention must be paid to patients with advanced age and heart disease. Chest physiotherapy is paramount to have uneventful outcomes.

  1. 26 CFR 1.280F-1T - Limitations on investment tax credit and recovery deductions under section 168 for passenger...

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Limitations on investment tax credit and... Limitations on investment tax credit and recovery deductions under section 168 for passenger automobiles and... the amount of investment tax credit determined under section 46(a) and recovery deductions under...

  2. L2₁ and XA Ordering Competition in Hafnium-Based Full-Heusler Alloys Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb).

    Science.gov (United States)

    Wang, Xiaotian; Cheng, Zhenxiang; Wang, Wenhong

    2017-10-20

    For theoretical designing of full-Heusler based spintroinc materials, people have long believed in the so-called Site Preference Rule (SPR). Very recently, according to the SPR, there are several studies on XA-type Hafnium-based Heusler alloys X₂YZ, i.e., Hf₂VAl, Hf₂CoZ (Z = Ga, In) and Hf₂CrZ (Z = Al, Ga, In). In this work, a series of Hf₂-based Heusler alloys, Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb), were selected as targets to study the site preferences of their atoms by first-principle calculations. It has been found that all of them are likely to exhibit the L2₁-type structure instead of the XA one. Furthermore, we reveal that the high values of spin-polarization of XA-type Hf₂VZ (Z = Al, Ga, In, Tl, Si, Ge, Sn, Pb) alloys have dropped dramatically when they form the L2₁-type structure. Also, we prove that the electronic, magnetic, and physics nature of these alloys are quite different, depending on the L2₁-type or XA-type structures.

  3. 42 CFR 137.168 - May the Secretary require audit or accounting standards other than those specified in § 137.167?

    Science.gov (United States)

    2010-10-01

    ... SERVICES TRIBAL SELF-GOVERNANCE Operational Provisions Audits and Cost Principles § 137.168 May the Secretary require audit or accounting standards other than those specified in § 137.167? No, no other audit... 42 Public Health 1 2010-10-01 2010-10-01 false May the Secretary require audit or accounting...

  4. sdg interacting-boson model in the SU(3) scheme and its application to 168Er

    Science.gov (United States)

    Yoshinaga, N.; Akiyama, Y.; Arima, A.

    1988-07-01

    The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to 168Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model.

  5. Growth of conductive HfO{sub 2-x} thin films by reactive molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Hildebrandt, Erwin; Kurian, Jose; Alff, Lambert [Institut fuer Materialwissenschaft, TU Darmstadt (Germany); Kleebe, Hans-Joachim [Institut fuer Angewandte Geowissenschaften, TU Darmstadt (Germany)

    2009-07-01

    Thin films of oxygen deficient hafnium oxide were grown on single crystal c-cut and r-cut sapphire substrates by reactive molecular beam epitaxy. The oxidation conditions during growth were varied within a wide range using RF-activated oxygen. Hafnium oxide thin films were characterized using X-ray diffraction, resistivity measurements ({rho}-T) and transmission electron microscopy (TEM). The results show a dramatic increase in conductivity of the deposited oxygen deficient hafnium oxide thin films with decreasing oxidation conditions during growth. The electrical properties of deficient hafnium oxide thin films varied from insulating over semiconducting to conducting. X-ray diffraction data as well as TEM data rule out the possibility of conductivity due to metallic hafnium.

  6. Hafnium in peralkaline and peraluminous boro-aluminosilicate glass, and glass subcomponents: a solubility study

    International Nuclear Information System (INIS)

    Davis, Linda L.; Darab, John G.; Qian, Maoxu; Zhao, Donggao; Palenik, Christopher S.; Li, Hong; Strachan, Denis M.; Li, Liyu

    2003-01-01

    A relationship between the solubility of hafnia (HfO2) and the host glass composition was explored by determining the solubility limits of HfO2 in peralkaline and peraluminous borosilicate glasses in the system SiO2-Al2O3-B2O3-Na2O, and in glasses in the system SiO2-Na2O-Al2O3 in air at 1450 C. The only Hf-bearing phase to crystallize in the peralkaline borosilicate melts is hafnia, while in the boron-free melts sodium-hafnium silicates crystallize. All peraluminous borosilicate melts crystallize hafnia, but the slightly peraluminous glasses also have sector-zoned hafnia crystals that contain Al and Si. The more peraluminous borosilicate glasses also crystallize a B-containing mullite. The general morphology of the hafnia crystals changes as peralkalinity (Na2O/(Na2O+Al2O3)) decreases, as expected in melts with increasing viscosity. In all of the glasses with Na2O > Al2O3, the solubility of hafnia is linearly and positively correlated with Na2O/(Na2O + Al2O3) or Na2O - Al2O3 (excess sodium), despite the presence of 5 to 16 mol% B2O3. The solubility of hafnia is higher in the sodium-aluminum borosilicate glasses than in the sodium-aluminosilicate glasses, suggesting that the boron is enhancing the effect that excess sodium has on the incorporation of Hf into the glass structure. The results of this solubility study are compared to other studies of high-valence cation solubility in B-free silicate melts. From this, for peralkaline B-bearing glasses, it is shown that, although the solubility limits are higher, the solution behavior of hafnia is the same as in B-free silicate melts previously studied. By comparison, also, it is shown that in peraluminous melts, there must be a different solution mechanism for hafnia: different than for peralkaline sodium-aluminum borosilicate glasses and different than for B-free silicate melts studied by others

  7. Distribución de los elementos Cu-Pb-Zn en suelos de la plancha 168 (Argelia).

    OpenAIRE

    Sánchez-Arredondo, Luis Hernán

    2014-01-01

    El objetivo de este estudio fue el análisis espacial de los elementos cobre, plomo y cinc en horizontes A de suelos de la plancha geológica 168 (Argelia), región sureste del departamento de Antioquia Colombia. Las muestras utilizadas hacen parte del programa "Levantamiento y Compilación de Información Geoquímica-Mapas Regionales-Ingeominas (Colombia)" y fueron facilitadas por INGEOMINAS (hoy Servicio Geológico Colombiano) para el proyecto "Mapa Geoquímico de Antioquia". Para la elaboración de...

  8. Construction of a highly efficient Bacillus subtilis 168 whole-cell biocatalyst and its application in the production of L-ornithine.

    Science.gov (United States)

    Wang, Meizhou; Xu, Meijuan; Rao, Zhiming; Yang, Taowei; Zhang, Xian

    2015-11-01

    L-Ornithine, a non-protein amino acid, is usually extracted from hydrolyzed protein as well as produced by microbial fermentation. Here, we focus on a highly efficient whole-cell biocatalyst for the production of L-ornithine. The gene argI, encoding arginase, which catalyzes the hydrolysis of L-arginine to L-ornithine and urea, was cloned from Bacillus amyloliquefaciens B10-127 and expressed in GRAS strain Bacillus subtilis 168. The recombinant strain exhibited an arginase activity of 21.9 U/mg, which is 26.7 times that of wild B. subtilis 168. The optimal pH and temperature of the purified recombinant arginase were 10.0 and 40 °C, respectively. In addition, the recombinant arginase exhibited a strong Mn(2+) preference. When using whole-cell biocatalyst-based bioconversion, a hyper L-ornithine production of 356.9 g/L was achieved with a fed-batch strategy in a 5-L reactor within 12 h. This whole-cell bioconversion study demonstrates an environmentally friendly strategy for L-ornithine production in industry.

  9. The rnf168 paralog rnf169 defines a new class of ubiquitylated histone reader involved in the response to dna damage

    NARCIS (Netherlands)

    Kitevski-Leblanc, Julianne; Fradet-Turcotte, Amélie; Kukic, Predrag; Wilson, Marcus D.; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D.; Van Ingen, Hugo; Arrowsmith, Cheryl H.; Rubinstein, John L.; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E

    2017-01-01

    Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking

  10. Sdg interacting-boson model in the SU(3) scheme and its application to /sup 168/Er

    International Nuclear Information System (INIS)

    Yoshinaga, N.; Akiyama, Y.; Arima, A.

    1988-01-01

    The sdg interacting-boson model is presented in the SU(3) tensor formalism. The interactions are decomposed according to their SU(3) tensor character. The existence of the SU(3)-seniority preserving operator is found to be important. The model is applied to /sup 168/Er. Energy levels and electromagnetic transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first K/sup π/ = 4 + band relative to that of the first K/sup π/ = 2 + one. E4 transitions are calculated to give different predictions from those by the quasiparticle-phonon nuclear model

  11. Comparison of HfCl4, HfI4, TEMA-Hf, and TDMA-Hf as precursors in early growing stages of HfO2 films deposited by ALD: A DFT study

    International Nuclear Information System (INIS)

    Cortez-Valadez, M.; Fierro, C.; Farias-Mancilla, J.R.; Vargas-Ortiz, A.; Flores-Acosta, M.; Ramírez-Bon, R.; Enriquez-Carrejo, J.L.

    2016-01-01

    Highlights: • Hafnium oxide growth on Si(100) by atomic layer deposition was simulated. • The interface structure was considered as silicate and silicide. • The interface was studied employing DFT. • TDMA-Hf precursor show better interface stability. - Abstract: The final structure of HfO 2 films grown by atomic layer deposition (ALD) after reaction with OH − ions has been analyzed by DFT (density functional theory). The interaction of the precursors: HfCl 4 (hafnium tetrachloride), HfI 4 (hafnium tetraiodide), TEMA-Hf (tetrakis-ethylmethylamino hafnium), and TDMA-Hf (tetrakis-dimethylamino hafnium) with HO–H was studied employing the B3LYP (Becke 3-parameter, Lee–Yang–Parr) hybrid functional and the PBE (Perdew–Burke–Ernzerhof) generalized gradient functional. The structural evolution at the Si(100) surface has been analyzed by LDA (local density approximation). The structural parameters: bond length and bond angle, and the vibrational parameters for the optimized structures are also reported. The presence of hafnium silicate at the interface was detected. The infrared spectra and structural parameters obtained in this work agree with previously reported experimental results.

  12. Coulomb blockade and magnetoresistance in granular La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} under hydrostatic pressure

    Energy Technology Data Exchange (ETDEWEB)

    Narjis, A., E-mail: narjis78@gmail.com [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El Kaaouachi, A.; Limouny, L.; Dlimi, S.; Errai, M.; Sybous, A. [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Kumaresavanji, M. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rua Dr. Xavier Sigaud, 150 Urca, Rio de Janeiro (Brazil)

    2013-04-15

    The transport properties in the La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} layered manganite system have been studied in the presence of magnetic field up to 5 T. An analysis of the low temperature (T<45 K) dependence of the resistivity under hydrostatic pressure up to 25 kbars shows the spin-dependent Coulomb Blockade phenomenon. The surface phase and the link condition in grain boundaries are suggested to be responsible for the magnetoresistance data while influencing the charge transfer probability between grains. - Highlights: ►Magnetotransport in a colossal magnetoresistive material La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7}. ► The effect of the forming pressure on the magnetoresistance (MR). ► The grain size effect and charge transfer probability between grains. ► A simple model to explain the negative MR.

  13. Synthesis and characterization of hafnium carbide microcrystal chains with a carbon-rich shell via CVD

    International Nuclear Information System (INIS)

    Tian, Song; Li, Hejun; Zhang, Yulei; Liu, Sen; Fu, Yangxi; Li, Yixian; Qiang, Xinfa

    2013-01-01

    Graphical abstract: Novel HfC microcrystal chains have been synthesized via a catalyst-assisted chemical vapor deposition process. SEM results show the chains have a periodically changing diameter and a nanoscale sharpening tip. Analysis of TEM/SAED/EELS/EDX data shows the single-crystal chains grow along a [0 0 1] direction and consist of a HfC core and a thin carbon-rich shell with embedded HfC nanocrystallites surrounding the core. This work achieves the controllable preparation of nanoscale HfC sharpening tips for application as a point electron emission source and facilitates the application of HfC ultrafast laser-triggered tips in attosecond science. Highlights: •HfC microcrystal chains were synthesized by a catalyst-assisted CVD. •The chains grow along a [0 0 1] direction and have a periodically changing diameter. •Single-crystal HfC core is sheathed by a thin carbon-rich shell. •A growth mechanism model is proposed to explain the growth of microcrystal chians. •This work achieves the controllable preparation of nanoscale HfC sharpening tips. -- Abstract: Novel hafnium carbide (HfC) microcrystal chains, with a periodically changing diameter and a nanoscale sharpening tip at the chain end, have been synthesized via a catalyst-assisted chemical vapor deposition (CVD) process. The as-synthesized chains with many octahedral microcrystals have diameters of between several hundreds of nm and 6 μm and lengths of ∼500 μm. TEM diffraction studies show that the chains are single-crystalline HfC and preferentially grow along a [0 0 1] crystal orientation. TEM/EELS/EDX analysis proves the chains are composed of a HfC core and a thin (several tens of nm to 100 nm) carbon-rich shell with the embedded HfC nanocrystallites (typically below 10 nm) surrounding the core. The growth mechanism model for the chains based on the vapor–liquid–solid process, the vapor–solid process, and the HfC crystal growth characteristics is discussed

  14. Design of an Extractive Distillation Column for the Environmentally Benign Separation of Zirconium and Hafnium Tetrachloride for Nuclear Power Reactor Applications

    Directory of Open Access Journals (Sweden)

    Le Quang Minh

    2015-09-01

    Full Text Available Nuclear power with strengthened safety regulations continues to be used as an important resource in the world for managing atmospheric greenhouse gases and associated climate change. This study examined the environmentally benign separation of zirconium tetrachloride (ZrCl4 and hafnium tetrachloride (HfCl4 for nuclear power reactor applications through extractive distillation using a NaCl-KCl molten salt mixture. The vapor–liquid equilibrium behavior of ZrCl4 and HfCl4 over the molten salt system was correlated with Raoult’s law. The molten salt-based extractive distillation column was designed optimally using a rigorous commercial simulator for the feasible separation of ZrCl4 and HfCl4. The molten salt-based extractive distillation approach has many potential advantages for the commercial separation of ZrCl4 and HfCl4 compared to the conventional distillation because of its milder temperatures and pressure conditions, smaller number of required separation trays in the column, and lower energy requirement for separation, while still taking the advantage of environmentally benign feature by distillation. A heat-pump-assisted configuration was also explored to improve the energy efficiency of the extractive distillation process. The proposed enhanced configuration reduced the energy requirement drastically. Extractive distillation can be a promising option competing with the existing extraction-based separation process for zirconium purification for nuclear power reactor applications.

  15. Cobalt(II), nickel(II), copper(II), zinc(II) and hafnium(IV) complexes of N'-(furan-3-ylmethylene)-2-(4-methoxyphenylamino)acetohydrazide.

    Science.gov (United States)

    Emam, Sanaa M; El-Saied, Fathy A; Abou El-Enein, Saeyda A; El-Shater, Heba A

    2009-03-01

    Cobalt(II), nickel(II), copper(II), zinc(II) and hafnium(IV) complexes of furan-2-carbaldehyde 4-methoxy-N-anilinoacetohydrazone were synthesized and characterized by elemental and thermal (TG and DTA) analyses, IR, UV-vis and (1)H NMR spectra as well as magnetic moment and molar conductivity. Mononuclear complexes are obtained with 1:1 molar ratio except complexes 3 and 9 which are obtained with 1:2 molar ratios. The IR spectra of ligand and metal complexes reveal various modes of chelation. The ligand behaves as a neutral bidentate one and coordination occurs via the carbonyl oxygen atom and azomethine nitrogen atom. The ligand behaves also as a monobasic tridentate one and coordination occurs through the enolic oxygen atom, azomethine nitrogen atom and the oxygen atom of furan ring. Moreover, the ligand behaves as a neutral tridentate and coordination occurs via the carbonyl oxygen, azomethine nitrogen and furan oxygen atoms as well as a monobasic bidentate and coordination occurs via the enolic oxygen atom and azomethine nitrogen atom. The electronic spectra and magnetic moment measurements reveal that all complexes possess octahedral geometry except the copper complex 10 possesses a square planar geometry. The thermal studies showed the type of water molecules involved in metal complexes as well as the thermal decomposition of some metal complexes.

  16. Recruitment of the cohesin loading factor NIPBL to DNA double-strand breaks depends on MDC1, RNF168 and HP1γ in human cells

    International Nuclear Information System (INIS)

    Oka, Yasuyoshi; Suzuki, Keiji; Yamauchi, Motohiro; Mitsutake, Norisato; Yamashita, Shunichi

    2011-01-01

    Highlights: → NIPBL is recruited to DSBs. → Localization of NIPBL to DSBs is regulated by MDC1 and RNF168. → HP1γ is required for NIPBL accumulation at DSBs. -- Abstract: The cohesin loading factor NIPBL is required for cohesin to associate with chromosomes and plays a role in DNA double-strand break (DSB) repair. Although the NIPBL homolog Scc2 is recruited to an enzymatically generated DSB and promotes cohesin-dependent DSB repair in yeast, the mechanism of the recruitment remains poorly understood. Here we show that the human NIPBL is recruited to the sites of DNA damage generated by micro-irradiation as well as to the sites of DSBs induced by homing endonuclease, I-PpoI. The recruitment of NIPBL was impaired by RNAi-mediated knockdown of MDC1 or RNF168, both of which also accumulate at DSBs. We also show that the recruitment of NIPBL to the sites of DNA damage is mediated by its C-terminal region containing HEAT repeats and Heterochromatin protein 1 (HP1) interacting motif. Furthermore, NIPBL accumulation at damaged sites was also compromised by HP1γ depletion. Taken together, our study reveals that human NIPBL is a novel protein recruited to DSB sites, and the recruitment is controlled by MDC1, RNF168 and HP1γ.

  17. Band mixing and electric monopole contribution in 2sub(. gamma. ). -->. 2sub(g) transition in /sup 168/Er

    Energy Technology Data Exchange (ETDEWEB)

    Sahota, H S; Hasiza, M L; Mittal, R [Punjabi Univ., Patiala (India). Dept. of Physics

    1976-06-01

    The 2sub(..gamma..)..-->..2sub(g) transition in /sup 168/Er has been examined for the presence of electric monopole contribution. The experimental E0/E2 reduced transition probabilities and monopole matrix element have been found to be somewhat larger than the theoretical predictions of the Bohr-Mottelson model but the ratio rhosup(2)/X has been found to agree well with the theoretical value. The band mixing parameters have also been evaluated and found to be sizeable.

  18. Comparison of HfCl4, HfI4, TEMA-Hf, and TDMA-Hf as precursors in early growing stages of HfO2 films deposited by ALD: A DFT study

    Science.gov (United States)

    Cortez-Valadez, M.; Fierro, C.; Farias-Mancilla, J. R.; Vargas-Ortiz, A.; Flores-Acosta, M.; Ramírez-Bon, R.; Enriquez-Carrejo, J. L.; Soubervielle-Montalvo, C.; Mani-Gonzalez, P. G.

    2016-06-01

    The final structure of HfO2 films grown by atomic layer deposition (ALD) after reaction with OH- ions has been analyzed by DFT (density functional theory). The interaction of the precursors: HfCl4 (hafnium tetrachloride), HfI4 (hafnium tetraiodide), TEMA-Hf (tetrakis-ethylmethylamino hafnium), and TDMA-Hf (tetrakis-dimethylamino hafnium) with HO-H was studied employing the B3LYP (Becke 3-parameter, Lee-Yang-Parr) hybrid functional and the PBE (Perdew-Burke-Ernzerhof) generalized gradient functional. The structural evolution at the Si(100) surface has been analyzed by LDA (local density approximation). The structural parameters: bond length and bond angle, and the vibrational parameters for the optimized structures are also reported. The presence of hafnium silicate at the interface was detected. The infrared spectra and structural parameters obtained in this work agree with previously reported experimental results.

  19. A spanish mineral of zirconium and hafnium. Separation of the two elements by liquid-liquid extraction, using tributyl phosphate as chelating agent; Beneficio de un mineral espanol de circonio-hafnio. Separacion de ambos elementos por extraccion liquido-liquido, empleando fosfato de tributilo como agente de quelacion

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz Sanchez, F; Cruz Castillo, F. de la; Fernandez Cellini, R

    1962-07-01

    The zirconium and Hafnium oxides are obtained from a Spanish mineral of zircon with an average contest of 55% in ZrO{sub 2}-HfO{sub 2}. An alkaline fusion to open the mineral, followed by a purification by crystallization as (Zr O-Hf O)Cl{sub 2} H{sub 2}O or as (Zr-Hf) (SO{sub 4}){sub 2}. 4H{sub 2}O, is used. A discussion of the best experimental conditions for opening the mineral and of the purification method is made. (Author) 45 refs.

  20. 6-Peroxo-6-zirconium crown and its hafnium analogue embedded in a triangular polyanion: [M6(O2)6(OH)6(gamma-SiW10O36)3]18- (M = Zr, Hf).

    Science.gov (United States)

    Bassil, Bassem S; Mal, Sib Sankar; Dickman, Michael H; Kortz, Ulrich; Oelrich, Holger; Walder, Lorenz

    2008-05-28

    We have synthesized and structurally characterized the unprecedented peroxo-zirconium(IV) containing [Zr6(O2)6(OH)6(gamma-SiW10O36)3]18- (1). Polyanion 1 comprises a cyclic 6-peroxo-6-zirconium core stabilized by three decatungstosilicate units. We have also prepared the isostructural hafnium(IV) analogue [Hf6(O2)6(OH)6(gamma-SiW10O36)3]18- (2). We investigated the acid/base and redox properties of 1 by UV-vis spectroscopy and electrochemistry studies. Polyanion 1 represents the first structurally characterized Zr-peroxo POM with side-on, bridging peroxo units. The simple, one-pot synthesis of 1 and 2 involving dropwise addition of aqueous hydrogen peroxide could represent a general procedure for incorporating peroxo groups into a large variety of transition metal and lanthanide containing POMs.

  1. Clinical laboratorial analysis of 168 patients with galactorrhea from different etiologic conditions

    International Nuclear Information System (INIS)

    Pacheco, I.H.F.

    1984-01-01

    This paper evaluated the data of 168 patients with galactorrhea throught factorial analysis. This method consists, initially, of an intercorrelation analysis, which serves as a base for the determination of a number of factors, one of them, which could be described as the patient's risk of having a pituitary tumour. This factor was formed, basically, by four elements: the existence of radiological changes, head pain, menstrual irregularities and the prolactin level. After the global study, the patients were analysed within the etiological subgroups, in several clinical and laboratorial aspects, as menstrual abnormalities, duration of the galactorrhea, prolactin level, dynamic tests to evaluate the prolactin secretion an the pituitary reserve, and by the therapeutic aspect. The results of the tests that measures the prolactin secretion were analysed, also, in terms of it's basal hormonal level, and have shown to be more dependent on them, than on the etiological group. We have compared the surgical, radioactive and bromocriptine treatment of pituitary tumours. There wasn't a satisfactory cure rate in any of them, which reinforces the need of an earlier recognition of these tumours. (author)

  2. Comparison of HfCl{sub 4}, HfI{sub 4}, TEMA-Hf, and TDMA-Hf as precursors in early growing stages of HfO{sub 2} films deposited by ALD: A DFT study

    Energy Technology Data Exchange (ETDEWEB)

    Cortez-Valadez, M. [Departamento de Investigación en Física, Universidad de Sonora, Apdo. Postal 5-88, 83190 Hermosillo, Son. (Mexico); Fierro, C.; Farias-Mancilla, J.R. [Instituto de Ingeniería y Tecnología, Departamento de Física y Matemáticas, Universidad Autónoma de Ciudad Juárez, Av. del Charro 450, Cd. Juárez C.P. 32310, Chihuahua (Mexico); Vargas-Ortiz, A. [Universidad Autónoma de Sinaloa, Facultad de Ingeniería Mochis, Ciudad Universitaria, C.P. 81223 Los Mochis, Sinaloa (Mexico); Flores-Acosta, M. [Departamento de Investigación en Física, Universidad de Sonora, Apdo. Postal 5-88, 83190 Hermosillo, Son. (Mexico); Ramírez-Bon, R. [Centro de Investigación y Estudios Avanzados del IPN, Unidad Querétaro, Apdo. Postal 1-798, 76001 Querétaro, Qro. (Mexico); Enriquez-Carrejo, J.L. [Instituto de Ingeniería y Tecnología, Departamento de Física y Matemáticas, Universidad Autónoma de Ciudad Juárez, Av. del Charro 450, Cd. Juárez C.P. 32310, Chihuahua (Mexico); and others

    2016-06-15

    Highlights: • Hafnium oxide growth on Si(100) by atomic layer deposition was simulated. • The interface structure was considered as silicate and silicide. • The interface was studied employing DFT. • TDMA-Hf precursor show better interface stability. - Abstract: The final structure of HfO{sub 2} films grown by atomic layer deposition (ALD) after reaction with OH{sup −} ions has been analyzed by DFT (density functional theory). The interaction of the precursors: HfCl{sub 4} (hafnium tetrachloride), HfI{sub 4} (hafnium tetraiodide), TEMA-Hf (tetrakis-ethylmethylamino hafnium), and TDMA-Hf (tetrakis-dimethylamino hafnium) with HO–H was studied employing the B3LYP (Becke 3-parameter, Lee–Yang–Parr) hybrid functional and the PBE (Perdew–Burke–Ernzerhof) generalized gradient functional. The structural evolution at the Si(100) surface has been analyzed by LDA (local density approximation). The structural parameters: bond length and bond angle, and the vibrational parameters for the optimized structures are also reported. The presence of hafnium silicate at the interface was detected. The infrared spectra and structural parameters obtained in this work agree with previously reported experimental results.

  3. Corrosion resistant surface for vanadium nitride and hafnium nitride layers as function of grain size

    Science.gov (United States)

    Escobar, C. A.; Caicedo, J. C.; Aperador, W.

    2014-01-01

    In this research it was studied vanadium nitride (VN) and hafnium nitride (HfN) film, which were deposited onto silicon (Si (100)) and AISI 4140 steel substrates via r.f. magnetron sputtering technique in Ar/N2 atmosphere with purity at 99.99% for both V and Hf metallic targets. Both films were approximately 1.2±0.1 μm thick. The crystallography structures that were evaluated via X-ray diffraction analysis (XRD) showed preferential orientations in the Bragg planes VN (200) and HfN (111). The chemical compositions for both films were characterized by EDX. Atomic Force Microscopy (AFM) was used to study the morphology; the results reveal grain sizes of 78±2 nm for VN and 58±2 nm for HfN and roughness values of 4.2±0.1 nm for VN and 1.5±0.1 nm for HfN films. The electrochemical performance in VN and HfN films deposited onto steel 4140 were studied by Tafel polarization curves and impedance spectroscopy methods (EIS) under contact with sodium chloride at 3.5 wt% solution, therefore, it was found that the corrosion rate decreased about 95% in VN and 99% for HfN films in relation to uncoated 4140 steel, thus demonstrating, the protecting effect of VN and HfN films under a corrosive environment as function of morphological characteristics (grain size). VN(grain size)=78±2.0 nm, VN(roughness)=4.2±0.1 nm, VN(corrosion rate)=40.87 μmy. HfN(grain size)=58±2.0 nm, HfN(roughness)=1.5±0.1 nm, HfN(corrosion rate)=0.205 μmy. It was possible to analyze that films with larger grain size, can be observed smaller grain boundary thus generating a higher corrosion rate, therefore, in this work it was found that the HfN layer has better corrosion resistance (low corrosion rate) in relation to VN film which presents a larger grain size, indicating that the low grain boundary in (VN films) does not restrict movement of the Cl- ion and in this way the corrosion rate increases dramatically.

  4. Prostate alpha/beta revisited - an analysis of clinical results from 14 168 patients

    Energy Technology Data Exchange (ETDEWEB)

    Dasu, Alexandru [Dept. of Radiation Physics UHL, County Council of Oestergoetland, Linkoeping (Sweden); Radiation Physics, Dept. of Medical and Health Sciences, Faculty of Health Sciences, Linkoeping Univ., Linkoeping (Sweden); Toma-Dasu, Iuliana [Medical Radiation Physics, Stockholm Univ. and Karolinska Institutet, Stockholm (Sweden)

    2012-11-15

    Purpose. To determine the dose response parameters and the fractionation sensitivity of prostate tumours from clinical results of patients treated with external beam radiotherapy. Material and methods. The study was based on five-year biochemical results from 14 168 patients treated with external beam radiotherapy. Treatment data from 11 330 patients treated with conventional fractionation have been corrected for overall treatment time and fitted with a logit equation. The results have been used to determine the optimum {alpha}/{beta} values that minimise differences in predictions from 2838 patients treated with hypofractionated schedules. Results. Conventional fractionation data yielded logit dose response parameters for all risk groups and for all definitions of biochemical failures. The analysis of hypofractionation data led to very low {alpha}/{beta} values (1-1.7 Gy) in all mentioned cases. Neglecting the correction for overall treatment time has little impact on the derivation of {alpha}/{beta} values for prostate cancers. Conclusions. These results indicate that the high fractionation sensitivity is an intrinsic property of prostate carcinomas and they support the use of hypofractionation to increase the therapeutic gain for these tumours.

  5. Gene activation of heavy ion treated bacillus subtilis 168 endospores during germination involved DNA-repair

    International Nuclear Information System (INIS)

    Moeller, R.; Berger, T.; Reitz, G.; Okayasu, Ryuichi

    2006-01-01

    This research project is aimed at correlating radiation effects induced DNA damage in Bacillus subtilis endospores with the linear energy transfer (LET) of the used radiation by investigating survival and gene activation after irradiation with high-LET particles. During the stationary growth phase Bacillus subtilis change their metabolic active state from the vegetative cells to the metabolic inactive but even more resistant endospores. If spores find optimal conditions, they could germinate and switch to the vegetative growth. With these outgrowth spores can and/or must repair the induced formed DNA damage. During germination spores lose their most resistance. In more detail, DNA repair and mutation induction events investigated will include the survivability, behaviour against specific antibiotics and their germination. DNA repair pattern will be detected during germination by using DNA microarrays, which contain the whole genome of Bacillus subtilis 168. (author)

  6. Technical Note: A simulation study on the feasibility of radiotherapy dose enhancement with calcium tungstate and hafnium oxide nano- and microparticles.

    Science.gov (United States)

    Sherck, Nicholas J; Won, You-Yeon

    2017-12-01

    To assess the radiotherapy dose enhancement (RDE) potential of calcium tungstate (CaWO 4 ) and hafnium oxide (HfO 2 ) nano- and microparticles (NPs). A Monte Carlo simulation study was conducted to gauge their respective RDE potentials relative to that of the broadly studied gold (Au) NP. The study was warranted due to the promising clinical and preclinical studies involving both CaWO 4 and HfO 2 NPs as RDE agents in the treatment of various types of cancers. The study provides a baseline RDE to which future experimental RDE trends can be compared to. All three materials were investigated in silico with the software Penetration and Energy Loss of Positrons and Electrons (PENELOPE 2014) developed by Francesc Salvat and distributed in the United States by the Radiation Safety Information Computational Center (RSICC) at Oak Ridge National Laboratory. The work utilizes the extensively studied Au NP as the "gold standard" for a baseline. The key metric used in the evaluation of the materials was the local dose enhancement factor (DEF loc ). An additional metric used, termed the relative enhancement ratio (RER), evaluates material performance at the same mass concentrations. The results of the study indicate that Au has the strongest RDE potential using the DEF loc metric. HfO 2 and CaWO 4 both underperformed relative to Au with lower DEF loc of 2-3 × and 4-100 ×, respectively. The computational investigation predicts the RDE performance ranking to be: Au > HfO 2 > CaWO 4 . © 2017 American Association of Physicists in Medicine.

  7. Urinary phthalates from 168 girls and boys measured twice a year during a 5-year period

    DEFF Research Database (Denmark)

    Mouritsen, A; Frederiksen, H; Sørensen, K

    2013-01-01

    Background: Little is known about the possible deleterious effects of phthalate exposure on endogenous sex steroid levels in children. Objective: Our objective was to investigate whether urinary phthalate metabolite levels are associated with circulating adrenal androgen levels and age at puberty....... Methods: This was a longitudinal study of 168 healthy children (84 girls) examined every 6 months for 5 years. Serum levels of dehydroepiandrostenedione sulfate (DHEAS), Δ4-androstenedione, testosterone, and urinary morning excretion of 14 phthalate metabolites, corresponding to 7 different phthalate...... diesters were determined. A variation in urinary excretion of phthalates was evident in each child, which made a mean of repetitive samples more representative for long-term excretion than a single determination. Results: We found that girls with excretion of monobutyl phthalate isomers (MBP) and di(2...

  8. Effect of Advanced Plasma Source bias voltage on properties of HfO2 films prepared by plasma ion assisted electron evaporation from metal hafnium

    International Nuclear Information System (INIS)

    Zhu, Meiping; Yi, Kui; Arhilger, Detlef; Qi, Hongji; Shao, Jianda

    2013-01-01

    HfO 2 films, using metal hafnium as starting material, are deposited by plasma-ion assisted electron evaporation with different Advanced Plasma Source (APS) bias voltages. The refractive index and extinction coefficient are calculated, the chemical state and composition, as well as the stress and aging behavior is investigated. Laser induced damage threshold (LIDT) and damage mechanism are also evaluated and discussed. Optical, structural, mechanical and laser induced damage properties of HfO 2 films are found to be sensitive to APS bias voltage. The film stress can be tuned by varying the APS bias voltage. Damage morphologies indicate the LIDT of the HfO 2 films at 1064 nm and 532 nm are dominated by the nodular-defect density in coatings, while the 355 nm LIDT is dominated by the film absorption. HfO 2 films with higher 1064 nm LIDT than samples evaporated from hafnia are achieved with bias voltage of 100 V. - Highlights: • HfO 2 films are evaporated with different Advanced Plasma Source (APS) bias voltages. • Properties of HfO 2 films are sensitive to APS bias voltage. • With a bias voltage of 100 V, HfO 2 coatings without any stress can be achieved. • Higher 1064 nm laser induced damage threshold is achieved at a bias voltage of 100 V

  9. Evaluación sobre la seguridad de la acupuntura en 297.168 punturas.

    Directory of Open Access Journals (Sweden)

    Liliana Hernández Leal

    2014-07-01

    Full Text Available Con el propósito de obtener una casuística propia y de determinar la seguridad de la práctica de la acupuntura en nuestro medio, se realizó el seguimiento de la incidencia de efectos adversos en la consulta particular de un médico acupunturista con amplia experiencia clínica durante un periodo de 72 meses en el que se realizaron 24.707 consultas, encontrándose 260 eventos adversos de 297.168 punturas, con una incidencia de 0.87 por 1.000 y 7 de 2.390 puntos moxados para una incidencia de 2.92 por 1.000. El efecto adverso más frecuente para la acupuntura fue la presentación de equimosis – hematomas con una incidencia de 0.65 por 1.000. Para la moxibustión el único efecto adverso que se presentó fue la quemadura con una incidencia de 2.92 por 1.000. No hubo ningún efecto adverso mayor que requiriera intervención médica. En conclusión se puede considerar que la acupuntura en manos expertas es una práctica médica segura.

  10. Impedance Characterization of the Capacitive field-Effect pH-Sensor Based on a thin-Layer Hafnium Oxide Formed by Atomic Layer Deposition

    Directory of Open Access Journals (Sweden)

    Michael LEE

    2014-05-01

    Full Text Available As a sensing element, silicon dioxide (SiO2 has been applied within ion-sensitive field effect transistors (ISFET. However, a requirement of increasing pH-sensitivity and stability has observed an increased number of insulating materials that obtain high-k gate being applied as FETs. The increased high-k gate reduces the required metal oxide layer and, thus, the fabrication of thin hafnium oxide (HfO2 layers by atomic layer deposition (ALD has grown with interest in recent years. This metal oxide presents advantageous characteristics that can be beneficial for the advancements within miniaturization of complementary metal oxide semiconductor (CMOS technology. In this article, we describe a process for fabrication of HfO2 based on ALD by applying water (H2O as the oxygen precursor. As a first, electrochemical impedance spectroscopy (EIS measurements were performed with varying pH (2-10 to demonstrate the sensitivity of HfO2 as a potential pH sensing material. The Nyquist plot demonstrates a high clear shift of the polarization resistance (Rp between pH 6-10 (R2 = 0.9986, Y = 3,054X + 12,100. At acidic conditions (between pH 2-10, the Rp change was small due to the unmodified oxide gate (R2 = 0.9655, Y = 2,104X + 4,250. These preliminary results demonstrate the HfO2 substrate functioned within basic to neutral conditions and establishes a great potential for applying HfO2 as a dielectric material for future pH measuring FET sensors.

  11. A silicon doped hafnium oxide ferroelectric p–n–p–n SOI tunneling field–effect transistor with steep subthreshold slope and high switching state current ratio

    Directory of Open Access Journals (Sweden)

    Saeid Marjani

    2016-09-01

    Full Text Available In this paper, a silicon–on–insulator (SOI p–n–p–n tunneling field–effect transistor (TFET with a silicon doped hafnium oxide (Si:HfO2 ferroelectric gate stack is proposed and investigated via 2D device simulation with a calibrated nonlocal band–to–band tunneling model. Utilization of Si:HfO2 instead of conventional perovskite ferroelectrics such as lead zirconium titanate (PbZrTiO3 and strontium bismuth tantalate (SrBi2Ta2O9 provides compatibility to the CMOS process as well as improved device scalability. By using Si:HfO2 ferroelectric gate stack, the applied gate voltage is effectively amplified that causes increased electric field at the tunneling junction and reduced tunneling barrier width. Compared with the conventional p–n–p–n SOI TFET, the on–state current and switching state current ratio are appreciably increased; and the average subthreshold slope (SS is effectively reduced. The simulation results of Si:HfO2 ferroelectric p–n–p–n SOI TFET show significant improvement in transconductance (∼9.8X enhancement at high overdrive voltage and average subthreshold slope (∼35% enhancement over nine decades of drain current at room temperature, indicating that this device is a promising candidate to strengthen the performance of p–n–p–n and conventional TFET for a switching performance.

  12. Secondhand smoke exposure among never-smoking youth in 168 countries.

    Science.gov (United States)

    Veeranki, Sreenivas P; Mamudu, Hadii M; Zheng, Shimin; John, Rijo M; Cao, Yan; Kioko, David; Anderson, James; Ouma, Ahmed E O

    2015-02-01

    To estimate the prevalence of secondhand smoke (SHS) exposure among never-smoking adolescents and identify key factors associated with such exposure. Data were obtained from nationally representative Global Youth Tobacco Surveys conducted in 168 countries during 1999-2008. SHS exposure was ascertained in relation to the location-exposure inside home, outside home, and both inside and outside home, respectively. Independent variables included parental and/or peer smoking, knowledge about smoke harm, attitudes toward smoking ban, age, sex, and World Health Organization region. Simple and multiple logistic regression analyses were conducted. Of 356,414 never-smoking adolescents included in the study, 30.4%, 44.2%, and 23.2% were exposed to SHS inside home, outside home, and both, respectively. Parental smoking, peer smoking, knowledge about smoke harm, and positive attitudes toward smoke ban were significantly associated with increased odds of SHS exposure. Approximately 14% of adolescents had both smoking parents and peers. Compared with never-smoking adolescents who did not have both smoking parents and peers, those who had both smoking parents and peers had 19 (adjusted odds ratio [aOR], 19.0; 95% confidence interval [CI], 16.86-21.41), eight (aOR, 7.71; 95% CI, 7.05-8.43), and 23 times (aOR, 23.16; 95% CI, 20.74-25.87) higher odds of exposure to SHS inside, outside, and both inside and outcome home, respectively. Approximately one third and two fifths of never-smoking adolescents were exposed to SHS inside or outside home, and smoking parents and/or peers are the key factors. Study findings highlight the need to develop and implement comprehensive smoke-free policies consistent with the World Health Organization Framework Convention on Tobacco Control. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  13. Synergistic effect of carbon nanotube as sintering aid and toughening agent in spark plasma sintered molybdenum disilicide-hafnium carbide composite

    Energy Technology Data Exchange (ETDEWEB)

    Mukherjee, Biswajyoti; Asiq Rahman, O.S.; Sribalaji, M [Materials Science and Engineering, Indian Institute of Technology Patna, Bihta Kanpa Road, Bihta, Patna, Bihar 801103 (India); Bakshi, Srinivasa Rao [Department of Metallurgical and Materials Engineering, Indian Institute of Technology Madras, Chennai 600036 (India); Keshri, Anup Kumar, E-mail: anup@iitp.ac.in [Materials Science and Engineering, Indian Institute of Technology Patna, Bihta Kanpa Road, Bihta, Patna, Bihar 801103 (India)

    2016-12-15

    Hafnium carbide (HfC) along with sintering aids was consolidated at a relatively lower temperature i.e. 1600 °C (i.e. T=~0.41 T{sub m}) under a uniaxial load of 50 MPa by spark plasma sintering. Two different sintering aids such as molybdenum disilicide (MoSi{sub 2}) and carbon nanotube (CNT) were added to enhance the densification and lower the extent of grain growth in the sintered pellets. Density of the sintered pellet increased from 96.0±0.8% in HfC +5 wt% MoSi{sub 2} (HM) to 99.0±0.5% with the addition of 2 wt% CNT in HfC+5 wt% MoSi{sub 2} (HMC) at sintering temperature of 1600 °C. Further, the extent of grain growth drastically reduced from 204% in HM to 50% in HMC. Analysis of linear shrinkage during densification revealed that CNT addition increased densification rate and decreased the time required to reach the density of 99.0±0.5% at 1600 °C. Increased densification and lower degree of grain growth could be due to the synergistic effect offered by the CNT, which are as follows: (i) Lubrication effect of CNT, (ii) Lower activation energy for grain boundary diffusion (iii) Reduction in liquid phase sintering temperature and (iv) Grain boundary pinning. Fracture toughness of the sintered HM and HMC composite was obtained using indentation technique. By the addition of 2 wt% CNT in HM, drastic increase of 91% in fracture toughness was seen. This significant improvement in fracture toughness was due to the enhanced densification and relatively lower grain size of HMC. Also crack bridging, crack deflection, crack arrest, CNT and graphene sheet pull-out and swording played major role in toughening of HMC pellet.

  14. X-ray tube targets

    International Nuclear Information System (INIS)

    Hirsch, H.H.

    1980-01-01

    In rotary targets for X-ray tubes warping is a problem which causes X-ray deficiency. A rotary target is described in which warping is reduced by using alloys of molybdenum with 0.05 to 10% iron, silicon, cobalt, tantalum, niobium, hafnium, stable metal oxide or mixture thereof. Suitable mixtures are 0.5 to 10% of tantalum, niobium or hafnium with from 0.5 to 5% yttrium oxide, or 0.05 to 0.3% of cobalt or silicon. Optionally 0.1 to 5% by weight of additional material may be alloyed with the molybdenum, such as tantalum or hafnium carbides. (author)

  15. Spectrum fluctuations from regular and damped rotational structures in {sup 16}`8Yb and {sup 163}Tm nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Herskind, B; Dossing, T; Ninel, N; Atac, A; Jensen, H J; Hagemann, G B; Lieder, R M; Maj, A; Nyberg, J; Piiparinen, M; Sugawara, M; Virtanen, A [Niels Bohr Inst., Copenhagen (Denmark); Leoni, S; Vigezzi, E; Bosetti, P; Bracco, A; Broglia, R A; Million, B [Milan Univ. (Italy); Matsuo, M [Kyoto Univ., Uji (Japan). Uji Research Center of Yukawa Inst. for Theoretical Physics; Bergstrom, M; Brockstedt, A; Carlsson, H; Ekstrom, P; Nordlund, A; Ryde, H [Lund Univ. (Sweden). Dept. of Physics; Jongman, J [Rijksuniversiteit Groningen (Netherlands). Kernfysisch Versneller Inst.; Ingebretsen, F; Tjom, P O [Oslo Univ. (Norway); Lonnroth, T [Aabo Akademi, Turku (Finland). Dept. of Physics

    1992-08-01

    A new method has been developed for analyzing fluctuations of count in two-dimensional gamma ray energy coincidence spectra of deformed nuclei formed in heavy ion fusion reactions. Most of the gamma decay cascades flow through regions of high level density, and the method is based upon assumptions about average properties of the excited states. Transition energies along discrete rotational bands are viewed as randomly selected from a continuous distribution of rotational frequencies and moments of inertia. For damped rotational motion, implying a mixing of the rotational bands, a random matrix model is assumed, leading to smooth energy spectra, and strong fluctuations of the transition strengths. The method is illustrated for {sup 168}Yb and {sup 163}Tm. 4 refs., 4 figs.

  16. 40 CFR 421.332 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... times. (d) SiCl4 purification wet air pollution control. BPT Limitations for the Primary Zirconium and...) Sand drying wet air pollution control. BPT Limitations for the Primary Zirconium and Hafnium... chlorination off-gas wet air pollution control. BPT Limitations for the Primary Zirconium and Hafnium...

  17. Application of the RPA method based on the cranked Hartree-Fock-Bogolyubov model in 168Er and 158Dy

    International Nuclear Information System (INIS)

    Kvasil, J.; Khariev, M.M.; Cwiok, S.; Mikhajlov, I.N.; Khoriev, B.

    1984-01-01

    The Random Phase Approximation (RPA) based on the Cranked Hartree-Fock-Bogolyubov (CHFB) model is used for the study of low-lying nuclear states near the yrast line in 158 Dy and 168 Er. The relation of the spurious unphysical states connected with the nucleus centre of mass rotational motion to the solutions of RPA equations of motion is cleared up. The calculated level energies and reduced probabilities B(E2) are compared with experimental ones. The dependence of the residual interaction strength constants and the nucleus moment of inertia on the angular momentum is discussed. The experimental characteristics of low-lying states up to approx. 2 MeV are reproduced by the CHFB+RPA model. (author)

  18. Electrochemical-metallothermic reduction of zirconium in molten salt solutions

    International Nuclear Information System (INIS)

    McLaughlin, D.F.; Talko, F.

    1990-01-01

    This patent describes a method for separating hafnium from zirconium of the type wherein a feed containing zirconium and hafnium chlorides is prepared from zirconium-hafnium chloride and the feed is introduced into a distillation column, which distillation column has a reboiler connected at the bottom and a reflux condenser connected at the top and wherein a hafnium chloride enriched stream is taken from the top of the column and a zirconium enriched chloride stream is taken from the bottom of the column. It comprises: reducing the zirconium enriched chloride stream taken from the distillation column to metal by electrochemically reducing an alkaline earth metal in a molten salt bath with the molten salt in the molten salt bath consisting essentially of a mixture of at least one alkali metal chloride and at least one alkaline earth metal chloride and zirconium chloride, with the reduced alkaline earth metal reacting with the zirconium chloride to produce zirconium metal and alkaline earth metal chloride

  19. Determination of hafnium at the 10−4% level (relative to zirconium content) using neutron activation analysis, inductively coupled plasma mass spectrometry and inductively coupled plasma atomic emission spectrometry

    International Nuclear Information System (INIS)

    Smolik, Marek; Polkowska-Motrenko, Halina; Hubicki, Zbigniew; Jakóbik-Kolon, Agata; Danko, Bożena

    2014-01-01

    Graphical abstract: -- Highlights: •We worked out ICP-MS method of Hf determination in Zr and Zr compounds. •We used NAA method as reference one. •We obtained pure zirconium matrix by ion exchange (Diphonix ® resin). •These permit to determine ≥1 × 10 −4 % Hf in Zr sample by ICP MS with good precision and accuracy. -- Abstract: Hafnium at the very low level of 1–8 ppm (in relation to zirconium) was determined in zirconium sulfate solutions (originating from investigations of the separation of ca. 44 ppm Hf from zirconium by means of the ion exchange method) by using three independent methods: inductively coupled plasma mass spectrometry (ICP MS), neutron activation analysis (NAA) and inductively coupled plasma atomic emission spectrometry (ICP-AES). The results of NAA and ICP MS determinations were consistent with each other across the entire investigated range (the RSD of both methods did not exceed 38%). The results of ICP-AES determination were more diverse, particularly at less than 5 ppm Hf (RSD was significantly higher: 29–253%). The ion exchange method exploiting Diphonix ® resin proved sufficient efficiency in Zr–Hf separation when the initial concentration ratio of the elements ([Zr] 0 /[Hf] 0 ) ranged from 1200 to ca. 143,000

  20. Heterologous expression and characterization of a new heme-catalase in Bacillus subtilis 168.

    Science.gov (United States)

    Philibert, Tuyishime; Rao, Zhiming; Yang, Taowei; Zhou, Junping; Huang, Genshu; Irene, Komera; Samuel, Niyomukiza

    2016-06-01

    Reactive oxygen species (ROS) is an inherent consequence to all aerobically living organisms that might lead to the cells being lethal and susceptible to oxidative stress. Bacillus pumilus is characterized by high-resistance oxidative stress that stimulated our interest to investigate the heterologous expression and characterization of heme-catalase as potential biocatalyst. Results indicated that recombinant enzyme significantly exhibited the high catalytic activity of 55,784 U/mg expressed in Bacillus subtilis 168 and 98.097 µmol/min/mg peroxidatic activity, the apparent K m of catalytic activity was 59.6 ± 13 mM with higher turnover rate (K cat = 322.651 × 10(3) s(-1)). The pH dependence of catalatic and peroxidatic activity was pH 7.0 and pH 4.5 respectively with temperature dependence of 40 °C and the recombinant heme-catalase exhibited a strong Fe(2+) preference. It was further revealed that catalase KatX2 improved the resistance oxidative stress of B. subtilis. These findings suggest that this B. pumilus heme-catalase can be considered among the industrially relevant biocatalysts due to its exceptional catalytic rate and high stability and it can be a potential candidate for the improvement of oxidative resistance of industrially produced strains.

  1. Perturbed angular correlation

    International Nuclear Information System (INIS)

    Fabris, J.D.

    1977-01-01

    The electric quadrupolar interaction in some hafnium complexes, measured at the metal nucleus level is studied. For that purpose, the technique of γ-γ perturbed angular correlation is used: the frequencies of quadrupolar interaction are compared with some hafnium α-hydroxicarboxilates, namely glycolate, lactate, mandelate and benzylate; the influence of the temperature on the quadrupolar coupling on the hafnium tetramandelate is studied; finally, the effects associated with the capture of thermal neutrons by hafnium tetramandelate are examined locally at the nuclear level. The first group of results shows significant differences in a series of complexes derived from glycolic acid. On the other hand, the substitution of the protons in hafnium tetramandelate structure by some alkaline cations permits to verify a correlation between the variations in the quadrupolar coupling and the electronegativities of the substituent elements. Measurements at high temperatures show that this complex is thermally stable at 100 and 150 0 C. It is possible to see the appearance of two distinct sites for the probe nucleus, after heating the sample at 100 0 C for prolonged time. This fact is attributed to a probable interconversion among the postulated structural isomers for the octacoordinated compounds. Finally, measurements of angular correlation on the irradiated complex show that there is an effective destruction of the target molecule by neutron capture [pt

  2. The nuclear catastrophe of Chernobyl as experienced by 168 male and female probands of various age groups

    International Nuclear Information System (INIS)

    Janke, W.; Hueppe, M.

    1987-01-01

    A collective of 168 persons aged 18 to 59 were studied to assess the impact of the Chernobyl reactor accident on how they experience, and react to, incidents. Four groups were made up of 42 persons each (male/female; 18-39-year-olds/40-59-year-olds). As variables, the instantaneous psychic condition as a reaction to the accident, and strategies to cope with stress were studied by psychometric methods. Furthermore a questionnaire on attitudes and behaviour, specially drawn up for the study, was used, whose reliability was confirmed by analyses of the individual items. The Chernobyl nuclear accident, it is found, was felt to be a grave incident and led to a number of reactions in the attitudes and views of people. The very different response of the age and sex groups is considered to be the result of the highest significance. (orig./MG) [de

  3. Use of the on-line Moessbauer effect as a contribution to the study of recoil defects in solids

    International Nuclear Information System (INIS)

    Jeandey, Christian

    1974-01-01

    This research thesis addresses the study of effects of nuclear reactions, also known as 'after-effects' such as atomic disorders resulted from atom recoil, but also possible chemical modifications. The author more particularly focuses of recoil defects. He reports a critical review of studies of structure defects (in pure metals, ordered alloys, ionic crystals) performed by using conventional resonance absorption, and then presents an analysis of results of the defect creation dynamics as it had been proposed by other authors. He also proposes an overview of the evolution and disappearance of defects during thermal treatments. After a review of experiments based on the on-line Moessbauer effect, the author reports the study of recoil effects in pure metals (iron, hafnium), in alloys (Fe 1-x Al x , FeGe 2 , cubic, monoclinic and hexagonal FeGe), and in organic complexes (ferrous oxalate, different types of hafnium chelate, hafnium oxide). He finally discusses the electronic properties of different types of iron and hafnium chelate in solid phase [fr

  4. Grindability of cast Ti-Hf alloys.

    Science.gov (United States)

    Kikuchi, Masafumi; Takahashi, Masatoshi; Sato, Hideki; Okuno, Osamu; Nunn, Martha E; Okabe, Toru

    2006-04-01

    As part of our systematic studies characterizing the properties of titanium alloys, we investigated the grindability of a series of cast Ti-Hf alloys. Alloy buttons with hafnium concentrations up to 40 mass% were made using an argon-arc melting furnace. Each button was cast into a magnesia-based mold using a dental titanium casting machine; three specimens were made for each metal. Prior to testing, the hardened surface layer was removed. The specimens were ground at five different speeds for 1 min at 0.98 N using a carborundum wheel on an electric dental handpiece. Grindability was evaluated as the volume of metal removed per minute (grinding rate) and the volume ratio of metal removed compared to the wheel material lost (grinding ratio). The data were analyzed using ANOVA. A trend of increasing grindability was found with increasing amounts of hafnium, although there was no statistical difference in the grindability with increasing hafnium contents. We also found that hafnium may be used to harden or strengthen titanium without deteriorating the grindability.

  5. Heat-sensitive lysis mutants of Bacillus subtilis 168 blocked at three different stages of peptidoglycan synthesis.

    Science.gov (United States)

    Buxton, R S; Ward, J B

    1980-10-01

    Three heat-sensitive mutants of Bacillus subtilis 168, which lysed at the non-permissive temperature, have been shown under these conditions to be defective in the synthesis of peptidoglycan. This was caused by lesions in three different stages of peptidoglycan synthesis.In one mutant (ddl), D-alanine: D-alanine ligase was defective, leading to the accumulation of UDP-MurAc-L-Ala-D-Glu-meso-A,pm ; the ddl mutation was closely linked(87 yo cotransducible) with dal, specifying alanine racemase. In a second mutant (dapE),the lesion was in N-acetyl-L-diaminopimelate deacylase, resulting in UDP-MurAc-L-Ala-D-Glu being accumulated, whilst in a third mutant (ptg-1435), UDP-MurAc-L-Ala-D-Glumeso-A,pm-D-Ala-D-Ala was the peptidoglycan precursor accumulated although the enzyme defect has not been ascertained. Both dapE and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible with pyr(AD).

  6. Basaltic magmatism at the Juan de Fuca Ridge, NE Pacific ocean (ODP Leg 168): geological control on chemical zonation

    Science.gov (United States)

    Cortesogno, L.; Gaggero, L.; Marescotti, P.

    2003-04-01

    Basalts, from around 0.8 to 3.5 Ma in age, were recovered during Leg 168 from nine sites (Sites 1023-1029 and 1031-1032), drilled across the eastern flank of the Juan de Fuca Ridge (JdFR). The sites are located from about 20 km to roughly 100 km east of the ridge axis and were subdivided into the Hydrothermal Transition (HT, Sites 1023-1025), Buried Basement (BB, Sites 1028-1031), and Rough Basement (RB, Sites 1026 and 1027) transects, described in the Leg 168 Initial Reports (Davis, Fisher, Firth, et al., 1997). The igneous rocks mainly consists of aphyric to moderately phyric pillow basalt (Sites 1023-1029 and 1031-1032), subordinate aphyric massive basalt (Site 1025), basalt-hyaloclastite breccia (Site 1026), and fine- to medium-grained diabase (Site 1027). On the whole, samples are weakly altered: the alteration style and intensity vary systematically from Site to Site being related to several factors, including the ageing of the igneous crust, the increase of temperatures from younger to older Sites (from 15.5 ^oC at the youngest 1023 Site to 62.8^oC at the oldest 1027 Site), the local and regional variations in lithology and primary porosity, and the degree of fracturing. Over 90 samples of basalts representative of the nine Sites were studied for mineralogy and petrography; 30 selected samples, representative of the igneous chemistry were analyzed for major, minor, trace and rare earth elements by XRF, ICP, ICP-MS, and INAA. An overall MORB high-Ti tholeiitic affinity arises from the Ti - LaN/SmN, Ti/Cr-Ni, Cr - Y diagrams. The sequence ranges from very primitive (Sites 1023, 1027: Mg# ≈ 70, Zr ≈ 60 ppm) to highly evolved Fe-basaltic compositions (Mg# up to 46). The FMM-normalized patterns of the most primitive compositions compared with the melting models for major oceans (Pearce & Parkinson, 1993) evidence a good analogy with magmas from 10-15% partial melting of a Fertile MORB Mantle source. The progressive decrease of compatible elements and the

  7. Twin radio relics in the nearby low-mass galaxy cluster Abell 168

    Science.gov (United States)

    Dwarakanath, K. S.; Parekh, V.; Kale, R.; George, L. T.

    2018-06-01

    We report the discovery of twin radio relics in the outskirts of the low-mass merging galaxy cluster Abell 168 (redshift=0.045). One of the relics is elongated with a linear extent ˜800 kpc and projected width of ˜80 kpc and is located ˜900 kpc towards the north of the cluster centre, oriented roughly perpendicular to the major axis of the X-ray emission. The second relic is ring-shaped with a size ˜220 kpc and is located near the inner edge of the elongated relic at a distance of ˜600 kpc from the cluster centre. These radio sources were imaged at 323 and 608 MHz with the Giant Meterwave Radio Telescope and at 1520 MHz with the Karl G. Jansky Very Large Array (VLA). The elongated relic was detected at all frequencies, with a radio power of 1.38 ± 0.14 × 1023 W Hz-1 at 1.4 GHz and a power law in the frequency range 70-1500 MHz (S ∝ να, α = -1.1 ± 0.04). This radio power is in good agreement with that expected from the known empirical relation between the radio powers of relics and host cluster masses. This is the lowest mass (M500 = 1.24 × 1014 M⊙) cluster in which relics due to merger shocks are detected. The ring-shaped relic has a steeper spectral index (α) of -1.74 ± 0.29 in the frequency range 100-600 MHz. We propose this relic to be an old plasma, revived due to adiabatic compression by the outgoing shock that produced the elongated relic.

  8. Radioisotopic heat source

    Science.gov (United States)

    Jones, G.J.; Selle, J.E.; Teaney, P.E.

    1975-09-30

    Disclosed is a radioisotopic heat source and method for a long life electrical generator. The source includes plutonium dioxide shards and yttrium or hafnium in a container of tantalum-tungsten-hafnium alloy, all being in a nickel alloy outer container, and subjected to heat treatment of from about 1570$sup 0$F to about 1720$sup 0$F for about one h. (auth)

  9. High-spin nuclear target of 178m2Hf: creation and nuclear reaction studies

    International Nuclear Information System (INIS)

    Oganessyan, Yu.Ts.; Karamyan, S.A.; Gangrskij, Yu.P.

    1993-01-01

    A long-lived (31 years) four-quasiparticle isomer 178m 2 Hf(I,K π =16,16 + ) was produced in microweight quantities using the nuclear reaction 176 Yb( 4 He, 2n). Methods of precision chemistry and mass-separation for the purification of the produced Hf material have been developed. Thin targets of isomeric hafnium-178 on carbon backings were prepared and used in experiments on a neutron, proton and deuteron beams. First results on nuclear reactions on a high-spin exotic target were obtained. Experiments on electromagnetic interactions of the isomeric hafnium using methods of the collinear laser spectroscopy as well as of the nuclear orientation of hafnium implanted into a crystalline media were started. 11 refs.; 11 figs.; 2 tabs

  10. New type of colour reactions of o,o'-dihydroxyazo compounds

    International Nuclear Information System (INIS)

    Dedkov, Yu.M.; Podvigina, T.I.

    1977-01-01

    It is shown that in the system: zirconium (hafnium)-picramine-epsilon (PE)-ethylrhodamine S (ERS), a heteroligand complex is formed, with an excess of the organic reagents, having the following ratio of components: Zr(Hf):PE:ERS=1:2:5. The molecules of ERS substitute the protons of free OH groups in binary complexes of zirconium (hafnium) with PE, while the excess molecules of ERS are added associatively. The resulting complex is floated off, the flotation product is dissolved in acetone, and its optical density is measured. The true molar extinction coefficient of the complex is equal to 6x10 5 , while the apparent one equals 3.2x10 5 . It is possible to determine submicroamounts of zirconium (hafnium) with preminary Ti and Nb masking

  11. Evolution of E 2 transition strength in deformed hafnium isotopes from new measurements on 172Hf,174Hf, and 176Hf

    Science.gov (United States)

    Rudigier, M.; Nomura, K.; Dannhoff, M.; Gerst, R.-B.; Jolie, J.; Saed-Samii, N.; Stegemann, S.; Régis, J.-M.; Robledo, L. M.; Rodríguez-Guzmán, R.; Blazhev, A.; Fransen, Ch.; Warr, N.; Zell, K. O.

    2015-04-01

    Background: The available data for E 2 transition strengths in the region between neutron-deficient hafnium and platinum isotopes are far from complete. More and precise data are needed to enhance the picture of structure evolution in this region and to test state-of-the-art nuclear models. In a simple model, the maximum collectivity is expected at the middle of the major shell. However, for actual nuclei, particularly in heavy-mass regions, which should be highly complex, this picture may no longer be the case, and one should use a more realistic nuclear-structure model. We address this point by studying the spectroscopy of Hf as a representative case. Purpose: We remeasure the 21+ half-lives of 172,174,176Hf, for which there is some disagreement in the literature. The main goal is to measure, for the first time, the half-lives of higher-lying states of the rotational band. The new results are compared to a theoretical calculation for absolute transition strengths. Method: The half-lives were measured using γ -γ and conversion-electron-γ delayed coincidences with the fast timing method. For the determination of half-lives in the picosecond region, the generalized centroid difference method was applied. For the theoretical calculation of the spectroscopic properties, the interacting boson model is employed, whose Hamiltonian is determined based on microscopic energy-density functional calculations. Results: The measured 21+ half-lives disagree with results from earlier γ -γ fast timing measurements, but are in agreement with data from Coulomb excitation experiments and other methods. Half-lives of the 41+ and 61+ states were measured, as well as a lower limit for the 81+ states. Conclusions: This work shows the importance of a mass-dependent effective boson charge in the interacting boson model for the description of E 2 transition rates in chains of nuclei. It encourages further studies of the microscopic origin of this mass dependence. New experimental

  12. Ceramic material suitable for repair of a space vehicle component in a microgravity and vacuum environment, method of making same, and method of repairing a space vehicle component

    Science.gov (United States)

    Riedell, James A. (Inventor); Easler, Timothy E. (Inventor)

    2009-01-01

    A precursor of a ceramic adhesive suitable for use in a vacuum, thermal, and microgravity environment. The precursor of the ceramic adhesive includes a silicon-based, preceramic polymer and at least one ceramic powder selected from the group consisting of aluminum oxide, aluminum nitride, boron carbide, boron oxide, boron nitride, hafnium boride, hafnium carbide, hafnium oxide, lithium aluminate, molybdenum silicide, niobium carbide, niobium nitride, silicon boride, silicon carbide, silicon oxide, silicon nitride, tin oxide, tantalum boride, tantalum carbide, tantalum oxide, tantalum nitride, titanium boride, titanium carbide, titanium oxide, titanium nitride, yttrium oxide, zirconium diboride, zirconium carbide, zirconium oxide, and zirconium silicate. Methods of forming the ceramic adhesive and of repairing a substrate in a vacuum and microgravity environment are also disclosed, as is a substrate repaired with the ceramic adhesive.

  13. Substitutions at NS3 Residue 155, 156, or 168 of Hepatitis C Virus Genotypes 2 to 6 Induce Complex Patterns of Protease Inhibitor Resistance

    DEFF Research Database (Denmark)

    Jensen, Sanne B.; Serre, Stephanie B. N.; Humes, Daryl G.

    2015-01-01

    to nine PIs (telaprevir, boceprevir, simeprevir, asunaprevir, vaniprevir, faldaprevir, paritaprevir, deldeprevir, and grazoprevir) in Huh7.5 cells. We found that most variants showed decreased fitness compared to original viruses. Overall, R155K-, A156G/S-, and D/Q168A/E/H/N/V-variants showed highest...... resistant. For the remaining PIs, most genotype 2-, 4-, 5-, and 6-, but not genotype 3-variants, showed varying resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants.This is the first comprehensive study revealing the impact of described key PI...

  14. Measurements of the 169Tm(n,2n)168Tm cross section between 9.0 and 17.5 MeV

    Science.gov (United States)

    Soter, J.; Bhike, Megha; Krishichayan, Fnu; Finch, S. W.; Tornow, W.

    2016-09-01

    Measurements of the 169Tm(n,2n)168Tm cross section have been performed in 0.5 MeV intervals for neutron energies ranging from 9.0 MeV to 17.5 MeV in order to resolve discrepancies in the current literature data. The neutron activation technique was used with 90Zr and 197Au as monitor foils. After irradiation, de-excitation gamma rays were recorded off-line with High-Purity Germanium (HPGE) detectors in TUNL's Low-Background Counting Facility. In addition, data for the 169Tm(n,3n)167Tm reaction have also been obtained from 15.5 MeV to 17.5 MeV. The results of these measurements provide the basis for investigating properties of the interial confinement fusion plasma in deuterium-tritium (DT) capsules at the National Ignition Facility located at Lawrence Livermore National Laboratory.

  15. Corrective Action Decision Document for Corrective Action Unit 168: Area 25 and 26 Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada, Rev. No.: 2 with Errata Sheet

    Energy Technology Data Exchange (ETDEWEB)

    Wickline, Alfred

    2006-12-01

    This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada. The purpose of this Corrective Action Decision Document is to identify and provide a rationale for the selection of a recommended corrective action alternative for each corrective action site (CAS) within CAU 168. The corrective action investigation (CAI) was conducted in accordance with the ''Corrective Action Investigation Plan for Corrective Action Unit 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada'', as developed under the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 168 is located in Areas 25 and 26 of the Nevada Test Site, Nevada and is comprised of the following 12 CASs: CAS 25-16-01, Construction Waste Pile; CAS 25-16-03, MX Construction Landfill; CAS 25-19-02, Waste Disposal Site; CAS 25-23-02, Radioactive Storage RR Cars; CAS 25-23-13, ETL - Lab Radioactive Contamination; CAS 25-23-18, Radioactive Material Storage; CAS 25-34-01, NRDS Contaminated Bunker; CAS 25-34-02, NRDS Contaminated Bunker; CAS 25-99-16, USW G3; CAS 26-08-01, Waste Dump/Burn Pit; CAS 26-17-01, Pluto Waste Holding Area; and CAS 26-19-02, Contaminated Waste Dump No.2. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) to determine contaminants of concern (COCs) for CASs within CAU 168. Radiological measurements of railroad cars and test equipment were compared to unrestricted (free) release criteria. Assessment of the data generated from the CAI activities revealed the following: (1) Corrective Action Site 25-16-01 contains hydrocarbon-contaminated soil at concentrations exceeding the PAL. The contamination is at discrete locations associated with asphalt debris. (2) No COCs were identified at CAS 25-16-03. Buried construction waste is present in at least two

  16. Proton and O sup(2-) ion diffusion studied by γ-γ angular correlation and by impedance spectroscopy

    International Nuclear Information System (INIS)

    Oliveira Damasceno, O. de.

    1988-01-01

    The interaction of sup(181) Ta quadrupole momentum with electric field gradient was measured by perturbed angular correlation spectroscopy in polycrystalline samples of hafnium hydride and hafnium oxide. The measurements were done as function of the temperature, in cubic and tetragonal phases of hafnium hydride. In the cubic phase, spin relaxation effects related to proton diffusion with activation energy of 0.43 ± 0.05eV were observed, and in the tetragonal phase, the interaction was purely static. The hafnium oxide was studied in cubic phase stabilized by addition of calcium oxide or magnesium oxide. Relaxation effects probably due to O sup(2-) ion diffusion were verified. The protonic conduction in K H sub(2) PO sub(4) was studied by impedance spectroscopy, in pellets prepared by melting or powder compression using silver and platinum electrodes. In the case of silver electrodes, in the low frequency region, the impedance spectrum tends to a 45 sup(0) typical line of the diffusion process. It was attributed to hydrogen injection in the electrode. Heating k H sub(2) PO sub(4) at about 230 sup(0)C modifies significantly the electric properties. Two relaxation annealing reduced conductivities to constant values independently of preparation method. (author)

  17. Lowering the environmental impact of high-kappa/ metal gate stack surface preparation processes

    Science.gov (United States)

    Zamani, Davoud

    ABSTRACT Hafnium based oxides and silicates are promising high-κ dielectrics to replace SiO2 as gate material for state-of-the-art semiconductor devices. However, integrating these new high-κ materials into the existing complementary metal-oxide semiconductor (CMOS) process remains a challenge. One particular area of concern is the use of large amounts of HF during wet etching of hafnium based oxides and silicates. The patterning of thin films of these materials is accomplished by wet etching in HF solutions. The use of HF allows dissolution of hafnium as an anionic fluoride complex. Etch selectivity with respect to SiO2 is achieved by appropriately diluting the solutions and using slightly elevated temperatures. From an ESH point of view, it would be beneficial to develop methods which would lower the use of HF. The first objective of this study is to find new chemistries and developments of new wet etch methods to reduce fluoride consumption during wet etching of hafnium based high-κ materials. Another related issue with major environmental impact is the usage of large amounts of rinsing water for removal of HF in post-etch cleaning step. Both of these require a better understanding of the HF interaction with the high-κ surface during the etching, cleaning, and rinsing processes. During the rinse, the cleaning chemical is removed from the wafers. Ensuring optimal resource usage and cycle time during the rinse requires a sound understanding and quantitative description of the transport effects that dominate the removal rate of the cleaning chemicals from the surfaces. Multiple processes, such as desorption and re-adsorption, diffusion, migration and convection, all factor into the removal rate of the cleaning chemical during the rinse. Any of these processes can be the removal rate limiting process, the bottleneck of the rinse. In fact, the process limiting the removal rate generally changes as the rinse progresses, offering the opportunity to save resources

  18. Malignant transformation of a rat fibroma by the treatment with an anti-fibrosing drug: CY-168F (Plastenan

    Directory of Open Access Journals (Sweden)

    Sonia G. Andrade

    1981-09-01

    Full Text Available Fifteen albino (Sprague Dawley rats with subcutaneous transplanted fibromas was used in the present study. The tumour was formed by typical fibroblasts in a dense collagen matrix and was provenient from a fibroma that appeared spontaneously in an albino rat of the same strain. Ultrastructurally collagen disclosed normal periodicity and the fibroblasts showed irregular notched nuclei with irregular distribution of chromatin, that suggests transitional aspects to fibrosarcoma. The 15 animals, from different passage groups, were divided into: 8 animals submitted to treatment with the drug acexamic acid (CY-168F - N acetyl-amino-6-hexanoic acid (plastenan and 7 untreated control animals. Three of the treated animals showed a malignant transformation to fibrosarcoma. transitional histological features from typical fibroma to highly indifferentiated fibrosarcoma could be detected in come animal subjected to repeated biopsies. Ultrastructural study disclosed nuclear alterations and hyperactive ergastoplasm and collagen containing inclusions into the cytoplasm of fibroblasts. In the group of 7 untreated naimals, no malignant transformation could be detected histologically. Two aspects deserve attention: the malignant potential of a typical fibroma and the apparent effect of an antifibrosing drug in inducing malignization of this tumour.Foram utilizados no presente estudo, quinze ratos albinos (Sprague Dawley portadores de fibronas transplantados no tecido subcutâneo da parede abdominal. O tumor era constituído por fibroblastos típicos, em uma densa matriz colagênica e eram provenientes de um fibroma que apareceu espontaneamente em um rato albino da mesma linhagem. Ultraestruturalmente o colágeno mostrava periodicidade normal e os fibroblastos mostravam núcleo irregularmente denteado, com cromatina irregularmente distribuída, sugerindo aspectos transicionais para um fibrossarcoma. Os quinze animais, de diferentes grupos de passagem do tumor, foram

  19. Solvent extraction columns

    International Nuclear Information System (INIS)

    Middleton, P.; Smith, J.R.

    1979-01-01

    In pulsed columns for use in solvent extraction processes, e.g. the reprocessing of nuclear fuel, the horizontal perforated plates inside the column are separated by interplate spacers manufactured from metallic neutron absorbing material. The spacer may be in the form of a spiral or concentric circles separated by radial limbs, or may be of egg-box construction. Suitable neutron absorbing materials include stainless steel containing boron or gadolinium, hafnium metal or alloys of hafnium. (UK)

  20. RETRACTED: Granular and intergranular conduction in La1.32Sr1.68Mn2O7 layered manganite system

    International Nuclear Information System (INIS)

    Narjis, A.; El kaaouachi, A.; Dlimi, S.; Biskupski, G.; Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L.

    2013-01-01

    This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process

  1. Cobalt catalysts for the conversion of methanol and for Fischer-tropsch synthesis to produce hydrocarbons

    International Nuclear Information System (INIS)

    Mauldin, C.H.; Davis, S.M.; Arcuri, K.B.

    1987-01-01

    A regeneration stable catalyst is described for the conversion at reaction conditions of methanol or synthesis gas to liquid hydrocarbons which consists essentially of from about 2 percent to about 25 percent cobalt, based on the weight of the catalyst composition, composited with titania, or a titania-containing support, to which is added sufficient of a zirconium, hafnium, cerium, or uranium promoter to provide a weight ratio of the zirconium, hafnium, cerium, or uranium metal:cobalt greater than about 0.101:1

  2. Application of energy-dispersive XRF technique in the hydrometallurgy study of local zircon

    International Nuclear Information System (INIS)

    Meor Yusoff Sulaiman; Kamaruddin Hussin; Azizan Aziz

    1996-01-01

    In this study, energy-dispersive X-ray Fluorescence (EDXR-F) was used to analyse the elemental composition of the starting zircon mineral associated elements in the leaching solution. Besides analysing the major elements i.e. of zirconium, silicon and hafnium, trace elemental analysis for iron, titanium and the naturally occurring radioactive element thorium and uranium are important in establishing the grades of Malaysian zircon. The technique was also used in determine the optimum conditions for zirconium and hafnium recovery during the leaching process

  3. Reactive evaporation of low-defect density hafnia

    International Nuclear Information System (INIS)

    Chow, R.; Falabella, S.; Loomis, G.E.; Rainer, F.; Stolz, C.J.; Kozlowski, M.R.

    1993-01-01

    Motivation for this work includes observations at Lawrence Livermore National Laboratory of a correlation between laser damage thresholds and both the absorption and the nodular-defect density of coatings. Activated oxygen is used to increase the metal-oxidation kinetics at the coated surface during electron-beam deposition. A series of hafnia layers are made with various conditions: two μ-wave configuations, two sources (hafnium and hafnia), and two reactive oxygen pressures. Laser damage thresholds (1064-nm, 10-ns pulses), absorption (at 511 nm), and nodular-defect densities from these coatings are reported. The damage thresholds are observed to increase as the absorption of the coatings decreases. However, no significant increase in damage thresholds are observed with the coatings made from a low nodular-defect density source material (hafnium). Hafnia coatings can be made from hafnium sources that have lower nodular-defect densities, lower absorption, and damage thresholds that are comparable with coatings made from a conventional hafnia source

  4. Study of N-cinnamoylphenylhydroxylaminate solubility in water and organic solvents

    International Nuclear Information System (INIS)

    Pilipenko, A.T.; Shpak, Eh.A.; Samchuk, A.I.

    1975-01-01

    The composition of complexes of N-cinnamoylphenylhydroxylamine with copper, cadmium, lead, indium, iron, gallium, titanium, zirconium, hafnium, niobium, tantalum, tungsten, molybdenum and vanadium was determined. The solubility products of the N-cinnamoylphenylhydroxylaminates of copper, cadmium, indium, gallium and iron were determined by the method of measuring the solubility of precipitates in acid. The solubility of N-cinnamoylphenylhydroxalaminates of cadmium, indium, iron, titanium, zirconium, hafnium, niobium, tantalum, vanadium, molybdenum and tungsten in organic solvents was studied. Two-phase constants for the stability of the complexes were calculated. (author)

  5. Experimental Observations of Nuclear Activity in Deuterated Materials Subjected to a Low-Energy Photon Beam

    Science.gov (United States)

    Steinetz, Bruce M.; Benyo, Theresa L.; Pines, Vladimir; Pines, Marianna; Forsley, Lawrence P.; Westmeyer, Paul A.; Chait, Arnon; Becks, Michael D.; Martin, Richard E.; Hendricks, Robert C.; hide

    2017-01-01

    Exposure of highly deuterated materials to a low-energy (nom. 2 MeV) photon beam resulted in nuclear activity of both the parent metals of hafnium and erbium and a witness material (molybdenum) mixed with the reactants. Gamma spectral analysis of all deuterated materials, ErD2.8+C36D74+Mo and HfD2+C36D74+Mo, showed that nuclear processes had occurred as shown by unique gamma signatures. For the deuterated erbium specimens, posttest gamma spectra showed evidence of radioisotopes of erbium ((163)Er and (171)Er) and of molybdenum ((99)Mo and (101)Mo) and by beta decay, technetium (99mTc and 101Tc). For the deuterated hafnium specimens, posttest gamma spectra showed evidence of radioisotopes of hafnium (180mHf and 181Hf) and molybdenum ((99)Mo and (101)Mo), and by beta decay, technetium ((99m)Tc and (101)Tc). In contrast, when either the hydrogenated or non-gas-loaded erbium or hafnium materials were exposed to the gamma flux, the gamma spectra revealed no new isotopes. Neutron activation materials showed evidence of thermal and epithermal neutrons. CR-39 solid-state nuclear track detectors showed evidence of fast neutrons with energies between 1.4 and 2.5 MeV and several instances of triple tracks, indicating (is) greater than 10 MeV neutrons. Further study is required to determine the mechanism causing the nuclear activity.

  6. Aperture-time of oxygen-precursor for minimum silicon incorporation into the interface-layer in atomic layer deposition-grown HfO{sub 2}/Si nanofilms

    Energy Technology Data Exchange (ETDEWEB)

    Mani-Gonzalez, Pierre Giovanni [CINVESTAV-Unidad Querétaro, Querétaro 76230, Querétaro, Mexico and Departamento de Física y Matemáticas, Instituto de Ingeniería y Tecnología, Universidad Autónoma de Ciudad Juárez, Ave. Del Charro 450, Cd. Juárez C.P. 32310, Chihuahua (Mexico); Vazquez-Lepe, Milton Oswaldo [CINVESTAV-Unidad Querétaro, Querétaro 76230, Querétaro, Mexico and Departamento de Ingeniería de Proyectos, Universidad de Guadalajara, Guadalajara 45100, Jalisco (Mexico); Herrera-Gomez, Alberto, E-mail: aherrera@qro.cinvestav.mx [CINVESTAV-Unidad Querétaro, Querétaro 76230, Querétaro (Mexico)

    2015-01-15

    Hafnium oxide nanofilms were grown with atomic layer deposition on H-terminated Si (001) wafers employing tetrakis dimethyl amino hafnium (TDMA-Hf) and water as precursors. While the number of cycles (30) and the aperture-time for TDMA-Hf (0.08 s) were kept constant, the aperture-time (τ{sub H{sub 2O}}) for the oxidant-agent (H{sub 2}O) was varied from 0 to 0.10 s. The structure of the films was characterized with robust analysis employing angle-resolved x-ray photoelectron spectroscopy. In addition to a ∼1 nm hafnium oxide layer, a hafnium silicate interface layer, also ∼1 nm thick, is formed for τ{sub H{sub 2O}} > 0. The incorporation degree of silicon into the interface layer (i.e., the value of 1 − x in Hf{sub x}Si{sub 1−x}O{sub y}) shows a minimum of 0.32 for τ{sub H{sub 2O}} = 0.04 s. By employing the simultaneous method during peak-fitting analysis, it was possible to clearly resolve the contribution from the silicate and from oxide to the O 1s spectra, allowing for the assessment of the oxygen composition of each layer as a function of oxidant aperture time. The uncertainties of the peak areas and on the thickness and composition of the layers were calculated employing a rigorous approach.

  7. Anisotropic bonded Sm2.3Fe16.8Zr0.2Ny magnets prepared by milling of as cast material

    International Nuclear Information System (INIS)

    Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H.

    2001-01-01

    As cast Sm 2.3 Fe 16.8 Zr 0.2 material was milled for 100 min ≤ t ≤ 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity μ 0J H C of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH) max of 50 kJm -3 (136 kJm -3 for the theoretical density of 7.7 gcm -3 ) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)

  8. Low temperature magnetoresistance in La1.32Sr1.68Mn2O7 layered manganite under hydrostatic pressure

    International Nuclear Information System (INIS)

    Kumaresavanji, M.; Fontes, M.B.

    2010-01-01

    The La 1.32 Sr 1.68 Mn 2 O 7 layered manganite system has been studied by the low temperature electrical resistance and magnetoresistance under hydrostatic pressure up to 25 kbar. We have observe both, a Curie temperature (T C ) and a metal-insulator transition (T MI ) at 118 K in the ambient pressure. The applied pressure shifts the T MI to higher temperature values and induces a second metal-insulator transition (T 2 MI ) at 90 K, in the temperature dependence of resistivity measurements. Also, the pressure suppresses the peak resistance abruptly at T C . When an external field of 5 T is applied, we have observed a large negative magnetoresistance of 300% at the transition temperature and a 128% at 4.5 K. However, the increased pressure decreases the magnetoresistance ratio gradually. When the pressure reaches its maximum available value of 25 kbar, the magnetoresistance ratio decreases at a rate of 1.3%/kbar. From our experimental results, the decrease of magnetoresistance ratio with pressure is explained by the pressure induced canted spin state which is not favor for the spin polarized intergrain tunneling in layered manganites.

  9. Preparation of refractory cermet structures for lithium compatibility testing

    Science.gov (United States)

    Heestand, R. L.; Jones, R. A.; Wright, T. R.; Kizer, D. E.

    1973-01-01

    High-purity nitride and carbide cermets were synthesized for compatability testing in liquid lithium. A process was developed for the preparation of high-purity hafnium nitride powder, which was subsequently blended with tungsten powder or tantalum nitride and tungsten powders and fabricated into 3 in diameter billets by uniaxial hot pressing. Specimens were then cut from the billets for compatability testing. Similar processing techniques were applied to produce hafnium carbide and zirconium carbide cermets for use in the testing program. All billets produced were characterized with respect to chemistry, structure, density, and strength properties.

  10. The vibrational spectra of some tetrachlorides in rare gas matrices with particular reference to the molecular shapes of ThCl4 and UCl4

    International Nuclear Information System (INIS)

    Arthers, S.A.; Beattie, I.R.

    1984-01-01

    Infrared spectra of tin, lead, hafnium, thorium, and uranium tetrachlorides isolated in inert gas matrices are reported. The results obtained for the tin, lead, and hafnium compounds follow the expected isotope patterns for a tetrahedral molecule except for the observation of additional weak features to high frequency of the all- 35 Cl isotopomers. By contrast for thorium tetrachloride the observed spectrum is not characteristic of a Tsub(d) molecule but can be fitted to a species with Csub(2v) symmetry. Similar results (although less detailed) were obtained for uranium tetrachloride. (author)

  11. Metal oxide targets produced by the polymer-assisted deposition method

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Mitch A., E-mail: mitch@berkeley.ed [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Ali, Mazhar N.; Chang, Noel N.; Parsons-Moss, T. [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Ashby, Paul D. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gates, Jacklyn M. [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Stavsetra, Liv [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gregorich, Kenneth E.; Nitsche, Heino [Department of Chemistry, Room 446 Latimer Hall, University of California Berkeley, Berkeley, CA 94720-1460 (United States); Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

    2010-02-11

    The polymer-assisted deposition (PAD) method was used to create crack-free homogenous metal oxide films for use as targets in nuclear science applications. Metal oxide films of europium, thulium, and hafnium were prepared as models for actinide oxides. Films produced by a single application of PAD were homogenous and uniform and ranged in thickness from 30 to 320 nm. Reapplication of the PAD method (six times) with a 10% by weight hafnium(IV) solution resulted in an equally homogeneous and uniform film with a total thickness of 600 nm.

  12. Metal oxide targets produced by the polymer-assisted deposition method

    International Nuclear Information System (INIS)

    Garcia, Mitch A.; Ali, Mazhar N.; Chang, Noel N.; Parsons-Moss, T.; Ashby, Paul D.; Gates, Jacklyn M.; Stavsetra, Liv; Gregorich, Kenneth E.; Nitsche, Heino

    2010-01-01

    The polymer-assisted deposition (PAD) method was used to create crack-free homogenous metal oxide films for use as targets in nuclear science applications. Metal oxide films of europium, thulium, and hafnium were prepared as models for actinide oxides. Films produced by a single application of PAD were homogenous and uniform and ranged in thickness from 30 to 320 nm. Reapplication of the PAD method (six times) with a 10% by weight hafnium(IV) solution resulted in an equally homogeneous and uniform film with a total thickness of 600 nm.

  13. Lead Sorption from Aqueous Solutions by Pseudomonas putida (p168 and its Composites with Palygorskite and Sepiolite Clays

    Directory of Open Access Journals (Sweden)

    Marzieh tavanaei

    2017-02-01

    Full Text Available Introduction: Heavy metals contamination due to natural and anthropogenic sources is a global environmental concern. Lead (Pb is one of the very toxic heavy metals. Industrial production processes and their emissions, mining operation, smelting, combustion sources and solid waste incinerators are the primary sources of lead. This heavy metal has aberrant effects on the environment and living organisms. Hence, proper treatment of lead from soil and industrial wastewaters is very important. In order to remove toxic heavy metals from contaminated water systems, conventional methods such as chemical precipitation, coagulation, ion exchange, solvent extraction and filtration, evaporation and membrane methods are being used. These conventional methods generally have high costs and technical problems. Therefore, biosorption processes, in which microorganisms are used as sorbents, have been considered as economical and environmentally friendly options for removal of heavy metals from aqueous solution. Clay minerals are another group of sorbents used in removal of heavy metals from polluted environments. Furthermore, bacterial cells can be attached on clay mineral surfaces and form bacteria-mineral composites. These composites adsorb heavy metals and convert them into forms with low mobility and bioavailability. Pseudomonas putida is a unique microorganism with a high tendency to sorb and/or degrade certain environmental pollutants. Palygorskite and sepiolite are the fibrous clay minerals of arid and semiarid regions; their structures consist of ribbons and channels. These fibrous minerals have various applications in industry and the environment because of its large surface area and high adsorption capacity. The present study was conducted in order to determine the ability of Pseudomonas putida (P168, and its composites with palygorskite and sepiolite in lead sorption. Materials and Methods: The bacterial strain used in the present study was Pseudomonas

  14. Evaluation of T-111 forced-convection loop tested with lithium at 13700C

    International Nuclear Information System (INIS)

    DeVan, J.H.; Long, E.L. Jr.

    1975-04-01

    A T-111 alloy (Ta--8 percent W--2 percent Hf) forced-convection loop containing molten lithium was operated 3000 h at a maximum temperature of 1370 0 C. Flow velocities up to 6.3 m/s were used. The results obtained in this forced-convection loop are very similar to those observed in lower velocity thermal-convection loops of T-111 containing lithium. Weight changes were determined at 93 positions around the loop. The maximum dissolution rate occurred at the maximum wall temperature of the loop and was less than 1.3 μ m/year. Mass transfer of hafnium, nitrogen, and, to a lesser extent, carbon occurred from the hotter to cooler regions. Exposed surfaces in the highest temperature region were found to be depleted in hafnium to a depth of 60 μ m with no detectable change in tungsten content. There was some loss in room-temperature tensile strength for specimens exposed to lithium at 1370 0 C, attributable to depletion of hafnium and nitrogen and to attendant grain growth. (U.S.)

  15. Separation of zirconium and hafnium; Separation du zirconium et de l'hafnium

    Energy Technology Data Exchange (ETDEWEB)

    Saint-James, D [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1959-07-01

    This account is more chemical than metallurgical in character. The reason for this is that so-called 'nuclear metal' must fulfil standards of purity which only chemical processes can attain. This paper must therefore be considered as a preliminary study, from which the metallurgists can form an idea of the treatments leading to the production of the metal. (author) [French] Cet expose a un caractere chimique plutot que metallurgique. La raison en est que le metal dit 'nucleaire' a des exigences de purete que seuls des processus chimiques peuvent satisfaire. Il faut donc considerer cet expose comme un preliminaire, permettant de donner une idee aux metallurgistes des traitements qui aboutissent a l'elaboration du metal. (auteur)

  16. Point defect engineering strategies to retard phosphorous diffusion in germanium

    KAUST Repository

    Tahini, H. A.; Chroneos, Alexander I.; Grimes, Robin W.; Schwingenschlö gl, Udo; Bracht, Hartmut A.

    2013-01-01

    The diffusion of phosphorous in germanium is very fast, requiring point defect engineering strategies to retard it in support of technological application. Density functional theory corroborated with hybrid density functional calculations are used to investigate the influence of the isovalent codopants tin and hafnium in the migration of phosphorous via the vacancy-mediated diffusion process. The migration energy barriers for phosphorous are increased significantly in the presence of oversized isovalent codopants. Therefore, it is proposed that tin and in particular hafnium codoping are efficient point defect engineering strategies to retard phosphorous migration. © the Owner Societies 2013.

  17. Oscillations in the open solar magnetic flux with a period of 1.68 years: imprint on galactic cosmic rays and implications for heliospheric shielding

    Directory of Open Access Journals (Sweden)

    A. Rouillard

    2004-12-01

    Full Text Available An understanding of how the heliosphere modulates galactic cosmic ray (GCR fluxes and spectra is important, not only for studies of their origin, acceleration and propagation in our galaxy, but also for predicting their effects (on technology and on the Earth's environment and organisms and for interpreting abundances of cosmogenic isotopes in meteorites and terrestrial reservoirs. In contrast to the early interplanetary measurements, there is growing evidence for a dominant role in GCR shielding of the total open magnetic flux, which emerges from the solar atmosphere and enters the heliosphere. In this paper, we relate a strong 1.68-year oscillation in GCR fluxes to a corresponding oscillation in the open solar magnetic flux and infer cosmic-ray propagation paths confirming the predictions of theories in which drift is important in modulating the cosmic ray flux. Key words. Interplanetary physics (Cosmic rays, Interplanetary magnetic fields

  18. PRODUCTION OF HAFNIUM METAL

    Science.gov (United States)

    Elger, G.W.; Boubel, R.W.

    1963-01-01

    This patent deals with a process of producing pure Hf metal from oxygen- contaminated gaseous Hf chloride. The oxygen compounds in the chioride gas are halogenated by contacting the gas at elevated temperature with Cl/sub 2/ in the presence of C. The Hf chloride, still in gaseous form, is contacted with molten Mg whereby Hf metal is formed and condensed on the Mg. (AEC)

  19. Determination of HER2 amplification in primary breast cancer using dual-colour chromogenic in situ hybridization is comparable to fluorescence in situ hybridization: a European multicentre study involving 168 specimens

    Science.gov (United States)

    García-Caballero, Tomás; Grabau, Dorthe; Green, Andrew R; Gregory, John; Schad, Arno; Kohlwes, Elke; Ellis, Ian O; Watts, Sarah; Mollerup, Jens

    2010-01-01

    García-Caballero T, Grabau D, Green A R, Gregory J, Schad A, Kohlwes E, Ellis I O, Watts S & Mollerup J (2010) Histopathology56, 472–480 Determination of HER2 amplification in primary breast cancer using dual-colour chromogenic in situ hybridization is comparable to fluorescence in situ hybridization: a European multicentre study involving 168 specimens Aims: Fluorescence in situ hybridization (FISH) can be used to reveal several genomic imbalances relevant to proper cancer diagnosis and to the correct treatment regime. However, FISH requires expensive and advanced fluorescence microscopes in addition to expertise in fluorescence microscopy. To determine whether a newly developed dual-colour chromogenic in situ hybridization (CISH) method is a suitable alternative to FISH, we analysed the human epidermal growth factor receptor 2 gene (HER2) amplification level of 168 breast cancer specimens using dual-colour CISH and FISH and compared the results. Methods and results: We found 100% agreement between HER2 status determined by FISH and dual-colour CISH. Furthermore, we observed that the time used to score slides was significantly reduced by 28% in dual-colour CISH compared with the FISH protocol. Concordance between HER2 protein status and dual-colour CISH or FISH was equally good with an overall agreement of 96.8%. Correlation between the HER2/centromere 17 gene ratios obtained with dual-colour CISH and FISH was highly significant with an overall correlation coefficient (ρ) of 0.96. Conclusions: We conclude that dual-colour CISH and bright field microscopy are excellent alternatives to FISH when analysing the HER2 status of primary breast cancer. PMID:20459554

  20. MIVOC method at the mVINIS ion source

    Directory of Open Access Journals (Sweden)

    Jovović Jovica

    2007-01-01

    Full Text Available Based on the metal-ions-from-volatile-compounds (MIVOC method with the mVINIS ion source, we have produced multiply charged ion beams from solid substances. Highly in tense, stable multiply charged ion beams of several solid substances with high melting points were extracted by using this method. The spectrum of multiply charged ion beams obtained from the element hafnium is presented here. For the first time ever, hafnium ion beam spectra were recorded at an electron cyclotron resonance ion source. Multiply charged ion beams from solid substances were used to irradiate the polymer, fullerene and glassy carbon samples at the channel for the modification of materials.

  1. Thickness independent reduced forming voltage in oxygen engineered HfO{sub 2} based resistive switching memories

    Energy Technology Data Exchange (ETDEWEB)

    Sharath, S. U., E-mail: sharath@oxide.tu-darmstadt.de; Kurian, J.; Komissinskiy, P.; Hildebrandt, E.; Alff, L. [Institute of Materials Science, Technische Universität Darmstadt, 64287 Darmstadt (Germany); Bertaud, T.; Walczyk, C.; Calka, P. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Schroeder, T. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Brandenburgische Technische Universität, Konrad-Zuse-Strasse 1, 03046 Cottbus (Germany)

    2014-08-18

    The conducting filament forming voltage of stoichiometric hafnium oxide based resistive switching layers increases linearly with layer thickness. Using strongly reduced oxygen deficient hafnium oxide thin films grown on polycrystalline TiN/Si(001) substrates, the thickness dependence of the forming voltage is strongly suppressed. Instead, an almost constant forming voltage of about 3 V is observed up to 200 nm layer thickness. This effect suggests that filament formation and switching occurs for all samples in an oxidized HfO{sub 2} surface layer of a few nanometer thickness while the highly oxygen deficient thin film itself merely serves as a oxygen vacancy reservoir.

  2. Characterization of electron beam deposited thin films of HfO2 and binary thin films of (HfO2:SiO2) by XRD and EXAFS measurements

    International Nuclear Information System (INIS)

    Das, N.C.; Sahoo, N.K.; Bhattacharyya, D.; Thakur, S.; Kamble, N.M.; Nanda, D.; Hazra, S.; Bal, J.K.; Lee, J.F.; Tai, Y.L.; Hsieh, C.A.

    2009-10-01

    In this report, we have discussed the microstructure and the local structure of composite thin films having varying hafnia and silica compositions and prepared by reactive electron beam evaporation. XRD and EXAFS studies have confirmed that the pure hafnium oxide thin film has crystalline microstructure whereas the films with finite hafnia and silica composition are amorphous. The result of EXAFS analysis has shown that the bond lengths as well as coordination numbers around hafnium atom change with the variation of hafnia and silica compositions in the thin film. Finally, change of bond lengths has been correlated with change of refractive index and band gap of the composite thin films. (author)

  3. 164 -168_Zhigila

    African Journals Online (AJOL)

    USER

    2014-12-02

    Dec 2, 2014 ... 2Applied Plant Anatomy and Wood Technology Laboratory, Department Of Plant Biology, University Of Ilorin, ... Fresh flowers of five species of Amaranthus were studied and documented in detail using light ... problems related to the origin and evolution of many taxa (Nair, 1980) and provide classification of.

  4. RETRACTED: Granular and intergranular conduction in La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} layered manganite system

    Energy Technology Data Exchange (ETDEWEB)

    Narjis, A., E-mail: NARJIS78@gmail.com [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El kaaouachi, A.; Dlimi, S. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Biskupski, G. [Laboratoire de Spectroscopie Hertzienne LSH, Bâtiment P5, Université des Sciences et Technologies, de Lille I 59 655 Villeneuve d’Ascq Cedex (France); Daoudi, E.; Errai, M.; Sybous, A.; Limouny, L. [Research Group ESNPS, Physics department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco)

    2013-06-15

    This article has been retracted: please see Elsevier Policy on Article Withdrawal ( (http://www.elsevier.com/locate/withdrawalpolicy)). This article has been retracted at the request of the Editors. The authors have plagiarized part of a paper that had already appeared in J. Appl. Phys. 106, 093709 (2009); (10.1063/1.3256182) (6 pages): Title: Effects of pressure on charge transport and magnetic properties of La1.32Sr1.68Mn2O7 layered manganite by M. Kumaresavanji, M. S. Reis, Y. T. Xing, and M. B. Fontes. One of the conditions of submission of a paper for publication is that authors declare explicitly that their work is original and has not appeared in a publication elsewhere. Re-use of any data should be appropriately cited. As such this article represents a severe abuse of the scientific publishing system. The scientific community takes a very strong view on this matter and apologies are offered to readers of the journal that this was not detected during the submission process.

  5. Effect of zirconium purity on the glass-forming-ability and notch toughness of Cu{sub 43}Zr{sub 43}Al{sub 7}Be{sub 7}

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, Laura M. [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA (United States); Hofmann, Douglas C. [Materials Development and Manufacturing Technology Group, NASA Jet Propulsion Laboratory/California Institute of Technology, MS 18-105, 4800 Oak Grove Dr. Pasadena, CA 91109 (United States); Vecchio, Kenneth S., E-mail: kvecchio@ucsd.edu [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA (United States)

    2016-09-30

    The effect of substituting standard grade zirconium lump (99.8% excluding up to 4% hafnium) for high purity zirconium crystal bar (99.5%) in a Cu{sub 43}Zr{sub 43}Al{sub 7}Be{sub 7} bulk metallic glass (BMG) is examined. The final hafnium content in the BMG specimens was found to range from 0 to 0.44 at%. Introducing low purity zirconium significantly decreased the glass-forming-ability and reduced the notch toughness of the BMG. In contrast, when adding high purity hafnium to Cu{sub 43}Zr{sub 43}Al{sub 7}Be{sub 7} made with high purity zirconium, no significant change in the glass-forming-ability or toughness was observed. This suggests that the introduction of low purity zirconium in BMGs creates a more complex response than a simple addition of hafnium. It is likely that other impurities in the material, such as oxygen, play a role in the complex crystallization kinetics and change in mechanical properties. The notch toughness was measured through four-point-bend tests, which showed a decrease in notch toughness from an average of ~53 MPa m{sup 1/2} for the high purity samples to an average of ~29 MPa m{sup 1/2} with full substitution of low purity zirconium. A similar decrease in glass-forming-ability and toughness is observed in commercially synthesized high purity Cu{sub 43}Zr{sub 43}Al{sub 7}Be{sub 7}. The large scale commercial process is expected to introduced some unintentional impurities, which decrease the properties of the BMG in the same way as the lower purity elements. Lastly, Weibull statistics are used to provide an analysis of variability in toughness for both ingots synthesized in a small laboratory arc-melter and those synthesized commercially.

  6. Development of new extraction agents for separation of rare radioactive elements

    International Nuclear Information System (INIS)

    Hala, J.; Navratil, O.; Prihoda, J.; Smola, J.

    1977-01-01

    Certain transition elements, such as rhodium and palladium may be recovered from waste solutions produced in spent fuel reprocessing. The extraction of palladium was studied using sulfur compounds of the sulfide and sulfoxide types and the effects were investigated of the individual factors on palladium distribution between the aqueous and the organic phases. The possibility of separating hafnium in the form of extractable complexes was tested on several systems. Studied in more detail were mainly the complexes of hafnium with pyrocatechol violet, xylenol orange, and tributyl phosphate. The extraction of other metals, mainly of scandium, europium and indium was investigated in detail in the system acid aqueous phase - organophosphinic acids solution in benzene. (L.K.)

  7. Novel Manufacturing Process for Unique Mixed Carbide Refractory Composites, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This STTR Phase I project will establish the feasibility of an innovative manufacturing process to fabricate a range of unique hafnium/silicon based carbide...

  8. Cobalt catalysts, and use thereof for the conversion of methanol and for fischer-tropsch synthesis, to produce hydrocarbons

    International Nuclear Information System (INIS)

    Mauldin, C.H.; Davis, S.M.; Arcuri, K.B.

    1988-01-01

    This patent describes a process useful for the conversion of methanol to hydrocarbons which comprises contacting the methanol at reaction conditions with a catalyst which comprises from about 2 percent to about 25 percent cobalt, based on the weight of the catalyst composition, composited with titania, or a titania-containing support, to which is added a zirconium, hafnium, cerium, or uranium promoter, the weight ratio of the zirconium, hafnium, cerium, or uranium metal:cobalt being greater than about 0.010:1; the reaction conditions being defined within ranges as follows: Methanol:H/sub 2/ ratio: greater than about 4:1, Space Velocities, Hr/sup -1/:about 0.1 to 10, Temperatures, 0 C.:about 150 to 350, Methanol Partial Pressure, psia: about 100 to 1000

  9. Ceramic component for M.H.D electrode

    International Nuclear Information System (INIS)

    Marchant, D.D.; Bates, J.L.

    1980-01-01

    A ceramic component which exhibits electrical conductivity down to near room temperatures has the formula: Hfsub(x)Insub(y)Asub(z)O 2 where x = 0.1 to 0.4, y = 0.3 to 0.6, z = 0.1 to 0.4 and A is a rare earth or yttrium. The rare earth may be Yb, Tb, Pr or Ce. The component is suitable for use in the fabrication of MHD electrodes or as the current lead-out portion of a composite electrode with other ceramic components. An MHD electrode comprises a cap of a known ceramic, e.g. stabilised zirconium or hafnium oxide or terbium stabilised hafnium, a current lead-out ceramic according to the invention, and a copper frame. (author)

  10. 40 CFR 302.6 - Notification requirements.

    Science.gov (United States)

    2010-07-01

    ..., phosphate, tin, zircon, hafnium, vanadium, monazite, and rare earth mines. Land disturbance incidental to..., chromium, copper, lead, nickel, selenium, silver, thallium, or zinc is not required if the mean diameter of...

  11. Anisotropic bonded Sm{sub 2.3}Fe{sub 16.8}Zr{sub 0.2}N{sub y} magnets prepared by milling of as cast material

    Energy Technology Data Exchange (ETDEWEB)

    Gebel, B.; Kubis, M.; Roessler, U.K.; Mueller, K.H. [Institut fuer Festkoerper- und Werkstofforschung Dresden e.V. (Germany). Inst. fuer Metallische Werkstoffe

    2001-07-01

    As cast Sm{sub 2.3}Fe{sub 16.8}Zr{sub 0.2} material was milled for 100 min {<=} t {<=} 900 min. After annealing at 800 C for 1 h and subsequent nitrogenation, the samples were cold compacted in a magnetic field and resin bonded. The coercivity {mu}{sub 0J}H{sub C} of the samples increased from 0.59 T (t = 100 min) to 2.18 T (t = 900 min). On the other hand, the remanence along the texture axis decreased monotonically with increasing milling time due to the decrease of the degree of texture of the aligned powders. Prolonged milling leads finally to the formation of a soft magnetic phase as indicated by a shoulder in the demagnetization curve for t > 600 min. The highest energy product (BH){sub max} of 50 kJm{sup -3} (136 kJm{sup -3} for the theoretical density of 7.7 gcm{sup -3}) was obtained for an intermediate milling time of 400 min. Zn bonding of the powders resulted in magnets with lower energy products but improved coercivities. (orig.)

  12. Electrochemical investigations of ion-implanted oxide films

    International Nuclear Information System (INIS)

    Schultze, J.W.; Danzfuss, B.; Meyer, O.; Stimming, U.

    1985-01-01

    Oxide films (passive films) of 40-50 nm thickness were prepared by anodic polarization of hafnium and titanium electrodes up to 20 V. Multiple-energy ion implantation of palladium, iron and xenon was used in order to obtain modified films with constant concentration profiles of the implanted ions. Rutherford backscattering, X-ray photoelectron spectroscopy measurements and electrochemical charging curves prove the presence of implanted ions, but electrochemical and photoelectrochemical measurements indicate that the dominating effect of ion implantation is the disordering of the oxide film. The capacity of hafnium electrodes increases as a result of an increase in the dielectric constant D. For titanium the Schottky-Mott analysis shows that ion implantation causes an increase in D and the donor concentration N. Additional electronic states in the band gap which are created by the implantation improve the conductivity of the semiconducting or insulating films. This is seen in the enhancement of electron transfer reactions and its disappearance during repassivation and annealing. Energy changes in the band gap are derived from photoelectrochemical measurements; the absorption edge of hafnium oxide films decreases by approximately 2 eV because of ion implantation, but it stays almost constant for titanium oxide films. All changes in electrochemical behavior caused by ion implantation show little variation with the nature of the implanted ion. Hence the dominating effect seems to be a disordering of the oxide. (Auth.)

  13. Microstructural characterization of as-cast hf-b alloys

    Directory of Open Access Journals (Sweden)

    João Carlos Jânio Gigolotti

    2012-04-01

    Full Text Available An accurate knowledge of several metal-boron phase diagrams is important to evaluation of higher order systems such as metal-silicon-boron ternaries. The refinement and reassessment of phase diagram data is a continuous work, thus the reevaluation of metal-boron systems provides the possibility to confirm previous data from an investigation using higher purity materials and better analytical techniques. This work presents results of rigorous microstructural characterization of as-cast hafnium-boron alloys which are significant to assess the liquid composition associated to most of the invariant reactions of this system. Alloys were prepared by arc melting high purity hafnium (minimum 99.8% and boron (minimum 99.5% slices under argon atmosphere in water-cooled copper crucible with non consumable tungsten electrode and titanium getter. The phases were identified by scanning electron microscopy, using back-scattered electron image mode and X-ray diffraction. In general, a good agreement was found between our data and those from the currently accepted Hafnium-Boron phase diagram. The phases identified are αHfSS and B-RhomSS, the intermediate compounds HfB and HfB2 and the liquide L. The reactions are the eutectic L ⇔ αHfSS + HfB and L ⇔ HfB2 + B-Rhom, the peritectic L + HfB2 ⇔ HfB and the congruent formation of HfB2.

  14. WWER-440 local power peaking experiment with/without Hf inserts in the LR-0 reactor

    International Nuclear Information System (INIS)

    Josek, R.; Hudec, F.; Rypar, V.

    2006-01-01

    One of the known issues of the WWER-440 reactors is the control rod coupler induced power peaking in the neighbouring fuel assemblies. The effect has been discovered some years ago and is believed to be the cause of several fuel failures during operation in WWER-440 reactors. The effect itself is due to over-moderation and small absorption in the region of control rod coupler, leading to increase in thermal neutron flux and hence to power flare-up in the neighbouring fuel pins. The fuel vendor tackled the problem by attaching hafnium inserts on the inside of the control assembly box. The experiment performed in the LR-0 reactor was focused on the axial and radial power profiles in the vicinity of the control assembly with and without the hafnium inserts. The results of measurements with zero boron concentration are presented. The hafnium insert causes a decrease in peaking factor of about 30% in selected pins close to the control assembly. The measurements are compared with calculations performed with the MCNP-4C code. The compared variables are: the axial fission density distributions; peking factors and peaking factor decrease due to Hf insert. The MCNP results are accurate with respect to the experimental results. A series of benchmarks is being prepared on the basis of these measurements

  15. Design of thermoelectrically highly efficient Heusler compounds using phase separations and nano-composites under an economic point of view

    Science.gov (United States)

    Balke, Benjamin

    Half-Heusler (HH) compounds are one of the most promising candidates for thermoelectric materials for automotive and industrial waste heat recovery applications. In this talk, I will give an overview about our recent investigations of phase separations in HH thermoelectrics, focusing on the ternary system TiNiSn-ZrNiSn-HfNiSn. I will show how we adapted this knowledge to design a p-type HH compound which exhibits a ZT that is increased by 130% compared to the best published bulk p-type Heusler. I will also present how we used the phase separation to design thermoelectric highly efficient nano-composites of different single-phase materials. Since the price for Hafnium doubled within the last year, our research focused on the design of HH compounds without Hafnium. I will present a very recent calculation on ZT per Euro and efficiency per Euro for various materials followed by our latest very promising results for n-type Heusler compunds without Hafnium resulting in 20 times higher ZT/Euro values. These results strongly underline the importance of phase separations as a powerful tool for designing highly efficient materials for thermoelectric applications that fulfill the industrial demands for a thermoelectric converter. The author gratefully acknowledges financial support by the thermoHEUSLER2 Project (Project No. 19U15006F) of the German Federal Ministry of Economics and Technology (BMWi).

  16. Mesoporous TiO2 powders as host matrices for iron nanoparticles. Effect of the preparation procedure and doping with Hf

    Czech Academy of Sciences Publication Activity Database

    Dimitrov, M.; Ivanova, R.; Velinov, N.; Henych, Jiří; Slušná, Michaela; Štengl, Václav; Tolasz, Jakub; Mitov, I.; Tsoncheva, T.

    2016-01-01

    Roč. 7, JUL (2016), s. 56-63 ISSN 2352-507X Institutional support: RVO:61388980 Keywords : Mesoporous titania * Hafnium doping * Iron modification * Ethyl acetate oxidation * Methanol decomposition Subject RIV: CA - Inorganic Chemistry

  17. Cathodoluminescence of Irradiated Hafnium Dioxide

    Science.gov (United States)

    2011-03-01

    Martin and Michael Rhoby for their hard work in fixing assorted problems that cropped up during the course of my thesis work. Emily A. Purcell...Cathodoluminescence Microscopy of Inorganic Solids. New York: Plenum Press, 1990. [13] D. Drouin, A. R. Couture, D. Joly , X. Tastet, V. Aimez and R. Gauvin

  18. Zirconium Zr and hafnium Hf

    International Nuclear Information System (INIS)

    Busev, A.I.; Tiptsova, V.G.; Ivanov, V.M.

    1978-01-01

    The basic methods for extracting and determining Zr(4) and Hf(4) are described. Diantipyrinemethane and its alkyl homologs selectively extract Zr and Hf from HNO 3 solutions in the presence of nitrates. Zr is selectively extracted with tetraethyldiamide of heptyl phosphoric acid (in benzene) as well as with 2-thenoyltrifluoroacetone (in an acid). The latter reagents is suitable for rapid determination of 95 Zr in a mixture with 95 Nb and other fragments. The complexometric determination of Zr is based on formation of a stable complex of Zr with EDTA. The titration is carried out in the presence of n-sulfobenzene-azo-pyrocatechol, eriochrome black T. The determination is hindered by Hf, fluoride-, phosphate-, oxalate- and tartrate-ions. The method is used for determining Zr in zircon and eudialyte ore. Zr is determined photometrically with the aid of xylenol orange, arsenazo 3 and pyrocatechol violet (in phosphorites). Hf is determined in the presence of Zr photometrically with the aid of xylenol orange or methyl-thymol blue. The method is based on Zr being masked with hydrogen peroxide in the presence of sulfate-ions

  19. Alkali metal hafnium oxide scintillators

    Science.gov (United States)

    Bourret-Courchesne, Edith; Derenzo, Stephen E.; Taylor, Scott Edward

    2018-05-08

    The present invention provides for a composition comprising an inorganic scintillator comprising an alkali metal hafnate, optionally cerium-doped, having the formula A2HfO3:Ce; wherein A is an alkali metal having a valence of 1, such as Li or Na; and the molar percent of cerium is 0% to 100%. The alkali metal hafnate are scintillators and produce a bright luminescence upon irradiation by a suitable radiation.

  20. High-pressure torsion of hafnium

    International Nuclear Information System (INIS)

    Edalati, Kaveh; Horita, Zenji; Mine, Yoji

    2010-01-01

    Pure Hf (99.99%) is processed by high-pressure torsion (HPT) under pressures of 4 and 30 GPa to form an ultrafine-grained structure with a gain size of ∼180 nm. X-ray diffraction analysis shows that, unlike Ti and Zr, no ω phase formation is detected after HPT processing even under a pressure of 30 GPa. A hydride formation is detected after straining at the pressure of 4 GPa. The hydride phase decomposes either by application of a higher pressure as 30 GPa or by unloading for prolong time after HPT processing. Microhardness, tensile and bending tests show that a high hardness (360 Hv) and an appreciable ductility (8%) as well as high tensile and bending strength (1.15 and 2.75 GPa, respectively) are achieved following the high-pressure torsion.

  1. X-ray target with substrate of molybdenum alloy

    International Nuclear Information System (INIS)

    Hirsch, H.H.

    1980-01-01

    Rotary targets for x-ray tubes are provided comprising a molybdenum base body alloyed with a stabilizing proportion of iron, silicon, cobalt, tantalum, niobium, hafnium, stable metal oxide, or a mixture of the preceding

  2. Coulomb-nuclear interference measurements of 168Yb, 176Hf, 178Hf, and 180Hf and lifetime measurements in 186Hg

    International Nuclear Information System (INIS)

    Nettles, W.G.

    1979-01-01

    Alpha scattering measurements were performed at center-of-mass energies near the Coulomb barrier. These energies allow for nuclear as well as pure Coulomb forces to play a significant role in the excitation process. The interference of these two forces is very sensitive to the sign of the E4 ground-state moment, whereas pure Coulomb excitation is not. Systematics of the E4 moments of the rare earth mass region indicate a transition in the magnitude and sign of the reduced matrix element of the M(E4) operator between 0 + and 4 + states from small and positive to large and negative between Yb and W. Previous Coulomb-nuclear interference measurements show that this reduced matrix element for 180 Hf is large and negative. The present results agree with that conclusion. It is also shown that the above reduced matrix element for 178 Hf, like that of 180 Hf, is large and negative. The small and positive moment (matrix element) for 168 Yb is seen to be consistent with the experimental data. No conclusions are drawn for the E4 moment in 176 Hf. The measurement of nuclear lifetimes shorter than 500 ps requires the use of plastic scintilltor detectors. These detectors, however have very poor energy resolution. A system is described that uses plastic scintillators with a magnetic lens spectrometer for energy selection. The system was used to measure the lifetime of the 522-keV 0 + sate in 186 Hf. A data analysis method using higher-order distribution moments is also presented

  3. Control rod

    International Nuclear Information System (INIS)

    Igarashi, Takao; Sugawara, Satoshi; Yoshimoto, Yuichiro; Saito, Shozo; Fukumoto, Takashi.

    1987-01-01

    Purpose: To reduce the weight and thereby obtain satisfactory operationability of control rods by combining absorbing nuclear chain type neutron absorbers and conventional type neutron absorbers in the axial direction of blades. Constitution: Neutron absorber rods and long life type neutron absorber rods are disposed in a tie rod and a sheath. The neutron absorber rod comprises a poison tube made of stainless steels and packed with B 4 C powder. The long life type neutron absorber rod is prepared by packing B-10 enriched boron carbide powder into a hafnium metal rod, hafnium pipe, europium and stainless made poison tube. Since the long life type absorber rod uses HF as the absorbing nuclear chain type neutron absorber, it absorbs neutrons to form new neutron absorbers to increase the nuclear life. (Yoshino, Y.)

  4. Thermodynamic study of the MWG system/components and measurement of the oxygen partial pressure in the heat source capsule

    International Nuclear Information System (INIS)

    David, D.J.

    1980-01-01

    A thermodynamic study of the Milliwatt Generator heat source capsule was performed to determine the effects of the oxide fuel on container materials at elevated temperatures in order to evaluate the factors affecting embrittlement of T-111 alloy. The study indicates that relatively slow oxidation of the T-111 of the capsule occurs during pretreatment. Yttrium added to the 238 PuO 2 fuel charge is functioning in its designed role as an oxygen getter and is stabilizing at an O/Pu ratio of 1.75. The free energy of formation of hafnium oxide has been measured and found to be -70632 cal/mole; this suggests that the ability of hafnium to strongly function as an oxygen getter may be largely determined by the kinetics, and the free energy may play a lesser role

  5. Development of Advanced Environmental Barrier Coatings for SiC/SiC Ceramic Matrix Composites: Path Toward 2700 F Temperature Capability and Beyond

    Science.gov (United States)

    Zhu, Dongming; Harder, Bryan; Hurst, Janet B.; Good, Brian; Costa, Gustavo; Bhatt, Ramakrishna T.; Fox, Dennis S.

    2017-01-01

    Advanced environmental barrier coating systems for SiC-SiC Ceramic Matrix Composite (CMC) turbine and combustor hot section components are currently being developed to meet future turbine engine emission and performance goals. One of the significant coating development challenges is to achieve prime-reliant environmental barrier coating systems to meet the future 2700F EBC-CMC temperature stability and environmental durability requirements. This presentation will emphasize recent NASA environmental barrier coating system testing and down-selects, particularly the development path and properties towards 2700-3000F durability goals by using NASA hafnium-hafnia-rare earth-silicon-silicate composition EBC systems for the SiC-SiC CMC turbine component applications. Advanced hafnium-based compositions for enabling next generation EBC and CMCs capabilities towards ultra-high temperature ceramic coating systems will also be briefly mentioned.

  6. 10 CFR Appendix L to Part 110 - Illustrative List of Byproduct Materials Under NRC Export/Import Licensing Authority a

    Science.gov (United States)

    2010-01-01

    ... material produced, extracted, or converted for use for a commercial, medical, or research activity...) Gallium 72 (Ga 72) Germanium 68 (Ge 68) Germanium 71 (Ge 71) Gold 198 (Au 198) Gold 199 (Au 199) Hafnium...

  7. Corrective Action Investigation Plan for Corrective Action Unit 168: Areas 25 and 26 Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada (Rev. 0) includes Record of Technical Change No. 1 (dated 8/28/2002), Record of Technical Change No. 2 (dated 9/23/2002), and Record of Technical Change No. 3 (dated 6/2/2004)

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada

    2001-11-21

    This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 168 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 168 consists of a group of twelve relatively diverse Corrective Action Sites (CASs 25-16-01, Construction Waste Pile; 25-16-03, MX Construction Landfill; 25-19-02, Waste Disposal Site; 25-23-02, Radioactive Storage RR Cars; 25-23-18, Radioactive Material Storage; 25-34-01, NRDS Contaminated Bunker; 25-34-02, NRDS Contaminated Bunker; CAS 25-23-13, ETL - Lab Radioactive Contamination; 25-99-16, USW G3; 26-08-01, Waste Dump/Burn Pit; 26-17-01, Pluto Waste Holding Area; 26-19-02, Contaminated Waste Dump No.2). These CASs vary in terms of the sources and nature of potential contamination. The CASs are located and/or associated wit h the following Nevada Test Site (NTS) facilities within three areas. The first eight CASs were in operation between 1958 to 1984 in Area 25 include the Engine Maintenance, Assembly, and Disassembly Facility; the Missile Experiment Salvage Yard; the Reactor Maintenance, Assembly, and Disassembly Facility; the Radioactive Materials Storage Facility; and the Treatment Test Facility Building at Test Cell A. Secondly, the three CASs located in Area 26 include the Project Pluto testing area that operated from 1961 to 1964. Lastly, the Underground Southern Nevada Well (USW) G3 (CAS 25-99-16), a groundwater monitoring well located west of the NTS on the ridgeline of Yucca Mountain, was in operation during the 1980s. Based on site history and existing characterization data obtained to support the data quality objectives process, contaminants of potential concern (COPCs) for CAU 168 are primarily radionuclide; however, the COPCs for several CASs were not defined. To address COPC

  8. Hafnium and neodymium isotopes and REY distribution in the truly dissolved, nanoparticulate/colloidal and suspended loads of rivers in the Amazon Basin, Brazil

    Science.gov (United States)

    Merschel, Gila; Bau, Michael; Schmidt, Katja; Münker, Carsten; Dantas, Elton L.

    2017-09-01

    Radiogenic isotopes in river sediments and river waters have been widely used in provenance studies, as these samples naturally integrate the geology/chemistry of the entire catchment. While the Hf and Nd isotope systems are coupled during igneous processes, they are decoupled during supergene processes at the Earth's surface, which is reflected by the isotope composition of riverine sediments. We present the first data for both Hf and Nd isotope compositions of the dissolved (0.2 μm-filtrates rich in nanoparticles and colloids, NPCs) and the truly dissolved (1 kDa-ultrafiltrates) load of rivers. Hafnium and Nd isotope compositions and concentrations of the Rare Earths and Yttrium (REY) and Hf were determined for suspended particles (>0.2 μm) as well as for the dissolved and the truly dissolved load of the Rio Solimões, the Amazon's largest tributary draining the Andes, and of the Rio Negro, an organic NPC- and particle-rich river draining the rainforest of northern Amazonia. We also analyzed the Nd isotope compositions of suspended sediments and 0.2 μm-filtered water samples from the Amazon River and its tributaries Rio Tapajos, Rio Xingu and Rio Jari. Our novel results clearly show that the decoupling of the Hf and Nd isotope systems is related to incongruent weathering processes on the continent, as this decoupling can already be observed in the different Hf and Nd pools, i.e. in the particulate, the NPC-dominated dissolved and the truly dissolved load of rivers. In the Rio Negro and Rio Solimões, a strong particle size-dependent difference in Hf isotope composition is observed. Values of εHf become more radiogenic as filter poresize decreases, which can be related to the density- and size-dependent distribution of Hf-rich minerals, e.g. zircons, and their absence from the truly dissolved pool. In contrast, the Nd isotope composition of Amazonian river waters reflects that of their catchment geology. Tributaries draining the Precambrian Brazilian and

  9. Areva At September 30, 2010: Revenue growth to euro 6.168 bn: + 6.3%. Backlog growth to euro 42.7 bn: + 2.2%

    International Nuclear Information System (INIS)

    2010-01-01

    AREVA generated consolidated revenue of 6.168 billion euros over the first nine months of 2010 for growth of 6.3% (+5.2% like-for-like) compared with the same period in 2009. The main revenue growth engines were the Reactors and Services Business Group and the Back End Business Group, with growth of 11.5% and 7.1% respectively. Foreign exchange had a positive impact of 82 million euros over the period, while changes in consolidation scope had negligible impact. Third quarter 2010 revenue amounted to 2.011 billion euros for growth of 6.1% (+4.4% LFL) compared with the third quarter of 2009. The Reactors and Services Business Group and the Back End Business Group, posting increases of 11.2% and 9.0% respectively, continued to lead this growth. Foreign exchange had a positive impact of 39 million euros, while changes in consolidation scope had negligible impact. The group's backlog came to 42.7 billion euros at September 30, 2010, an increase of 2.2% compared with September 30, 2009 (41.8 billion euros). For the full year of 2010, the group confirms its outlook for significant revenue and backlog growth, increased operating performance excluding particular items, negative operating income, and strong growth in net income attributable to owners of the group with the contribution of the gain on the sale of the Transmission and Distribution business

  10. Fabrication of cermet bearings for the control system of a high temperature lithium cooled nuclear reactor

    Science.gov (United States)

    Yacobucci, H. G.; Heestand, R. L.; Kizer, D. E.

    1973-01-01

    The techniques used to fabricate cermet bearings for the fueled control drums of a liquid metal cooled reference-design reactor concept are presented. The bearings were designed for operation in lithium for as long as 5 years at temperatures to 1205 C. Two sets of bearings were fabricated from a hafnium carbide - 8-wt. % molybdenum - 2-wt. % niobium carbide cermet, and two sets were fabricated from a hafnium nitride - 10-wt. % tungsten cermet. Procedures were developed for synthesizing the material in high purity inert-atmosphere glove boxes to minimize oxygen content in order to enhance corrosion resistance. Techniques were developed for pressing cylindrical billets to conserve materials and to reduce machining requirements. Finishing was accomplished by a combination of diamond grinding, electrodischarge machining, and diamond lapping. Samples were characterized in respect to composition, impurity level, lattice parameter, microstructure and density.

  11. The determination of light elements in heavy matrix using proton induced X-ray emission

    International Nuclear Information System (INIS)

    Levenets, V.V.; Omel'nik, A.P.; Shchur, A.A.; Chernov, A.E.; Usikov, N.P.; Zats, A.V.

    2007-01-01

    In this report the possibility of determination of light impurities in heavy matrixes is studied using proton induced X-Ray emission. The wide-band X-ray emission filter made from pyrolytic graphite was used in spectrometric scheme of experiment. The results of studying of filter features in energy range of X-ray emission from 4 to 12 keV were presented. The possibilities were examined of application of pyrolytic graphite filter to modify the X-rays spectrum for determination of iron, using characteristic emission of K-series, and hafnium, using L-series, in substances on base of zirconium (glasses, alloys etc.). It was shown, that the using of similar filter allows to reach the significant improving of metrological characteristics of analysis of mentioned impurities: the limits of detection of iron and hafnium were lowered single-order of magnitude. (authors)

  12. Chemical effects in x-ray emission spectra

    International Nuclear Information System (INIS)

    Fernandes, N.G.

    1982-01-01

    The chemical bond influence in X-ray emission spectra of hafnium, iodine, iron, sulphur, aluminium and magnesium is detected. The position of one X-ray emission line is determined by three methods: parabolic profile; Gaussian distribution and extra-heavy maximum. (author)

  13. Highly stable thin film transistors using multilayer channel structure

    KAUST Repository

    Nayak, Pradipta K.; Wang, Zhenwei; Anjum, Dalaver H.; Hedhili, Mohamed N.; Alshareef, Husam N.

    2015-01-01

    We report highly stable gate-bias stress performance of thin film transistors (TFTs) using zinc oxide (ZnO)/hafnium oxide (HfO2) multilayer structure as the channel layer. Positive and negative gate-bias stress stability of the TFTs was measured

  14. Association between investigator-measured body-mass index and colorectal adenoma: a systematic review and meta-analysis of 168,201 subjects.

    Science.gov (United States)

    Wong, Martin Chi-Sang; Chan, Chun-Hei; Cheung, Wilson; Fung, Din-Hei; Liang, Miaoyin; Huang, Jason Li-Wen; Wang, Yan-Hong; Jiang, Johnny Yu; Yu, Chun-Pong; Wang, Harry Haoxiang; Wu, Justin Che-Yuen; Chan, Francis Ka-Leung; Sung, Joseph Jao-Yiu

    2018-01-01

    The objective of this meta-analysis is to evaluate the odds of colorectal adenoma (CRA) in colorectal cancer screening participants with different body mass index (BMI) levels, and examine if this association was different according to gender and ethnicity. The EMBASE and MEDLINE were searched to enroll high quality observational studies that examined the association between investigator-measured BMI and colonoscopy-diagnosed CRA. Data were independently extracted by two reviewers. A random-effects meta-analysis was conducted to estimate the summary odds ratio (SOR) for the association between BMI and CRA. The Cochran's Q statistic and I 2 analyses were used to assess the heterogeneity. A total of 17 studies (168,201 subjects) were included. When compared with subjects having BMI CRA (SOR 1.44, 95% CI 1.30-1.61; I 2  = 43.0%). Subjects with BMI ≥ 30 had similarly higher risk of CRA (SOR 1.42, 95% CI 1.24-1.63; I 2  = 18.5%). The heterogeneity was mild to moderate among studies. The associations were significantly higher than estimates by previous meta-analyses. There was no publication bias detected (Egger's regression test, p = 0.584). Subgroup analysis showed that the magnitude of association was significantly higher in female than male subjects (SOR 1.43, 95% CI 1.30-1.58 vs. SOR 1.16, 95% CI 1.07-1.24; different among different ethnic groups (SOR 1.72, 1.44 and 0.88 in White, Asians and Africans, respectively) being insignificant in Africans; and no difference exists among different study designs. In summary, the risk conferred by BMI for CRA was significantly higher than that reported previously. These findings bear implications in CRA risk estimation.

  15. EXPERIMENTAL ANALYSIS OF THE HEALING PROCESS IN THE AREA OF TIBIAL BONE FRACTURE

    Directory of Open Access Journals (Sweden)

    I. F. Аkhtyamov

    2016-01-01

    Full Text Available Purpose. To quantify the density of the cortical bone of the tibia in the area of reparative regeneration and the state of the vascular bed (hemodynamics of the operated limb under intramedullary osteosynthesis using pins coated with titanium and hafnium nitrides. Materials and methods. In the experiment, changes in the bone density and the characteristics of the local blood supply were studied on 40 outbred rabbits which underwent intramedullary osteosynthesis by the use of pins with a nanocoating based on superhard compounds which consist of titanium and hafnium nitrides and pins without a coating. Using color Doppler mode helped to evaluate the condition of the vascular bed proximally to the fracture site. Results. It is noted that the use of pins with the described coating above did not violate the osteoregeneration staging. The density of the cortical bone in the test group exceeded that of the comparison group by an average of 30%. Bone remodeling processes in the test group completed at an earlier date, as determined by the higher rates of its density. In the study of the vascular bed of the operated limb, it was found that on the 10th day of the experiment, an increase in the maximal velocity of the blood flow was recorded (TAMAX. In animals of the test group this index approached preoperative values on the 30th day, while in animals of the comparison group this index approached the initial values only by the 60th day. Conclusion. The use of implants coated with titanium and hafnium nitrides which are characterized by high strength, thermal and chemical stability is accompanied by the formation of a cortical bone in the area of osteotomy with higher density characteristics. The changes which are typical of the vasodilatation in the area of injury in the early postoperative period can be regarded as a positive factor in the formation of primary bone union. In the group where implants coated with titanium and hafnium nitrides were used

  16. Behavior of uranium and its surrogates in molten aluminosilicate glasses in contact with liquid metals

    International Nuclear Information System (INIS)

    Chevreux, Pierrick

    2016-01-01

    This study concerns an innovative process used for conditioning nuclear waste that contain metallic parts contaminated with actinides. High actinides concentrations are expected to be incorporated in the glass melt in contact with the molten metals. Among these metals, aluminum and/or stainless steel impose a strongly reducing environment to the glass melt involving redox reactions. These reactions modify actinides oxidation states and therefore change their solubilities in the glass and could also reduce them into the metallic form. In this work, we focus on the behavior of uranium and its surrogates, namely hafnium and neodymium, in aluminosilicate glasses from the Na 2 O-CaO-SiO 2 -Al 2 O 3 system melted in highly reducing conditions. The first step consists in comparing the hafnium and uranium solubilities in the glass as functions of redox conditions and glass composition. A methodology has been set up and a specific device has been used to control the oxygen fugacity and the alkali content of the glass. The results show that uranium is far less soluble in the glass than hafnium (Hf(IV)) in reducing conditions. The uranium solubility ranges from 4 to 7 wt% UO 2 for an oxygen fugacity below 10 -14 atm at 1250 C-1400 C. Uranium oxidation states have been investigated by X-ray absorption spectroscopy (XANES). It has been pointed out that U(IV) is the main form in the glass for such imposed oxygen fugacities. The second step of this work is to identify the glass-metal interaction mechanisms in order to determine the localization of uranium and its surrogates (Nd, Hf) in the glass-metal system. Mechanisms are mostly ruled by the presence of metallic aluminum and are similar for uranium, neodymium and hafnium. Glass-metal interaction kinetics demonstrate that uranium and its surrogates can temporarily be reduced into the metallic form for particular conditions. A re-oxidation occurs with time which is in good agreement with thermodynamics. Regarding uranium, the re

  17. Study of a new magnetic dipole mode in the heavy deformed nuclei 154Sm, 156Gd, 158Gd, 164Dy, 168Er, and 174Yb by high-resolution electron spectroscopy

    International Nuclear Information System (INIS)

    Bohle, D.

    1985-01-01

    By inelastic electron scattering with high energy resolution a new magnetic dipole mode in heavy, deformed nuclei could be detected. For this the nuclei 154 Sm, 156 Gd, 158 Gd, 164 Dy, 168 Er, and 174 Yb were studied at the Darmstadt electron linear accelerator (DALINAC) at small momentum transfer q ≤ 0.6 fm -1 and low excitation energies. A collective magnetic dipole excitation could be discovered in all nuclei at an excitation energy of E x ≅ 66 δA -1/3 MeV whereby δ means the mass deformation. The transition strength extends in the mean to B(M1)↑ ≅ 1.3 μ N 2 . A systematic study of the nucleus 156 Gd yielded hints to a strong fragmentation of the magnetic dipole strength. A comparison of electron scattering, proton scattering, and nuclear resonance fluorescence experiments shows that the new mode is a pure orbital mode. (orig./HSI) [de

  18. A Fully Transparent Resistive Memory for Harsh Environments

    KAUST Repository

    Yang, Po-Kang; Ho, Chih-Hsiang; Lien, Der-Hsien; Duran Retamal, Jose Ramon; Kang, Chen-Fang; Chen, Kuan-Ming; Huang, Teng-Han; Yu, Yueh-Chung; Wu, Chih-I; He, Jr-Hau

    2015-01-01

    A fully transparent resistive memory (TRRAM) based on Hafnium oxide (HfO2) with excellent transparency, resistive switching capability, and environmental stability is demonstrated. The retention time measured at 85 °C is over 3 × 104 sec

  19. Influences of different oxidants on the characteristics of HfAlOx films deposited by atomic layer deposition

    International Nuclear Information System (INIS)

    Fan Ji-Bin; Liu Hong-Xia; Ma Fei; Zhuo Qing-Qing; Hao Yue

    2013-01-01

    A comparative study of two kinds of oxidants (H 2 O and O 3 ) with the combinations of two metal precursors [trimethylaluminum (TMA) and tetrakis(ethylmethylamino) hafnium (TEMAH)] for atomic layer deposition (ALD) hafnium aluminum oxide (HfAlO x ) films is carried out. The effects of different oxidants on the physical properties and electrical characteristics of HfAlO x films are studied. The preliminary testing results indicate that the impurity level of HfAlO x films grown with both H 2 O and O 3 used as oxidants can be well controlled, which has significant effects on the dielectric constant, valence band, electrical properties, and stability of HfAlO x film. Additional thermal annealing effects on the properties of HfAlO x films grown with different oxidants are also investigated. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  20. Thermodynamics of HfCl/sub 4/-KCl molten mixtures containing HfCl/sub 4/ up to 33. 3 mol. per cent

    Energy Technology Data Exchange (ETDEWEB)

    Smirnov, M V; Salyulev, A B; Kudyakov, V Ya [AN SSSR, Sverdlovsk. Inst. Ehlektrokhimii

    1980-05-01

    Based on measurements of saturated vapour pressure in components of melted mixtures of HfCl/sub 4/-KCl, depending on temperature and concentration, calculated are the results of changes in activity coefficients of hafnium tetrachloride and potassium chloride on transition from diluted solutions, where the Henry law is met, to those concentrated where the law is disobeyed. Growth in the activity coefficient of HfCl/sub 4/ is due to dissociation of complex groups of HfCl/sub 6//sup 2 -/ into complexes with a lesser number of ligands and decreasing relative binding energy of Hf/sup 4 +/-Cl/sup -/ there. In this case, marked changes take place in partial enthalpy and entropy of hafnium tetrachloride mixing. Similar dependences are observed for potassium chloride, but they are expressed considerably weaker. Evaporation enthalpy and entropy are calculated for HfCl/sub 4/ and KCl monomers from their melted mixtures of various concentrations.

  1. Thermodynamics of HfCl4-KCl molten mixtures containing HfCl4 up to 33.3 mol. per cent

    International Nuclear Information System (INIS)

    Smirnov, M.V.; Salyulev, A.B.; Kudyakov, V.Ya.

    1980-01-01

    Based on measurements of saturated vapour pressure in components of melted mixtures of HfCl 4 -KCl, depending on temperature and concentration, calculated are the results of changes in activity coefficients of hafnium tetrachloride and potassium chloride on transition from diluted solutions, where the Henry law is met, to those concentrated where the law is disobeyed. Growth in the activity coefficient of HfCl 4 is due to dissociation of complex groups of HfCl 6 2- into complexes with a lesser number of ligands and decreasing relative binding energy of Hf 4+ -Cl - there. In this case, marked changes take place in partial enthalpy and entropy of hafnium tetrachloride mixing. Similar dependences are observed for potassium chloride, but they are expressed considerably weaker. Evaporation enthalpy and entropy are calculated for HfCl 4 and KCl monomers from their melted mixtures of various concentrations

  2. Enhanced extracellular production of L-asparaginase from Bacillus subtilis 168 by B. subtilis WB600 through a combined strategy.

    Science.gov (United States)

    Feng, Yue; Liu, Song; Jiao, Yun; Gao, Hui; Wang, Miao; Du, Guocheng; Chen, Jian

    2017-02-01

    L-asparaginase (EC 3.5.1.1, ASN) exhibits great commercial value due to its uses in the food and medicine industry. In this study, we reported the enhanced expression of type II ASN from Bacillus subtilis 168 in B. subtilis WB600 through a combined strategy. First, eight signal peptides (the signal peptide of the ASN, ywbN, yvgO, amyE, oppA, vpr, lipA, and wapA) were used for ASN secretion in B. subtilis by using Hpa II promoter, respectively. The signal peptide wapA achieved the highest extracellular ASN activity (28.91 U/mL). Second, Hpa II promoter was replaced by a strong promoter, P43 promoter, resulting in 38.1 % enhanced ASN activity. By two rounds of error-prone PCR mutation, the P43 promoter variants with remarkably enhanced strength (D7, E2, H6, B2, and F3) were identified. B2 (-28: A → G, -13: A → G) achieved ASN activity up to 51.13 U/mL. Third, after deletion of the N-terminal 25-residues, ASN activity reached 102.41 U/mL, which was 100 % higher than that of the intact ASN. At last, the extracellular ASN of the B. subtilis arrived at 407.6 U/mL (2.5 g/L of ASN protein) in a 3-L bioreactor by using a fed-batch strategy. The purified ASN showed maximal activity at 65 °C and its half-life at 65 °C was 61 min. The K m and k cat of the ASN were 5.29 mM and 54.4 s -1 , respectively. To the best of our knowledge, we obtained the highest yield of ASN in a food-grade host ever reported, which may benefit the industrial production and application of ASN.

  3. The high-spin {sup 178m2}Hf isomer: production, chemical and isotopic separations, gamma spectrometry and internal conversion electrons spectrometry; L`isomere de haut spin {sup 178m2}Hf: production, separations chimiques et isotopiques, spectrometrie gamma et spectrometrie d`electrons de conversion interne

    Energy Technology Data Exchange (ETDEWEB)

    Kim, J B

    1993-10-13

    The high-spin isometric state of the nucleus 178Hf is a challenge for new and exotic nuclear physics studies. With its long half-life of 31 years, the production of a reasonable micro-weight quantity, with an isometric to ground state ratio as high as 5 per cent, is now regularly performed by intensive irradiations of ytterbium targets with helium ions of 36 MeV. Using sur-enriched, at 99,998 per cent, ytterbium 176 that we have prepared at the PARIS mass separator, the isomer purity has been improved. Targets of such material but also of enriched stable isotopes of hafnium have been prepared by electro-spraying of methanolic and acetic solutions. By inelastic diffusion of protons and deuton on these targets, the energy of the first state of the rotation band built on the isomer has been measured. Isotopic separations of the isomer have been performed, with a yield greater than 20 per cent, by the use of isotopically pure hafnium 176 as carrier. The separated beam of the mass 178 allowed to record the complete hyperfine spectrum of the isomer and to measure, for the first time, the magnetic dipole moment and the electric quadrupole moment. Isomer targets, implanted in various materials like copper, iron and hafnium monocrystal, provide the opportunity to accurately measure gamma and internal conversion decay of this nuclei and so to precise the multipolarity mixing of all transitions from K=16{sup +} to K=8{sup -}. (author). 49 refs., 47 figs., 11 tabs.

  4. m manjula

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. M MANJULA. Articles written in Bulletin of Materials Science. Volume 41 Issue 1 February 2018 pp 19. Elastic and thermodynamic properties of zirconium- and hafnium-doped Rh$_3$V intermetallic compounds: potential aerospace material · M MANJULA M SUNDARESWARI ...

  5. Structure of Zr-Hf alloys

    International Nuclear Information System (INIS)

    Dobromyslov, A.V.; Taluts, N.I.

    1991-01-01

    Structure of quenched zirconium-hafnium alloy system containing up to 2.5 at. % was studied. Existence of three morphological forms of α-phase was presented: lath, twinned, laminated. Twinning plane in the system was identified. Formation model of packet structure of lath martensite was suggested

  6. Nanomechanical properties of hafnium nitride coating

    International Nuclear Information System (INIS)

    Chen Yao; Laha, Tapas; Balani, Kantesh; Agarwal, Arvind

    2008-01-01

    Nanomechanical properties of plasma-sprayed HfN coating with and without hot isostatic pressing (HIP) treatment were evaluated using nanoindentation. For HIPed HfN coating, the elastic modulus (E) and yield strength increase whereas the hardness (H), H/E ratio and fraction of the elastic work decrease. HIPed HfN coating shows a larger pile-up around the indent as compared to as-sprayed HfN. HIPing causes densification and improvement in inter-splat bonding which subsequently lead to increase in nanomechanical properties

  7. Coexistence of different charge states in Ta-doped monoclinic HfO2: Theoretical and experimental approaches

    DEFF Research Database (Denmark)

    Taylor, M.A.; Alonso, R.E.; Errico, L.A.

    2010-01-01

    A combination of experiments and ab initio quantum-mechanical calculations has been applied to examine hyperfine interactions in Ta-doped hafnium dioxide. Although the properties of monoclinic HfO2 have been the subject of several earlier studies, some aspects remain open. In particular, time dif...

  8. Temperature Effects on a-IGZO Thin Film Transistors Using HfO2 Gate Dielectric Material

    Directory of Open Access Journals (Sweden)

    Yu-Hsien Lin

    2014-01-01

    Full Text Available This study investigated the temperature effect on amorphous indium gallium zinc oxide (a-IGZO thin film transistors (TFTs using hafnium oxide (HfO2 gate dielectric material. HfO2 is an attractive candidate as a high-κ dielectric material for gate oxide because it has great potential to exhibit superior electrical properties with a high drive current. In the process of integrating the gate dielectric and IGZO thin film, postannealing treatment is an essential process for completing the chemical reaction of the IGZO thin film and enhancing the gate oxide quality to adjust the electrical characteristics of the TFTs. However, the hafnium atom diffused the IGZO thin film, causing interface roughness because of the stability of the HfO2 dielectric thin film during high-temperature annealing. In this study, the annealing temperature was optimized at 200°C for a HfO2 gate dielectric TFT exhibiting high mobility, a high ION/IOFF ratio, low IOFF current, and excellent subthreshold swing (SS.

  9. Pressure induced phase transition in HfTiO4

    International Nuclear Information System (INIS)

    Mishra, A.K.; Garg, Nandini; Sharma, Surinder M.; Panneerselvam, G.

    2012-01-01

    Hafnium titanate is a low thermal expansion ceramic with a very good absorption cross section for thermal neutrons and a high refractoriness, thus making it a desirable nuclear material. At ambient conditions it crystallizes with the orthorhombic structure (space group Pbcn). The material properties of this ceramic have been studied as a function of temperature. However, apart from a lone shock study several decades ago there is no study at static high pressure on this compound. Since this ceramic is used as control rods in nuclear reactors it is important to understand its phase stability at different thermodynamic conditions. Therefore to understand the high pressure behaviour of hafnium titanate we have carried out diamond anvil cell based X-ray diffraction studies up to ∼20 GPa. The studies on this ceramic show that its structure is stable till 11 GPa. However, at ∼11.7 GPa appearance of new diffraction peaks indicate that it undergoes a structural phase transition to a low symmetry structure

  10. 168 | P a g e

    African Journals Online (AJOL)

    Fr. Ikenga

    situations, civilians have suffered loss of property, life and limb and it would seem that the civilian population is not ... conflict thus ensuring that in the midst of hostilities, the dignity of the human person is and shall be respected. ..... Funding and human resource development efforts should be improved for the military trainers.

  11. 34 CFR 300.168 - Membership.

    Science.gov (United States)

    2010-07-01

    ... birth through 26). (Approved by the Office of Management and Budget under control number 1820-0030... with disabilities (ages birth through 26); (2) Individuals with disabilities; (3) Teachers; (4... of private schools and public charter schools; (9) Not less than one representative of a vocational...

  12. The age of fathers in the USA is rising: an analysis of 168 867 480 births from 1972 to 2015.

    Science.gov (United States)

    Khandwala, Yash S; Zhang, Chiyuan A; Lu, Ying; Eisenberg, Michael L

    2017-10-01

    How has the mean paternal age in the USA changed over the past 4 decades? The age at which men are fathering children in the USA has been increasing over time, although it varies by race, geographic region and paternal education level. While the rise in mean maternal age and its implications for fertility, birth outcomes and public health have been well documented, little is known about paternal characteristics of births within the USA. A retrospective data analysis of paternal age and reporting patterns for 168 867 480 live births within the USA since 1972 was conducted. All live births within the USA collected through the National Vital Statistics System (NVSS) of the Centers for Disease Control and Prevention (CDC) were evaluated. Inverse probability weighting (IPW) was used to reduce bias due to missing paternal records. Mean paternal age has increased over the past 44 years from 27.4 to 30.9 years. College education and Northeastern birth states were associated with higher paternal age. Racial/ethnic differences were also identified, whereby Asian fathers were the oldest and Black fathers were the youngest. The parental age difference (paternal age minus maternal age) has decreased over the past 44 years. Births to Black and Native American mothers were most often lacking paternal data, implying low paternal reporting. Paternal reporting was higher for older and more educated women. Although we utilized IPW to reduce the impact of paternal reporting bias, our estimates may still be influenced by the missing data in the NVSS. Paternal age is rising within the USA among all regions, races and education levels. Given the implications for offspring health and demographic patterns, further research on this trend is warranted. No funding was received for this study and there are no competing interests. N/A. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For

  13. Reseña de «Lo divino y lo humano: poetas místicos de India y de España en la modernidad temprana», ed. Meenakshi Sundriyal y Juan Manuel Escudero Baztán, New Delhi/Pamplona, CSPILAS-Jawaharlal Nehru University/GRISO-Universidad de Navarra (Friends Digital Color Solutions, 2017, 168 pp., ISBN 181-901849-9-7

    Directory of Open Access Journals (Sweden)

    Sabyasachi Mishra

    2018-06-01

    Full Text Available Reseña de Lo divino y lo humano: poe­tas místicos de India y de España en la modernidad temprana, ed. Meenakshi Sundriyal y Juan Manuel Escudero Baztán, New Delhi/Pamplona, CSPILAS-Jawaharlal Nehru University/GRISO-Universidad de Navarra (Friends Digital Color Solutions, 2017, 168 pp., ISBN 181-901849-9-7.

  14. Mesocrystals luminescent BaZrHfO{sub 3} synthesized via hydrothermal process assisted by microwave

    Energy Technology Data Exchange (ETDEWEB)

    Fassbender, Rafael Uarth, E-mail: uarth.fisica@gmail.com

    2016-07-01

    Full text: The Barium Zirconate (BaZrO{sub 3}), is a ceramic oxide belonging to the functional group of perovskites (ABO{sub 3}), this compound can be doped with hafniun (Hf) in solid solution by microwave assisted hydrothermal method (MAH) radioluminescent increases their properties. This method allows to obtain barium zirconate at low temperature as 140 deg C and short times as 160 minutes. The choice of Hafnium (Hf) as a dopant is based on its similarity with Zirconium (Zr), another good reason for this choice is that the Hafnium has intrinsic luminescent characteristics. In general, radioluminescent materials have high density and high atomic mass (atomic number of Hafnium is 72), thereby facilitating the absorption of ionizing radiation to convert it into visible light, this characteristic is strongly dependent on the morphology and especially the electronic structure of (BaZrO{sub 3}). This work consisted in production of barium zirconate powders doped 1-2-4-8-16% (Hf) using (MAH) method. For the characterization of the powders was employed methods : a) X-ray diffraction, b) Raman Spectroscopy, c) Xanes, d) photoluminescence spectroscopy. After the electronic and structural characterization the powders were introduced in a polymeric resin (nylon-BZO), one new characterizations will be performed to validate the results obtained in the production of films to the results already obtained for the powders. We conclude so far, that the powders-doped with 16% Hf has an intense luminescent emission compared to the powders with less concentration of Hf. The small structural change that causes the Hf in (BZO) is considered as a secondary factory. (author)

  15. Catalytic activity of metall-like carbides in carbon oxide oxidation reaction

    International Nuclear Information System (INIS)

    Kharlamov, A.I.; Kosolapova, T.Ya.; Rafal, A.N.; Kirillova, N.V.

    1980-01-01

    Kinetics of carbon oxide oxidation upon carbides of hafnium, niobium, tantalum, molybdenum, zirconium and chromium is studied. Probable mechanism of the catalysts action is suggested. The established character of the change of the carbide catalytic activity is explained by the change of d-electron contribution to the metal-metal interaction

  16. George de Hevesy (1885 - 1966), founder of radioanalytical chemistry

    International Nuclear Information System (INIS)

    Niese, S.

    2006-01-01

    George de Hevesy has founded Radioanalytical Chemistry and Nuclear Medicine, discovered the element hafnium and first separated stable isotopes. For all these different important achievements he was nominated for the Nobel Prize. On occasion of his discovery of activation analysis 70 years ago his life and work will be illustrated. (author)

  17. Pramana – Journal of Physics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 68; Issue 1 ... pp 1-19 Research Articles ... Maximum yield and best quality CNTs were obtained using H2 as the carrier gas. ... Electronic structure of hafnium: A Compton profile study ... Odd–even effect in fragment angular momentum in low-energy fission of actinides.

  18. Nanomechanical study of amorphous and polycrystalline ALD HfO2 thin films

    Science.gov (United States)

    K. Tapily; J.E. Jakes; D. Gu; H. Baumgart; A.A. Elmustafa

    2011-01-01

    Thin films of hafnium oxide (HfO2) were deposited by atomic layer deposition (ALD). The structural properties of the deposited films were characterised by transmission electron microscopy (TEM) and X-ray diffraction (XRD). We investigated the effect of phase transformations induced by thermal treatments on the mechanical properties of ALD HfO

  19. Neutron activation analysis measurements of sub micron aerosol deposition onto a cylinder energized with an alternating electric field

    Energy Technology Data Exchange (ETDEWEB)

    Fila, M S [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1994-12-31

    Experimental measurements of aerosol deposition onto a cylinder energized with a 60 Hz electric field were conducted using a neutron activation analysis technique with a hafnium salt aerosol. The measured collection efficiencies were compared to theoretical expressions based on an electrostatic collection mechanism and fair agreement was found. (author). 5 refs., 1 tab., 2 figs.

  20. Viscosity measurements of molten refractory metals using an electrostatic levitator

    International Nuclear Information System (INIS)

    Ishikawa, Takehiko; Paradis, Paul-François; Okada, Junpei T; Watanabe, Yuki

    2012-01-01

    Viscosities of several refractory metals (titanium, nickel, zirconium, niobium, ruthenium, rhodium, hafnium, iridium and platinum) and terbium have been measured by the oscillation drop method with an improved procedure. The measured data were less scattered than our previous measurements. Viscosities at their melting temperatures showed good agreement with literature values and some predicted values. (paper)

  1. Submicrometric gratings fabrication from photosensitive organo-silica-hafnia thin films elaborated by sol-gel processing

    Energy Technology Data Exchange (ETDEWEB)

    Franc, Janyce [Universite de Lyon, F-42023 Saint-Etienne (France); CNRS, UMR 5516, Laboratoire Hubert Curien, 42023 Saint-Etienne (France); Universite de Saint-Etienne, Jean-Monnet, F-42023 Saint-Etienne (France); Barnier, Vincent, E-mail: barnier@emse.fr [Ecole Nationale Superieure des Mines, SMS-EMSE, CNRS:UMR 5146, LCG, F-42023 Saint-Etienne (France); Vocanson, Francis, E-mail: francis.vocanson@univ-st-etienne.fr [Universite de Lyon, F-42023 Saint-Etienne (France); CNRS, UMR 5516, Laboratoire Hubert Curien, 42023 Saint-Etienne (France); Universite de Saint-Etienne, Jean-Monnet, F-42023 Saint-Etienne (France); Gamet, Emilie; Lesage, Maryline [Universite de Lyon, F-42023 Saint-Etienne (France); CNRS, UMR 5516, Laboratoire Hubert Curien, 42023 Saint-Etienne (France); Universite de Saint-Etienne, Jean-Monnet, F-42023 Saint-Etienne (France); Jamon, Damien [Universite de Lyon, F-42023 Saint-Etienne (France); Laboratoire Claude Chappe, Telecom Saint-Etienne, 42000 Saint-Etienne Cedex 2 (France); Universite de Saint-Etienne, Jean-Monnet, F-42023 Saint-Etienne (France); Jourlin, Yves [Universite de Lyon, F-42023 Saint-Etienne (France); CNRS, UMR 5516, Laboratoire Hubert Curien, 42023 Saint-Etienne (France); Universite de Saint-Etienne, Jean-Monnet, F-42023 Saint-Etienne (France)

    2012-07-31

    The aim of this study is the elaboration of a high index sol-gel material in order to prepare submicrometric grating. The gratings were obtained after few seconds of UV exposure in one step using an organically modified silica-hafnia matrix. The chemical composition of thin films after UV and annealing treatments were studied using Fourier Transform Infrared Spectroscopy and X-Ray Photoelectron Spectroscopy. The study of optical properties revealed that the annealed films are transparent from 200 to 1000 nm and have a refractive index from 1.550 to 1.701 depending on the hafnium concentration. - Highlights: Black-Right-Pointing-Pointer Silica-hafnia matrix with high refractive index was prepared using sol-gel process. Black-Right-Pointing-Pointer Organic and inorganic networks formation of thin films was investigated. Black-Right-Pointing-Pointer Optical properties are influenced by annealing treatment and initial hafnium amount. Black-Right-Pointing-Pointer The use of high Si:Hf molar ratio can lead to a loss transmittance below 300 nm. Black-Right-Pointing-Pointer Submicrometric grating period can be prepared using a holographic method.

  2. Dissolution kinetics of small amounts of oxygen in tantalum alloy T-111 and internal oxide displacement reactions during annealing

    Science.gov (United States)

    Stecura, S.

    1976-01-01

    Oxygen was added to T-111 (Ta-8W-2Hf, wt. %) at 820 and 990 C at an oxygen pressure of about 0.0003 torr. The technique employed permitted predetermined and reproducible doping of T-111 up to 3.0 at. % oxygen. Based on the temperature dependence of the doping reaction, it is concluded that the initial rates of oxygen pickup are probably controlled by solution of oxygen into the T-111 lattice. Although hafnium oxides are more stable than those of tantalum or tungsten, analyses of extracted residues indicate that the latter oxides predominate in the as-doped specimens, presumably because of the higher concentrations of tantalum and tungsten in the alloy. However, high-temperature annealing promotes gettering of dissolved oxygen and of other oxides to form hafnium oxides. Small amounts of tantalum and tungsten oxides were still present after high-temperature annealing. Tungsten oxide (WO3) volatilizes slightly from the surface of T-111 at 990 C. The vaporization of WO3 has no apparent affect on the doping reaction.

  3. Temperature dependence of the work function of ruthenium-based gate electrodes

    International Nuclear Information System (INIS)

    Alshareef, H.N.; Wen, H.C.; Luan, H.F.; Choi, K.; Harris, H.R.; Senzaki, Y.; Majhi, P.; Lee, B.H.; Foran, B.; Lian, G.

    2006-01-01

    The effect of device fabrication temperature on the work function of ruthenium (Ru) metal gate and its bilayers was investigated. The work function shows strong temperature dependence when Ru electrodes are deposited on silicon oxide, SiO 2 , but not on hafnium silicates (HfSiO x ). Specifically, the work function of Ru on SiO 2 increased from 4.5 eV at 500 deg. C to 5.0 eV at 700 deg. C. On further annealing to 900 deg. C or higher, the work function dropped to about 4.4 eV. In the case of HfSiO x , the work function of Ru changed by less than 100 mV over the same temperature range. Identical temperature dependence was observed using hafnium (Hf)/Ru and tantalum (Ta)/Ru bilayers. However, the peak values of the work function decreased with increasing Hf/Ru and Ta/Ru thickness ratios. Materials analysis suggests that these trends are driven by interactions at the Ru metal gate-dielectric interface

  4. Experience of CR and RCCA operation in Ukrainian WWER-1000: Aspects of reliability, safety and economic efficiency

    International Nuclear Information System (INIS)

    Afanasyev, A.

    2000-01-01

    The next topics are represented in the paper: A brief history of WWER-1000 control rod (CR) and WWER-1000 rod cluster control assembly (RCCA) design; Evolution of WWER-1000 CR manufacturing technology and design; Experience of RCCA operation; Lifetime extension of WWER-1000 boron carbide CR; WWER-1000 reactor core operation problems due to partial RCCA insertion; Designing and licensing procedures and first operational experience of WWER-1000 RCCA (CR) with a combined absorber 'boron carbide-hafnium' and a chromium-nickel alloy cladding. The main conclusions are: Fuel assembly (FA) bow is the main reason of partial RCCA insertion during reactor core operation. However, the use of the RCCA and its driver bar with increased dead load, alongside with other measures, allow to reduce the probability of incomplete RCCA insertion; The materials used in CRs of RCCA in existing reactor operating modes have been working reliably; The use of hafnium under an appropriate price policy can give certain economic advantages for the Ukrainian NPPs, however, additional research is needed in order to confirm the specific CR physical characteristics and reliability. (author)

  5. Luminescence of Ce doped oxygen crystalline compounds based on Hf and Ba

    CERN Document Server

    Borisevich, A E; Lecoq, P

    2003-01-01

    The luminescence properties of the Ce-doped hafnium and barium compounds have been investigated to determine their potential as heavy scintillation materials. Compounds have been prepared by solid state synthesis. All of them have shown a bright luminescence attributed to trivalent cerium. Emission bands are peaked in the 425-475nm spectral region at room temperature.

  6. Activation Analysis of Aluminium

    Energy Technology Data Exchange (ETDEWEB)

    Brune, Dag

    1961-01-15

    An analysis of pure aluminium alloyed with magnesium was per- formed by means of gamma spectrometry , Chemical separations were not employed. The isotopes to be determined were obtained in conditions of optimum activity by suitably choosing the time of irradiation and decay. The following elements were detected and measured quantitatively: Iron, zinc, copper, gallium, manganese, chromium, scandium and hafnium.

  7. Neutron-Activation Analysis of Biological Material with High Radiation Levels

    Energy Technology Data Exchange (ETDEWEB)

    Samsahl, K

    1966-09-15

    A method has been developed for the chemical separation and subsequent gamma-spectrometric analysis of the alkali metals, the alkaline earths, the rare earths, chromium, hafnium, lanthanum, manganese, phosphorus, scandium and silver in neutron-activated biological material. The separation steps, being fully automatic, are based on a combination of ion-exchange and partition chromatography and require 40 min.

  8. Process and operating device for an apparatus using a running liquid film and application to separation of Zr and Hf tetrachlorides

    International Nuclear Information System (INIS)

    Brun, R.

    1989-01-01

    A process is claimed allowing to maintain a thin film in a running film exchanger, by increasing the flow rate for a short time to establish a film all over the surface. Application is made to continuous condensation of zirconium and hafnium tetrachlorides, from the separation column, by absorption in a liquid solvent made of potassium chloroaluminate [fr

  9. Neutron-Activation Analysis of Biological Material with High Radiation Levels

    International Nuclear Information System (INIS)

    Samsahl, K.

    1966-09-01

    A method has been developed for the chemical separation and subsequent gamma-spectrometric analysis of the alkali metals, the alkaline earths, the rare earths, chromium, hafnium, lanthanum, manganese, phosphorus, scandium and silver in neutron-activated biological material. The separation steps, being fully automatic, are based on a combination of ion-exchange and partition chromatography and require 40 min

  10. Passive behaviour of zirconium, hafnium and niobium

    International Nuclear Information System (INIS)

    Hornkjoel, S.

    1990-01-01

    The paper deals mainly with the results of stationary and transient polarization measurements together with capacitance measurements on passive electrodes of Zr, Hf and Nb over the entire pH-scale. The passive current densities are exstremely low, and essentially both pH and potential independent, exept for Nb at high pH. The extrapolated potential of zero inverse capacitance seems to be different from the extrapolated potential of zero film thickness for Zr and Hf, but not for Nb. The potential versus time curves at constant current show a downwards bending for Zr and Hf. It is shown that the pitting potentials of Zr and Hf are dependent of the concentration of halide ions and the type of halide ion, but not on pH. It is also shown that the pitting induction is second-order stimulated by chloride ions and first-order hindered by sulphate ions. Results from electron transfer reactions on passive niobium are reported. 9 refs

  11. PEMISAHAN Zr – Hf SECARA SINAMBUNG MENGGUNAKAN MIXER SETTLER

    Directory of Open Access Journals (Sweden)

    Dwi Biyantoro

    2017-01-01

    Full Text Available ABSTRAK PEMISAHAN Zr – Hf SECARA SINAMBUNG MENGGUNAKANMIXER SETTLER. Telah dilakukan pemisahanZr – Hf secara sinambung menggunakan pengaduk pengenap (mixer settler 16 stage. Larutan umpan adalah zirkon nitrat dengan kadar Zr = 30786 ppm dan Hf = 499 ppm. Ekstraktan dipakai adalah solven 60 % TBP dalam kerosen dan larutan scrubbingyang dipakai adalah asam nitrat 1 M. Umpan masuk pada stageke 5 dikontakkan secara berlawanan arah dengan solven masuk pada stage ke 16 dan larutan scrubbing masuk pada stage ke 1. Tujuan penelitian ini adalah memisahkan unsur Zr dan Hf dari hasil olah pasir zirkon menggunakan solven TBP dengan alat mixer settler16 stage. Analisis umpan dan hasil proses pemisahan untuk zirkonium (Zr dilakukan dengan menggunakan alat pendar sinar-X, sedangkananalisis unsur hafnium (Hf menggunakan Analisis Pengaktifan Neutron (APN. Parameter penelitian dilakukan dengan variasi keasaman asam nitrat dalam umpan dan variasi waktu pada berbagai laju pengadukan. Hasil penelitian pemisahan unsur Zr dengan Hf diperolehkondisi optimum pada keasaman umpan 4 N HNO3, keseimbangan dicapai setelah 3jam dan laju pengadukan 3300 rpm. Hasil ekstrak  unsur zirkon (Zr diperoleh kadar sebesar 28577 ppm dengan efisiensi 92,76 % serta kadar pengotor hafnium (Hf sebesar 95 ppm. Kata Kunci: pemisahan Zr, Hf, ekstraksi, mixer settler, alat pendar sinar-X, APN. ABSTRACT SEPARATION of Zr - Hf CONTINUOUSLY USE THE MIXER SETTLER. Separation of Zr - Hf continuously using mixer settler 16 stage has been done. The feed solution is zircon nitrate concentration of Zr = 30786 ppm  and Hf = 499 ppm. As the solvent used extractant 60 % TBP in 40 % kerosene. Nitric acid solution used srubbing 1 M. The feed entered into stage to 5 is contacted with solvents direction on the stage to 16 and the scrubbing solution enter the stage to 1. The purpose of this study is to separate Zr and Hf of the results from the process of zircon sand using solvent TBP using 16 stage

  12. 22 CFR 16.8 - Agency review.

    Science.gov (United States)

    2010-04-01

    ...), the Director of Personnel and Manpower (AID), and the Chief, Employee-Management Relations Division... correspondence under § 16.7(a), any documentary evidence readily available to the grievant on which the grievance... documentary evidence, and, in that official's discretion, interview persons having knowledge of the facts. The...

  13. Publications | Page 168 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Filipino women migrant domestic workers' access to sexual and reproductive health services in Hong Kong, Singapore and Qatar (open access) ... to disadvantaged populations, national health policies such as universal health coverage risk ...

  14. 21 CFR 168.180 - Table sirup.

    Science.gov (United States)

    2010-04-01

    ... percent soluble sweetener solids by weight and is prepared with or without added water. It may contain one.... (5) Natural and artificial flavorings, either fruit or nonfruit, alone or in carriers. (6) Color...

  15. 40 CFR 421.333 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... 2.387 1.108 Nickel 4.688 3.154 Ammonia (as N) 1,136.000 499.500 (d) SiCl4 purification wet air... air pollution control. BAT Limitations for the Primary Zirconium and Hafnium Subcategory Pollutant or... 0.159 0.074 Nickel 0.312 0.210 Ammonia (as N) 75.710 33.280 (b) Sand chlorination off-gas wet air...

  16. Removal of iron contaminant from zirconium chloride solution

    International Nuclear Information System (INIS)

    Voit, D.O.

    1992-01-01

    This patent describes a process for eliminating iron contaminant from an aqueous zirconium chloride solution that has been contaminated with FeCl 3 in a plant in which zirconium and hafnium chloride solutions are separated by a main MINK solvent extraction system and the FeCl 3 is normally removed from the zirconium chloride solution by a secondary MINK solvent extraction system

  17. Artificial Composites for High Temperature Applications; A Review (Composites Artificiels Destines a des Applications a Haute Temperature; Un Expose),

    Science.gov (United States)

    1987-01-01

    ceramic fibres and whiskers including silicon carbide, aluminium oxide, zirconium oxide, hafnium oxide and uranium dioxide, were being considered as...3.1.3 Fabrication Processes.................................. 9 3.1.4 Wire/Matrix Interactions and diffusion barriers ........ 10 3.1.5 Mechanical...20 3.2.1 Fibres, Matrices and Fabrication Processes ............ 20 3.2.2 Fibre/Matrix Interaction and Properties............... 21 3.3 Ductile

  18. Contribution to development of SPNDs for instantaneous and selective measurement of different radiation fields in nuclear reactors; Contribution au developpement de collectrons pour la mesure instantanee et selective des differents champs de rayonnements en reacteurs nucleaires

    Energy Technology Data Exchange (ETDEWEB)

    Blandin, Christophe [Institut National Polytechnique, 38 - Grenoble (France)

    1998-02-20

    The objective of this work was conceiving and experimentally optimizing the SPNDs (Self-Powdered Neutron Detector) able to control fast power transients in test reactors and also to cope with requirements of surveillanceand protection of EDF reactors. Thus, different SPND emitters of platinum, gadolinium, hafnium and cobalt were provided according to their nature with sheathing and stainless steel plugs as well as with zirconium over-sheathing in order to render them faster, more selective and adapted for wear checking. Special experimental devices were designed for measuring inside the Siloe reactor the promptness of the signals from SPND, on one hand, and their sensitivity to thermal and epithermal neutrons as well as to gamma rays, on the other hand. The follow-up of power transients in test reactors is ensured by the instantaneous measurement of thermal and epithermal neutron flux as well as of gamma field by means of three special SPND with gadolinium, hafnium and platinum. Also, we have defined the characteristics of a new SPND with cobalt, that delivers a current of unique neutronic origin, able to ensure the surveillance and protection of a power reactor over a period of at least six years.

  19. Contribution to development of SPNDs for instantaneous and selective measurement of different radiation fields in nuclear reactors

    International Nuclear Information System (INIS)

    Blandin, Christophe

    1998-01-01

    The objective of this work was conceiving and experimentally optimizing the SPNDs (Self-Powdered Neutron Detector) able to control fast power transients in test reactors and also to cope with requirements of surveillance and protection of EDF reactors. Thus, different SPND emitters of platinum, gadolinium, hafnium and cobalt were provided according to their nature with sheathing and stainless steel plugs as well as with zirconium over-sheathing in order to render them faster, more selective and adapted for wear checking. Special experimental devices were designed for measuring inside the Siloe reactor the promptness of the signals from SPND, on one hand, and their sensitivity to thermal and epithermal neutrons as well as to gamma rays, on the other hand. The follow-up of power transients in test reactors is ensured by the instantaneous measurement of thermal and epithermal neutron flux as well as of gamma field by means of three special SPND with gadolinium, hafnium and platinum. Also, we have defined the characteristics of a new SPND with cobalt, that delivers a current of unique neutronic origin, able to ensure the surveillance and protection of a power reactor over a period of at least six years

  20. Electrical characterisation of ferroelectric field effect transistors based on ferroelectric HfO2 thin films

    International Nuclear Information System (INIS)

    Yurchuk, Ekaterina

    2015-01-01

    Ferroelectric field effect transistor (FeFET) memories based on a new type of ferroelectric material (silicon doped hafnium oxide) were studied within the scope of the present work. Utilisation of silicon doped hafnium oxide (Si:HfO 2 ) thin films instead of conventional perovskite ferroelectrics as a functional layer in FeFETs provides compatibility to the CMOS process as well as improved device scalability. The influence of different process parameters on the properties of Si:HfO 2 thin films was analysed in order to gain better insight into the occurrence of ferroelectricity in this system. A subsequent examination of the potential of this material as well as its possible limitations with the respect to the application in non-volatile memories followed. The Si:HfO 2 -based ferroelectric transistors that were fully integrated into the state-of-the-art high-k metal gate CMOS technology were studied in this work for the first time. The memory performance of these devices scaled down to 28 nm gate length was investigated. Special attention was paid to the charge trapping phenomenon shown to significantly affect the device behaviour.

  1. Electrical characterisation of ferroelectric field effect transistors based on ferroelectric HfO{sub 2} thin films

    Energy Technology Data Exchange (ETDEWEB)

    Yurchuk, Ekaterina

    2015-02-06

    Ferroelectric field effect transistor (FeFET) memories based on a new type of ferroelectric material (silicon doped hafnium oxide) were studied within the scope of the present work. Utilisation of silicon doped hafnium oxide (Si:HfO{sub 2}) thin films instead of conventional perovskite ferroelectrics as a functional layer in FeFETs provides compatibility to the CMOS process as well as improved device scalability. The influence of different process parameters on the properties of Si:HfO{sub 2} thin films was analysed in order to gain better insight into the occurrence of ferroelectricity in this system. A subsequent examination of the potential of this material as well as its possible limitations with the respect to the application in non-volatile memories followed. The Si:HfO{sub 2}-based ferroelectric transistors that were fully integrated into the state-of-the-art high-k metal gate CMOS technology were studied in this work for the first time. The memory performance of these devices scaled down to 28 nm gate length was investigated. Special attention was paid to the charge trapping phenomenon shown to significantly affect the device behaviour.

  2. Spatial conductivity mapping of unprotected and capped black phosphorus using microwave microscopy

    International Nuclear Information System (INIS)

    Visser, Pieter J de; Chua, Rebekah; Island, Joshua O; Finkel, Matvey; Katan, Allard J; Thierschmann, Holger; Zant, Herre S J van der; Klapwijk, Teun M

    2016-01-01

    Thin layers of black phosphorus present an ideal combination of a 2D material with a tunable direct bandgap and high carrier mobility. However the material suffers from degradation in ambient conditions due to an oxidation reaction which involves water, oxygen and light. We have measured the spatial profile of the conductivity on flakes of black phosphorus as a function of time using scanning microwave impedance microscopy. A microwave excitation (3 GHz) allows to image a conducting sample even when covered with a dielectric layer. We observe that on bare black phosphorus, the conductivity changes drastically over the whole surface within a day. We demonstrate that the degradation process is slowed down considerably by covering the material with a 10 nm layer of hafnium oxide. It is stable for more than a week, opening up a route towards stable black phosphorus devices in which the high dielectric constant of hafnium oxide can be exploited. Covering black phosphorus with a 15 nm boron nitride flake changes the degradation process qualitatively, it is dominated by the edges of the flake indicating a diffusive process and happens on the scale of days. (letter)

  3. Morphological Studies of Local Influence of Implants with Coatings Based on Superhard Compounds on Bone Tissue under Conditions of Induced Trauma

    Directory of Open Access Journals (Sweden)

    Galimzyan KABIROV

    2015-07-01

    Full Text Available In this paper we analyze the response of bone tissue to a transosseous introduction of implants made of copper (Cu, medical steel 12X18H9T, steel with nitrides of titanium and hafnium coatings (TiN + HfN, as well as steel coated with titanium and zirconium nitrides (TiN + ZrN into the diaphysis of the tibia of experimental rats. The obtained results showed that the restoration of the injured bone and bone marrow in groups with implants made of steel 12X18H9T occurred without the participation of the granulation and cartilaginous tissues, but with implants made of steel coated with titanium and hafnium nitrides (TiN + HfN, this bone recovery also took place in the early term. At the same time, in groups, where the implants were made of copper (Cu, implants were made of steel coated with titanium and zirconium nitrides (TiN + ZrN were used, such phenomena as necrosis, lysis and destruction of the bone were registered and the bone tissue repair went through formation of the cartilaginous tissue.

  4. Neutronic design of pulse operation simulating device for in-pile functional test of fusion blanket by MCNP

    Energy Technology Data Exchange (ETDEWEB)

    Nagao, Yoshiharu; Nakamichi, Masaru; Kawamura, Hiroshi [Japan Atomic Energy Research Inst., Oarai, Ibaraki (Japan)

    2000-03-01

    The pulse operation of a fusion reactor can be simulated in a fission reactor by controlling the neutron flux entering a test section by using a rotating 'hollow cylinder with window' made of hafnium. The rotating cylinder is installed between the test section and the fixed outer neutron absorber cylinder and is also made of hafnium with an opening in the direction to the core center. For gathering engineering data for the tritium breeding blanket such as characteristics of temperature change, tritium release and recovery, etc., it is desirable that the ratio of minimum to maximum thermal neutron fluxes is greater than 1:10. Design calculations were performed for the test assembly which considered local neutronic effects and the mechanical constraints of the device. From the results of these calculations, the ratio of minimum to maximum thermal neutron flux under irradiation would be about 1:10 using a pulse operation simulating device which has a thickness of 6.5 mm and a 150deg window angle for the rotating hollow cylinder and 5.0 mm in thickness of fixed neutron absorber. (author)

  5. Thermal effects on the Raman phonon of few-layer phosphorene

    International Nuclear Information System (INIS)

    Ling, Zhi-Peng; Ang, Kah-Wee

    2015-01-01

    Two-dimensional phosphorene is a promising channel material for next generation transistor applications due to its superior carrier transport property. Here, we report the influence of thermal effects on the Raman phonon of few-layer phosphorene formed on hafnium-dioxide (HfO 2 ) high-k dielectric. When annealed at elevated temperatures (up to 200 °C), the phosphorene film was found to exhibit a blue shift in both the out-of-plane (A 1 g ) and in-plane (B 2g and A 2 g ) phonon modes as a result of compressive strain effect. This is attributed to the out-diffusion of hafnium (Hf) atoms from the underlying HfO 2 dielectric, which compresses the phosphorene in both the zigzag and armchair directions. With a further increase in thermal energy beyond 250 °C, strain relaxation within phosphorene eventually took place. When this happens, the phosphorene was unable to retain its intrinsic crystallinity prior to annealing, as evident from the broadening of full-width at half maximum of the Raman phonon. These results provide an important insight into the impact of thermal effects on the structural integrity of phosphorene when integrated with high-k gate dielectric

  6. Cardiovascular Disease Death Before Age 65 in 168 Countries Correlated Statistically with Biometrics, Socioeconomic Status, Tobacco, Gender, Exercise, Macronutrients, and Vitamin K.

    Science.gov (United States)

    Cundiff, David K; Agutter, Paul S

    2016-08-24

    Nutrition researchers recently recognized that deficiency of vitamin K2 (menaquinone: MK-4-MK-13) is widespread and contributes to cardiovascular disease (CVD). The deficiency of vitamin K2 or vitamin K inhibition with warfarin leads to calcium deposition in the arterial blood vessels. Using publicly available sources, we collected food commodity availability data and derived nutrient profiles including vitamin K2 for people from 168 countries. We also collected female and male cohort data on early death from CVD (ages 15-64 years), insufficient physical activity, tobacco, biometric CVD risk markers, socioeconomic risk factors for CVD, and gender. The outcome measures included (1) univariate correlations of early death from CVD with each risk factor, (2) a multiple regression-derived formula relating early death from CVD (dependent variable) to macronutrient profile, vitamin K1 and K2 and other risk factors (independent variables), (3) for each risk factor appearing in the multiple regression formula, the portion of CVD risk attributable to that factor, and (4) similar univariate and multivariate analyses of body mass index (BMI), fasting blood sugar (FBS) (simulated from diabetes prevalence), systolic blood pressure (SBP), and cholesterol/ HDL-C ratio (simulated from serum cholesterol) (dependent variables) and dietary and other risk factors (independent variables). Female and male cohorts in countries that have vitamin K2 24 µg/day of vitamin K2 per 2000 kcal/day (n = 72). A multiple regression-derived formula relating early death from CVD to dietary nutrients and other risk factors accounted for about 50% of the variance between cohorts in early CVD death. The attributable risks of the variables in the CVD early death formula were: too much alcohol (0.38%), too little vitamin K2 (6.95%), tobacco (6.87%), high blood pressure (9.01%), air pollution (9.15%), early childhood death (3.64%), poverty (7.66%), and male gender (6.13%). Worldwide dietary vitamin K2

  7. Preparation of thermoluminescent materials

    International Nuclear Information System (INIS)

    1976-01-01

    Thermoluminescent materials have been found to be suitable for measuring long term exposures to low level ionizing radiation. Oxyhalides of lanthanum, gadolinium and yttrium, including the oxychlorides and oxybromides are activated with terbium and have been found to be most efficient oxygendominated phosphors having thermoradiant efficiencies with excitation by low level ionizing radiation. Thermoluminescence response increases when the previous materials have hafnium and zirconium additives

  8. Dispersion engineering of thick high-Q silicon nitride ring-resonators via atomic layer deposition.

    Science.gov (United States)

    Riemensberger, Johann; Hartinger, Klaus; Herr, Tobias; Brasch, Victor; Holzwarth, Ronald; Kippenberg, Tobias J

    2012-12-03

    We demonstrate dispersion engineering of integrated silicon nitride based ring resonators through conformal coating with hafnium dioxide deposited on top of the structures via atomic layer deposition. Both, magnitude and bandwidth of anomalous dispersion can be significantly increased. The results are confirmed by high resolution frequency-comb-assisted-diode-laser spectroscopy and are in very good agreement with the simulated modification of the mode spectrum.

  9. Hafnium Isotopic Variations in Central Atlantic Intraplate Volcanism

    Science.gov (United States)

    Geldmacher, J.; Hanan, B. B.; Hoernle, K.; Blichert-Toft, J.

    2008-12-01

    Although one of the geochemically best investigated volcanic regions on Earth, almost no Hf isotopic data have been published from the broad belt of intraplate seamounts and islands in the East Atlantic between 25° and 36° N. This study presents 176Hf/177Hf ratios from 61 representative samples from the Canary, Selvagen and Madeira Islands and nearby large seamounts, encompassing the full range of different evolutionary stages and geochemical endmembers. The majority of samples have mafic, mainly basaltic compositions with Mg-numbers within or near the range of magmas in equilibrium with mantle olivine (68-75). No correlation was found between Mg-number and 176Hf/177Hf ratios in the data set. In comparison to observed Nd isotope variations published for this volcanic province (6 ɛNd units), 176Hf/177Hf ratios span a larger range (14 ɛHf units). Samples from the Madeira archipelago have the most radiogenic compositions (176Hf/177Hfm= 0.283132-0.283335), widely overlapping the field for central Atlantic N-MORB. They form a relatively narrow, elongated trend (stretching over >6 ɛHf units) between a radiogenic MORB-like endmember and a composition located on the Nd-Hf mantle array. In contrast, all Canary Islands samples plot below the mantle array (176Hf/177Hfm = 0.282943-0.283067) and, despite being from an archipelago that stretches over a much larger geographic area, form a much denser cluster with less compositional variation (~4 ɛHf units). All samples from the seamounts NE of the Canaries, proposed to belong to the same Canary hotspot track (e.g. Geldmacher et al., 2001, JVGR 111; Geldmacher et al., 2005, EPSL 237), fall within the Hf isotopic range of this cluster. The cluster largely overlaps the composition of the proposed common mantle endmember 'C' (Hanan and Graham, 1996, Science 272) but spans a space between a more radiogenic (depleted) composition and a HIMU-type endmember. Although samples of Seine and Unicorn seamounts, attributed to the Madeira hotspot track, show less radiogenic Hf and Nd isotope ratios than Madeira, their isotopic compositions lie along an extension of the Madeira trend in plots of Hf versus Sr, Nd, Pb isotopes. The new Hf isotope ratios confirm the existence of at least two geochemically distinct volcanic provinces (Canary and Madeira) in the East Atlantic as previously proposed.

  10. Hafnium isotope ratios of nine GSJ reference samples

    International Nuclear Information System (INIS)

    Hanyu, Takeshi; Nakai, Shun'ichi; Tatsuta, Riichiro

    2005-01-01

    176 Hf/ 177 Hf ratios of nine geochemical reference rocks from the Geological Survey of Japan, together with BIR-1 and BCR-2, were determined using multi-collector inductively coupled plasma mass spectrometry. Our data for BIR-1, BCR-2 and JB-1 are in agreement with those previously reported, demonstrating the appropriateness of the chemical procedure and isotopic measurement employed in this study. The reference rocks have a wide range of 176 Hf/ 177 Hf covering the field defined by various volcanic rocks, such as mid-ocean ridge basalts, ocean island basalts, and subduction related volcanic rocks. They are therefore suitable as rock standards for Hf isotope measurement of geological samples. (author)

  11. Elastic and Thermodynamic Properties of Zirconium and Hafnium ...

    Indian Academy of Sciences (India)

    65

    Here Rh3V is chosen as the parent binary compound and the doping ..... Grüneisen parameter ζ [44] are two key quantities in solid state problems due to their .... The authors wish to thank DRDO (ER & IPR), New Delhi for the financial support.

  12. Hafnium(IV) complexation with oxalate at variable temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Friend, Mitchell T.; Wall, Nathalie A. [Washington State Univ., Pullmanm, WA (United States). Dept. of Chemistry

    2017-08-01

    Appropriate management of fission products in the reprocessing of spent nuclear fuel (SNF) is crucial in developing advanced reprocessing schemes. The addition of aqueous phase complexing agents can prevent the co-extraction of these fission products. A solvent extraction technique was used to study the complexation of Hf(IV) - an analog to fission product Zr(IV) - with oxalate at 15, 25, and 35 C in 1 M HClO{sub 4} utilizing a {sup 175+181}Hf radiotracer. The mechanism of the solvent extraction system of 10{sup -5} M Hf(IV) in 1 M HClO{sub 4} to thenoyltrifluoroacetone (TTA) in toluene demonstrated a 4{sup th}-power dependence in both TTA and H{sup +}, with Hf(TTA){sub 4} the only extractable species. The equilibrium constant for the extraction of Hf(TTA){sub 4} was determined to be log K{sub ex}=7.67±0.07 (25±1 C, 1 M HClO{sub 4}). The addition of oxalate to the aqueous phase decreased the distribution ratio, indicating aqueous Hf(IV)-oxalate complex formation. Polynomial fits to the distribution data identified the formation of Hf(ox){sup 2+} and Hf(ox){sub 2(aq)} and their stability constants were measured at 15, 25, and 35 C in 1 M HClO{sub 4}. van't Hoff analysis was used to calculate Δ{sub r}G, Δ{sub r}H, and Δ{sub r}S for these species. Stability constants were observed to increase at higher temperature, an indication that Hf(IV)-oxalate complexation is endothermic and driven by entropy.

  13. Electric field cycling behavior of ferroelectric hafnium oxide.

    Science.gov (United States)

    Schenk, Tony; Schroeder, Uwe; Pešić, Milan; Popovici, Mihaela; Pershin, Yuriy V; Mikolajick, Thomas

    2014-11-26

    HfO2 based ferroelectrics are lead-free, simple binary oxides with nonperovskite structure and low permittivity. They just recently started attracting attention of theoretical groups in the fields of ferroelectric memories and electrostatic supercapacitors. A modified approach of harmonic analysis is introduced for temperature-dependent studies of the field cycling behavior and the underlying defect mechanisms. Activation energies for wake-up and fatigue are extracted. Notably, all values are about 100 meV, which is 1 order of magnitude lower than for conventional ferroelectrics like lead zirconate titanate (PZT). This difference is mainly atttributed to the one to two orders of magnitude higher electric fields used for cycling and to the different surface to volume ratios between the 10 nm thin films in this study and the bulk samples of former measurements or simulations. Moreover, a new, analog-like split-up effect of switching peaks by field cycling is discovered and is explained by a network model based on memcapacitive behavior as a result of defect redistribution.

  14. Electronic structure of hafnium: A Compton profile study

    Indian Academy of Sciences (India)

    To extract the true Compton profile from the raw data, the raw data were cor- rected for ... For the present sample and experimental conditions, the contribution of .... are in better agreement with the simple renormalized free atom calculations for.

  15. Neutron Detection Utilizing Gadolinium Doped Hafnium Oxide Films

    National Research Council Canada - National Science Library

    Blasy, Bryan D

    2008-01-01

    ... retains monoclinic local symmetery for all levels of doping. Current as a function of voltage experiments identified the films as having poor diode characteristics with high leakage current in the forward bias region...

  16. Elastic and thermodynamic properties of zirconium- and hafnium ...

    Indian Academy of Sciences (India)

    2018-02-02

    Feb 2, 2018 ... ties. The volume optimization curves (both LDA and GGA) for binary Rh3V, Rh3Zr and Rh3Hf compounds are shown in ... the strength of covalent bonding of the given material. ..... Bulk modulus is correlated with binding energy or cohesive energy of atoms, since it is a measure of average atomic bond.

  17. A new position-sensitive detector for thermal and epithermal neutrons

    International Nuclear Information System (INIS)

    Jeavons, A.P.; Ford, N.L.; Lindberg, B.; Sachot, R.

    1977-01-01

    A new two-dimensional position-sensitive neutron detector is described. It is based on (n,γ) neutron resonance capture in a foil with subsequent detection of internal conversion electrons with a high-density proportional chamber. Large-area detectors with a 1 mm spatial resolution are feasible. A detection efficiency of 50% is possible for thermal neutrons using gadolinium-157 foil and for epithermal neutrons using hafnium-177. (Auth.)

  18. Composites having an intermetallic containing matrix

    International Nuclear Information System (INIS)

    Nagle, D.C.; Brupbacher, J.M.; Christodoulou, L.

    1990-01-01

    This paper describes a composite material. It comprises: a dispersion of in-situ precipitated second phase particles selected from the group consisting of borides, carbides, nitrides, and sulfides, in an intermetallic containing matrix selected from the group consisting of the aluminides, silicides, and beryllides of nickel, copper, titanium, cobalt, iron, platinum, gold, silver, niobium, tantalum, zinc, molybdenum, hafnium, tin, tungsten, lithium, magnesium, thorium, chromium, vanadium, zirconium, and manganese

  19. Surface layers in the 4A group metals with implanted silicon ions

    International Nuclear Information System (INIS)

    Kovneristyj, Yu.K.; Vavilova, V.V.; Krasnopevtsev, V.V.; Galkin, L.N.; Kudyshev, A.N.; Klechkovskaya, V.V.

    1987-01-01

    A study was made on the change of structure and phase composition of fine near the surface layers of 4A group metals (Hf, Zr, Ti) during ion Si implantation and successive thermal annealing at elevated temperatures. Implantation of Si + ions with 30 or 16 keV energy in Ti, Zr and Hf at room temperature results to amorphization of metal surface layer. The surface hafnium and titanium layer with implanted Si atoms due to interaction with residual atmosphere of oxygen turns during annealing at 870 K to amorphous solid solution of HfO 2m or TiO 2 with Si, preventing further metal oxidation; layers of amorphous alloy are characterized by thermal stability up to 1270 K. Oxidation of the surface amorphous layer in residual oxygen atmosphere and its crystallization in ZrO 2 take place in result of Zr annealing with implanted Si ions at temperature not exceeding 870 K. Similar phenomena are observed in the case of hafnium with implanted oxygen ions or small dose of silicon ions. Thermal stability of amorphous layers produced during ion implantation of Si in Ti, Zr and Hf corresponds to scale resistance of monolithic alloys in Ti-Si, Zr-Si and Hf-Si systems

  20. Thermal effects on the Raman phonon of few-layer phosphorene

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Zhi-Peng; Ang, Kah-Wee, E-mail: eleakw@nus.edu.sg [Department of Electrical and Computer Engineering, National University of Singapore, 4 Engineering Drive 3, Singapore 117583 (Singapore); Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, Singapore 117546 (Singapore)

    2015-12-01

    Two-dimensional phosphorene is a promising channel material for next generation transistor applications due to its superior carrier transport property. Here, we report the influence of thermal effects on the Raman phonon of few-layer phosphorene formed on hafnium-dioxide (HfO{sub 2}) high-k dielectric. When annealed at elevated temperatures (up to 200 °C), the phosphorene film was found to exhibit a blue shift in both the out-of-plane (A{sup 1}{sub g}) and in-plane (B{sub 2g} and A{sup 2}{sub g}) phonon modes as a result of compressive strain effect. This is attributed to the out-diffusion of hafnium (Hf) atoms from the underlying HfO{sub 2} dielectric, which compresses the phosphorene in both the zigzag and armchair directions. With a further increase in thermal energy beyond 250 °C, strain relaxation within phosphorene eventually took place. When this happens, the phosphorene was unable to retain its intrinsic crystallinity prior to annealing, as evident from the broadening of full-width at half maximum of the Raman phonon. These results provide an important insight into the impact of thermal effects on the structural integrity of phosphorene when integrated with high-k gate dielectric.

  1. Derivation of Mutants of Erwinia carotovora subsp. betavasculorum Deficient in Export of Pectolytic Enzymes with Potential for Biological Control of Potato Soft Rot

    Science.gov (United States)

    Costa, José M.; Loper, Joyce E.

    1994-01-01

    Erwinia carotovora subsp. betavasculorum Ecb168 produces an antibiotic(s) that suppresses growth of the related bacterium Erwinia carotovora subsp. carotovora in culture and in wounds of potato tubers. Strain Ecb168 also produces and secretes pectolytic enzymes and causes a vascular necrosis and root rot of sugar beet. Genes (out) involved in secretion of pectolytic enzymes by Ecb168 were localized to two HindIII fragments (8.5 and 10.5 kb) of Ecb168 genomic DNA by hybridization to the cloned out region of E. carotovora subsp. carotovora and by complementation of Out- mutants of E. carotovora subsp. carotovora. Out- mutants of Ecb168, which did not secrete pectate lyase into the culture medium, were obtained when deletions internal to either HindIII fragment were introduced into the genome of Ecb168 through marker exchange mutagenesis. Out- mutants of Ecb168 were complemented to the Out+ phenotype by introduction of the corresponding cloned HindIII fragment. Out- mutants of Ecb168 were less virulent than the Out+ parental strain on potato tubers. Strain Ecb168 and Out- derivatives inhibited the growth of E. carotovora subsp. carotovora in culture, indicating that the uncharacterized antibiotic(s) responsible for antagonism was exported through an out-independent mechanism. Strain Ecb168 and Out- derivatives reduced the establishment of large populations of E. carotovora subsp. carotovora in wounds of potato tubers and suppressed tuber soft rot caused by E. carotovora subsp. carotovora. PMID:16349316

  2. Search Results | Page 168 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... (sub-Saharan Africa), consisted of a study of the risk of diarrheal diseases or their resurgence in the ... Microfinance and reducing poverty in Central Africa ... The business process outsourcing (BPO) sector, worth over $130 billion worldwide, ...

  3. 26 CFR 1.168-5 - Special rules.

    Science.gov (United States)

    2010-04-01

    ...) Retirement-replacement-betterment (RRB) property—(1) RRB replacement property placed in service before... for the taxable year for retirement-replacement-betterment (RRB) replacement property (as defined in...

  4. 47 CFR 90.168 - Equal employment opportunities.

    Science.gov (United States)

    2010-10-01

    ... encourage referral of qualified minority or female applicants. (F) Encouraging present employees to refer... who make decisions on placement and promotion that minority employees and females are to be considered... groups and female employees equal opportunity for positions which lead to higher positions. Inquiring as...

  5. Search Results | Page 168 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Tax policies in developing countries, and indeed around the world, are under continued reform. ... ICTs, Economic Growth and Poverty ... a research network on the theme of equal access to health services in West Africa under project 101160.

  6. Glacial Features (Point) - Quad 168 (EPPING, NH)

    Data.gov (United States)

    University of New Hampshire — The Glacial Features (Point) layer describes point features associated with surficial geology. These glacial features include, but are not limited to, delta forsets,...

  7. Fisheries Restoration Grant Program Projects [ds168

    Data.gov (United States)

    California Natural Resource Agency — This shapefile (FRGP_All_020209.shp) represents the locations of all ongoing and completed salmonid restoration projects in California with existing records in the...

  8. 15 CFR 16.8 - Termination of participation.

    Science.gov (United States)

    2010-01-01

    ... written decision to the participant in the event such participant does not appeal the proposed termination... responsibilities under this program with regard to a specific type of product by giving written notice to the... products of the type involved. ...

  9. 7 CFR 1.168 - Procedure for hearing.

    Science.gov (United States)

    2010-01-01

    ... surprise. (2) The parties shall not be required to exchange testimony in accordance with this paragraph if... with the Hearing Clerk a notice of the change, which notice shall be served on the parties, unless it... notice is given to the parties. (2)(i) Any party may move that the hearing be conducted by telephone or...

  10. Thermophysical Properties of Matter - The TPRC Data Series. Volume 4. Specific Heat - Metallic Elements and Alloys

    Science.gov (United States)

    1971-01-01

    Indium—Indium alloys—Iron—iron alloys— lanthanum — load—lead alloys—lithium—lithium alloya—«agnaslum—magnaalum alloys—manganas^ —naoganasa alloys—marcury...Germanium 21 Gold 22 Hafnium 23 Holmium 24 Indium 25 Iridium 26 Iron 27 Lanthanum 28 Lead 29 Lithium 30 Lutetium 31 Magnesium 32 Manganese 33...hexahydrate (ErC^-eHjO Erbium gallate (see Trierbium pentagallium 1 dodecaoxide) 4 5 65 822 Freon 10 (see Carbon tetrachloride) Freon 11

  11. Out-of-plane strain effect on silicon-based flexible FinFETs

    KAUST Repository

    Ghoneim, Mohamed T.; Alfaraj, Nasir; Sevilla, Galo T.; Fahad, Hossain M.; Hussain, Muhammad Mustafa

    2015-01-01

    Summary form only given. We report out-of-plane strain effect on silicon based flexible FinFET, with sub 20 nm wide fins and hafnium silicate based high-κ gate dielectric. Since ultra-thin inorganic solid state substrates become flexible with reduced thickness, flexing induced strain does not enhance performance. However, detrimental effects arise as the devices are subject to various out-of-plane stresses (compressive and tensile) along the channel length.

  12. Evaluated phase diagrams of binary metal-tellurium systems of the D-block transition elements

    International Nuclear Information System (INIS)

    Chattopadhyay, G.; Bharadwaj, S.R.

    1989-01-01

    The binary phase diagrams of metal-tellurium systems for twenty seven d-block transition elements have been critically evaluated. Complete phase diagrams are presented for the elements, chromium, manganese, iron, cobalt, nickel, copper, molybdenum, palladium, silver, lanthanum, platinum and gold, whereas, for scandium, titanium, vanadium, yttrium, zirconium, niobium, technitium, ruthenium, rhodium, hafnium, tantalum, tungsten , rhenium, osmium and iridium, the phase diagrams are incomplete and tentative. (author). 20 refs., 27 tabs., 27 figs

  13. Out-of-plane strain effect on silicon-based flexible FinFETs

    KAUST Repository

    Ghoneim, Mohamed T.

    2015-06-21

    Summary form only given. We report out-of-plane strain effect on silicon based flexible FinFET, with sub 20 nm wide fins and hafnium silicate based high-κ gate dielectric. Since ultra-thin inorganic solid state substrates become flexible with reduced thickness, flexing induced strain does not enhance performance. However, detrimental effects arise as the devices are subject to various out-of-plane stresses (compressive and tensile) along the channel length.

  14. Caracterización de una delta endotoxina mutante de Bacillus thuringiensis con estabilidad y toxicidad aumentadas

    Directory of Open Access Journals (Sweden)

    A. Hussain Syed Rehan

    2012-06-01

    Full Text Available Título en ingles: Characterization of a Mutant Bacillus thuringiensis d-endotoxin With Enhanced Stability and Toxicity SummaryThe centrally located a-helix 5 of Bacillus thuringiensis d-endotoxins is critical for insect toxicity through ion-channel formation. We analyzed the role of the highly conserved residue Histidine 168 (H168 using molecular biology, electrophysiology and biophysical techniques. Toxin H168R was ~3-fold more toxic than the wild type (wt protein whereas H168Q was 3 times less toxic against Manduca sexta. Spectroscopic analysis revealed that the H168Q and H168R mutations did not produce gross structural alterations, and that H168R (Tm= 59 °C was more stable than H168Q (Tm= 57.5 °C or than the wt (Tm= 56 °C toxins. These three toxins had similar binding affinities for larval midgut vesicles (Kcom suggesting that the differences in toxicity did not result from changes in initial receptor binding. Dissociation binding assays and voltage clamping analysis suggest that the reduced toxicity of the H168Q toxin may result from reduced insertion and/or ion channel formation. In contrast, the H168R toxin had a greater inhibition of the short circuit current than the wt toxin and an increased rate of irreversible binding (kobs, consistent with its lower LC50 value.  Molecular modeling analysis suggested that both the H168Q and H168R toxins could form additional hydrogen bonds that could account for their greater thermal stability. In addition to this, it is likely that H168R has an extra positive charge exposed to the surface which could increase its rate of insertion into susceptible membranes. Key words: a-helix 5; Circular dichroism; molecular modeling; site-directed mutagenesis;  thermal stability; Bacillus thuringiensis ResumenLa a-Hélice 5 del domino I de las d-endotoxinas de Bacillus thuringiensis, es crítica para la toxicidad de las toxinas contra insectos al participar en la formación de canales iónicos. La

  15. Separation of magnesium from magnesium chloride and zirconium and/or hafnium subchlorides in the production of zirconium and/or hafnium sponge metal

    International Nuclear Information System (INIS)

    Abodishish, H.A.M.; Adams, R.J.; Kearl, S.R.

    1992-01-01

    This patent describes the producing of a refractory metal wherein a sponge refractory metal is produced as an intermediate product by the use of magnesium with the incidental production of magnesium chloride, and wherein residual magnesium is separated from the magnesium chloride and from refractory metal to a vacuum distillation step which fractionally distills the magnesium, the magnesium chloride, and the metal sub-chlorides; the steps of: recovering fractionally distilled vapors of magnesium chloride and metal sub-chlorides from a sponge refractory metal; separately condensing the vapors as separately recovered; and recycling the separately recovered magnesium at a purity of at least about 96%

  16. Production and analysis of some atomic emission spectra in the vacuum ultraviolet

    International Nuclear Information System (INIS)

    Meijer, F.G.

    1979-01-01

    The development of technical facilities for spectra analysis are described including the design, construction and adjustment of a grazing incidence spectrograph for the extreme ultraviolet and the improvements in light sources. The investigations of the fifth and fourth spectra of tantalum, the analysis of the sixth spectrum of tungsten, the extension of the analysis of the fourth spectrum of hafnium and a start of the analysis of the seventh spectrum of rhenium are presented. (C.F.)

  17. Environmental, social, and corporate report 2010 - Cezus Ugine (Areva)

    International Nuclear Information System (INIS)

    2011-01-01

    CEZUS, a subsidiary of AREVA, is the global leader in the market for zirconium, the metal used, among other things, for nuclear fuel cladding. CEZUS's operations are distributed over six sites. The site in Ugine handles production of ingots and transformation of zirconium, titanium, tantalum, and hafnium into semi-finished products. This document shows details of the CEZUS Ugine facility and its 2010 initiatives on: consumption and waste management, risk management, environmental and safety management, social and corporate responsibilities

  18. Annual reports in inorganic and general syntheses 1974

    CERN Document Server

    Niedenzu, Kurt

    1975-01-01

    Annual Reports in Inorganic and General Syntheses-1974 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses the chemistry of simple and complex metal hydrides of main groups I, II, and III, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, lead, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens, and pseudohalogens. The text also describes the chemistry of scandium, yttrium, lanthanides, actinides, titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, ma

  19. Environmental, social, and corporate report 2012 - Cezus Ugine (Areva)

    International Nuclear Information System (INIS)

    2013-01-01

    CEZUS, a subsidiary of AREVA, is the global leader in the market for zirconium, the metal used, among other things, for nuclear fuel cladding. CEZUS's operations are distributed over six sites. The site in Ugine handles production of ingots and transformation of zirconium, titanium, tantalum, and hafnium into semi-finished products. This document shows details of the CEZUS Ugine facility and its 2012 initiatives on: consumption and waste management, risk management, environmental and safety management, social and corporate responsibilities

  20. Proceedings of IEEE International Conference on Nanotechnology (4th) held at the Technische Universitat Muenchen, Munich, Germany on 17-19 Aug 2004.

    Science.gov (United States)

    2004-08-01

    Based Membranes: A Platform for Studying Nanofluidics , J.K. Holt, H.G. Park, A. Noy, T. Huser, D. Eaglesham, and O. Bakajin, (Chemistry and Materials...56122 Pisa, Italy, 2IEIIT-CNR, Pisa, Italy) TH2_3_4 How Quantum Effects and Unintentional Doping Affect the Threshold Voltage of Narrow-Width SOI...Hafnium Doped Tantalum Oxide High k Film, J. Lu and Y. Kuo, (The Thin Film Nano and Microelectronics Research Laboratory, Texas A&M University, College